Page 1

Галицький лікарський вісник, 2013, Т. 20, № 4

ISSN 2306-4285

Міністерство охорони здоров'я України Івано-Франківський національний медичний університет

ÃÀËÈÖÜÊÈÉ Ë²ÊÀÐÑÜÊÈÉ Â²ÑÍÈÊ Щоквартальний науково-практичний часопис Заснований в 1994 році

Засновник та видавець Івано-Франківський національний медичний університет Свідоцтво про державну реєстрацію серія КВ №7296 від 14.05.2003 року

Том 20 - число 4 - 2013

РЕДАКЦ ІЙНА КОЛЕГІЯ

Головний редактор - М.М. Рожко Рекомендовано до друку Вченою Радою Івано-Франківського національного медичного університету протокол № 14 від 26.12.2013 р.

Адреса редакції: Україна, 76018 м.Івано-Франківськ, вул. Галицька, 2 Медичний університет Телефон: (0342) 53-79-84 факс (03422) 2-42-95 glvisnyk.if.ua E-maіl:glvisnyk@ifnmu.edu.ua

Вакалюк І.П. (заступник головного редактора) Боцюрко В.І. (відповідальний секретар) Вишиванюк В.Ю. (секретар) Вірстюк Н.Г. Волосянко А.Б. Геращенко С.Б. Гудз І.М. Ерстенюк А.М. Ємельяненко І.В Заяць Л.М. Ковальчук Л.Є. Мізюк М.І. Міщук В.Г. Ожоган З.Р. Середюк Н.М. Яцишин Р.І.

Редакцiйна рада

Комп'ютерний набір і верстка редакції журналу "Галицький лікарський вісник" Підписано до друку 27.12.2013 р. Формат 60/88 1/2 Обсяг - 16 друк. арк. Друк офсетний. Наклад 200 Тираж здійснено у видавництві Івано-Франківського національного медичного університету. Свідоцтво про внесення суб’єкта видавничої справи до Державного реєстру видавців, виготівників і розповсюджувачів видавничої продукції. ДК №2361 від 05.12.2005 р. 76018, м.Івано-Франківськ, вул. Галицька, 2.

Бальцер К. (ФРН, Мюльгейм) Вагнер Р. (США, Джорджтаун) Волков В.І. (Україна, Харків) Волошин О.І. (Україна, Чернівці) Геник С.М. (Україна, Івано-Франківськ) Енк П. (ФРН, Тюбінген) Ковальчук І.П. (Канада, Летбридж) Ковальчук О.В. (Канада, Летбридж) Поворознюк В.В. (Україна, Київ) Погрібний І.П. (США, Джефферсон) Скальний А.В. (Росія, Москва) Швед М.І. (Україна, Тернопіль) Журнал включено до Переліку наукових видань, в яких можуть публікуватись основні результати дисертаційних робіт (Постанова Президії ВАК України від 10.11.2010 року, №1-05/7)

© Видавництво Івано-Франківського національного медичного університету, 2013 © Галицький лікарський вісник, 2013

1


Галицький лікарський вісник, 2013, Т. 20, № 4

ISSN 2306-4285 The Ministry of Public Health of Ukraine Ivano-Frankivsk National Medical University

GALIC’KIJ LIKARS’KIJ VISNIK GALICIAN MEDICAL JOURNAL

Founder and publisher Ivano-Frankivsk National Medical University Certificate of state registration series KB № 7296 of 14.05.2003

Quarterly scientific and practical journal Established in 1994

Volume 20 - number 4 – 2013 Approved for publication by the Scientific Council of the Ivano-Frankivsk National Medical University Minutes № 14 of 26.12.2013

Address of the editorial office: Medical University Halytska Street, 2 Ivano-Frankivsk 76018 Ukraine Tel: (0342) 53-79-84 fax (03422) 2-42-95 www.glvisnyk.if.ua E-maіl:glvisnyk@ifnmu.edu.ua

Typesetting services and layout by the editorial staff of Galician Medical Journal. Passed for printing 27.12.2013. Format 60/88 1/2 Volume – 16 quires. Offset printing. Circulation 200. Printed in the publishing house of the Ivano-Frankivsk National Medical University. Certificate of introduction of the publishing entity into the State Register of Publishers, manufacturers and distributors of publishing products. ДK №2361 of 05.12.2005. Halytska Street 2, Ivano-Frankivsk 76018.

MEMBERS OF EDITORIAL BOARD

Editor -in- Chief – M. M. Rozhko Vakalyuk I.P. (Associate Editor) Botsyurko V.I. (Executive Secretary) Vyshyvanyuk V.Yu. (Secretary) Virstyuk N.G. Volosyanko A.B. Gerashchenko S.B. Gudz I.M. Erstenyuk G.M. Yemelyanenko I.V. Zayats L.M. Kovalchuk L.Ye. Mizyuk M.I. Mishchuk V.G. Ozhohan Z.R. Seredyuk N.M. Yatsyshyn R.I.

Editorial Council Balzer K. ( Dusseldorf,Germany) Vagner R. (Georgetown, USA) Volkov V.I. (Kharkiv, Ukraine) Voloshyn O.I. (Chernivtsi, Ukraine) Genyk S.M. (Ivano-Frankivsk, Ukraine) Enk P. (Tubingen, Germany) Kovalchuk I.P. (Lethbridge, Canada) Kovalchuk O.V. (Lethbridge, Canada) Povoroznyuk V.V. (Kyiv, Ukraine) Pohribnyi (Jefferson, USA) Skalniy A.V. (Moscow, Russia) Shved M.I. (Ternopil, Ukraine) The Journal is on the List of Specialized Editions in which the main results of theses are allowed to be published (The Resolution of the Presidium the Higher Attestation Commission of Ukraine of 10.11.2010, № 1-05/7)

Publishing House of Ivano-Frankivsk National Medical University, 2013 Galician Medical Journal, 2013

2


Галицький лікарський вісник, 2013, Т. 20, № 4

Ç Ì ² Ñ Ò

C O N T E N T S

ÏÐÎÁËÅÌͲ ÑÒÀÒÒ² Геник Ю., Алексопоулос С. -7Трансплантація печінки у хворих, які мають 40 і більше балів згідно шкали для оцінки захворювання печінки останньої стадії

PROBLEM ARTICLES Yuri Genyk, Sophoclis Alexopoulos Liver Transplantation in Patients with Model for End-Stage Liver Disease Score of 40 or Higher

ÎÐÈòÍÀËÜͲ ÄÎÑ˲ÄÆÅÍÍß Вагнер Р., Фаган Й. - 12 Огляд отоларингічних послуг у Центральній Америці: Потреба у комплексному втручанні Вікерсхем С., Голубов А., Ковальчук І. - 15 Очищення білків Ku70, Ku80, Rad51 і Rad52 арабідопсису та покоління антитіл анти-Ku70 і анти-Rad51

ORIGINAL RESEARCH Richard Wagner, Johan Fagan Survey of Otolaryngology Services in Central America: Need for a Comprehensive Intervention S. Wickersham, A. Golubov, I. Kovalchuk Purification of Ku70, Ku80, Rad51 and Rad52 proteins in Arabidopsis thaliana and generation of anti-Ku70 and antiRad51 antibodies L.I. Haridzhuk, L.E. Kovalchuk, M.I. Kimachuk, V.V. Vytvytska, O.V. Tkachuk Chromosomal Instability of Hereditary Apparatus in Children of Early Age, Suffering from Complicated Pneumonia Combined with Iron Deficiency Anemia D.M. Kalashnyk Analysis of Stable Nitric Oxide Metabolites in Blood Plasma of Patients with Chronic Obstructive Pulmonary Disease (COPD), Coronary Heart Disease (CHD) and COPD Concomitant with CHD Yu.V. Klymiuk, Z.R. Ozhohan Improved Technique and Mathematical Substantiation of Preparing Frontal Teeth when Making Aesthetic Unit-Cast Dentures R.V. Kozoviy Testing the Hypothesis Identifying the Link between the Indicators of the Functional Condition of Oral Cavity Mucosa Epitheliocytes Genome, Lymphocytes and Blood Neutrophil Granulocytes in Long Livers Using Correlation Analysis V.M. Kulaiets Indices of the Liver Functional State, Blood Lipid Spectrum in Patients with Non-Alcoholic Steatohepatitis Combined with Obesity when Applying Combined Therapy Yu.A. Labiy, G.М. Melnychuk Status of the Dental Health of Children with the Systemic Enamel Hypoplasia, who Live in Different by Anthropogenic Pollution Districts of Ivano-Frankivsk Region N.V. Lyseiko, R.A. Levandovskyi, Ye.A. Koval Comparative Analysis of the Methods of Determining Dental Arch Occlusion Disorders M.V. Melnychuk, M.M. Rozhko Consonants Pronunciation Diagnostics in Patients with Complete Denture Based on Entropy R.M. Nazaruk The Peculiarities of the Microcrystallization in Mixed Saliva of Children Living in Different Regions of Prykarpattia O.M. Panko The Treatment Efficacy of the Patients with Non-Proliferative Diabetic Retinopathy Using Оcuvite Lutein According to the Data of Physiologic Examinations H.B. Prots, M.M. Rozhko, V.P. Piuryk Modern Aspects of Surgical Treatment of the Patients Suffering from Generalized Periodontitis M.M. Rozhko, I.O. Kinash Index Evaluation of the Dental Status of the Patients who Received Solid Stump Inserts L.P. Sidorenko, Z.R. Ozhohan Features of the Methodology and Analysis of Biometric Studies of Small Defects of Dentition M.М. Chuiko Comparison of Immunological Parameters in Preterm Infants with Intraventricular Hemorrhage and without it

Гаріджук Л.І., Ковальчук Л.Є., Кимачук М.І., Витвицька В.В., Ткачук О.В. Хромосомна нестабільність спадкового апарату у дітей раннього віку, хворих на ускладнену пневмонію у поєднанні із залізодефіцитною анемією Калашник Д.М. Аналіз рівня стабільних метаболітів оксиду азоту в плазмі крові хворих на хронічне обструктивне захворювання легень (ХОЗЛ), ішемічну хворобу серця (ІХС) та ХОЗЛ у поєднанні з ІХС Клим’юк Ю.В., Ожоган З.Р. Удосконалена методика і математичне обгрунтування препарування фронтальних зубів при виготовленні естетичних суцільнолитих конструкцій Козовий Р.В. Перевірка гіпотези про наявність зв’язку між показниками функціонального стану геному епітеліоцитів слизової оболонки ротової порожнини, лімфоцитів та нейтрофільних гранулоцитів крові у довгожителів за допомогою кореляційного аналізу Кулаєць В.М. Показники функціонального стану печінки, ліпідного спектру крові у хворих на неалкогольний стеатогепатит, поєднаний з ожирінням, при застосуванні комбінованої терапії Лабій Ю.А., Мельничук Г.М. Стоматологічний статус дітей, хворих на системну гіпоплазію емалі, які проживають у різних за антропогенним забрудненням районах Івано-Франківської області Лисейко Н.В., Левандовський Р.А., Коваль Є.А. Порівняльна характеристика методів визначення порушень оклюзії зубних рядів Мельничук М.В., Рожко М.М. Діагностика вимови приголосних звуків в осіб з повними знімними конструкціями зубних протезів на основі ентропії Назарук Р.М. Особливості мікрокристалізації змішаної слини в дітей, які проживають у різних регіонах Прикарпаття Панько О.М Ефективність лікування хворих з діабетичною непроліферативною ретинопатією із застосуванням Окювайт лютеїну за даними фізіологічних досліджень Проць Г.Б., Рожко М.М., Пюрик В.П. Сучасні аспекти хірургічного лікування хворих на генералізований пародонтит Рожко М.М., Кінаш І.О. Індексна оцінка стоматологічного статусу пацієнтів, яким виготовляли суцільнолиті куксові вкладки Сидоренко Л.П., Ожоган З.Р. Особливості методики та аналізу біометричних досліджень малих дефектів зубних рядів Чуйко М.М. Порівняльна характеристика імунологічних показників у недоношених новонароджених із внутрішньошлуночковими крововиливами й без них

- 19 -

- 22 -

- 25 -

- 29 -

- 31 -

- 34 -

- 37 - 40 - 43 - 45 -

- 48 - 52 - 54 - 57 -

3


Галицький лікарський вісник, 2013, Т. 20, № 4

Якубовська І.О., Міщиха Л.П., Запорожець Т.Ю., - 60 - I.O. Yakubovska, L.P. Mishchyha, T.Yu. Zaporozhets, Хромей М.І. M.I. Hromei Ризики виникнення синдромів хронічної втоми та емоційThe Risks of Chronic Fatigue Syndrome and Burnout ного вигорання у студентів-медиків в процесі навчання у ВНЗ Syndrome Appearance in Medical Students Studying залежно від індивідуального психологічного профілю Depending on their Individual Psychological Type Яцишин Р.І., Попадинець І.Р. - 64 - R.І. Yatsyshyn I.R. Popadynets Роль визначення С-реактивного білка в діагностиці запальThe Role of Determining C-Reactive Protein when Diagnosного синдрому при бронхіальній астмі ing Inflammatory Syndrome in Bronchial Asthma Яцишин Р.І., Ліснянська І.С., Коваль Н.М. - 66 - R.I. Yatsyshyn, I.S. Lisnianska, N.M. Koval Діагностичні перспективи визначення маркерів запалення Diagnostic Prospects of Determining Inflammatory Markers у сечі у хворих на хронічний пієлонефрит in the Urine of Patients with Chronic Pyelonephritis

ÇÀ̲ÒÊÈ Ç ÏÐÀÊÒÈÊÈ Іваночко Н.Я. Тактичні алгоритми оперативного лікування хворих на перфоративну виразку шлунка та дванадцятипалої кишки Насраллах А.Х. Клінічні особливості перебігу метаболічного синдрому у жінок в постменопаузі Пилипчук В.І., Хруник А.Д., Дирів О.Л. Результати хірургічного лікування хронічного панкреатиту Попадюк О.Я. Стентування правої підключичної артерії

MEDICAL PRACTICE NOTES - 69 - N.Yа. Ivanochko Tactical Algorithms of Surgical Treatment of Patients with Perforated Peptic and Duodenal Ulcers - 71 - A.H. Nasrallah The Clinical Features of Metabolic Syndrome Course in Postmenopausal Women - 73 - V.V. Pylypchuk, A.D. Khrunyk, O.L. Dyriv Results of Chronic Pancreatitis Surgical Treatment - 76 - O.Ya. Popadiuk Stenting of the Right Subclavian Artery

ÌÅÄÈ×ÍÀ ÎѲÒÀ Багрій М.М. Поетапність підготовки до складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка» Бойчук Л.Г. Особливості навчання в клінічній ординатурі на кафедрі акушерства та гінекології Василишин У.Р. Актуальні питання формування толерантності в майбутніх лікарів-стоматологів у системі післядипломної освіти України Кривенький Т.П. Впровадження інноваційних форм навчання на кафедрі стоматології факультету післядипломної освіти ІваноФранківського національного медичного університету

MEDICAL EDUCATION - 78 - M.M. Bahrii Single-Step Preparation to the Integrated Licensed Examination ‘Krok 1. General Medical Training’ - 81 - L.H. Boichuk Peculiairties of the Clinical Residency Training at the Department of Obstetrics and Gynecology - 82 - U.R. Vasylyshyn Urgent Questions of Forming the Tolerance of Future DoctorsDentists in the System of Postgraduate Studies of Ukraine - 85 - T.P. Kryvenkyi Introduction of the Innovative Forms of Studying at the Dentistry Department of the Postgraduate Education Faculty of the State Higher Educational Institution “Ivano-Frankivsk National Medical University” - 87 - I.Ya. Makoida, M.M. Ostrovskyi Students’ Self-Reliant Work – a Method of Preparing Highly Qualified Specialists - 88 - V.B. Мotriuk The Importance of Testing in the Study of Propedeutics of Pediatrics - 90 - H.M. Strutynskyi Scientific and Methodical Aspects of Teaching the Pharmacology of the Anticoagulants According to the Credit-Modular Educational System - 93 - M.І. Fedorovska The Role of Practical Skills in Studying the Subject “Manufacturing Technology of Drugs” - 95 - V.Y. Shatylo Approaches to the Organization of Scientific Researches in Nursing

Макойда І.Я., Островський М.М. Самостійна робота студента – метод підготовки висококваліфікованого спеціаліста Мотрюк В.Б. Значення тестового контролю при вивченні пропедевтики педіатрії Струтинський Г.М. Науково-методичні аспекти викладання фармакології антикоагулянтів за кредитно-модульною системою навчання Федоровська М.І. Роль практичних навичок при вивчені дисципліни «Промислова технологія лікарських засобів» Шатило В.Й. Підходи до організації наукових досліджень в медсестринстві

ÎÐÃÀͲÇÀÖ²ß ÎÕÎÐÎÍÈ ÇÄÎÐÎÂ’ß PUBLIC HEALTH SERVICE Геник С.М. - 98 - S.M. Henyk Проблеми в реорганізації медичної допомоги в Україні The Problems in Restructuring of Health Care in Ukraine Кочерга З.Р., Ковальчук Л.Є. - 99 - Z.R. Kocherha, L.Ye. Kovalchuk Медичні та генетичні аспекти демографічної ситуації серед Medical and Genetic Aspects of Demographic Situation among новонароджених Івано-Франківської області the Newborns in Ivano-Frankivsk Oblast Яворський М.І. - 104 - М.І. Yavorskyi Епідеміологічні особливості захворюваності на кір в ІваноEpidemiological Features of Measles in the Ivano-Frankivsk Франківській області Region ÎÃËßÄ Ë²ÒÅÐÀÒÓÐÈ Дорошенко О.О. - 107 Аналіз ефективності застосування внутрішньовенного імуноглобуліну в лікуванні розсіяного склерозу за даними міжнародних досліджень

4

BOOK REVIEWS O.О. Doroshenko Analysis of the Effectiveness of the Intravenous Immunoglobulin use in the Treatment of Multiple Sclerosis According to the International Studies


Галицький лікарський вісник, 2013, Т. 20, № 4

Мельник О.П., Островський М.М. - 109 - O.P. Melnyk, M.M. Ostrovskyi Особливості клініко-функціональних та патогенетичних The Peculiarities of the Clinical-and-Functional and порушень у хворих на інфільтративний туберкульоз легень, Pathogenetic Disturbances of Patients with Infiltrative поєднаний із хронічним бронхітом Pulmonary Tuberculosis Combined with Chronic Bronchitis Ромаш І.Р., Винник М.І. - 113 - I.R. Romash, M.I. Vinnik Порушення вуглеводневого і ліпідного обміну у пацієнтів Carbohydrate and Lipid Metabolism Disorders in Patients with з параноїдною шизофренією під час застосування атипових Paranoid Schizophrenia when Applying Atypical Neuroleptics нейролептиків Томків З.В. - 117 - Z.V. Tomkiv Механізми формування патології підшлункової залози у Mechanisms of Formation of Pancreatic Disease in Children дітей з хронічними гастродуоденальними захворюваннями with Chronic Gastroduodenal Diseases

ÌÀÒÅвÀËÈ ÊÎÍÃÐÅѲÂ, ÊÎÍÔÅÐÅÍÖ²É Бортник Ю.В., Николишин Л.В., Гуранич Т.В., Ерстенюк Г.М., Воронич-Семченко Н.М. Вплив мікроелементного дисбалансу на показники протирадикального захисту у тварин із гіпотиреоїдною дисфункцією Вишиванюк В.Ю. Динаміка показників обміну заліза і міді у хворих на виразкову хворобу в процесі лікування Зайцева И.П. Суточный баланс цинка у спортсменок различных специализаций под воздействием тренировочной нагрузки и в последующий день отдыха в разное время года Куров И.А., Скальная М.Г. Неинвазивное исследование показателей минерального обмена у молодых мужчин с кариесом, хроническом периодонтитом и санированной ротовой полостью Линник В.А. Перспективные направления исследований в области нанобиотехнологий Побігун Н.Г. Кальцій-фосфорний баланс та мінеральна щільність кісткової тканини при експериментальній гіпотиреоїдній дисфункції Пюрик В.П., Проць Г.Б., Деркач Л.З., Пюрик Я.В., Омельчук Л.Г. Використання макро- і мікроелементного складу аутологічного кісткового мозку і штучних замінників кістки в лікуванні хворих з післяопераційними кістковими дефектами щелеп Скрипко В.Д., Клименко Ю.А., Клименко А.О., Атаманюк О.Ю. Особливості ранньої діагностики формування розвитку поліорганної дисфункції у хворих на гостру тонкокишкову непрохідність Федорків М.Б., Багрій М.М., Перцович В.М. Морфологічні прояви гострого панкреатит-асоційованого легеневого пошкодження в експерименті та їх корекція

MATERIALS OF CONGRESSES AND CONFERENCES - 122 - Yu.V. Bortnyk, L.V. Nukolyshyn, T.V. Huranych, H.M. Ersteniuk, N.М. Voronych-Semchenko Influence of Microelement Disbalance on the Indexes of Antiradical Defence of Animals with Hypothyroid Dysfunction - 125 - V.Yu. Vyshyvaniuk Dynamics of Indicators of Iron Metabolism and Copper in Patients with Peptic Ulcer During Treatment - 128 - I.P. Zaitseva The Daily Balance of Zinc in Female Athletes of Different Specialties Under the Influence of Training and During Resting Period in Different Seasons of the Year - 130 - I.P. Kurov, M.G. Skalnaya Non-Invasive Study of Indicators of Mineral Metabolism in Young Men with Caries, Chronic Periodontitis and Sanified Mouth - 135 - V.A. Lynnyk Perspective Research Directions in the Field of Nanobiotechnologies - 137 - N.H. Pobihun Calcium-Phosphorus Balance and Bone Mineral Density in Experimental Hypothyroid Dysfunction - 140 - V.P. Piuryk, H.B. Prots, L.Z. Derkach, Ya.V. Piuryk, L.H. Omelchuk Using Macro- and Microelement Content of the Autologic Bone Marrow and Artificial Bone Substitutes in the Treatment of Patients with Postoperative Bone Defects of the Jaws - 143 - V.D. Skrypko, Yu.А. Klymenko, A.O. Klymenko, O.Yu. Atamaniuk Features of the Early Diagnostics of Polyorganic Dysfunction in Patients with Acute Small Intestinal Obstruction

ÏÐÀÂÈËÀ ÄËß ÀÂÒÎвÂ

- 150 - RULES FOR AUTHORS

- 145 - M.В. Fedorkiv, M.М. Bahrii, V.М. Pertsovych Morphological Manifestations of Acute PancreatitisAssociated Lung Injury in Experiment and Its Correction

5


Галицький лікарський вісник, 2013, Т. 20, № 4

ÑÒÎвÍÊÀ ÃÎËÎÂÍÎÃÎ ÐÅÄÀÊÒÎÐÀ

ШАНОВНІ КОЛЕГИ! Ми продовжуємо публікації науковців України та інших країн стосовно найнагальніших медичних питання сьогодення. Нас, як і всю медичну громадськість, цікавлять результати досліджень щодо етіології та патогенезу захворювань, сучасні підходи до їх діагностики, лікування, профілактики та реабілітації, проблеми, з якими стикається сфера охорони здоров’я у сучасних умовах реформування, у тому числі питання удосконалення підготовки медичних кадрів. Тому, як завжди, дорогі читачі, Ви знайдете у нашому науково-практичному часописі висліди оригінальних фундаментальних досліджень, присвячених вивченню морфо-функціональних змін при різних захворюваннях, оцінці ефективності діагностичних та лікувальних новітніх медичних технологій і препаратів, питання організації охорони здоров’я і медичної освіти, короткі повідомлення, замітки з практики та огляди літератури. Особлива увага звертається на питання трансплантології, генетичних аспектів формування різних захворювань. Практичні лікарі в замітках з практики знайдуть відповіді на питання щодо алгоритму лікування хворих на перфоративну виразку шлунка. Значна увага приділена удосконаленню навчання студентів згідно з вимогами Болонського процесу. Сподіваємось, матеріали цього номера часопису допоможуть Вашому професійному зростанню. Запрошуємо до співпраці!

З повагою головний редактор М.РОЖКО

6


Галицький лікарський вісник, 2013, Т. 20, № 4

ÏÐÎÁËÅÌͲ ÑÒÀÒÒ² Yuri Genyk, MD., Sophoclis Alexopoulos, MD. Liver Transplantation in Patients with Model for End-Stage Liver Disease Score of 40 or Higher Division of Hepatobiliary and Pancreatic Surgery and Abdominal Organ Transplantation, Department of Surgery, Keck School of Medicine, University of Southern California, Los Angeles, California, USA Abstract Background: Patients with Model for End-Stage Liver Disease (MELD) scores of 40 or higher are at high risk for liver transplantation. In some regions, the organ donor shortage has resulted in a substantial increase in the number of patients who underwent transplantation with MELD scores of 40 or higher. The objective of this study was to characterize the outcomes of liver transplantation in these patients. Methods: A single-center retrospective study evaluating the outcome of liver transplantation in 38 consecutive patients achieving a MELD score of 40 or higher from January 1, 2006, to November 30, 2010, was conducted. Patient and graft survivals and independent risk factors for postoperative death or graft loss were determined. Results: Kaplan-Meier–based 1-, 2-, and 3-year patient survival rates were 89%, 82%, and 77% with 1-, 2-, and 3-year graft survival rates of 84%, 75%, and 70.3%, respectively. One of three recipients was on a vasopressor before transplantation, and 13% were mechanically ventilated. Renal replacement therapy was used before operation in 90% of the recipients. Postoperative length of stay averaged 38 days. There was a 42% incidence of postoperative bacteremia and an 18% incidence of bile duct stricture within 6 months. Univariate analysis identified admission-to-transplantation time and recipient diabetes as risk factors for graft failure and patient death. Multivariate analysis confirmed recipient diabetes as a risk factor for patient survival and admission-to-transplantation time of more than 15 days as a risk factor for graft survival. Conclusions: Acceptable outcomes are achievable after liver transplantation in patients with MELD scores of 40 or higher but come at high pre-transplantation and post-transplantation resource utilization.

MELD score of 40 or higher at our institution from January 1, 2006, to November 30, 2010, was obtained from UNOS. The UNOS report contained demographic data for each patient including primary diagnosis, listing date, delisting date, and the individual components of each MELD score update from the time that a MELD score of 40 or higher was reached to the time of transplantation, death, or delisting. Data were collected by retrospective chart review. Diagnosis of postoperative bacteremia or fungemia required a positive culture within 90 days of transplantation. Biliary stricture was diagnosed by endoscopic retrograde cholangiopancreatography or percutaneous transhepaticcholangiogram requiring any type of intervention including stricture dilatation or stent placement. Immunosuppression after transplantation consisted of a combination of steroids, mycophenolatemofetil, and a calcineurin inhibitor. Tacrolimus was typically instituted within 48 hr of transplantation. Antibody induction is not routinely used in our center. Similar data were collected for a comparator group of 26 consecutive deceaseddonor whole-liver transplants performed from January 1, 2010, to December 31, 2010, in which the recipient MELD score remained less than 40.Patient and graft survival rates were estimated by the Kaplan-Meier product-limit method. Univariate and multivariate Cox regression analyses were used to estimate hazard ratios for patient death and graft loss. All reported P values were two tailed. STATA version 12 (StataCorp, College Station, TX) was used in all statistical analyses.

In the past 2 decades, liver transplantation has transitioned from a therapy offered at a few elite academic medical centers throughout the United States to an accepted operation currently performed in more than 100 academic and private institutions. The dramatic increase in the number of both centers performing and patients awaiting liver transplantation necessitated a more objective approach to the allocation of deceased-donor livers resulting in the implementation of the Model for End-Stage Liver Disease (MELD) scoring system in 2002 (1, 2). The aim of the MELD system was to allocate organs based on the likelihood of recipient mortality without liver transplantation in accordance with the Final Rule (Federal Register [FR Doc. 988191]) (3). At the time of implementation, a decision was made to cap the MELD score at 40 because of the near-100% mortality of such patients at 3 months without liver transplantation. Patients with a score of 40 or higher were considered at a very high risk for transplantation and represented only 5% of all transplants (4). Although no limitations were created defining patients as “too sick to transplant,” additional priority was not given to waitlisted patients with a score higher than 40 to discourage the performance of futile transplants. Since then, there has been a progressive increase in the median MELD score of liver transplant recipients, especially in larger organ procurement organizations (5). In organ procurement organizations with multiple transplant centers, this has resulted in more patients waitlisted at a MELD score of 40 or higher. Southern California has been particularly affected by this phenomenon, resulting in a large increase in the number of liver transplants performed for patients with a MELD score of 40 or higher. However, there are no publications specifically addressing outcomes in this group of patients. In this retrospective single-center review, we aim to better characterize this group of patients and their outcomes after liver transplantation.

Results Between January 1, 2006, and November 30, 2010, 94 patients listed for liver transplantation achieved a MELD score of 40 or higher. Fifty (53%) patients on the list died or were delisted and subsequently died. A total of 44 patients underwent liver transplantation: 6 for acute liver failure (status 1a) and 38 for chronic liver failure (CLF). Status 1a patients were excluded from further analysis. Of the 38 CLF patients, 12 (32%) underwent combined liver and kidney transplantation, and 26 (68%) underwent liver transplantation alone. As shown in Table 1, the average recipient age was 50 years, with the majority being male. The most common indication for liver transplantation was long-term hepatitis C viral infection (45%) followed by alcoholic cirrhosis (16%). Nearly one of four patients had undergone prior upper abdominal surgery, and 13% of recipients had undergone prior liver transplantation. The median time interval from admission at the transplantation center to liver transplantation was 15 days. The median peak MELD score of the recipients was 43 with a median time of 7.5 days at a MELD score of 40 or higher. The mean and median bilirubin level, creatinine level, and international normalized ratio are also shown. Donor data were available for 37 of the transplants and are summarized in Table 2. Pre-transplantation critical care utilization in the CLF transplant recipients was high (Table 1). Two thirds of recipients required admission to the intensive care unit prior to transplantation. One of three recipients was on a vasopressor before transplantation, and 13% were mechanically ventilated. Renal replacement therapy in the form of either standard hemodialysis or continuous veno-venous hemodialysis was used before operation in 90% of the recipients. The mean length of surgery for liver transplantation was 8 hr, with combined kidney transplan-

Materials and methods A list of all liver transplantation candidates achieving a

tation adding an additional 3.5 hr (Table 3). All but one liver transplantation were performed in the piggyback fashion. An aortic conduit was required in 21% of 7


Галицький лікарський вісник, 2013, Т. 20, № 4

Table 1. Patient demographics

the recipients, and one recipient required a portal vein graft. A choledocho-choledochostomy was performed in 82% of the recipients. An average of 16 U of packed red blood cells was transfused. Outcomes after liver transplantation for patients with a MELD score of 40 or higher are shown in Table 4. Length of stay for the transplantation admission averaged 58 days with a mean postoperative length of stay of 38 days. There was a 21% perioperative reoperation rate mostly for evacuation of hematoma. Eleven percent of patients developed a culture-positive postoperative intraabdominal infection. There were no hepatic artery thromboses, and a single patient developed portal vein thrombosis requiring reexploration. One patient developed a bile leak after operation, and 18% of patients developed a bile duct stricture within 6 months diagnosed by either endoscopic retrograde cholangiopancreatography or percutaneous transhepatic cholangiography. Bacteremia diagnosed by positive blood culture developed in 42% of the patients within the first 90 days after operation, and 8% of patients developed fungemia. Kaplan-Meier–based 1-, 2-, and 3-year patient survival rates were 89%, 82%, and 77% with 1-, 2-, and 3-year graft survival rates of 84%, 75%, and 70%, respectively (Fig. 1). Three liver-alone transplant recipients with graft failure underwent retransplantation. In comparison, the 1-year patient survival rate in 26 consecutive liver transplants for patients with a MELD score of less than 40 performed in 2010 was 92%. The mean age at transplantation for this comparator group was 53.7 years, with 77% undergoing isolated liver transplantation and 23% undergoing

8

Table 2. Donor demographic data.

combined liver and kidney transplantation. The most common indication for transplantation was hepatitis C (46.2%) followed by alcoholic cirrhosis (23.1%). Thirty-eight percent of recipients also had hepatocellular carcinoma. The mean MELD score at the time of transplantation was 30, and the median postoperative length of stay was 15.5 days. The incidence of postoperative bacteremia was 7.7% with no postoperative fungemia. Slightly more than a quarter of patients (27%) required reoperation. One patient developed hepatic artery thrombosis, and there were no portal vein thromboses. The biliary stricture rate at 1 year was 23.1%. Univariate analysis of transplantation patients with a MELD score of 40 or higher identified an admission-to-transplantation time of more than 15 days, combined liver and kidney transplantation, and recipient diabetes as preoperative factors associated with an increased risk of postoperative death (Table 5). Recipient diabetes remained a significant risk factor in the multivariate analysis with both admission-to-transplantation time of more than 15 days and combined liver and kidney transplantation only trending toward an increased risk of death. Similarly, Table 3. Perioperative data.


Галицький лікарський вісник, 2013, Т. 20, № 4 Table 4. Post-operative outcomes.

univariate analysis identified an admission-to-transplantation time of more than 15 days and combined liver and kidney transplantation as preoperative factors associated with an increased risk of graft loss (Table 6). Admission-to-transplantation time of more than 15 days remained a significant risk factor in the multivariate analysis. Discussion Although the number of liver transplants performed annually seems to have plateaued at 6000 per year, Scientific Registry of Transplant Recipients data indicate that the degree of illness of liver transplant recipients continues to rise. The percentage of transplant recipients nationally achieving a MELD score of 40 or higher increased from 6.8% in 2006 to 10.7% in 2010 (www.ustransplant.org, Accessed April 18, 2012). In our center, more than 50% of transplant recipients with a MELD score of 40 or higher waited more than 7 days to receive a suitable organ offer. As both the number of transplants performed for patients with a MELD score of 40 or higher rises and the amount of time that the recipients spend waiting for an organ increases, it becomes important to characterize this specific group of patients. To our knowledge, no publications address outcomes in this unique group of patients. Several single-institution series have reported inferior outcomes for liver transplant recipients stratified by an increasing MELD score at the time of transplantation (6, 7). Onaca et al. (6) grouped 669 patients according to their MELD scores: those with a MELD score of less than 15, those with a MELD score of 15 to 24, and those with a MELD score of 25 or higher. Patients

Fig 1. Kaplan-Meier overall graft and patient survival rates for recipients who underwent transdplantation for chronic liver failure with a MELD score of 40 or higher

with a MELD score of 25 or higher showed a significantly inferior 12- and 24-month survival rate compared with those with a MELD score of less than 15. Saab et al. (7) grouped 404 patients as follows: those with a MELD score of less than 10, those with a MELD score of 11 to 18, those with a MELD score of 19 to 24, those with a MELD score of 25 to 35, and those with a MELD score of 36 or higher. Patients with a MELD score of 36 or higher showed a 1-year survival rate of 69% compared with 79% for those with a MELD score of 25 to 35 and 90% for all other groups. Similar outcomes were described in a study by Jacob et al. (8). However, all the aforementioned studies group together patients with a MELD score of less than 40, who are ranked in descending order based on a dynamic numerical score, with patients with a MELD score of 40 or higher, who are ranked in descending order based on the time at a MELD score of 40 or higher. Our 1-year patient survival rate of 89% in patients with a

Table 5. Cox regression analysis of patient survival

9


Галицький лікарський вісник, 2013, Т. 20, № 4

Table 6. Cox regression analysis of graft survival

MELD score of 40 or higher is superior to that of the highest MELD groups reported in the aforementioned series and similar to the 92% 1-year patient survival rate in patients with a MELD score of less than 40 in our center. An increasing amount of attention has recently been focused on donor factors that affect recipient outcomes. Some metrics such as the Donor Risk Index predict recipient outcome solely based on donor information, whereas others such as the DMELD, the product of the donor age and recipient MELD score, use a combination of donor and recipient information (9, 10). Merion et al. demonstrated that waitlisted patients with a MELD score of 40 or higher achieved the most significant survival benefit from liver transplantation irrespective of donor allograft quality due to their high waitlist mortality rate and short life expectancy (4, 11). In practice, however, selection of a donor allograft with a 50% likelihood of failure at 1 year would be unacceptable even if declining the organ transplant resulted in a greater than 50% likelihood of mortality on the waitlist. We preferentially used high-quality donors in this critically ill group of patients to minimize the incidence of graft dysfunction during and after operation. This approach is conceptually similar to attempting to minimize the D-MELD score. The typical accepted organ donor was from a man in his mid-30s with a body mass index of 25. We avoided using partial allografts or those from donation after cardiac death. Despite this, our average peak DMELD score was still 1599 (range, 792–3008) with 17 patients having a peak D-MELD score of greater than 1628 and an estimated 3-year survival rate of less than 70% (12). However, analysis of our data did not demonstrate any significant difference in patient or graft survival rate between the group whose D-MELD is greater than 1628 and the group whose D-MELD is equal to or less than 1628 at 3 years. Several studies have found high MELD score to be associated with an increased risk for posttransplantation infection, intensive care utilization, length of stay, and cost (13–15). Most of our recipients required intensive care with a significant percentage needing hemodynamic, ventilatory, or renal support. We found that the likelihood of being placed on renal replacement therapy increased with an increasing time from admission to transplantation. Although not statistically significant because of small sample size, we also found an increasing rate of combined liverkidney transplantation of 44% in recipients waiting more than 15 days from the time of admission to transplantation as compared with a 20% rate in those waiting for 15 days or less. By comparison, the rate of combined liver-kidney transplantation was 23% in 2010 for recipients with a MELD score of less than 40 at our institution. One of five recipients required reoperation, and nearly 20% developed a bile duct stricture within 6 months. These complication rates are similar to those seen in our transplant recipients with a MELD score of less than 40. A 42% posttransplantation bacteremia rate reflects the profound immunosuppression associated with end-stage liver disease and liver-

10

related malnutrition in this critically ill population and is much higher than the 7.7% rate we have seen in our patients with a MELD score of less than 40. The degree of recipient deconditioning resulted in the need for prolonged hospital-level care and a median postoperative length of stay of 23 days as compared with 15.5 days in our patients with a MELD score of less than 40. Despite these challenges, an acceptable 1-year patient survival rate is achievable. Our 2- and 3-year outcomes are consistent with the published United Network for Organ Sharing (UNOS) data. Causes of postoperative mortality included recurrent hepatitis C graft failure, sepsis, cardiac dysfunction, and ischemic cholangiopathy. Identifying preoperative factors associated with poor postoperative outcomes is critically important in liver transplantation because of the scarcity of suitable donor organs. A limited univariate analysis identified three factors that influenced post– liver transplantation outcomes in patients who underwent transplantation with a MELD score of 40 or higher: admission-totransplantation time of more than 15 days, combined liver and kidney transplantation, and recipient diabetes. Our multivariate analysis is limited by our small sample size but confirmed the deleterious effect of prolonged pretransplantation hospitalization and pretransplantation diabetes on posttransplantation outcome. As expected, the nutritional, immunologic, and renal deteriorations associated with prolonged pretransplantation hospitalization and diabetes should and do manifest in posttransplantation mortality. Our findings emphasize that time is of essence in this critically ill group of patients. Waiting in the hospital for a prolonged period increases the likelihood of not only pretransplantation mortality but also posttransplantation graft loss and death in patients with a MELD score of 40 or higher. However, it is important to emphasize that liver transplantation in patients with a MELD score of 40 or higher can have acceptable outcomes, and an optimal scoring index to consistently predict futile transplantation remains to be identified. References 1. Kamath PS, Wiesner RH, Malinchoc M, et al. A model to predict survival in patients with end-stage liver disease. Hepatology 2001; 33: 464. 2. Freeman RB Jr, Wiesner RH, Harper A, et al. The new liver allocation system: moving toward evidence-based transplantation policy. Liver Transpl 2002; 8: 851. 3. Federal Register. [FR Doc. 98-8191] 42 CFR Part 121 1998: 16296. 4. Merion RM, Schaubel DE, Dykstra DM, et al. The survival benefit of liver transplantation. Am J Transplant 2005; 5: 307. 5. Trotter JF, Osgood MJ. MELD scores of liver transplant recipients according to size of waiting list: impact of organ allocation and patient outcomes. JAMA 2004; 291: 1871. http://ovidsp.tx.ovid. com.libproxy.usc.edu/sp-3.10.0b/ovidweb.cgi?&S= NNKOFPEPHHDDGGHDNCNKOEMCLGNKAA00 &Link+Set=S.sh.22% 7c4%7csl_10 - 22 6. OnacaNN, Levy MF, Sanchez EQ, et al. A correlation between the pretransplantation MELD score and mortality in the first two years after


Галицький лікарський вісник, 2013, Т. 20, № 4 liver transplantation. Liver Transpl 2003; 9: 117. 7. Saab S, Wang V, Ibrahim AB, et al. MELD score predicts 1-year patient survival post-orthotopic liver transplantation. Liver Transpl 2003; 9: 473. 8. Jacob M, Copley LP, Lewsey JD, et al.Pretransplant MELD score and post liver transplantation survival in the UK and Ireland. Liver Transpl 2004; 10: 903. 9. Feng S, Goodrich NP, Bragg-Gresham JL, et al. Characteristics associated with liver graft failure: the concept of a donor risk index. Am J Transplant 2006; 6: 783. 10. Halldorson JB, Bakthavatsalam R, Fix O, et al. D-MELD, a simple predictor of post liver transplant mortality for optimization of donor/recipient matching. Am J Transplant 2009; 9: 318. 11. Pomfret EA, Fryer JP, Sima CS, et al. Liver and intestine transplantation in the United States, 1996–2005. Am J Transplant 2007; 7: 1376. 12. Avolio AW, Cillo U, Salizzoni M, et al. Balancing donor and recipient risk factors in liver transplantation: the value of D-MELD with particular reference to HCV recipients. Am J Transplant 2011; 11: 2724. 13. Sun HY, Cacciarelli TV, Singh N. Identifying a targeted population at high risk for infections after liver transplantation in the MELD era. Clin Transplant 2011; 25: 420. 14. Foxton MR, Al-Freah MA, Portal AJ, et al. Increased model for end-stage liver disease score at the time of liver transplant results in prolonged hospitalization and overall intensive care unit costs. Liver Transpl 2010; 16: 668 15. Oberkofler CE, Dutkowski P, Stocker R, et al. Model of end stage liver disease (MELD) score greater than 23 predicts length of stay in the ICU but not mortality in liver transplant recipients. Crit Care 2010; 14: R117 Геник Ю., Алексопоулос С. Трансплантація печінки у хворих, які мають 40 і більше балів згідно шкали для оцінки захворювання печінки останньої стадії. Відділ хірургії печінки, жовчного тракту та підшлункової залози і трансплантації органів черевної порожнини Факультет хірургії, Кекська школа медицини, університет Південної Каліфорнії, Лос Анджелес, Каліфорнія, США. Резюме. Історія питання: Пацієнти, що набирають 40 і більше

балів за шкалою оцінки захворювання печінки останньої стадії (ШОЗПОС), мають високу ймовірність у потребі пересадки печінки. У деяких регіонах обмеженість донорських органів привела до суттєвого зростання числа пацієнтів, які отримали трансплант, маючи 40 і більше балів згідно ШОЗПОС. Ціллю цієї статті було описання наслідків трансплантації печінки у цих пацієнтів. Методи: Ретроспективне дослідження проводилось в одному центрі і оцінило результати трансплантації печінки у 38 пацієнтів, що набрали 40 і більше балів згідно ШОЗПОС у період з 1 січня 2006 року до 30 листопада 2010 року. Визначили рівень виживання пацієнтів, довговічності трансплантів і незалежних факторів ризику у післяопераційній смерті. Результати: Згідно Каплана і Меєра рівень виживання пацієнтів після 1 року складав 89%, після 2 років – 82%, після 3 років – 77%. З пересаджених органів після 1 року продовжували функціонувати 84%, після 2 років – 75%, після 3 років – 70.3%. Кожен третій з пацієнтів отримував вазопресори перед трансплантацією, а 13% були на механічному вентилюванні. Терапія обміну ниркових речовин проводилась у 90% пацієнтів перед операцією. У середньому післяопераційне перебування тривало 38 днів. Бактеріємія трапилась у 42% пацієнтів, а звуження жовчного тракту відбулось у 18% пацієнтів протягом 6 місяців після операції. Одновимірний аналіз показав, що тривалість перебування у лікарні (від прийому до трансплантації) і наявність діабету в пацієнтів є факторами ризику, що можуть провести до смерті пацієнта і відмови транспланта. Багатовимірний аналіз підтвердив, що діабет є фактором ризику, що впливає на виживання пацієнта, а перебування у лікарні більше 15 днів (від прийому до трансплантації) є фактором ризику для пересадженого органу. Висновки: Задовільні результати можуть досягатись після пересадки печінки у пацієнтів, які набрали 40 і більше балів згідно ШОЗПОС, при інтенсивнішому використанні ресурсів перед та після трансплантації.

Received 25.11.2013.

11


Галицький лікарський вісник, 2013, Т. 20, № 4

ÎÐÈòÍÀËÜͲ ÄÎÑ˲ÄÆÅÍÍß Richard Wagner, MD1, Johan Fagan, MBChB, MMed2 Survey of Otolaryngology Services in Central America: Need for a Comprehensive Intervention 1

Global ENT Outreach, Coupeville, WA Division of Otolaryngology, Faculty of Health Sciences, University of Cape Town, South Africa 2

Abstract In the developing world, there exists a scarcity of services and training in otolaryngology, audiology, and speech therapy, which is reflected by the gap between health care delivery in high-income countries and low-income countries. We surveyed, by questionnaire, the countries of Central America, except for Belize, because of the lack of otolaryngology services, on the following issues: availability of otolaryngology, audiology, and speech therapy services and equipment; otolaryngologist, audiologist, and speech therapist training; and availability of services in rural areas. Surveys were distributed via email and by hand at the 2011 Central American Congress of Otolaryngology, in San Salvador, El Salvador, to otolaryngologists, audiologists, and speech therapists. Not to our surprise, there is a shortfall in services and training in all three professions. The data collected and presented in this commentary will provide a basis by which change might take place. Keywords: otolaryngology, ENT, audiology, speech therapy, developing countries, Central America.

Development is about transforming the lives of people, not just transforming economies.’’1 This quote by Joseph Stiglitz, a renowned economist, appropriately lays the foundation for the importance of public health and the intense debate around addressing global health problems. Although public health threats emanating from chemical exposure, nuclear accidents, environmental disasters, and terrorism are ever present, they are outweighed by acquired natural diseases such as influenza and diseases of poverty and neglect. Unequal distribution of wealth as seen on a global scale, and along with it suboptimal infrastructure and education, subject developing countries to growing economic disparity. The overall burden of disease, as assessed using the disability-adjusted life-year, a time-based measure that combines years of life lost due to premature mortality and years of life lost due to time lived in states of less than full health, are unequally disproportionate in developing countries. As pointed out in a previous article, ‘‘Survey of Otolaryngology Services in Africa,’’2 this inverse relationship is most evident in Africa. However, other regions, such as Central America, although not frequently studied, have similar challenges. Along similar lines, Paul Farmer identities that a lack of surgical services on a global proportion is responsible for the deaths of millions of people annually and, along with noncommunicable diseases, receives poor attention by global public heath communities.3 Epidemiological studies on disabling hearing loss cite that between 5% and 8% of the world’s population is afflicted by some form of ear disease, which ranks it third globally on the list of nonfatal disabling conditions in developing countries.4 The World Development Report in 1993 found that 51,000 children younger than 5 years died per year from ear disease and its related complications and that even this is an overwhelming underestimation.5 In the global health arena, agreement exists that there is a need to initiate interventions that will address conditions neglected by global estimates of burden of disease, such as hearing loss.6 This survey was conducted to assess the availability of otolaryngology, audiology, and speech therapy services and training in Central America. Aims of the Study 1. Establish a database of otolaryngology, audiology, and speech therapy services in Central America. 2. Improve awareness of the status of these services in Cen-

12

tral America. 3. Gather data to lobby Central American governments, the Pan American Health Organization, donor countries, and aid organizations. 4. Plan and promote programs that will target support for these services. 5. Help promote the creation of a Developing World Forum for Otolaryngology, Audiology, and Speech Therapy Detailed Methods There were 8 surveys emailed, and approximately 4 of them were returned. At the 2011 Central American Congress of Otolaryngology, held in San Salvador, El Salvador, the survey was distributed to 40 attendees of the congress, and 21 were returned. The surveys requested information on professional training; specialty demographics; available services in otolaryngology, audiology, and speech therapy, as well as equipment and testing available; and the outlook for the future. Results Otolaryngologists, audiologists, and speech therapists from the Central American countries of Costa Rica, El Salvador, Honduras, Guatemala, Nicaragua, and Panama were solicited and responded to the survey (Figure 1). Twenty surveys were returned, and data were collectively compiled for this report. All of the Central American countries studied have otolaryngology, audiology, and speech therapy services. Table 1 presents the numbers of otolaryngology surgeons, audiologists, and speech therapists per country, presents the ratio of population to practitioners, and compares it to the United States; the United

Figure 1. Six countries that participated in the survey


Галицький лікарський вісник, 2013, Т. 20, № 4

13


Галицький лікарський вісник, 2013, Т. 20, № 4

States has a far superior ratio per 100,000 people compared with the Central American countries polled. Although Costa Rica and Panama had the best ratios of otolaryngology surgeons/100,000, this represented only 55% and 50% of the US ratio, respectively. Guatemala has the biggest deficit of otolaryngology surgeons, equating to only 11% of the US ratio. There is a big shortage of audiologists in the six Central American countries (Table 1). Panama has the best ratio to population (47%) compared with the United States, followed by Costa Rica (6%); Guatemala has a ratio of only 0.7% compared with the United States. There is an even bigger shortage of speech therapists. Costa Rica has the best ratio/100,000 people, but only 5% of the US ratio, followed by Guatemala and Nicaragua, both with a ratio of 0.08% compared with the United States. If one were to apply the current ratios of otolaryngology surgeons, audiologists, and speech therapists in the United States to the total population (42.8 million) of the countries surveyed, then the shortages of personnel in these 6 countries is as follows: otolaryngology, 1498 2 408 = 1090; audiology, 1643 2 87 = 1556; speech therapy, 17,334 2 177 = 17,157. Table 2 presents a summary of otolaryngology, audiology, and speech therapy training programs. All 6 countries have otolaryngology training programs; however, only Costa Rica and Panama have audiology training programs, and speech therapy training is available only in Guatemala, Costa Rica, and Panama. Table 3 indicates that Costa Rica and Panama have the best public otologic surgical services; all other countries were considered ‘‘poor’’ to ‘‘good.’’ Hearing aids are not available to public patients in Nicaragua and are only poorly available in Guatemala, Panama, and El Salvador; auditory brainstem response is not available in Honduras, Nicaragua, or El Salvador in state services. There is no hearing screening in Honduras, Guatemala, El Salvador, and Guatemala. Costa Rica is the only country where acoustic neuroma and cochlear implantation surgery are done at state hospitals. Table 4 summarizes the availability of modern otolaryngology equipment at state facilities. Costa Rica and Panama maintain the highest standards of modern equipment, whereas El Salvador, Nicaragua, and Guatemala are all considered ‘‘poor’’; this includes basic otolaryngology equipment such as flexible nasopharyngoscopes, operating microscopes, and otologic drills. Radiation therapy is only poorly available in 4 of 6 counties, and positron emission tomography is not available in any of the countries in the state sector. CO2 laser was available only in Costa Rica. Not tabulated were the data on head and neck oncology surgery. Costa Rica and Panama are the most advanced in terms of head and neck surgical procedures. Costa Rica is the only country that has a CO2 laser. Partial laryngectomy and voice restoration prostheses are nonexistent in Guatemala, Honduras, and El Salvador, and neither pedicled nor free flaps are done in El Salvador. With regard to the access that patients have to sinus and rhinologic surgery, endoscopic sinus surgery is considered to be excellent in Panama and Costa Rica compared with all other countries surveyed. In all of the countries surveyed, we noted that the overwhelming majority of people depend on state health services. According to 2011 World Bank data (http://data.worldban k.org/topic/ agriculture-and-rural-development), a significant percentage of the population in Central America lives in rural areas: Guatemala (50%), Honduras (48%), Nicaragua (42%), El Salvador and Costa Rica (35%), and Panama (25%). Yet otolaryngology services for the most part are restricted to major cities (Table 3), and access was considered to be either poor or very poor outside of the major cities. Discussion This project represents the second report of otolaryngology,

14

audiology, and speech therapy services in developing world countries.2 The first author (R.W.) has taught otology and done otologic surgery in Central America for a number of years. Based on his personal experience and the data presented in this study, there are clearly both disparities and similarities of otolaryngology-related services in Central American countries. Panama and Costa Rica have the highest levels of care and resources available in the state-run health care systems in Central America. Costa Rica, interestingly, is the only Central American country without a military and a military budget.7 Both Costa Rica and Panama spend 4 to 5 times the amount in dollars on health at purchasing power parity per capita than the rest of the countries.8 Although specialty training in otolaryngology is available in all of the countries surveyed, there are enormous shortfalls of otolaryngology surgeons, as well as audiologists and speech therapists, when compared with the neighboring United States. Each country sets its own standards and does not follow uniform educational criteria and standards such as those set forth by the American Board of Otolaryngology or its European equivalent. Fellowship training is not available in any of the subspecialities laryngology, otology, head and neck surgery, or rhinology. Head and neck surgery in many of the countries is performed by general surgeons, such as in El Salvador in particular. Otology is available only in the capitals or the largest cities and is performed by those who were trained outside the country. Although otosclerosis is quite prevalent in El Salvador, such patients only rarely undergo surgery due to lack of implants and skilled surgeons. Graduates who wish to further their specialist education upon completion of otolaryngology residency usually do so in Mexico, Argentina, Spain, or Columbia. Only recently has the younger generation of otolaryngology surgeons been interested in ear disease and in going overseas for training. There is a great need for audiology and speech therapy training other than in Panama and Costa Rica, where programs already exist. Since 2000, there has essentially been little improvement in terms of access to training in these fields.9 The shortage of audiologists results in poorly trained technicians doing the bulk of the testing. In many Central and South American countries, like in some parts of Europe, otolaryngology specialists who hold the title of ‘‘auditory physician’’ practice audiology as their sole profession. The deaf do not have access to speech therapists because of their short supply. Health care is delivered at three levels in Central America. The first level is the public level, which includes hospitals and clinics. The second level is the social security system, which generally has a higher level of care due to its funding from taxes paid by the working class; here, the infrastructure and resources are generally more abundant. The third level of care is the private sector, where the infrastructure and medical technology is in many cases on a par with the developed world; less than 20% of the population in Central America has private insurance.10 Most professionals, be they otolaryngologists, audiologists, or speech therapists, allocate morning hours to working in public or state-run health institutions; the remainder of the day is spent in the private sector, where they earn the majority of their income. It is common knowledge that Central American countries have an enormous otolaryngology-related burden of disease. This audit presents a disturbing picture of underresourced, understaffed, and outdated otolaryngology, audiology, and speech therapy services in Central America. Mortality from simple otolaryngology infections, such as cholesteatoma and curable cancers, is ever present, and access to the most basic hearing tests or hearing rehabilitation is limited. Also highlighted is the lack of training facilities, critical to improving the shortage of qualified staff. Central America is geographically small, and the 6 countries surveyed have only 42 million inhabitants. A turnaround strategy to improve otolaryngology, audiology, and speech therapy services is therefore far simpler to implement than for the vast continent of Africa.2 A multinational collective approach is required to address the challenges identified in this study. Mea-


Галицький лікарський вісник, 2013, Т. 20, № 4

sures may include the following: otolaryngology training should be standardized for all of these countries, and a common board examination should be administered; training programs should be developed in countries that lack audiologist and speech therapists; and countries with existing training programs should either develop programs in countries lacking such programs or open their doors to foreigners. References 1. Stiglitz J. Making Globalization Work. New York, NY: W. W. Norton & Company; 2006. 2. Fagan J. Survey of otolaryngology services in Africa: need for a comprehensive intervention. Glob Health Action. 2009;2. http:// www.ncbi.nlm.nih.gov/pmc/articles/PMC2779942/. March 19, 2009. 3. Farmer PE, Kim JY. Surgery and global health: a view from beyond the OR. World J Surg. 2008;32:533–536. 4. Pascolini D, Smith A. Hearing impairment in 2008: a compilation of available epidemiological studies. Int J Audiol. 2009; 48:473–485. 5. World Development Report 1993. New York, NY: Oxford University Press; 1993:224–225, http://bjp.rcpsych.org/content/ 165/1/9.citation. 6. Garrett L. The challenges of global health. Foreign Aff. January/ February 2007. http://foreignaffairs.com/articles/ 62268/laurie-garrett/the-challenge-of-global-health. 7. World Bank Data. Military expenditure (% of GDP). 2012. http:// data.worldbank.org/indicator/MS.MIL.XPND.GD.ZS. 8. World Bank Data. Agriculture & rural development. 2011. http:// data.worldbank.org/topic/agriculture-and-rural-development. 2011. 9. Madriz JJ. Hearing impairment in Latin America: an inventory of limited options and resources. Audiology. 2000;39:212–220.

10. World Health Organization. World health statistics 2012. http:// www.who.int/gho/publications/world_health_statistics/2012/ en/. p. 133. Вагнер Р., Фаган Й. Огляд отоларингічних послуг у Центральній Америці: Потреба у комплексному втручанні Глобал ІНТ Аутріч, Купевіл, Вашингтон Відділення отоларингології, Кафедра Оздоровчих Наук, Університет М. Кейптаун, Південна Америка Резюме. У світі, що розвивається, існує дефіцит у послугах отоларингологів і нестача закладів, що їх готують, а також спеціалістів з аудіології та мовної терапії. Це підтверджується різницею у якості надання медичної допомоги між країнами з високим рівнем заробітку і країнами з низьким рівнем заробітку. За допомогою анкет, ми досліджували країни Центральної Америки (за винятком держави Беліз) і виявили наступні проблеми: наявність послуг та обладнання з отоларингології, аудіології і мовної терапії; наявність цих послуг у сільських місцевостях. Анкети були розповсюджені електронною поштою і людьми. На конгресі з отоларингології у Центральній Америці у 2011 році в Сан Сальвадорі, Ель Сальвадорі їх отримали отоларингологи, аудіологи і мовні терапевти. Ми не здивувались, коли дізнались про недостачу у послугах, які надаються представниками цих трьох професій, а також про недостачу навчальних закладів, що готують цих фахівців. Дані, зібрані й представлені у цьому дослідженні, стануть основою для впровадження подальших змін. Ключові слова: отоларингологія, ВГН, аудіологія, мовна терапія, країни, що розвиваються, Центральна Америка. Received 25.11.2013.

УДК 575.113+577.21

S. Wickersham, A. Golubov, I. Kovalchuk Purification of Ku70, Ku80, Rad51 and Rad52 proteins in Arabidopsis thaliana and generation of antiKu70 and anti-Rad51 antibodies Department of Biological Sciences, University of Lethbridge, Lethbridge, Alberta, Canada Summary. Successful techniques of genetic engineering and gene targeting depend on high activity of homologous recombination repair. Strand breaks in plant and animal somatic cells are primarily repaired by non-homologous end joining, a competitor of homologous recombination pathway. The objective of this study was to shift the naturally occurring balance of double strand break DNA repair in cells away from non-homologous end joining and towards homologous recombination. We hypothesized that this will improve the current methods for genetic engineering and ultimately practical applications like gene therapy. We amplified full cDNA copies of the proteins Ku70, Ku80, Rad51 and Rad54 using cDNA from Arabidopsis. The cDNA were overexpressed in Rosetta cells and the proteins were sent away to GenScript to obtain polyclonal antibodies. Generated antibodies were tested for recognition of Arabidopsis Ku70 and Rad51 proteins. We hypothesized that introducing the anti-Ku70 antibodies into cells would deplete the amount of Ku70 and this would result in the shift of strand break repair towards homologous recombination. In the future, we will use cell-penetrating peptide to deliver the antibody and to test the level of homologous recombination. Key words: Ku70, Ku80, Rad51 and Rad52 proteins, generation of anti-Ku70 and anti-Rad51 antibodies.

Introduction. Altering the balance between non-homologous end joining (NHEJ) frequency and homologous recombination (HR) frequency has been the focused direction of this work. NHEJ involves among other proteins Ku70 and Ku80, while homologous recombination utilizes Rad51 and Rad54 [7]. In S. cerevisiae Ku70 and Ku80 work in conjunction with ligase IV and XRCC4 to ensure proper DNA repair via the NHEJ path-

way [7]. In vertebrate cells Ku70 and Ku80 form a heterodimer that has a strong penchant for DNA ends and consequently binds with the damaged DNA [3]. The DNA bound Ku70/Ku80 heterodimer associates with, stabilizes, and activates the DNA-PKcs a catalytic subunit to form DNA-PK (DNA-dependent protein kinase), a necessary component of the non-homologous end joining pathway [9]. In studies investigating cell lines deficient in Ku proteins, little if any DNA-PK activity is seen indicating that the cell requires the presence of the Ku70/Ku80 for proper DNAPK functioning and therefore also non-homologous end joining [15]. The role of Ku proteins has been linked to the detection of damaged DNA in all eukaryotic cells. Rad51 and Rad54 are also conserved in eukaryotic cells and necessary elements of the homologous recombination DNA repair pathway [2]. Rad51 is very important for the HR DNA repair process because it catalyses the exchange of DNA between homologous strands by encouraging the association of the damaged DNA strand to its respective complementary, template strand [7]. Rad51 requires interaction with Rad54 for optimal efficiency and proper functioning [11]. Animal studies have shown that inactivation of Rad51 through artificial means results in early death of developing embryos while knockout studies of Rad54 show only an increased sensitivity to agents that induce double stranded breaks in DNA which emphasizes the essentialness of Rad51 and the complementary actions of Rad54 [4]. The success of genetic engineering and gene targeting in particular depends directly upon the activity of homologous re-

15


Галицький лікарський вісник, 2013, Т. 20, № 4

combination repair pathway [6]. Currently concerns exist surrounding the actual process of genetic modification and gene therapy. Part of this worry relates to the imbalance between the occurrence of homologous recombination and non-homologous end joining in cell DNA repair. The insertion of the transgene into the genome typically occurs through available breaks in the genomic DNA. These breaks are often the results of mistakes in replication and transcription as well as direct damage to DNA via free radicals and other toxic metabolites. The cell has two predominant ways to repair strand breaks – HR and NHEJ [10]. HR is quite specific because it makes use of its partner chromosome as a template. In contrast, NHEJ ligates the broken ends together without the use of such a homologous template [10]. When the ends can not be ligated directly, the modification of the broken ends occurs, followed by microhomology search and subsequent rejoining via ligation.The repair via end joining thus leads to insertions, deletions, and translocations. In vertebrates, the breaks are repaired predominantly via NHEJ, thus reducing the possibility of using somatic cells for efficient gene targeting and gene therapy [16]. Taking into consideration all the mentioned above, it can be hypothesized that a decrease in the amount of proteins required for NHEJ would result in a decrease in the frequency with which cells utilize NHEJ. This would in turn lead to a compensatory increase in the frequency of usage of HR repair mechanism. Similarly the overexpression of the proteins required for HR would help fuel the compensatory increase in HR activity. We hypothesized that delivery of antibodies against Ku70 or Ku80 proteins into cells used for gene targeting may decrease the activity of NHEJ by binding and precipitating Ku70/Ku80 proteins. We further hypothesized that by limiting the availability of resources required for proper completion of NHEJ, the cell will compensate by relying more on homologous recombination and shift the balance in favor of HR when repairing breaks in the cell’s DNA. The use of antibodies would make this shift temporary so only a limited upset in this balance would occur. Research by Pierce et al. (2001) [12]. has recently shown that knockouts of either Ku70, XRCC4, or DNA-PKCS in mammalian cells resulted in the increase of the frequency of occurrence of HR, supporting our prediction that a compensatory shift can occur [12]. As the first step in the aforementioned technique of increasing gene targeting rate we attempted to purify Ku70 and Rad51 proteins and to generate antibodies against them. We report successful purification of these proteins and generation of the anti-Ku70 and ant-Rad51 antibodies. Methods Primers used for the experiments The Vector NTI program was used to design forward and a reverse primers specific for Ku70, Ku80, Rad51 and Rad54 based on previously determined sequences in Arabidopsis thaliana (see Table 1). These were used together with PCR to amplify the genes from a cDNA library. They were designed with consideration for the availability of convenient restriction sites and melting temperature. Table 1. The sequence of the primers designed for all four genes: Ku70, Ku80, Rad51, and Rad54 Primer Gene Sequence name Ku70 Ku70.for ATGGAATTGGACCCAGATGATG Ku70 Ku70.rev TTATTTACCAATGTGAGTCAGAATCCG Ku80 KU80.for ATGGCACGAAATCGGGAGG Ku80 Ku80.rev TTAGCTCTCGAGCATTGACTCTTGTT Rad51 Rad51.for AAAGGTACCATGACCACCATGGAACAG CGCC Rad51 Rad51.rev AAAGGTACCCTATCAGTCCTTGCAGTCG GTCACG Rad54 Rad54.for AAAGGTACCATGGCCAGGCGCAGGCTC Rad54 Rad54.rev AAAGGTACCCTATCAGTGAGAGATGTA CTGGAAGGCGAAG

16

Table 2. PCR Reaction components for Ku70, Ku80, Rad51 and Rad54 Rad51 and Ku70 and Ku80 Rad54 HF 5X Buffer (50 mM) 10 l 10 l dNTPs (2 mM) 5 l 5 l Forward Primer (10 M) 1 l 1 l Reverse Primer (10 M) 1 l 1 l DNA 8 l 0.5 l Phusion HF Polymerase (2 u/l) 0.5 l 0.5 l Gibco Pure Water 24.5 l 32 l Total Volume 50 l 50 l No. of Cycles 35 32 98 98 Denaturation Temperature (C) Denaturation Time (s) 10 30 58 65 Annealing Temperature (C) Annealing Time (s) 30 30 72 72 Elongation Temperature (C)

RNA purification and cDNA synthesis RNA was extracted from frozen ground in liquid nitrogen leaf tissues (~ 100 mg) of A. thaliana using Trizol reagent (Molecular Research Center, Inc.). The concentration of the isolated RNA was measured using the Amersham Pharmacia Biotech Ultraspec 1100pro UV/Visible spectrophotometer. For cDNA synthesis the RevertAid H Minus First Strand cDNA Synthesis Kit (Fermentas) was used. For our purposes, Oligo (dT)18 (100µM, 0.5µg/µl (15 A260 u/ml)) was used. The primers and the RNA (5-15 µg) were incubated at 70ЪC for five minutes to denature any double-stranded RNA pieces. Next the 5X Reaction Buffer (250 mM Tris-HCl (pH 8.3), 250 mM KCl, 20 mM MgCl2, 50mM DTT) was used to provide the appropriate chemical condition. Nucleotides (10 mM) and a ribonuclease inhibitor (RiboLock Ribonuclease Inhibitor; 20 u/µL) were added to the mixture and incubated at 37ЪC for 2 min. Reverse transcriptase (RevertAid H Minus M-MulV RT; 200 u/µL) finished the procedure by constructing strands of DNA using the mRNA as a template resulting in a single stranded cDNA library. Isolation of Ku70, Ku80, Rad51, and Rad54 Arabidopsis cDNA was used as the template in the PCR reactions for amplification of Ku70 (1866 bp) and Ku80 (2043 bp) genes. Amplification of Rad51 (1029 bp) was done from the plasmid pDEST::AtRad51, whereas amplification of Rad54 (2733 bp) – from plasmid pDEST::AtRad54. The PCR reactions also included a 1x Phusion GC Buffer (1.5 mM MgCl2) to provide optimal conditions for the PCR reaction, dNTPs (2 mM), the appropriate forward and reverse primers (10 mM) (Table 1) and Phusion HF polymerase (2 u/ml) (New England Biolabs, Inc.) and ddH2O to the final volume of 50 ml. See PCR reaction details in Tables 2. PCR products were excised from the gel and purified using the QIAquick PCR Purification Kit (QIAGEN) and used to clone into protein overexpression vector pET45b. Cloning into pET45b plasmid pET45b plasmid was selected for protein overexpression because it utilizes strong bacteriophage T7 signals for transcription and translation which allow for high expression of the cloned gene. PCR fragments with genes of interest (Ku70, Ku80, Rad51 and Rad54) were cloned into pET45b plasmids, generating pET45b::Ku70, pET45b::Ku80, pET45b::Rad51, and pET45b::Rad54 plasmids. Cloning of intact gene fragments was confirmed by sequencing. Induction and isolation of proteins Rosetta 2 cells were transformed with pET45b::Ku70, pET45b::Ku80, pET45b::Rad51, and pET45b::Rad54 plasmids. Gene expression was induced using 1 mM IPTG in 10 mL of LB/Carb100/Cm35. The transformed Rosetta 2 cells were incubated at 37°Cwith the IPTG enriched media at constant shaking (200 rpm) for five hours. The protein was purified using “Protocol 18: FPLC Purification of 6x His-tagged Proteins using NiNTA Superflow under Denaturing Conditions” and “Protocol


Галицький лікарський вісник, 2013, Т. 20, № 4

35kDa

1 1 2

3

2

3

1 2 3 4 5

Figure 1. PCR amplification of Ku70, Ku80, Rad51, Rad52 and Rad54 cDNA A. 1% agarose gel. Lane 1 - 1kb DNA Ladder Plus; Lane 2 - Ku70 PCR product; Lane 3 - Ku80 PCR product. B. 1% agarose gel. Lane 1 - 1kb DNA Ladder Plus; Lane 2 - Rad51 PCR product; Lane 3 and 4 - Rad52 PCR product; Lane 5 - Rad54 PCR product

Figure 2. Purification of Rad51 protein from Rosetta 2 cells 12% Coomassie-Stained PAGE gel. Lane 1 - PageRuler Plus Prestained Protein Ladder; Lane 2 – Rad51; Lane 3 – Re-purified Rad51 KU70

RAD52,

70.4 kD

56kD

250 kDa 100 kD a 70 kDa

A

55 kDa

Area with two hardly visible bands, which can be KU80, 76.8 kD

250 kDa

RAD51, 35 kDa 37kD

130 kDa 27 kDa

100 kDa

KU70 70.4 kD

70 kDa

15 kDa

55 kDa

1

1

2

3

4

5

2

3

4

5

6 Figure 4. Western Blot using anti-his-tag antibodies Lane 1 - PageRuler Plus Prestained Protein Ladder; Lane 2 – marker for 15, 30, 55 and 70 kDA; Lane 3 - Ku70; Lane 4 - Rad51; Lane 5 Rad54

B

19: 6X His-tagged Protein Minipreps under Denaturing Conditions” from the QIAexpressionist (QIAGEN) kit. Polyacrylamide gel electrophoresis (PAGE) using a 10% gel was used to identify the purified protein samples. Western Blots were run to further confirm the identity of the bands from the PAGE gels. The isolated and purified Rad51 and Ku70 proteins were sent to GenScript for antibody production. Polyclonal rabbit antibodies obtained from GenScript were used to detect purified Rad51 and Ku70 proteins.

1

2

3

4

5

6

7

8

9

Figure 3. Overexpression of Ku70, Ku80 and Rad52 proteins in Rosetta 2 cells A. 10% Coomassie-stained PAGE gel. Lane 1 - PageRuler Plus Prestained Protein Ladder; Lane 2 and 3 - Ku70; Lane 4 - Empty; Lane 5 and 6 - Ku80. 10% Coomassie-stained PAGE gel. Lane 1 - PageRuler Plus Prestained Protein Ladder; Lane 2 - empty; Lane 3 to 5 - Rad52; Lane 6 - empty; Lane 7 to 9 – Ku70

Results and Discussion As the first step in the attempt to regulate the NHEJ and HR activity in the cells, we decided to amplify cDNA and overexpress main NHEJ and HR repair proteins. As a next step, we have attempted to prepare antibodies against these proteins. Ku70, Ku80, Rad51, Rad54 and Rad52 genes were successfully amplified from A. thaliana cDNA (Figure 1). The PCR fragments were used for overexpression in pET45b plasmid. Ku70, Ku80, Rad51 and Rad52 were successfully overexpressed in Rosetta 2 cells, although Ku80 concentration was very low

17


Галицький лікарський вісник, 2013, Т. 20, № 4

To further confirm that the products visualized on ComB C D A massie gel carried the his-tag, we performed the Western blot with the antibodies against the his-tag. We were able to identify Ku70, Rad51 and Rad52 proteins, with corresponding sizes of 70.4, 37 and 56 kDa, respectively (Figure 4). We then used the purified Rad51 proteins to generate polyclonal antibodies that can be in the future used for deliv1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 ering into mammalian cells. The polyclonal anti-Rad51 antibodies from Genscript when Figure 5. Western Blot analysis using GenScript anti-Rad51 antibodies tested on A. thaliana plant exA. Reconstituted Pre-immune serum from Rabbit A. From left to right: Lane 1 – PageRuler Plus tract displayed a great degree Prestained Protein Ladder; Lane 2 - purified Rad51; Lane 3 – 1:10 dilution of Arabidopsis plant extract; Lane 4 - undiluted Arabidopsis plant extract. of nonspecific binding (Figure B. Reconstituted Antiserum after 4th Immunization from Rabbit A. From left to right: Lane 1 – 5). However, when using a PageRuler Plus Prestained Protein Ladder; Lane 2 - purified Rad51; Lane 3 – 1:10 dilution of Arabidoppurified Rad51 protein solusis plant extract; Lane 4 - undiluted Arabidopsis plant extract. tion instead of the plant extract C. Reconstituted Pre-immune serum from Rabbit B. From left to right: Lane 1 – PageRuler Plus it was clear that the polyclonal Prestained Protein Ladder; Lane 2 - purified Rad51; Lane 3 – 1:10 dilution of Arabidopsis plant extract; antibody serums detected Lane 4 - undiluted Arabidopsis plant extract. Rad51 while the pre-immune Reconstituted Antiserum after 4th Immunization from Rabbit B. From left to right: Lane 1 – PageRserums did not (Figure 6). uler Plus Prestained Protein Ladder; Lane 2 - purified Rad51; Lane 3 – 1:10 dilution of Arabidopsis It is not clear why the polyplant extract; Lane 4 - undiluted Arabidopsis plant extract clonal anti-Rad51 antibodies were not able to recognize and the bands were hardly visible on the gel (Figure 2,3). After being run through a 12% PAGE gels, the purified Rad51 protein plant Rad51. There are four different homologs of Rad51 in samples showed bands near the 35 kDa band of the PageRuler Arabidopsis, including Rad51B, Rad51C, Rad51D and Plus Prestained Protein Ladder (Fermentas), very close to the AtXRCC3 [1]. Although we used purified Rad51, the antibodsize of native Arabidopsis Rad51 protein of 37 kDa (see Figure ies may recognize several homologs, including truncated and 2). The purified Ku70 protein samples showed bands between modified proteins, thus preventing us from identification of a the 70 kDa and 100 kDa bands of the PageRuler Plus Prestained single protein band. As mentioned in the introduction, the freProtein Ladder (Fermentas) in a 10% PAGE gel, with the size of quency of successful gene targeting events depends on the activity of homologous recombination in the cell. That is, the highnative protein in Arabidopsis being 70.4 kDa (Figure 3). er is the HR frequency, the higher is the chance of integration of the transgene at a specific genomic location. This is one of the reasons the gene targeting is more efficient in the cells in which HR repair is more frequent, such as dividing cells, including embryonic stem cells [8]. Also, gene targeting and gene replacing is much easier in the organisms with high frequency of HR, such as yeasts [5] and Physcomitrella patens [14]. If our hypothesis is correct, then downregulation of key HR proteins would decrease the gene targeting frequency in the cells. In the future, we will test this hypothesis by delivering purified anti-Rad51 antibodies into cells, followed by the analysis of HR frequency and gene targeting efficiency. In addition, we will test whether delivery of anti-Ku70 antibodies into cells may increase the HR frequency as well as gene targeting events. References

Figure 6. Western Blot analysis using GenScript anti-Rad51 antibodies against purified Arabidopsis Rad51 protein Reconstituted Antiserum after 4th Immunization from Rabbit B was used. From left to right: Lane 1 – PageRuler Plus Prestained Protein Ladder; Lane 2 - purified Rad51; Lane 3 – 1:10 dilution of Arabidopsis plant extract; Lane 4 undiluted Arabidopsis plant extract; Lane 5 – PageRuler Plus Prestained Protein Ladder

18

1. Abe K. Arabidopsis RAD51C gene is important for homologous recombination in meiosis and mitosis / K. Abe, K. Osakabe, S. Nakayama [et al.] // Plant Physiol . – 2005. – Vol.139. – P. 896–908. 2. Ceballos S.J. Functions of the Snf2/Swi2 family Rad54 motor protein in homologous recombination / S.J. Ceballos, W.D. Heyer // Biochim Biophys Acta. – 2011. – Vol.1809.– P. 509–523. 3. Critchlow S.E. DNA end-joining: from yeast to man / S.E. Critchlow, S.P. Jackson // Trends Biochem Sc i . – 1998. – Vol. 23. – P. 394–398. 4. Essers J. Disruption of mouse RAD54 reduces ionizing radiation resistance and homologous recombination / J. Essers, R.W.Hendriks, S.M. Swagemakers.[et al.] // Cell. – 1997. – Vol. 89. – P. 195–204. 5. Haber J.E. Mating-type genes and MAT switching in Saccharomyces cerevisiae / J.E Haber // Genetics. – 2012. – Vol.191. – P. 33– 64. 6. Humbert O. Targeted gene therapies: tools, applications, optimization / O. Humbert, L. Davis, N. Maizels // Crit Rev Biochem Mol


Галицький лікарський вісник, 2013, Т. 20, № 4 Biol. – 2012. – Vol. 47. – P. 264–281. 7. Karpenshif Y. From yeast to mammals: recent advances in genetic control of homologous recombination / Y. Karpenshif, K.A. Bernstein // DNA Repair (Amst). –2012. – Vol. 11. – P. 781-788. 8. Leavitt A.D. Homologous recombination in human embryonic stem cells: a tool for advancing cell therapy and understanding and treating human disease / A.D. Leavitt, I. Hamlett // Clin Transl Sci. – 2011– Vol. 4. – P. 298–305. 9. Mahaney B.L. Repair of ionizing radiation-induced DNA double-strand breaks by non-homologous end-joining / B.L. Mahaney, K. Meek, S.P. Lees-Miller // Biochem. J. – 2009. – Vol. 417. – P. 639– 650. 10. Mao Z. 2008). DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells / Z. Mao, M. Bozzella, A. Seluanov [et al.] // Cell Cycle. – 2008. – Vol. 7. – P. 2902–2906. 11. Mazin A.V. Rad54, the motor of homologous recombination / A.V. Mazin, O.M. Mazina, D.Vbugreev [et al] // DNA Repair (Amst). – 2010. – Vol. 9. – P. 286–302. 12. Pierce A.J. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells / A. J. Pierce, P. Hu, M. Han [et al.] // Genes Dev. – 2001. – Vol. 15. – P. 3237–3242. 13. Reiss B. Homologous recombination and gene targeting in plant cells / B. Reiss // Int Rev Cytol. – 2003. – Vol. 228. – P. 85–139. 14. Schaefer D.G. A new moss genetics: targeted mutagenesis in Physcomitrella patens / D.G. Schaefer // Annu Rev Plant Biol. – 2002. – Vol. 53. – P. 477–501. 15. Singleton B.K. The C terminus of Ku80 activates the DNAdependent protein kinase catalytic subunit / B.K. Singleton, M.I. TorresArzayus, S.T. Rottinghaus [et al.] // Mol. Cell Bio. – 1999. – Vol. 19. – P.3267–3277. 16. Sonoda E. Differential usage of non-homologous end-joining and homologous recombination in double strand break repair / E. Son-

oda, H. Hochegger, A. Saberi [et al.] / DNA Repair (Amst). 2006. – Vol. 5. – P.1021–1029. Вікерсхем С., Голубов А., Ковальчук І. Очищення білків Ku70, Ku80, Rad51 і Rad52 арабідопсису та покоління антитіл анти-Ku70 і анти-Rad51 Кафедра біологічних наук, Летбриджський університет, Летбридж, Альберта, Канада Резюме. Успішні техніки генної інженерії та генного таргетингу залежать від високої активності репарування гомологічної рекомбінації. Розриви нитки рослинних і тваринних соматичних клітин головним чином репаруються негомологічним з’єднанням кінців, шляхом протилежним до гомологічної рекомбінації. Метою даного дослідження було змінити натурально виникаючий баланс репарування подвійного розриву нитки ДНК від негомологічного з’єднання кінців до гомологічної рекомбінації. Ми зробили припущення, що це дозволить поліпшити сучасні методи генної інженерії та, врешті-решт, практичні застосування, такі як генна терапія. Ми посилили повні копії кДНК білків Ku70, Ku80, Rad51і Rad54 використовуючи кДНК арабідопсису. Дані кДНК були надлишково виражені в клітинах Rosetta і відіслані на GenScript, щоб отримати поліклональні антитіла. Генеровані антитіла були протестовані на наявність білків Ku70 і Rad51. Ми припустили, що введення антитіл анти-Ku70 в клітини вичерпає кількість Ku70 і це призведе до зміни репарування розриву нитки до гомологічної рекомбінації. В подальшому ми використаємо клітинно-проникні пептиди, щоб доставити антитіла і протестувати рівень гомологічної рекомбінації. Ключові слова: білки Ku70, Ku80, Rad51 і Rad52, покоління антитіл анти-Ku70 і анти- Rad51. Received 30.09.2013.

УДК 616-076.5+575.1+613.953+616.24-002+616.155.194

Гаріджук Л.І., Ковальчук Л.Є., Кимачук М.І., Витвицька В.В., Ткачук О.В. Хромосомна нестабільність спадкового апарату у дітей раннього віку, хворих на ускладнену пневмонію у поєднанні із залізодефіцитною анемією Кафедра дитячих хвороб факультет післядипломної освіти (в.о. зав. каф. – проф. Синоверська О.Б.) Кафедра медичної біології з курсом медичної генетики (зав. каф. – проф. Ковальчук Л.Є.) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Вивчено цитогенетичні зміни спадкового апарату у дітей раннього віку, хворих на ускладнену пневмонію у поєднанні із залізодефіцитною анемією. Порівняльним аналізом змін генетичного апарату дітей, які хворіли на ускладнену пневмонію у поєднанні із залізодефіцитною анемією, було доведено їх залежність від ступеня тяжкості анемії. Виявлено збільшення частоти асоціацій акроцентричних хромосом та хромосомних аберацій у дітей з ускладненою пневмонією, порівняно з контролем, та залежність цих показників від ступеня тяжкості залізодефіцитної анемії. Встановлено, що найбільшу здатність до утворення асоціацій мають хромосоми 21, 15 і 14, найменшу – 12 і 13 у кожній групі хворих дітей. Серед типів хромосомних аберацій ідентифіковано хроматидні (одиночні фрагменти), хромосомні (парні фрагменти, поодинокі дицентрики і аномальні моноцентрики), делеції та розриви хромосом. У спектрі хромосомних аберацій доведено перевагу делецій довгого плеча четвертої та короткого плеча п’ятої і шостої хромосом. Ключові слова: діти, пневмонія, анемія, асоціації акроцентричних хромосом.

Постановка проблеми і аналіз останніх досліджень: Однією з актуальних проблем дитячої пульмонології, що

пов’язано з високим рівнем розповсюдженості та смертності, є пневмонії. Особливої уваги заслуговують випадки перебігу пневмонії на тлі обтяженого преморбідного фону чи супутньої патології [1, 2]. Серед багатьох причин, що можуть ускладнювати перебіг пневмонії, є дефіцит заліза. В останні роки спостерігається збільшення числа хворих на пневмонію серед дітей раннього віку, що протікає у поєднанні із залізодефіцитною анемією (ЗДА) [2]. Одним з найменш освітлених аспектів розглянутої проблеми залишаються порушення цитогенетичного гомеостазу при вищевказаній поєднаній патології. В даний час встановлений зв’язок між змінами хромосомного апарату клітин і запаленням. [5, 6, 9]. Зокрема, в літературі описано підвищення рівня хромосомних перебудов при таких запальних захворюваннях бронхолегеневої системи, як хронічний бронхіт, бронхіальна астма, гостра пневмонія [5, 11]. Серед чинників, які порушують генетичну стабільність при запаленні бронхів і легень, виділяють наступні: вплив інфекції, включаючи пряму цитогенетичну дію вірусів, а також непрямі ефекти бактеріальних і вірусних агентів; підвищений викид медіаторів запалення; кількісну та функціональну недостатність клітинної ланки імунітету.

19


Галицький лікарський вісник, 2013, Т. 20, № 4

Разом з тим, причинно-наслідкові взаємини запального процесу і цитогенетичних альтерацій не до кінця зрозумілі. У зв’язку з цим нами було досліджено зміни в хромосомному апараті дітей при даній поєднаній патології. При цьому основна увага була зосереджена на вивченні частоти асоціацій акроцентричних хромосом (ААХ) і хромосомних аберацій (ХА) у лімфоцитах периферійної крові, як маркерів імуногенетичного статусу людини. Мета дослідження – вивчення цитогенетичних змін у дітей раннього віку, хворих на ускладнену пневмонію у поєднанні із залізодефіцитною анемією. Матеріали і методи дослідження Об’єктом дослідження слугувала периферійна кров 25 дітей віком від двох місяців до трьох років. Пацієнти були розділені на п’ять однакових груп. В I групу ввійшли здорові діти, II групу склали діти, хворі на ускладнену пневмонію (УПн) без анемії, до III, IV і V груп належали хворі на ускладнену пневмонію з анемією легкого, середнього і тяжкого ступенів, відповідно. Культивування лімфоцитів периферійної крові та приготування препаратів хромосом проводилося за методичними рекомендаціями, затвердженими МОЗ України [3, 4]. Аналізували метафазні пластинки з добрим розкидом хромосом. Ідентифікацію хромосомних порушень, кількість асоціацій акроцентричних хромосом та хромосомних аберацій проводили з розрахунку 100 клітин на одного хворого на оптико-електронному комплексі “Метаскан–2.” Статистична обробка отриманих результатів здійснювалася на персональному комп`ютері за допомогою пакету статистичних программ Microsoft Exel 7.0. Цифрові результати були статистично оброблені за допомогою методу варіаційного аналізу. Вірогідність відмінності оцінювалась за допомогою параметричного критерію Фішера-Стьюдента [8].

Результати дослідження та їх обговорення Порівняльним аналізом змін генетичного апарату дітей, які хворіли на УПн у поєднанні із ЗДА, було доведено їх залежність від ступеня тяжкості анемії. Виявлено 437 ААХ у 513 метафазних клітинах хворих дітей, а в контролі цей показник був меншим в 4,05 рази (38 ААХ в 180 клітинах). При наростанні дефіциту заліза спостерігалася тенденція до зростання частоти ААХ. Найбільш виражені відмінності даного показника визначено у дітей V групи. Першим етапом роботи було вивчення загального розподілу ААХ залежно від кількості асоційованих у них хромосом. В контрольній групі частіше зустрічалися ААХ з двох і трьох хромосом, меншу кількість склали асоціації, до складу яких входили по чотири акроцентричних хромосоми. У дітей, хворих на УПн без ЗДА зареєстровано зростання ААХ по два акроцентрики у 1,21 рази, порівняно з контролем (р>0,05), проте меншу кількість склали ААХ з трьох хромосом. У групі дітей, хворих на ускладнену пневмонію у поєднанні із залізодефіцитною анемією легкого ступеню тяжкості, також відзначено зростання частоти ААХ, до складу яких входили по дві акроцентричних хромосоми у 1,16 рази, порівняно з контролем (р>0,05). Щодо кількості ААХ з трьох виявлено тенденцію до зростання, порівняно з такою у дітей II групи. Водночас у дітей III групи ідентифіковано ААХ з чотирьох хромосом на противагу дітям II групи. У дітей IV групи асоціації, до складу яких входили по дві акроцентричні хромосоми, зустрічалися з однаковою частотою, порівняно з групою контролю (рис. 1, а). Меншу кількість склали ААХ з трьох хромосом, проте помітно збільшилася частота ААХ з чотирьох у 1,60 рази (рис. 1, б). З наростанням ступеня тяжкості ЗДА (V клінічна група) відзначалася тенденція до збільшення асоціацій з двох та чотирьох хромосом. Однак, порівняно з частотою ААХ дітей з УПн у поєднанні із ЗДА середнього ступеня тяжкості, вищеназвані показники були нижчими, що може свідчити про виснаження компенсаторних можливостей імунної системи. Середня кількість ААХ в одній клітині контрольної групи становила (0,23±0,03) %. У дітей, хворих на УПн без анемії середня частота ААХ в одній клітині становила (0,63±0,03)%,

20

а

б Рис. 1. Метафазні пластинки дітей, хворих на ускладнену пневмонію із залізодефіцитною анемією середнього (а) та тяжкого (б) ступенів, з асоціаціями аероцентричних хромосом. Забарвлення за Гімза. Збільшення х1000

(р<0,001) і надалі збільшувалася в міру наростання тяжкості ЗДА: до (0,70±0,08) % – при легкому (р<0,001), до (0,85±0,10) % – при середньому (р<0,001), і до (1,50±-0,07)% (р<0,001) – при тяжкому ступені ЗДА. Всі ААХ за числом асоціацій хромосом були розділені на три групи (G, D i G+D), кожна з яких мала по три підгрупи, залежно від кількості хромосом в ААХ (табл. 1). У дітей, хворих на ускладнену пневмонію без анемії, частота асоціацій хромосом групи D по два акроцентрики переважала таку у контролі на 30,64 %. При аналізі особливостей у дітей з УПн на тлі ЗДА легкого, середнього та тяжкого ступенів достовірних відмінностей не виявлено, проте їхня частота перевищувала контроль на 20,0 %. Частота ААХ з трьох акроцентриків у дітей II, III та IV груп зустрічалася відповідно в 1,34, 1,27 та 1,38 рази рідше,ніж у контролі, а у дітей V групи неістотно зростала в 1,15 рази, порівняно з такою в IV групі. У дітей I та II груп ААХ з чотирьох хромосом не відмічалася і зареєстрована у дітей, хворих на УПн у поєднанні із ЗДА. Найчастіше зустрічалася у дітей, хворих на ускладнену пневмонію на тлі ЗДА середнього ступеня на 58,38 %, порівняно з такими у дітей III та V груп. У здорових дітей частота ААХ по дві хромосоми з групи


Галицький лікарський вісник, 2013, Т. 20, № 4

ступеня тяжкості залізодефіцитної анемії зміни в структурі хромосом зустрічалися з більшою ймовірністю. Середньогрупова частота метафаз із ХА у дітей з тяжким ступенем ЗДА переважала таку при тяжкому перебігу ЗДА в 1,33 рази (р<0,05). Серед типів ХА ідентифіковано хроматидні (одиночні фрагменти), які зустрічалися з більшою частотою при поєднаній патології, особливо при тяжкому ступені ЗДА (див табл. 2). Серед аберацій хромосомного типу спостерігалися парні фрагменти, у однієї дитини із УПн і ЗДА середнього ступеня – дицентрик, і у одного із пацієнтів V групи – аномальний моноцентрик. Вірогідне зростання частоти делецій та розривів хромосом встановлено у дітей II - V клінічних груп, порівняно з контролем (див. табл. 2). Виявлено тенденцію до збільшення кількості пробілів хромосом залежно від ступеня тяжкості ЗДА. Пробіли відрізняються від розривів тим, що між фрагментом і хромосомою не було зміщення, між ними спостерігався зв’язок. Всі вищеописані зміни хромосомного апарату засвідчили нестабільність генотипу, що могло зумовити порушення реалізації спадкової інформації та метаболізму клітин [7]. Дані дослідження показали, що в усіх групах дітей, хворих на УПн у поєднанні із ЗДА, виявлено делеції короткого плеча п’ятої-шостої хромосоми та довгого плеча четвертої хромосоми. А у V групі виявлено делеції у двох дітей: довгого плеча четвертої хромосоми та короткого плеча п’ятої хромосоми. Окрім того,ідентифіковано делецію сьомої хромосоми (46, ХХ, del 7 q32) у дівчинки із середнім ступенем ЗДА.

Таблиця 1. Показники асоціацій акроцентричних хромосом в лімфоцитах периферійної крові дітей, хворих на ускладнену пневмонію у поєднанні із залізодефіцитною анемією, M±m Частота Групи обстежених дітей клітин з асоціаціями залежно від I, n=5 II, n=5 III, n=5 IV, n=5 V, n=5 групи хромосом, (%) група D 2 асоціації 14,42±2,23 20,79±2,42 18,04±1,91 18,04±2,17 18,15±1,89 3 асоціації 12,56±1,73 9,36±0,73 9,83±3,56 9,08±0,75 10,40±1,39 4 асоціації 3,33±0,00 8,0±0,00 3,02±0,55 група G 2 асоціації 12,56±1,73 7,88±2,16 6,64±1,07* 7,34±0,67* 8,46±0,52 3 асоціації 12,88±3,79 5,84±0,84 7,32±1,70 7,18±1,80 5,68±0,69 4 асоціації 8,7±0,00 D+G групи 2 асоціації 27,73±2,54 37,40±3,54 38,69±4,14 30,44±1,83 30,88±1,26 * * 3 асоціації 32,88±4,30 18,0±1,11 17,37±1,53 24,40±2,58 16,94±0,56* 4 асоціації 19,09±0,91 7,94±1,95* 13,89±2,14 7,90±0,60* Примітки: * - дані вірогідні відносно контролю (р<0,05).  – дані вірогідні поміж четвертою та п’ятою групами (р<0,001)

G зустрічалася найчастіше. У дітей, хворих на ускладнену пневмонію без анемії, цей показник був на 37,26 % менший, порівняно з контролем. У дітей, хворих на УПн у поєднанні із ЗДА легкого ступеня тяжкості, зареєстровано найменшу кількість ААХ, порівняно з контролем, на 47,13 % (р<0,05). У всіх досліджуваних пацієнтів зареєстровано перевагу ААХ, які об’єднували хромосоми груп D i G. Особливо показовим у цьому відношенні була частота ААХ з чотирьох хромосом (див. табл. 1). Наступним етапом роботи було дослідження асоціативної здатності хромосом залежно від їх групової належності. В кожній групі хворих дітей найбільшу здатність до асоціацій мали хромосоми 21 (16,28 %), 15 (17,31 %) і 14 (19,24%), найменшу – хромосоми 22 (13,22 %) і 13 (11,43%). Варто зазначити, що кількість асоціацій хромосом групи D переважала таку групи G. При аналізі особливостей групи D у дітей з УП на тлі ЗДА середнього і тяжкого ступенів достовірних відмінностей не виявлено. Серед поєднання хромосом груп D і G переважно асоціювали 14 і 21. Інші хромосоми об’єднувались з однаковою частотою, хоча 21 хромосома частіше асоціювалася з хромосомами групи D, ніж 22. Окрім того, в комбінаціях хромосом групи G також відзначено більшу тенденцію до асоціювання 21 хромосоми, порівняно з 22 хромосомою. Останнє можна пояснити тим, що в інтерфазному ядрі формуються супутникові асоціації впродовж тривалої кон’югації гомологічних локусів гетерохроматичних районів супутникових ниток, які переносяться через мітоз і реєструються на метафазних пластинках [10]. Кількісні показники ААХ узгоджувалися з даними частоти ХА. Остання також переважала при поєднаній патології (УПн і ЗДА) (табл. 2). У дітей, хворих на УПн і ЗДА, загальний показник ХА був більшим, ніж у дітей без ЗДА в 1,32 та 2,51 рази (р<0,05), порівняно з таким у контролі. Наявність хромосомних мутацій відзначено у всіх обстежених дітей, однак з наростанням Таблиця 2. Частота і типи хромосомних аберацій у дітей, хворих на ускладнену пневмонію із залізодефіцитною анемією, M±m Групи обТипи хромосомних аберацій, % Хромосомні стежених, аберації, % делеції, пробіли інші n=25 розриви I, n=5 1,04±0,09 0,33±0,01 0,70±0,01 0,01±0,003 II, n=5 1,97±0,21 0,96±0,01* 0,91±0,02 0,10±0,001* III, n=5 2,61±0,12* 1,48±0,04* 1,01±0,01 0,12±0,002* IV, n=5 2,83±0,83* 1,67±0,02* 1,03±0,04 0,13±0,001* * * * * V, n=5 3,46±0,15 1,89±0,03 1,12±0,02 0,45±0,003 Примітка. * - вірогідність відмінності від контрольних показників (р< 0,05)

Висновки 1. Виявлено збільшення частоти ААХ та ХА у дітей з УПн, порівняно з контролем, та залежність цих показників від ступеня тяжкості ЗДА. 2. Встановлено, що найбільшу здатність до утворення асоціацій мають хромосоми 21, 15 і 14, найменшу – 12 і 13 у кожній групі хворих дітей. 3. У спектрі ХА доведено перевагу делецій довгого плеча четвертої та короткого плеча п’ятої і шостої хромосом. Перспективи подальших досліджень у даному напрямку полягають у вивченні взаємозв’язку між цитогенетичними порушеннями та функціонального стану геному нейтрофільних гранулоцитів периферійної крові. Література 1. Антипкін Ю. Г. Позалікарняна пневмонія у дітей / Ю. Г. Антипкін, А. О Гурецька // Здоровье женщины. – 2005. – № 4. – С. 159–161. 2. Гаріджук Л. І. Фактори ризику ускладненої пневмонії у поєднанні з дефіцитом заліза у дітей раннього віку / Л. І. Гаріджук // Галицький лікарський вісник – 2011. – № 2. – С. 28–30. 3. Зернова-Любимова Т. Е. Цитогенетичні методи дослідження хромосом людини / Т. Е. Зернова-Любимова, Н. Г. Горовенко // Методичні рекомендації. – Київ, 2003. – 23 с. 4. Зернова-Любимова Т. Е. Стандарти аналізу препаратів хромосом людини Т. Е. Зернова-Любимова, Н. Г. Горовенко // Методичні рекомендації. – Київ, 2003. – 52 с. 5. Козина С. Ю. Цитогенетические и иммунные нарушения у детей 2-5 лет, больных пневмонией, и их коррекция с использованием препарата «Три-Ви-Плюс» / С. Ю. Козина // Український журнал екстремальної медицини імені Г. О. Можаєва. – 2008. – № 4. – С. 81–8. 6. Козовий Р.В. Оцінка генетичного здоров’я дітей із районів посиленого екогенетичного контролю Івано-Франківської області / Р.В. Козовий // Науковий вісник Ужгородського університету серія «Медицина». вип. 23. – 2004. – С. 209–211.

21


Галицький лікарський вісник, 2013, Т. 20, № 4 7. Наследственные болезни: национальное руководство / Под. ред. Н. П. Бочкова, Е. К. Гинтера, В. П. Пузырева. – М.: ГЕОТАРМедиа, 2012. – 936 с. 8. Сазикин В. Л. Метод определения степепени достоверности показаталей / В. Л. Сазикин // Проблемы социальной гигиены, здравоохраненя и истории медицины. – 2006. – № 2. – 52 с. 9. Третяк Н. Н. Цитогенетические маркеры как фактор прогноза МДС / Н. Н. Третяк, А. М. Вакульчук, Т. П. Перехрестенко, О. В. Басова, и др. // Актуальные вопросы трансфузиологии и клинической медицины: Всероссийское совещание 27–28 мая 2008 г.: тезисы докл. – Кировск, 2008. – С. 132–133. 10. Фролов А.К. Иммуноцитогенетика. / А. К. Фролов, Н. Г. Арцимович, А. А. Сохин // – М.: Мед., 1993. – 240 с. 11. Чернюк Н. В. Інтерлейкіни та асоціації акроцентричних хромосом як імуноцитогенетичні параметри важкості перебігу бронхіальної астми / Н. В. Чернюк // Український медичний альманах. – 2001. – № 1. – С. 179–182. Гариджук Л.И., Ковальчук Л.Е., Кимачук М.И., Витвицькая В.В., Ткачук О.В. Хромосомная нестабильность наследственного аппарата у детей раннего возраста, больных, осложненной пневмонией в сочетании с железодефицитной анемией Кафедра детских болезней факультета последипломного образования (и. о. зав. каф. –проф. Синовеская О.Б.) Кафедра медицинской биологии с курсом медицинской генетики (зав. каф. – проф. Ковальчук Л.Е.) ГВУУ «Ивано-Франковский национальный медицинский университет» Резюме. Изучены цитогенетические изменения наследственного аппарата у детей раннего возраста, больных, осложненной пневмонией в сочетании с железодефицитной анемией. Сравнительным анализом изменений генетического аппарата детей, которые болели осложненной пневмонией в сочетании с железодефицитной анемией, была доказана их зависимость от степени тяжести анемии. Обнаружено увеличение частоты ассоциаций акроцентричных хромосом и хромосомных абераций в детей с осложненной пневмонией в сравнении с контролем и зависимость этих показателей от степени тяжести железодефицитной анемии. Установлено, что наибольшую способность к образованию ассоциаций имеют хромосомы 21, 15 и 14, наименьшую – 12 и 13 в каждой

группе больных детей. Среди типов хромосомных абераций идентифицировано хроматидные (одиночные фрагменты), хромосомные (парные фрагменты, одиночные дицентрики и аномальные моноцентрики), делеций и разрывов хромосом. В спектре хромосомных абераций доказано преимущество делеций длинного плеча четвертой и короткого плеча пятой и шестой хромосомы. Ключевые слова: дети, пневмония, анемия, ассоциации акроцентрических хромосом. L.I. Haridzhuk, L.E. Kovalchuk, M.I. Kimachuk, V.V. Vytvytska, O.V. Tkachuk Chromosomal Instability of Hereditary Apparatus in Children of Early Age, Suffering from Complicated Pneumonia Combined with Iron Deficiency Anemia SHEE “Ivano-Frankivsk National Medical University” Department of Children’s Diseases of the Postgraduate Education Faculty (Acting Head of the Faculty – Doctor of Medical Science, Professor Synoverska O.B) Department of Medical Biology with course of Medical Genetics (Head of the Department Doctor of Medical Science, Professor Kovalchuk L.E.) Ivano-Frankivsk, Ukraine, lyusic@ukr.net Summary: Cytogenetic changes of the hereditary apparatus in children of early age suffering from complicated pneumonia combined with iron deficiency anemia have been studied. Using comparative analysis of changes in the genetic apparatus of children suffering from CP combined with IDA, we proved their dependence on the severity of anemia. We found an increase in the frequency of associations of acrocentric chromosomes and chromosomal aberrations in children with complicated pneumonia compared with control and dependence of these parameters on the severity of iron deficiency anemia. It has been established that chromosomes 21, 15 and 14 have the greatest ability to form associations, the lowest - 12 and 13 in each group of sick children. Among the types of chromosomal aberrations we identified chromatic (single fragments), chromosomal (paired fragments, isolated dicentrics and abnormal monocentrics), deletions and chromosome disruption. In the spectrum of chromosomal aberrations we proved the advantage of deletions of long arm of the 4th and short arm of the 5th and 6th chromosomes. Key words: children, pneumonia, anemia, associations of acrocentric chromosomes. Надійшла 14.10.2013 року.

УДК: 616.24-007.272-036.12+616-005.4]-092:546.172.6-03

Калашник Д.М. Аналіз рівня стабільних метаболітів оксиду азоту в плазмі крові хворих на хронічне обструктивне захворювання легень (ХОЗЛ), ішемічну хворобу серця (ІХС) та ХОЗЛ у поєднанні з ІХС ДУ «Національний інститут терапії ім. Л.Т.Малої НАМН України», darunika@rambler.ru Резюме. Мета роботи - вивчити рівень стабільних метаболітів оксиду азоту - нітритів і нітратів у пацієнтів на ХОЗЛ, ІХС та ХОЗЛ у поєднанні з ІХС. Матеріали і методи: За темою дослідження обстежено 87 хворих, із них з ХОЗЛ+ІХС (n=31) віком (63,00+1,05) роки, ХОЗЛ (n=29) віком (64,00+1,01) роки, ІХС (n=27) віком (62,00+1,52) років. Чоловіків - 50 (57%), жінок - 37 ( 43%). Середній індекс маси тіла склав 30,1 кг/м2. Результати: Визначено, що вміст в плазмі крові суми метаболітів оксиду азоту NO2+NO3 у пацієнтів з (ХОЗЛ+ІХС) становить (21,52+3,17) мкмоль/л, при ХОЗЛ – (28,37+3,52) і при ІХС (31,72+5,84) мкмоль/л. Встановлено зворотній кореляційний зв’язок між NO2 + NO3 і ЛПНЩ (r = - 0,73, p = 0,006). Досліджено вміст NO2+NO3 у хворих з різним анамнезом паління. Так, NO2+NO3 значно вищий у тих, хто не палить, порівняно з курцями у всіх групах обстежених, р<0,05. Не виявлено кореляції між рівнем дисфункції ендотелію зі ступенем обструкції дихальних шляхів (р від 0,22 до 0,97). Ключові слова: стабільні метаболіти оксиду азоту,

22

паління, хронічне обструктивне захворювання легень, ішемічна хвороба серця.

Постановка проблеми і аналіз останніх досліджень. В останні роки все більше уваги приділяється ролі ендотелію судин в регуляції легеневого кровообігу, формуванню легеневої гіпертензії у хворих на ХОЗЛ, що обумовлює необхідність і важність дослідження функціонального стану ендотелію у даної категорії хворих. Серед біомаркерів патофізіології легень виділяють оксид азоту (NO), оксид вуглецю (CO), перекис водню (H2O2) та інші вуглеводи [1,2]. Аналіз дихання забезпечує зручну і просту альтернативу традиційному тестуванню зразків в клінічній лабораторії, але не надає повного уявлення про механізми розвитку патологічного стану. Недостатнє утворення і виділення NO є переважним механізмом розвитку гіпертензії малого кола і втрати


Галицький лікарський вісник, 2013, Т. 20, № 4

легеневими судинами здатності відповідати вазодилатацією на ендотелійзалежні субстанції. NO бере участь у реалізації багатьох функцій судинного ендотелію і відіграє провідну роль у підтримці гомеостазу серцево-судинної системи [3]. У нормі NO метаболізується до нітритів і нітратів, а частина його взаємодіє з супероксид-аніоном з утворенням пероксинітриту. Гіпоксія супроводжується збільшенням вільних радикалів, у тому числі супероксид-аніона, що призводить до руйнування NO і зниження його концентрації. При ХОЗЛ та ІХС виявлена ендотеліальна дисфункція на тлі оксидативного стресу з підвищеною продукцією вільних радикалів. У чисельних проспективних дослідженнях показано взаємозв’язок між дисфункцією ендотелію і розвитком несприятливих серцево-судинних ускладнень у хворих з ІХС, артеріальною гцпертонією, периферійним атеросклерозом [3]. Саме тому в даний час сформульоване уявлення про ендотелій як орган-мішень, який треба поліпшувати за допомогою профілактики і лікуванні серцево-судинних захворювань (ССЗ) [3]. Таким чином, ендотеліальна дисфункція та ремоделювання судин є важливими механізмами формування та прогресування серцево-судинної та бронхолегеневої патології. Наша увага припадає на коморбідність ІХС і ХОЗЛ у старших вікових груп, яка становить близько 60% [4,5]. Відомо, що ХОЗЛ підвищує ризик розвитку ІХС в 2-3 рази. Основні патогенетичні фактори, що об’єднують ХОЗЛ ті ІХС куріння і вільнорадикальне окислення. Загальний перебіг ХОЗЛ та ІХС підкоряються закону взаємного обтяження. Гіпоксія та її компенсаторні механізми (еритроцитоз, тахікардія), що розвиваються при ХОЗЛ, сприяють підвищенню потреби міокарда в кисні. Гіпоксія разом із системним запаленням і окислювальним стресом впливають на кровоносні судини, серце і легені, що приводить до ранніх проявів серцево-судинних захворювань при ХОЗЛ [6]. Вказані процеси мають безпосереднє відношення до утворення і функціонування NO. Крім того, нітрити та нітрати досить реакційноздатні, постійно перетворюються один в одного під дією оточуючих факторів і визначення їх концентрації відбувається в сумі, тобто нітрати відновлюються і виходить сумарний результат. З урахуванням вищесказаного метою роботи стало вивчення рівня стабільних метаболітів оксиду азоту - нітритів і нітратів у пацієнтів на ХОЗЛ, ІХС та ХОЗЛ у поєднанні з ІХС. Матеріали і методи дослідження

досліджено в плазмі крові спектрофотометричним методом за реакцією Гриса з використанням 1% розчину сульфонаміду та 0,1% розчину N-1-нафтил-етилендіамін дігідрохлориду та відновлення нітрату до нітриту з цинковим пилом. Депротеїнізацію зразків плазми проводили 55мМ ZnSO4 та 75мМ NaOH у об’ємному співвідношенні 2/5. Вимірювання оптичної щільності забарвленого комплексу проводили із використанням колориметру фотоелектричного “SPEKOL-11” (Германія). Дослідження проведено з використанням ZnSO4, NaOH, реактиву Гриса, який містить 12% оцтової кислоти, сульфонамід, альфа-нафтиламін. Результати досліджень виражали в мкмоль/л. Статистичну обробку проводили за допомогою комп’ютерних програм “SPSS 13”.

Результати дослідження та їх обговорення У результаті дослідження виявлено, що у курців з (ХОЗЛ+ІХС) вміст в плазмі крові суми метаболітів оксиду азоту NO2+NO3 становить (21,52+3,17) мкмоль/л, при ХОЗЛ – (28,37+3,52), при ІХС (31,72+5,84) мкмоль/л (таблиця 1). Порівняно з контролем (39,77+2,45), у всіх хворих вміст NO2+NO3 вірогідно нижчий (р<0,05). Так, у хворих на ІХС це може свідчити про дефіцит NO, який поглиблюється внаслідок зрушення рівноваги між анти- та прооксидантними системами в бік останніх [7]. Причиною цього зниження може бути нестійкість структури оксиду азоту або реакцією між NO і токсичним радікалом кисню. Згідно з даними літератури, зниження синтезу оксиду азоту в атеросклеротично змінених судинах обумовлено пригніченням експресії гену еNOS [8,9]. Слід зазначити, що однією з імовірних причин зниження активності еNOS є пероксид-модифіковані ЛПНЩ, які утворюються внаслідок оксидативного стресу та відіграють головну роль у розвитку атеросклерозу [10]. Відомості про взаємозв’язки рівня (NO2 + NO3) з показниками ліпідного спектру вельми суперечливі: за одними даними, концентрація NO2 + NO3 знижена й існує негативна кореляція з рівнем ЗХС, ХС ЛПНЩ, за іншими - підвищення рівня NO2 + NO3 у хворих на гіперхолестеринемію, що може бути пов’язано з інгібуючим дією NO при окисленні ЛПНЩ [11]. Одним з несприятливих факторів синтезу NO є гіперхолестеринемія. Так, відомо, що при гіперхолестеринемії відбувається порушення відновлення біоптеріна, в результаті чого знижується його біологічна активність і відбувається надлишкове утворення пероксинітриту. Також при гіперхолестеринемії може відбуватися порушення функції глутатіонового механізму - одного з основних шляхів інактивації пероксинітриту. Пероксинітрит збільшується в стінці судини й індукує окислення ЛПНЩ, в результаті чого зростає вміст лізофосфатіділхоліна - основного фактора, що ушкоджує eNOS, який призводить до дефіциту оксиду азоту [12]. У нашому досліджені продемонстровано, що гіперхолестеринемія поглиблює ендотеліальний розлад, що підтверджує наявність негативного кореляційного зв’язку між ХСЛПНЩ та рівнем нітриту (r = - 0,73, p = 0,006). Враховуючи похилий вік обстежених хворих, порівняно з контролем, та відсутність відмінностей у віці між групами пацієнтів, можна вважати виявлене нами зниження вмісту стабільних метаболітів оксиду азоту в плазмі крові ще й віковою характеристикою. Так, на зв’язок зниження вмісту стабільних метаболітів оксиду азоту з віковими змінами в організмі вказували і раніше [13].

За темою дослідження обстежено 87 хворих, із них з (ХОЗЛ+ІХС) - 31 людина віком (63,00+1,05) роки, ХОЗЛ - 29, віком (64,00+1,01) роки, ІХС – 27, віком (62,00+1,52) років. Чоловіків50 (57%), жінок - 37 ( 43%). Середній індекс маси тіла склав 30,1 кг/м2. Усі хворі були розділені на групи залежно від анамнезу куріння. Загальний стаж курця становив у пацієнтів з ХОЗЛ+ІХС (16,00+2,72), з ХОЗЛ - (6,06+2, 27) і при ІХС (10,8+3,0) пачкороків. Тривалість ХОЗЛ у хворих з коморбідним станом становила (4,70+0,46) роки, тривалість ІХС – (5,97+0,74) роки. Тривалість захворювання в інших групах: ХОЗЛ – (5,50+0,57) роки, ІХС – (9,07+1,30) роки. У контрольну групу увійшли 15 практично здорових осіб, середній вік яких становив (45,0+6,5) роки. Діагноз ХОЗЛ ставили згідно з наказом МОЗ України № 128 від 12.03.07, та положеннями, сформульованими в Таблиця 1. Рівень NO2 + NO3 у плазмі крові хворих на ХОЗЛ, документі GOLD (Global initiative for ChronicObstructive ІХС та ХОЗЛ у поєднанні з ІХС Lung Disease), на основі даних анамнезу, загальнокліКонтроль ХОЗЛ+ІХС нічного обстеження, ЕКГ, Ехо-КС, рентгенoграфії органів Показники ІХС (n= 27) ХОЗЛ (n=29) грудної клітки, визначення функції зовнішнього дихання (n=10) (n=31) (ФЗД). Курці/не Курці/не Курці/не Курці/не Згідно з рекомендаціями Європейського товариства палять палять палять палять кардіологів діагноз ІХС встановлювали на основі клініки NO2 +NO3, 39,77+2,45/ 31,72+5,84*/ 28,37+2,52*/ 21,52+3,17*/ (ангінозний біль), навантажувальних тестів (стресс-ЕхоКГ мкмоль/л 48,32+3,75* 39,7+2,12* 33,87+2,3* 27,34+2,18* з добутаміном, велоергометрія), ХМ ЕКГ, коронароангіоПримітки: * р<0,05 порівняно з групою контролю, курцями та графії або перенесеного інфаркту міокарда в анамнезі. тими, хто не палить; – р<0,05 порівняно з ІХС та ХОЗЛ Суму стабільних метаболітів оксиду азоту (NO2 + NO3)

23


Галицький лікарський вісник, 2013, Т. 20, № 4

Нами була встановлена негативна кореляція між рівнем NO2 + NO3 та віком пацієнтів (r=–0,67; р<0,05). Слід зазначити суттєвий вклад куріння в зниженні вмісту оксиду азоту. Відомо, що сигаретний дим впливає на розвиток ХОЗЛ у людини і тварин [14]. Механізм даного впливу пов’язують із вкладом індуцибельної NO-синтази в окислювальний стрес. При цьому збільшення тиску в легеневій артерії після шести місяців впливу сигаретного диму пов’язують з ремоделюванням судин і підвищенням судинної експресії нітротирозину – маркеру реактивних видів азоту, індукуючого оксидативне пошкодження. У людей вміст судинного нітротирозину підвищений у курців з ХОЗЛ, порівняно з некурцями, а в подальшому збільшений у курців з ХОЗЛ у поєднанні з легеневою гіпертензією. Тобто індукована сигаретним димом ЛГ пов’язана з оксидативним пошкодженням судин від реактивних форм азоту, джерелом яких є сам сигаретний дим. У нашому досліджені рівень NO2 + NO3 був значно вищий у тих, хто не палить, порівняно з курцями у всіх групах обстежених, р<0,05 (табл. 1). Відомо, що тяжкість дисфункції ендотелію в легеневих артеріях і венах корелює зі ступенем обструкції дихальних шляхів [15]. Хворі на ХОЗЛ демонструють зменшення утворення ендотеліального NO, що також може віддзеркалюватись на зниженні сумарного вмісту стабільних метаболітів оксидів азоту досліджувальних. Вважають також, що пригнічення експресії ендотеліальної NO-синтази (eNOS) і гальмування її активації лежить в основі зниження NO у хворих на ХОЗЛ. NO, як і ендотелій-похідний фактор гіперполяризації (EDHF), беруть участь в регуляції судинного тонусу в людських легеневих артеріях і венах, що впливає на тяжкість порушень і прогресування захворювання. Однак, існує протилежна думка. Так, Rutgers і співавтори повідомляють про відсутність відмінностей від групи здорових людей у NO, який видихається і NO2+NO3 в мокротинні та сироватці пацієнтів з ХОЗЛ. Автори припускаються думки, що NO не має великої ролі в патофізіології ХОЗЛ у стабільній фазі захворювання [16]. З урахуванням цього ми оцінили співвідношення між рівнем ОФВ1 та NO2 + NO3 у хворих всіх трьох груп. Нами не було встановлено суттєвого зв’язку між рівнем NO2 + NO3 та ОФВ1 (р від 0,22 до 0,97). На відміну від наших даних Jang and Choi, стверджує, що виявлені у мокротінні метаболіти NO є більш інформативним показником запалення дихальних шляхів, ніж сироватковий рівень [17]. Однак, наші пацієнти були в стабільній фазі ХОЗЛ. Підвищення рівня NO, що видихається, було продемонстровано у хворих на ХОЗЛ й іншими дослідниками та виявлена позитивна кореляція між видихуваним NO і ОФВ1 [18]. Дослідження Masakazu та співавторів показали, що рівні NO, що видихаються, були значно збільшені при бронхіальній астмі, порівняно з хворими на ХОЗЛ, хоча iNOSіммунопозитивні клітини спостерігалися майже в однаковому співвідношенні між астмою та ХОЗЛ. Відповідно до отриманих результатів, Masakazu припустив, що NO продукується в дихальних шляхах в результаті реакції з супероксид-аніон та/ або пероксидазо-залежного окиснення нітритів [19]. Зниження рівня NO у хворих на ХОЗЛ може бути пояснено реакцією NO зі збільшенням вільних радикалів кисню з утворенням пероксинітриту, який в кінцевому результаті призводить до відносно низьких сироваткових рівнів NO. У здорових людей NO2+NO3 рівні були значно нижчі у курців, ніж у тих, хто не палить (p<0,05). Ці результати підтверджуються спостереженнями Rutgers і співавт. [16]. Corradi і співавт. продемонстрували, що NO рівень, що видихається, був нижчий у курців, як здорових, так і хворих на ХОЗЛ. Автори припустили, що куріння може викликати хронічне пошкодження клітин, що продукують NO у дихальних шляхах [18]. Pryor and Stone встановили, що газова фаза

24

куріння сигарет містить 1015 радикалів за одну затяжку, насамперед алкільні і пероксильні типи. Крім того, оксид азоту присутній в сигареті в концентраціях від 500-1000 ppm за одну затяжку. Оксид азоту (No) швидко реагує з супер аніон оксидом з утворенням пероксинітриту (ONOO-). Ця сполука є дуже шкідливою для клітин і тканин. Підвищення інгаляції NO у курців може бути збільшено за рахунок NO і супероксид-аніону. Ці дві сполуки швидко реагують з утворенням пероксинітриту, тим самим знижуючи сироватковий рівень NO. Ця ситуація може сприяти тому, що знижується сироватковий рівень NO2+NO3 у здорових курців. Інша точка зору є такою, що підвищення інгаляції NO на сигаретний дим може призводити до зниження регуляторного впливу синтезу окису нітриту [16]. Висновки 1. Вміст у плазмі крові суми метаболітів оксиду азоту NO2+NO3 у пацієнтів з ХОЗЛ+ІХС, ХОЗЛ і ІХС вірогідно нижчий, порівняно з контролем (p<0,05), що може свідчити про дефіцит NO в результаті пригнічення еNOS. 2. Визначено, що існує кореляція між кількістю стабільних метаболітів окиду азоту у плазмі крові і віком пацієнта. Виявлена негативна кореляція між рівнем NO2 + NO3 та віком пацієнтів (r=–0,67; р<0,05). 3. Досліджено вміст NO2 + NO3 у хворих з різним анамнезом паління. Так, NO2 + NO3 значно вищий у тих, хто не палить, порівняно з курцями у всіх групах обстежених, р<0,05. 4. Не встановлено кореляції між тяжкістю дисфункції ендотелію зі ступенем обструкції дихальних шляхів. Не знайдено суттєвого зв’язку між рівнем NO2 + NO3 та ОФВ1 (р від 0,22 до 0,97). Перспективи подальшого дослідження Перспективним вважається проведення порівнювального дослідження між рівнем NO у крові, мокроті та повітрі, що видихається. Література 1. Dariusz Zakrzewicz Protein Arginine Methyltransferases (PRMTs): Promising Targets for the Treatment of Pulmonary Disorders / Dariusz Zakrzewicz, Anna Zakrzewicz, Klaus T. Preissner, Philipp Markart, and Malgorzata Wygrecka// Int J Mol Sci.2012.- Vol. 13(10).-P. 12383–12400. 2. Wright J.L. Pulmonary hypertension and vascular oxidative damage in cigarette smoke exposed eNOS(-/-) mice and human smokers / Wright J.L., Zhou S., Churg A. // Inhal Toxicol.- 2012.- Sep.Vol. 24(11).-P. 732-40. 3. Heitzer T. Endothelial dysfunction, oxidative stress and risk of cardiovascular events in patients with coronary disease/ Heitzer T, Schlinzig T, Krohn K et al. //Circulation.- 2001.- Vol. 104.-P. 263–268. 4. Бова А.А. Современные подходы к диагностике и лечению ишемической болезни сердца у больных хронической обструктивной болезнью легких / А.А.Бова, Д.В.Лапицкий // Медицинские новости. – 2007. – №9. – С.7-14. 5. Brulй C. Proteomic study of calpain interacting proteins during skeletal muscle aging / C.Brulй, E.Dargelos, R.Diallo et al. // Biochimie. – 2010. – Vol.92, №12. – P. 1923-1933. 6. Cui H. Prevalence of cardiovascular disease in subjects hospitalized due to chronic obstructive pulmonary disease in Beijing from 2000 to 2010 / H.Cui, D.M.Miao, Z.M.Wei [et al.] // J. Geriatr. Cardiol. – 2012. – Vol.9, №1. – P. 5-10. 7. Channon K.M. Nitric oxide synthase in atherosclerosis and vascular injury/ Channon K.M., Qian H.S., George S.E. // Arterioscler. Thromb.Vasc. Biol. – 2000. – Vol. 20. – P. 1873-1881. 8. Li H. Regulation of endothelial-tipe NO-synthase expression in pathophysiology and in responce to drugs/ Li H., Wallerath T., Munzel T., Fostermann U. // Nitric oxide. – 2002. – Vol. 7 (3). – P. 149-164. 9. Channon K.M. Nitric oxide synthase / Channon K.M., Qian H.S., George S.E. // Arterioscler. Thromb.Vasc. Biol. – 2002. – Vol. 31. – P. 1975-1979. 10. Ланкин В.З. Антиоксиданты в комплексной терапии атеросклероза: pro et contra/ Ланкин В.З., Тихазе А.К., Беленков Ю.Н. /


Галицький лікарський вісник, 2013, Т. 20, № 4 / Кардиология. – 2004. – № 2. – С. 72-81. 11. Балахонова Т.В. Влияние аторвастатина на функциональное состояние эндотелия у больных с наследственной гиперхолестеринемией / Балахонова Т.В., Погорелова О.А, Сусеков А.В и др. // Кардиология. – 2002. – № 1. – С. 20. 12. Коломиец В.В. Влияние атровастатина на функцию эндотелия у больных с ишемической болезнью сердца и артериальной гипертензией / Коломиец В.В., Ванханен Н.В., Боброва Е.В. и др. // Український кардіологічний журнал – 2006. – № 3. – С. 83-87. 13. Лапшина Л. А. Значение определения нитритов-нитратов как маркеров дисфункции эндотелия при сердечно-сосудистой патологии / Лапшина Л. А. , Кравчун П. Г. , Титова А. Ю. , Глебова О. В. // Врачу-практику № 6(74) XI - XII 2009 г. : С.49-53. 14. Declan Lyons, Teresa Donnelly, Thomas Walsh M.B. Impaired Endothelial Nitric Oxide Bioavailability: A Common Link Between Aging, Hypertension, and Atherogenesis?/ Declan Lyons, Teresa Donnelly, Thomas Walsh M.B. //Journal of the American Geriatrics Society.- Volume 57, Issue 1.-P.140–145, January 2009. 15. Yang Q. NO and EDHF pathways in pulmonary arteries and veins are impaired in COPD patients. / Yang Q., Shigemura N., Underwood M.J., Hsin M., Xue H.M., Huang Y., He G.W., Yu C.M. // Vascul Pharmacol. – 2012.- Vol. 57(2-4).-P.113-118. 16. Rutgers S.R.Markers of nitric oxide metabolism in sputum and exhaled air are not increased in chronic obstructive pulmonary diseases/ Rutgers S.R., Th. W van der Mark, Coers W., et al. // Thorax.- 1999.-Vol. 54.-P.576-580. 17. J. Jang A.S.Nitric oxide metabolites in patients with asthma: induced sputum versus blood/ J. Jang A.S., Choi I.S. //Repir Med.1999.-Vol. 93(12).-P. 912-918. 18. Corradi M.Increased exhaled nitric oxide in patients with stable chronic obstructive pulmonary disease/ Corradi M., Majori M., Caccian G.C. et al. // Thorax.- 1999.-Vol. 54.-P. 572-575. 19. Ichinose M. Increase in reactive nitrogen species production in chronic obstructive pulmonary disease airways/ Ichinose M., Sugiura H., Yamagata S. et al. // Am J Respir Crit Care Med.- 2000.-Vol. 162.-P. 701- 706. Калашник Д.Н. Анализ уровня стабильных метаболитов оксида азота в плазме крови больных с ХОЗЛ, ИБС и ХОЗЛ в сочетании с ИБС ГУ «Национальный институт терапии им. Л.Т.Малой НАМН Украины» Резюме. Цель работы - изучить уровень стабильных метаболитов оксида азота - нитритов и нитратов у пациентов ХОЗЛ, ИБС и ХОЗЛ в сочетании с ИБС. Материалы и методы: По теме исследования обследовано 87 больных, из них с (ХОЗЛ + ИБС) - 31

пациент в возрасте ( 63,00 +1,05 ) года , ХОЗЛ - у 29 пациентов в возрасте ( 64,00 +1,01 ) года , ИБС - 27 больных в возрасте ( 62,00 +1,52 ) лет. Мужчин -50 ( 57 % ) , женщин -37 ( 43%). Средний индекс массы тела составил 30,1 кг/м2. Результаты: Установлено, что содержание в плазме крови суммы метаболитов оксида азота NO2 + NO3 у пациентов с ( ХОЗЛ + ИБС ) составляет ( 21,52 +3,17) мкмоль / л , при ХОЗЛ - ( 28,37 +3,52 ) и при ИБС ( 31,72 +5,84 ) мкмоль / л. Выявлена обратная корреляционная связь между NO2 + NO3 и ЛПНП ( r=-0,73, p=0,006) . Исследовано содержание NO2 + NO3 у больных с различным анамнезом курения. Так, NO2 + NO3 значительно выше у тех, кто не курит по сравнению с курильщиками во всех группах обследованных, (р < 0,05). Не выявлено корреляции между уровнем дисфункции эндотелия со степенью обструкции дыхательных путей ( р от 0,22 до 0,97). Ключевые слова : стабильные метаболиты оксида азота, курение, хроническое обструктивное заболевание легких, ишемическая болезнь сердца. D.M. Kalashnyk Analysis of Stable Nitric Oxide Metabolites in Blood Plasma of Patients with Chronic Obstructive Pulmonary Disease (COPD), Coronary Heart Disease (CHD) and COPD Concomitant with CHD Government Institution «National Institute of Therapy of the National Academy of Medical Sciences of Ukraine named after L.T.Maloia» Summary. In this study we have examined 87 patients , including 31 patients with COPD and CHD of the following age range 63.00±1.05 , 29 patients with COPD of age range 64.00±1.01 , 27 patients with CHD of age range 62.00±1.52 . The researched group consisted of 50 men (57%) and 37 women (43 %). The average body mass index was 30.1 kg/m2. We have determined that the contents in plasma of nitric oxide metabolites (NO2 + NO3) in the patients with COPD concomitant with CHD is 21.52±3.17 mcmol/l, in patients suffering from COPD - 28.37±3.52 and in those diagnosed with CHD 31.72±5.84 mcmol/l. Inverse correlation was found between nitric oxide metabolites(NO2 + NO3) and LDL (r = - 0,73, p = 0,006). The content of nitric oxide metabolites (NO2 + NO3) in patients with different smoking history was studied. Therefore, the sum of nitric oxide metabolites (NO2 + NO3) is much higher in those who do not smoke in comparison with the smokers in all groups of patients, (p<0.05). There was no correlation between the degree of endothelial dysfunction with the degree of airway obstruction (p from 0.22 to 0.97). Key words: stable metabolites of nitric oxide, smoking, chronic obstructive pulmonary disease, coronary heart diseases. Надійшла 18.11.2013 року.

УДК 616.314-07 +616.314.17-008+616.314.-77

Клим’юк Ю.В., Ожоган З.Р. Удосконалена методика і математичне обгрунтування препарування фронтальних зубів при виготовленні естетичних суцільнолитих конструкцій Кафедра ортопедичної стоматології (зав.каф. – проф. З.Р. Ожоган) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Проведено вивчення особливостей ортопедичного лікування дефектів твердих тканин зуба на прикладі нижнього центрального вітального різця. За допомогою комп’ютерної програми SolidWorks 2011 розроблено тривимірну скінченно-елементну модель, змодельовано методику препарування, вказано пошарову структуру металокерамічного протеза та виконано симуляцію навантаження прирізних варіантах фізіологічного прикусу. Встановлено, що у випадку проведення препарування всієї коронкової частини з імітацією уступа і наступним виготовленням металокерамічної коронки з повним керамічним облицюванням при різних видах фізіологічного прикусу максимальні напруження виникатимуть біля ріжучого краю і в пришийковій ділянці та значно перевищуватимуть максимально допустимий показник міцності на згин для кераміки, тоді як при препаруванні

опорних зубів з уступом з вестибулярної та до половини апроксимальних поверхонь та подальшим виготовленням металокерамічних конструкцій найбільші напруження та деформації, що виникають в керамічному шарі в у вказаних місцях, не перевищують максимальних показників міцності на згин. У результаті проведених математичних досліджень виявлено особливості біомеханіки протеза внаслідок жувальних навантажень, виявлено ймовірні місця найбільших напружень та деформацій. Ключові слова: пародонт, дентометрія, опорний зуб, комп’ютерне моделювання.

Постановка проблеми і аналіз останніх досліджень. При виготовленні суцільнолитих коронок виникає необхід-

25


Галицький лікарський вісник, 2013, Т. 20, № 4

Рис. 1. Вигляд відпрепарованої кукси нижнього центрального різця

ність вибору оптимального способу препарування твердих тканин опорного зуба. На сьогодні в літературі висвітлено численні переваги вітальних опорних зубів над девітальними, однак збереження життєздатності нерва – питання не до кінця вирішене, з цього приводу проводяться різноманітні дослідження [1]. Для того, щоб максимально зберегти здорові тканини зуба, проводять найбільш ретельне і тканиннозберігаюче препарування. Вік пацієнта тут має виняткове значення, оскільки в молодих осіб пульпова камера досягає значних розмірів, в той час як у більш старших пацієнтів через утворення вторинного дентину внаслідок пристосувальних і захисних реакцій вона поступово зменшується [2,3]. Важливим етапом проведення ортопедичного лікування є препарування твердих тканин опорних зубів. Надмірне їх видалення має перелік негативних наслідків, зокрема, значне видалення дентину та емалі впливає на стан пульпи, а чим об’ємнішим є препарування, тим більш вираженою є реакція пульпи [4]. Тому, при спрепаровуванні тканин і створенні кукси зуба необхідно залишати достатньо товстий та рівномірний шар дентину перед пульпою, при препаруванні зубів слід зважати на дані про топографію порожнини зуба і товщину її стінок у різних місцях [5], в межах яких дозволено впевнено проводити необхідне одонтопрепарування. При цьому слід зазначити, що прицільне рентгенологічне дослідження дає змогу вивчити розміщення пульпової камери лише в одній проекції. Техніка одонтопрепарування зубів для суцільнолитих металічних, металокерамічних і cуцільнокерамічних протезів безпосередньо залежить від наступних позицій: збереження твердих тканин зуба, ретенція та стійкість, міцність, крайове прилягання, збереження здорового стану пародонта [6]. Проте, також необхідно проводити препарування таким способом, щоб об’єм твердих тканин коронки зуба, що залишається після препарування, дозволяв забезпечити надійну фіксацію конструкції незнімного протеза, а також міцність самого опорного зуба, його стійкість до жувальних навантажень при різних положеннях щелеп під час артикуляції. Стосовно різців нижньої щелепи в літературі є різноманітні і суперечливі дані щодо можливості їх препарування при виготовленні незнімних суцільнолитих коронок. Тому питання особливостей препарування твердих тканин є актуальним на даний час і потребує вивчення. Мета роботи: вибір оптимального методу препарування вітальних фрогтальних зубів, враховуючи фізико-механічні характеристики матеріалів для естетичних конструкцій та

26

Рис. 2. Вигляд керамічного облицювання

їх напружено-деформований стан після фіксації. Матеріали та методи дослідження Матеріалом для нашого дослідження були нижні вітальні центральні різці, яким проводилось ощадливе препарування запропонованим нами методом. Його суть полягає в тому, що із урахуванням даних топографії розташування пульпової камери в зубах пацієнтів різного віку, зон безпеки Аболмасова-Клюєва, показників дентометрії, отриманих за допомогою приладу ENDO EST 3D, препарування здійснювалось із створенням уступу з вестибулярної сторони під прямим кутом на глибину 0,6 мм з подальшим переходом на передню половину апроксимальних поверхонь. Наступний перехід на задню половину апроксимальних поверхонь здійснювався також із прямокутним уступом, але його глибина була лише 0,3-0,4 мм для забезпечення належної товщини металу гірлянди. Після препарування пришийкової ділянки і екватора зуба верхня частина коронки зпрепаровувлась з усіх сторін із урахуванням товщини, достатньої для моделювання металічного каркасу і покриття його керамічним шаром [7]. По висоті зуб відпрепаровано на 2,0 мм (Рис.1). Попереднє моделювання обраного способу препарування було виконане методом скінчених елементів в комп’ютерній програмі SolidWorks 2011, а можливі навантаження, їх сила, напрямки та ймовірні напруження і деформації були задані за допомогою модуля CosmosM даної програми [8]. Комп’ютерне моделювання проводили наступним чином: створювалась тривимірна параметрична модель, задавались механічні властивості матеріалів, граничні умови для скінченноелементної моделі: зафіксована геометрія та напрям діючого навантаження. Гірлянду було змодельовано до рівня середини коронки, оскільки саме на рівні екватора розміщений дах пульпової камери. Облицювання керамікою виконане з вестибулярної сторони, починаючи від рівня клінічної шийки – уступа, до середини апроксимальних поверхонь із переходом на язикову поверхню (рис. 2).

Результати дослідження та їх обговорення Дослідження проведені при прикладанні жувального тиску (100Н) в певній точці: імітація прямого прикусу (вертикально прикладене навантаження в проекції ріжучого краю) та ортогнатичного прикусу (місце переходу ріжучого краю в вестибулярну поверхню), із врахуванням міцності на згин, яка в сучасних керамічних матеріалів коливається в межах 70-140 МПа (Таблиця 1).


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1. Міцність на Матеріал Матеріал згин Ультропалін 105-125 Carmen Duceram 70-72 Vita VMK Duceram LFC 110-111 Vita- OMEGA 900 IPS Empress 1 140 Vita VM 13 IPS-Classic 76-78 Noritake EX-3

Міцність на згин 75 70 110-120 120 112

Проаналізувавши проведені комп’ютерні дослідження, можна зробити висновок, що максимальні напруження в керамічному шарі під час жувального навантаження у випадку прямого прикусу виникатимуть в ділянці ріжучого краю 37,79 МПа, пришийковій ділянці 31,5 та в тих місцях апроксимальних поверхонь 25,2 МПа, де облицювання з’єднується з гірляндою (Рис.3,4). Результати комп’ютерних досліджень, виконаних внаслідок імітації жувальних навантажень у випадку ортогнатичного прикусу засвідчили, що найбільші напруження та деформації в керамічному шарі виникають в ділянці ріжучого краю 65,76 МПа та в пришийковій ділянці 56,37 МПа (Рис 5,6). Нами також змодельовано та проаналізовано варіант препарування нижнього центрального різця з імітацією уступа. У випадку проведення препарування всієї коронкової частини з імітацією уступа і наступним виготовленням металокерамічної коронки з повним керамічним облицюванням при різних видах фізіологічного прикусу максимальні напруження виникатимуть біля ріжучого краю і в пришийковій ділянці та значно перевищуватимуть максимально допустимий показник міцності на згин для кераміки. Так, у випадку імітації ортогнатичного прикусу ці показники в ділянці ріжучого краю та пришийковій ділянці з язикової сторони відповідно становитимуть 145,07 МПа та 161,19 МПа, а у випадку прямого прикусу – 84,36 МПа в пришийковій ділянці з вестибулярної сторони. Таким чином, існує в обох випадках більша ймовірність виникнення сколів кераміки при користуванні металокерамічною коронкою, якщо кукса відпрепарована з імітацією уступа, аніж після препарування запропонованим нами методом.

Рис. 3. Розподіл напруг в тканинах зуба при вертикальному навантаженні

навантаження як в самих тканинах, так і матеріалах незнімної конструкції. 2. Препарування твердих тканин опорних зубів слід проводити з урахуванням вікових особливостей хворого, зон безпеки Аболмасова-Клюєа та показників дентометрії. 3. Комп’ютерний аналіз напружено-деформованих станів, які виникають при застосуванні металокерамічного протеза на вітальному нижньму центральному різці, дає підстави використовувати металокерамічну конструкцію як при наявності дефекту коронкової частини, так і використанні цього зуба як опорного для мостоподібного протеза.

Висновки 1. Запропонований метод препарування твердих тканин опорних зубів дозволяє фізіологічно перерозподіляти

Перспектива подальших досліджень Планується проаналізувати індексні показники зубоясенних боріздок вітальних і девітальних зубів хворих, протезованих запропонованим нами методом.

Рис. 4. Розподіл напруг в тканинах зуба при вертикальному навантаженні (сагітальний розріз)

Рис. 5. Розподіл напруг в тканинах зуба при ортогнатичному прикусі

27


Галицький лікарський вісник, 2013, Т. 20, № 4

Рис. 6. Розподіл напруг в тканинах зуба при ортогнатичному прикусі (сагітальний розріз)

Література 1. Скібіцький В.С. Структурно-функціональні зміни пульпи зубів після препарування під незнімні суцільнолиті конструкції / В.С. Скібіцький // Современная стоматология. – 2008. – №3. – С.143-147. 2. Опанасюк Ю.В. Клініко-експериментальне обґрунтування раціональних методів протезування незнімними конструкціями зубних протезів: автореф. дис. на здобуття наук. ступеня канд. мед. наук : спец. 14.01.22 «Стоматологія» / Ю.В.Опанасюк. – ІваноФранківськ, 1998. – 14 с. 3. Борисенко А.В. Морфоункциональная и клиническая оценка зубов с дефектами твёрдых тканей / А.В. Борисенко, В.А. Клёмин, П.В. Ищенко. – МЕДпресс-информ, 2009. – 112 с. 4. Аболмасов Н.Г. Ортопедическая стоматология / [Н.Г. Аболмасов, Н.Н.Аболмасов, В.А Бычков, Аль – Хаким А.] - Москва. «МЕДпресс - информ», 2007. – 486 с. 5. Використання комп’ютерного моделювання при вивченні особливостей функціонування мостоподібних протезів / Л.В. Мізюк, З.Р. Ожоган, Л.О. Борущак [та ін.] // Галицький лікарський вісник. – 2005. – №4. – С.71-76. 6. Рожко М.М. Вивчення та аналіз віддалених результатів лікування металокерамічними конструкціями / Т.П. Кривенький, М.М. Рожко, Р.М. Назарук, І.Р. Кумгир // Галицький лікарський вісник – 2008. – Т.15, ч.4.– С. 25-28. 7. Волошин А.И. Математическое моделирование и расчет напряженно-деформированного состояния зубочелюстного сегмента после депульпирования зуба / Волошин А.И., Чумаченко Е.Н., Барер Г.Н., Ведеев А.И. // Стоматология. – 2003. - №4. – С. 4-7. 8. Применение метода конечных елементов к расчету конструкции. Учебное пособие для технических вузов / под ред. Р.А. Хегумова. – М.: Ассоциация строительных вузов, 1994. – 353 с.

28

Климюк Ю.В., Ожоган З.Р. Усовершенствованная методика и математическое обоснование препарирования фронтальных зубов при изготовлении эстетических цельнолитых конструкций Резюме. Проведено изучение особенностей ортопедического лечения дефектов твердых тканей зуба на примере нижнего центрального поздравительное резца. С помощью компьютерной программы SolidWorks 2011 разработано трехмерную конечно-элементную модель, смоделировано методику препарирования, указано послойную структуру металлокерамического протеза и выполнено симуляцию нагрузки при различных вариантах физиологического прикуса. Установлено, что в случае проведения препарирования всей коронковой части с имитацией уступа и последующим изготовлением металлокерамической коронки с полным керамической облицовкой при различных видах физиологического прикуса максимальные напряжения возникает у режущего края и в пришеечной области и значительно превышает максимально допустимый показатель прочности на изгиб для керамики, тогда как при препарировании опорных зубов с уступом с вестибулярной и до половины апроксимальных поверхностей с последующим изготовлением металлокерамических конструкций наибольшие напряжения и деформации, возникающие в керамическом слое в указанных местах, не превышают максимальных показателей прочности на изгиб. В результате проведенных математических исследований выявлены особенности биомеханики протеза вследствие жевательных нагрузок, обнаружено вероятные места наибольших напряжений и деформаций . Ключевые слова: пародонт, дентометрия, опорный зуб, компьютерное моделирование. Yu.V. Klymiuk, Z.R. Ozhohan Improved Technique and Mathematical Substantiation of Preparing Frontal Teeth when Making Aesthetic Unit-Cast Dentures Department of Orthopedic Dentistry (Head of the Department – Prof. Z.R. Ozhogan) Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine Summary. There was conducted a study of the characteristics of the orthopedic treatment for the defects in dental hard tissues at the example of the lower central vital incisor. With the help of computer software SolidWorks 2011 there was developed a three-dimensional finite-element model and was simulated the method for preparation; there also was stated the layered structure of the metal-ceramic dentures and was designed the pressure in different variants of physiological maximum intercuspation. It was established that maximum pressure, when preparing the entire crown part with lug imitation and further making of the metal-ceramic crowns with full facing in various types of physiological bite, will occur by the incisive edge and in the cervical area and significantly exceed the maximum rate of the flexural strength for ceramics; while in preparing the abutment teeth with the lug from the vestibular and till the half of approximal surfaces and with the subsequent making of the metal-ceramic constructions, the greatest pressure and deformation, occurring in the ceramic layer in the specified location, do not exceed the maximum flexural strength. In consequence of the performed mathematical research there were revealed the peculiarities of the denture biomechanics resulting from the masticatory pressure and the possible places of the greatest pressure and deformation. Keywords: periodontium, densitometry, abutment tooth, computer simulation. Надійшла 25.11.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК: 575.113+616.31+612.112+ 612.11+612.68

Козовий Р.В. Перевірка гіпотези про наявність зв’язку між показниками функціонального стану геному епітеліоцитів слизової оболонки ротової порожнини, лімфоцитів та нейтрофільних гранулоцитів крові у довгожителів за допомогою кореляційного аналізу Кафедра медичної біології та медичної генетики (зав. каф. – проф. Ковальчук Л.Є.) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Проведено комплексний аналіз кореляційних зв’язків між індексами (хроматизації, ядерцевим, морфологічно змінених ядер, статевого хроматину) функціонального стану геному (ФСГ) і мікроядер епітеліоцитів слизової оболонки ротової порожнини (СОРП) лімфоцитів та нейтрофільних гранулоцитів крові у 332 довгожителів та 218 осіб віком від 36 до 60 років у родоводах яких не було довгожителів. Кореляційний аналіз показників ФСГ у довгожителів показав подібні тенденції у формуванні взаємозв’язків між різними етапами реалізації біологічної інформації, незалежно від типу клітин. Вивчення взаємозв’язків між послідовними етапами генної експресії в клітинах епітеліальної та сполучної тканини засвідчило існування сильних позитивних взаємозв’зків. Отримані результати свідчать про достатню інформативність індексів ФСГ епітеліальних клітин як інтегральних показників функціональної активності спадкового апарату організму, що дає змогу використовувати неінвазійне дослідження епітеліоцитів СОРП як скринінг-тест. Ключові слова: довгожителі, функціональний стан геному, епітеліоцити слизової оболонки порожнини рота, нейтрофільні гранулоцити, лімфоцити.

Постановка проблеми і аналіз останніх досліджень. Процес старіння обумовлений як генетичними, так і чинниками навколишнього середовища, що діють на організм протягом життя. За однією з теорій в основі старіння лежить накопичення клітинних порушень, ослаблення механізмів виживання і відновлення клітин і тканин. До молекулярних причин старіння відносяться мутації, порушення процесів реплікації і репарації ДНК, гліколіз білків, утворення поперечних зшивок між макромолекулами, оксидативний стрес, метилювання ДНК [1]. Морфологічним проявом останнього, як основного епігенетичного феномена, може бути стан оптичної щільності ядер і діапазон її мінливості, обумовлений співвідношенням конденсації / деконденсація хроматину [2]. Саме з деталями структури хроматину пов’язані, здебільшого, молекулярні основи тканеспецефічної експресії генів [3]. Тому актуальним в умовах сучасної антропогенного навантаження стає вивчення не тільки хромосомних аберацій, а й особливостей потенційно оборотних змін структури хроматину в соматичних клітинах. Особливо перспективним в цьому напрямку є порівняння функціонального стану геному різних інтерфазних клітин, що доводить існування фундаментальних властивостей спадкового апарату – цілісності та універсальності [4]. Метою роботи було вивчення кореляційних зв’язків між показниками функціонального стану геному (ФСГ) епітеліоцитів слизової оболонки ротової порожнини (СОРП), лімфоцитами (ЛПК) та нейтрофільних гранулоцитів периферійної крові (НГПК). Матеріали і методи дослідження Матеріалом слугували показники ФСГ: індекси хроматизації (ІХ), ядерцевий (ЯІ), морфологічно змінених ядер (МЗЯ), гетеропікнотичної Х-хромосоми (СХ), які отримані при дослідженні епітеліоцитів СОРП, ЛПК та НГПК [5]. Структурні зміни хромосомного апарату оцінювали за частотою мікроядер (МЯ). Об’єктом дослідження слугували епітеліоцити СОРП, ЛПК та НГПК 332 довгожителів (основна група) та 218 людей різного віку (група порівняння). Групу порівняння склали особи віком від 36 до 60 років у родоводах яких не було довгожителів. Забір матеріалу, виготовлення препаратів з наступним забарвленням за Фьольгеном у модифікації, яка дозволяє провести диференційне фарбування ДНК ядра і РНК ядерець – основних компонентів клітини здійснювали за відповідними методиками [6].

Дослідження виготовлених препаратів проводили на оптикоелектронному комплексі „Метаскан – 2”. Індекси ФСГ вивчали у 100 ядровмісних епітеліоцитах СОПР, ЛПК та НГПК кожного обстежуваного. ІХ встановлювали за відношенням кількості клітин, в ядрах яких переважав евхроматин, до кількості клітин, з перевагою гетерохроматину. СХ, ЯІ, МЗЯ – за відсотком відповідних клітин. Для аналізу структурних змін хромосомного апарату за МЯ проглядали не менше 500 клітин від кожної людини. Статистичну обробку отриманих результатів досліджень здійснювали за допомогою персонального комп’ютера та ліцензованих прикладних програм для роботи з електронними таблицями Microsoft Excel, і пакету “STATISTIKA 7,0”. Для проведення кореляційного аналізу отриманих кількісних характеристик використано метод С.Н. Лапач і співавт. [7,8].

Результати дослідження та їх обговорення Для перевірки взаємозв’язків між показниками транскрипційно-трансляційного апарату епітеліальних клітин, ЛПК та НГПК у довгожителів, розраховано величину коефіцієнта кореляції. Стан гетеропікнотичної Х-хромосоми нині розцінюється як показник регуляції реалізації генетичної інформації [9]. Інтерпретація отриманих чисел СХ відрізняється у чоловіків і жінок. Встановлено, що між трьома індексами хроматизації, гетеропікнотичної Х-хромосоми у довгожителів існують сильні позитивні взаємозв’язки (відповідно r=0,96 при р=0,75; r=0,95 при р=0,25; r=0,98 при р=0,65). Серед осіб зрілого віку зафіксовано одна кореляція середньої сили (між показниками СХ клітин крові (r=0,66 при р=0,35)) та два сильних зв’язки (між показником СХ епітеліоцитів СОПР і НГПК (r=0,79 при р=0,55) та ЛПК і НГПК (r=0,85 при р=0,75). Найважливішим маркером експресибельності геному, що опосередковано корелює з кількістю дерепресованої ДНК є індекс конденсації хроматину [10] Під час аналізу отриманих результатів ІХ у довгожителів виявлено сильні кореляційні зв’язки між усіма видами клітин, але недостовірні (між епітеліоцитами СОПР і НГПК (r=0,99); між епітеліоцитами СОПР і ЛПК (r=0,95) та між НГПК і ЛПК (r=0,98)). У групі порівняння зафіксовано також сильні зв’язки, однак дещо слабші, порівняно із основною: (r=0,85; r=0,78; r=0,82 відповідно). На наступному етапі роботи наша увага була зосереджена на механізмах, які забезпечують трансляцію – синтез білкової молекули. Показником цього процесу є активність ядерцевого апарату. В ядерцях здійснюється транскрипція генів, які кодують рибосомні білки [11]. Кількість ядерець, їхні розміри і структура відображають метаболічну активність клітин або рівень диференціювання і, відповідно, транскрипцію генів рибосомної РНК. Оскільки структурно-функціональні зміни ядерець є важливим компонентом реакції клітин на стрес і зумовлюють їх адаптацію до зовнішніх впливів, ЯІ може бути об’єктивним діагностичним маркером активності трансляційного апарату. Вивчення взаємозв’зків у різних видах клітин довгожителів важливого компоненту ядерного апарату, ЯІ, виявило сильну кореляцію між епітеліоцитами СОПР і ЛПК (r=0,89 при р=0,47) та слабкі між НГПК і ЛПК (r=0,03 при р=0,0002), між клітинами букального епітелії і НГПК (r=0,06 при р=0,069). Однак у групі порівняння кореляції були наступними: між епітеліоцитами СОПР і ЛПК (r=0,52 при р=0,78), між НГПК і ЛПК (r=0,83 при р=0,027), між клітинами букального епітелії і

29


Галицький лікарський вісник, 2013, Т. 20, № 4

НГПК (r=0,31 при р=0,001). Не викликає сумніву той факт, що метаболізм клітини залежить від морфо-функціональних особливостей ядра. Структура і забарвлення хроматину в МЗЯ приблизно відповідала хроматину ядер в нормі або була гомогеннішою. В цитоплазмі деяких клітин з’являлися вакуолі, які мали округлу форму. Для диференціації вакуолізації ядер від стану конденсації хроматину, при якій також утворюються порожнини, що розділяють грудки і тяжі хроматину, враховано рекомендації про те, що ядро при гетерохроматизації не набухає, а навпаки, зморщується і хроматин стає темнішим і щільнішим [12]. Нами встановлено у довгожителів сильні зв’язки між МЗЯ епітеліоцитів СОПР і ЛПК (r=0,98 при р=0,16), між НГПК і ЛПК (r=0,85 при р=0,009) та сердній між МЗЯ епітеліоцитів СОПР і НГПК (r=0,67 при р=0,02). Однак, у групі порівнняння між МЗЯ у всіх видах клітин виявлено кореляційні зв’язки середньої сили (відповідно r=0,64 при р=0,82; r=0,67 при р=0,11 та r=0,51 при р=0,069). МЯ опосередковано засвідчують частоту хромосомних аберацій та можуть слугувати показником негативного впливу. Встановлено, що розміри мікроядер у клітинах букального епітелію дорівнювали 1-3 мкм. Вони розташовувалися в цитоплазмі поблизу основного ядра клітини, мали оболонку та були заповнені хроматином. Щільність останнього була нижчою або не перевищувала таку хроматину основного ядра. Мікроядра інколи щільно прилягали до основного ядра, але й в цьому випадку вони були оточені своєю ядерною оболонкою. У всіх обстежених людей частота МЯ не залежала від віку. Значущих відмінностей між кількістю МЯ у довгожителів та групі порівняння не виявлено. Сильні кореляції діагностовані між показниками МЯ епітеліоцитів СОПР і ЛПК (r=0,97 при р=0,001) у довгожителів та (r=0,89 при р=0,47) у групі порівняння. Між іншими показниками МЯ кореляції були недостовірні. Таким чином, кореляційний аналіз показників ФСГ у довгожителів показав подібні тенденції у формуванні взаємозв’язків між різними етапами реалізації біологічної інформації незалежно від типу клітин. Вивчення взаємозв’язків між послідовними етапами генної експресії в клітинах епітеліальної та сполучної тканини засвідчило існування сильних позитивних взаємозв’зків. Отримані результати свідчать про достатню інформативність індексів ФСГ епітеліальних клітин як інтегральних показників функціональної активності спадкового апарату організму, що дає змогу використовувати неінвазійне дослідження епітеліоцитів СОРП як скринінг-тест. Висновки Було перевірено гіпотезу про наявність зв’язків між індексами ФСГ епітеліоцитів СОРП, ЛПК та шляхом проведення кореляційного аналізу отриманих кількісних характеристик встановлено: 1. У довгожителів існують сильні позитивні взаємозв’язки (відповідно r=0,96 при р=0,75; r=0,95 при р=0,25; r=0,98 при р=0,65) між трьома індексами хроматизації гетеропікнотичної Х-хромосоми. Серед осіб зрілого віку зафіксовано одну кореляцію середньої сили (між показниками СХ клітин крові (r=0,66 при р=0,35)) та два сильні зв’язки (між показником СХ епітеліоцитів СОПР і НГПК (r=0,79 при р=0,55) та ЛПК і НГПК (r=0,85 при р=0,75). 2. Аналіз ІХ у довгожителів виявив сильні кореляційні зв’язки між усіма видами клітин (між епітеліоцитами СОПР і НГПК (r=0,99); між епітеліоцитами СОПР і ЛПК (r=0,95) та між НГПК і ЛПК (r=0,98)), однак недостовірні. У групі порівняння зафіксовано сильні зв’язки (r=0,85; r=0,78; r=0,82 відповідно). 3. Діагностовано сильну кореляцію ЯІ між епітеліоцитами СОПР і ЛПК (r=0,89 при р=0,47) та слабкі між НГПК і ЛПК (r=0,03 при р=0,0002), між клітинами букального епітелію і НГПК (r=0,06 при р=0,069). У групі порівняння

30

кореляції ЯІ між епітеліоцитами СОПР і ЛПК (r=0,52 при р=0,78), між НГПК і ЛПК (r=0,83 при р=0,027), між клітинами букального епітелію і НГПК (r=0,31 при р=0,001). 4. Зафіксовано у довгожителів сильні зв’язки між МЗЯ епітеліоцитів СОПР і ЛПК (r=0,98 при р=0,16), між НГПК і ЛПК (r=0,85 при р=0,009) та сердній між МЗЯ епітеліоцитів СОПР і НГПК (r=0,67 при р=0,02). В осіб зрілого віку між МЗЯ у всіх видах клітин кореляційні зв’язки були середньої сили (відповідно r=0,64 при р=0,82; r=0,67 при р=0,11 та r=0,51 при р=0,069). 5. Сильні кореляції встановлено між показниками МЯ епітеліоцитів СОПР і ЛПК (r=0,97 при р=0,001) у довгожителів та (r=0,89 при р=0,47) у групі порівняння. Перспективи подальших досліджень полягають у вивченні внеску спадкових та зовнішніх факторів у процес формування довголіття шляхом факторного аналізу. Література 1. Анисимов В.Н. Молекулярные и физиологические механизмы старения. – СПб.: Наука, 2003. – 468 с. 2. Gesser S.M. Visualizing chromatin dynamics in interphase buclei / S.M. Gesser // Science. – 2002. – Vol.296. – P.1412-1416. 3. Rasmusser T. Embryonic stem cell differentiation: a chromatin perspective // Reprod. Biol. Endocrinol. – 2003. – Vol.1 (1). – p.100 4. Палійчук І.В. Вивчення функціонального стану геному епітеліоцитів слизової оболонки порожнини рота у хворих на різні форми протезного стоматиту / І. В. Палійчук, Л. Є. Ковальчук, Г. М. Ерстенюк // Галицький лікарський вісник. – 2007. - Т.14.- №1. - С. 61-65. 5. Гвоздев В.А. Гетерохроматин и его функциональные характеристики / В.А. Гвоздев, Л.А.Усакин, Г.Л. Коган // Медицинская генетика . – 2003.- №7. – С.290 – 296. 6. Рац. пропозиція 30/2319 Івано-Франківськ Виявлення ДНК в цитологічних препаратах / [Ковальчук Л.Є., Ковальчук Н.В., Ілик В.В.]; заявник і патентовласник Івано-Франк. держ. мед. ун-т.– 1997. 7. Лапач С.Н. Статистические методы в медико-биологических исследованиях с использованием Excel / С.Н. Лапач, А.В. Губенко, П.Н.Бабич // 2-е изд., перераб. и доп. – К.: МОРИОН. – 2000. – 10408 с. 8. Статистический портал Statsoft [електронний ресурс] : – режим порталу : http://www.statsoft.ru/home/portal/default.asp. 9. Тепляков А.И. Топография интерфазного хроматина нейтрофильных гранулоцитов при атеросклерозе: еще одно подтверждение активной экспрессии генов для завершения ими функциональной программы / А.И. Тепляков // Иммунопатология, аллергология, инфектология. – 2004. – №2. – С. 40-43 10. Newburger P.E. Global analysis of neutrofil gene expression / P.E. Newburger, Y.V. Subrahmanyam, S.M. Weissman //Cur. Opin. Haematol. – 2000 – V.1, №7. –– Р. 16 – 20. 11. Кочерга З.Р. Діагностика затримки внутрішньоутробного розвитку плода за показниками фукціонального стану нейтрофільних гранулоцитів периферійної крові новонароджених / З.Р. Кочерга, Л.Є. Ковальчук // Галицький лікарський вісник. – 2011. – Т.18, №2. – С.50–53. 12. Сычева Л.П. Биологическое значение, критерии определения и пределы варьирования полного спектра кариологических показателей при оценке цитогенетического статуса человека / Л.П. Сычева // Медицинская генетика. – 2007. – Т.6. - №11 (65). – С. 3-11. Козовой Р.В. Проверка гипотезы о наличии связи между показателями функционального состояния генома эпителиоцитов слизистой оболочки полости рта, лимфоцитов и нейтрофилов крови у долгожителей с помощью корреляционного анализа ГВУЗ «Ивано-Франковский национальный медицинский университет» Резюме. Проведен комплексный анализ корреляционных связей между индексами (хроматизации, ядрышкового, морфологически измененных ядер, полового хроматина) функционального состояния генома (ФСГ) и микроядер эпителиоцитов слизистой оболочки ротовой полости (СОРП), лимфоцытов и нейтрофилов крови у 332 долгожителей и 218 человек в возрасте от 36 до 60 лет, в родословных, которых не было долгожителей. Корреляционный анализ показателей ФСГ у долгожителей показал подобные тенденции в формировании взаимосвязей между различными этапами реализации биологической информации независимо от типа клеток.


Галицький лікарський вісник, 2013, Т. 20, № 4 Изучение взаимосвязей между последовательными этапами генной экспрессии в клетках эпителиальной и соединительной ткани показало существование сильных положительных связей. Полученные результаты свидетельствуют о достаточной информативности индексов ФСГ эпителиальных клеток как интегральных показателей функциональной активности наследственного аппарата организма, что позволяет использовать их как скрининг-тест. Ключевые слова: долгожители, функциональное состояние генома, эпителиоциты слизистой оболочки полости рта, нейтрофильные гранулоциты, лимфоциты. R.V. Kozoviy Testing the Hypothesis Identifying the Link between the Indicators of the Functional Condition of Oral Cavity Mucosa Epitheliocytes Genome, Lymphocytes and Blood Neutrophil Granulocytes in Long Livers Using Correlation Analysis Department of Medical Biology and Medical Genetics (Head of the Department – Prof. L.Ye. Kovalchuk) Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine Summary. There was performed a comprehensive analysis of the

correlation between the indices (of chromatization, nucleolar indices, of morphologically altered nuclei, and of sex chromatin) of the functional state of the genome (FSG) and micronuclei of epithelial cells of oral mucosa (OM), lymphocytes and neutrophils in the blood of 332 long livers and 218 persons aged from 36 to 60 years having no long livers in their family trees. Correlation analysis of the long livers’ FSG showed similar tendencies in the formation of relationships between the different stages of biological information realization, regardless of the cell type. Investigation of the relationship between the successive stages of gene expression in the cells of epithelial and connective tissue showed the existence of strong positive correlations. The obtained results confirmed the sufficient information content of the FSG indices of epithelial cells as the integral indicators of functional activity of the body hereditary apparatus that allows you to use noninvasive study of the OM epitheliocytes as a screening test. Keywords: long livers, the functional state of the genome, nasal epithelial cells, neutrophilic granulocytes, lymphocytes.

Надійшла 09.09.2013 року.

УДК: 616.36-002+577.115+616-056.2+616-08

Кулаєць В.М. Показники функціонального стану печінки, ліпідного спектру крові у хворих на неалкогольний стеатогепатит, поєднаний з ожирінням, при застосуванні комбінованої терапії Кафедра терапії і сімейної медицини ФПО (зав. каф.- проф. Л.В. Глушко) ДВНЗ «Івано-Франківський національний медичний університет» Резюме: Вивчено особливості клінічного перебігу, ультрасонографічну картину, показники функціонального стану печінки, ліпідного спектру крові у хворих на неалкогольний стеатогепатит (НАСГ), поєднаний з ожирінням. У 29(63,0%) хворих на НАСГ виявлено достовірне підвищення рівня прямого білірубіну у сироватці крові, у 33 (71,7%) - активності сироваткових амінотрансфераз (АЛТ,АСТ), у 24 (52,2%) - лужної фосфатази (ЛФ) у 26 (56,5%) - тимолової проби, у 35 (76,1%) - показників ліпідного спектру крові. Ультрасонографічно відзначено дифузне збільшення розмірів печінки, зміни її ехощільності. Більше, ніж у половини обстежених, за даними індексу маси тіла (ІМТ) спостерігалося вісцеральне ожиріння. Після проведеного курсу комбінованої терапії відзначено достовірно позитивну динаміку біохімічних показників крові (р<0,05): зниження рівня прямого білірубіну в 3,0 рази, амінотрансфераз (АЛТ- в 1,5 рази, АСТ- в 1,34 рази), тимолової проби- в 3,0 рази, ЛФ - в 2,16 раз. Показники ліпідного спектру крові наближалися до показника норми(р<0,05). Це свідчило про практично повне відновлення функціональної активності печінки, а в клінічному плані – про досягнення стійкої клінікобіохімічної ремісії НАСГ. Ключові слова: неалкогольний стеатогепатит, ожиріння, ліпідний спектр крові, препарати урсодезоксихолевої кислоти, ультрасонографічне дослідження органів черевної порожнини, ехоструктура печінки.

Постановка проблеми і аналіз останніх досліджень. Актуальність пошуку безпечних та ефективних методів лікування хворих на неалкогольний стеатогепатит (НАСГ) в поєднанні з ожирінням визначається високими темпами їх поширення, труднощами лікування та високою частотою ускладнень [5,7]. Збільшення кількості хворих на НАСГ зумовлено зростанням захворюваності на ожиріння, яким страждає майже третина дорослого працездатного населення України. За сучасними уявленнями ожиріння та НАСГ викликає “омолодження” контингенту хворих та часту медикаментозну резистентність до лікування, що проводиться. У великих популяційних дослідженнях, проведених у США та Італії,

виявлено стеатоз у 35% загальної людської популяції та у 75% осіб з надмірною масою тіла [1,2]. На думку авторів, ці показники продовжують зростати [2,4]. Так, наявність стеатогепатозу призводить до формування НАСГ, який супроводжується підвищеними рівнями активності амінотрансфераз та прогресуванням до фіброзу / цирозу печінки [3,8]. Ризик розвитку НАСГ значно зростає при збільшенні абдомінального депо жиру. Вільні жирні кислоти, які вивільняються внаслідок інтенсивного ліполізу вісцерального жиру, у великих кількостях надходять у печінку, що сприяє розвитку її стеатозу, зменшення деградації інсуліну гепатоцитами, в подальшому розвитку гіперінсулінемії [6,8]. Прогресуюча інсулінорезистентність та надлишок вільних жирних кислот спричиняють порушення активності ліпопротеїнліпази та печінкової ліпази, що посилює синтез тригліцеридів, ліпопротеїдів дуже низької щільності (ЛПДНЩ), що призводить до розвитку цукрового діабету II типу, а в подальшому метаболічного синдрому (МС) з ураженням серцево-судинної системи (ССС). Метою дослідження є вивчення біохімічних показників функціонального стану печінки (печінкових проб), показників ліпідного спектра крові (ЛСК) і на основі цього розробка сучасних схем лікування даних порушень у хворих на НАСГ в поєднанні з ожирінням. Матеріал і методи дослідження Обстежено 46 амбулаторних пацієнтів з діагнозом НАСГ та ожиріння: 29 (63,1%) чоловіків та 17 (36,9%) жінок у віці 32-55 років. Діагноз НАСГ виставляли відповідно до стандартизованих протоколів діагностики та лікування хвороб органів травлення згідно з наказом МОЗ України №271 від 13.06.2005р. Хворі були розподілені на дві групи. Перша (основна) група з діагнозом НАСГ та ожиріння становили 19 (41,3%) осіб, які отримували аторвастатин в дозі 20 мг на добу (перед сном) 25-30 днів та багатокомпонентний гепатопротектор “Гепадиф” перорально по 1 капсулі 3 рази на добу протягом 3-4 тижнів. Друга група (порівняння) – 27

31


Галицький лікарський вісник, 2013, Т. 20, № 4 (58,7%) пацієнтів з НАСГ та ожирінням, яким в комплексі з аторвастатином та “гепадифом” призначали препарати урсодезоксихолевої кислоти по одній таблетці 250 мг 3-4 рази на добу (15 мг/кг маси тіла) 25-30 днів. Група здорових – склала 12 осіб відповідного віку. Антропометричним критерієм ожиріння був індекс Кетле (ІМТ= маса тіла(кг)/зріст(м2)). Фенотиповий варіант ожиріння визначали за співвідношенням обвід талії / обвід стегон (ОТ/ОС). В усіх обстежених хворих спостерігалося вісцеральне ожиріння. Серед хворих основної групи було 9 (47,4%) осіб з ожирінням I ступеня (ІМТ=32,6±2,2 кг/м2), 6 (31,5%) – II ступеня (ІМТ=35,8±3,6 кг/м2), та 4 (21,1%) – III ступеня (ІМТ=40,0±2,1 кг/м2), у групі порівняння – відповідно 17 (62,9%), 6 (22,3%) та 4 (14,8%). Це свідчило про те, що у хворих був абдомінальний тип ожиріння. Окрім медикаментозного лікування, всі пацієнти отримували диференційовану дієту з розрахунком енергетичної цінності, квоти білка (1,4-1,6г), жиру (1,2-1,4г), вуглеводів (2-3г) на 1 кг ідеальної маси тіла і дозованої фізичної активності. Після ретельного аналізу клініко-анамнестичних даних критеріями включення вважалися пацієнти з діагнозом НАСГ та ожиріння, у яких відзначали: ультрасонографічну картину стеатогепатиту; достовірні дані про невживання або вживання мінімальних доз алкоголю (<40 г на тиждень); відсутність серологічного підтвердження вірусної етіології гепатиту. Критеріями виключення були: токсичне ураження печінки, алкогольне ураження печінки, аутоімунний гепатит, вагітність, генетична патологія гепатобіліарної зони, артеріальна гіпертензія ІІ-ІІІ ступеня, ішемічна хвороба серця, цукровий діабет. Тривалість курсу лікування становила 4 тижні. Всім хворим до і через 1 міс. після лікування проводили загальноклінічні та клініко-лабораторні обстеження, інструментальні – ультрасонографічне дослідження органів черевної порожнини (УЗД ОЧП), імуноферментні (визначення вмісту у сироватці крові маркерів вірусів гепатитів ВГ-В, ВГ-С, ВГ-D). Для оцінки функціонального стану печінки досліджували біохімічні показники з використанням уніфікованих методів (рівень загального білірубіну і його фракцій (прямої та непрямої), активність сироваткових амінотрансфераз АЛТ і АСТ, тимолову пробу, лужну фосфатазу (ЛФ), вміст загального холестерину (ЗХС) у сироватці крові, ХС ліпопротеїдів високої щільності (ЛПВЩ), ХС ліпопротеїдів низької щільності (ЛПНЩ), ХС ліпопротеїдів дуже низької щільності (ЛПДНЩ) реативи: LDL Cholesterol, triglycerides liquicolor HumaStar 600 «Human». Обробку даних проводили з використанням пакета прикладних програм «Статистика 6,0» (Stat Soft Inc., США). Вірогідність різниці показників визначали за допомогою t-критерія Стьюдента.

Результати дослідження та їх обговорення Аналіз анамнестичних даних показав: у всіх хворих відзначались порушення в режимі харчування (нерегулярне вживання їжі, швидка їжа, зловживання гострими, жирними стравами), 40 (78,6%) обстежених пацієнтів мали шкідливі звички до періодичного вживання алкоголю, систематичного паління. Із суб’єктивної симптоматики спостерігали загальну слабкість 32 (69,5%), підвищена втомлюваність 39 (84,8%), порушення сну 23 (50,0%), зниження працездатності 28 (60,8%). При об’єктивному обстеженні у 24 (52,2%) пацієнтів відзначено субіктеричність склер, у 16 (34,8%) – помірну гепатомегалію (печінка виступала на 2-5 см з-під реберного краю, була підвищеної щільності). За даними УЗД ОЧП, ехоскопічно виявляли збільшення вертикального і сагітального розміру печінки на 2-4 см та гіперехогенність, неоднорідність структури паренхіми печінки (у центральній частині печінки визначали численні дрібні ехощільні утворення). Контури печінки залишалися рівними, що свідчило про інтактність капсули печінки, відсутність у ній запальних явищ. При біохімічному обстеженні виявлено, що у двох групах спостерігалося підвищення рівня прямого білірубіну в межах (7,8±0,8 мкмоль/л): у хворих першої групи та (7,9±0,7 мкмоль/л) у хворих другої групи; активність АЛТ була збільшена до (1,99±0,05 ммоль/л) у першій групі та до (1,87±0,03 ммоль/л) у пацієнтів другої групи; АСТ – до (1,65±0,04 ммоль/л) у хворих першої групи та до (1,75±0,06 ммоль/л) у хворих другої групи; тимолова проба – (6,7±0,2 од.) у першій групі та – (6,8±0,18 од.) у пацієнтів другої групи. Збіль-

32

шення концентрації у сироватці крові рівня ЗХС прослідковувалося: у хворих основної групи – в 3,13 (р<0,05) рази, у хворих групи порівняння – в 3,23 рази (р<0,05). Вміст ХС ЛПВЩ у пацієнтів основної групи був нижчим за норму в середньому в 1,25 рази (р<0,05), у хворих групи порівняння – в 1,52 рази (р<0,05), рівень ХС ЛПНЩ перевищував норму в 2,5 рази (р<0,05) в обстежених першої групи та в 3,0 рази (р<0,05) в пацієнтів другої групи, концентрація ХС ЛПДНЩ – відповідно в 2 і 2,5 рази (р<0,05). У більшості пацієнтів була помірно збільшена активність ЛФ та рівня тригліцеридів сироватки крові (р<0,05). Аналізуючи результати обстеження після завершення курсу лікування, у більшості пацієнтів спостерігали позитивну динаміку клінічної симптоматики (р<0,05). У обстежених основної групи відзначено достовірну тенденцію до поліпшення біохімічних показників (р<0,05): зниження рівня прямого білірубіну в сироватці у 1,5 рази, зменшення активності АСТ – в 1,13 рази, АЛТ – в 1,32 рази, величини тимолової проби в 2,15 раз, ЛФ – в 1,41 раз, однак майже у 23,5% обстежених ці показники залишалися вищими за норму, що свідчило про неповне відновлення функціональної активності печінки. У групі порівняння, що отримувала комплексне лікування із включенням урсодезоксихолевої кислоти відзначено достовірно позитивну динаміку біохімічних показників (р<0,05): рівень прямого білірубіну знизився в 3,0 рази, АЛТ – в 1,5 рази, АСТ – в 1,34 рази, тимолова проба – в 3,0 рази, ЛФ – в 2,16 рази. Це свідчило про практично повне відновлення функціональної активності печінки, а в клінічному плані – про досягнення стійкої клінікобіохімічної ремісії НАСГ. Оцінюючи показники ліпідного спектру крові після курсу лікування відзначали, що рівень ХС ЛПВЩ у хворих першої групи був нижчим за норму в середньому в 0,5 рази, тоді як у хворих другої групи наближався до показника норми (р<0,05), ХС ЛПНЩ в обстежених першої групи був нижчим за норму в середньому в 1,2 рази, а у хворих другої групи також наближався до показника норми (р<0,05), ХС ЛПДНЩ – відповідно в 1,7 і 3,0 рази (р<0,05), тригліцериди – в 2,0 і 3,0 рази (р<0,05) (табл. 1). Після проведенного курсу лікування за даними УЗД ОЧП у більшої половини пацієнтів нормалізувались розміри та ехоструктура печінки, хоча у третини зберігалась неоднорідність структури паренхіми печінки (у центральній частині печінки простежувались поодинокі, дрібні ехощільні утворення). Таким пацієнтам рекомендували продовжити курс лікування – комбінацію статина і двох гепатопротекторів ще протягом 2-3-х місяців. Для УДХК в даній ситуації притаманні такі лікувальні ефекти: антихолестатичний, цитопротекторний, імуномоделювальний, антифібротичний, гіпохолестеринемічний, холерeтичний, холекінетичний, літолітичний [6]. УДХК як препарат, що містить поліненасичену жовчну кислоту, є справжнім холеретиком (індукція гідрокарбонатного холерезу, який посилює елімінацію жовчних кислот у кишечник), механізм дії якого полягає в зниженні концентрації холестерину в жовч за рахунок інгібування його синтезу в печінці, а також збільшення розчинності холестерину [6]. Отже, з огляду на отримані нами дані, комбінація аторвастатина в дозі 20 мг на добу 25-30 днів та гепатопротекторів: «гепадифу» перорально по 1 капсулі 3 рази на добу протягом 3-4 тижнів і препаратів урсодезоксихолевої кислоти (15 мг/кг маси тіла) 25-30 днів, можна вважати патогенетично обґрунтованим, клінічно доцільним та перспективним у лікуванні хворих на НАСГ поєднаний з ожирінням. Висновки 1. Хворі на НАСГ, поєднаного з ожирінням, скаржилися на загальну слабкість, нездужання, порушення сну, підвищену стомлюваність, зниження розумової та фізичної працездатності, зменшення апетиту. 2. При об’єктивному обстеженні виявлено субіктерич-


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1. Динаміка показників печінкових проб, ліпідного спектру крові у хворих з неалкогольним стеатогепатитом та ожирінням Основна група Група порівняння Здорові (п=19) (п=27) Показник (п = 12) До Після До Після лікування лікування лікування лікування Білірубін (прямий), мкмоль/л 4,1±1,2 7,8±0,8* 6,3 ±0,5** 7,3±0,7* 4,3±0,6** АЛТ, мкмоль/л/год 0,48±0,06 1,99±0,05* 0,67±0,03** 1,87±0,03* 0,47±0,02** АСТ, мкмоль/л/год 0,38±0,05 1,65±0,04* 0,52±0,01** 1,75±0,06* 0,41±0,03** Лужна фосфатаза мкмоль/л/год 0,8±0,09 5,13±0,04* 3,72±0,03** 5,16±0,05* 3,0±0,03** Тимолова проба, од. 3,5±0,40 6,7±0,2* 4,55±0,1** 6,80,18* 4,0±0,17** Загальний холестерин, ммоль/л 4,17±0,09 7,3±0,4* 5,8±0,2** 7,4±0,5* 4,7±0,38** ХС-ЛПНЩ, ммоль/л 2,31 ±0,07 4,8±0,3* 3,6±0,2** 5,2±0,23* 2,9±0,27** ХС-ЛПДНЩ, ммоль/л 0,37±0,07 4,8±0,3* 3,1±0,2** 4,9±0,23* 1,9±0,27** ХС-ЛПВЩ, ммоль/л 1,05 ±0,04 0,42 ±0,1* 1,04±0,07** 0,17±0,03* 1,1±0,04** ТГ,ммоль/л 1,62±0,05 5,2±0,3* 3,19±0,2** 5,07±0,4* 2,11±0,6** Примітка: Різниця показників вірогідна (р<0,05): * - порівняно зі здоровими; ** - порівняно із показниками до лікування

ність склер, помірну гепатомегалію (печінка підвищеної щільності виступала на 2-5 см з-під реберного краю). 3. При проведенні сонографічного дослідження органів черевної порожнини відзначено дифузне збільшення розмірів печінки, зміни її ехощільності. 4. У пацієнтів з НАСГ та ожиріння, до початку лікування виявлено зміни біохімічних показників (печінкових проб), які характеризують функціональний стан печінки: підвищення рівня прямого (зв’язаного) білірубіну у сироватці крові – 29(63,0%), активності амінотрансфераз (АЛТ АСТ) – 33 (71,7%), лужної фосфатази – 24 (52,2%), тимолової проби – 26 (56,5%), показників ліпідного спектру крові – 35 (76,1%). 5. Включення до комплексу лікування хворих на НАСГ та ожиріння комбінації препарату статина і двох гепатопротекторів «гепадифу» і урсодезоксихолевої кислоти сприяло позитивній динаміці клінічних показників, функціонального стану печінки, показників ліпідного спектру крові та досягнення клініко-біохімічної ремісії патологічного процесу у печінці. У пацієнтів групи, що приймала статин і гепадиф, динаміка вивчених клініко-біохімічних показників була менш вираженою, що свідчило про збереження стану помірного загострення паренхіми печінки. Перспективи подальших досліджень у даному напрямку полягають у визначенні особливостей перебігу неалкогольної жирової хвороби печінки на тлі цукрового діабету I та II-го типів, вивчення сучасних підходів до дієтотерапії при даних коморбідних захворюваннях. Література 1.Sowers J.R. Role of insulinresistance and hyperinsulinemia in development of hypertension and atherosclerosis / J.R Sowers, P.S Sowers, J.D. Peuler // J Lab. Clin. Med. –1993. –Vol. 123. – P. 647-652. 2. Dixon JB. Nonalcoholic fatty liver disease: predictors of nonalcoholic steatohepatitis and liver fibrosis in the severelyobese / J.B Dixon, P.S Bhathal, P.E O’Brien // Gastroenterology. –2001. –Vol. 21. –P.91–100. 3. Wild SH. Metabolic syndrome, haemostaticand inflammatory markers, cerebrovascular and peripheral arterial disease: The Edinburgh Artery Study / S.H Wild, C.D Byrne, I. Tzoulaki // Atherosclerosis. – 2008. – Vol.14. – P.83-102. 4. Wieckowska A. Increased hepatic and circulating interleukin–6 levels in human nonalcoholic steatohepatitis / A. Wieckowska, B.G Papouchado, Z. Li // Am J Gastroenterol. –2008. –Vol. 103. – P.1372–1379. 5. Yilmaz Y. Liver function tests: Association with cardiovascular outcomes / Y. Yilmaz // World J Hepatol. –2010. –Vol. 27. – P.143–147. 6. Чернобровий В.М. Біліарний рефлюкс-гастрит та рефлюксезофагіт: актуальні питання застосування урсодезоксихолевої кислоти / В.М. Чернобровий. – 2013. – № 2. – С. 47-51. 7. Lazebnyk L.B. Non–alcoholic fatty liver disease with dyslipidemia and insulin resistance: similarities and differences. Differentiation approach to the therapy / L.B. Lazebnyk, L.A Zvenyhorodskaya, E.G Egorova // Farmateca. – 2008. – № 15. – P. 79-85. 8. Tarquini R. Non–alcoholic fatty liver disease: a new challenge for cardiologists / Tarquini R., Lazzeri C., Boddi M.G // Ital Cardiol

(Rome). Review. Italian. –2010. – Vol.11(9). – P.60–69. 9. Sciacqua A. Endothelial dysfunction and non – alcoholic liver steatosis in hypertensive patients / Sciacqua A., Perticone M., Miceli S // Nutr Metab Cardiovasc Dis. – 2010. –Vol.12. – P.17–23.

Кулаец В.М. Показатели функционального состояния печени, липидного спектра крови у больных на неалкогольный стеатогепатит в сочетании с ожирением при применении комбинированной терапии Резюме: Изучены особенности клинического течения, ультрасонографическую картину, показатели функционального состояния печени, липидного спектра крови, у больных на неалкогольный стеатогепатит (НАСГ) в сочетании с ожирением. У 29(63,0%) больных на НАСГ обнаружено достоверное повышение уровня прямого билирубина в сыворотке крови, у 33 (71,7%) - активности сывороточных аминотрансфераз (АЛТ,АСТ), у 24 (52,2%) - щелочной фосфатазы (ЛФ), у 26 (56,5%) - тимоловой пробы, у 35 (76,1%) - показателей липидного спектра крови. Ультрасонографически отмечено диффузное увеличение размеров печени, изменения ее ехоструктуры. Больше чем у половини обследованных по данным индекса массы тела (ИМТ) имело место висцеральное ожирение. После проведенного курса комбинированной терапии отмечена достоверно позитивная динамика биохимических показателей крови (р<0,05): снижение уровня прямого билирубина в 3,0 разы, аминотрансфераз (АЛТ- в 1,5 разы, АСТ- в 1,34 разы), тимоловой проби - в 3,0 разы, ЛФ - в 2,16 раз. Показатели липидного спектра крови приближались к показателю нормы (р<0,05). Это свидетельствовало о практически полном возобновлении функциональной активности печенки, а в клиническом плане – о достижении стойкой клинико-биохимической ремиссии НАСГ. Ключевые слова: неалкогольный стеатогепатит, ожирение, липидный спектр крови, препараты урсодезоксихолевой кислоты, ультрасонографическое исследования органов брюшной полости, ехоструктура печени. V.M. Kulaiets Indices of the Liver Functional State, Blood Lipid Spectrum in Patients with Non-Alcoholic Steatohepatitis Combined with Obesity when Applying Combined Therapy Department of Therapy and Family Medicine, FPGE (Head of the Department – Prof. L.V. Hlushko) Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine Summary. There were investigated the peculiarities of the clinical course, the ultrasonographic picture, the indices of the liver functional state of the, the blood lipid spectrum in patients with non-alcoholic steatohepatitis (NASH) combined with obesity. In most patients suffering from NASH there was found a reliable increase of the direct bilirubin level in the blood, of the activity of alanine aminotransferase (ALAT, ALT) and alkaline phosphatase (ALP) of the thymol test, and of the blood lipid spectrum. There was ultrasonographically detected the diffuse enlargement of the liver sizes and the changes of its echo structure. According to the body mass index (BMI) most of the examined patients had visceral obesity. After the course of the combined therapy there were marked the positive dynamics in biochemical indices of the blood (p<0.05): 3.0 times decrease of the direct bilirubin level, aminotransferase (ALAT – 1.5, АLТ – 1.34 times), thymol test – 3.0 times, and blood phosphatase – 2.16 times. The indices of blood lipid spectrum approached to the normal indexes (p<0.05). This indicates the almost complete recovery of the liver functional activity and, in the clinical aspect, the achievement of the consistent clinical and biochemical remission of NASH. Keywords: non-alcoholic steatohepatitis, obesity, blood lipid spectrum, ursodeoxycholic acid drugs, abdominal ultrasound, echo structure of liver. Надійшла 04.11.2013 року.

33


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 616.314.13-007.23 + 613.955

Лабій Ю.А., Мельничук Г.М. Стоматологічний статус дітей, хворих на системну гіпоплазію емалі, які проживають у різних за антропогенним забрудненням районах Івано-Франківської області Кафедра дитячої стоматології (зав. каф. – проф. Мельничук Г.М.) Івано-Франківського національного медичного університету e-mail: jura999@rambler.ru Резюме. Обстежено стоматологічний статус 361 дитини у віці 6-16 років із різних за характером забруднення довкілля районів Івано-Франківської області. Визначали DDE-index, ступені важкості системної гіпоплазії емалі (СГЕ), поширеність та інтенсивність карієсу, гігієнічний індекс OHI-s, індекс РМА. Встановлено, що поширеність СГЕ залежить від характеру антропогенного забруднення довкілля. Найчастіше СГЕ діагностувалася серед дітей, які проживають у районі з радіаційним забрудненням, найменше – у районі з інгаляційним забрудненням діоксинами сірки, азоту і вуглецю. Важкі ступені СГЕ найчастіше виявлялися за наявності в атмосферному повітрі великої кількості неметанових летких органічних високомолекулярних сполук. Незалежно від характеру забруднювача СГЕ найбільше уражалися центральні різці і перші моляри постійного прикусу, а під дією радіації – перші і другі премоляри, що свідчить про особливо шкідливий вплив усіх вивчених ксенобіотиків на формування емалі зубів на першому році життя та радіаційного забруднення – на шостому. Ураженість дітей, хворих на СГЕ, карієсом зубів є тотальною і не залежить від району проживання та виду ксенобіотика. Встановлені закономірності вказують на необхідність здійснення профілактичних заходів у віці одного і шести років для попередження виникнення як СГЕ, так і карієсу зубів. Ключові слова: діти, постійні зуби, системна гіпоплазія емалі, карієс, індекс гігієни OHI-s, індекс PMA.

Постановка проблеми і аналіз останніх досліджень. За даними різних джерел, у 60-80-х роках ХХ століття системну гіпоплазію емалі (СГЕ) зубів виявляли у 12-19 % людей [1, 5]. Але, починаючи із середини вісімдесятих років минулого століття, поширеність СГЕ стала стрімко зростати і досягла показника 81,2-82,4%, тобто впритул наблизилася до поширеності карієсу зубів [7]. Це може бути пов’язане зі швидким розвитком цивілізації в останні десятиріччя, який призвів до погіршення екологічної ситуації на нашій планеті. В Україні екологічні негаразди ще й значно обтяжені аварією на Чорнобильській АЕС. Поширеність і клінічні прояви СГЕ зубів у дітей, на думку деяких дослідників, значною мірою відображають екологічний стан місцевості і можуть слугувати його індикаторами [8]. За даними Головного управління статистики в ІваноФранківській області [3], у 2006 році викиди забруднюючих речовин в атмосферне повітря від стаціонарних та пересувних джерел забруднення становили в Галицькому районі 241,9 тисяч тон, у Долинському – 7,8 тисяч тон, у Калуському – 8,9 тисяч тон, у Снятинському – 1,7 тисяч тон. Із розрахунку на одну особу населення, що проживає у цих районах, викиди складали: у Галицькому районі – 3810,0 кг, у Долинському – 110,8 кг, у Калуському – 145,1 кг, у Снятинському – 25,1 кг. Серед забруднювачів атмосферного повітря в Галицькому районі переважали сполуки діоксину сірки, діоксину азоту і діоксину вуглецю. У Долинському районі виявлено забруднення питної води продуктами нафтогазовидобутку. У Калуському районі переважали викиди неметанових летких органічних високомолекулярних сполук. У Снятинському, як сільськогосподарському районі, переважали забруднення грунтів і грунтових вод гербіцидами, мінеральними та органічними добривами. Матеріал і методи дослідження Під епідеміологічним обстеженням була 361 дитини ІваноФранківської області у віці 6-16 років, в яких визначали стоматологічний статус. Серед них: 121 школяр с. Задністрянське Галицького району, які страждають від високого забруднення повітря, зумовленого значною мірою викидами в атмосферу продуктів

34

спалювання вугілля на Бурштинській теплоелектростанції; 79 дітей с. Верхня Калуського району, які проживають на території, забрудненій продуктами хімічної промисловості органічних високомолекулярних сполук від діяльності заводу-гіганту „Лукор”; 86 дітей с. Яворів Долинського району, що є місцевістю з інтенсивним забрудненням питної води шкідливими речовинами нафтогазовидобувного комплексу; 75 дітей с. Стецева Снятинського району, яке, відповідно до Постанови Кабінету Міністрів України №106 від 23 липня 1991 року, віднесене до зони посиленого радіаційного контролю (IV зони радіаційного забруднення внаслідок аварії на Чорнобильській АЕС) [4]. У цьому селі та на прилеглих територіях виявлені плями радіаційного забруднення до 5 Кюрі/км2. При обстеженні особливої уваги надавали дослідженню стану емалі постійних зубів. Якісні та кількісні показники дефектів у дітей, хворих на СГЕ зубів, визначали візуально при природному освітленні та зондуванням і вітальним зафарбовуванням 1% розчином метиленового синього. У спеціально розроблену карту вносилися цифрові показники індексу дефектів розвитку емалі (DDE-index) у модифікації Clarkson-O’Mullane (1989) [9]. У подальшому для спрощення класифікації всі дані щодо діагностованої СГЕ систематизувалися за класифікацією Луцькою І. К. і спіавт. [5], які виділяють такі ступені важкості СГЕ: легкий, що проявляється зміною забарвлення; середній, при якому діагностують малі дефекти емалі і важкий ступінь, до якого включають випадки значних дефектів емалі аж до повної аплазії. Поширеність та інтенсивність карієсу зубів досліджували відповідно до рекомендацій ВООЗ. Стан гігієни ротової порожнини визначали за допомогою індекса OHI-s (Greene, Vermillion, 1969), а тканин пародонта – за індексом РМА у модифікації С. Парма (1960). Статистична обробка даних проводилася із застосуванням стандартних пакетів програми „Microsoft Office Exel 2007”.

Результати дослідження та їх обговорення За даними нашого обстеження, поширеність СГЕ є досить високою. Найвищі показники спостерігалися у Снятинському районі з радіаційним характером забруднення (58,67±5,72%), а найменші – у Галицькому районі з інгаляційним характером забруднення (22,31±3,80%). Ці дані наведено в таблиці 1. При аналізі ступенів важкості СГЕ встановлено, що найважче захворювання проявлялося у дітей, які проживають у місцевості, забрудненій викидами хімічної промисловості високомолекулярних сполук, тобто у Калуському районі (табл. 2). Там частота СГЕ важкого ступеня становила Таблиця 1. Поширеність системної гіпоплазії емалі постійних зубів у дітей, які проживають в різних районах Івано-Франківської області Кількість Поширеність СГЕЗ Район обстежених абсолютна відносна дітей кількість, n кількість, % Галицький 121 27 22,31±3,80 Долинський 86 36 41,86±5,35 Калуський 79 26 32,91±5,32 Снятинський 75 44 58,67±5,72 Таблиця 2. Розподіл поширеності системної гіпоплазії емалі постійних зубів у дітей, які проживають в різних районах Івано-Франківської області, ступенями важкості Середній Легкий ступінь Важкий ступінь Район ступінь n % n % n % Галицький 22 81,48±7,62 5 18,52±7,62 0 0 Долинський 27 75,0±7,31 7 19,44±6,69 2 5,56±3,87 Калуський 15 57,69±9,88 7 26,92±8,87 4 15,38±7,22 Снятинський 34 77,27±6,39 9 20,45±6,15 1 2,27±2,27


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 3. Розподіл видів дефектів на окремих зубах у дітей Галицького району, хворих на системну гіпоплазію емалі (за DDE – індексом) Зуби Вид дефекту 1 2 3 4 5 6 7 n % n % n % n % n % n % n % обмежене помутніння 13 48,1 10 37,0 1 3,7 8 29,6 4 14,8 16 59,3 0 0 лінії 0 0 1 3,7 0 0 0 0 0 0 0 0 0 0 плями 0 0 0 0 0 0 2 7,4 2 7,4 0 0 0 0 малюнок, що зливається 1 3,7 0 0 0 0 0 0 0 0 0 0 0 0 ямки 1 3,7 0 0 0 0 0 0 0 0 4 14,8 0 0 відсутність емалі 0 0 0 0 0 0 0 0 0 0 0 0 0 0 всього 15 55,5 11 40,7 1 3,7 10 37 6 22,2 20 74,1 0 0 Таблиця 4. Розподіл видів дефектів на окремих зубах у дітей Долинського району, хворих на системну гіпоплазію емалі (за DDE – індексом) Зуби Вид дефекту 1 2 3 4 5 6 7 n % n % n % n % n % n % n % обмежене помутніння 11 30,6 7 19,4 1 2,8 3 8,3 4 11,1 8 25,0 1 2,8 лінії 1 2,8 2 5,6 2 5,6 2 5,6 2 5,6 2 5,6 0 0 плями 4 11,1 3 8,3 2 5,6 8 22,2 8 8,3 4 11,1 2 5,6 малюнок, що 1 2,8 2 5,6 0 0 2 5,6 2 5,6 1 2,8 1 2,8 зливається ямки 6 16,7 3 8,3 3 8,3 0 0 0 0 5 13,9 0 0 відсутність емалі 1 2,8 1 2,8 0 0 0 0 0 0 2 5,6 0 0 всього 24 66,7 18 50,0 8 22,3 15 41,7 16 44,4 22 61,1 4 11,2 Таблиця 5. Розподіл видів дефектів на окремих зубах у дітей Калуського району, хворих на системну гіпоплазію емалі (за DDE – індексом) Зуби Вид дефекту 1 2 3 4 5 6 7 n % n % n % n % n % n % n % обмежене помутніння 13 50,0 10 38,5 0 0 9 34,6 1 3,8 9 34,6 1 3,8 лінії 3 11,5 3 11,5 0 0 0 0 0 0 0 0 0 0 плями 1 3,8 0 0 1 3,8 3 11,5 1 3,8 4 15,4 0 0 малюнок, що 0 0 0 0 0 0 0 0 0 0 0 0 0 0 зливається ямки 7 26,9 6 23,1 2 7,7 0 0 0 0 7 26,9 0 0 відсутність емалі 1 3,8 1 3,8 0 0 0 0 0 0 3 11,5 0 0 всього 25 96,2 20 76,9 3 11,5 12 46,1 2 7,6 23 88,5 1 3,8 Таблиця 6. Розподіл видів дефектів на окремих зубах у дітей Снятинського району, хворих на системну гіпоплазію емалі (за DDE – індексом) Зуби Вид дефекту 1 2 3 4 5 6 7 n % n % n % n % n % n % n % обмежене помутніння 13 29,5 10 22,7 5 5,4 21 47,7 14 31,8 23 52,3 4 9,1 лінії 2 4,5 1 2,3 1 2,3 0 0 0 0 0 0 0 0 плями 3 6,8 0 0 1 2,3 1 2,3 0 0 1 2,3 0 0 малюнок, що зливається 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ямки 3 6,8 3 6,8 1 2,3 0 0 0 0 8 18,2 0 0 відсутність емалі 0 0 0 0 0 0 0 0 0 0 1 2,3 0 0 всього 21 47,7 14 31,8 8 12,3 22 50,0 14 31,8 33 65,1 4 9,1

15,38±7,22%, на відміну від району з інгаляційним забрудненням (Галицький район), де важкий ступінь взагалі не зустрічався, а легкий фіксувався у 81,48±7,62% дітей. Значний інтерес становлять дані стосовно проявів СГЕ на окремих зубах, які наведені в таблицях 3-6. Нами встановлено, що ураження перших постійних молярів було найбільшим і коливалося у межах від 61,11±8,24% (у Долинському районі) до 88,46±6,39% (у Калуському районі). Подібна картина відзначалася і при аналізі ушкоджень центральних різців, частота яких складала від 47,73±7,62% (у Снятинському районі) до 96,15±3,85% (у Калуському районі). Це вказує на те, що всі ксенобіотики особливо шкідливі для дітей першого року життя, тобто тоді, коли відбувається первинна мінералізація цих зубів [1]. Необхідно зазначити, що в Сня-

тинському районі з радіаційним характером забруднення спостерігався досить високий рівень ураження перших та других премолярів (див. табл. 6), який складав 50,0±7,63% і 31,82±7,1% відповідно. Первинна мінералізація цих зубів відбувається внутрішньощелепно у шестирічному віці [1], отже радіаційне еконаватаження особливо шкідливо діє на формування емалі саме у цей час. Нашим дослідженням встановлено, що поширеність карієсу зубів у дітей, хворих на СГЕ, коливалася в межах від 92,59±5,14% (у Галицькому районі) до 97,73±2,27% (у Снятинському районі), тобто ураження карієсом було тотальним і близьким за значенням у всіх районах (табл. 7). Така ж закономірність спостерігалася і при аналізі показника інтенсивності карієсу – КПВ.

35


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 7. Поширеність та інтенсивність карієсу постійних зубів у дітей, хворих на системну гіпоплазію емалі, які проживають в різних районах ІваноФранківської області Район Поширеність карієсу, Інтенсивність карієсу, % КПВ Галицький 92,59±5,14 4,14±0,46 Долинський 97,22±2,78 4,47±0,38 Калуський 96,15±3,85 4,23±0,41 Снятинський 97,73±2,27 5,93±0,41

Порівнянням даних, отриманих при аналізі стану гігієни ротової порожнини за допомогою індекса OHI-s (табл. 8), не виявлено достовірної різниці між показниками різних районів, а рівень гігієни був задовільним і склав від 1,15±0,11 балів у Снятинському районі до 1,26±0,15 балів у Галицькому районі. При цьому рівень ураження тканин пародонта гінгівітом (за показниками індексу РМА) у дітей, хворих на СГЕ, є досить низьким і не залежить від місця проживання та характеру еконавантаження на довкілля. Висновки 1. Поширеність СГЕ залежить від характеру антропогенного забруднення довкілля. Найчастіше СГЕ діагностувалася серед дітей, які проживають у районі з радіаційним характером забруднення (Снятинському), найменше – у районі з інгаляційним забрудненням диоксинами сірки, азоту і вуглецю (Галицькому). Важкі ступені СГЕ найчастіше виявлялися у дітей, мешканців Калуського району, де в атмосферному повітрі наявні у великій кількості неметанові леткі органічні високомолекулярні сполуки. 2. Незалежно від характеру забруднювача СГЕ найбільше уражалися центральні різці і перші моляри постійного прикусу у всіх районах. При цьому виявлено високий відсоток дітей з ураженням перших і других премолярів (50,0±7,63% і 31,82±7,1% відповідно) у Снятинському районі. Встановлені закономірності засвідчують особливо шкідливий вплив усіх вивчених нами ксенобіотиків на формування емалі зубів на першому році життя та патогенну дію на емаль радіаційного забруднення на шостому році життя. 3. Ураженість дітей, хворих на СГЕ, карієсом зубів є тотальною і не залежить від району проживання та виду ксенобіотика. 4. Особливо негативний вплив екопатогенів на розвиток зубів у віці одного і шести років зумовлює необхідність здійснення профілактичних заходів у ці вікові періоди розвитку дитини для попередження виникнення як СГЕ, так і карієсу зубів. Перспективою подальших досліджень є розробка способів лікування і профілактики СГЕ та карієсу зубів у дітей різного віку. Література 1. Боровский Е. В. Биология полости рта / Е. В. Боровский, В. К. Леонтьев. – М.: Медицинская книга, 2001. – 204 с. 2. Грошиков М. И. Некариозные поражения тканей зуба / М. И. Грошиков. – М.: Медицина, 1985. – 145 с. 3. Довкілля Івано-Франківщини у 2010 році: статистичний збірник / Державний комітет статистики України, Головне управління статистики в Івано-Франківській області; [за ред. Л. О. Зброй]. – Івано-Франківськ. – 2011. – 151 с. 4. Кіріяк О. П. Чорнобильські наслідки на Івано-Франківщині / О. П. Кіріяк, В. В. Пантазі, В. В. Мурзов [та ін.] // Гигиена населенных мест. – К.: Полимед. – 2001. – Т.2. – С. 168-169. 5. Луцкая И. К. Клинические проявления аномалий цвета постоянных зубов человека / И. К. Луцкая, Н. В. Новак, Ю. П. Чернявский [и др.] // Стоматолог. – 2001. – №9. – С. 16-21. 6. Федоров Ю. А. Клиника, диагностика и лечение некариозных поражений зубов / Ю. А. Федоров, В. А. Дрожжина // Новое в стоматологии. – 1997. – №10(60). – Спец. вып. – 147с. 7.Федоров Ю. А. Некоторые особенности распространенности

36

Таблиця 8. Стан гігієни ротової порожнини та тканин пародонта у дітей, хворих на системну гіпоплазію емалі, які проживають в різних районах Івано-Франківської області Гігієнічний індекс Район Індекс РМА, бали OHI-s, бали Галицький 1,25±0,12 0,53±0,53 Долинський 1,19±0,10 1,11±0,53 Калуський 1,26±0,15 1,58±0,76 Снятинський 1,15±0,11 1,35±0,71 и клинического проявления некариозных поражений зубов, развившихся в период их формирования (до прорезывания) / Ю. А. Федоров, И. А. Киброцашвили // Стоматология детского возраста и профилактика. – 2007. – №1. – С. 47-52. 8.Хоменко Л.О. Стан твердих тканин постійних зубів у дітей в різних за екологічною ситуацією регіонах України / Л. О. Хоменко, О. І. Остапко, Ю. М. Трачук // Новини стоматології. -– 2007. – №1(50). – С. 87-91. 9. Clarkson J. The Prevalence of Enamel Defects using a Modified DDE Index / Clarkson J., O’Mullane D. M., O’Hickey S. // J Dent Res. – 1988. – 67:229, Abst. No. 935. Лабий Ю.А., Мельничук Г.М. Стоматологический статус детей, больных системной гипоплазией эмали, проживающих в различных по антропогенному загрязнению районах Ивано - Франковской области Кафедра детской стоматологии (зав. каф. - проф . Мельничук Г.М.) Ивано-Франковского национального медицинского университета e-mail: jura999@rambler.ru Резюме. Обследовано стоматологический статус 361 ребенка в возрасте 6-16 лет из различных по характеру загрязнения окружающей среды районов Ивано-Франковской области. Определяли DDE-index, степени тяжести системной гипоплазии эмали (СГЭ), распространенность и интенсивность кариеса, гигиенический индекс OHI-s, индекс РМА. Установлено, что распространенность СГЭ зависит от характера антропогенного загрязнения окружающей среды. Чаще всего СГЭ диагностировалась среди детей, проживающих в районе с радиационным загрязнением, меньше всего – в районе с ингаляционным загрязнением диоксидами серы, азота и углерода. Тяжелые степени СГЭ чаще выявлялись при наличии в атмосферном воздухе большого количества неметановых летучих органических высокомолекулярных соединений. Независимо от характера загрязнителя СГЭ больше поражались центральные резцы и первые моляры постоянного прикуса, а под действием радиации – первые и вторые премоляры, что свидетельствует об особо вредном воздействии всех изученных ксенобиотиков на формирование эмали зубов на первом году жизни и радиационного загрязнения - на шестом. Пораженность детей, больных СГЭ, кариесом зубов является тотальной и не зависит от района проживания и вида ксенобиотика. Установлены закономерности указывают на необходимость осуществления профилактических мероприятий в возрасте одного и шести лет для предупреждения возникновения как СГЭ, так и кариеса зубов. Ключевые слова: дети, постоянные зубы, системная гипоплазия эмали, кариес, индекс гигиены OHI-s, индекс PMA. Yu.A. Labiy, G.М. Melnychuk Status of the Dental Health of Children with the Systemic Enamel Hypoplasia, who Live in Different by Anthropogenic Pollution Districts of Ivano-Frankivsk Region Pediatric Dentistry Department (Head of Department. - Prof. Melnychuk H.M.) of Ivano-Frankivsk National Medical University, e-mail: jura999@rambler.ru Summary. The study examined status of the dental health of 361 children from 6 to 16 years of age from different districts of the IvanoFrankivsk region with different levels of environmental pollution. The DDE-index, severity level of systemic enamel hypoplasia (SEH), spread and intensity of dental caries, hygienic index OHI-s, PMA index were determined. It was concluded that the spread of SEH depends on the level of anthropogenic pollution. The highest rate of SEH was diagnosed among children living in the area with radiation contamination, the lowest rate - in the area with the air contaminated with sulfur dioxin, nitrogen dioxin and carbon dioxin. Severe degrees of SEH are often detected in the ambient air with a large number of non-methane volatile organic macromolecular compounds. Regardless of the pollutant type, SEH mostly affected central incisors and first molars of permanent


Галицький лікарський вісник, 2013, Т. 20, № 4 dentition, and under the influence of radiation - first and second premolars, which indicates a particularly harmful effect of all studied xenobiotics on forming tooth enamel in the first year of life, and of radiation pollution – in the sixth year. Caries affection of children with enamel SEH is total and does not depend on the area of residence and type of xenobiotics. The determined consistencies indicate the need

for prophylactic measures at the age of one and six years for the prevention of both SEH and dental caries. Keywords: children, permanent teeth, systemic enamel hypoplasia, dental caries, hygienic index OHI-s, PMA index. Надійшла 28.10.2013 року.

УДК 616.314.2-07

Лисейко Н.В1., Левандовський Р.А2., Коваль Є.А.1 Порівняльна характеристика методів визначення порушень оклюзії зубних рядів 1 2

Національний медичний університет імені О.О. Богомольця, Київ Буковинський державний медичний університет, Чернівці

Резюме. Величина жувального навантаження та особливості його розподілу в нормі характеризуються значними індивідуальними варіаціями та залежать від анатомічних характеристик зубощелепної системи, сили скорочення жувальних м’язів та виду оклюзії. Проведена порівняльна характеристика методів виявлення оклюзійних порушень у пацієнтів з генералізованим пародонтитом на основі використання артикуляційного паперу та апаратно-комп’ютерного комплексу T-Scan III (Tekscan, USA), у тому числі у хворих зі складною щелепно-лицевою патологією. За допомогою арикуляційного паперу виявлено 176 супраконтактів, а із застосуванням Tekscan Occlusal Diagnostic System - 483 супраконтакти. Отже, достовірність оклюзійної діагностики артикуляційним папером не перевищує 36,6%, що дає змогу говорити про необхідність залучення об’єктивних методів у повсякденній практиці. Ключові слова: генералізований пародонтит, оклюзійні співвідношення, артикуляційний папір, апаратно-комп’ютерний комплекс T-Scan III.

Постановка проблеми і аналіз останніх досліджень. Оклюзійна травма є найбільш поширеним ускладненням, що супроводжує генералізований пародонтит, особливо на ранніх стадіях захворювання. Вона може зашкодити пацієнтам зі здоровим пародонтом, призвести до руйнування композитних реставрацій, поломок ортопедичних конструкцій та дестабілізації різноманітних видів знімних протезів, особливо тих, що застосовують при складній щелепнолицевій патології, у пацієнтів, які хворіють на генералізований пародонтит. Саме тому діагностика порушень оклюзійних співвідношень є невід’ємною частиною лікувального процесу даного захворювання. При рухомості зубів діагностика стану оклюзійних співвідношень в артикуляторі є не точною, а у деяких випадках взагалі неможлива. Тому артикуляційний папір залишається одним із основних, а у деяких випадках єдиним інструментом для виявлення порушень оклюзії у пацієнтів з генералізованим пародонтитом. Запропонована 100 років тому методика використання артикуляційного паперу не зазнала значних змін. Було запропоновано послідовне застосування артикуляційного паперу різної товщини та різного кольору для виявлення супраконтактів, але трудомісткість методики зумовила використовувати папір однієї товщини. Неодноразово науковці наголошували на недосконалості даного методу діагностики супраконтактів [3,4,5]. В 1987 році була представлена перша комп’ютеризована система діагностики оклюзійних співвідношень, що дозволяє в режимі реального часу вивчити і проаналізувати різні види оклюзії зубних рядів як в статиці, так і в динаміці. Цей комплекс дозволяє збирати, систематизувати та аналізувати дані про послідовність контактів, час виникнення першого контакту та його локалізацію, послідовність виникнення контактів у режимі реального часу, силу стискання зубних

рядів протягом певного часу, прослідкувати за зміною оклюзійних співвідношень зубних рядів від першого контакту до максимального міжгорбкового контакту, опосередковано говорити про стан жувальної мускулатури [1,2]. Зауважимо, що на даний момент це є єдиний кількісний аналіз оклюзійних співвідношень, що застосовується на практиці [6,7,8]. Тому метою нашої роботи стало порівняння достовірності різних методик виявлення контактів надмірної сили. Матеріал і методи дослідження Для виявлення порушень оклюзії, а саме, для виявлення контактів надмірної сили ми використовували як традиційні методи, так і новітні, із залученням сучасних комп’ютерних технологій. Як основний метод виявлення супраконтактів ми використовували артикуляційний папір товщиною 200 мкм з наростаючою інтенсивністю кольору. Для виявлення супраконтактів ми користувалися загальноприйнятою методикою та рекомендаціями виробника. Так виробник вказує, що даний папір здатний представити оклюзійну силу різної інтенсивності у вигляді кольорових ділянок з відтінками, що залежать від величини цього навантаження, тобто, менше навантаження при накушуванні позначається світлішим кольором, а тиск більшої сили - більш інтенсивним забарвленням. Наявність контактів з яскравим забарвленням, або великих за площею має свідчити про надмірну силу, тоді як контакти малої площі, або не виражені свідчать про мінімальне оклюзійне навантаження. Для дослідження оклюзійних взаємовідносин використовували апарат “T-Scan III” (США), який являє собою спеціальний сенсор, що реагує на тиск, та під’єднаний до комп’ютера (рис.1). При визначенні оклюзійних контактів зубних рядів пацієнт прикушує спеціальний датчик, який реагує на тиск зубів.

Рис1. Запис оклюзійних співвідношень за допомогою T-Scan III

37


Галицький лікарський вісник, 2013, Т. 20, № 4

Колір Контакт

Рожевий 3 (12%) 4 (12,12%) 2 (3,70%)

Розчавлений контакт Контакт з інтенсивним фарбуванням Контакт з неінтенсивним фарбуванням Незначний слід від артикуляційного паперу Відсутній слід від артикуляційного паперу

-

Таблиця 1. ПомаЧервоний ранчевий 2 5 (8%) (20%) 5 1 (15,15%) (3,03%) 4 3 (7,40%) (5,55%) 3 (7,89%)

-

-

Результати дослідження та їх обговорення Першу групу склали 17 пацієнтів, 7 чоловіків та 10 жінок, віком від 35 до 53 років. Дана група характеризувалась зубними рядами без дефектів та генералізованим пародонтитом І та ІІ ступеня, рухомістю зубів І ступеня, відсутністю скарг оклюзійного характеру. Загалом, у пацієнтів І-ої групи ми дослідили 158 оклюзійних контактів у положенні центральної оклюзії. У дослідженні порівнювали однакові щодо розміщення оклюзійні контакти на отриманих зображеннях зубних рядів з відбитками артикуляційного паперу з даними комп’ютерного аналізу оклюзії. Фотографії отриманих з допомогою артикуляційного паперу відбитків оклюзійних контактів були розділені на п’ять груп: - розчавлений контакт; - контакт з інтенсивним фарбуванням; - контакт з неінтенсивним фарбуванням; - незначний слід від артикуляційного паперу;

Роздавлений контакт Контакт з інтенс. фарб. Контакт з неінтен. фарб. Незначний слід артикул. паперу Відсутній слід артикул. паперу

38

-

Червоний 3 (5,76%) 16 (20,77%) 4 (6,89%) 8 (12,90%) -

Зелений

Блакитний

Синій

4 (16%) 2 (6,06%) 8 (14,81%) 10 (26,31%)

6 (24%) 10 (30,30%) 12 (22,22%) 5 (13,15%) 3 (37,50%)

3 (12%) 7 (21,21%) 14 (25,92%) 7 (18,42%) 1 (12,50%)

2 (8%) 4 (12,12%) 11 (20,37%) 13 (34,21%) 4 (50%)

-

Інформація з сенсора передається у спеціальну програму, що аналізує отримані дані та дозволяє оцінювати наступні параметри оклюзії: розташування першого контакту, послідовність виникнення контактів до моменту максимального міжгорбкового контакту, час оклюзії та дезоклюзії, дослідити як центральну оклюзію, так і будь-які латеротрузії, протрузію, відносне навантаження на кожний зуб, розподіл навантаження між правою та лівою сторонами щелеп тощо. Особливістю цього методу є кількісна оцінка оклюзії. Перевагою його є те, що отримані дані зберігаються в програмі, у вигляді відеозаписів, з можливістю неодноразового перегляду та подальшого аналізу. Для порівняння результатів дослідження отримані дані заносились у спеціальні таблиці та аналізувались. Відбитки оклюзійних контактів, отриманих з допомогою артикуляційного паперу, фотографувались та прикліплялись до бази данних пацієнтів в програмі комп’ютерного аналізу оклюзійних взаємовідносин “T-Scan III”. Розподіл на групи. Для оцінки достовірності отриманих даних ми розділили пацієнтів на три групи. Перша група - пацієнти, 17 чоловік, з генералізованим пародонтитом різного ступеня важкості та без дефектів зубних рядів. До другої групи ми віднесли 12 пацієнтів із незнімними ортопедичними конструкціями в порожнині рота. Третю групу склали 9 пацієнтів зі знімними протезами. Всього було досліджено 780 оклюзійних контактів зубів, зроблених за допомогою артикуляційного паперу та апаратно-комп’ютерного комплексу T-Scan III (Tekscan, USA).

Рожевий 1 (1,92%) 18 (23,37%) 3 (5,17%)

Жовтий

- відсутній слід від артикуляційного паперу. Дані порівняння відповідності відбитку артикуляційного паперу від сили контакту наведені у таблиці 1. Згідно з анотацією виробника артикуляційного паперу – розчавлений слід означає місце супраконтакту, але, співставивши слід артикуляційного паперу з результатами, отриманими у “T-Scan 3”, можна дійти висновку, що розчавлений слід лише у 40% випадків означає супраконтакт, в 16% контакт більшої сили, у 34% випадків – контакт нормальної сили. Контакт з інтенсивним маркуванням – у 30,3% це супраконтакти, в 6,06% - контакт підвищеної сили, 63,63% контакти з нормальним навантаженням. Неінтенсивне маркування оклюзійних контактів у 16,65% виявляється контактами, що мають патологічний вплив на тканини пародонту, 14,81 – контакти підвищеної сили, а у 68,51% - контакти нормальної сили. Марковані контакти із незначним слідом від артикуляційного паперу в 7,89% виявляються супраконтактами, 26,31% - контактами значного навантаження, а у 65,78% випадків відповідають контактам з нормальним навантаженням. Не маркуються 5,06% контактів. У пацієнтів ІІ групи - наявність в порожнині рота ортопедичних незнімних конструкцій ми дослідили 254 контакти (Таблиця 2). Як показали отримані дані, роздавлений слід від артикуляційного паперу підтверджує наявність супраконтакну лише у 30,76% сипадків, в 13, 46% він вказує на контакт підвищеної сили, а у 55,79%, взагалі, вказує на контакти з фізіологічною силою. У 58,42% випадків інтенсивний слід від артикуляційного паперу, що мав би маркувати контакти з підвищеною силою, маркує супраконтакти, в 20,68% - контакти підвищеної сили, а в 27,27% випадків маркує нормальні за силою контакти. Слід з неінтенсивним фарбування маркує нормальні за силою контакти 48,27% випадків, у 20,68% - контакти підвищеної сили, а в 31,02% - супраконтакти. Незначний слід від артикуляційного поперу, що мав би вказувати на локалізацію нормальних за силою контактів у 20,96% вказує на супраконтакти, у 16,13% - на контакт підвищеної сили і у 62,90% вказує на нормальні за силою контакти. 1,97% контактів взагалі не маркуються. Всього у пацієнтів ІІІ групи ми дослідили 368 контактів. Отримані дані свідчать, що у пацієнтів ІІІ-ої групи наявність супраконтактів при діагностиці артикуляційним папе-

Таблиця 2. Помаранч 12 (23,08%) 11 (14,28%) 11 (18,96%) 5 (8,06%) -

-

Жовтий 7 (13,46%) 14 (18,18%) 12 (20,68%) 10 (16,13%)

Зелений 14 (26,95%) 7 (9,09%) 10 (17,24%) 13 (20,96%)

-

-

Блакитн 11 (21,15%) 5 (6,49%) 11 (18,96%) 17 (27,42%) 4 (80%)

Синій 4 (7,69%) 9 (11,69) 7 (12,07%) 9 (14,52%) 1 (20%)


Галицький лікарський вісник, 2013, Т. 20, № 4

Роздавлений контакт Контакт з інтенс. фарб. Контакт з неінтен. фарб. Незначний слід артикул. паперу Відсутні слід артикул. паперу

Рожевий 5 (7,81%) 14 (14,14%) 8 (9,64%) 6 (7,23%)

Червоний 7 (10,94%) 12 (12,12%) 5 (6,02%) 10 (12,04%)

-

-

Таблиця 3. Помаранч 4 (6,25%) 13 (13,13%) 15 (18,07%) 11 (13,25%) -

Жовтий 19 (29,69%) 15 (15,15%) 10 (12,04%) 19 (22,89%) -

Зелений 11 (17,19%) 13 (13,13%) 11 (13,25%) 10 (12,04%) 1 (12,5%)

Блакитний 15 (23,44%) 14 (14,14%) 15 (18,07%) 12 (14,46%) 3 (37,5%)

Синій 3 (4,69%) 18 (18,19%) 19 (22,89%) 15 (18,07%) 4 (50%)

исследований в ортопедической стоматологии // Dental Forum.2011.-№3.-С.80 2. Перегудов А.Б., Маленкина О.А., Гвасалия Л.В. Применение компьютеризированного аппарата баланса окклюзии Т-СКАН для проведения научных исследований в ортопедической стоматологии // Сборник трудов VIII Всероссийской научно-практической конференции «Образование, наука, и практика в стоматологии».- 2010.- С.117-118. 3. Millstein,P. Know your indicator. J Mass Dental Soc 2008, 56(4) :30-31. 4. Lerman, Martin D: A Revised View of the Dynamics, Physiology, and Treatment of Occlusion: A New Paradigm, The Journal of Craniomandibular Practice, January 2004, Vol. 22, No. 1 pp 50–63. 5. Carey JP, Craig M, Kerstein RB, Radke J. Determining a relationship between applied occlusal load and articulating paper marc area. The open Dentistry Journal, Рис.2 Порівняння оклюзійних співвідношень у пацієнтів ІІІ групи за 2007,(1), 1-7. допомогою T-Scan III та артикуляційного паперу 6. Koos B, Godt A, Schille C, Gцz G Precision of an instrumentation-based method Ті контакти, що маркуються як контакти підвищеної сили of analyzing occlusion and its resulting distribution of forces in the у 39,39% випадків виявляються супраконтактами, лише dental arch J Orofac Orthop. 2010 Nov;71(6):403-10. Epub 2010 Nov 17. English, German. 7. Mark W. Montgomery, DMD. T-Scan Dental Force 15,15% дійсно являються контактами підвищеної сили, а у Analysis for Routine Dental Examination. - Dentistry Today, 2011. 27,27% - контактами нормальної оклюзійної сили. Контакти 8. Dr. Robert Kerstein, DMD. Healthy and Harmonised Function з неінтенсивним фарбуванням, ті, що згідно з анотацією ви- via Computer Guided Occlusion, Cosmetic Dentistry, 2011, (2) 6-12

ром підтверджується у 25% випадків, 29,69% розчавлених контактів відповідають контактам підвищеної сили, але не супраконтактам, а у 45,32% - контактам нормальної сили (рис. 2).

робника артикуляційного паперу є контактами нормалної сили, такими являються у 54,21% випадків, у 12,04% - це контакти підвищеної сили, а у 33,73% - супраконтакти. Незначні сліди від артикуляційного паперу у 32,52% випадків маркують супраконтакти, 22,89% - контакти підвищеної сили, 44,57% відповідають нормальним за силою контактам. 2,27% контактів взагалі не маркуються артикуляційним папером (табл. 3).

Висновки З використанням нових методів діагностики оклюзії стала помітною висока точність розподілу і величини контактів на поверхні зубів при різних видах оклюзії, що дає змогу більш точно діагностувати стан оклюзії та силу жувальних м’язів. Величина жувального навантаження та особливостей його розподілу в нормі характеризуються значними індивідуальними варіаціями та залежать від анатомічних характеристик зубощелепної системи, сили скорочення жувальних м’язів та виду оклюзії. Завдяки використанню діагностичного комплексу T-Scan стало можливим об’єктивно оцінити достовірність даних, отриманих за допомогою артикуляційного паперу. Так, за допомогою арикуляційного паперу було виявлено 176 супраконтактів. Під час аналізу тих самих контактів, але із застосування Tekscan Occlusal Diagnostic System було виявлено 483 супраконтакти. Отже, достовірність оклюзійної діагностики артикуляційним папером не перевищує 36,6%, що дає змогу говорити про необхідність залучення об’єктивних методів у повсякденній практиці. Література 1. Маленкина О.А. Компьютеризированный аппарат анализа баланса окклюзии Т-скан как современный инструмент научных

Лысейко Н.В.1, Левандовский Р.А.2, Коваль Е.А.1 Сравнительная характеристика методов определения нарушений окклюзии зубных рядов 1 Национальный медицинский университет имени А.А.Богомольца, Киев 2 Буковинський государственный медицинский университе, Черновцы Резюме. Размер жевательной нагрузки и особенности его распределения в норме характеризуются значительными индивидуальными вариациями и зависят от анатомических характеристик зубочелюстной системы, силы сокращения жевательных мышц и вида окклюзии. Проведена сравнительная характеристика методов выявления окклюзионных нарушений у пациентов с генерализованным пародонтитом на основе использования артикуляционной бумаги и аппаратно - компьютерного комплекса T- Scan III (Tekscan, USA) , в том числе у больных со сложной челюстно-лицевой патологией. С помощью арикуляцийного бумаги обнаружено 176 супраконтакты, а с применением Tekscan Occlusal Diagnostic System - 483 супраконтакты. Итак , достоверность окклюзионной диагностики артикуляционным бумагой не превышает 36,6%, что позволяет говорить о необходимости привлечения объективных методов в повседневной практике. Ключевые слова: генерализованный пародонтит, окклюзионные соотношения, артикуляционная бумага, аппаратно компьютерный комплекс T- Scan III. N.V. Lyseiko1, R.A. Levandovskyi2, Ye.A. Koval1 Comparative Analysis of the Methods of Determining Dental Arch Occlusion Disorders 1 O.O. Bohomolets National Medical University, Kyiv, Ukraine 2 Bukovyna State Medical University, Chernivtsi, Ukraine Summary. The amount of masticatory force and the peculiarities of its normal distribution are characterized by considerable individual variations and depend on the anatomical characteristics of the dental

39


Галицький лікарський вісник, 2013, Т. 20, № 4 craniomaxillofacial complex, the force of masticatory muscles contraction and the type of occlusion. There has been conducted the comparative analysis of the methods of detecting occlusal disorders in patients with generalized periodontitis using articulating paper and a diagnostic device ‘T-Scan III’ (Tekscan, USA), including the patients with complicated maxillofacial pathology. With the help of articulating paper there have been detected 176 supracontacts, while using Tekscan Occlusal Diagnostic System – 483 supracontacts. Thus, the reliability

of the occlusal analysis using articulating paper does not exceed 36.6% that makes it possible to talk about the necessity of involving the objective methods in the everyday practice. Keywords: generalized periodontitis, occlusal relationship, articulating paper, diagnostic device ‘T-Scan III’. Надійшла 25.11.2013 року.

УДК 616.314-07+616.314-77

Мельничук М.В., Рожко М.М. Діагностика вимови приголосних звуків в осіб з повними знімними конструкціями зубних протезів на основі ентропії Кафедра стоматології факультету післядипломної освіти (зав. каф.- проф. М.М.Рожко) Івано-Франківського національного медичного університету Резюме. Проведено аналіз встановлення мовної функції при ортопедичному лікуванні повної відсутності зубів знімними пластинковими протезами, виготовленими загальноприйнятим методом і з використанням твердого базису на клінічних етапах його виготовлення на основі ентропійних характеристик приголосних звуків «С» та «Ш» відповідних буквосполученнь «ИС» та «ИШ». Встановлено, що еталоном вимови (на прикладі 72-х осіб зі збереженими зубними рядами, без мовних порушень) слід вважати значення середньоквадратичного відхилення оцінок ентропії, яке становить 0,04. Для проведення аналізу розроблено спеціалізоване програмне забезпечення WavAnaliser v1.2, що дозволяє реалізувати розрахунок оцінок ентропії та операції порівняння в автоматичному режимі з подальшим представленням результатів у вигляді цифрових наборів, зручних для графічного представлення. За результатами дослідження встановлено, що використання твердого базису протеза та проведення мовної корекції на клінічному етапі виготовлення повного знімного протезу сприяє швидшій мовній адаптації до протезів після їх фіксації. Ключові слова: повний знімний протез, ентропія, мовна функція.

Постановка проблеми і аналіз останніх досліджень. Незважаючи на значну кількість робіт з удосконалення клінічних і лабораторних етапів виготовлення повних знімних протезів, проблема відновлення вимови звуків при ортопедичному лікуванні повної відсутності зубів залишається актуальною. За твердженням авторів від 20% до 28% пацієнтів, яким виготовлено повні знімні пластинкові протези, не користуються ними з різних причин [1]. Слід зазначити, що до останнього часу стоматологиортопеди не надавали великого значення фонетичному фактору у підвищенні функціональної ефективності протезів завдяки великим адаптаційним можливостям органів ротової порожнини, в першу чергу язика [2]. Проте відомо, що звукові хвилі, проходячи через ротову порожнину, коливаються залежно від скорочень піднебінних, язикових, губних і жувальних м’язів, також змінюється положення язика, губ та щік. У ротовій порожнині утворюються різноманітні канали і щілини, у яких переривається вільний рух повітряної (голосової) хвилі, і в результаті виникають приголосні звуки [3]. Отже, вимова приголосних звуків при лікуванні повними знімними пластинковими протезами залежить від постановки штучних зубних рядів, від форми та товщини оральної і вестибулярної поверхонь базису протеза, міжкоміркової висоти, рівня розташування оклюзійної поверхні. Голосні звуки утворюються внаслідок коливань голосових зв’язок і подальшої модифікації тонів, що виникли у над-

40

гортанних порожнинах. Враховуючи те, що повний знімний пластинковий протез зменшує об’єм ротової порожнини, тому максимальне рівномірне стоншення базису повинно бути загальним принципом при ортопедичному лікуванні знімними пластинковими протезами. З метою відтворення рельєфу твердого піднебіння для збереження звичних рефлекторно закріплених відчуттів у пацієнта при артикуляціях язика з базисом протеза та досягнення однорідної товщини базису протеза нами запропоновано виготовляти базис протеза методом моделювання останнього під тиском, використовуючи при цьому тверді еластичні акрилові пластини без мономера БІОКРИЛ „С” товщиною 2,0мм, та апарат miniSTAR (фірми SHEU-DENTAL). Товщина базису виготовленого цим способом становить 1,0 мм по всій площині твердого піднебіння . Тому підвищити ефективність ортопедичного лікування у фонетичному плані можна лише при умові конструювання протеза із врахуванням закономірностей мовної артикуляції. Мета роботи. Підвищити ефективність ортопедичного лікування пацієнтів повними знімними пластинковими протезами шляхом удосконалення способу конструювання базису знімного протеза із врахуванням закономірностей мовної артикуляції. Матеріал і методи дослідження У клініці кафедри стоматології ФПО ІФНМУ було обстежено 139 осіб з повною відсутністю зубів і без дефектів зубних рядів і записано 278 аудіофайлів. У це число ввійшли 72 особи, які складали контрольну групу віком від 30 до 60 років. У них був ортогнатичний прикус без дефектів зубних рядів, вони не мали дефектів вимови слів (заїкування, гаркавлення). Дослідну групу складали 67 осіб з повною відсутністю зубів на верхній та нижній щелепі. Втрата зубів у них спричинена хворобами пародонта і ускладненнями карієсу зубів. До втрати зубів вони не мали вад вимови слів. Дослідну групу було поділено на дві підгрупи: в першій підгрупі було 23 чоловік, їм протези виготовляли традиційним методом і всі клінічні етапи виготовлення повних знімних пластинкових протезів проводилися з використанням воскового базису, у другій підгрупі було 44 чоловік, яким базис протеза виготовляли з твердої еластичної пластини «Біокрил» методом штампування, відповідно клінічні етапи проводилися з використанням твердого базису. Хворим дослідної групи і особам без дефектів зубних рядів пропонували мовне завдання. Воно полягало у вимові складів «ИС», «ИШ» української мови, оскільки особливістю вимови цих складів є контакт бокової поверхні язика з піднебінними горбиками бокових зубів і утворенням щілини між спинкою (звук «С»), кінчиком (звук «Ш») язика і передньою частиною твердого піднебіння


Галицький лікарський вісник, 2013, Т. 20, № 4 в якості оцінюваного параметру ефективності відновлення голосової функції при лікуванні повними знімними пластинковими протезами. З огляду на отримані результати, а також для спрощення аналітичного опису, доцільно задіяти середнє квадратичне відхилення оцінок ентропії приголосної частини як ознаку наближеності згаданого фрагменту характеристики до прямої і встановити верхню межу на рівні 0.04.

С

Ш

Рис. 1. Схематичне зображення положення язика при вимові звуків С, Ш

Результати дослідження та їх обговорення Аналіз результатів проведеного нами дослідження представлено наступним чином: розподіл осіб за методом виготовлення знімних пластинкових протезів, середньо квадратичне відхилення оцінок ентропії приголосних звуків «С» та «Ш» на різних етапах виготовлення повних знімних ортопедичних конструкцій (Табл. 1, 2). Розглянуто основні послідовні етапи з погляду оцінювання якісних характеристик вимови на основі звукових представлень буквосполучень «ИС» та «ИШ». Зокрема для осіб, яким виготовлявся повний знімний пластинковий протез за загальноприйнятим методом, проаналізовано вимову звукових рядів на таких проміжних етапах Lp: 1 – повна відсутність зубів; 2 –фіксація повного знімного пластинкового протеза; 3 – на 3-тій день після фіксації протеза; 4 – на 7-ий день після фіксації протеза. З отриманих даних випливає, що значення середньоквадратичного відхилення перевищує 0.04 при фіксації повного пластинкового протеза (Lp 2) в 3 рази (p1<0,05) при вимові звуку «С» та 3,3 рази (p1<0,05) при вимові звуку «Ш». Після 3-ох днів (Lp3) користування протезами вимова даних приголосних звуків дещо покращується і становить 0,072 (p1<0,05) при вимові звуку «С» та 0,05 (p1<0,05) при вимові звуку «Ш». Після 7-ми денного терміну адаптації до повного знімного пластинкового протеза виготовленого за загальноприйнятим методом ентропійне значення середньоквадратичного відхилення становить 0,04 (p1<0,05) при вимові звуку «С» і 0,032 (p1<0,05) при вимові звуку «Ш». Також проведено дослідження звукових рядів буквосполучень для осіб, яким виготовляли повні знімні пластинкові протези удосконаленим методом на таких клінічних етапах Lp: 1 – повна відсутність зубів; 2 – на етапі перевірки постановки штучних зубів; 3 – фіксація повного знімного пластинкового протезу; 4 – на 3-тій день після фіксації протезу; 5 – на 7-ий день після фіксації протезу. Як і в попередньому випадку, спостерігається погіршення ентропійної характеристики вимови звуку «С» та «Ш» на етапі фіксації повного знімного пластинкового протеза (Lp 3) в 1,5 рази (p1<0,05), і 2,1 рази (p1<0,05) відповідно. Проте уже третього дня (Lp 4) значення ентропії близькі до межі прийнятності

Через 7 дні Lp 5

Через 7 дні Lp 5

Через 3 дні Lp 4

Через 3 дні Lp 4

Фіксація Протезу Lp 3

Фіксація Протезу Lp 3

Постановка Lp 2

Постановка Lp 2

Повна Відсутність Lp 1

Повна Відсутність Lp 1

Через 7 днів Lp 4

Через 7 днів Lp 4

Через 3 дні Lp 3

Через 3 дні Lp 3

Фіксація Протезу Lp 2

Повна Відсутність Lp 1 Фіксація Протезу Lp 2

Повна Відсутність Lp 1

з прилягаючою до них частиною коміркового відростка, при цьому утворюючи посередині вузьку щілину, через яку повітряний струмінь із силою виривається між фронтальними зубами, виникає різкий шум, що нагадує свист (неритмічні коливання). Від ступеня вузькості щілини залежить чіткість, чистота вимови приголосних звуків [С] та [Ш] (рис.1). Але оскільки приголосні звуки окремо вимовляти важко, особливо для людей, яким вперше виготовляються ортопедичні конструції, то ми рекомендуємо поєднувати їх з голосними звуками. При утворенні голосних звуків немає точки дотику язика, верхівка язика розташовується за фронтальними нижніми зубами, тому звукове дихання не зустрічає ніякої перепони (ритмічні коливання). Контур при вимові голосних звуків розташовується на рівні оклюзійних площин зубів нижньої щелепи, а нижня щелепа знаходиться в стані фізіологічного спокою [5]. Перед записом кожному роз’яснювався спосіб вимови складів, а саме те, що вимова повинна бути монотонною, спокійною, без демонстрації інтонації, тобто повинен оцінюватися розмовний спокійний голос. Звучання кожного вимовленого складу (тесту) записують по черзі через мікрофон, підключений до комп’ютера. Обов’язково дотримується ідентичність дослідження на всіх етапах (відстань до мікрофона, відсутність сторонніх шумів, рівень гучності й т.д.). Пацієнтів обстежували до ортопедичного лікування, на клінічному етапі постановки штучних зубів, у день фіксації протеза, через 3, 7 днів після фіксації протеза. Записані аудіофайли вимовлених складів зберігають на цифровому носії у вигляді аудіо і графічних записів у якості лікарського, наукового і юридичного документів. Для проведення аналізу використовували розроблене спеціалізоване програмне забезпечення WavAnaliser v1.2, що дозволяє реалізувати розрахунок оцінок ентропії та операції порівняння в автоматичному режимі з подальшим представленням результатів у вигляді цифрових наборів, зручних для графічного представлення та аналізу. Використання ентропійних характеристик доТаблиця 1. Показники середньоквадратичного відхилення о цінок ентропії зволяє розглянути досліджуваний приголосного звука «С» звуковий сигнал як імовірноЗдорові Стандартний метод n=23 Удосконалений метод n=44 часову послідовність, що в свою n=72 чергу призводить до формування різних за формою представлень, більш придатних для кореляційного аналізу, порівняно з амплітудно-частотними характеристи0,024 0,134 0,113 0,072 0,047 0,147 0,085 0,061 0,041 0,021  ками [6]. З метою забезпечення p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1>0,05 оптимального розрахунку оцінок Примітки. p1 – до величини показників здорових ентропії проведено ряд експериментальних досліджень, за яким Таблиця 2. Показники середньоквадратичного відхилення оцінок ентропії встановлено, що прийнятна збіжприголосного звука«Ш» ність результатів спостерігається Стандартний метод n=23 Удосконалений метод n=44 при таких параметрах: розмір фіксованого фрагменту 256 відЗдорові ліків амплітуди, кількість рівнів n=72 квантування амплітуди 4. Ентропійні представлення приголосної частини звукового ряду здорових (еталон) людей задовільно групу0,086 0,132 0,05 0,032 0,164 0,168 0,082 0,044 0,019  0,025 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p1<0,05 p 1>0,05 ються по прямій, що дозволяє Примітки. p1 – до величини показників здорових використати таку закономірність

41


Галицький лікарський вісник, 2013, Т. 20, № 4

за обраними критеріями 0,04, тобто запропонований метод виготовлення знімних протезів демонструє вищу адаптаційну здатність, порівняно із загальноприйнятим. Після 7ми денного терміну користування (Lp 5) повними знімними протезами виготовленими методом штампування ентропійне значення середньоквадратичного відхилення становить 0,022 при вимові звуку «С» та 0,019 при вимові звуку «Ш». Проте, на відміну від загальноприйнятого методу, виготовлення знімних протезів ці дані є недостовірними (p1>0,05). Отримані дані досліджень ентропійних показників відновлення якості вимови приголосних звуків «С», «Ш» при ортопедичному лікуванні повної відсутності зубів знімними протезами, виготовлених методом штампування, мовні адаптаційні процеси проходять швидше, ніж при лікуванні протезами, виготовленими за загальноприйнятим методом. Висновки 1. Ентропійні представлення приголосних звуків «Ш», «С» здорових людей задовільно групуються по прямій, що дозволяє використати таку закономірність в якості оцінюваного параметру ефективності відновлення мовної функції при лікуванні повними знімними пластинковими протезами. 2. Для контролю встановлення мовної функції при ортопедичному лікуванні повними знімними протезами доцільно задіяти середнє квадратичне відхилення оцінок ентропії приголосних звуків як ознаку наближеності до прямої. 3. Мінімальне та рівномірне звуження резонаторного простору ротової порожнини за рахунок мінімальної та рівномірної товщини протеза по всій площині піднебіння сприяє швидкій мовній адаптації. Перспектива подальших досліджень Перспективним є подальше вивчення ентропійних оцінок приголосних звуків при ортопедичному лікуванні повної відсутності зубів знімними пластинковими протезами. Література 1. Абрамович, А. М. Качество жизни больных с частичным и полным отсутствием зубов : автореф. дис. ... канд. мед. наук / А. М. Абрамович. - Тверь, 2005.-27 с. 2.Чикор В.П. Особливості вимовляння язикових приголосних звуків на початку користування повними знімними зубними протезами // Вісник стоматології. – 2005.- №4. – с.94-96. 3. Караман С.О., Караман О.В. Сучасна українська літературна мова: Навчальний посібник. Частина І. Синтаксис словосполучень. Синтаксис простих речень. – КМПУ ім.. Б.Д. Грінченка, 2005. – 276 с. 5. Гаврилов, Е. И. Протез и протезное ложе / Е. И. Гаврилов. М.: Медицина, 1979. - 264 с. 6. Мельничук С.І., Кулинин Н.Л. Методи і алгоритми обчислень: Навчальний посібник для студентів вищих навчальних закладів. – Івано-Франківськ: видавництво ПВНЗ «Галицька Академія», 2010. – 140с.

42

Мельничук М.В., Рожко М.М. Диагностика произношения согласных звуков у лиц с полными съемными конструкциями зубных протезов, на основе энтропии Кафедра стоматологии факультета последипломного образования (зав. каф. - проф. М.М.Рожко) Ивано-Франковского национального медицинского университета Резюме. Проведен анализ установления языковой функции при ортопедическом лечении полного отсутствия зубьев съемными пластиночными протезами изготовленными общепринятым методом и с использованием твердого базиса на клинических этапах его изготовления на основе ентропийных характеристик согласных звуков “С” и “Ш” соответствующих слагов “ИС” и “ИШ”. Установлено, что эталоном произношения (на примере 72- х лиц с сохраненными зубными рядами, без языковых нарушений) нужно считать значение среднеквадратичного отклонения оценок энтропии, которое составляет 0,04. Для проведения анализа разработан специализированное программное обеспечение WavAnalіser v1.2, что разрешает реализовать расчет оценок энтропии и операции сравнения в автоматическом режиме с дальнейшим представлением результатов в виде цифровых наборов удобных для графического представления. По результатам исследование установлено, что использование твердого базиса протеза и проведение языковой коррекции на клиническом этапе изготовления полного съемного протезу оказывает содействие более скорой языковой адаптации к протезам после их фиксации. Ключевые слова: полный съемный протез, энтропия, языковая функция. M.V. Melnychuk, M.M. Rozhko Consonants Pronunciation Diagnostics in Patients with Complete Denture Based on Entropy Department of Dentistry, FPGE (Head of the Department – Prof. M.M. Rozhko) Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine Summary. There was made an analysis of the formation of linguistic functions in orthopedic treatment of complete absence of teeth with complete denture, which was made with the help of the generally accepted methods using solid basis on the clinical stages of its production, based on entropy characteristics of consonants /s/ and /sh/ in an appropriate letter combinations ‘YS’ and ‘YSH’. It was found out that the etalon of pronunciation (at the example of 72 people with saved dental series without speech disorders) should be considered the value of standard deviation estimation of entropy, which is 0.04. For the analysis there has been developed specialized software called WavAnaliser v1.2 allowing you to realize the calculation of entropy and comparison operation in the automatic mode with the further presentation of the results in the form of digital sets suitable for graphical representing. According to the research results, it was established that the use of solid denture base and conducting the linguistic correction at the clinical stage of making the complete dentures contributes to the faster language adaptation to the dentures after fixation. Keywords: full dentures, entropy, language function. Надійшла 04.11.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК: 543.219.3+616-008.843.1+613.95

Назарук Р.М. Особливості мікрокристалізації змішаної слини в дітей, які проживають у різних регіонах Прикарпаття Кафедра стоматології факультету післядипломної освіти (зав. каф. – проф. Рожко М.М.) Івано-Франківського національного медичного університету Резюме. Стаття присвячена вивченню особливостей мікрокристалізації (МКС) та мінералізуючого потенціалу (МПС) змішаної слини у дітей, які проживають на територіях із різним вмістом важких металів (ВМ) у об’єктах довкілля. Дослідження мікрокристалізації ротової рідини проведені у 150 дітей двох вікових груп (6 та 12 років) Івано-Франківської області. Порівняльний аналіз структуроутворення в змішаній слині дітей Прикарпаття дозволив встановити особливості, залежно від території проживання. Кристалографічна картина в слині школярів із екологічно чистих регіонів характеризувалася переважанням кристалів II типу (44±7,02%). У ротовій рідині дітей, які проживали на територіях із підвищеним вмістом ВМ у об’єктах довкілля, частіше зустрічався ІІІ тип кристалоутворення (46±7,05%). МПС у школярів із регіону з підвищеним вмістом ВМ був вірогідно меншим, ніж у мешканців областного центру та екологічно чистих регіонів відповідно на 21,40% та 18,75%. У вікому аспекті виявлено зростання МПС ротової рідини у дітей з областного центру на 15,50%, з екологічно чистих регіонів – на 17,80%, з екологічно несприятливих регіонів – на 4,27%. Зміни структуроутворення супроводжувалися зниженням МПС у дітей із регіону з підвищеним вмістом ВМ у об’єктах довкілля, що сприяло порушенню гомеостазу емалі зубів та виникненню карієсогенної ситуації. Ключові слова: діти, слина, кристалоутворення, важкі метали.

Постановка проблеми і аналіз останніх досліджень. Із літературних джерел відомо [2], що однією з основних функцій змішаної слини є її мінералізуюча здатність. “Дозрівання” емалі після прорізування зуба, підтримування її оптимального складу відбувається за рахунок динамічної рівноваги мінеральних компонентів у ротовій порожнині. Для забезпечення процесів мінералізації та ремінералізації емалі зубів важливим є факт перенасичення ротової рідини іонами Са2+ та НРО2-4 (мінералізуючими компонентами). Механізмом підтримки перенасиченості іонів кальцію та гідрофосфату в змішаній слині є їх міцелярний стан, що зумовлює структурні властивості слини. На властивості ротової рідини суттєвий вплив мають внутрішні фактори, загальносоматичні хвороби дітей та несприятливі чинники довкілля [5]. Під їх дією порушуються структурні властивості змішаної слини, процеси МКС проходять неоднорідно [9]. Проведені дослідження доводять, що порушення структурних властивостей змішаної слини супроводжуються змінами її мінералізуючого потенціалу [7]. При цьому ротова рідина втрачає можливість утримувати іони кальцію та гідрофосфату в перенасиченому стані, що і призводить до її структурних змін аж до зникнення кристалічної структури ротової рідини і зниження МПС [6; 9]. Такі процеси супроводжуються виникненням карієсогенної ситуації. Антропогенне забруднення довкілля, особливо ВМ, викликає стурбованість через негативні наслідки для здоров’я населення. За умов інтенсивного і тривалого впливу несприятливих факторів довкілля на організм дітей відбувається виснаження його адаптаційних можливостей і пов’язаний з цим неухильний ріст захворювань, в тому числі і стоматологічних [4]. Дослідженнями було доведено залежність типу кристалоутворення та мінералізуючого потенціалу змішаної слини дітей від техногенного забруднення довкілля [8]. Особливості МКС доводять можливість їх використання як прогностичного тесту стійкості зубів до карієсу. Аналіз наукової літератури свідчить про активне використання з діагностичною та прогностичною метою вивчення морфологічної картини ротової рідини. Вдосконалення кристало-

графічних методів дослідження знаходиться в центрі уваги науковців України та країн СНД [3]. Мета дослідження. Вивчення морфологічних властивостей ротової рідини дітей шкільного віку, які проживали на території Івано-Франківської області з різним рівнем хімічного навантаження. Матеріал і методи дослідження У ході виконання роботи для вивчення МКС та МПС обстежено 150 дітей Івано-Франківської області, які проживали на територіях із різним ступенем хімічного навантаження. При виборі регіонів для проведення обстеження ми скористалися картами екологічного стану ґрунтів та ґрунтових вод, які були результатами науково-дослідної роботи кафедри екології ІФНТУ нафти і газу під керівництвом д.геол.-мінерал.н., проф. Адаменко О.М. Виявлено, що забруднення кадмієм та свинцем мало острівний характер. Вміст Cd в окремих овалах перевищував гранично допустиму концентрацію в 1,2 рази. Перевищення гранично допустимої концентрації в 1,5 рази по Pb приурочено до автомобільних доріг. В умовно забрудненій зоні (УЗЗ) знаходились села Горохолино, Старуня, Ластівці. В умовно чистій зоні (УЧЗ), де рівень солей ВМ у природних середовищах не перевищував середніх показників норми, були села Зелена та Бистриця. Нами досліджено структуру кристалів змішаної слини у 150 школярів 6 та 12 років. Серед школярів м.Івано-Франківська, УЧЗ та УЗЗ обрано по 50 дітей, які були розподілені по 25 осіб у кожній віковій групі. Порівняльний аналіз вираженості структурних ознак ротової рідини учнів проведено залежно від місця проживання. Кристалоутворення змішаної слини досліджували за методикою Леуса П.А. [10]. МПС визначали за допомогою методу мікрокристалізації змішаної слини за Х.М. Сайфуліною, А.Р. Поздєєвою [12]. Оцінювання МПС здійснювали за 5-ти бальною шкалою із врахуванням типу кристалоутворення в кожній краплі й обчислювали середнє значення. Забір ротової рідини проводили з дна ротової порожнини стерильною піпеткою через дві години після прийому їжі та полоскання рота дистильованою водою. Три краплі змішаної слини поміщали на предметне скло, попередньо оброблене спиртом та висушували при кімнатній температурі. Після висихання краплі слини залишається осад, який має різну мікроскопічну будову. Дослідження проводили під мікроскопом у відбитому світлі при збільшенні 2х6. Кристалографічна картина за І типом МКС характеризується наявністю крупних видовжених чітких кристалів правильної геометричної форми, які збираються у вигляді папороті по 2-5 пучків і знаходяться в центрі висохлої краплі препарату. При структуроутворенні за ІІ типом відсутні центри кристалоутворення, а препарат набуває вигляду густої сітки різних за формою та величиною кристалів, що рівномірно розташовані по всьому полі зору або можливе групування по периферії краплі. ІІІ тип МКС характеризується незначним кристалоутворенням, яке має вигляд рідкої сітки ізометрично розташованих мінеральних структур неправильної форми, можлива також повна відсутність кристалів у полі зору. Відомо, що в дітей при наявності кристалографічної картини за І типом МПС найвищий. Дещо нижчий він при домінуванні ІІ типу МКС, а при переважанні структуроутворення в змішаній слині за ІІІ типом значення МПС найнижчі. Статистичну обробку результатів клінічних досліджень здійснювали на персональних ЕОМ за допомогою пакетів стандартних програм “Statistik”.

Результати дослідження та їх обговорення Аналізуючи результати вивчення ротової рідини дітей встановлено, що в середньому по області ІІ тип МКС був виявлений у 42,67±4,04% випадків. Кристалографічна картина за І та III типом спостерігалась у обстежених школярів області в середньому відповідно в 21,33±3,34% та 36,00±3,92% випадків.

43


Галицький лікарський вісник, 2013, Т. 20, № 4

Поширен ість (%) 50 45 40 35 30 25 20 15 10 5 0 І Івано-Франківськ

ІІ

ІІІ УЧЗ

Т ип МКС УЗЗ

Рис. 1. Динаміка змін МКС у дітей залежно від території проживання

Порівняльний аналіз структуроутворення в змішаній слині учнів дозволив встановити особливості залежно від території проживання (рис. 1). Ми з’ясували, що в ротовій рідині обстежених школярів кристали ІІ типу зустрічались приблизно з однаковою частотою. Зокрема, в учнів з м.Івано-Франківська, екологічно чистих регіонів та регіону з підвищеним вмістом ВМ дана ситуація спостерігалась відповідно в: 42±6,98%, 44±7,02% та 42±6,98%. Встановлено, що в слині дітей з УЗЗ кількість кристалів III типу становила 46±7,05%, що в 1,5 рази більше, ніж у дітей із м. Івано-Франківська, і в 1,4 рази більше, ніж у школярів з УЧЗ (відповідно: 30±6,48% та 32±6,60%). Водночас у цих учнів відзначалося значне зниження частоти визначення МКС за I типом. Якщо в школярів із сіл УЗЗ кристали І типу фіксувалися в 12±4,60% випадків, то в осіб, які мешкали в місті та в населених пунктах УЧЗ, – відповідно в 2,3 та 2 рази більше, тобто в 28±6,35% та 24±6,04% випадків. МКС характеризує її мінералізуючу здатність. Відповідно до виявлених типів кристалів у змішаній слині обстежених дітей ми провели аналіз МПС. Встановлено відмінності середніх числових значень МП серед дітей залежно від території проживання. Аналіз результатів дослідження з’ясував, що в середньому даний показник у дітей міста та УЧЗ становив відповідно: 2,15±0,09, 2,08±0,09 а в дітей УЗЗ – 1,69±0,08 бала. Тобто досліджуваний параметр у жителів УЗЗ був нижчим на 21,40% (1,69±0,08 проти 2,15±0,09 балів, р<0,05) та 18,75% (1,69±0,08 проти 2,15±0,09 балів, р<0,05), ніж у мешканців міста та УЧЗ. Порівняння отриманих результатів у вікому аспекті виявило особливості МПС, залежно від території проживання. У дітей з обласного центру та УЧЗ ми зафіксували тенденцію до збільшення вказаного параметра на 15,50% (з 2,00±0,13 до 2,31±0,11 бала, р>0,05) та 17,80% (з 1,91±0,13 до 2,25±0,11 бала, р<0,05). У представників з УЗЗ даний показник з віком залишався практично без змін і відповідав у молодших та у старших учнів відповідно 1,64±0,12 балів та 1,73±0,12 балів, р>0,05 (різниця у 4,27%). Низький рівень МПС у всіх дітей сприяв порушенню гомеостазу емалі зубів та виникненню карієсогенної ситуації в ротовій порожнині. Результати проведеного клінічного обстеження засвідчили вищі показники мінералізуючої здатності ротової рідини у школярів із екологічно чистих регіонів порівняно з дітьми з регіону з підвищеним вмістом ВМ. Клінічно це відображалося в значно вищих показниках каріозного ураження

44

зубів у дітей, які мешкають на територіях із підвищеним рівнем ВМ. У середньому поширеність карієсу постійних зубів у дітей УЗЗ становила 83,63±2,46% при КПВ 4,27±0,20, що значно переважало відповідні показники у дітей м.ІваноФранківська та УЧЗ: відповідно 53,02±3,4%, 67,63±3,97% при КПВ 2,00±0,18, 2,99±0,25. Різниця між середніми значеннями показників каріозного ураження постійних зубів у дітей з УЗЗ та аналогічних індексів у школярів із міста та УЧЗ була достовірною (р<0,05). Слина є оптимальним фізіологічним мінералізуючим середником, який відіграє важливу роль у виникненні стоматологічних захворювань. Проведені дослідження доводять, що порушення структурних властивостей змішаної слини супроводжуються змінами її мінералізуючого потенціалу. Це служить одним із пускових механізмів у розвитку карієсу зубів. Порівняльний аналіз результатів дослідження виявив відповідність з даними інших авторів, які вивчали особливості МКС та МПС у дітей з урахуванням віку та екологічних умов проживання [1; 8; 11; 13]. Висновки 1. Для дітей, які мешкають в екологічно несприятливих регіонах, характерною є кристалографічна картина слини за ІІІ типом (46,00±7,05%). У дітей з обласного центру та екологічно чистих регіонів спостерігається більш сприятливе співвідношення типів мікрокристалізації – структуроутворення відбувається переважно за ІІ типом (42,00±6,98% та 44,00±7,02%). 2. У жителів УЗЗ виявлено зниження мінералізуючої здатності ротової рідини порівняно з мешканцями обласного центру та УЧЗ на 21,40% та 18,75% (відповідно 2,15±0,09 проти 1,69±0,08 бала, р<0,05 та 2,08±0,09 проти 1,69±0,08 бала, р<0,05). Перспективи подальших досліджень Подальші дослідження потрібно проводити в напрямку пошуку препаратів, які сприяють профілактиці та корекції порушень, що спричинені підвищеним вмістом ВМ у об’єктах довкілля. Література 1. Безвушко Е.В. Морфологічна картина ротової рідини у дітей при карієсі зубів з урахуванням екологічних умов проживання / Е.В. Безвушко // Новини стоматології. – 2010. – №2(63). – С.80-82. 2. Боровский Е.В. Биология полости рта. / Е.В. Боровский, В.К. Леонтьев. – М: Медицинская книга, Н.Новгород: Изд-во НГМА, 2001. – 304с. 3. Використання методу мікрокристалізації змішаної слини з діагностичною та прогностичною метою (огляд літератури) / А.В. Самойленко, О.Д. Салюк, І.В. Горб-Гаврильченко, В.Д. Каюкова / / Медичні перспективи. – 2012. – Том XVII № 3. – С. 8-12. 4. Дычко Е.Н. Сравнительная характеристика заболеваемости кариесом зубов у детей в отдельных районах промышленного мегаполиса / Е.Н. Дычко, А.В. Вербицкая, И.В. Ковач // Вісник стоматології. – 2005. – Спец. випуск № 2. – С. 146 – 147. 5. Іванчишин В.В. Морфологічна картина ротової рідини при початковому карієсі постійних зубів у дітей / В.В. Іванчишин // Український стоматологічний альманах. – 2010. – №2.– С.62-64. 6. Каськова Л.Ф. Мінералізуюча здатність ротової рідини у дітей із дисбактеріозом кишечнику / Л.Ф. Каськова, Г.О. Акжитова // Український стоматологічний альманах. – 2008. – №6 – С.47-49. 7. Колесніченко О.В. Особливості мікрокристалізації змішаної слини у дітей, народжених матерями, хворими на цукровий діабет // Вісник стоматології. – 2002. – № 4. – С. 69-73. 8. Крупник Н.М. Особливості мікрокристалізації змішаної слини у дітей регіону сірчаного виробництва / Н.М. Крупник // Вісник стоматології. – 1997. – №3. – С. 454-457. 9. Леонтьев В.К. Об особенностях минерализующей функции слюны / В.К.Леонтьев // Стоматология. – 1983. – №6. – С.5-8. 10. Леус П.А. Клинико-экспериментальное исследование патогенеза, патогенетической консервативной терапии и профилактики кариеса зубов: Автореф. дис. …д-ра мед. наук. – М., 1977. – 30 с. 11. Показники мінералізуючого потенціалу ротової рідини у дітей


Галицький лікарський вісник, 2013, Т. 20, № 4 7- і 12-річного віку / І.В. Ковач, А.В. Вербицька, Є.Н. Дичко, І.Б. Зєбзєєва // Медичні перспективи. – 2008. – 13, № 4. – С. 137-140. 12. Сайфуллина Х.М. Кариес зубов у детей и подростков. – М.: МЕДпресс, 2000. – 96 с. 13. Смоляр Н.І. Вікові особливості ротової рідини у дітей дошкільного віку / Н.І. Смоляр, І.С. Дубецька-Грабоус // Вісник стоматології. – 2011. – №3. – С.73-74. Назарук Р.М. Особенности микрокристаллизации смешанной слюны у детей, проживающих в разных регионах Прикарпатья Кафедра стоматологии факультета последипломного образования (зав.каф. –проф. Рожко Н.М.) Ивано-Франковского национального медицинского университета Резюме. Статья посвящена изучению особенностей микрокристаллизации (МКС) и минерализующего потенциала (МПС) смешанной слюны у детей, проживающих на территориях с различным содержанием тяжелых металлов (ТМ) в объектах окружающей среды. Исследование микрокристаллизации ротовой жидкости проведены в 150 детей двух возрастных групп (6 и 12 лет) Ивано-Франковской области. Сравнительный анализ структурообразования в смешанной слюне детей Прикарпатья позволил установить особенности в зависимости от территории проживания. Кристаллографическая картина в слюне школьников с экологически чистых регионов характеризовалась преобладанием кристаллов II типа (44±7,02%). В ротовой жидкости детей, проживающих на территориях с повышенным содержанием ТМ в объектах окружающей среды, чаще встречался ІІІ тип кристаллообразования (46±7,05%). МПС у школьников из региона с повышенным содержанием ТМ был достоверно меньше, чем у жителей областного центра и экологически чистых регионов соответственно на 21,40% и 18,75%. В возрастном аспекте выявлен рост МПС ротовой жидкости у детей с областного центра на 15,50%, из экологически чистых регионов - на 17,80%, из экологически неблагоприятных регионов - на 4,27%. Изменения структурообразования сопровождались снижением МПС у детей из региона с повы-

шенным содержанием ТМ в объектах окружающей среды, что способствовало нарушению гомеостаза эмали зубов и возникновению кариесогенной ситуации. Ключевые слова: дети, слюна, кристаллообразование, тяжелые металлы. R.M. Nazaruk The Peculiarities of the Microcrystallization in Mixed Saliva of Children Living in Different Regions of Prykarpattia Department of Dentistry, FPDE (Head of the Department – Prof. M.M. Rozhko) Ivano-Frankivsk National Medical University, Ivano-Frankivsk Summary. The article is dedicated to the study of the peculiarities of the mixed saliva microcrystallization (MCS) and mineralization potential (MPS) in the children living in the areas with the varying contents of heavy metals (HM) in the environmental objects. The study of the oral fluid microcrystallization was conducted involving 150 children of two age groups (6 and 12 years) of the Ivano-Frankivsk oblast. The comparative analysis of structural formation of children’s mixed saliva in Prykarpattia allowed the determining of the features depending on the area of residence. The crystallographic picture in saliva of school children from ecologically clean regions was characterized by predominance of the second type of crystals (44±7.02%). In oral fluid of the children, who lived in the areas with the high content of HM in the environmental objects, the third type of crystal formation was found more often (46±7.05%). MPS of school children from the region with the high content of HM was lower than that of the inhabitants of the oblast center and the ecologically clean regions by 21.40% and 18.75 % respectively. With regard to age, there was found MPS increase in the oral fluid of the children from the oblast centre by 15.50%, in children from the ecologically clean regions – by 17.80% and in children from the ecologically unfavorable regions – by 4.27%. Changes of the structure were accompanied by MPS decrease in children from the region with the high content of HM that led to the disturbances of the teeth enamel homeostasis and appearing of caries. Keywords: сhildren, saliva, crystal formation, heavy metals. Надійшла 25.11.2013 року.

УДК:616-08+616.379-008.64+617.735+615.322

Панько О.М Ефективність лікування хворих з діабетичною непроліферативною ретинопатією із застосуванням Окювайт лютеїну за даними фізіологічних досліджень Кафедра нейрохірургії та офтальмології (зав. каф. - проф. Потапов О.І.) ДВНЗ „Івано-Франківський національний медичний університет” Резюме. У статті представлені результати застосування Окювайт лютеїну в комплексному лікуванні хворих з непроліферативною стадією діабетичної ретинопатії. Показано, що препарат сприяє більш вираженому терапевтичному ефекту, ніж базове лікування, в тому числі в цій групі відзначено підвишення гостроти зору з 0,7 до 0,79 (на 12,8%), розширення меж сумарного поля зору на білий об’єкт з 434 до 471 (на 8,5%); на зелений об’єкт – з 38 до 46 (на 20,08%); на червоний об’єкт – з 61 до 72 (на 17,9%), а також зниження межі електричної чутливості на 12,7% та підвищення критичної частоти злиття мерехкотінь на 15,2%. Опираючись на відомі дані про безпеку і ефективність Окювайт лютеїну в якості препарату для стабілізації та покращення зорових функцій при діабетичній ретинопатії, доцільно досліджувати можливість його використання як засобу для попередження різних патологічних змін сітківки у людей віком від 40 років. Ключові слова: діабетична ретинопатія, лікування, Окювайт лютеїн, фізіологічне дослідження.

Постановка проблеми і аналіз останніх досліджень. Діабетична ретинопатія (ДР) є важким ускладненням цукрового діабету (ЦД) і в більшості випадків призводить до різкого погіршення чи втрати зору та інвалідності [9]. Існу-

ючі медикаментозні середники для лікування таких змін не завжди ефективні. Підвищення ефективності лікування хворих з діабетичною ретинопатією є тим напрямком сучасної офтальмологічної науки і практики, який спроможний суттєво вплинути на структуру інвалідності по зору серед осіб працездатного віку. Актуальність і соціальне значення цієї патології вимагає пошуку нових методів комплексного лікування з розширенням використання лікарських засобів, які впливають на патогенетичні ланки виникнення ДР [8, 15, 16]. Пріоритетним напрямком в консервативному лікуванні ДР є корекція метаболічних порушень, в першу чергу окислювального стресу, та компенсація порушень [7]. Саме тому одним з основних сучасних підходів до лікування ДР є призначення антиоксидантів, в тому числі, вітамінів А, С, Е, ліпоєвої кислоти [4, 14]. Серед каротиноїдів тільки лютеїн і зеаксантин мають здатність проникати в тканини ока і ефективно їх захищати, основними механізмами яких являється поглинаюча, екрануюча та антиоксидантна функції [3]. При ДР обмінні процеси в сітківці порушуються, що приводить до зниження концентрації пігменту

45


Галицький лікарський вісник, 2013, Т. 20, № 4

і загибелі світлочутливих клітин [12]. Препарат окювайт лютеїн представляє комбінацію незамінимих каротиноїдів (лютеїн, зеаксантин), мікроелементів (цинк, селен) і вітамінів-антиоксидантів (С і Е) для захисту сітківки. Каротиноїдні пігменти лютеїн і зеаксантин, які містяться більшою мірою в жовтій плямі, мають сильну протекторну дію, а також сприяють виведенню вільних радикалів і продуктів метаболізму з сітківки [1, 10]. Метою цієї работи було вивчення ефективності комплексного лікування хворих з ДР із застосуванням Окювайт лютеїну за даними фізіологічних досліджень. Матеріал і методи дослідження Дослідження виконано на базі відділення мікрохірургії ока та ендокринологічного відділення Івано-Франківської обласної клінічної лікарні. Для дослідження відібрали хворих з діабетичною ангіопатією та непроліферативною стадією ДР. Нами спостерігалося 73 хворих (146 очей), з них - 45 мужчин і 28 жінок. Oбстеження проводили під час лікування хворих в ендокринологічному відділенні та через 2 місяці після застосування препарату Окювайт лютеїну. Хворі були розподілені на 3 групи, беручи до уваги характер змін на сітківці та використане лікування: - I група (порівняльна) – 10 чоловік (20 очей) – пацієнти з діабетичною ангіопатією без змін на сітківці і без значного погіршення зорових функцій. - II група (основна) – 25 чоловік (50 очей) пацієнти з ДР (непроліферативною стадією), які приймали комплексне загальноприйняте лікування: адекватну інсулінотерапію, внутрішньом’язеві ін’єкції мільгами, тіатріазоліну, АТФ, еспа-ліпону, актовегіну. - III група (основна) – 28 чоловік (56 очей) пацієнти з непроліферативною ДР, в комплексне загальноприйняте лікування яких було включено препарат Окювайт лютеїн. Окювайт лютеїн фірми Bausch&Lomb (Німеччина) призначали перорально по 1 таблетці 2 рази на день протягом 2 місяців. В II і III основні групи ввійшли 53 хворих з непроліферативною ДР, при якій поряд з судинними змінами спостерігалися периферичні поодинокі точкові ексудативні вогнища (м’які та тверді), мікроаневризми та штрихоподібні і дрібноточкові крововиливи. Клінічні обстеження складалися з анамнезу захворювання та об’єктивного обстеження пацієнтів: візометрія, периметрія на білий колір та кольори (зелений та червоний), кампіметрія, пряма та зворотня офтальмоскопія, фосфен-діагностика. Візометрія проводилась за таблицями Сівцева-Головіна за стандартною методикою [2, 5]. Периметрію проводили за допомогою сферопериметра фірми “Carl Zeiss Iena”(НДР) з білою та кольоровими мітками розміром 3 мм [6]. Кампіметрію проводили за допомогою кампіметра. Стан очного дна оцінювали за допомогою зворотної та прямої офтальмоскопії. Показники фосфену – поріг електричної чутливості (ПЕЧ) та критична частота злиття мерехкотінь (КЧЗМ) визначали на електростимуляторі Фосфен КНСО1-88 [11, 13]. Статистичну обробку даних проводили з допомогою пакету статистичних програм Microsoft Excel. Достовірність відмінностей між двома порівнюваними значеннями оцінювалась за допомогою критерія t за Ст’юдентом. Різниця між сукупностями даних визнавалася достовірною при рівні статистичної значимості (р) менше за 0,05.

При ЦД відбувається звуження не тільки загальних меж поля зору на білий об’єкт, але звужуються межі полів зору на кольори (зелений та червоний), що вказує на зміни в парамакулярній ділянці. В результаті лікування сумарне поле зору розширилось більше у хворих, які отримували Окювайт лютеїн. Так, межі сумарного поля зору у хворих III групи розширились на 37 (з 434,48±5,77 до 471,48±4,07 після лікування (р<0,001). В II групі цей показник зріс з 441,64±5,67 до 457,76±5,06 (на 16) (р<0,05). В I (порівняльній) групі показник поля зору майже не змінився з часу першого огляду та через 2 місяці (481,3±5,71 до 488±6,59, р>0,05) і залишився дещо вищий від показників основних (II i III) груп (р<0,05). Визначення меж поля зору на зелений колір показало, що у групі хворих, які приймали лише традиційне лікування, приріст даного показника склав 7,58%. В III групі приріст склав 20,08%. Динаміка змін меж поля зору у пацієнтів досліджуваних груп на червоний колір в результаті лікування спостерігалась у хворих обох груп, проте у хворих, яким до базового лікування був включений Окювайт лютеїн, результат лікування був кращий. Так, у III групі приріст склав 17,93% (р<0,001), тоді як в II групі - 7,61% (р<0,05). Дане обстеження свідчить про позитивний вплив препарату Окювайт лютеїну на розширення меж сумарного поля зору на білий та кольорові об’єкти (рис.1). Результати визначення розмірів сліпої плями за даними кампіметрії у хворих всіх досліджуваних груп не виявили достовірно значимих відмінностей в цих показниках на різних термінах спостереження - вони знаходилися в межах фізіологічної норми. Отже, виходячи з вищенаведених даних, можна зробити висновок, що межі сумарного поля зору на білий об’єкт та полів зору на кольорові об’єкти (зелений та червоний) звужуються в зв’язку з розвитком патологічних змін в зоровому нерві. Проте, постійний контроль рівня глікемії, періодичне комплексне базове лікування та постійне вживання Окювайт лютеїну призводить до покращення функціонального стану органу зору, що забезпечує більш тривалий компенсаторний період у розвитку ДР. При визначенні порогу електричної чутливості по фосфену (ПЕЧФ) та критичної частоти зникнення мерехтінь по фосфену (КЧЗМФ) були отримані результати, які подані в таблицах 1 і 2. Вихідні дані порогу електричної чутливості у хворих з ангіопатією до лікування були нижчі (48,75±1,15 мкА), ніж 140

%

120 100 80 60

Результати дослідження та їх обговорення Результати спостережень за хворими з ДР у процесі лікування виявили покращення основних функцій органу зору. Підвищення гостроти зору відмічено як в групі, яка мала тільки базове лікування (0,71±0,04 до 0,74±0,04, р>0,05), так і в групі, пацієнти якої отримувала Окювайт лютеїн (з 0,7±0,03 до 0,79±0,03, р<0,05). У хворих порівняльної групи змін гостроти зору не спостерігалось (з 0,88±0,04 на момент огляду до 0,89±0,04, р>0,05 через 2 місяці). Позитивна динаміка у хворих обох клінічних груп спостерігалась не тільки у вигляді підвищення гостроти зору, але і розширення меж сумарних полів зору на білий та кольорові об’єкти.

46

40 20 0 1 група до обстеження зелений об'єкт

2 група

3 група білий об'єкт червоний об'єкт

Рис.1 Зміна меж полів зору на обєкти різного кольору у хворих різних клінічних груп (% по відношенню щодо даних до обстеження)


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1. Поріг електричної чутливості по фосфену, мкА Досліджувані групи Група НДР, НДР, компТерміни порівняння – комплексне лексне лікудослідження ангіопатія, лікування, вання+окювай n=20 n=50 т лют., n=56 Первинний 48,75±1,15 58,82±1,12 55,85±1,19 огляд Огляд через 49±1,42 56,46±0,99 48,41±0,76 2 місяці P>0,05 P>0,05 P<0,001 Примітка. Достовірність змін порогу електричної чутливості по фосфену після лікування відносно показників до лікування

в основних групах (58,82±1,12 - в II основній та 55,85±1,19 мкА - в основній III). Як видно з таблиці 1, показник ПЕЧФ у пацієнтів з ангіопатією практично не змінився (48,75±1,15 і 49±1,42 мкА). Показники покращувались у хворих обох основних груп через 2 місяці після лікування. Так, в III основній групі пацієнтів з НДР, які приймали Окювайт лютеїн, відмічалось суттєве зниження ПЕЧФ з 55,85±1,19 до 48,41±0,76 мкА (p<0,001), в той час як у основній II групі (НДР, комплексне лікування) достовірних змін ПЕЧФ не відзначалось – 58,82±1,12 і 56,46±0,99 мкА відповідно. Отримані результати свідчать про покращення стану сітківки та її провідних шляхів у результаті комплексного лікування хворих з використанням препарату Окювайт лютеїн. Визначення КЧЗМФ показало, що після проведеного лікування у пацієнтів основної III групи показник достовірно зріс на 15,24%, а у хворих оcновної II групи – на 11,11%. При цьому у пацієнтів групи порівняння показник практично не змінився, він збільшився лише на 2,7% через 2 місяці лікування. Треба зауважити, що в обидвох групах показники знаходились в межах норми. Проте, найбільш виражене зниження ПЕЧФ і підвищення КЧЗМФ відмічено у хворих основної III групи, яким до загальноприйнятого лікування було включено Окювайт лютеїн. Загалом, результати дослідження свідчать про більш значиме покращення функціонального стану органу зору у групі пацієнтів, які в комплексному лікування отримували Окювайт лютеїн. Це робить доцільним його використання з лікувальною та профілактичною метою у хворих з діабетичною ретинопатією. Отже, опираючись на все вищесказане, можна зробити висновок, що у хворих з ЦД при відсутності виражених змін на очному дні відбувається погіршення функціонального стану, а саме: дещо знижується гострота зору, концентрично звужується сумарне поле зору на білий об’єкт, досить виражено змінюється поле зору на зелений та червоний кольори, змінюються показники ПЕЧФ та КЧЗМФ. Це свідчить про ранні, невидимі при звичайному огляді, зміни в структурах очного дна, які проявляють себе не клінічно, а при проведенні функціональних методів обстеження. Навіть, якщо кожне окремо взяте обстеження не є достатньо результативним, сума всіх обстежень дає більш чітке уявлення про ранні патологічні зміни в структурах ока і провідних шляхах. Тому, пацієнти, у яких діагностовано ЦД, повинні регулярно оглядатися і комплексно обстежуватися офтальмологом для виявлення ранніх змін в структурах ока і вчасної медикаментозної корекції цих порушень. Висновки Застосування Окювайт лютеїну в комплексному лікуванні хворих з непроліферативною стадією ДР сприяє більш вираженному терапевтичному ефекту в групі хворих, які приймали додатково Окювайт лютеїн, ніж у пацієнтів, які отримували лише базове лікування, а саме: 1. підвищенню гостроти зору з 0,7 до 0,79 (на 12,8%); 2. розширенню меж сумарного поля зору на білий об’єкт з 434є до 471є (на 8,5%); на зелений об’єкт – з 38є до 46є (на 20,08%); на червоний об’єкт – з 61є до 72є (на 17,9%);

Таблиця 2. Критична частота злиття мерехкотінь по фосфену, Гц Досліджувані групи Група НДР, НДР, Терміни порівняння – комплексне лікування дослідження ангіопатія, лікування, окювайт лют, n=20 n=50 n=56 Первинний 21,17±0,47 20,88±0,34 21,85±0,34 огляд Огляд через 21,74±0,61 23,2±0,21 25,18±0,31 2 місяці P>0,05 P<0,001 P<0,001 Примітка. Достовірність змін показників критичної частоти злиття мерехкотінь по фосфену після лікування відносно показників до лікування

3. зниженню порогу електричної чутливості на 12,7% та підвищенню критичної частоти злиття мерехкотінь на 15,2% порівнянно з відповідними даними у пацієнтів, які отримували тільки загальноприйняте комплексне лікування непроліферативної стадії ДР. Перспективи подальших досліджень Опираючись на отримані дані відносно безпеки і ефективності Окювайт лютеїну в якості препарату для стабілізації і покращення зорових функцій при ДР, доцільно досліджувати можливість його використання як засіб попередження різних патологічних станів сітківки у людей віком від 40 років. Література 1. Білоус В. Й. Окювайт Компліт в лікуванні вікової макулярної дистрофії / В. Й Білоус: матеріали науково-практичної конференції офтальмологів з міжнародною участю„Філатовські читання”, присвяченої 80-річчю тканинної терапії за методом академіка В.П. Філатова.- Одеса [23-24 травня 2013].- Одеса, 2003.-С. 118-119. 2. А.А.Бочкарева, Т.И.Ерошевский, А.П.Нестеров[ и др.] /Глазные болезни / Бочкарева А.А.- 3 изд.- М.: Медицина, 1989.- 416 с. 3. Завгородняя Н.Г. Применение коротких каротиноидов для профилактики и лечения диабетической ретинопатии / Н.Г. Завгородняя, С.В. Михальчик: матеріали науково-практичної конференції офтальмологів з міжнародною участю „Філатовські читання”, присвяченої 80-річчю тканинної терапії за методом академіка В.П. Філатова.- [Одеса, 23-24 травня 2013 р].- Одеса.С. 275-276. 4. Ищенко И.А. Эффективность применения антиоксидантов в лечении диабетической ретинопатии / И.А.Ищенко Т.М.Миленькая / / Русский меди-цинский журнал.- 2007.- №3.- С. 97-100. 5. Лучик В.І. Офтальмологічні маніпуляції./ В.І. Лучик Чернівці. “Мед-академія”, 2001.- 78 с. 6. Миткох Д.И. –Методы и приборы для исследования поля зрения/ Д.И. Миткох А.Д Носкова.- М.(Медицина)1975.- 184 с. 7. Недзвецкая О. В. Эффективность длительной антиоксидантной терапии в лечении диабетической ретинопатии / О. В Недзвецкая Н.Г.: матеріали науково-практичної конференції офтальмологів з міжнародною участю„Філатовські читання”, присвяченої 80-річчю тканинної терапії за методом академіка В.П. Філатова.- [Одеса, 23-24 травня 2013 ].- Одеса,2013.-С. 277-278. 8. Нероев В.В., Опыт применения ретиналамина в лечении диабетической ретинопатии / В.В.Нероев, М.В.Рябина // Офтальмол. журн.- 2011.- №1.- С. 33-35. 9. Олейник Т.В. Течение диабетической ретинопатии у больных сахарным диабетом 11 типа, перенесших операцию по поводу катаракты / Т.В.Олейник // Офтальмол. журн.- 2009.- №4.- С. 22-26. 10. “Лютеин комплекс” в лечении дистрофии сетчатки / В.М Пеухов, Л.Г. Сеннова, А.В. Медведев [и др. ] // Офтальмология.2006.- Т.3.- №4.- C. 76-78. 11. Пономарчук В.С.Метод и устройство для дифференциальной диагностики патологических состояний сетчатки / В.С.Пономарчук, В.А.Іванов, С.Фиафер // Офтальмол. журн.- 1990.- №8.С. 451-455. 12. Саксонова Е.О. Лютеин и зеаксантин – основные компоненты антиоксидантной системы защиты глаза / Е.О.Саксонова / / Русский медицинский журнал- 2005.- Т.13,- №2.- С. 124-129. 13. Сидорова М.В. Діабетична ретинопатія: патогенез, клініка, лікування. / М.В. Сидорова К.:СМП “АВЕРС”, 2006.- 156 с.

47


Галицький лікарський вісник, 2013, Т. 20, № 4 14. Диабетическая ретинопатия. Современные направления лекарствен-ной терапии /Ю.А.Трахтенберг, А.С.Аметов, Т.Ю.Демидова [и др. ] // Офтальмология.- 2006.- Т.3,- №3.- С. 5-9. 15. Bormusov E. Diabetic cataract and antioxidants in the organ culture bovine lenses / E. Bormusov, A. Dovrat: матеріали науковопрактичної конференції офтальмологів з міжнародною участю „Філатовські читання”, присвяченої 80-річчю тканинної терапії за методом академіка В.П. Філатова.- [Одеса, 24-25 травня 2012 р.]- Одеса, 2012.-С. 217-218. 16. Dodson P.M. Diabetic retinopathy: treatment and prevention / P.M. Dodson // Diab. Vasc. Dis. Res.- 2007.- Vol.4 №3:Р.9-11. Панько О.М Эффективность лечения больных диабетической ретинопатией с использованием Окювайт лютеина по данным физиологических исследований Резюме. В статье представлены результаты применения окювайт лютеина в комплексном лечении больных з непролиферативной стадией ДР. Было показано, что препарат способствует более выраженному терапевтическому эффекту чем базовое лечение, в том числе в этой группе отмечено повышение остроты зрения с 0,7 до 0,79 (на 12,8%), расширение границ суммарного поля зрения на белый объект с 434 до 471 (на 8,5%); на зеленый объект – с 38 до 46 (на 20,08%); на красный объект – с 61 до 72 (на 17,9%), а также снижение порога электрической чувствительности на 12,7% и повышение критической частоты слияния мельканий на 15,2%. Основываясь на полученных данных относительно безопасности и эффективности окювайт лютеина в качестве препарата для стабилизации и улучшения зрительных функций

при ДР, целесообразно исследовать возможность его использования как способ предупреждения различных патологических изменений сетчатки у людей старше 40 лет. Ключевые слова: диабетическая ретинопатия, лечение, Окювайт лютеин, физиологические исследования. O.M. Panko The Treatment Efficacy of the Patients with Non-Proliferative Diabetic Retinopathy Using Оcuvite Lutein According to the Data of Physiologic Examinations Department of Neurosurgery and Ophthalmology (Head of the Department – O.I. Potapov) Ivano-Frankivsk National Medical University, Ivano-Frankivsk Summary. The article presents the results of Ocuvite Lutein use in the complex treatment of patients with non-proliferative stage of diabetic retinopathy. It was shown, that the medicine contributes to the more remarkable therapeutic effect than the basic treatment, that is, to visual acuity increase by 12.8%, to the total peripheral fields increase by 8.5% for white object, by 20.08% - for green object, by 17.9% - for red object, as well as to the decrease of electric sensitivity threshold by 12.7% and to the increase of critical flicker fusion rate by 15.2%. Basing upon the well-known safety and efficacy of Ocuvite Lutein as a medication for the stabilization and improve of visual functions at DR, it is reasonable to conduct the study of its use for the prevention from different pathologic eye processes in people over 40 y.o. age. Keywords: diabetic retinopathy, treatment, Ocuvite Lutein, physiologic examinations. Надійшла 23.09.2013 року.

УДК: 616-003.93+616.314.-089+616.314.17-008.1

Проць Г.Б., Рожко М.М., Пюрик В.П. Сучасні аспекти хірургічного лікування хворих на генералізований пародонтит Кафедра хірургічної стоматології (зав. каф. – проф. В.П.Пюрик) Івано-Франківського національного медичного університету Резюме. Робота присвячена дослідженню особливостей використання кісткового заміщуючого матеріалу, збагаченого активним остеогенним компонентом, під час проведення клаптевих операцій при лікуванні хворих на генералізований пародонтит. Подано результати остеоденситометричних досліджень та результати вивчення маркерів кісткового ремоделювання у 160 хворих, яким проводили хірургічні втручання. Встановлено, що хірургічні втручання на тканинах пародонту у 46% пацієнтів проводились на фоні зниженої щільності кісткової тканини. При плануванні хірургічного лікування у хворих на генералізований пародонтит доцільно досліджувати маркери кісткового ремоделювання для оцінки структурно-функціонального стану кісткової тканин та для диференційованого призначення остеотропних препаратів, що буде сприяти позитивному перебігу післяопераційного періоду та профілактиці ускладнень. Результати свідчать, що проведення клаптевих операцій з поєднаним використанням кісткового мозку і остеопластичного матеріалу активізує процеси регенерації кісткової тканини коміркового паростка і сполучнотканинного прикріплення, покращує результати хірургічного лікування хворих на генералізований пародонтит. Ключові слова: генералізований пародонтит, клаптева операція, маркери кісткового ремоделювання, остеотропна терапія.

Постановка проблеми і аналіз останніх досліджень. Хірургічні методи лікування є невід’ємною частиною комплексного лікування генералізованого пародонтиту середнього та важкого ступеня. Оперативне лікування запальних захворювань пародонту є найбільш ефективним методом отримання стабільних позитивних результатів [1, 6, 8]. Воно дозволяє видалити глибоко розміщені зубні відкладення і грануляції, які недоступні при проведенні терапевтичного закритого кюретажу і дозволяє створити умови для віднов-

48

лення кісткової тканини і сполучнотканинного прикріплення [8]. Успіх пародонтальної хірургії в останні роки пов’язують не тільки з усуненням пародонтальних кишень, але й з використанням середників та методів, стимулюючих регенеративні процеси тканин пародонту [1,2]. Залишається недостатньо вирішеним питання низької остеогенної активності кістковозаміщуючих матеріалів, часті післяопераційні ускладнення, недостатні функціональні та естетичні результати лікування. Однак, не дивлячись на різні модифікації, самі по собі хірургічні втручання на пародонті все ж таки не створюють достатніх умов для ліквідації патологічного процесу в кісткових структурах щелепових кісток, бо не враховується мінеральна щільність скелету та особливості метаболізму кісткової тканини у людей різного віку та статі. Зниження мінеральної щільності кісток може негативно впливати на стан тканин пародонту [8]. Для оцінки структурно-функціонального стану кісткової тканини, діагностики метаболічних остеопатій, аналізу ефективності остеотропної терапії використовують метод ультразвукової денситометрії та досліджують біохімічні маркери ремоделювання [4,5,7]. Показники біохімічних маркерів більш динамічно відображають зміни метаболізму кіскової тканини і більш швидше реагують у порівнянні з денситометрією. Тому комплексне вивчення маркерів активності резорбції і процесів кісткоутворення у хворих на генералізований пародонтит дозволить розкрити особливості мінеральної щільності коміркових щелепових кісток і, в свою чергу, дасть можливість забезпечити довготривалу стабілізацію отриманих результатів шляхом призначення остеотропних препаратів.


Галицький лікарський вісник, 2013, Т. 20, № 4

Мета дослідження - підвищення процесів регенерації при хірургічному лікуванні хворих на генералізований пародонтит шляхом використання кістковозаміщуючих матеріалів, збагачених активним остеогенним компонентом під час проведення клаптевих операцій і оцінка ролі показників маркерів кісткового ремоделювання в комплексному лікуванні даного захворювання. Матеріал і методи дослідження Під нашим спостереженням знаходились 160 хворих на генералізований пародонтит середнього і важкого ступенів, яким проводилося хірургічне лікування віком 30-55 років, з яких 87 жінки (54,38%) та 73 чоловіки (45,62%). Генералізований пародонтит середнього ступеня важкості спостерігався в 83-х пацієнтів, пародонтит важкого ступеня – 77 хворих. Клінічні обстеження включали: -опитування хворих (враховували скарги пацієнтів, тривалість захворювання, частоту виникнення абсцесів, час ремісії, наявність та характер хронічних соматичних захворювань, стресових ситуацій, раніше проведеного лікування, особливо використання антибіотиків і хірургічного втручання та його результати); -огляд і пальпацію слизової оболонки в ділянці післяопераційної рани, колір ясен. Для об’єктивної оцінки стану пародонту використовували пробу Шіллера-Пісарєва, індекс гігієни Грін-Вермільйона, індекс кровоточивості Мюлемана, індекс Рамфйорда, визначали число Свракова. Проводили рентгенологічні методи дослідження стану тканин пародонту (ортопантомограму, прицільні рентгенограми). Функціональний стан кісткової тканини оцінювали методом двофотонної рентгенівської абсорбціометрії на апараті Chelenger (ДМС –Франція). Методика базується на принципі порівняння даних про мінеральну щільність кісткової тканини даного пацієнта з побудованою моделлю, станом мінеральної щільності кісткової тканини в окремій етнічній популяції з урахуванням показників статі, віку та ваги [7]. Оцінку структурно-функціонального стану кісткової тканини проводили ще й за допомогою маркерів метаболізму кісткової тканини, які реагують швидше, порівняно з денситометрією [4, 5,10]. Одним з маркерів кісткового формування є остеокальцин, найпоширеніший білок кістки, який синтезується остеобластами та одонтобластами і є найбільш специфічним маркером остеобластичної активності. Рівень циркуляції остеокальцину відображає швидкість утворення кістки. Для кількісного визначення остеокальцину в сироватці крові застосовувався імуноферментний тест Nordic Bioscience Diagnostics A/S N-MID Osteocalcin ELISA (Данія), референтні показники для якого становили у чоловіків 9,6 – 40,8 нг/мл, для жінок в променопаузі - 8,4 – 33,9 нг/мл, для жінок в постменопаузі - 9,5 – 48,3 нг/мл. Діоксипіридинолін вивільняється із кісткового матеріалу при резорбції його остеокластами і є високочутливим та специфічним маркером резорбції. Надмірно високий рівень діоксипіридиноліну в сечі вказує на підвищену резорбцію кісткової тканини. Рівень діоксипіридиноліну в сечі визначали імуноферментним методом із застосуванням набору DPD EIA KIT (США), референтні показники складали для жінок (25-44років) 3,0 – 7,4 н/моль, для чоловіків (25-55років) - 2,3 – 5,4 н/моль. Виконано 160 клаптевих операцій, з них на верхній щелепі – 86, на нижній -74. При плануванні оперативних втручань всі хворі були розділені на 3 групи: 1 група – 52 хворих, яким проводились клаптеві операції за традиційною методикою Відман-Нейман-Цішинським у модифікації В.І.Лук’яненко (1977); 2 група- 53 хворих, проведення клаптевих операцій за ВідманНейман-Цішинським у модифікації В.І Лук’яненко (1977) було поєднано з використанням остеогенного препарату “Фізіографт” з метою стимуляції кісткоутворення, який вводили в кісткові кишені та на гребінь альвеолярного паростка. Особливістю матеріалу є його ремоделююча активність, тобто здатність брати участь у формуванні губчастої та компактної кісток [2]; 3 група - 55 хворих, яким використовувалася нами запропонована методика клаптевої операції з використанням остеогенного матеріалу “Фізіографт” і кісткового мозку. Червоний кістковий мозок людини містить популяцію стовбурових клітин, які мають великий потенціал росту і проліферацію, виражену здатність до диференціювання і мають імунорегуляторну і гемопоетичну дію. Функціонально вони є активними клітинами за продукцією факторів росту і регенерації. Доведено, що при внутрішньокістковій

інфузії клітин кісткового мозку швидше відновлюється і зберігається нормальний донорський гемопоез, краще приживляється трансплантат [3]. Перед проведенням хірургічного лікування всім пацієнтам усували місцеві фактори, які сприяли накопиченню і активації дії мікробного фактору, шинували рухомі зуби, проводили функціональне вибіркове пришліфовування, кюретаж пародонтальних кишень, корекцію м’яких тканин рота, диференційовано призначали остеотропну терапію, враховуючи результати досліджень маркерів кісткового ремоделювання. У результаті проведених досліджень нами запропонована і розроблена методика хірургічного лікування генералізованого пародонтиту шляхом використання кістковозаміщуючого матеріалу, збагаченого активним остеогенним компонентом. Першим етапом операції було проведення трапецієподібного розрізу в ділянці уражених зубів, висічення внутрішньої вистилки зубоясенної кишені, зберігаючи архітектоніку ясенного краю. Розрізи проводили під кутом, близьким до 30°. Тоді робили горизонтальний розріз періосту, відсепаровували слизово-окістний клапоть, обробляли цемент коренів зубів від грануляційної тканини та зубних відкладень. У кісткові кишені накладали остеогенний матеріал “Фізіографт”, а на гребінь коміркового паростка накладали суміш аутологічного кісткового мозку і колагенової губки у співвідношенні 1:1 вагових частин [8] , після чого слизово-окістний клапоть укладали на місце, піднімаючи або опускаючи новостворений ясенний край до рівня анатомічних шийок зубів. Клапоть фіксували швами у кожному міжзубному проміжку. Забір кісткового мозку проводили спеціальним пристроєм [9]. У післяопераційному періоді всім пацієнтам призначали протизапальну, дезінтоксикаційну, знеболюючу терапію. Клінічні дослідження проводили в динаміці до і після хірургічного втручання через 1, 6 і 12 місяців. Рентгенологічний параметр оцінювали до лікування і через 12, 18 місяців.

Результати дослідження та їх обговорення За даними ультразвукової денситометрії виділили групи хворих: з остеопорозом, остеопенією, осіб з нормальним станом кісткової тканини та підвищеними показниками щільності кісткової тканини - остеосклерозом. При обстеженні хворих І групи, середній вік яких складав 45,9 ± 2,3 роки, зменшення щільності кісткової тканини було виявлено у 23 хворих – остеопороз - у 4 ( 8% обстежених) , остеопенію – у 19 (36%) хворих. Нормальну кісткову тканину, за даними ультразвукової денситометрії, констатовано у 27 хворих (52%), а у 2 (4%) обстежених було виявлено остеосклеротичну кісткову тканину. Таким чином, у 44% хворих патологічні процеси в тканинах пародонту пов’язані із низькою щільністю кісткової тканини. У 56% хворих перебіг захворювань пародонту відбувався на тлі нормальних та підвищених показників щільності кісткової тканини. При вивченні метаболізму кісткової тканини у хворих з нормальною щільністю кісткової тканини спостерігали незначне пригнічення процесів кісткоутворення (20,68±2,54 нг/мл) та вірогідне збільшення показників резорбції кістки (9,42±1,13н/моль). У хворих з остеопенією відзначали утворення кісткової тканини в межах норми (22,76±1,15нг/мл) та вірогідне підвищення розсмоктування кістки (10,82±1,34 н/моль), а у хворих з остеопорозом – пригнічення процесів кісткоутворення (18,05 ±2,08/мл) та збільшення показників резорбції (15,34±1,87н/моль), (табл. 1). При обстеженні хворих ІІ групи, середній вік яких становив 45,9±3,4 років, у 26 (49%) обстежених виявлено нормальні показники щільності кісткової тканини та у 3 (6%) остеосклеротичну кісткову тканину. Зменшення щільності кісткової тканини – остеопенію у 20 хворих (38%) та остеопороз – у 4-х обстежених (7%). Результати досліджень свідчать, що у хворих ІІ групи патологічні процеси в тканинах пародонту розвиваються в 55% випадків на тлі нормальної та остеосклеротичної кісткової тканини, та у 45% хворих патологічні процеси в тканинах пародонту пов’язані з низькою щільністю кісткової тканини. Дослідження метаболізму кісткової тканини у хворих ІІ групи виявили пригнічення процесів утворення кісткової тканини у хворих з остео-

49


Галицький лікарський вісник, 2013, Т. 20, № 4

яких спрямована на відновлення втраченої кісткової маси і кісткові антирезорбенти, здатні сповільнити її втрату. Хворим, в яких були сповільнені процеси кісткоутворення призначали препарати, які стимулюють новоутворення кістки – остеогенон по 1 табл. 2р. на день, тривалість лікування - 3 місяці. А хворим, в яких підвищено розостеокальцин нг/мл 20,68±2,54 22,76± 1,15 18,05±2,08* 25,19±2,15 смоктування кісткової тканини, призначали антидіоксипіридиноліну 9,42±1,13 10,820±1,34 15,34±1,87* 7,96±1,64 резорбенти – Кальцій – Д3 – Нікомед по 1 табл. н/моль 2р. на день, 3 місяці. Примітки: * - достовірність відмінності у порівнянні із результатами у здоПорівняльний аналіз показав, що протікання рових осіб (Р<0,05);  - достовірність відмінностей між групами спостереження (Р<0,05) післяопераційного періоду за даними клінічного (гіперемія, набряк, біль при пальпації слизової пенією і остеопорозом, рівень остеокальцину становив оболонки в ділянці післяопераційної рани, колір ясен) і 22,67± 1,83 нг/мл; 18,21 ±1,32нг/мл і збільшення показника рентгенологічного контролю в групах хворих значно відрезорбції кісткової тканини (рівень діоксипіридиноліну - різнявся. У результаті проведеного лікування позитивний 12,87±1,41н/моль; 16,54±1,23н/моль) . У хворих, у яких клінічний ефект був отриманий у всіх хворих на генеращільність кісткової тканини відповідає нормі, показник лізований пародонтит. остеокальцину свідчить про високі темпи кісткоутворення У пацієнтів І групи ліквідація запального процесу в (25,12±2,23нг/мл), а підвищення показника маркера ре- навколозубних тканинах після проведеного лікування спозорбції обумовлює високі темпи розсмоктування кісткової стерігалась у 87,2% хворих, в II групі - у 91,6% пацієнтів, а тканини (8,54±1,23н/моль). У хворих з остеоскелеротичною в ІІІ групі - у 94,8% осіб. щільністю кісткової тканини не виявлено суттєвих коливань Найбільш ефективним було хірургічне втручання у паостеокальцину (24,56±2,45нг/мл), утворення кісткової цієнтів ІІІ групи. На 5-6 день у цих хворих не спостерігалися тканини в межах норми. Процеси розсмоктування кісткової ознаки запалення. Помірний колатеральний набряк в більтканини збільшені, про що свідчать показники діоксипіри- шості пацієнтів зникав на 4 добу. Слизовий клапоть з перших диноліну (9,21±1,42н/моль), порівняно з хворими з нормальними показниками щільності кісткової Таблиця 2. Аналіз основних показників метаболізму кісткової тканини тканини (8,54±1,23 н/моль), (табл.2). у хворих ІІ групи При обстеженні хворих ІІІ групи, середній вік Хворі з різним стуЩільність Щільність Щільність Щільність яких становив 46,8±4,5 років у 26 хворих (47%) пенем щільКТ КТ КТ відпоКТ відпоності КТ відповідає відповідає відає остео- відає остеовиявлено нормальні показники щільності кісткової показники нормі остеопенії склерозу тканини та у 2 (4%) остосклеротичну кісткову порозу (n=4) метаболізму (n=26) (n=20) (n=3) тканину. Зменшення щільності кісткової тканини остеокальцин нг/мл 25,12±2,23 22,67±1,83 18,21±1,32* 24,56±2,45 остеопенію у 22 хворих (40%) та остеопорозу у 5 діоксипіридиноліну 8,54±1,23 12,87±1,41 16,54±1,23* 9,21±1,42 обстежених(9%). н/моль Результати досліджень свідчать, що у хворих Примітки: * - достовірність відмінності у порівнянні із результатами у здоІІІ групи патологічні процеси в тканинах паро- рових осіб (Р<0,05);  - достовірність відмінностей між групами спостедонту розвивались у 49% випадків з низькою щіль- реження (Р<0,05) ністю кісткової тканини. Метаболізм кісткової тканини в обстежених ІІІ групи з остеосклеротичною щільністю кісткової тканини характеризується приско- днів після операції був розовий або блідо-розовий. Рана зареними процесами розсмоктування кісткової тканини гоювалася первинним натягом. Біль при пальпації слизової (7,62±1,94н/моль), у той же час процеси утворення кісткової оболонки в ділянці післяопераційної рани не спостерігався. тканини в межах норми (23,34±2,34 нг/мл). У пацієнтів з Рухомість зубів, що виникла після операції, зникала на 5-6 нормальною щільністю кісткової тканини спостерігали не- тиждень. Через 1 місяць після операцій у хворих не спостезначне пригнічення процесів кісткоутворення (22,68±2,45 рігалось запальних явищ, ясенний край щільно охоплював нг/мл) та збільшення показників резорбції кістки (9,42±1,42 шийки зубів, глибина пародонтальних кишень зменшувалась н/моль), а у хворих з остепеопенією та остеопорозом пригні- за рахунок післяопераційного рубцювання слизового клаптя чено утворення кісткової тканини (21,76±2,06 нг/мл; і регенерації кісток тканин. 17,22±1,32 нг/мл ) та вірогідно підвищене розсмоктування Відсутність запалення в ясенних тканинах, різке зниженкісткової тканини (10,82±1,21 н/моль; 15,34±1,54 н/моль), ня його відображалось позитивною динамікою основних (Табл.3). пародонтальних індексів. Таким чином, отримані результати дослідження маркерів В І та II групах пацієнтів нами також спостерігалася порезорбції і формування кісткової тканини дозволили ціле- зитивна динаміка клінічних змін, однак термін регресії клінаправлено призначати хворим з порушенням мінеральної нічних ознак запалення запізнювався в середньому на 2-3 щільності кісткової тканини кісткоутворюючі середники, дія дні. У результаті проведеного лікування у хворих спостерігалася менш виражена динаміка показників пародонтальних проб та індексів порівняно з пацієнтами Таблиця 3. Аналіз основних показників метаболізму кісткової ІІІ групи. Одним із основних показників ефективтканини у хворих ІІІ групи ності хірургічного лікування генералізованого пароХворі з різним стуЩільність Щільність Щільність Щільність донтиту вважають віддалені результати після пропенем щільКТ КТ КТ відпоКТ відповеденого лікування. Через 12-18 місяців після провеності КТ відповідає відповідає відає остео- відає остеопоказники нормі остеопенії порозу склерозу деного лікування клініко-рентгенологічна стабіліметаболізму (n=26) (n=22) (n=5) (n=2) зація наступила у 83,4% хворих ІІІ групи, 80,2% осіб остеокальцин нг/мл 22,68±2,45 21,76±2,06 17,22±1,32 23,34±2,34 II групи, 76,5% обстежених І групи. діоксипіридиноліну 9,42±1,42 10,82±1,21 15,34±1,54 7,62±1,94 Через 12-18 місяців після проведеного лікування н/моль у пацієнтів ІІ, ІІІ групи відзначена позитивна динаПримітки: * - достовірність відмінності у порівнянні із результатами у міка основних пародонтальних індексів і проб. У здорових осіб (Р<0,05);  - достовірність відмінностей між групами спопацієнтів І групи виявлена менша ступінь нормалістереження (Р<0,05) Таблиця 1. Аналіз основних показників метаболізму кісткової тканини у хворих І групи Хворі з різним стуЩільність Щільність Щільність Щільність пенем щільКТ відпоКТ відпоКТ відпоКТ відповіності КТ відає остеовідає нормі відає остео- дає остеомопоказники склерозу (n=27) пенії (n=19) розу (n=4) метаболізму (n=2)

50


Галицький лікарський вісник, 2013, Т. 20, № 4

зації пародонтологічних показників. Таким чином, аналізуючи проведені нами дослідження можна стверджувати, що розроблена нами методика хірургічного лікування хворих на генералізований пародонтит шляхом використання кістковозаміщуючого матеріалу і кісткового мозку та диференційованого призначення остеотропного матеріалу дозволяє акивізувати процеси регенерації кісткової тканини коміркового паростку і сполучнотканинного прикріплення, покращує анатомо-функціональні результати хворих на генералізований пародонтит. Висновки 1. Результати дослідження свідчать, що хірургічні втручання на тканинах пародонту у 46% хворих проводились на фоні зниженої щільності кісткової тканини, що потребує корекції структурно-функціональних порушень. 2. При плануванні хірургічного лікування у хворих на генералізований пародонтит доцільне визначення маркерів кісткового ремоделювання для оцінки структурно-функціонального стану кісткової тканини і для диференційованого призначення остеотропних препаратів. 3. Проведення клаптевих операцій з поєднаним використанням кісткового мозку і остеопластичного матеріалу активізує процеси регенерації кісткової тканини коміркового паростку і сполучнотканинного прикріплення, що сприяє позитивному протіканню післяопераційного періоду, профілактиці післяопераційних ускладнень. Перспективи подальших досліджень У подальшому планується ряд досліджень у хворих на генералізоваиий пародонтит після проведення хірургічного втручання та призначення остеотропних препаратів. Література 1. Гажва С.И. Хирургические методы лечения заболеваний пародонта / С.И.Гажва. – Нижний Новгород.- 2003р. – 108с. 2. Грудянов А.И. Клиническая оценка остеопластических препаратов в хирургической пародонтологии /А.И.Грудянов, А.И.Ерохин, С.П.Новоселов // Наука-практика: матер. научн. сесии ЦНИС посвящ. 35-летию института. - М. -1998. - С. 118-221. 3. Куцевляк В.І. Віддалені результати застосування автологічних стовбурових клітин в імплантології і пародонтології / В.І.Куцевляк, В.Ф. Куцевляк // Імплантологія, пародонтологія, остеологія. -2009. -№3. –с.54-56. 4. Мащенко И.С. Оценка остеопоротического процесса в альвеолярной кости / И.С.Мащенко // Вісник стоматології. -2002. -№2. –С.20-24. 5. Нейко Є.М. Клінічні, інструментальні і лабораторні методи діагностики остеопорозу / Є.М.Нейко, І.Ю.Головач, З.М.Митник // Навчальний посібник. -2001. –53с. 6. Поворознюк В.В. Костная система и заболевания пародонта / В.В.Поворознюк, І.П.Мазур. – Киев. -2003. –446 с. 7. Проць Г.Б. Використання остеоденситометрії для оцінки структурно-функціонального стану кісткової тканини скелету у хворих на генералізований пародонтит /Г.Б.Проць // Український морфологічний альманах. -2007. -№4. –С.113-114. 8. Пюрик В.П. Нові підходи до хірургічного лікування хворих на генералізований пародонтит /В.П. Пюрик, Г.Б. Проць, Н.П. Махлинець // Всеукраїнська науково-методична конференція з міжнародною участю “Досягнення стоматології та їх впровадження в учбовий процесс.” - 31 жовтня Харьків. -2008. - С.60-61.

9. Патент №34117 UA МПК (2006) А61 В17/34. Пристрій для забору кісткового мозку //В.П. Пюрик, Н.П.Махлинець, Я.В.Пюрик. -2006. -Бюл. №14. - 4с. 10. Bettsca F. MoroI. Biochemical marcers of the metabolism in the assessment of osteoporosis // JFCC 1995 – V.T. issues 1/ - P. 16-22. Проць Г.Б., Рожко М.М., Пюрик В.П. Современные аспекты хирургического лечения больных генерализированным пародонтитом Резюме. Робота посвящается исследованию особенностей использования костного заместительного материала, обогащённого активным остеогенным компонентом во время проведения лоскутных операций при лечении генерализированного пародонтита. Приведены результаты остеоденситометрических исследований и результаты исследования маркеров костного ремоделирования у 160 больных, которым проводилось хирургическое вмешательство. Установлено, что хирургическое вмешательство на тканях пародонта у 46% пациентов проводилось на фоне низкой плотности костной ткани. При планировании хирургического лечения у больных генерализированным пародонтитом целесообразно проведение исследования маркеров костного ремоделирования для оценки структурно-функционального состояния костной ткани и для дифференцированного назначения остеотропных препаратов, что способствует положительному протеканию послеоперационного периода и профилактике послеоперационных осложнений. Результаты свидетельствуют, что проведение лоскутных операций с совместным использованием костного мозга и остеопластического материала активизирует процесс регенерации костной ткани альвеолярного отростка и соединительнотканевого прикрепления, улучшает анатомо-функциональные результаты больных генерализированным пародонтитом. Ключевые слова: генерализированный пародонтит, лоскутная операция, маркеры костного ремоделирования, костный метаболизм, остеотропная терапия. H.B. Prots, M.M. Rozhko, V.P. Piuryk Modern Aspects of Surgical Treatment of the Patients Suffering from Generalized Periodontitis Department of Dental Surgery (Head of the Department – Prof. V. P. Piuryk) Ivano-Frankivsk National Medical University, Ivano-Frankivsk Summary. The research focuses on investigating the peculiarities of applying bone replacement material enriched with an active osteogenic component while performing flap surgeries on the patients suffering from generalized periodontitis. There have been presented the results of the osteodensitometry as well as the research outcomes of bone remodeling markers in 160 patients having undergone surgeries. It has been discovered that in 46% of the patients surgical interventions on periodontium tissues were performed on the background of low bone tissue density. Considering surgical treatment of the patients with generalized periodontitis it is reasonable to investigate bone remodeling markers in order to evaluate the structural and functional state of the osseous tissue and to differentially prescribe the osteotrophic drug that will contribute to favourable course of postoperative period and prevention of complications. The results indicate that performing flap surgeries with the combined use of bone marrow and osteoplastic material activates the regeneration processes in the osseous tissue of the alveolar process as well as connective tissue attachment and improves the results of the surgical treatment of the patients suffering from generalized periodontitis. Keywords: generalized periodontitis, flap surgery, bone remodeling markers, osteotrophic therapy. Надійшла 03.06.2013 року.

51


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК: 616.31+616.97+615.465

Рожко М.М., Кінаш І.О. Індексна оцінка стоматологічного статусу пацієнтів, яким виготовляли суцільнолиті куксові вкладки Кафедра стоматології факультету післядипломної освіти (зав. каф. - проф. М.М.Рожко) ДВНЗ “Івано-Франківський національний медичний університет” Резюме. У статті подаються результати дослідження першого етапу ортопедичних заходів, які передбачали підготовку ясенного краю до виготовлення суцільнолитих куксових вкладок під ортопедичні конструкції. Проведення індексної оцінки 142 пацієнтів (з них 30 практично здорових осіб, 112 – основна група, яка потребувала санаційних заходів) включало визначення гігієнічних індексів Федорова-Володкіної та Грін-Вермільона (OHI-S), а також визначали індекси та проби, які визначають стан запалення у тканинах пародонту: пробу Шиллєра-Пісарєва, число Свракова, індекс гінгівіту Сілнесс-Лое, пародонтальний індекс Рассела (PI Russel), індекс Рамфьорда. До уваги також брали індекс КПВ (каріозні, пломбовані, видалені). На основі проведення основних найбільш інформативних гігієнічних та пародонтологічних індексів та проб у пацієнтів, яким необхідно було відновлювати опорні зуби під ортопедичні конструкції суцільнолитими куксовими вкладками, було зроблено висновки про найбільш ефективний та оптимальний спосіб корекції ясенного краю зубів із глибокими під’ясенними дефектами твердих тканин, які підлягали виготовленню суцільнолитих куксових вкладок. Встановлено, що підготовка ясенного краю зубів, які підлягають виготовленню куксових вкладок, діодним лазером, дозволяє досягнути кращих результатів із більшим ступенем вірогідності. Ключові слова: індексна оцінка, стоматологічний статус, суцільнолиті куксові вкладки.

Постановка проблеми і аналіз останніх досліджень. Надмірне захоплення лікарями-стоматологами та пацієнтами композитними реставраціями не завжди якісне ендодонтичне лікування призвело до того, що у разі виготовлення постійної ортопедичної конструкції є потреба у відновленні кукси зуба суцільнолитою куксовою вкладкою. Часто відлом коронкової частини зуба супроводжується пенетрацією під ясна. Проте, під’ясенне руйнування кореня зуба до 1 мм не є протипоказом виготовлення суцільнолитих куксових вкладок [1]. Зволікання із візитом до лікаря-стоматолога призводить до того, що в зоні зруйнованого зуба спотворюється гармонійна лінія крайових ясен за рахунок гіпертрофічного розростання крайового епітелію та некротизованих грануляційних тканин [2]. Це унеможливлює зняття повноцінного відбитка та виготовлення ортопедичної конструкції – одиничної коронки чи мостоподібного протеза. Існує декілька способів корекції крайових ясен навколо зуба [3]. Об’єктивно оцінити ефективність корекції ясенного краю можна за допомогою математичного аналізу проведених гігієнічних та пар одонтологічних індексів та проб. Індексна оцінка є об’єктивним та актуальним критерієм порівняння та ефективності показників, які є нормою, та отриманих до і після лікування. Це дає змогу за клінічними показниками запропонувати оптимальний та ефективний спосіб лікування. Матеріал і методи дослідження Індексна оцінка стоматологічного статусу пацієнтів була проведена всім пацієнтам, які були включені в наше дослідження. Всього було обстежено 142 пацієнти, з яких 30 були включені у групу контролю «здорові», стоматологічне та соматичне здоров’я яких відповідали критеріям ВООЗ, решта 112 осіб склали основну групу дослідження. Основна група дослідження, пацієнтам якої було необхідно виготовити суцільнолиті куксові вкладки, була поділена на три групи. Першій групі, в якій було 29 чоловік, проводилась корекція ясенного краю хірургічним скальпелем в умовах хірургічного стоматологічного кабінету. Другій групі, в які було 28 чоловік, корекція ясенного краю проводилась електрокоагуляцією в умовах стоматологічного кабінету. Третій групі, яка склала 55 осіб, була здійснена корекція ясенного краю діодним лазером «Ліка-хірург» для м’яких тканин. Всім пацієнтів, які були включені в дослідження, було проведене об’єктивне обстеження та визначен-

52

ня клінічних індексів на час звернення. Групу контролю викликали одноразово. В основній групі дослідження після проведеного обстеження визначали комплекс необхідних лікувальних заходів, який передбачав екстракцію зубів із безнадійним прогнозом, ендодонтичне лікування та пломбування зубів, заміну застарілих пломб, професійну гігієну та навчання і контроль індивідуальної гігієни, тобто корекцію тих параметрів, які можуть впливати на показники індексної оцінки. Отже, включення у дослідження 112 пацієнтів основної групи передбачало весь об’єм загальноприйнятих діагностичних заходів, встановлення діагнозу, проведення комплексу хірургічних, терапевтичних, ортопедичних заходів. Ортопедичні заходи передбачали підготовку ясенного краю до виготовлення суцільнолитих куксових вкладок, власне виготовлення суцільнолитих куксових вкладок та зняття робочих відбитків під ортопедичні конструкції. Власне, ми сконцентрувалися на дослідженні першого етапу ортопедичних заходів, які передбачали підготовку ясенного краю до виготовлення суцільнолитих куксових вкладок. Проведення індексної оцінки включало визначення гігієнічних індексів Федорова-Володкіної та Грін-Вермільона (OHI-S), а також визначали індекси та проби, які визначають стан запалення у тканинах пародонту: пробу Шиллєра-Писарєва, число Свракова, індекс гінгівіту Сілнесс-Лое, пародонтальний індекс Рассела (PI Russel), індекс Рамфьорда. А також брали до уваги індекс КПВ (каріозні, пломбовані, видалені). Математичні показники отримували в балах, згідно з рекомендованими методиками [4, 5]. Статистичну обробку здійснювали за допомогою програми «Statistica». Результати вважали статистично значущими при р<0,05 та р<0,001.

Результати дослідження та їх обговорення За допомогою індексу гігієни Федорова-Володкіної (ІГФВ) визначали площу зубного нальоту шляхом зафарбування шести нижніх фронтальних зубів. За критеріями оцінки в контрольній групі ІГФВ оцінювали як добрий – 1,51±0,07 бала. В І групі основної групи ІГФВ склав 2,31±0,16 бала, у ІІ групі 2,29±0,15 бала та в ІІІ групі – 2,32±0,11 бала. У ІІ групі ІГФВ наближався до задовільного, а у І та ІІІ групі був незадовільним. Після проведеного лікування у всіх досліджуваних групах ІГФВ став задовільним: у І групі – 1,88±0,04 бала, у ІІ групі – 1,76±0,06 бала, у ІІІ групі – 1,72±0,04 бала (зміни були достовірні порівняно із групою контролю та значеннями ІГФВ до лікування – р1<0,001, р2<0,001 відповідно). Тут і далі р1 – достовірність відмінності від групи контролю, р2 – достовірність відмінності від показника до лікування (табл. 1). У разі визначення індексу Грін-Вермільона (ІГВ) на досліджуваних поверхнях зубів визначали зубний наліт (Debrax-Index) та зубний камінь (Calculus-index). Хороша гігієна ротової порожнини була у групі контролю (0,59±0,02 бала). ІГВ у пацієнтів, які потребували ортопедичного лікування, склав у І групі 0,72±0,06 бала (р1>0,05), у ІІ групі – 0,81±0,02 бала (р1<0,001) та у ІІІ групі – 0,79±0,02 бала (р1<0,001). Після проведеного лікування ІГВ набув значень, які відповідають хорошій гігієні: у І групі – 0,58±0,04 бала, у ІІ групі 0,61±0,03, у ІІІ групі 0,62±0,06 балів (для всіх р2>0,05). Активність запального процесу ясен, інтенсивність якого характеризує проба Шиллєра-Писарєва, було значним у всіх групах хворих і достовірно відрізнялось від показника контрольної групи (1,00±0,09 бала). У І групі показник знижувався і набував значень із 3,83±0,07 бала до 1,81±0,04 балів, і це зниження було достовірним порівняно з показником до лікування – р1<0,001, р2<0,05). У ІІ групі дослідження числове значення ПШП була до лікування 3,89±0,04 балів, а після лікування – 1,72±0,02 (р1<0,001, р2<0,05), у ІІІ групі відповідно 4,01±0,02 балів до лікування і 1,54±0,08 після лікування


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1. Динаміка клінічних показників у досліджуваних групах під впливом лікування Контрольна Основна група до лікування Основна група після лікування Показники група І ІІ ІІІ І ІІ ІІІ n=30 n=29 n=28 n=55 n=29 n=28 n=55 Індекс гігієни Федорова1,51±0,07 2,31±0,16 2,29±0,15 2,32±0,11 1,88±0,04 1,76±0,06 1,72±0,04 Володкіної, бали р1>0,05 р1>0,05 р1<0,001 р1<0,001 р1<0,001 р1<0,001 р2<0,001 р2<0,001 р2<0,001 Індекс Грін-Вермільона, 0,59±0,02 0,72±0,06 0,81±0,02 0,79±0,02 0,58±0,04 0,61±0,03 0,62±0,06 бали р1>0,05 р1<0,001 р1<0,001 р1<0,001 р1<0,001 р1<0,001 р2>0,05 р2>0,05 р2>0,05 Проба Шиллєра1,00±0,09 3,83±0,07 3,89±0,04 4,01±0,02 1,81±0,04 1,72±0,02 1,54±0,08 Писарєва, бали р1>0,05 р1>0,05 р1<0,001 р1<0,001 р1<0,001 р1<0,05 р2<0,05 р2<0,05 р2<0,05 Число Свракова 0,04±0,01 1,54±0,09 1,72±0,03 1,76±0,07 0,15±0,03 0,18±0,01 0,18±0,02 р1<0,05 р1<0,05 р1<0,001 р1>0,05 р1<0,001 р1<0,001 р2>0,05 р2<0,001 р2<0,001 Індекс гінгівіту Сілнесс0,11±0,01 2,81±0,04 2,83±0,03 2,91±0,04 1,02±0,01 1,18±0,02 0,99±0,01 Лое, бали р1<0,05 р1<0,001 р1<0,05 р1<0,05 р1<0,05 р1<0,001 р2<0,001 р2<0,001 р2>0,05 Пародонтальний індекс 0,71±0,03 1,45±0,06 1,49±0,05 1,47±0,07 0,86±0,09 0,69±0,02 0,61±0,02 Рассела, бала р1>0,05 р1>0,05 р1>0,05 р1>0,05 р1<0,05 р1<0,05 р2>0,05 р2<0,05 р2<0,001 Індекс Рамфьорда, бали 1,03±0,01 3,04±0,06 2,97±0,03 3,11±0,01 1,98±0,07 2,01±0,03 1,99±0,02 р1>0,05 р1>0,05 р1<0,001 р1<0,001 р1<0,001 р1<0,001 р2<0,05 р2<0,001 р2<0,001 КПВ, бали 5,15±0,35 9,94±0,09 10,11±0,07 11,31±0,09 12,01±0,04 12,03±0,03 11,04±0,06 р1<0,05 р1<0,05 р1<0,05 р1<0,05 р1<0,05 р1<0,001 р2<0,05 р2<0,001 р2<0,001 Примітка: Вірогідність відмінностей: р1 – відновно величини групи контролю; р2 – відновно величини до лікування

(р1<0,001, р2<0,05). Число Свракова (ЧС) та індекс гінгівіту Сілнесс-Лоу (ІГСЛ) були в межах норми у групі контролю: відповідно ЧС 0,04±0,01 та ІГСЛ 0,11±0,01 балів, що свідчило про відсутність запалення. У обстежених хворих ці показники вказували на запалення, яке проявлялось гіперемією, набряком, гіпертрофією в усіх групах дослідження. Зокрема, у І групі до лікування ЧС склало 1,54±0,09, ІГСЛ 2,81±0,04 балів (р1<0,05) та після лікування – ЧС 0,15±0,03 (р1>0,05, р2>0,05), ІГСЛ 1,02±0,01 балів (р1<0,05 р2<0,001). У ІІ групі до лікування ЧС дорівнювало 1,72±0,03 (р 1<0,05), ІГ 2,83±0,03 (р1<0,001), а після лікування – ЧС 0,18±0,01 (р1<0,001, р2<0,001), ІГ 1,18±0,02 балів (р1<0,05, р2<0,001). У хворих ІІІ групи ЧС було 1,76±0,07, ІГ 2,91±0,04 бала (для обох р1<0,05) до лікування, та після лікування ЧС 0,18±0,02 (р1<0,001, р2<0,001), ІГ 0,99±0,01 балів (р1<0,001, р2>0,05). Таким чином, після лікування спостерігалося зниження обох індексів – ЧС та ІГСЛ, проте найбільш значним воно було в ІІІ групі. Оцінка в балах вираженості запально-деструктивних змін у пародонті за допомогою пародонтального індексу Рассела (ПІ) показала значення 0,71±0,03 бала у групі контролю, 1,45±0,06 бала (р1>0,05) у І групі дослідження до лікування, 1,49±0,05 бала (р>0,05) у ІІ групі дослідження, 1,47±0,07 бала (р1>0,05) у ІІІ групі дослідження, що інтерпретувалось як початкова стадія пародонтиту. Після лікування у ІІ та ІІІ групах дослідження були отримані показники із вірогідною різницею: 0,69±0,02 (р1<0,05, р2<0,05) та 0,61±0,02 (р1<0,05, р2<0,001) відповідно. У І групі показник знижувався недостовірно: 0,86±0,09 (р1>0,05, р2>0,05). Проте у всіх групах, незважаючи на проведене лікування, пародонтальний індекс залишався в межах показника, який відповідає початковій стадії пародонтиту. Індекс Рамфьорда, який оцінює в балах два показники – запалення ясен різного ступеня та глибину патологічних зубо-ясенних кишень, у групі контролю становив 1,03±0,01 бала, в той же час у групах дослідження він склав 3,04±0,06 бала (р1>0,05), 2,97±0,03 балів (р1>0,05), 3,11±0,01 бала (р1<0,001) у І, ІІ, ІІІ групі відповідно, що свідчило про запалення ясен середньої важкості, пародонтальні кишені були відсутні. Після лікування у І групі дослідження індекс Рамфьорда склав 1,98±0,07 бала (р1<0,001, р2>0,05), у ІІ групі –

2,01±0,03 балів (р1<0,001, р2<0,001), у ІІІ групі – 1,99±0,02 балів (р1<0,001, р2<0,001). В нашому дослідженні до уваги було прийнято показник інтенсивності карієсу КПВ. Після лікування показник достовірно змінювався у всіх досліджуваних групах: в І групі показник КПВ змінився з 9,94±0,09 балів (р1>0,05) до лікування до 11,04±0,06 балів (р1<0,05, р2<0,05) після лікування. В ІІ групі до лікування він складав 10,11±0,07 бала (р1<0,05), після лікування – 12,03±0,03 (р1<0,05, р2<0,001), до лікування в ІІІ групі КПВ склав 11,31±0,09 бала (р1<0,05), після лікування – 12,01±0,04 (р1<0,001, р2<0,001). На зміну показника КПВ впливав весь комплекс заходів, які проводились: видалення зубів із безнадійним прогнозом, ендодонтичне лікування та пломбування зубів уражених карієсом, заміна застарілих пломб, професійна гігієна, навчання та контроль індивідуальної гігієни. Таким чином, всі методи корекції та підготовки ясенного краю зубів як першого етапу ортопедичного лікування з виготовленням суцільнолитих куксових вкладок, продемонстрували клінічну ефективність, проте вона відрізнялася залежно від способу підготовки. В І групі дослідження, де підготовка ясен здійснювалась хірургічним способом, нам вдалося досягнути зниження запального процесу в яснах та покращення рівня гігієни, проте не було отримано достатньої кількості вірогідних результатів індексної оцінки. Та сама тенденція зберігалась і в ІІ досліджуваній групі, де здійснювали корекцію ясенного краю електрокоагулятором. В ІІІ досліджуваній групі, де застосовувався діодний лазер, вірогідно покращився індекс гігієни Федорова-Володкіної, індекс Грін-Вермільона, проба Шиллєра-Пісарєва, індекс гінгівіту Сілнесс-Лоу, пародонтальний індекс Рассела, індекс Рамфьорда. Висновки 1. Поглиблене обстеження стоматологічного хворого та проведення комплексу оздоровчих санаційних заходів дозволяє покращити стан стоматологічного здоров’я хворого, про що може свідчити динамічна зміна гігієнічних, пародонтологічних індексів та проб у статистичній групі. 2. Підготовка ясенного краю зубів, які підлягають виготовленню куксових вкладок діодним лазером, дозволяє досягнути результатів зі більшим ступенем вірогідності.

53


Галицький лікарський вісник, 2013, Т. 20, № 4

3. Незважаючи на трудомісткий процес визначення та математичний аналіз, визначення індексів та проб є актуальним, оскільки дає об’єктивну оцінку клінічної картини на етапах обстеження хворого та в процесі лікування. Перспективними дослідженнями в даному напрямку є подальше вивчення індексів та проб та їх клінічної значимості при різних видах стоматологічної патології та різноманітних методах їх корекції. Література 1. Стоматологія: Т. 1 /М.М. Рожко, З.Б. Попович та ін.; за ред. проф. М.М. Рожка. – Івано-Франківськ: «Нова зоря», 2007. – 520 с. – С. 151-155. 2. Костенко Є.Я. Морфологічне дослідження структурного стану ясен на початку ортопедичного лікування зубів, зруйнованих нижче рівня ясенного краю / Є.Я. Костенко // Современная стоматология. – 2008. – №2. – С. 144-148. 3. Мюзікант Б.Л. Принципи встановлення і підбору коронковокореневих вкладок: як збільшити довговічність відновлення // Б.Л. Мюзікант, Б.І. Коен, А.С. Дойч // Новини стоматології. – 2002. – № 3. – С. 36-37. 4. Соціальна медицина і організація охорони здоров’я / Н.І.Кольцова, О.З.Децик, М.М. Рожко, М.М. Довжинський, В.О. Дешко, Р.В. Казакова. – Івано-Франківськ, 1999. – 304 с. 5. Данилевський М.Ф. Захворювання слизової оболонки порожнин рота / М.Ф. Данилевський, О.Ф. Несин, Ж.І. Рахній. – К.: Здоров’я, 1998. – 406 с. Рожко Н.М., Кинаш И.Е. Индексная оценка стоматологического статуса пациентов, которым изготовляли цельнолитые культевые вкладки Кафедра стоматологии факультета последипломного образования (зав. каф. - проф. Н.М.Рожко ) ГВУЗ “Ивано -Франковский национальный медицинский университет” Резюме. В статье представляются результаты исследования первого этапа ортопедических мероприятий, которые предусматривали подготовку десневого края к изготовлению цельнолитых культевых вкладок для ортопедических конструкций. Проведение индексной оценки 142 пациентов (из них 30 практически здоровых лиц , 112 – основная группа, которая нуждалась в санационных мероприятиях) включало определение гигиенических индексов Федорова-Володкиной и Грин-Вермильона (OHI-S), а также оценкуиндексов и проб, которые определяют состояние воспаления в тканях пародонта: пробу Шиллера-Писарева, число Свра-

кова, индекс гингивита Силнесс-Лоэ, пародонтальный индекс Рассела (PI Russel), индекс Рамфьорда. Во внимание также принимали индекс КПУ (кариозные, пломбированные, удалены). На основе проведения оценки основных наиболее информативных гигиенических и пародонтологических индексов и проб у пациентов, которым необходимо было восстанавливать опорные зубы под ортопедические конструкции цельнолитой культевой вкладкой, были сделаны выводы о наиболее эффективном и оптимальном способе коррекции десневого края зубов с глубокими поддесневым дефектом твердых тканей, которые подлежали изготовлению цельнолитых культевых вкладок. Установлено, что подготовка десневого края зубов, подлежащих изготовлению культевых вкладок, диодным лазером позволяет достичь лучших результатов с большей степенью вероятности. Ключевые слова: индексная оценка, стоматологический статус, цельнолитые культевые вкладки I.O. Kinash, M.M. Rozhko Index Evaluation of the Dental Status of the Patients who Received Solid Stump Inserts Dentistry Department of the Postgraduate Education Faculty (Head of the Faculty, Doctor of the Medical Science, Professor M.M. Rozhko) SHEI “Ivano-Frankivsk National Medical University” Abstract. The article describes the research results of the first stage of orthopedic work, which prepared the edges of the gums for the placement of the whole stump inserts for orthopedic structures. Performance of the index evaluation of the 142 patients (among them 30 were practically healthy people, 112 – the main group of patients, who needed some sanitation work) included the determination of the hygienic indexes of Fedorov - Volodkina and Greene-Vermillion (OHIS). We also determined the indexes and tests, which measure the inflammation state of the periodontium tissues: Schiller-Pisarev test, Svrakov’s number, Silness and Loe gingival index, Russel’s parodontium index (PI), Ramford’s index. The DMF index (decayed, missing and filled) was considered as well. Taking into account the results of the main, most informative hygienic and periodontologic indexes and tests in the patients who needed restoration of the supporting teeth for orthopedic constructions with solid stump inserts, we found the most effective and optimal way of correcting the gums edges with deep under gum defects of the hard tissues, which needed the solid stump inserts. It was determined, that diode laser treatment of the gums edges, where the solid stump inserts needed to be placed, helped to reach better results with higher degree of probability. Key words: Index evaluation, dental status, solid stump inserts. Надійшла 02.12.2013 року.

УДК 616.314-77-616.314

Сидоренко Л.П., Ожоган З.Р. Особливості методики та аналізу біометричних досліджень малих дефектів зубних рядів Івано-Франківський національний медичний університет Резюме. У роботі наведені результати біометричних досліджень малих дефектів зубних рядів, які були проведені за допомогою внутрішньоротових та позаротових методів (на гіпсових моделях щелеп). Таким чином, метою роботи є обґрунтування переваг застосування методу ортопедичного лікування за допомогою запропонованих адгезивних мостоподібних протезів для відновлення малих дефектів зубних рядів. Після проведеного вимірювання було отримано значення розмірів малих дефектів зубних рядів та проведено обчислення середніх величин за допомогою статистичних програм. Таким чином

54

у даній роботі представлені середні значення розмірів малих дефектів зубних рядів без дентоальвеолярних деформацій та із наявними дентоальвеолярними деформаціями в обстежених. З метою детальної діагностики стану опорних зубів, характеристики дефектів зубних рядів, вивчення впливу малих дефектів зубних рядів на біомеханіку рухів суглобових головок скроневонижньощелепних суглобів та розробки комплексу лікувальних заходів проведено порівняння розмірів дефектів зубних рядів у хворих без деформацій та з вторинними деформаціями. Такі вимірювання дають змогу провести детальну характеристику малих дефектів зубних рядів та у подальшому виявити закономірності


Галицький лікарський вісник, 2013, Т. 20, № 4 для проведення комплексної діагностики і запропонувати методи ортопедичного лікування. Наведені дані відіграють важливу роль при плануванні проведення ортопедичного лікування з використанням запропонованих конструкцій адгезивних мостоподібних протезів, які дозволять запобігти розвитку і прогресуванню вторинних деформацій та їх негативному впливу на стан зубощелепної системи, зокрема спричиняють функціональне перевантаження тканин пародонта зубів, порушення функції скронево-нижньощелепного суглоба та виникнення розладів у жувальних м’язах. Ключові слова: дентоальвеолярні деформації, адгезивні мостоподібні протези.

Постановка проблеми і аналіз останніх досліджень. Однією з найбільш поширених проблем клініки ортопедичної стоматології на сьогоднішній день є руйнування оклюзійної поверхні зуба та наявність малих дефектів зубних рядів у хворих, які, в свою чергу, сприяють виникненню дентоальвеолярних деформацій. [1,2,3]. Як правило, дентоальвеолярні деформації, які виникають у молодому віці, спричинені такими основними чинниками: наявність дефекту зубного ряду при ранньому видаленні зубів, а також руйнування оклюзійних поверхонь зубів внаслідок дефектів твердих тканин каріозного чи некаріозного походження [4,5]. Виникнення дентоальвеолярних деформацій у пацієнтів молодого віку є особливо важливою проблемою, так як у цей період будь-які порушення в зубощелепній системі сприяють виникненню та швидким темпам прогресування функціональних і морфологічних змін [6,7]. При втраті хоча б одного зуба, яка спричиняє виникнення дефекту та зумовлює порушення цілісності зубного ряду, відбувається функціональне перевантаження тканин пародонта зубів, які обмежують дефект, порушення функції жувальних м’язів, а також провокується виникнення розладів скронево-нижньощелепного суглоба. Таким чином, метою роботи є обґрунтування переваг застосування методу ортопедичного лікування за допомогою запропонованих адгезивних мостоподібних протезів для відновлення малих дефектів зубних рядів. Матеріал і методи дослідження Для визначення поширеності малих дефектів зубних рядів нами було проведено обстеження стану зубощелепної системи 590 осіб, віком 18-25 років. Після статистичної обробки результатів дослідження встановлено, що у 191 (32,37%) із них наявні малі дефекти зубних рядів, що свідчить про високу поширеність даної патології. Серед обстежених пацієнтів відсутність одного зуба виявлена у 138 (72,2%), а відсутність 2 зубів - у 53 (27,8%). При аналізі локалізації дефектів встановлено, що на верхній щелепі дефекти зубних рядів виявлено у 69 (36,1%) обстежених, на нижній щелепі – у 112 (58,6%), а на верхній і нижній разом у 10 (5,2%). Також, слід відзначити, що серед обстежених переважають пацієнти з однобічними малими дефектами зубних рядів – 175 (91,6%), однак у 16 хворих (8,4%) виявлено двобічні дефекти. Серед обстежених переважали дефекти в ділянці втраченого першого моляра на нижній щелепі (82 випадки, 42,9%), а також дефекти в ділянці втраченого премоляра верхньої щелепи - 47 (24,6%). Нами проведено аналіз стану зубів, які обмежують дефекти зубних рядів. При цьому встановлено, що малі дефекти зубних рядів в осіб молодого віку тільки в 43 (22,5%) обмежують інтактні зуби, у 53 (27,8%) - наявні зуби з відновленими дефектами твердих тканин, у 74 (38,7%) - дефект обмежує один девітальний зуб та у 21 (11,0%) - обидва зуби є девітальними. Окрім цього, у 72 пацієнтів (37,7% випадків) зафіксовано порушення цілісності оклюзійної поверхні зубів, які обмежують дефект зубного ряду з дистального боку (моляри). Наступним етапом, метою якого було вивчення характеристик і розмірів малих дефектів зубних рядів, було проведення аналізу внутрішньоротових вимірів та діагностичних моделей за допомогою штангенциркуля. Під час проведеного дослідження нами було визначено точки для проведення вимірювання А, В, С, D, E, F, K, L та відстані, які можна отримати при проведенні ліній через з’єднання даних точок AB, CD, EF, AD, BC, KL та висоту H відповідно. Такі вимірювання дають змогу провести детальну характе-

ристику малих дефектів зубних рядів та у подальшому виявити закономірності для проведення комплексної діагностики і запропонувати та обґрунтувати методи ортопедичного лікування.

Результати дослідження Після проведеного вимірювання нами було отримано значення розмірів малих дефектів зубних рядів та проведено обчислення середніх величин за допомогою статистичних програм. При цьому встановлено, що: - відстань АВ - від центру медіальної апроксимальної поверхні до центру дистальної апроксимальної поверхні в ділянці клінічних шийок зубів, що оточують дефект зубного ряду становить (7,26±0,14)мм; - відстань CD - від центру медіальної апроксимальної жувальної поверхні до центру дистальної апроксимальної жувальної поверхні зубів, які обмежують дефект зубного ряду становить (7,19±0,14)мм; - відстань EF - від медіальної апроксимальної поверхні до дистальної апроксимальної поверхні в ділянці екваторів становить (7,19±0,13)мм; - відстань AD - від центру медіальної апроксимальної поверхні в ділянці клінічної шийки зуба до центру дистальної апроксимальної жувальної поверхні зуба становить (7,48±0,14)мм; - відстань BC - від центру дистальної апроксимальної поверхні в ділянці клінічної шийки зуба до точки С, яка знаходиться по центру медіальної апроксимальної жувальної поверхні зуба становить (7,81±0,13)мм; - ширина коміркового відростка беззубої ділянки KL становить (6,77±0,13)мм; - середня висота дефекту зубного ряду H становить (4,81±0,08)мм. З метою детальної діагностики стану опорних зубів, характеристики дефектів зубних рядів, вивчення впливу малих дефектів зубних рядів на біомеханіку рухів суглобових головок скронево-нижньощелепних суглобів та розробки комплексу лікувальних заходів нами проведено порівняння розмірів дефектів зубних рядів у хворих без деформацій та з вторинними деформаціями. Після отримання даних значень розмірів малих дефектів зубних рядів та обчислення середніх величин у хворих без вторинних дентоальвеолярних деформацій ми можемо стверджувати, що: - відстань АВ - від центру медіальної апроксимальної поверхні до центру дистальної апроксимальної поверхні в ділянці клінічних шийок зубів, що оточують дефект зубного ряду становить (7,32±0,19)мм; - відстань CD - від центру медіальної апроксимальної жувальної поверхні до центру дистальної апроксимальної жувальної поверхні зубів, які обмежують дефект зубного ряду становить (7,28±0,19)мм; - відстань EF - від медіальної апроксимальної поверхні до дистальної апроксимальної поверхні в ділянці екваторів становить (7,27±0,19)мм; - відстань AD - від центру медіальної апроксимальної поверхні в ділянці клінічної шийки зуба до центру дистальної апроксимальної жувальної поверхні зуба становить (7,73±0,19)мм; - відстань BC - від центру дистальної апроксимальної поверхні в ділянці клінічної шийки зуба до точки С, яка знаходиться по центру медіальної апроксимальної жувальної поверхні зуба становить (7,82±0,19)мм; - ширина коміркового відростка KL становить (6,96±0,17)мм; - висота дефекту зубного ряду H становить (4,79±0,11)мм. Обговорення Нами встановлено, що відстань АВ у хворих із малими дефектами зубних рядів без вторинних деформацій є

55


Галицький лікарський вісник, 2013, Т. 20, № 4

більшою, ніж середні дані і становить (7,32±0,19)мм, проти (7,26±0,14)мм. Достатньо показовими та інформативними є діагональні розміри AD та BC, які у хворих без деформацій мають показники (7,73±0,19)мм та (7,82±0,19)мм у порівнянні з середніми даними відповідно (7,48±0,14)мм та (7,81±0,13)мм. Середнє значення ширини коміркового відростка становить (6,77±0,13)мм, а в обстежених без деформацій (6,96±0,17)мм і відповідно, висота дефекту зубного ряду – (4,81±0,08)мм, проти (4,79±0,11)мм у хворих без деформацій. Висновки Таким чином, отримані результати біометричних досліджень свідчать що середні значення розмірів малого дефекту зубного ряду є більшими від таких же параметрів в обстежених без дентоальвеолярних деформацій. Наведені дані відіграють важливу роль при плануванні проведення ортопедичного лікування з використанням запропонованих конструкцій адгезивних мостоподібних протезів, які дозволять запобігти розвитку і прогресуванню вторинних деформацій та їх негативному впливу на стан зубощелепної системи. Перспективи подальших досліджень У наступному дослідженні при виконанні наукових досліджень буде проведено оцінку стану зубощелепної системи у хворих із малими дефектами зубних рядів, поєднаними із деформаціями при ортопедичному лікуванні запропонованими адгезивними мостоподібними протезами. Література 1. Король М.Д. Підготовка і ортопедичне лікування хворих із вторинними деформаціями зубних рядів: автореф. дис. на здобуття наук. ступеня д-ра мед. наук: спец. 14.01.22 “Стоматологія” / М.Д. Король. - Полтава, 1999. – 33 с. 2. Сидоренко Л.П. Порівняльна характеристика різних ортопедичних методів малих дефектів зубних рядів:автореф. дис. на здобуття наук. ступеня канд. мед. наук. 14.01.22Стоматологія / Л.П. Сидоренко.-Івано-Франківськ, 2010. – 27с. 3. Біда В.І. Принципи ортопедичного лікування патології зубощелепної системи при зниженні висоти прикусу, його прогнозування та профілактика: автореф. дис. на здобуття наук. ступеня д-ра мед. наук: спец. 14.01.22 “Стоматологія”/ В.І.Біда. – К., 2003. – 31с. 4. Occlusal area of mandibular teeth during lateral excursion / H. Hayasaki, A. Okamoto, J. Iwase [et al] // Int. J. Prosthodont. – 2004. – Vol. 17, №1. – P. 72-76. 5. Lauret J.F. The function of mastication: a key determinant of dental occlusion / J.F. Lauret, MG. Le Gall // Pract. Periodontics Aesthet. Dent. – 1996. – Vol. 8, №8. – P. 807 – 817. 6. Nakamura Y. A clinical study of the significance of the occlusal contacts on chewing movements / Y. Nakamura // Osaka Daigaku Shigaku Zasshi. – 1990. – Vol. 35, №2. – P. 486-516. 7. Influence of environmental factors on tooth displacement / B. Amarsaikhan, H. Miura, D. Okada [et al] // J. Med. Dent. Sci. – 2002. – Vol. 49, №1. – P.19-26. Сидоренко Л.П., Ожоган З.Р. Особенности методики и анализа биометрических исследований малых дефектов зубных рядов Резюме. В работе приведены результаты биометрических исследований малых дефектов зубных рядов, которые были проведены с помощью внутриротовых и внеротовой методов (на гипсовых моделях челюстей) . Таким образом, целью работы является обоснование преимуществ применения метода ортопедического лечения с помощью

56

предложенных адгезивных мостовидных протезов для восстановления малых дефектов зубных рядов. После проведенного измерения было получено значение размеров малых дефектов зубных рядов и проведено вычисление средних величин с помощью статистических программ. Таким образом в данной работе представлены средние значения размеров малых дефектов зубных рядов без дентоальвеолярных деформаций и с имеющимися дентоальвеолярными деформациями в обследованных . С целью детальной диагностики состояния опорных зубов, характеристики дефектов зубных рядов, изучение влияния малых дефектов зубных рядов на биомеханику движений суставных головок височно -нижнечелюстных суставов и разработки комплекса лечебных мероприятий проведено сравнение размеров дефектов зубных рядов у больных без деформаций и с вторичными деформациями. Такие измерения позволяют провести детальную характеристику малых дефектов зубных рядов и в дальнейшем выявить закономерности для проведения комплексной диагностики и предложить методы ортопедического лечения. Представленные данные играют важную роль при планировании проведения ортопедического лечения с использованием предложенных конструкций адгезивных мостовидных протезов, которые позволят предотвратить развитие и прогрессирование вторичных деформаций и их негативное влияние на состояние зубочелюстной системы, в частности вызвать функциональную перегрузку тканей пародонта зубов, нарушение функции височнонижнечелюстного сустава и возникновения расстройств в жевательных мышцах. Ключевые слова: дентоальвеолярные деформации, адгезивные мостовидные протезы. L.P. Sidorenko, Z.R. Ozhohan Features of the Methodology and Analysis of Biometric Studies of Small Defects of Dentition Ivano- Frankivsk National Medical University Summary: This paper presents the results of biometric research of small defects of dentition, which were carried out using intraoral and extraoral methods ( on plaster jaw models). Thus, the purpose of this study is to show the advantages of the method of orthopedic treatment with the adhesive prosthetic appliances to restore small defects of dentition. We measured the size of small defects of dentition and calculated the average values using statistical software programs. Thus, this paper presents the average values of small size defects of dentition without dentoalveolar deformations and with dentoalveolar deformations in patients. For the purpose of detailed diagnosis of the condition of the abutment teeth, characteristic defects of dentition, study of the influence of small defects of dentition on the biomechanics of movements of the temporomandibular joint condyle and the development of complex therapeutic interventions we compared the size of dentition defects in patients without deformations and in patients with secondary dentoalveolar deformations. These measurements make performing of a detailed description of small defects of dentition possible and further identify patterns for comprehensive diagnosis and suggest methods for orthopedic treatment. These data play an important role in the planning of orthopedic treatment with the proposed constructions of adhesive prosthetic appliances that will prevent the development and progression of the secondary dentoalveolar deformations and their negative impact on the dentition, including functional overload of periodontal tissues of the teeth, dysfunction of the temporomandibular joint and occurrence of disorders in the masticatory muscles. Keywords: dentoalveolar deformations, adhesive prosthetic appliances. Надійшла 25.11.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК: 616.831.38 -005.1-053.31-092.19

Чуйко М.М. Порівняльна характеристика імунологічних показників у недоношених новонароджених із внутрішньошлуночковими крововиливами й без них Кафедра педіатрії і неонатології факультету післядипломної освіти Львівського національного медичного університету ім. Данила Галицького Резюме. Серед 115 недоношених новонароджених з гестаційним віком менше 35 тиж, які були під спостереженням, визначили динаміку змін імунного статусу у дітей з внутрішньошлуночковими крововиливами (n=41) та без них (n=74) на підставі аналізу показників лейкограми, концентрацій ІgА, ІgМ та ІgG у периферичній крові, кількісного підрахунку субпопуляцій Т-лімфоцитів (CD3+, CD4+, CD8+, CD4+/CD8+), які виконували у першу і десяту доби життя. Виявленні зміни досліджуваних показників продемонстрували здатність організму дітей з середнім гестаційним віком 31,69 ± 2,3 тиж. регулювати силу імунної відповіді на антигенну стимуляцію та контролювати антигенний гомеостаз з першої доби після народження. У подальшому спостерігалось швидке виснаження резервних можливостей імунітету дітей обох груп, з переважанням процесів напруження адаптивного імунітету, ознак запальних реакцій у дітей з внутрішньошлуночковими крововиливами. Відносну кількість CD4+ та показники CD4+/CD8+ у недоношених новонароджених, визначені у десятиденному віці, необхідно враховувати у призначенні лікування, уникаючи імуностимуляції. Ключеві слова: внутрішньошлуночкові крововиливи, Т-клітинний імунітет, імуноглобуліни, недоношені новонароджені.

Постановка проблеми і аналіз останніх досліджень. Функціональна та анатомічна незрілість всіх органів і систем у недоношених новонароджених, яка обернено пропорційно залежить від гестаційного віку, впливає на перебіг неонатального періоду [6,10,12]. Одним з основних ускладнень, що розвивається у період новонародженості, вважаються внутрішньошлуночкові крововиливи (ВШК), які відносяться до тяжких перинатальних уражень головного мозку [7, 8, 10]. Багатофакторність та різні механізми виникнення ВШК асоціюються не тільки з високими показниками захворюваності та смертності, а й з віддаленими неврологічними наслідками, кінцевою трансформацією яких є порушення моторного, мовленевого, інтелектуального, поведінкового та пізнавального розвитку у різні періоди дитинства [2, 8]. Специфічного лікування ВШК не існує, тому особлива увага практиків перинатальної медицини має бути прикута до патогенетичного розуміння виникнення ВШК, що допоможе передбачати загрозу виникнення ВШК, а в разі їх виникнення або збільшення розмірів сформувати оптимальний комплекс обстежень, починаючи з антенатального періоду та лікувально-профілактичних заходів. Надзвичайно важливо профілактувати ВШК в перші години життя, коли специфічні для перинатального періоду захворювання розвиваються на тлі напружених адаптаційних процесів у функціонально-незрілому організмі недоношеного новонародженого [10, 12]. Адже відомо, що 90 % ВШК стається в перші чотири, п’ять днів життя новонароджених, з них від 30 до 50 % виникають в перші 12 год життя, а 40% ВШК розвиваються у першу год. життя. Поширення зони крововиливу може виникати в 20-40 % новонароджених у перші кілька днів після виникнення [12]. Значні неврологічні ускладнення у дітей, які вижили після ВШК, що розвиваються у 22-44% недоношених новонароджених, створюють негативний вплив на життя не тільки цих дітей, їхніх батьків та рідних, але й визначають велике навантаження соціального і фінансового характеру для держави [2, 7, 8]. Поліорганна незрілість, особливо кардіо-респіраторної системи, виражена нестабільність функціонування органних систем недоношеної дитини, під впливом різноманітних зовнішніх чинників, може провокувати значні зміни церебральної гемодинаміки, які призводять до виникнення крововиливів у гермінальний матрикс та бокові шлуночки [12].

Важливою анатомічно-фізіологічною особливістю недоношених дітей у виникненні ВШК є не закінчене формування гематоенцефалічного бар’єру через недостатню кількість астроцитів і високу проникливість судинної стінки, що також може підвищувати ризик виникнення ВШК при наявності інфекційно-запального процесу в організмі дитини [12]. Продовжуються дослідження щодо визначення ролі цитокінів, вазоактивних, судинних, ростових факторів у виникненні ВШК. Суперечливими є дані щодо ролі інфекцій й прозапальних цитокінів у виникненні ВШК, оскільки одні дослідники в епідеміологічних та експериментальних роботах показали зв’язок між наявністю інфекцій, продукцією запальних цитокінів й виникненням ВШК [3, 13], інші такого висновку не дійшли [11]. Для недоношених новонароджених характерна незрілість основних механізмів антибактеріального захисту, що визначається зниженими показниками гуморального, клітинного і місцевого імунітету. Відомо, що мобілізація факторів вродженого й адаптивного імунітету у новонароджених підпорядковується загальним закономірностям адаптації [1, 5, 6], однак характеристика показників клітинного та гуморального імунітету у недоношених новонароджених залишається невизначеною у випадках виникнення ВШК у перинатальний період. Мета дослідження. Оцінити зміни імунного статусу недоношених новонароджених з ВШК і без них на підставі аналізу показників лейкограми, концентрацій ІgА, ІgМ та ІgG у периферичній крові, кількісного підрахунку субпопуляцій Т-лімфоцитів (CD3+, CD4+, CD8+, CD4+/CD8+) для урахування виявлених результатів у призначенні складових діагностично-лікувального комплексу недоношеним новонародженим. Матеріал і методи дослідження У когортне ретроспективне дослідження, побудоване за типом «випадок-контроль», увійшли 115 передчасно народжених дітей. Середній гестаційний вік дітей, які перебували під спостереженням, не перевищував 35 тиж. і становив 31,69 ± 2,3 тиж. (тут і далі стандартне відхилення ± SD), середня маса тіла при народженні 1634,29±400,65 г. 66 (57,39%) новонароджених були чоловічої статі. Затримку внутрішньоутробного розвитку (ЗВУР) діагностували у 13 (11,3%) новонароджених, з багатоплідної вагітності були 16 (13,91%) недоношених. Усі діти народились у тяжкому стані. Оцінка за шкалою Апгар на 1-й 5-й – 20-й хв життя в жодному випадку не перевищувала 6 балів (рис. 1). (80,87%) новонародженим проводили реанімаційні заходи, використовуючи штучну вентиляцію легенів під позитивним тиском, з них 26 (22,62%) новонароджених були інтубовані. Непрямий масаж серця проводили 24 (20,88%) немовлятам. Уведення розчину соди відбулося у 5 (4,35%) дітей. Усі діти народились від матерів з анамнезом, обтяженим чинниками ризику, які потенційно сприяють збільшенню перинатальної патології, у тому числі й ВШК. У когорті новонароджених, яка перебувала під спостереженням, переважала вторинна ексрагенітальна патологія – 87 (75, 69%) випадків, первинні екстрагенітальні захворювання зустрічались з частотою 39,15% (45 випадків), p=0,0001. Усім новонародженим проводили нейросонографію (НСГ) в першу добу життя, на другу та третю доби життя за умови будьяких ознак погіршення загального стану. Нейросонографію виконували за допомогою ультразвукового апарату RADMIR – TI – 628A. Наявність ВШК встановлювали за класифікацією Papile L. A. (1978), поділяючи їх на чотири ступені тяжкості [13]. Залежно від наявності або відсутності ВШК новонароджених розподілили

57


Галицький лікарський вісник, 2013, Т. 20, № 4 допомогою програми “Statistica - 7” (США), використовуючи статистичні характеристики частоти, середнього, параметричний метод: t - тест для незалежних змінних, непараметричні методи: критерій 2, точний Фішера, кореляційний аналіз за Пірсоном. Результати вважали вірогідними при р<0,05 [4].

Результати дослідження та їх обговорення Частота ВШК передчасно народжених немовлят, залучених у дослідження, становила 36%. У сформованих групах спостерігалась суттєва відмінність за окремими клініко-демографічними показниками (табл. 1.). Відмінність між основною та контрольною групою за показниками маси тіла та гестаційного віку підтверджує вплив цих характеристик на часРис. 1. Оцінка дітей (n=115) за шкалою Апгар на 1-й, 5-20 й хв життя тоту ВШК [12]. Найбільший відсоток ВШК виник в першу дві групи. Основну групу сформували 41 недоношена новона- добу життя 58% проти 36% і 4,8% на другу й третю добу роджена дитина, у яких в процесі спостереження розвинулись життя (p<0,0001). Виявлені вірогідні відмінності найвищої ВШК. Контрольну групу створили 74 пацієнти без ВШК. Вміст ІgА, ІgМ, ІgG у сироватці крові визначали методом кіне- частоти ВШК в першу добу життя, можна пояснити розвиттичної нефелометрії на імунохімічному аналізаторі ICS-2 (Beck- ком специфічних станів, характерних для передчасно народman, США). Використовували моноспецифічні сироватки проти жених дітей, на фоні максимальної напруженості адапімуноглобулінів людини виробництва Нижнє-Новгородського дер- таційних процесів [2, 3]. Клінічні прояви ВШК були неспецифічними, а тому будьжавного підприємства бактерійних препаратів (Росія). Кількісний підрахунок субпопуляцій Т-лімфоцитів (CD3, CD4, CD8, CD4/CD8) які зміни у загальному стані дитини з ризиком виникнення виконували на проточному цитофлоуметрі (Beckton-Dіcіnson FAC- пери- та внутрішньошлуночкових крововиливів, поява Scan, США) за допомогою автоматичної комп’ютерної програми нових або підсилення вже існуючих клінічних патологічних IMV-lymphocyte. Позначення кластерів СD представлено відпо- симптомів після сонографічного підтвердження ВШК розвідно до міжнародної класифікації. У дослідженні субпопуляцій цінювали як прояв зазначеного виду крововиливів. лімфоцитів використовували моноклональні антитіла до антигенів З першої години життя у новонароджених, які перебували мембран лімфоцитів СD3 (загальні Т-лімфоцити), СD4 (Т-хелперипід спостереженням, спостерігали дихальні розлади. Респіраіндуктори), СD 8 (Т-цитотоксичні і супресорні лімфоцити), співвідношення СD4/СD8 (імунорегуляторний індекс) [9]. Для торний дистрес синдром новонародженого розвинувся в 30 виконання імунологічних досліджень забирали 1,5 мл венозної (72%) новонароджених основної групи і 24 (32,4%) у дітей крові. Забір крові здійснювали за допомогою венепункції будь- контрольної групи, (р=0,0001). За даними досліджень РДС якої вени немовляти з дотриманням правил асептики й антисеп- один з чинників ризику розвитку ВШК [13]. З першої години тики у стандартні пробірки з сухим антикоагулянтом “EDTA” і життя у новонароджених, які перебували під спостеревідразу транспортували до лабораторії. Визначення показників клі- женням, спостерігали дихальні розлади. Респіраторний дитинного, гуморального імунітету у крові та лейкограми проводили стрес синдром новонародженого розвинувся в 30 (72%) в перший день госпіталізації у спеціалізоване відділення і в динановонароджених основної групи і 24 (32,4%) у дітей конміці через 10 днів. Під час роботи використовували дані материнського анамнезу, трольної групи, (р=0,0001). Суттєво відрізнялись недоноякий отримували аналізуючи обмінні карти, історії перебігу по- шені основної групи від дітей контрольної за наявністю відлогів, карти розвитку новонароджених і карти стаціонарних хворих критої артеріальної протоки (ВАП), відповідно, 18 (43,90%) дітей, що лікувались у спеціалізованих відділеннях для новонарод- випадків проти 13 (17,57%), (р = 0,003) й розвитком гіпержених м. Львова. білірубінемії - 30 (73,17%) випадків проти 66 (89,19%), У роботі використовували клінічні, сонографічні, математико- (р=0,03). За даними багатьох досліджень РДС, ВАП відностатистичні методи дослідження. Отримані дані аналізували за сяться до чинників ризику розвитку ВШК [2,8]. Ознаки генералізованої внутрішньоутробної інфекції спостерігались у 13 (31,71%) новонароджених з ВШК і 18 (24,32%) дітей без Таблиця 1. Клінічна характеристика сформованих груп них (р>0,05). Не виявили також вірогідної відмінності між ВірогідОсновна Контрольна групами за частотою вродженої пневмонії та НЕКу. ність Показник група група відмінАналіз показників лейкоцитів, лімфоцитів та моноцитів (n=41) (n=74) ності показав особливості, отриманих значень у сформованих Маса тіла при народгрупах (табл.2) 1419,63351,57 1756,53353,66 =0,0001 женні (грами)* Незважаючи на те, що імунна відповідь у недоношених Гестаційний вік =0,0001 новонароджених характеризується імуносупресивною на30,64  1,86 32,29  1,97 (тижні)* правленістю, спрямованою на попередження ризику важких Кількість хлопчиків у 7 (38,92) 13(40,69) >0,05 імунопатологічних реакцій в цей період (пов’язані з конгрупі (%) Кількість дітей у важкому стані після народження (%) Кількість дітей, з оцінкою за шкалою Апгар на 1-й хвилині < 4 балів (%) Кількість дітей, з оцінкою за шкалою Апгар на 5-й хвилині < 7 балів (%) Вік госпіталізації у відділення інтенсивної терапії (години)*

58

27(64,8)

36 (48,6)

>0,05

7 (16,8)

15 (20,25)

>0,05

34 (81,6)

27 (79,65)

>0,05

4,33  0,54

4,13  0,65

>0,05

Таблиця 2. Порівняльна характеристика окремих показників лейкограми у недоношених новонароджених Показники Основна група Контрольна Вірогідність лейкограми (n=41) група (n=74) відмінності (р) Лейкоцити 8,57±3,44* 10,97±5,18* =0,008 х109/л 8,54±3,69** 7,29±3,27** =0,06 Лімфоцити 33,88±13,91* 35,5±11,89* =0,5 % 40,0±10,8** 30,47±13,53** =0,0002 Лімфоцити 2,64 ±1,17* 3,38 ± 1,17* =0,002 х109/л 2,43 ± 1,26** 3,03 ± 1,36** =0,02 Моноцити 7,38 ±5,98* 7,5 ± 4,69* =0,9 % 16,23 ± 6,9** 12,31 ± 5,8** =0,001 Примітка: * - перше визначення; ** - повторне визначення


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 3. Показники рівня імуноглобулінів крові у недоношених дітей на 1-й та 10-й дні життя Основна група Контрольна Вірогідність Показники (n=41) група (n=74) відмінності (р) IgA г/л * 0,83±0,02 0,72±0,01 = 0,0001 г/л ** 0,11±0,01 0,08±0,02 = 0,0001 IgM г/л * 0,2±0,08 0,19±0,07 = 0,48 г/л ** 0,30±0,24 0,24±0,15 = 0,1 IgG г/л * 5,32±1,33 5,34±0,19 = 0,67 г/л ** 5,17±1,53 5,19±1,05 = 0,65 Примітка: * - перше визначення; ** - повторне визначення

тактом великої кількості антигенів оточуючого середовища) [1, 6], показники лейкограми у новонароджених з ВШК мали вірогідно меншу кількість лейкоцитів на першу добу життя, порівняно з дітьми без крововиливів (p<0,05). Були наявними ознаки активації імунокомпетентних клітин (лімфоцитів та моноцитів) в обох групах, однак з суттєвими перевагами вищих показників у недоношених новонароджених з ВШК. Відомо, що у новонароджених дітей гуморальні захисні реакції забезпечуються в основному материнськими антитілами (IgG), рівень яких у недоношених новонароджених до 34 тиж. гестації суттєво нижчий, порівняно із дітьми, які народились після зазначеного терміну, а концентрація IgА й IgМ у недоношених новонароджених практично відсутні [1]. Наші дослідження функціональної В-ланки імунітету, за допомогою визначення імуноглобулінів крові трьох основних класів продемонстрували активацію гуморального імунітету у недоношених двох груп з переважанням процесу у новонароджених з ВШК (табл.3). Нормальні значення показників відносної кількості Тлімфоцитів (CD3+) як у першому, так і другому визначеннях свідчить про готовність недоношених новонароджених виконувати ефекторну і регуляторну функції, здійснювати імунологічний нагляд за антигенним гомеостазом в організмі (табл.4). Вірогідно вищі абсолютні значення (CD3+) за рахунок дітей контрольної групи є проявом адаптивної та компенсаторної напруженості імунітету, що яскравіше виражена у недоношених новонароджених без ВШК. Однак оцінка абсолютних величин CD3+ всередині груп демонструє їх вірогідне зниження в динаміці (р=0,02). Напруженість Т-клітинних реакцій відображали відносні й абсолютні показники (CD4+). Результати абсолютних значень CD4+ підтверджували гіперактивність імунітету у недоношених новонароджених обох груп при першому визначенні, причому підсилення адаптивної імунної відповіді недоношених новонароджених, які лікуються у ВІТН, за абсолютною кількістю (CD4+) було кращим у новонароджених без крововиливів. Таблиця 4. Показники окремих показників Т-клітинного імунного профілю у недоношених новонароджених, які перебували під спостереженням Основна Контрольна Вірогідність Показники група група відмінності (n=41) (n=74) (р) 9 CD3+, %* х10 /л * 52,84±17,06 57,58±13,22 = 0,09 2,07±0,71 2,53±0,38 = 0,00001 CD3+,** 61,30±14,92 65,82±9,73 = 0,05 9 х10 /л** 1,66±0,91 1,98±0,61 = 0,03 CD4+,%* 40,11±11,94 34,18±11,21 =0,01 х109/л * 1,36±0,5 0,86±0,41 =0,00001 CD4+%** 35,70±7,05 35,75±8,38 = 0,98 х109/л** 0,99±0,46 1,07±0,51 = 0,4 CD8+%,* 14,8±5,02 14,24±5,13 = 0,87 х109/л* 0,53±0,17 0,35±0,16 = 0,00001 CD8+%,** 14,75±5,29 16,5±4,22 = 0,05 9 х10 /л** 0,44±0,27 0,59±0,29 = 0,01 CD4+/CD8+* 2,98±0,72 2,57±1,15 = 0,04 CD4+/CD8+** 2,7 ± 1,21 2,38±0,93 = 0,11 Примітка: * - перше визначення; ** - повторне визначення

Натомість в динаміці абсолютні значення CD4+ характеризувались вірогідною гіпореактивністю в обох групах, очевидно, за рахунок інтенсифікації запальних реакцій в організмі недоношених новонароджених, які лікуються у ВІТН (р=0,0001). Знижені відносні показники CD8+ в обох групах свідчить за низьку здатність антигенного розпізнавання й участь в передачі як активаційних так і супресорних антигенів в Тлімфоцити, яка характеризується чіткою тенденцією до зниження у дітей основної групи (р=0,07). Аналіз показників CD4+/CD8+ показав, що інтенсивність імунної відповіді відображала високу функціональну активність і свідчила про наявність виражених запальних реакцій у недоношених новонароджених як з ВШК, так і без них. За підсумками кореляційного аналізу спостерігався достовірний позитивний кореляційний зв’язок між ВШК і відносною кількістю CD4+ (r = 0,69; p < 0,05) та CD4+/CD8+ (r = 0,62; p < 0,05) у десятиденному віці, значення яких необхідно враховувати у призначенні лікуванні, уникаючи імуностимуляції. Отже, нормальні відносні значення CD3+ та CD4+ в периферичній крові недоношених новонароджених з середнім гестаційним віком 31,69±2,3 тиж. – це здатність регулювати силу імунної відповіді на антигенну стимуляцію та контролювати антигенний гомеостаз з першої доби після народження, а вірогідне зниження абсолютних значень цих показників у групах в динаміці вказує на швидке виснаження резервних можливостей імунітету цих дітей при збереженні виражених запальних реакцій (CD4+/CD8+). Отримані дані доповнюють результати існуючих досліджень про роль запалення в патогенезі ВШК. Висновки 1. Дослідження показників лейкограми (лімфоцити, моноцити) у недоношених новонароджених з ВШК продемонстрували вірогідні ознаки активації імунокомпетентних клітин, що поєднуються з напруженістю Т-клітинних реакцій. 2. В-ланка імунітету, яку представляли імуноглобуліни крові трьох основних класів, характеризувалась активацією гуморального імунітету у недоношених двох груп з переважанням процесу у новонароджених з ВШК. 3. Т-клітинні реакції згідно з аналізом динаміки відносних та абсолютних показників CD3+, CD4+, CD8+, CD4+/ CD8+ характеризуються зниженням адаптивних процесів імунного захисту та функціональною недосконалістю. 4. Відносну кількість CD4+ та показники CD4+/CD8+ у недоношених новонароджених, визначені у десятиденному віці, необхідно враховувати у призначенні лікування, уникаючи імуностимуляції. Перспективи подальших досліджень Удосконалити складові профілактично-лікувальних заходів ВШК у недоношених новонароджених, розширюючи знання про патогенетичні особливості їх виникнення. Література 1. Вельтищева Е. Ю. Иммунитет новорожденного и повышенная чувствительность к некоторым вирусным инфекциям (обзор литературы) / Е. Ю. Вельтищева // Российский вестник перинатологии и педиатрии. – 1993. - № 5. – С. 9-10. 2. Володин Н. Н. Перинатальная энцефалопатия и ее последствия – дискуссионные вопросы семиотики, ранней диагностики и терапии / Н.Н. Володин, М.И. Медведев, С. О. Рогаткин // Российский педиатрический журнал. – 2001. – С 4- 7. 3. Горінець І. Б. Роль запальних реакцій у розвитку внутрішньошлуночкових крововиливів у глибоконедоношених новонароджених / І. Б. Горінець // Педіатрія, акушерство та гінекологія. – 2010. – Т.72, №5. – С.7-13. 4. Гринхальх Т. Основы доказательной медицины: Пер. с англ.

59


Галицький лікарський вісник, 2013, Т. 20, № 4 – М.: ГЭОТАР-МЕД, 2004. – 240 с. 5. Збірник наукових праць асоціації акушерів-гінекологів України. – К.: Інтермед, 2005. – 716 с. 6. Каракушикова А. С. Особенности имунного статуса недоношенных детей с перинатальной патологией в раннем неонатальном периоде / А. С. Каракушикова, К. В. Рахимова, Г. М. Абдулаева // Педиатрия. – 2012. – Т. 91, № 1. – С. 20-25. 7. Клименко Т. М. Перивентрикулярна лейкомаляція мозку у недоношених новонароджених: клініко – нейрофізіологічні кореляти / Т. М. Клименко, А. М. Закревський, В. С. Агашков // Педіатрія, акушерство та гінекологія. – 2010. - №6. – С.20-24. 8. Козявкин В. І. Детские церебральне параличи / В. І. Козявкін, М. А. Бабадагли, С. К. Ткаченко, О. А. Качмар. – Львів.: Медицина світу, 1999. – с. 295. 9. Назаренко Г. И. Клиническая оценка результатов лабораторных исследований / Г. И. Назаренко, А. А. Кишкун. – М.: Медицина, 2002. – С. 191. 10. Шунько Є. Є. Діти з дуже малою масою тіла: сучасні проблеми організації медичної допомоги, інтенсивної терапії та виходжування / Є. Є. Шунько, О. С. Яблонь // Жіночий лікар. – 2007. - № 4. – С. 13 – 17. 11. Association of histologic chorioamnionitis, increased levels of cord blood cytokines, and intracerebral hemorrhage in preterm neonates. / M. K. Tauscher, D. Berg, M. Brockmann [et al.] // Biol. Neonate. – 2003. – T. 83, V. 3. – P. 166 – 170. 12. Badr L. K. Brain injury in the infant the old, the new, and the uncertain / L. K. Badr, I. Purdy // J. Perinat. Neonat. Nurs. – 2006. - V. 20, №. 2. – Р. 163–175. 13. Fetal and neonatal brain injury / edited by D. K. Stevenson, E. W. Benits, Philip Sunshine [et al.]. – 4th ed.: Cambridge University Press, New York. – 2009. – 628 p. Чуйко М.М. Сравнительная характеристика иммунологических показателей у недоношенных новорожденных с внутрижелудочковыми кровоизлияниями и без них Кафедра педиатрии и неонатологии факультета последипломного образования Львовский национальный медицинский университет им. Даниила Галицкого Резюме. Среди 115 недоношенных новорожденных с гестационным возрастом менее 35 нед, которые были под наблюдением определили динамику изменений иммунного статуса у детей с внутрижелудочковыми кровоизлияниями (n=41) и без них (n=74) на основании анализа показателей лейкограммы, концентраций IgА, IgМ и IgG в периферической крови, количественного подсчета

субпопуляций Т-лимфоцитов (CD3+, CD4+, CD8+, CD4+/CD8+), которые выполняли в первые и десятые сутки жизни. Выявленные изменения исследуемых показателей продемонстрировали способность организма детей со средним гестационным возрастом 31,69±2,3 нед. регулировать силу иммунного ответа на антигенную стимуляцию и контролировать антигенный гомеостаз с первых суток после рождения. В последующем наблюдалось быстрое истощение резервных возможностей иммунитета детей обеих групп, с преобладанием процессов напряжения адаптивного иммунитета, признаков воспалительных реакций у детей с внутрижелудочковыми кровоизлияниями. Относительное количество CD4+ и показатели CD4+/CD8+ у недоношенных новорожденных, определенные в десятидневном возрасте необходимо учитывать при назначении лечения, избегая иммуностимуляции. Ключевые слова: внутрижелудочковые кровоизлияния, Тклеточный иммунитет, иммуноглобулины, недоношенные новорожденные. M.М. Chuiko Comparison of Immunological Parameters in Preterm Infants with Intraventricular Hemorrhage and without it Department of Pediatrics and Neonatology, FPGE Danylo Halytskyi Lviv National Medical University, Lviv Summary. It has been examined, that in 115 preterm infants with a gestational age less than 35 weeks, the dynamics of immune status change was determined in children with intraventricular hemorrhage (n=41) or without (n=74) based on an analysis of leukogram indicators, concentrations of IgA, IgM and IgG in the peripheral blood, quantification of subpopulations of T lymphocytes (CD3+, CD4+, CD8+, CD4+ / CD8+), who performed in the first and tenth day of life. The changes were detected in the examined parameters, which demonstrated the ability in children with a mean gestational age of 31.69±2.3 weeks to adjust the strength of the immune response to antigenic stimulation and control antigenic homeostasis in the first days after birth. Further, rapid depletion of reserve capacity immunity of children in both groups was observed, with a predominance of adaptive immunity processes tension, signs of inflammatory reactions in children with intraventricular hemorrhage. The relative number of CD4+ and indicators of CD4+/CD8+ in preterm infants identified in the age of ten must be considered in prescribing treatment, avoiding immune stimulation. Keywords: intraventricular hemorrhage, T-cell-mediated immunity, immunoglobulins, preterm infants. Надійшла 23.09.2013 року.

УДК 616.8 - 009.1 + 616 - 057 + 614.253.4 Якубовська І.О., Міщиха Л.П., Запорожець Т.Ю., Хромей М.І. Ризики виникнення синдромів хронічної втоми та емоційного вигорання у студентів-медиків в процесі навчання у ВНЗ залежно від індивідуального психологічного профілю Кафедра внутрішньої медицини № 2 (зав. каф. - проф. Н.М.Середюк) ДВНЗ “Івано-Франківський національний медичний університет” Кафедра загальної та експериментальної психології (зав. каф. - проф. В.П.Москалець) ДВНЗ “Прикарпатський національний університет ім. В.Стефаника” Резюме. На теперішній час все більш актуальною проблемою є синдроми хронічної втоми та емоційного вигорання. Студенти-медики підлягають багатьом ризикам виникнення даних синдромів у зв’язку з особливостями навчального процесу медичного університету. Проведене дослідження мало на меті виявити психологічні передумови появи у студентів ранніх ознак СЕВ та СХВ при дії на них різних факторів навчального процесу та виокремити групу осіб, в яких виявлено соматичні зміни протягом навчального року. Дослідження проводилось на базі медичного факультету ІваноФранківського національного медичного університету протягом 2012/

60

2013 навчального року. В ньому взяли участь 100 студентів, серед яких 50 з 1-го курсу та 50 з 5-го курсу. Був використаний метод анкетування стандартизованими анкетами («16 PF-опитувальник» (Форма С, №105) Р. Кеттела, тест на копінг-поведінку в стресових ситуаціях) та авторськими анкетами. Виявлена кореляція між індивідуальним психологічним профілем студента та появою у нього ранніх проявів СЕВ та СХВ. Було показане зростання проявів ранніх симптомів СЕВ/СХВ у п’ятикурсників, порівняно з першокурсниками. Студенти, які користуються копінг-стратегіями, орієнтованими на емоції та вирішення задач, потрапляють в групу ризику виникнення


Галицький лікарський вісник, 2013, Т. 20, № 4 СЕВ/СХВ, в той час як студенти, що користуються копінг-стратегією на уникнення, виявилися найбільш стресостійкими. Ключові слова: синдром хронічної втоми, синдром емоційного вигорання, студенти-медики.

Постановка проблеми і аналіз останніх досліджень. Синдром хронічної втоми (СХВ) G 93.3 – хронічна втома, яка не зникає після відпочинку, спричиняє значне зниження фізичної і розумової працездатності понад 50%, триває понад 6 місяців. Поширеність СХВ у дорослій популяції може сягати 3 - 10%. [1-2] СХВ є мультифакторним розладом нейроімунних механізмів, що проявляється у генетично схильних осіб в результаті активації інфекційними агентами імунної системи і дисрегуляції центральної нервової системи, переважно в скроневолімбічній ділянці. Патогенез базується на інфекційній – вірусній (вірус Епштейна–Барра, цитомегаловірус, віруси простого герпесу І, ІІ, VІ типів, ентеровіруси, ретровіруси) етіології, психічних порушеннях, тощо. [3,5] Сприяючими факторами є ті, що зумовлюють стрес. [4] Виділяють 5 основних груп симптомів СЕВ. Фізичні симптоми: тривалий субфебрилітет, лімфоаденопатія, артралгії, фіброміалгії, втома, виснаження, зміна маси тіла, порушення сну, підвищена пітливість, виразкові і запальні хвороби шкіри, функціональні розлади серцево-судинної системи, фарингіти. Емоційні симптоми: недостатність емоцій, песимізм, цинізм, байдужість до роботи та особистого життя, відчуття безнадії, агресивність, дратливість, тривога, когнітивні порушення, депресія, відчуття вини, істерики, душевні страждання, втрата ідеалів, надії, професійної перспективи; переважає відчуття самотності. Соціальні симптоми: низька соціальна активність, втрата зацікавленості в дозвіллі, обмежені соціальні контакти, відчуття ізоляції, неможливість зрозуміти інших, відчуття недостатньої підтримки зі сторони сім’ї, друзів, співробітників. Поведінкові симптоми: під час роботи з’являється втома і бажання відпочити, байдужість до їжі, незначне фізичне навантаження, тютюнопаління, зловживання алкоголем, ліками; нещасні випадки, часті падіння, травми, аварії, імпульсивна емоційна поведінка. Інтелектуальний стан: втрата зацікавленості в роботі, апатія, нудьга, туга, втрата інтересу до життя, креативності у виконанні роботи. Синдром емоційного вигорання (англ. Burnout; СЕВ) Z 73 — це процес поступової втрати професійної, когнітивної, фізичної енергії, що проявляється в симптомах емоційного, розумового виснаження, фізичної втоми, особистого відсторонення, зниження відчуття задоволення від виконаної роботи. Зустрічається в осіб, чия робота пов’язана з постійним спілкуванням, інтенсивною інтелектуальною працею, емоційними перевантаженнями (лікарі, психологи, педагоги, менеджери, робітники соціальних та охоронних служб). Виявляється посиленням байдужості до своїх обов’язків та всього, що відбувається на роботі, дегуманізації у формі чимраз більшого негативізму, відчуття власної професійної нездатності, а в кінцевому підсумку різким погіршенням якості життя. В подальшому розвиваються деперсоналізація, невротичні розлади і психосоматичні захворювання. [6] СЕВ і СХВ можна розглядати як етапи однієї психосоматичної патології, при якій СЕВ – це брак визнання результатів праці та досягнень, а СХВ – як брак любові, радості та втрата резервів організму. Важливим у виникненні СЕВ та СХВ є психотип особистості та спосіб її реагування в стресовій ситуації – копінг-стратегія. До базових копінг-стратегій відносять: 1) Стратегія на вирішення задач - це активна поведінкова стратегія. Людина прагне використовувати особистісні ресурси для пошуку можливих способів ефективного вирішення проблеми, шукає і застосовує шляхи для якомога ефективнішого і швидшого вирішення стресової ситуації. 2) Стратегія на уникання – це пасивна поведінкова стратегія. Людина прагне уникнути вирішення, витісняє необхідність розв’язання проблеми, уникає стресової ситуації, яка склалася, часто стає байдужим свідком подій.

3) Стратегія, орієнтована на емоції – експресивна. В стресі особі притаманні внутрішня напруга, тривожність, розгубленість, паніка, істерика тощо. Що стосується актуальності дослідження ризиків виникнення синдромів хронічної втоми та емоційного вигорання саме у студентів-медиків, то має місце факт, що вони мають вищу інтенсивність та стресогенність навчального процесу за рахунок: підвищених вимог до інтеграції різнохарактерних дисциплін; високої емоційної включеності та емпатійності під час перебування на базі клінік і лікарень; підвищений (у порівнянні з іншими ВНЗ) ступінь відповідальності на практичних заняттях під час огляду пацієнта, проведення різних медичних маніпуляцій; високе академічне навантаження (протягом першого семестру на першому та п’ятому курсі передбачено вивчення 16 навчальних дисциплін), труднощі при здачі іспитів і заліків (модульний контроль у студентів 1 курсу після першого семестру складає 10 модулів, у студентів 5 курсу – 16 модулів). Мета дослідження: Виявити ризики розвитку синдромів хронічної втоми та емоційного вигорання у студентів-медиків у процесі навчання у ВНЗ залежно від індивідуального психологічного профілю. Матеріал і методи дослідження Дослідження проводилось на базі Івано-Франківського національного медичного університету. В ньому взяли участь 100 студентів медичного факультету. З них: 50 – студентів 1 курсу і 50 – студентів 5 курсу. Як методичний інструментарій нами були використані наступні методики: 1. «16 PF-опитувальник» (Форма С, №105) Р. Кеттела для визначення рис особистості студентів-медиків. 2. Копінг-поведінка в стресових ситуаціях (С.Норман, Д.Ф. Єндлер, Д.А. Джеймс, М.І. Паркер; адаптований варіант Т.А. Крюкової) 3. Метод опитування (авторські анкети, інтерв’ю, бесіда), спостереження.

Результати дослідження та їх обговорення Опитування та анкетування було проведено двічі: на початку навчального року, щоб мати уявлення про вихідний (базовий) стан студентів, та після першого семестру під час здачі ними модульного контролю, коли навчальне навантаження та стреси, зазвичай, досягають піку. По завершенню опитування за клінічними ознаками СЕВ/СХВ була виділена група студентів, у яких виявлено тривалі та стійкі відхилення в фізичному стані (група А) - група ризику виникнення СЕВ/СХВ. На початку навчального року вона склала: 68% - 1 курс та 28% - 5 курс. Відповідно всі інші опитані увійшли в групу В - студенти без ознак ризику розвитку СЕВ/СХВ (32% - 1 курс та 72% - 5 курс). Слід зазначити, що група А після закінчення першого семестру на 1 курсі скоротилася на 10% за рахунок адаптації та активації внутрішніх резервів особистості першокурсників, проте на 5 курсі група А зросла на 12%, що свідчить про психічне та фізичне виснаження студентів у процесі навчання. Динаміка клінічних симптомів наведена в таблиці 1. Тобто можемо простежити приріст студентів, у яких з’явилися чи посилилися прояви СЕВ/СХВ протягом навчання в першому семестрі. За допомогою стандартизованих психологічних тестів виявлено особливості психологічного профілю студентів групи А і основна увага була звернена до факторів (Р. Кеттел «16 PF – опитувальник»), які є вагомими у розвитку психосоматичних змін: MD – «адекватність самооцінки», фактору С – «емоційна нестійкість – емоційна стійкість», фактору О – «впевненість в собі – тривожність», фактору Q3 – «низький самоконтроль – високий самоконтроль», фактору Q4 – «розслабленість – напруженість. В групі А отримано наступні результати: середньостатистичний першокурсник, який потрапив у групу ризику щодо виникнення СЕВ/СХВ, володіє такими особистісними рисами як завищена самооцінка, лабільність інтересів, невротична схильність, вразливість, гіпермотивація, фрустраційна готовність. На п’ятому курсі в групу ризику потрапили студенти з дещо іншими психосо-

61


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1 Динаміка клінічних проявів СХВ у студентів 1 та 5 курсу за перший семестр за даними анкетування Приріст показника за І Симптоми СХВ семестр 1 курс 5 курс Відчуття втоми понад 50% за останні 6 -10% +12% місяців Відчуття втоми, неадекватної фізичним та -4% +4% психоемоційним навантаженням Частий головний біль під час та після +2% 0% навчання Порушення сну +2% +6% Потреба у лікуванні за останні 6 місяців +20% +16% Потреба у додатковому відпочинку під час +10% +10% навчання Погіршення зовнішнього вигляду +2% +24%

Таблиця 2. Характерологічні психологічні особливості опитаних групи А Фактор по опитувальнику Кеттела 1 курс 5 курс Фактор MD «адекватність самооцінки»: 1) занижена самооцінка 7% 25% 2) завищена самооцінка 25% 38% Фактор С «емоційна нестійкість – емоційна стійкість»: 1) лабільність інтересів, невротична схильність 31% 25% 2) емоційна ригідність 19% 23% Фактор О – «впевненість в собі – тривожність»: 1) вразливість, ранимість 69% 75% 2) самовпевненість 7% 0% Фактор Q3 – «низький самоконтроль – високий самоконтроль»: 1) недостатній самоконтроль 31% 0% 2) перфекціонізм 19% 88% Фактор Q4 – «розслабленість – напруженість»: 1) низька мотивація 14% 0% 2) гіпермотивація, фрустраційна готовність 25% 38%

матичними профілями особистості: завищена самооцінка, внутрішній гіперконтроль та перфекціонізм (88% опитуваних!), вразливість, ранимість (75% опитуваних), гіпермотивація. Важливо відзначити, що на п’ятому курсі не виявлено студентів, (фактор MD “адекватність самооцінки”, від’ємна кореляція котрі б мали недостатній самоконтроль, самовпевненість чи r=-0,307, при p<0,05); замкнутість (фактор А ”замкнутістьнизьку мотивацію. (Таблиця 2) Це свідчить про зростання товариськість”, від’ємна кореляція r=-0,451, при p<0,01); відповідальності у майбутніх медиків у процесі навчання. нерішучість (фактор H “нерішучість-сміливість”, від’ємна У рамках дослідження проведено аналіз копінг-стратегій кореляція r = -0,376, при p<0,01); низький самоконтроль (фактор студентів-медиків. Серед студентів 1 та 5 курсів: копінг-стратегія Q3 “низький самоконтроль-високий самоконтроль”, від’ємна на вирішення задачі (56% - 1 курс, 74% - 5 курс), копінг-стратегія кореляція r = -0,311, при p<0,05). Це є ознакою того, що студентина уникнення (30% -1 курс, 22% - 5 курс) та копінг-стратегія на медики 5-го курсу, які обирають копінг на емоції, невпевнені в емоції (14% - 1 курс, 4% - 5 курс) (рис. 1). своїх силах, неадекватно оцінюють свої можливості. Так як особи першого типу реагування у стресі проявляють Також в групу ризику потрапляють студенти, що кориснадмірну активну дієвість, експресивність на тлі високої туються копінг-стратегією, орієнтованою на вирішення задач, відповідальності та надмірного навчального навантаження, вони яка корелює з експресивністю (фактор F “стриманістьшвидко виснажуються, тому 89% з них складають групу ризику експресивність”, додатна кореляція r = 0,391, при p<0,01). Щоб розвитку психосоматичної патології. Також в групу ризику ефективно вирішувати ті чи інші проблеми, студентам-медикам входять всі особи з переважаючою копінг-стратегією на емоції. з копінг-стратегією на вирішення задач допомагає життєСтуденти, яким притаманна копінг-стратегія на уникнення, радісність, вміння створювати якісні взаємозв’язки з іншими практично не потрапляють в групу А, оскільки вони не схильні людьми, енергійність, вміння домовитися через спілкування піддаватися емоціям і афектам, а в деяких випадках їм, в певній тощо. З іншої сторони такі люди боляче переживають свої мірі, притаманна емоційна ригідність і нечуттєвість. помилки та невдачі, вони багато працюють та часто не Встановлено кореляційний взаємозв’язок між копінг- відчувають межі між фізичним та психологічним комфортом і стратегіями і особистісними рисами студентів (за допомогою виснаженням. Зазвичай це перфекціоністи, які мають високі коефіцієнту кореляції Пірсона), в результаті чого отримано показники в навчанні, гостро переживають брак визнання статистично значущі зв’язки між копінг-стратегіями та результатів своєї діяльності, жертвують відпочинком, окремими особистісними рисами студентів-медиків, нормальним сном, скорочують кількість соціальних контактів виявленими при діагностуванні опитувальником Р.Кеттела. на користь навчання. В результаті вони виснажуються та частина У групі ризику опинилися всі студенти-медики, що ко- таких студентів складає групу А. ристуються копінг-стратегією, орієнтованою на емоції, оскільки Копінг-стратегія, орієнтована на уникнення, корелює з вона корелює із такими рисами особистості, як: емоційна нестійкість (фактор C “емоційна нестійкість-емоційна стійкість”, від’ємна кореляція r=-0,486, при p<0,01); підпорядкованість (фактор E “підпорядкованість80 % 7 4% домінантність”, від’ємна кореляція r=0,397, при p<0,01); тривожність (фактор 70 % O “впевненість в собі-тривожність”, 5 6% додатна кореляція r = 0,462, при p<0,01). 60 % Тобто особистості з домінантною копінг50 % К опі н г- стра те гія н а стратегію на емоції відчувають внутрішню в и рі ш ен ня за дач і тривогу, напруження, емоційний і психо40 % К опі н г- стра те гія н а логічний тиск, який створюють несприят30% ун и к н ен ня ливі стресові ситуації. Такі люди дуже емо30 % 22 % К опі н г- стра те гія н а е моц ії ційно вразливі і зазвичай гостро пережи20 % вають стресові ситуації. Кореляція копінг1 4% стратегії, орієнтованої на емоції, з рисою 4% 10 % особистості «підпорядкованість» свідчить про те, що такі студенти часто є залежними 0% від думки оточуючих, їм притаманна неК о пін г- ст рате гії ви х од у з з Ко пін г-с трат егії ви хвиходу о ду з Копінг-стратегії виходу Копінг-стратегії з с тр ес о вих с и ту а ційнавс тр ес о вихситуацій с и ту ац ій навсамостійність та високий рівень тривожстресових ситуацій стресових н авч аль н ого пр о це с у навч аль н ог о п ро це с у чального процесу 1 курсу чального5процесу 5 курсу ності щодо своїх помилок. У студентів 51 кур с кур с го курсу ця копінг-стратегія також корелює Рис. 1. Розподіл студентів за копінг-стратегіями з такими рисами як низька самооцінка

62


Галицький лікарський вісник, 2013, Т. 20, № 4

такими рисами особистості як: емоційна стійкість (фактор С “емоційна нестійкість-емоційна стійкість”, додатна кореляція r=0,289, при p<0,05) і експресивність (фактор F “стриманістьекспресивність”, додатна кореляція r = 0,305, при p<0,05). Тому для уникнення стресових ситуацій студенти-медики з копінгстратегією, орієнтованою на уникнення часто вдаються до міжособистісної взаємодії з іншими людьми. Спілкування для них є соціально важливим феноменом, в спілкуванні вони життєрадісні, імпульсивні, рухливі, веселі, безтурботні. Тобто експресивність дає змогу забути про труднощі і стреси та переключитися на щось інше. Такі люди є стійкішими щодо ризиків виникнення СЕВ/СХВ. Висновки 1. У студентів Івано-Франківського національного медичного університету, що навчаються відповідно до Болонського процесу, виявлено ранні прояви СЕВ та СХВ. Так, ознаки цих синдромів були зафіксовані у 68% (1 курс) та 28% (5 курс) на початку навчального року, 58% (1 курс) та 50% (5 курс) – після закінчення першого семестру. 2. Виявлено чітку кореляцію між особистісними рисами студентів, їх копінг-стратегіями виходу зі стресових ситуацій та виникненням у них ранніх ознак психічних та соматичних порушень. Так, студенти, що переважно користуються копінгстратегією на емоції, завжди потрапляють у групу ризику, оскільки вони мають такі риси як низька самооцінка, емоційна нестійкість, тривожність, підпорядкованість, нерішучість, замкнутість, низький самоконтроль. Студенти, що обирають копінг на вирішення задач, часто втрачають баланс між навчанням та відпочинком, внаслідок чого швидко виснажуються. У студентів, які користуються копінгом на уникнення, рідко фіксуються ознаки СЕВ/СХВ. 3. Позитивним моментом є зростання кількості осіб протягом навчання від 1 до 5 курсу, які користуються копінгстратегією на вирішення задачі, тобто прагматично адаптуються до навчання (приріст складає = +18%). Але разом з цим частина їх поповнює групу ризику по СЕВ і СХВ. 4. Кореляція з особистим психопрофілем студента та копінгстратегіями реакції на стрес доводить необхідність психологічного супроводу студентів протягом навчального року, що може стати профілактичним заходом по виникненню СЕВ та СХВ. Це найбільше стосується тої вибірки студентів, що користуються копінг-стратегією, орієнтованою на емоції, їм потрібне особливе відношення викладачів та адаптивні психотренінги. Студентам, які обирають копінг на вирішення задач, рекомендовано дозувати навчальне навантаження індивідуально та при потребі оформити вільний графік відвідування, їм потрібне заохочення в процесі навчання та схвалення результатів їх роботи. Важливим є диференційований підхід викладачів до студентів з різними копінг-стратегіями у навчальному процесі. 5. Доречною є діагностика особистісних рис та стратегій виходу зі стресових ситуацій абітурієнтів з метою уникнення допуску до навчального процесу тих людей, які не зможуть адекватно адаптуватися до навантажень і складуть групу хворих на СЕВ та СХВ після закінчення навчання у ВНЗ. Перспективи подальших досліджень Перспективним є проведення лонгітудних досліджень зі спостереженням за студентами-медиками в процесі їх навчання від 1 курсу до 6 курсу із застосуванням індивідуальних та групових методик психологічної адаптації, що сприятиме ефективнішому навчанню та підтриманню відповідного рівня здоров’я. Література 1. Вермель А. Е. Синдром хронической усталости /А. Е. Вермель // Клиническая медицина. - 1999. - № 7. - С. 11-15. 2. Дзяк Л. А. Синдром хронической усталости / Л. А. Дзяк, А. Н. Шульга // Международный медицинский журнал. - 2002. - № 1. - С. 53-57. 3. Власюк В. Синдром хронічної втоми: погляд інтерніста на хворобу цивілізації [Електронний ресурс] / В. Власюк, В. Власюк //

Медичний вісник. - 29.11.2012. - Режим доступу до журн.: http:// medvisnyk.org.ua/content/view/3201/29/ 4. Комаров С. Г. Синдром хронической усталости (распространенность и организация медицинской помощи). Диссертация и автореферат, ВАК 14.00.33. [Електронний ресурс] / С. Г. Комаров.Режим доступу: http://www.dissercat.com/content/sindrom-khronicheskoiustalosti-rasprostranen nost-i-organizatsiya-meditsinskoipomoshchi#ixzz2ZsXVKuwH 5. Goldstein J. A. Chronic fatigue syndromes: the limbic hypothesis. / J. A. Goldstein. - Binghamton, NY : Haworth medical press. - 1993. - 259 pp. 6. Enzmann D. Burnout and coping will burnout. Development and evaluation of a burnout workshop. / D. Enzmann, P. Berief, C. Engelkamp et al. // Berlin: Technische Univercitat Berlin Якубовская И.О., Мищиха Л.П., Запорожец Т.Ю., Хромей М.И. Риски возникновения синдромов хронической усталости и эмоционального выгорания у студентов-медиков в процессе обучения в ВУЗе в зависимости от индивидуального психологического профиля Резюме. В наше время синдромы хронической усталости и эмоционального выгорания становятся актуальной проблемой. Студенты-медики подвергаются многим рискам возникновения данных синдромов в связи с особенностями учебного процесса медицинского университета. Целью данного исследования было установить психологические предпосылки возникновения у студентов ранних признаков СХУ и СЭВ при воздействии на них различных факторов учебного процесса и выделить групу лиц, у которых обнаружены соматические изменения на протяжении учебного года. Исследование проводилось на базе медицинского факультета Ивано-Франковского национального медицинского университета на протяжении 2012/2013 учебного года. В нем приняли участие 100 студентов, среди которых 50 с 1-го курса и 50 с 5-го курса. Был использован метод анкетирования стандартизованными анкетами («16 PF-опросник» (Форма С, №105) Р. Кеттела, тест на копинг-поведение в стрессовых ситуациях) и авторскими анкетами. Обнаружена корреляция между индивидуальным психологическим профилем студента и возникновением у него ранних проявлений СХУ и СЭВ. Было показано возрастание количества ранних симптомов СХУ и СЭВ у пятикурсников в сравнении с первокурсниками. Студенты, которые пользуются копинг-стратегиями, ориентированными на емоции и решение задач, попадают в группу риска по возникновению СХУ и СЭВ, в то время как студенты, которые пользуются копинг-стратегией на избежание, оказались наиболее стрессоустойчивыми. Ключевые слова: синдром хронической усталости, синдром эмоционального выгорания, студенты-медики. I.O. Yakubovska, L.P. Mishchyha, T.Yu. Zaporozhets, M.I. Hromei The Risks of Chronic Fatigue Syndrome and Burnout Syndrome Appearance in Medical Students Studying Depending on their Individual Psychological Type Department of Internal Medicine No.2 (Head of the Department – Prof. N.M. Serediuk) Ivano-Frankivsk National Medical University, Ivano-Frankivsk Department of General and Experimental Psychology (Head of the Department – Prof. V.P. Moskalets) Vasyl Stefanyk Prycarpathian National University Summary. Chronic fatigue syndrome (CFS) and burnout syndrome (BS) has appeared to be an important problem recently. Medical students experience various risks of development of these syndromes because of the circumstances of their studying process. The objective of the study was to investigate the physiological predispositions of development of the early symptoms of CFS/BS under various factors of the education process and find out the group of students, who underwent noticeable somatic changes during the academic year. The study was conducted at Faculty of Medicine, National Medical University in Ivano-Frankivsk, Ukraine during the academic year of 2012/ 2013. One hundred of students were involved. Half of those were freshmen, while the other half were the fifth-year students. The standard survey tests were used, namely 16PF Questionnaire by R.B. Kettel and a coping-strategy for stress situation test, as well as the original surveys developed by us. Correlations between individual physiological profile of the student and the susceptibility to CFS/BS were found. The increase of early symptoms of CFS/BS was shown in case of pre-graduates in comparison to the freshmen. The students of emotional and problem-solving coping-strategies are in the group of risk of having CFS/BS, while those of avoiding copingstrategy have proven to be the most stress-resistant. Keywords: chronic fatigue syndrome, burnout syndrome, medical students. Надійшла 30.09.2013 року.

63


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 616-071+577.112+616-002+616.248

Яцишин Р.І., Попадинець І.Р. Роль визначення С-реактивного білка в діагностиці запального синдрому при бронхіальній астмі Кафедра внутрішньої медицини №1, клінічної імунології та алергології ім. акад. Є.М. Нейка ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Бронхіальна астма – одне із найбільш розповсюджених хронічних захворювань і розглядається в сучасному суспільстві не лише як значна медична, але і як соціальна проблема. Одним з найчастіших поєднань вважають поєднання БА з гастроезофагеальною рефлюксною хворобою (ГЕРХ). За даними різних авторів, розповсюдженість ГЕРХ у хворих на БА коливається від 32 до 90%. Підвищення рівня СРБ є універсальною ознакою запалення незалежно від локалізації та інших характеристик запального процесу, що дозволяє назвати його основним маркером системного запалення в організмі. Беручи до уваги загальну біологічну функцію СРБ, потрібно вважати закономірним виявлення цього білка безпосередньо у «вогнищах ураження». Виявлений досить виражений взаємозв’язок між запаленням органів дихальної системи та системними запальними проявами. Визначення рівня СРБ у мокротинні є ознакою місцевої запальної відповіді та може бути використано для діагностики, моніторингу та оцінки ефективності протизапальної терапії. Ключові слова: бронхіальна астма, гастроезофагеальна рефлюксна хвороба, С-реактивний білок.

Постановка проблеми і аналіз останніх досліджень. За результатами популяційних епідеміологічних досліджень, поширеність БА в більшості країн світу коливається від 1 до 18%. За даними ВООЗ, в даний час від БА у всьому світі страждає 300 млн. чоловік, а до 2025р. експерти прогнозують збільшення цієї цифри ще на 100 млн. Щорічно захворювання забирає життя більше 250 тис. чоловік, а кількість хворих з діагнозом «бронхіальна астма» нестримно росте, подвоюючись кожні 15 років. В Україні на БА страждає 46% дорослого населення або 2 млн. чоловік старше 15 років [3, 5, 8]. Поєднання БА із патологією травного тракту – одне з найбільш частих, клінічно різноманітних і тяжких, яке ускладнює її перебіг і робить істотний внесок у формування синдрому взаємного обтяження [6]. За різними даними, поєднаний перебіг БА та хвороб органів травлення спостерігається у 8-50% випадків. Розповсюдженість патологічного ГЕР у хворих на БА (за даними 24-годинної рН-метрії) коливаються від 32 до 90% [4, 7]. У 82% хворих на БА виявляють ГЕРХ, у 30-80% – кислотний рефлюкс виникає частіше і триває довше, ніж у загальній популяції [7]. Загострення ГЕРХ розглядається як один із тригерів приступів БА. Поєднання двох патологій негативно впливає на перебіг кожної з них окремо. Присутність ГЕРХ у пацієнтів з БА призводить до погіршення контролю за перебігом БА, зниження якості життя, розвитку депресії. Наявність печії у хворих на БА супроводжується підвищеною потребою у використанні інгаляційних препаратів на 13,8% [4, 11]. Системна імунорегуляція у хворих на БА, окрім цитокінового каскаду, забезпечується збільшенням білків гострої фази, до яких відносять СРБ, орозомукоїд, церулоплазмін, феритин, гаптоглобін, фібриноген та інші. Підвищення рівня СРБ, на думку S. Kony et al. (2004), безпосередньо пов’язано з ураженням дихальної системи і, особливо, з гіперреактивністю бронхів [10, 15]. Виявлений досить виражений взаємозв’язок між запаленням органів дихальної системи та системними запальними проявами. За даними багатьох вчених, між рівнем СРБ в сироватці крові та показниками ОФВ1 існує сильний зворотній кореляційний зв’язок, який доводить значну роль СРБ у підтриманні гіперреактивності бронхів та посиленні бронхообструктивного синдрому при БА [1, 9, 14, 16, 17]. З огляду на загальну біологічну функцію СРБ потрібно вважати закономірним виявлення цього білка безпосередньо у «вогнищах ураження». На сьогодні в літературі йдеться про можливість локального синтезу СРБ

64

активованими клітинами: макрофагами, ендотеліоцитами, а також епітеліоцитами легень [2, 12, 13]. Хронічне запалення при БА локалізується в трахеобронхіальному дереві. Тому значний інтерес представляє місцеве визначення даного маркера запалення. Метою дослідження було оцінити діагностичну цінність визначення СРБ у сироватці крові та мокротинні у хворих на БА та на БА із супутньою ГЕРХ. Матеріал і методи дослідження Обстежено 40 хворих на БА ІІ-ІІІ ступенів тяжкості. З них було 20 хворих на БА без супутньої патології та 20 хворих на БА з супутньою ГЕРХ. Вік пацієнтів коливався від 19 до 68 років, в середньому (41,4±4,5) роки. Діагноз БА виставляли на основі клінічних, лабораторних та інструментальних досліджень, згідно з наказом МОЗ України № 128 від 19.03.2007 та № 868 від 08. 10.2013р. Стан функції зовнішнього дихання визначали за загальноприйнятими показниками за допомогою комп’ютерної спірографії. Наявність ГЕРХ встановлювали шляхом опитування щодо наявності характерних типових симптомів – печії, відрижки кислим (регургітація) та за допомогою ФЕГДС (згідно з наказом МОЗ України № 271 від 13.06.2005 року) та 24-годинного внутрішньостравохідного рН-моніторингу. Рівень СРБ у сироватці та мокротинні визначали напівкількісним методом латекс-аглютинації за допомогою набору реактивів “Dialab” (Австрія). Для визначення СРБ в мокротинні його розводили розчином 0,9% NaCl 1:1. Після цього протягом 10 хв центрифугували при 5000об/хв. Для дослідження відбирали надосадову рідину, яку розводили 0,9% NaCl згідно з інструкцією. Для визначення СРБ у мокротинні у контрольній групі проводили його індукцію методом H.A. Bickerman. Забір мокротиння здійснювали після інгаляцій гіпертонічного розчину. Проводили інгаляції тривалістю 4-5хв і перервою в 10-15хв з поступовим підвищенням концентрації розчину NaCl на 1% (тобто послідовно використовували 3-4-5%-й розчин) за допомогою ультразвукового небулайзера. Всі хворі були поділені на 2 групи: І (n=20) – хворі на БА без супутньої патології та ІІ (n=20) – хворі на БА з супутньою ГЕРХ. Пацієнти обох підгруп отримували препарати базової терапії БА рекомендовані наказом МОЗ України № 128 від 19.03.2007 та №868 від 08.10.2013р. Окрім базового лікування БА, всі обстежувані отримували кверцетин в дозі 1 г (1/2 чайної ложки) 2 рази на добу. Перші 5 днів хворі отримували розчинну форму кверцетину – корвітин по 50 мг на 100 мл фізіологічного розчину 1 раз на добу, в/в краплинно, а далі пероральну – кверцетин. Для порівняння було обстежено групу практично здорових осіб (n=20). Для об’єктивного судження про ступінь вірогідності результатів дослідження був застосований варіаційно-статистичний метод аналізу отриманих результатів із використанням пакету статистичних програм “Microsoft Excel”.

Результати дослідження та їх обговорення У всіх обстежених хворих були виявлені наступні симптоми: напади задухи різної тяжкості та тривалості, які турбували в різні періоди доби і провокувалися різноманітними факторами, задишка при фізичному навантаженні та у спокої, кашель сухий або з виділенням невеликої кількості густого слизистого мокротиння, закладеність носа, загальна слабість, швидка втомлюваність, зниження працездатності та розлади сну. Залежності від ступеня тяжкості захворювання ті чи інші симптоми проявлялись у більшій чи меншій мірі. Слід зауважити, що у хворих на БА з супутньою ГЕРХ клінічні прояви основного захворювання були більш вираженими, а саме: нічні напади задухи були частішими та більш інтенсивними, задишка спостерігалась при незначному фізичному навантаженні, а також у спокої, кашель тур-


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1. Показники функції зовнішнього дихання у досліджуваних групах (М±m) Контроль I група IІ група Показник % (n = 20) (n = 20) (n = 20) ФЖЄЛ 99,352,14 77,880,79* 74,520,67*є ОФВ1 94,122,18 73,181,18* 67,320,96* ОФВ1/ФЖЄЛ 94,741,23 87,061,32* 90,121,05* МОШ25 89,312,09 45,121,22* 41,820,98* МОШ50 86,112,47 48,661,38* 44,841,09* МОШ75 85,092,32 51,621,78* 49,181,57* Примітки: * – достовірність різниці між групами та контролем (р<0,05);  – достовірність різниці показників з аналогічними в І групі (р<0,05)

бував більше вночі та при горизонтальному положенні тіла. При оцінці ФЗД за допомогою комп’ютерної спірографії спостерігалось погіршення показників у обох досліджуваних групах, особливо у групі з супутньою ГЕРХ (табл. 1) Результати проведеної спірографії показали, що показники ФЗД у всіх обстежених хворих на БА були достовірно нижчими, ніж у групі контролю (р<0,05). У І групі спостерігалось зниження ФЖЄЛ на 21,6%, ОФВ1 – на 22,2%, МОШ25 – на 49,5%, МОШ50 – на 43,5%, а МОШ75 – на 39,3%, порівняно з контрольною групою (р<0,05). ОФВ1/ФЖЄЛ був нижчим на 8,2%, ніж у групі контролю. У хворих на БА з супутньою ГЕРХ відзначалися більш виражені зміни показників ФЗД, а саме зниження ФЖЄЛ на 24,9%, ОФВ1/ФЖЄЛ – на 4,9% ОФВ1 – на 28,5%, МОШ25 – на 53,2%, МОШ50 – на 47,9%, а МОШ75 – на 42,2%, порівняно з контрольною групою (р<0,05). Ці дані вказують на те, що у пацієнтів з поєднаною патологією бронхообструктивний синдром є більш вираженим, що обтяжує перебіг захворювання. Підвищення рівня СРБ є універсальною ознакою запалення незалежно від локалізації та інших характеристик запального процесу, що дозволяє назвати його основним маркером системного запалення в організмі. Ми проводили визначення СРБ у сироватці крові обстежених хворих. Результати обстеження показали, що рівень СРБ у сироватці був достовірно (р<0,05) підвищений в обох групах обстежуваних (табл. 2). У групі хворих на БА його рівень був у 3,8 разів, а у групі хворих на БА з супутньою ГЕРХ – у 4,7 разів вищий відносно групи контролю. При порівнянні показників рівня СБР у досліджуваних групах між собою достовірної різниці не було. Результати визначення СРБ у мокротинні показали його підвищений рівень у всіх хворих. У І групі рівень СРБ був вищим у 5,9 разів, у ІІ групі – у 6,9 разів (р<0,05). Для того, щоб оцінити вплив системного запалення на показники ФЗД у хворих на БА, ми провели кореляційний аналіз між рівнем СРБ у сироватці та ОФВ1. Виявлено, що у хворих І та ІІ групи між даними показниками існує сильний зворотній кореляційний зв’язок (r= -0,71, р<0,01) та (r=-0,76, р<0,01). Також при аналізі кореляційного зв’язку між рівнем СРБ у мокротинні та ОФВ1 у пацієнтів ІІ групи виявлено сильну зворотню залежність (r= -0,81, р<0,01). Висновки 1. У хворих на БА та на БА з супутньою ГЕРХ визначається підвищений рівень СРБ у сироватці, що є ознакою персистуючого системного запалення і посилює бронхообструктивний синдром. Підвищення рівня СРБ у мокротинні свідчить про наявність місцевої запальної реакції в бронхіальному дереві та підтверджує думку багатьох вчених про місцевий синтез СРБ. 2. Для діагностики активності запального процесу в бронхах у хворих на бронхіальну астму рекомендується визначати рівень С-реактивного білка в мокротинні, що дозволить підібрати адекватну схему лікування із

Таблиця 2. Рівень СРБ у сироватці крові та мокротинні хворих, (M±m) Контроль І група ІI група Показник (n = 20) (n = 20) (n = 20) СРБ у сироватці, 1,63±0,56 6,24±0,9* 7,68±0,85* мг/л СРБ у мокротинні, 1,77±0,82 10,4±1,89* 12,3±1,53* мг/л Примітка: * – достовірність різниці показників між групами та контролем (р<0,05);  – достовірність різниці показників в сироватці та мокротинні (р<0,05)

застосуванням протизапальних препаратів. Література 1. Авдеев С. Н. С-реактивный белок – новый или старый маркер бронхолегочных инфекций [Текст] / С. Н. Авдеев, Г. Е. Баймаканова // Атмосфера. Пульмонология и аллергология. – 2008. – № 4. – С. 26–32. 2. Глушко Л. В. C-реактивний білок: діагностичні та прогностичні перспективи визначення в плазмі/сироватці крові й інших біологічних рідинах організму / Л. В. Глушко, Н. М. Коваль, Н. М. Павелко // Клиническая иммунология. Алергология. Инфектология. – 2010. – № 7. – С. 58–61. 3. Дземан М. І. Лекція: Бронхіальна астма 1 частина / М. І. Дземан // Сучасні інфекції. – 2007. – № 3. – С. 66–77. 4. Матвєєва Л. Коморбидная патология: гастроезофагеальная рефлюксная болезнь и бронхиальная астма / Л. Матвєєва // Здоров’я України. Тематичний номер. – 2011. – С. 14–15. 5. Островський М. М. Роль антилейкотрієнових препаратів в лікуванні бронхіальної астми / М. М. Островський, О. І. Варунків // Здоров’я України. – 2012. – № 3. – С. 33–34. 6. Победьонна Г. П. Поширеність, особливості клініки і патогенезу бронхіальної астми, поєднаної з патологією органів травлення / Г. П. Победьонна, О. Г. Солона // Вісник Сумського державного університету. Серія медицина. – 2007. – №2. – С.86-94. 7. Рання діагностика гастроезофагальної рефлюксної хвороби (огляд літератури) / В.П.Польовий [та ін.] // Буковинський медичний вісник.–2010.–Том14, №1(53).–С.138-141. 8. Zorica Zivkovic. Загострення бронхіальної астми: причини розвитку, імунопатогенез, клініка і лікування гострого нападу. Внутрішня медицина. – 2007. – №3. – С. 89–100. 9. Amina Hamed Ahmad Al Obaidi. Association Between C Reactive Protein and Asthma / Amina Hamed Ahmad Al Obaidi, Abdul Ghani Mohamed Al Samarai, Abdul Karem Yahya Jawad, Jasim Mohamed Al Janabi // Turkish Thoracic Journal. – 2010. – № 11. – С. 98104. 10. Association of bronchial hyperresponsiveness and lung function with C-reactive protein (CRP): a population based study [Text] / S. Kony [et al.] // Thorax. – 2004. – Vol. 59. – P. 892–896. 11. Bor S., Kitapcioglu G., Solak Z. A. Prevalence of gastroesophageal reflux disease in patient with asthma and chronic obstructive pulmonary disease / S. Bor, G. Kitapcioglu, Z. A. Solak // J Gastroenterol Hepatol. – 2010. – №25 (2). – P. 309–313. 12. Jane M. Gould Expression of C-Reactive Protein in the Human Respiratory Tract / Jane M. Gould, Jeffrey N. Weiser // Infection and Immunity. – 2001. – Vol. 69 (3). – P. 1747–1754 13. Lindsay Ramage Expression of C-Reactive Protein in Human Lung Epithelial Cells and Up regulation by Cytokines and Carbon Particles / Lindsay Ramage, Lorna Proudfoot, Keith Guy// Inhalation Toxicology. – 2004. – №16. – Р. 607–613. 14. Mathews S. An update on the use of pantoprazole as a treatment for gastroesophageal reflux disease / S. Mathews, А. Reid, C. Tian, Q. Cai // Clinical and Experimental Gastroenterology. – 2010. – Vol. 3. – P. 11–16. 15. Мiyoshi Fujita C-reactive protein levels in the serum of asthmatic patients / Мiyoshi Fujita, Shigeharu Ueki, Wataru Ito // Annals of Allergy, Asthma & Immunology. – 2007. – Vol. 99. – P. 48-53. 16. Takemura M. High sensitivity C-reactive protein in asthma / M. Takemura, H. Matsumoto, A. Niimi [et all] // European Respiratory Journal. – 2006. – Vol. 27. – P. 908–912. 17. Wouters Emiel F. M. Systemic and Local Inflammation in Asthma and Chronic Obstructive Pulmonary Disease / Emiel F. M. Wouters, Niki L. Reynaert, Mieke A. Dentener // Proceedings of the American Thoracic Society. – 2009. – Vol. 6, No. 8. – Р. 638–647.

65


Галицький лікарський вісник, 2013, Т. 20, № 4 Яцишин Р.И., Попадинец И.Р. Роль определения С-реактивного белка в диагностике воспалительного синдрома при бронхиальной астме Резюме. Бронхиальная астма – одно из самых распространенных хронических заболеваний и рассматривается в современном обществе не только как значительная медицинская, но и как социальная проблема. Одним из наиболее частых сочетаний считают сочетание БА с гастроэзофагеальной рефлюксной болезнью (ГЭРБ). По данным разных авторов, распространенность ГЭРБ у больных БА колеблется от 32 до 90 %. Повышение уровня СРБ является универсальным признаком воспаления независимо от локализации и других характеристик воспалительного процесса, что позволяет назвать его основным маркером системного воспаления в организме. Принимая во внимание общую биологическую функцию СРБ, нужно считать закономерным выявления этого белка непосредственно в «очагах поражения». Обнаружена достаточно выраженная взаимосвязь между воспалением органов дыхательной системы и системными воспалительными проявлениями. Определение уровня СРБ в мокроте является признаком местного воспалительного ответа и может быть использовано для диагностики, мониторинга и оценки эффективности противовоспалительной терапии. Ключевые слова: бронхиальная астма, гастроэзофагеальная рефлюксная болезнь, С-реактивный белок.

R.І. Yatsyshyn I.R. Popadynets The Role of Determining C-Reactive Protein when Diagnosing Inflammatory Syndrome in Bronchial Asthma Summary. Asthma is one of the most common chronic diseases and is seen in today’s society not only as a significant medical, but also as a social problem. One of the most common combinations consider combining BA with gastroesophageal reflux disease (GERD). According to different authors, the prevalence of GERD in patients with asthma ranges from 32% to 90%. Increased CRP level is a universal sign of inflammation, regardless of the location and other characteristics of the inflammatory process that can be called its primary marker of systemic inflammation in the body. Taking into account the overall biological function of CRP it should be considered to be logical to detect the protein directly in the core of lesions. There was discovered quite distinct correlation between inflammation in the respiratory system and the systemic inflammatory manifestations. Determining the level of CRP in sputum is a sign of the local inflammatory response and can be used for diagnosing, monitoring and evaluation of anti-inflammatory therapy. Keywords: bronchial asthma, gastroesophageal reflux disease, C-reactive protein. Надійшла 02.12.2013 року.

УДК:577.112+612.124+612.461.1+616-07+616.61

Яцишин Р.І., Ліснянська І.С., Коваль Н.М. Діагностичні перспективи визначення маркерів запалення у сечі у хворих на хронічний пієлонефрит Кафедра внутрішньої медицини 1, клінічної імунології та алергології ім. акад. Є. М. Нейка (зав. каф.– проф. Р. І. Яцишин) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Обстежено 85 хворих на хронічний пієлонефрит у віці від 26 до 62 років. У всіх хворих визначали вміст С-реактивно білка (СРБ), інтерлейкіну-6 і фактору некрозу пухлин-альфа у крові і у сечі по стандартним методикам. При одночасному дослідженні СРБ в крові і у сечі хворих на хронічний пієлонефрит виявлений високий рівень даного біомаркера в сечі, який у деяких випадках перевищує його показники в крові. При вивченні рівнів прозапальних цитокінів, які вважаються головними індукторами виділення СРБ, ми встановили, що підвищення їх концентрації в сечі було більш виражене, ніж у крові, що підтверджує думку про те, що СРБ може синтезуватися в вогнищі запалення лімфоцитами, макрофагами та ендотеліоцитами. Вивчення рівнів цитокінів і СРБ в сечі може бути використано для оцінки важкості запальних змін у нирці і для моніторингу ефективності протизапальної терапії. Ключові слова: пієлонефрит, С-реактивний белок, інтерлейкін-6, фактор некрозу пухлин-альфа, діагностика.

Постановка проблеми і аналіз основних досліджень. Хронічний пієлонефрит (ХПН) є найпоширенішим захворюванням нирок. Збудниками цього захворювання можуть бути різні мікроорганізми, що відносяться як до ендогенної, так і екзогенної флори. Бактеріальні агенти при ХПН викликають зміни структурно-функціональних властивостей і метаболізму епітелію сечових шляхів, що супроводжується індукцією прозапальних цитокінів, що призводить до інфільтрації тканинних структур, що оточують сечовивідні шляхи, нейтрофілами та макрофагами. В результаті у хворих на ХПН розвиваються запальні зміни паренхіми нирок, фіброз і ендотеліальна дисфункція, а в кінцевому підсумку – ниркова недостатність [5, 6]. Сьогодні активно обговорюється питання про патогенетичні механізми запального процесу в паренхімі: ролі цитокінів, білків гострої фази в протіканні місцевих і системних реакцій при пієлонефриті, а також розвитку хронічного запального процесу в нирках. На сьогодні відомо, що типовою рекцією клітини у відповідь на пошкод-

66

ження будь-якого генезу є дестабілізація цитоплазматичної мембрани з виходом внутріклітинного вмісту за її межі. У відповідь на це відбувається активація клітин мононуклеарно-фагоцитарної системи з наступним викидом пулу синтезованих медіаторів запалення, до яких відноситься гетерогенна група низькомолекулярних пептидів – цитокінів [7, 8]. Пусковим моментом в прогресуванні запального процесу є викид помірної кількості цитокінів (як про-, так і протизапальних) в системний кровотік із вогнища запалення. З одної сторони, цей процес необхідний для запуску «гострозапальної» відповіді, що супроводжується переключенням синтезу білків в печінці з альбумінів на білки «гострої фази» – церулоплазмін, С-реактивний білок, який має антимікробну і антиоксидантну дію. В кінцевому підсумку створюються умови для повного знищення мікроорганізмів, відновлення гомеостазу, заживлення вогнища ураження. З іншої сторони, порушення динамічної рівноваги в системі взаємовідношень прозапальних (інтерлейкін-1 – ІЛ-1, інтерлейкін-6 – ІЛ-6, фактора некрозу пухлин-альфа – ФНП-) і протизапальних (інтерлейкін-4 – ІЛ-4, інтерлейкін-10 – ІЛ-10) цитокінів призводить до накопичення їх в системному кровотоці і реалізації їх деструктивних ефектів в організмі [2, 3]. Синтез СРБ ініціюється чисельними факторами: агресією антигенів бактеріальної, вірусної, грибкової, паразитарної, пухлинної природи, продуктами ушкодження тканин при травмах, некрозі тощо. Рівень СРБ стрімко зростає в перші 6–8 год після ураження, досягає максимуму через 48 год і перевищує в 20–100, а іноді в 1000 разів вихідні показники. Згідно з традиційним уявленням, синтез СРБ відбувається в гепатоцитах під дією прозапальних цитокінів (ФНП, ІЛ-1, ІЛ-6). ІЛ-6 є основним індуктором утворення СРБ печінкою під час гострої фази запалення. За сучасними поглядами, СРБ вважається не тільки чутливим біомаркером -


Галицький лікарський вісник, 2013, Т. 20, № 4

сумкові результати приведені в табл. 1. Нами виявлений сильний прямий кореляційний зв’язок між рівнями ІЛ-6 і СРБ у сечі (r = 0,75; Р < 0,001) (рис. 1) і середньої сили прямий кореляційний зв’язок між рівнями ФНП- і СРБ у сечі (r = 0,56; Р < 0,05) (рис. 2). Завдяки проведеним дослідженням встановлено значне підвищення рівня СРБ в сечі при загостренні ХПН, яке у деяких випадках перевищує рівень цього протеїна в крові, що може бути оцінено як ознака активних запальних реакцій в тубулоінтерстиціальній тканині нирок у відповідь на пошкодження патогенами. Ймовірно, синтезу СРБ у вогнищах ураження у нирках сприяє високий рівень прозапальних цитокінів. Так, сучасними дослідженнями відзначена активація продукції ІЛ-1, ІЛ-6, ІЛ-8, трансформуючого фактора росту-бета, що продукуються моноцитарно-макрофагальною ланкою і Т-лімфоцитами у хворих на ХПН, особливо за наявності бактеріальної (E. coli, St. faecalis) інфекції [1]. Привертає увагу виявлений нами факт підвищеної екскреції з сечею ІЛ-6 і ФНП- – головних регуляторів синтезу СРБ, концентрації яких у 1000 разів перевищували показники групи норми. В літературі зустрічаються дані, що високий рівень ІЛ-6 і ФНП- в сечі спостерігається і при термінальних стадіях хронічної хвороби нирок, їм відведена провідна роль в механізмах склерозу клубочків та фіброзу інтерстицію [6]. Таким чином, однією із характеристик розвитку запального процесу у нирках при хронічному пієлонефриті являється наростання в сечі прозапальних цитокінів та рівня С-реактивного білка.

Таблиця 1. Рівень СРБ, ІЛ-6 і ФНП- у крові і сечі хворих на хронічний пієлонефрит (M±m) Група контролю Досліджувана група Показник кров сеча кров сеча СРБ, мг/л 6,00±1,05 2,10±0,77 14,75±3,24* 29,34±4,75 ІЛ-6, 12,57±1,78 0,0120±0,0006 21,48±2,44* 11,53±1,23 пг/мл ФНП-, 39,54±11,48 0,0330±0,0012 167,45±65,50* 10,42±1,74 пг/мл Примітка: *Достовірна різниця у порівнянні з групою контролю (Р<0,05); Достовірна різниця у порівнянні з групою контролю (Р < 0,001)

його зростання запускає різноманітні механізми прогресування запалення, ураження тканин і судин шляхом активації ланки цитокінів, клітинних молекул адгезії, зменшення продукції ендотеліального оксиду азоту, ендотеліальної NO-синтетази тощо [1, 4]. Беручи до уваги загальну біологічну функцію СРБ, слід вважати закономірним знаходження цього білка безпосередньо в «осередках ураження». На сьогодні, в літературі йдеться про можливість локального синтезу СРБ активованими клітинами: макрофагами, лімфоцитами, ендотеліоцитами. Тому доцільно провести визначення даного біомаркера в сечі у хворих на хронічний пієлонефрит і порівняти його концентрації з концентраціями цитокінів, які вважаються основними індукторами виділення CРБ. Метою дослідження стала розробка нових діагностичних і прогностичних критеріїв важкості хронічного пієлонефриту на основі вивчення механізмів індукції синдрому запальної відповіді.

Висновки 1. При загостренні хронічного пієлонефриту виявлено значне підвищення рівня С-реактивного білка в сечі, яке в

Матеріал і методи дослідження

Коре ляція між рівнями СРБ і ІЛ-6 у се чі 20 18

ІЛ-6пг/мл

16 14 12 10 8

ІЛ-6, пг/мл

Дослідження проведені на клінічній базі Івано-Франківського національного медичного університету у нефрологічному відділенні обласної клінічної лікарні. Обстежено 85 жінок хворих на ХПН в стадії загострення у віці від 26 до 62 років. Тривалість анамнезу ХПН у хворих склала від 4 до 25 років. Діагностику ХПН здійснювали згідно наказу МОЗ України «Про затвердження клінічних протоколів надання медичної допомоги за спеціальністю “Нефрологія”» № 593 від 02.12.2004 р. Для визначення СРБ в крові і у сечі використовували метод латекс-аглютинації, який виконували за допомогою діагностичного набору («Cormay», Польща). Постановку тесту при дослідженні сироватки крові здійснювали згідно інструкції. Для дослідження сечі збирали ранкову порцію, центрифугували (1500 об/хв) протягом 10 хв і використовували для визначення СРБ 1–2 мл супернатанта [2]. Рівень прозапальних цитокінів (ІЛ-6, ТНФ-) визначали у крові і у сечі хворих на хронічний пієлонефрит за допомогою наборів реактивів для імуноферментного аналізу «ВекторБест» (Росія). Статистичний аналіз здійснювали методами варіаційної статистики з використанням програми «Statistica 6.0» (Stat. Soft. Inc. (США)). Достовірною вважали різницю при Р<0,05.

6 4 2 0 0

20

40

60

80

100

120

140

160

180

200

С-ре активний білок, мг/л

Рис. 1 Кореляція між рівнями СРБ і ІЛ-6 у сечі у хворих на хронічний пієлонефрит Кореляція між рівнями СРБ і ФНП-α у сечі 20 18

ФНП-пг/мл

16 14 12

пг/мл α,

10

ФНП-

Результати дослідження та їх обговорення У контрольній групі практично здорових осіб середній рівень СРБ у крові дорівнював 6,00 ± 1,05 мг/л, а у сечі склав 2,10±0,77 мг/л. У крові хворих на ХПН при поступленні реєстрували підвищення рівня СРБ, воно досягало «гострозапального» діапазону. Одночасне визначення СРБ у сечі хворих на ХПН в стадії загострення виявило концентрації біомаркера, що в деяких випадках у 2 рази перевищували показники в крові. Аналізуючи рівні ІЛ-6 і ФНП- ми виявили достовірне підвищення даних цитокінів і у крові, і у сечі порівняно з групою контролю (Р<0,05). Проте, середні значення даних цитокінів в крові у хворих на ХПН були у 2–4 рази вищими ніж у групі здорових осіб, тоді як їх концентрація у сечі, в деяких випадках, у 1000 разів перевищувала значення групи норми. Найбільш важливі під-

8 6 4 2 0 0

20

40

60

80

100

120

140

160

180

200

С-реактивний білок, мг/л

Рис. 2 Кореляція між рівнями СРБ і ФНП- у сечі у хворих на хронічний пієлонефрит

67


Галицький лікарський вісник, 2013, Т. 20, № 4

деяких випадках перевищує його вміст у сироватці крові, що дозволяє припустити можливість локального синтезу біомаркера при ураженнях нирок. 2. Аналіз концентрацій ІЛ-6 і ФНП-, як основних індукторів виділення СРБ, виявив підвищення рівнів даних цитокінів, яке було більш виражене у сечі. Виявлено сильний прямий кореляційний зв’язок між ІЛ-6 і СРБ у сечі (r = 0,75; Р<0,001) і середньої сили прямий кореляційний зв’язок між ФНП- і СРБ у сечі (r = 0,56; Р < 0,05). 3. Одночасне визначення С-реактивного білка, ІЛ-6 і ФНП- в крові і сечі дає можливість для тривалого моніторування з метою діагностики, прогнозування і оцінки ефективності терапії при хронічних захворюваннях нирок. Перспективи подальших досліджень Цікавим буде подальше вивчення динаміки маркерів запалення у сечі у процесі лікування хворих на хронічний пієлонефрит. Література 1. Вельков В. В. С-реактивний білок в лабораторній діагностиці гострого запалення і оцінці ризику судинної патології // Лаб. діагностика. – 2007. – Вип. 42, № 4. – С. 53–65. 2. Деклараційний пат. Україна (11) 38542 (51) У01 № 33/487. Спосіб експрес-діагностики активності і прогнозування перебігу хвороби нирок / Н. М. Коваль, Н. М. Середюк, Е. М. Бардяк, О. В. Мазур. Заявл. 28.07.2008. Опубл. 12.01.2009. Бюл. №1.2009 р. 3. Михайлова Ю. А. Уровни цистатина С,  2-мікроглобуліна, ТФР-, ФНО- при хронической сердечной недостаточности и сочетании хронической сердечной недостаточности с хронической болезнью почек // Експерим. і клін. медицина. – 2012. – № 1. – С.122–125. 4. Насонов Е. Л., Панюкова Е. В., Александрова Е. Н. С-реактивний белок – марк’р воспаления (новые данные) // Кардиология. – 2002. – № 7. – С. 53–62. 5. Паунова С. С., Кучеренко А. Г., Смирнов И. Е. Системы цитокинов и гуморальных факторов роста при пузырно-мочеточниковом рефлюксе у детей // Нефрология та диализ. – 2005. – № 4. – С. 435–439. 6. Пекарева Н. А., Чупрова А. В., Лоскутова С. А. и др. Патогенетическое значение динамики цитокинов при хроническом обструктивном пиелонефрите у детей // Педиатрия. – 2008. – Т. 87, № 3. – С. 23–24. 7. Семидоцкая Ж. Д., Шевченко А. Г. Содержание интерлейкина-6 и интерлейкина-12 у больных хроническим гломерулонефритом с различными стадиями хронического заболевания почек // Укр. журн. нефрології та діалізу – 2007. – Вип. 16, № 4. – С. 41–45.

68

8. Топчій І. І., Гальчінська В. Ю., Семенових П. С. Порушення секреції прозапальних цитокінів у хворих на хронічний гломерулонефрит та хронічний пієлонефрит // Укр. журн. нефрології та діалізу. – 2009. – Вип. 23, № 3. – С. 3–5. Яцишин Р.И., Лиснянская И.С., Коваль Н.М. Диагностические перспективы определения маркеров воспаления в моче у больных хроническим пиелонефритом Резюме. Обследовано 85 больных хроническим пиелонефритом в возрасте от 26 до 62 лет. У всех больных определяли содержание С-реактивного белка (СРБ), интерлейкина-6 и фактора некроза опухолей-альфа в крови и в моче по стандартным методикам. При одновременном исследовании СРБ в крови и в моче больных хроническим пиелонефритом обнаружен высокий уровень данного биомаркера в моче, который в некоторих случаях превышает его показатели в крови. При изучении уровней провоспалительных цитокинов, которые считаются главными индукторами выделения СРБ, мы установили, что повышение их концентрации в моче было более выражено, чем в крови, что подтверждает мнение о том, что СРБ может синтезироваться в очаге воспаления лимфоцитами, макрофагами и эндотелиоцитами. Изучение уровня цитокинов и С-реактивного белка в моче может быть использовано для оценки тяжести воспалительных изменений в почке и для мониторинга эффективности противовоспалительной терапии. Ключевые слова: пиелонефрит, С-реактивный белок, интерлейкин-6, фактор некроза опухолей-альфа, диагностика. R.I. Yatsyshyn, I.S. Lisnianska, N.M. Koval Diagnostic Prospects of Determining Inflammatory Markers in the Urine of Patients with Chronic Pyelonephritis Summary. The study involved 85 patients with chronic pyelonephritis from 26 to 62 years of age. All the patients were determined to have C-reactive protein (CRP), interleukin 6 and tumor necrosis factor-alpha in the blood and urine using common techniques. With the simultaneous study of CRP in the blood and urine of patients with chronic pyelonephritis there was detected a high level of this biomarker in the urine, which was in some cases higher than its level in blood. When studying the levels of proinflammatory cytokines, which are the main inducers of CRP excretion, we found that the increase in their concentration in urine was more expressive than in the blood that confirms the opinion that CRP can be synthesized in the core of inflammation by lymphocytes, macrophages and endotheliocytes. Studying the levels of cytokines and C-reactive protein in the urine can be used to assess the severity of inflammatory changes in the kidney and to monitor the efficacy of the anti-inflammatory therapy. Keywords: pyelonephritis, C-reactive protein, interleukin-6, factor-alpha of tumors necrosis, diagnosis. Надійшла 02.12.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4

ÇÀ̲ÒÊÈ Ç ÏÐÀÊÒÈÊÈ УДК: 616-089+616.34-002+616.342

Іваночко Н.Я. Тактичні алгоритми оперативного лікування хворих на перфоративну виразку шлунка та дванадцятипалої кишки Кафедра хірургії стоматологічного факультету (зав. каф.-проф. О.В.Пиптюк) ДВНЗ ” Івано-Франківський національний медичний університет ’’ Резюме. У статті відтворено тактичні складові комплексного лікування пацієнтів на перфоративну виразку шлунка та дванадцятипалої кишки. Дана група пацієнтів вимагає від хірурга швидкого реагування в плані діагностики та проведення об’єму оперативного втручання з урахуванням локалізації наявного перфоративного отвору з моменту її настання та встановлення комплексної оцінки загального стану хворого. Проаналізовано результати комплексного лікування 68 хворих з перфоративною виразкою шлунка (22) і дванадцятипалої кишки (46). Проведене передопераційне ультразвукове обстеження дало можливість виявити наявність вільної рідини в черевній порожнині у 89%, а оглядова рентгенографія черевної порожнини підтвердила наявність вільного повітря в ній у 63 випадках(93%).Застосовували принцип диференційованого хірургічного лікування. Госпіталізовано пацієнтів до 24 годин з моменту захворювання 65(96%); після 24 годин-3(4%). Терміни пізньої госпіталізації становили 19,2%. У 42 хворих проведене висічення виразки з пілоропластикою по Гейнеке-Мікулічу і передньою селективною ваготомією. Виконано висічення виразки з пілоропластикою без ваготомії у 4 хворих. Ушивання перфоративного отвору проведене при розлитому гнійному перитоніті у 15% пацієнтів, у вкрай запущених випадках, що передбачає мінімізацію об’єму і часу оперативного втручання. Післяопераційна летальність склала 4%. При проривній виразці дванадцятипалої кишки за сприятливих умов її висікають з радикальною дуоденопластикою та ваготомією. Ключові слова: перфоративна виразка, діагностика, оперативне лікування.

Постановка проблеми і аналіз останніх досліджень. На сучасному етапі на виразкову хворобу шлунку та дванадцятипалої кишки потерпає 3,5-12% населення, з них35-47% працездатного віку [1]. На патогенезі та ефективності лікування даної недуги відображається багатоланцюговий ряд соціальних та економічних факторів, тому своєчасна їх діагностика та лікування привертають особливу увагу. Незважаючи на досягнення сучасної медицини, відсоток небезпечних ускладнень даної патології не зменшується. Загальновідомо, що у патогенезі даної недуги провідна роль належить зрушенню рівноваги між агресивними та захисними факторами слизової оболонки. Виникнення дуоденальних виразок зумовлюється порушенням нейро-гуморальних та місцевих механізмів регуляції шлункової секреції, підвищенням агресивних властивостей шлункового соку. Встановлено, що у 90% хворих провідна роль у виникненні даної недуги належить Helicobacter pylori- грамнегативній неспороутворюючій бактерії [2,3]. Так, частота перфорації досягає 25% всіх ускладнень виразкової хвороби, а післяопераційна летальність з приводу перфоративної виразки-5,9-11,7% [4,6]. Значна частина хворих звертається за допомогою у пізні терміни (8,8-11,1%), що погіршує прогноз лікування [5,7]. Ускладнення виразки у вигляді перфорації вимагає проведення негайного оперативного втручання з урахуванням часового фактору, віку пацієнта та наявності супровідної патології. Ці складові визначають також об’єм і характер самої операції. Мета: покращення ефективності хірургічного лікування та оптимізація комплексного лікування хворих з перфоративною виразкою шлунка та дванадцятипалої кишки. Матеріал і методи дослідження Під нашим спостереженням перебували 68 хворих з перфоративною виразкою шлунка (22) і дванадцятипалої кишки (46), що

лікувались в клініці хірургічного відділення Центральної міської клінічної лікарні м.Івано-Франківськ . Вік пацієнтів коливався від 24 до 62 років. Чоловіків було 46 (68%), жінок- 22 (32%). Госпіталізовано пацієнтів до 24 годин з моменту захворювання 65(96%); після 24 годин-3(4%). Діагноз підтверджено на підставі сукупності суб’єктивних та об’єктивних клінічних даних: різкий біль в епігастральній ділянці, напруження м’язів передньої черевної стінки, вимушене положення тіла з підібганими до живота ногами,сухість в роті, тахікардія, а також на основі даних клініко-лабораторних показників. Проводили ультразвукове обстеження на апараті SDU-500С, SHIMADZU (Японія). Це дало можливість виявити наявність вільної рідини в черевній порожнині у 89%, а оглядова рентгенографія черевної порожнини підтвердила наявність вільного повітря під діафрагмою справа - 56, зліва - 7. Проводили езофагогастродуоденоскопію з використанням оптичної техніки, фіброендоскопом фірми „ OLYMPUS GIF XQ 30” (Японія). Застосування в клінічній практиці ендоскопічних методів обстеження при захворюваннях гепатопанкреатодуоденальної зони, в тому числі і фіброгастродуоденоскопії (ФГДС), дає можливість виявити патологію шлунка і дванадцятипалої кишки, відслідкувати викид жовчі у дванадцятипалу кишку, констатувати стан великого дуодентального сосочка. Терміни пізньої госпіталізації становили 19,2%. Всім хворим було проведене оперативне втручання. Післяопераційна летальність склала 4%. Основними принципами консервативної терапії, яка проводиться в стаціонарі, є: корекція синдрому ендотоксикозу шляхом призначення інфузійної терапії об’єм і склад визначається конкретною клінічною ситуацією. Розчини вводять у таких співвідношеннях: 1000 - 1500 мл 0,9 % №СІ або розчину Рінгера, 400мл 4% р-ну NaНСОз, розчини що містять сорбітол або ксилітол: сорбілакт, реосорбілакт 6-8 мл на 1 кг, ксилат 10-15 мл на 1 кг маси хворого (їх необхідно вводити перед введенням розчинів глюкози з метою її оптимального засвоєння), або 15% розчин манітолу із розрахунку 1,0 - 1,5 г на 1 кг маси хворого, 20 мл 2,4 % р-ну еуфіліну, 60 мл 3% р-ну КС1, 50 мл 10% рну NaСІ, 200 мл 1% р-ну СаС12 на 1000 мл 5% р-ну глюкози, 1000 -1500 мл білкових препаратів (на кожні 3% Ht, що перевищує 45, вводиться 300 мл р-ну білків – нативної і свіжозамороженої плазми, альбуміну, гідролізатів). Для покращення мікроциркуляції призначали - стабізолу, рефортану, гекодезу, реосорбілакту. Блокада секреторної активності ПЗ: а) для зиження кислотності шлунковогого соку застосовують назогастральну аспірацію, Н2-блокатори (ранітидин, фамотидин), атропін; б) для переривання синтезу ферментів - даларгін по 2 мл 2 рази на добу внутрішньовенно, 5фторурацил (фторафур) по 10мг/кг 1-2 рази на добу протягом 3-4 днів. Антиоксидантна терапія: аскорбінова кислота 5 % 10 - 20 мл в/венно протягом 5 днів; а-токоферол 2 мл п/шкірно протягом 5 днів; церулоплазмін 100 мг на добу протягом 5-7 днів (використовується також як стимулятор кровотворення при розвитку гнійно-септичних ускладнень); мілдронат 10 % - 5,0 в/венно 1 раз на добу протягом 5 - 10 днів. Антибактеріальна терапія містить антибіотики широкого спектру дії з урахуванням пригнічуючого ефекту на хелікобактерну інфекцію. Призначали фторхінолони (ципрофлоксацин - 400 мг 2 рази на добу, офлоксацин 400 - 800 мг 2 рази на добу в/венно крапельне, левофлоксацин 500 - 1000 мг 1-2 рази на добу. Цефалоспорини - цефтріаксон - 1-4 г 1-2 рази на добу, цефобід - 1 - 4 г 2 рази на добу, клафоран 1 - 3 г 4 рази на добу. Курс антибіотикотерапії триває не менше 14 діб і доповнюється антимікотичною терапією кетоконазол (нізорал) 200 мг на добу, флуконазол 50 - 400 мг на добу. Противиразкова терапія включала: Н2-блокатори, інгібітори протонної помпи (ранітидин 50 - 100 мг через кожні 6 год, квамател 20 мг 2 рази на добу в/в, лосек - 20 мг 1 раз на добу в/в); антациди, обволікаючі засоби: альмагель, секретин, амінокапронова кислота з тромбіном (за наявності ерозій). Гепатопротектори: есенсіале або гептрал по 5 мл 2 рази на добу внутрішньовенно, глутаргін. Обсяг оперативного втручання визначали індивідуально, враховуючи час з моменту настання перфо-

69


Галицький лікарський вісник, 2013, Т. 20, № 4 рації та локалізацію перфоративного отвору, наявність перитоніту, компенсаторні можливості хворого.

Результати дослідження та їх обговорення Сучасні знання патогенезу даної недуги вимагають дотримуватись кардинальних положень, що передбачають усунення морфологічного субстрату виразки, зниження кислотності, відновлення моторно-евакуаторної функції кишковошлункового тракту, ерадикація хелікобактерного чинника. Поширеною операцією при перфоративній виразці є її висічення та ушивання. Дана методика, проте, не ліквідує виразкову хворобу і подальші можливі ускладнення. Сприятливим радикальним доповненням є проведення селективної або стовбурової ваготомії, що значно пригнічує шлункову секрецію. При дуоденальних проривних виразках методом вибору є органозберігаючі операції, що передбачають висічення виразки, пілоропластику, ваготомію за умови відсутності гнійного перитоніту. Після проведення лапаротомії та ревізії органів черевної порожнини виявлено такі локалізації перфоративного отвору: передньої стінки пілороантрального відділу шлунка-12; задньої стінки тіла шлунка-2; малої кривизни-3; великої кривизни-5; передньої стінки дванадцятипалої кишки-37, задньої стінки-9. Проривна виразка у кожному випадку супроводжувалась наявним серозним (45), серозно-фібринозним (13) та гнійним (10) перитонітом. Просте зашивання перфоративного отвору проведене при розлитому гнійному перитоніті у 15% пацієнтів, у вкрай запущених випадках, що передбачає мінімізацію об’єму і часу оперативного втручання. Померло 2 пацієнтів. При перфорації і перитоніті на тлі діагностованого раку шлунка, до 6 годин з часу діагностованої перфорації, двом хворим провелено первинну резекцію шлунка успішно. Переважній частині хворих (42) проведене висічення виразки з пілоропластикою по Гейнеке-Мікулічу і передньою селективною ваготомією. Виконано висічення виразки з пілоропластикою без ваготомії у 4 хворих. Помер один хворий. Висновки 1. Своєчасно діагностувати перфоративну виразку шлунка та дванадцятипалої кишки у 96% випадках дозволяють клінічні прояви та інструментальні методи обстеження. 2. Хірургічна тактика та об’єм оперативного втручання визначаються: часовим фактором з моменту настання перфорації, наявним видом перитоніту, локалізацією виразкового дефекту, резервними можливостями організму кожного пацієнта зокрема. 3. Операцією вибору при проривній виразці дванадцятипалої кишки за сприятливих умов є її висічення з радикальною дуоденопластикою та ваготомією. Література 1.Баранская Е.К., Ивашкин В.Т. Клинический спектр предраковой патологии желудка //Рос.журн. гастроэнтерол.,гепатол., колопроктол.-2002.-№3.-С.7-14. 2.Голубчиков М.В. Статистичний огляд захворюваності населення України на хвороби органів травлення //Сучасна гастроентерологія та гепатологія.-2000.-№1.-С.17-20. 3. Гіленко І.О., Дем’янюк Д.Г., Горлачов М.І. Діагностика та лікування перфоративної виразки шлунка і дванадцятипалої кишки//Шпитальна хірургія.-2001.-№1.-С.66-68. 4. Короткий В.М., Колосович І.В. Фармакотерапевтичні аспекти раннього післяопераційного періоду у хворих з ускладненою гастродуоденальною виразкою//Клінічна хірургія.-2002.-№2.-С.15-18. 5. Передерій В.Г.,Ткач С.М. Пептичні виразки гастродуоденальної зони:сучасні уявлення про причини виникненняя. Діагностику і лікування//Нова медицина.-2003.-№6.-С.16-21. 6. Lopasso F.P., Rodrigues J.G.,Alves V.A. Acid-secretory response in the late follow-up of proximal gastric vagotomy for duodenal ulcer without Hp-eradication //Hepatogastroenterology.-1999.-Jan.-Feb.-

70

V.46, №25 .-P.240-244. 7. Turnage R.H., Sarosi G., Cryer B. et al. Evaluation and management of patients with recurrent peptic ulcer disease afte acid-reducing operations: a systematic review//J.Gastrointestinal Surg.-2003.-Jul.Aug.-V. 7,№ 5.-P.606-626. Иваночко Н.Я. Тактические алгоритмы оперативного лечения больных перфоративной язвой желудка и двенадцатиперстной кишки Кафедра хирургии стоматологического факультета (зав. каф. проф.О.В.Пиптюк) ГВУЗ “Ивано -Франковский национальный медицинский университет” Резюме. В статье воспроизведены тактические составляющие комплексного лечения пациентов с перфоративной язвой желудка и двенадцатиперстной кишки. Данная группа пациентов требует от хирурга быстрого реагирования в плане диагностики и проведения объема оперативного вмешательства с учетом локализации имеющегося перфоративного отверстия , времени с момента ее наступления и комплексной оценке общего состояния больного. Проанализированы результаты комплексного лечения 68 больных с перфоративной язвой желудка ( 22) и двенадцатиперстной кишки ( 46). Произведенное предоперационное ультразвуковое обследование позволило выявить наличие свободной жидкости в брюшной полости у 89% , а обзорная рентгенография брюшной полости подтвердила наличие свободного воздуха в ней в 63 случаях ( 93%). Применяли принцип дифференцированного хирургического лечения. Госпитализировано пациентов до 24 часов с момента заболевания 65 ( 96 % ) , после 24 часов -3 ( 4% ) . Сроки поздней госпитализации составили 19,2 %. В 42 больных проведено иссечение язвы с пилоропластикой по Гейнеке - Микулич и передней селективной ваготомией . Выполнено иссечение язвы с пилоропластикой без ваготомии у 4 больных . Ушивание перфоративного отверстия проведено при разлитом гнойном перитоните у 15% пациентов, в очень тяжелых случаях, предусматривающих минимизацию объема и времени оперативного вмешательства. Послеоперационная летальность составила 4%. При прободной язве двенадцатиперстной кишки, при благоприятных условиях, методом выбора оперативного вмешательства является ее иссение с радикальной дуоденопластика и ваготомией. Ключевые слова : перфоративная язва , диагностика , оперативное лечение. N.Yа. Ivanochko Tactical Algorithms of Surgical Treatment of Patients with Perforated Peptic and Duodenal Ulcers Department of Surgery, Faculty of Dentistry (Head of the Department – Prof. O.V. Pyptiuk) Ivano-Frankivsk National Medical University, Ivano-Frankivsk, Ukraine Summary. The article presents tactical constituents of the complex treatment of patients suffering from perforated peptic and duodenal ulcers. This group of patients requires immediate reaction in terms of diagnosing and performing surgery, taking into account the localization of the existent perforation, the time passed since its onset and complex evaluation of a patient’s general state. There were analyzed the results of the complex treatment of 68 patients with perforated gastric ulcers (22) and duodenal ulcers (46). The conducted pre-operation ultrasound examination gave an opportunity to detect the presence of free fluid in the abdominal cavity in 89%, and fluoroscopy of the abdominal cavity verified the presence of free air in it in 63 cases (93%). The principle of differentiated surgical treatment was applied. There were hospitalized 65 patients (96%) with the disease presence up to 24 hours since the onset and 3 patients (4%) with the disease presence more than 24 hours since the onset. The term of late hospitalization constituted 19.2%. 42 patients underwent excision of the ulcer with HeinekeMikulicz pyloroplasty and anterior selective vagotomy. 4 patients underwent excision of the ulcer with pyloroplasty without vagatomy. Closure of perforation was conducted in diffuse purulent peritonitis in 15% of patients in very neglected cases that presupposes minimising the extent and the time of the surgery. Postoperative mortality constitutes 4%. Under favourable conditions perforated duodenal ulcer is to be excised and undergo radical duodenoplasty and vagatomy. Keywords: perforated ulcer, diagnosis, surgical treatment. Надійшла 23.09.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 616.12-008+616-002-008.953-092+616-092.4

Насраллах А.Х. Клінічні особливості перебігу метаболічного синдрому у жінок в постменопаузі Кафедра терапії і сімейної медицини факультету післядипломної освіти ДВНЗ «Івано-Франківський національний медичний університет» anas_nasrallah@hotmail.com Резюме. Серцево-судинні захворювання (ССЗ) є головною причиною смерті жінок у розвинутих країнах. Існує зв’язок між менопаузою та ССЗ. В жіночій популяції метаболічний синдром (МС) зустрічається в 20-30% осіб середнього віку; у міру розвитку менопаузи частота випадків його значно збільшується. Мета дослідження - дослідити клініко-лабораторні особливості перебігу МС у жінок в постменопаузі. Матеріал та методи: обстежено 130 хворих із метаболічним синдромом (МС), серед яких було 24 особи чоловічої статі та 106 жінок. Останні, в свою чергу, були розділені на дві групи: 80 осіб, які перебували в стані фізіологічної менопаузи, та 26 хворих із МС без ознак менопаузи. Проведені антропометричні дослідження, визначення ЧСС та офісного АТ, показників ліпідного обміну. Отримані результати: Менопаузальний МС характеризується високим ІМТ, який подібний до аналогічного показника у групі чоловіків із МС; ОТ в 1,2 рази перевищує контрольні значення (p<0,01). Найбільш значущі порушення в ліпідограмі виявили у жінок із МС в постменопаузі. Рівень загального холестерину (ХС) в 1,22 рази перевищував показники контрольної групи (p<0,01). Рівень триацилгліцеролів (ТГ) плазми крові майже в 2,5 рази був вищим від контрольних значень (p<0,001). Концентрація холестерину ліпопротеїдів низької густини (ХС ЛПНГ) перевищувала контрольні параметри в 1,75 разів, а холестерину ліпопротеїдів дуже низької густини (ХС ЛПДНГ) – в понад 2,5 рази (p<0,001). Висновки. Для менопаузального МС характерні порушення основних показників гемодинаміки: зростання ЧСС на 16,5%, рівнів САТ і ДАТ – на 30%, які корелюють з ІМТ та ОТ. У жінок в менопаузі з ознаками МС виявляються найбільш значущі порушення ліпідного обміну. Ключові слова: метаболічний синдром, менопауза, ліпідний обмін.

Постановка проблеми і аналіз останніх досліджень. Серцево-судинні захворювання (ССЗ) є головною причиною смерті жінок у розвинутих країнах. Виникнення ССЗ у жінок затримується в часовому аспекті, загалом, на 10 років, порівняно з чоловічою популяцією [1]. Кардіоваскулярні недуги є рідкісними у віці до 45 років серед осіб жіночої статі, проте різко зростають в період менопаузи [2]. Вказаний факт зумовлює існування припущення щодо незалежного (окрім віку) зв’язку менопаузи та ризику ССЗ. Згадана гіпотеза підтверджується даними досліджень про високий несприятливий серцево-судинний ризик за умови хірургічної менопаузи та дослідження на тваринних моделях, які показали мінімальні судинні зміни до менопаузи та різке їх зростання в разі припинення місячних [3]. Метаболічний синдром (МС) характеризується наявністю складових компонентів, які значно підвищують ризик виникнення ССЗ чи цукрового діабету 2 типу. В жіночій популяції МС зустрічається в 20-30% осіб середнього віку; у міру розвитку менопаузи частота випадків його значно збільшується. Починаючи з 1988 року з моменту першої згадки Reaven про МС, існували численні класифікації даної патології – відповідно до визначень National Cholesterol Education Program (NCEP), міжнародної діабетичної федерації (International Diabetes Federation), та ВООЗ. В 2005 році Американська діабетична асоціація (American Diabetes Association) та Європейська асоціація з вивчення діабету (European Association for the Study of Diabetes) встановили тісний зв’язок МС та кардіоваскулярного ризику. Проведено багато міжнародних досліджень щодо підтвердження згаданого зв’язку [4]. Менопаузальний статус характеризуються певними зв’язками з розвитком МС, проте дані стосовно них є неповними. Багато обсерваційних кросс-секційних досліджень показали наявність високого вмісту в період менопаузи у

крові жінок тригліцеридів (ТГ) та низькі концентрації холестерину ліпопротеїдів високої густини (ХС ЛПВГ). Проте, інші дослідження, проведені в Європі, після врахування впливу вікових чинників заперечують дані зв’язки. У двох невеликих дослідженнях, проведених в Азії, не встановлена суттєва різниця у рівнях ТГ та ХС ЛПВГ у жінок доменопаузального та постменопаузального періодів. Вивчення ряду клініко-лабораторних параметрів серед когорти японських жінок, жертв атомного бомбування показало різницю тільки рівнів загального холестерину (ХС) у крові жінок у постменопаузі, проте не спостерігалась різниця у величині артеріального тиску (АТ) чи показника індексу маси тіла (ІМТ) [5]. Мета дослідження. Дослідити клініко-лабораторні особливості перебігу МС у жінок в постменопаузі. Матеріал і методи дослідження Обстежено 130 хворих із метаболічним синдромом (МС), серед яких було 24 особи чоловічої статі та 106 жінок. Останні, в свою чергу, були розділені на дві групи: 80 осіб, які перебували в стані фізіологічної менопаузи, та 26 хворих із МС без ознак менопаузи. Верифікація менопаузи проводилась згідно з рекомендаціями Американського товариства клінічних ендокринологів (2011). В дослідження також були включені 21 практично здорові жінки без ознак МС в менопаузі. Контрольну групу склали 30 практично здорових осіб. Діагноз МС виставлявся згідно з рекомендаціями Міжнародної діабетичної федерації (IDF – International Diabetes Federation), Американської серцевої асоціації (AHA – American Heart Association) та Національного інституту серця, легень та крові (NHLBI – National Heart, Lung and Blood Institute) (2005, 2009 – з доповненнями) [6]. Із антропологічних методів проводили визначення зросту (см), маси тіла (кг), обводу талії (ОТ) (см). На основі наявного зросту та маси тіла обчислювали індекс маси тіла (ІМТ) (кг/м2). Визначали частоту серцевих скорочень (ЧСС) та рівень офісного артеріального тиску (АТ). Типування ліпопротеїдемій здійснювалось за вмістом у плазмі крові холестерину (ХС), триацилгліцеролів (ТГ), холестерину ліпопротеїдів низької густини (ХС ЛПНГ), холестерину ліпопротеїдів високої густини (ХС ЛПВГ), холестерину ліпопротеїдів дуже низької густини (ХС ЛПДНГ) згідно з існуючими рекомендаціями. Статистичний аналіз проводили із використанням стандартного пакету програм Statistica 6.1 (StatSoft, Tulsa, OK, USA).

Результати дослідження та їх обговорення Проведені антропометричні вимірювання показали значне перевищення показника індексу маси тіла (ІМТ) у чоловіків із МС в порівнянні з групою контролю: 32,09±1,62 кг/м2 проти 23,34±1,60 кг/м 2 (p<0,01). При цьому, 6 (25%) чоловіків мали ожиріння І ступеня, четверо (16,67%) – ІІ ступеня, двоє – ІІІ ступеня (8,3%). Показник обводу талії (ОТ) був найвищий в групі чоловіків із МС - 111,42±3,57 см проти 86,51±2,97 см у практично здорових осіб (p<0,01). ІМТ у жінок із МС репродуктивного віку перевищував аналогічний контрольний - 28,47±1,18 кг/м2 (p<0,05), достовірно не відрізнявся від подібного показника у чоловіків (p>0,05). ОТ був достовірно вищим від контрольного 95,0±3,26 см, проте нижчим від такого ж показника у чоловіків (p<0,05). Менопаузальний МС характеризується високим ІМТ 32,31±0,71 кг/м2 (p<0,01), який подібний до аналогічного показника у групі чоловіків із МС. При цьому, на ожиріння І ступеня страждали 26 жінок (32,5%), ІІ ступеня – 12 (15%) осіб, ІІІ ступеня – 5 (6,25%) осіб. ОТ в 1,2 рази перевищує контрольні значення (p<0,01) і складає 103,5±1,53 см. ІМТ у жінок в менопаузі без МС не відрізняється від

71


Галицький лікарський вісник, 2013, Т. 20, № 4

нормальних величин - 24,09±0,37 кг/м2 (p>0,05) та достовірно нижчий від подібних показників в усіх обстежених із даним синдромом (p<0,01). ОТ вищий від показника контрольної групи - 96,71±3,36 см (p<0,05), нижчий від ОТ чоловіків із МС (p<0,05). У випадку наявності МС в усіх обстежених групах відзначається прямий кореляційний зв’язок між показниками ІМТ та ОТ: сильний - у чоловіків (r=0,87, p<0,05) та у жінок репродуктивного віку (r=0,86, p<0,05); середньої сили - у жінок в менопаузі (r=0,64, p<0,05). У чоловіків із МС встановлені сильні прямі кореляційні зв’язки між ЧСС та ІМТ (r=0,80, p<0,05), ЧСС та ОТ (r=0,75, p<0,05). За умови розвитку менопаузального МС відмічається слабкий прямий кореляційний зв’язок між ЧСС та ІМТ (r=0,25, p<0,05), САТ та ІМТ (r=0,29, p<0,05); прямий зв’язок середньої сили – між ДАТ та ІМТ (r=0,40, p<0,05) і ДАТ та ОТ (r=0,34, p<0,05). В усіх випадках МС супроводжувався порушеннями ліпідного обміну (табл. 1). Найбільш значущі порушення в ліпідограмі виявили у жінок із МС в постменопаузі. Рівень загального холестерину (ХС) в 1,22 рази перевищував показники контрольної групи (p<0,01). Рівень триацилгліцеролів (ТГ) плазми крові майже в 2,5 рази був вищим від контрольних значень (p<0,001). Концентрація холестерину ліпопротеїдів низької густини (ХС ЛПНГ) перевищувала контрольні параметри в 1,75 разів, а холестерину ліпопротеїдів дуже низької густини (ХС ЛПДНГ) – в понад 2,5 рази (p<0,001). Заслуговує увагу факт перевищення в 1,22 рази рівня ХС ЛПНГ у цій групі жінок подібних показників у чоловіків із

МС та в жінок репродуктивного віку з даним синдромом (p<0,05). Рівні холестерину ліпопротеїдів високої густини (ХС ЛПВГ) недостовірно відрізнялись від даних групи контролю (p>0,05), проте були нижчими. Зазначені зміни обумовили зростання показника коефіцієнта атерогенності (КА) у 2,16 рази та коефіцієнта співвідношення ТГ/ХС ЛПВГ у 2,52 рази (p<0,001), що може бути свідченням вираженого атеросклеротичного процесу в даній когорті хворих. В когорті жінок репродуктивного віку із МС рівні ХС у 1,22 рази перевищували контрольні значення (p<0,01), ТГ – удвічі (p<0,001), ХС ЛПНГ – у 1,44 рази (p<0,05), ХС ЛПДНГ – у 1,86 разів (p<0,001), КА – в 1,74 рази (p<0,01), індексу ТГ/ХС ЛПВГ – в 2,5 рази (p<0,001). Концентрація ХС в плазмі крові чоловіків із МС у 1,23 рази була вища, ніж у групі контролю (p<0,01); ТГ – у 2,16 разів (p<0,001), ХС ЛПНГ – в 1,43 рази, (p<0,05), ХС ЛПДНГ – у 2,14 разів (p<0,001), КА – удвічі (p<0,01), індексу ТГ/ХС ЛПВГ – в 2,31 разів (p<0,001). У зв’язку із втратою захисних властивостей естрогенів порушення ліпідного обміну відмічали також і в постменапаузальних жінок без ознак МС. Зокрема, рівні ХС в 1,2 рази перевищували аналогічний у групі контролю (p<0,05), ТГ – в 1,84 рази (p<0,001), ХС ЛПНГ – в 1,53 рази (p<0,01), ХС ЛПДНГ – в 1,82 рази (p<0,001), КА – удвічі, ІТ/ХС ЛПВГ – у 2,87 разів (p<0,001). В усіх групах обстежених хворих із МС, у яких типовано дисліпідіемію, основну частку складає IIb тип. Його верифікували у 62,5% чоловіків (15 осіб), 15,38% (4 особи) жінок репродуктивного віку та 50% жінок в менопаузі (40 осіб).

Таблиця 1. Показники ліпідограми в обстежених осіб (M±m) Групи обстеження Жінки в Показник Контроль Чоловіки Жінки з Жінки з М без з МС, МС без МС в М, , n=30 МС, n=24 М, n=26 n=80 n=21 ЗХС, 4,31±0,11 5,31±0,33 5,24±0,47 5,73±0,13 5,21±0,54 ммоль/л p1<0,01 p1<0,01 p1<0,01 p1<0,05 p2>0,05 p2>0,05 p2>0,05 p3>0,05 p3>0,05 p4>0,05 ТГ, 0,61±0,03 1,32±0,24 1,25±0,47 1,52±0,08 1,12±0,16 ммоль/л p1<0,001 p1<0,001 p1<0,001 p1<0,001 p2>0,05 p2>0,05 p2>0,05 p3>0,05 p3>0,05 p4<0,05 ХС 2,56±0,11 3,67±0,69 3,69±0,57 4,50±0,11 3,94±0,84 ЛПНГ, p1<0,05 p1<0,05 p1<0,01 p1<0,01 ммоль/л p2>0,05 p2<0,05 p2>0,05 p3<0,05 p3>0,05 p4>0,05 ХС 1,43±0,11 1,21±0,14 1,03±0,16 1,01±0,04 1,0±0,16 ЛПВГ, p1>0,05 p1>0,05 p1>0,05 p1>0,05 ммоль/л p2>0,05 p2>0,05 p2>0,05 p3>0,05 p3>0,05 p4>0,05 ХС 0,28±0,01 0,60±0,10 0,52±0,12 0,71±0,04 0,51±0,11 ЛПДНГ, p1<0,001 p1<0,001 p1<0,001 p1<0,001 ммоль/л p2>0,05 p2>0,05 p2>0,05 p3>0,05 p4>0,05 КА, 2,31±0,19 4,65±1,03 4,03±0,78 4,99±0,22 4,70±0,25 ум.од. p1<0,01 p1<0,01 p1<0,001 p1<0,001 p2>0,05 p2>0,05 p2>0,05 p3>0,05 p3>0,05 p4>0,05 ТГ/ХС 0,48±0,04 1,11±0,18 1,21±0,18 1,37±0,07 1,38±0,28 ЛПВГ, p1<0,001 p1<0,001 p1<0,001 p1<0,001 ум.од. p2>0,05 p2>0,05 p2>0,05 p3>0,05 p3>0,05 p4>0,05 Примітки: 1. р1 – достовірність порівняно з контролем; 2. р2 – достовірність порівняно з чоловіками з МС; 3. р3 – достовірність порівняно з жінками з МС без менопаузи; 4. р4 – достовірність порівняно з жінками з МС в менопаузі

Висновки 1. Для менопаузального МС характерні порушення основних показників гемодинаміки: зростання ЧСС на 16,5%, рівнів САТ і ДАТ – на 30%, які корелюють з ІМТ та ОТ. 2. У жінок в менопаузі з ознаками МС виявляються найбільш значущі порушення ліпідного обміну: зростання ХС в 1,22 рази, ТГ – в 2,5 рази, ХС ЛПНГ – в 1,75 разів, ХС ЛПДНГ – в понад 2,5 рази. У 50% випадків верифікували ІІ b тип дисліпідемії, яка характеризується високою атерогенністю.

72

Перспективою наступних досліджень є вивчення імунних змін в менопаузі та за умови наявності МС. Література 1. Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. Executive Summary of the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III). //JAMA, 2001. –Vol.285(19). –P. 2486-2497. 2. Rosamond W, Flegal K, Friday G, et al. American Heart Association Statistics Committee and Stroke Statistics Subcommittee. Heart disease and stroke statistics—2007 update: a report from the American Heart Association Statistics Committee and Stroke Statistics Subcommittee / W Rosamond, K Flegal, G Friday, [et al.] //Circulation, 2007. –Vol.115(5). –P. e69-e171. 3. Gohlke-Barwolf C. Coronary artery disease: is menopause a risk factor? //Basic Res Cardiol., 2000. –Vol.95, suppl 1. –P.I77-I83 4. Janssen I., Powell L., Crawford S. et al. Menopause and the Metabolic Syndrome. / I.Janssen, L.Powell, S.Crawford [et al.] // Arch. Intren. Med., 2008. - Vol.168. - P. 1568-75. 5. Carr M C. The emergence of the metabolic syndrome with menopause. //J Clin Endocrinol Metab. ,2003. –Vol.88(6). –P.2404-2411. 6. American Association of clinical endocrinologists medical guideline for clinical practice for the diagnosis and treatment of menopause / Neil F. Goodman; Rhoda H. Cobin; Samara Beth Ginzburg; Ira A. Katz; Dwain E. Woode //Endocrine Practice, 2011. –Vol.17, Suppl7. –P.1-25. Насраллах А.Х. Клинические особенности течения метаболического синдрома в женщин в постменопаузе Резюме. Сердечно-сосудистые заболевания – главная причина смерти женщин в развитых странах. В женской популяции метабо-


Галицький лікарський вісник, 2013, Т. 20, № 4 лический синдром (МС) встречается, в среднем, в 20-30% лиц среднего возраста; по мере развития менопаузы частота случаев его значительно увеличивается. Цель исследования – изучить клинико-лабораторные особенности течения МС у женщин в постменопаузе. Материал и методы: обследованы 130 больных из МС, среди которых - 24 мужчины и 106 женщин. Женщины, в свою очередь, были разделены на 2 группы: 80 лиц, которые были в физиологической менопаузе, и 26 больных репродуктивного возраста. Проводили антропометрические исследования, измерение ЧСС и офисного АД, липидограмму. Результаты исследования: Менопаузальный МС характеризуется высоким показателем ИМТ, который был идентичным с ИМТ у мужчин с МС; ОТ в 1,2 раза выше контрольных значений (p<0,01). У женщин в менопаузе с МС выявили значимые нарушения липидного обмена. Уровень холестерина (ХС) в 1,22 раза превышал показатели контрольной группы (p<0,01). Уровень триглицеридов (ТГ) практически в 2,5 раза был выше контрольных значений (p<0,001). Концентрация холестерина липопротеидов низкой плотности (ХС ЛПНП) превышала контрольные параметры в 1,75 раз, а холестерина липопротеидов очень низкой плотности (ХС ЛПДНП) – больше. чем в 2,5 раза (p<0,001). Выводы. Для менопаузального МС характерны нарушения основных показателей гемодинамики: увеличение ЧСС на 16,5%, уровней САД и ДАД – на 30%, которые коррелируют с ИМТ и ОТ. У женщин с Мс в менопаузе нарушены показатели липидного обмена. Ключевые слова: метаболический синдром, менопауза, липидный обмен. A.H. Nasrallah The Clinical Features of Metabolic Syndrome Course in Postmenopausal Women SHEI “Ivano-Frankivsk National Medical University”, Postgraduate Education Faculty, Department of Therapy and Family Medicine anas_nasrallah@hotmail.com

Summary. Cardiovascular diseases (CVD) are the primary cause of death in women in Western countries. The metabolic syndrome (MetS) is a summary measure of important CVD risk factors that frequently coexist. The syndrome is evident in 20% to 30% of middleaged women and has been linked to the development of CVD and diabetes. The aim of study was to determine the clinical and laboratory features of metabolic syndrome course in postmenopausal women . Material and Methods. 130 patients with MetS (24 males, 106 females) were observed. All females with MetS were divided into two groups: 80 menopausal and 24 females in reproductive age. 21 menopausal women without MetS were included to study too. Control group consisted of 30 practically healthy persons. We measured the basic anthropometric parameters, heart rate (HR), blood pressure (BP) and lipids level in plasma. Results: Menopausal metabolic syndrome is characterized by a high BMI (p <0,01), which is similar to the same index in the group of men with MetS. WC in 1.2 times higher than control values (p <0,01). The most significant disruption in lipidogramm we founded in postmenopausal women with metabolic syndrome. The level of total cholesterol (Ch) was in 1.22 times higher than in control group (p<0,01). The level of TG was in 2.5 times higher than control values (p<0,001). The concentration of low-density lipoprotein cholesterol (LDL-C) exceeded the control parameters in 1.75 times, and cholesterol of very low density (VLDL -C) - in more than 2.5 times (p <0,001). Conclusions. The menopausal MetS is characterized by the basic hemodynamic parameters violations: increase of HR by 16,5%, SBP and DBP by 30% which correlated with BMI and WC. Menopausal women with MetS have the most significant deviations in lipid metabolism. Keywords: metabolic syndrome, menopause, lipids metabolism Надійшла 25.11.2013 року.

УДК 616-089+616.37-002

Пилипчук В.І., Хруник А.Д., Дирів О.Л. Результати хірургічного лікування хронічного панкреатиту Кафедра хірургії факультету післядипломної освіти (зав. каф. - проф. О.Л.Ткачук) Івано-Франківського національного медичного університету Резюме. Проведено аналіз хірургічного лікування 81 хворого з хронічним панкреатитом (ХП), яким протягом 2009 - 2013 років проведено оперативне лікування. У 70 хворих (86,4%) був чітко виражений астено-вегетативний синдром, у 42 пацієнтів (51,8%) дискінетичний синдром. Диспептичний синдром визначався у всіх хворих. У 25 хворих (30,8%) були виражені симптоми пошкодження сусідніх органів, спричинені хронічним панкреатитом. Всім хворим проведені чітко обґрунтовані оперативні втручання з урахуванням змін в самій тканині залози (фібринозно-дегенеративні зміни тканини залози, інтрапанкреатична гіпертензія, кальциноз, вірсунголітіаз) та навколишніх органах (біліарна гіпертензія, дуоденостаз). Операцію Фрея виконано 14 хворим (17,4%), повздовжню панкреатоєюностомію – 27 (33,3%), цистоентеростомію - 7 (8,6%), дистальну резекцію підшлункової залози (ПЗ) - 5 (6,2%), ендоскопічне стентування головної панкреатичної протоки (ГПП) – 12 (14,8%), ендобіліарне стентування – 6 (7,4%), накладання обхідних анастомозів (гастроентеро-, біліодигестивних) – 3 (3,7%), ендоскопічну дуоденоцистостомію – 4 (4,9%), зовнішнє дренування псевдокіст – 3 (3,7%). Післяопераційна летальність – 2,5% (померло 2 хворих). Відсутність чітко сформульованих показів до оперативного втручання хронічного панкреатиту спричиняє його тривале та малоефективне консервативне лікування, часто призводить до запізнілої госпіталізації в хірургічний стаціонар. Вибір методу оперативного втручання у хворих із хронічним панкреатитом повинен бути патогенетично обгрунтованим, з урахуванням змін в самій тканині залози (фібринозно-дегенеративні зміни тканини залози, інтрапанкреатична гіпертензія, кальциноз, вірсунголітіаз) та навколишніх органах (біліарна гіпертензія, дуоденостаз). Під час втручання необхідно прагнути максимально усунути ці фактори. А тому в кожному конкретному випадку метод операції повинен бути строго індивідуальним.

Ключові слова: хронічний панкреатит, підшлункова залоза, головна панкреатична протока.

Постановка проблеми і аналіз останніх досліджень. Хронічний панкреатит – поширене захворювання в структурі патології шлунково-кишкового тракту. За даними різних авторів, захворюваність на ХП в країнах СНД складає близько 25-35 на 100 тис. нас., в країнах Європи – 8-10 на 100 тис. населення. З цих хворих від 4 до 9% потребують хірургічної допомоги. За етіологією переважну більшість (до 90%) складають ХП алкогольні, близько 10% - біліарні. Незначний відсоток складають ХП, причину яких точно встановити не вдається. Вважається, що в цих випадках етіологічними факторами можуть бути токсичні впливи медикаментів, аутоімуноагресія, спадкові фактори, тощо. Вищевказані причини в поєднанні з несвоєчасним та неадекватним лікуванням запускають механізм розвитку патологічних процесів у підшлунковій залозі та органах панкреато-біліарної зони. У таких хворих прогресують запально-деструктивні зміни в самій залозі, які зачіпають та глибоко змінюють як ацинарний апарат, так і протокову систему ПЗ. Все це призводить до заміщення тканини ПЗ на фіброзну, екзокринної та ендокринної недостатності ПЗ, розвитку протокової гіпертензії, у пізніх стадіях – до порушення функції сусідніх органів (біліарної гіпертензії, дуоденальної непрохідності, портальної гіпертензії тощо). В даний час лікуванням ХП займаються як гастроентерологи, так і хірурги. Проте, відсутні чітко визначені критерії та покази до консервативного чи

73


Галицький лікарський вісник, 2013, Т. 20, № 4

оперативного лікування. Тому і результати лікування цієї недуги не завжди позитивні. Мета дослідження: вивчити безпосередні результати хірургічного лікування хворих на хронічний панкреатит, виявити причини незадовільних результатів, визначити покази до оперативного лікування хворих та вибору методу операції. Матеріал і методи дослідження Проведено аналіз хірургічного лікування 81 хворого з ХП, яким протягом 2009 - 2013 років проведено оперативне лікування в хірургічному відділенні і у відділенні малоінвазивної та пластичної хірургії Івано-Франківської обласної клінічної лікарні. Всім пацієнтам до операції проводились загальноприйняті лабораторні обстеження (аналіз крові, сечі, група крові та резус-фактор, біохімічні дослідження крові, коагулограма, цукор крові) та інструментальні методи дослідження (рентгенологічні, відеоезофаго-гастро-дуоденоскопія, ультрасонографія підшлункової залози та органів черевної порожнини, спіральна комп’ютерна томографія з підсиленням). Ультразвукове дослідження проводили на апараті Alpinion ECUBE 9-STD, який дає можливість візуалізації розмірів, структури залози, її патологічних включень, в багатьох випадках чітко вказує на патологію протокової системи (звуження, ектазії, деформації протоків, кістозні трансформації). КТ проводили хворим на SOMATOM Emotion 16 з автоматичним ін’єктором (injectionsystem) MEDRAD VISTRON CT.

Результати дослідження та їх обговорення Всі хворі з ХП поступили на оперативне лікування в плановому порядку з відповідними обстеженнями. Серед 81 пацієнта чоловіків було 75 (92,6%), жінок всього 6 (7,4%). За віком хворі розподілились так: до 20 років був всього 1 хворий (1,2%), від 21 до 40 років – 31 (38,4%), від 41 до 60 років – 46 (56,7%), старші 60 років – 3(3,7%). Не мали постійного місця роботи, або взагалі не працювали 57 хворих (70,4%). Серед хворих – один студент та двоє пенсіонерів. 10 хворих (12,3%) перебували на інвалідності з причини панкреатиту (у 7 – третя група інвалідності, в 3 – друга). В хірургічне відділення ОКЛ повторно після раніше перенесених операцій на органах панкреато-біліарної зони поступили 14 (17,2%) хворих. У 10 з них раніше були проведені операції з приводу гострого деструктивного панкреатиту (2 – лапароскопічне дренування ферментативного перитоніту; 6 – лапаротомії з приводу панкреонекрозу, абсцесів сальникової сумки та заочеревинних флегмон; одному – люмботомія, дренування заочеревинних панкреатичних флегмон; одному – дренування гострої парапанкреатичної кисти катетером «pig tail» під контролем УЗД). Ще чотирьом хворим раніше було виконано ендоскопічну ретроградну панкреатохолангіографію та папілотомію з приводу біліарної гіпертензії. З решти 67 хворих 52 (64,2%) лікувались раніше стаціонарно консервативно в інших гастроентерологічних та хірургічних стаціонарах, 2 хворих – амбулаторно. 13 хворих (16,0%) ніколи не звертались раніше до лікарів з приводу проблем з ПЗ. Тривалість «панкреатичного анамнезу» від 1 до 5 років відмічена у 20 хворих (24,7%), більше 5 років – у 6 (7,4%). Решта пацієнтів відзначали, що хворіють не більше одного року. Проте, при більш ретельному опитуванні у них можна було відмітити незначно виражені диспептичні симптоми, на які вони не звертали належної уваги. Основною скаргою у всіх пацієнтів був біль в животі різного характеру, який періодично мав інтенсивний характер, що спонукало їх приймати знеболюючі середники. Тільки у 7 пацієнтів (8,6%) біль був пов’язаний з прийомом їжі. У решти хворих чіткого зв’язку болю з харчуванням не виявлено. У 70 хворих (86,4%) був чітко виражений астеновегетативний синдром (загальна слабість, подразливість, порушення сну, зниження працездатності). У 42 пацієнтів (51,8%) був виражений дискінетичний синдром (проноси, закрепи). Диспептичний синдром (зміна апетиту, нудота, блювання, яке не приносить полегшення, відраза до жирної їжі, слюнотеча, метеоризм) визначався у всіх хворих. Це

74

вказує на те, що у всіх досліджуваних пацієнтів спостерігалися симптоми екзокринної недостатності підшлункової залози. У 8 (9,8%) хворих були чітко виражені симптоми хронічної дуоденальної непрохідності. Ще у 19 (23,4%) пацієнтів була жовтяниця, пов’язана з патологічним процесом в головці ПЗ. У 2 хворих жовтяниця та хронічна дуоденальна непрохідність були одночасно. Отже, 25 хворих (30,8%) мали чітко виражені симптоми пошкодження сусідніх органів, спричинені хронічним панкреатитом. При поступленні у відділення у більше, ніж половини хворих – 50 (61,7%) визначалась анемія, причому в 18 з них вона була вираженою (Hb < 100 г/л). У 48,1% (39 пацієнтів) була значна гіпопротеїнемія (загальний білок < 65 г/л). Це зумовило необхідність проведення більш тривалої передопераційної підготовки. Показники загального білірубіну вище норми визначались у 19 хворих (23,4%), причому, у трьох з них цей показник перевищував 200 ммоль/л. Гіперглікемія при госпіталізації виявлена у 11 хворих (13,5%), що вказувало на ознаки ендокринної недостатності підшлункової залози. Основними інструментальними методами діагностики патології ПЗ та сусідніх органів були ультразвукове дослідження (УЗД) та селективна комп’ютерна томографія (СКТ) з підсиленням, які в значній мірі визначали вибір методу оперативного втручання. Ультрасонографію проведено всім хворим. При цьому, у 39 (48,1%) виявлено дифузне чи локальне (головка ПЗ) збільшення залози. У 68 хворих (83,9%) структура ПЗ була неоднорідною. У 16 (19,7%) на УЗД виявлено інтрапанкреатичні кісти, в 39 (48,1%) – кальцинати в тканині залози. У 34 хворих (41,9%) відмічено розширення вірсунгової протоки більше 5 мм, причому у 14 з них протока мала ширину від 8 мм до 10 мм, а у 2 хворих ширина протоки сягала 20 мм, що вказувало на виражену протокову гіпертензію. Хворим досліджуваної групи були проведені наступні оперативні втручання (табл. 1). Таблиця 1. Назва операції Операція Фрея Повздовжня панкреатоєюностомія Цистоентеростомія Дистальна резекція ПЗ Ендоскопічне стентування ГПП Ендобіліарне стентування Накладання обхідних анастомозів (гастроентеро-, біліодигестивних) Ендоскопічна дуоденоцистостомія Зовнішнє дренування псевдокіст Всього

Кількість 14 27 7 5 12 6 3

% 17,4 33,3 8,6 6,2 14,8 7,4 3,7

4 3 81

4,9 3,7 100

Основними показами для виконання операції Фрея вважали наявність фібринозно-дегенеративного панкреатиту з локалізацією процесу в головці ПЗ та поширенням вірсунгової протоки (14 хворих). У двох хворих операцію Фрея доповнено накладанням холедохо-єюноанастомозу в зв’язку з біліарною гіпертензією (в одного з них – на роз’єднаних кишкових петлях). В одного хворого операцію Фрея завершено накладанням панкреато-дуодено-ентероанастомозом (за В.М.Копчаком). Поздовжню панкреатоєюностомію виконано 27 хворим. Основним показом до виконання цієї операції вважаємо інтрапанкреатичну гіпертензію, вірсунголітіаз з інтрапанкреатичною гіпертензією. Останнім часом операцію Фрея та поздовжню панкреатоєюностомію завершуємо накладанням панкреатоєюноанастомозу виключно на ізольованій петлі тонкої кишки (за Ру) – 16 хворих. Операцію цистоентеростомії виконано 7 хворим зі зрілими псевдокістами ПЗ та сформованою стінкою кісти. У 4 хворих, у яких псевдокіста тісно прилягала до стінки дванадцятипалої кишки та спричиняла явища дуоденостазу,


Галицький лікарський вісник, 2013, Т. 20, № 4

проведено ендоскопічну цистодуоденостомію. Показанням до виконання цистоентеростомії вважаємо випадки, коли псевдокіста ПЗ має сполучення з головною панкреатичною протокою, хоча при цьому протока не поширена. Протягом 2012-2013 років 12 хворим з протоковою гіпертензією та вірсунгоектазією проведено ендоскопічне стентування вірсунгової протоки. При цьому, у 4 пацієнтів під час втручання виконано літоекстракцію з головної панкреатичної протоки. У 13 хворих, яким проведені вищеописані операції, під час втручання проведено видалення конкрементів з вірсунгової протоки. Дистальну резекцію ПЗ виконано у 5 пацієнтів з локалізацією патологічного процесу в хвості ПЗ. Цю операцію виконували при наявності ізольованого фіброзного чи фіброзно-дегенеративного процесу хвоста ПЗ або при підозрі на пухлинний процес. У 9 пацієнтів (11,1%) оперативні втручання були пов’язані з дуоденальною чи біліарною непрохідністю та полягали в накладанні обхідних анастомозів чи ендобіліарному стентуванні. Через тяжкість стану хворих у них резекційні операції на ПЗ не проводились. Безпосередні результати оперативних втручань у пацієнтів досліджуваної групи були наступними. Після виконаних операції померло двоє хворих (післяопераційна летальність – 2,5%), яким виконано операцію Фрея. Причиною летального випадку в одного хворого стали кишкові кровотечі із зони анастомозута недостатність швів панкреатоєюноанастомозу. В іншого хворого в ранньому післяопераційному періоді розвинулась гостра серцева слабість. Під час контрольних оглядів хворих після їх виписки з стаціонару відзначено, що помірно виражений больовий синдром залишався у 9 хворих (11,1%). За даними ультразвукового дослідження у 5 хворих (6,2%) після операції залишались явища біліарної гіпертензії (поширення холедоха до 0,8-0,9 см), хоча суб’єктивно хворі скарг не подавали, а дані біохімічного дослідження крові (білірубін, трансамінази) не вказували на порушення функції печінки. Висновки 1. Хронічний панкреатит – важлива медико-соціальна проблема, оскільки важко піддається лікуванню, призводить до значного зниження працездатності, а в 12,3% - до інвалідності. 2. Хронічний панкреатит є тяжким захворюванням, при якому у 100% наявні ознаки екзокринної недостатності ПЗ, у 13,5% - симптоми ендокринної недостатності та у 30,8% спричиняє пошкодження сусідніх органів. 3. Відсутність чітко сформульованих показів до оперативного втручання хронічного панкреатиту спричиняє його тривале та малоефективне консервативне лікування, часто призводить до запізнілої госпіталізації в хірургічний стаціонар та в кінцевому результаті – до не завжди позитивних результатів операції. 4. Вибір методу оперативного втручання у хворих з хронічним панкреатитом повинен бути патогенетично обгрунтованим, з урахуванням змін в самій тканині залози (фібринознодегенеративні зміни тканини залози, інтрапанкреатична гіпертензія, кальциноз, вірсунголітіаз) та навколишніх органах (біліарна гіпертензія, дуоденостаз). Під час втручання необхідно прагнути максимально усунути ці фактори. А тому в кожному конкретному випадку метод операції повинен бути строго індивідуальним. Перспективи подальших досліджень Перспектива дослідження полягає у визначенні чітких показів до оперативного лікування та вибору методу операції хворих на хронічний панкреатит, обґрунтуванні існуючих та розробці нових методів хірургічного лікування недуги. Література 1. Ничитайло М. Ю. Ендоскопічні хірургічні втручання при

хронічному панкреатиті, ускладненому псевдокістами / П. В. Огородник, А. Г. Дейниченко // Штитальна хірургія. - 2011. - № 3. – с. 5-8. 2. Кочатков А.В. Резекция головки поджелудочной железы с продольным панкреатоеюноанастомозом (операция Фрея) / А.В.Кочатков, А.Г. Кригер, С.В. Берелавичус // Хирургия. – 2012. - № 2. - с. 31-35. 3. Кубышкин В.А. Обоснование выбора способа хирургического лечения хронического панкреатита / В.А.Кубышкин, И.А.Козлов, Н.И.Яшина // Бюллетень сибирской медицины. – 2007. - № 3. -с. 43-49. Пилипчук В.І., Хруник А.Д., Дырив О.Л. Результаты хирургического лечения хронического панкреатита Резюме. Проведено анализ хирургического лечения 81 больного с ХП, которым на протяжении 2009 - 2013 годов проведено оперативное лечение. У 70 больных (86,4%) был выражен астено-вегетативный синдром, у 42 пациентов (51,8%) - дискинетический синдром. Диспептический синдром определялся у всех больных. У 25 больных (30,8%) определялись симптомы повреждения соседних органов вследствие хронического панкреатита. Всем больным проведены оперативные вмешательства с учетом изменений в самой тканижелезы (фибринознодегенеративные изменения ткани железы, интрапанкреатическая гипертензия, кальциноз, вирсунголитиаз) и в соседних органах (билиарная гипертензия, дуоденостаз). Операция Фрея выполнена 14 больным (17,4%), продольная панкреатоєюностомия – 27 (33,3%), цистоэнтеростомия – 7 (8,6%), дистальная резекция ПЗ – 5 (6,2%), эндоскопическое стентирование ГПП – 12 (14,8%), эндобилиарное стентирование – 6 (7,4%), наложение обходных анастомозов (гастроэнтеро-, билиодигестивних) – 3 (3,7%), эндоскопическая дуоденоцистостомия – 4 (4,9%), внешнее дренирование псевдокист – 3 (3,7%). Послеоперационная летальность – 2,5% (умерло 2 больных). Отсутствие четко сформулированых показаний к оперативному лечению хронического панкреатита определяет его длительное и малоэффективное консервативное лечение, часто приводит до поздней госпитализации в хирургический стационар. Вибор метода оперативного вмешательства у больных с хроническим панкреатитом должен быть патогенетически обоснованным, с учетом изменений в самой ткани железы (фибринозно-дегенеративные изменения ткани железы, интрапанкреатическая гипертензия, кальциноз, вирсунголитиаз) и соседних органах (билиарная гипертензия, дуоденостаз). Во время вмешательства необходимо стремиться максимально ликвидировать эти факторы. Поэтому, в каждом конкретном случае метод операции должен быть строго индивидуальным. Ключевые слова: хронический панкреатит, поджелудочная железа, главная панкреатическая протока V.V. Pylypchuk, A.D. Khrunyk, O.L. Dyriv Results of Chronic Pancreatitis Surgical Treatment Surgery department of postgraduate education faculty (head of the department – Prof. O. L. Tkachuk) Ivano-Frankivsk National Medical University Summary.We have analyzed 81 patient with chronic pancreatitis that underwent surgical treatment in 2009-2013. Asthenovegetative syndrome was distinct in 70 patients (86.4%), and dyskinetic syndrome – in 42 patients (51.8%). Dyspeptic syndrome was determined in all patients. Twenty-five patients (30.8%) had symptoms of damage to adjacent organs caused by chronic pancreatits. All patients received needed surgical treatment taking into account the changes of the pancreas tissue (fibrous and degenerative pancreas alterations, intrapancreatic hypertesion, calcinosis, pancreatic duct stones) and surrounding organs (bilious hypertension, duodenostasis). 14 patients (17.4%) underwent Frey surgery, 27 patients (33.3%) - lateral pancreaticojejunostomy, 7 patients (8.6%) –cystoenterostomy , 5 patients (6.2%) - distal pancreatectomy , 12 patients(14.8%) - endoscopic stenting of the Wirsung’s duct, 6 (7.4%) – endobiliary stenting, 3 (3.7%) - bypassing (gastroentero- and biliodigestive anastomoses), 4 (4.9%) - endoscopic duodenoscopy, and 3 (3.7%) - external draining of pancreatic pseudocyst. Operative mortality is 2.5% (2 patients died). Lack of clearly formulated surgical judgements concerning chronic pancreatitis is the reason for its long and inefficient conservative treatment that often leads to late admission to surgical hospital. Choice of surgery method for patients with chronic pancreatitis should be pathogenetically grounded taking into consideration pancreas tissue alterations (fibrous and degenerative pancreas alterations, intrapancreatic hypertension, calcinosis, Wirsung’s duct lithiasis) and alterations of surrounding organs (biliary hypertension, duodenostasis). It is necessary to strive for maximum elimination of these factors in the course of surgical procedure. Therefore, surgical method should be tailored to each individual case. Keywords: chronic pancreatitis, pancreas, Wirsung’s duct Надійшла 25.11.2013 року.

75


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 616-089+616.134

Попадюк О.Я. Стентування правої підключичної артерії Кафедра загальної хірургії (зав. каф. - проф. І.М.Гудз) Івано-Франківського національного медичного університету Резюме. Атеросклеротичні ураження артерій верхніх кінцівок є невирішеною проблемою хірургії та спричиняють порушення живлення тканин кінцівок, порушення сили м’язів. Такі порушення можуть призвести до дистрофiї, фiброзу i некрозу кінцівок. Одним з ефективних методів лікування стенотичних та оклюзійних уражень артерій верхніх кінцівок є ендоваскулярна ангіопластика. Мініінвазивним способом під ренген контролем встановлено місце локалізації стенозу правої підключичної артерії, проведено балонну предилятацію та імплантовано стент розміром 7мм на 23 мм у ділянку стенозу. Відновлено магістральний кровотік та кровопостачання правої верхньої кінцівки. Наступного дня після операції хворий з покращенням та відповідними рекомендаціями виписаний за місцем проживання. Ключові слова: атеросклероз, стеноз артерій, ангіопластика, стентування.

Постановка проблеми і аналіз останніх досліджень. Атеросклеротичні ураження та бляшки можуть появлятись у артеріях людського організму. Розростання таких бляшок призводить до звуження або оклюзії артерій та подальшим порушенням кровопостачання органів, які вони живлять. Внаслідок порушення притоку кровi до органiв i тканин розвиваються дистрофiя, фiброз i некроз. Часто наявність бляшки призводить до тромбозів що, в свою чергу, потребує екстреного хірургічного лікування [1]. Однією з таких артерій верхньої кінцівки, де найчастіше локалізуються атеросклеротичні бляшки, є підключична артерія. Однак слід пам’ятати, що ураження артерій верхньої кінцівки може бути спричинено іншими патологіями, охоплюючи різні рівні артеріальної системи верхньої кінцівки. Тому пацієнтам з такими ураженнями слід провести ретельну клінічну діагностику, що грунтується на анамнезі та фізикальному обстеженні: вимірювання артеріального тиску на обох кінцівках та оцінювання аксилярного, брахіального, радіального та ульнарного пульсу; аускультація є важливою частиною обстеження верхньої кінцівки, її повинні починати із надключичної ямки. Обов’язково слід провести ультразвукове дуплексне сканування та при виявленні стенозів чи оклюзій контрастну аортогафію. Ознаки і симптоми, такі як низький пульс, біль у руці, блідість шкіри, парестезія, зниження місцевої темпера тури та неоднаковий артеріальний тиск на кінцівках, слугують підставою для подальшого обстеження для виявлення оклюзії артерій верхньої кінцівки [1,2,3]. У лікуванні пацієнтів із симптомами ураження артерій верхніх кінцівок можливе застосування як ендоваскулярної

Рис. 1. Контрастна артеріографія правої підключичної артрерії з візуалізацією ділянки стенозу

76

(балонна ангіопластика чи стентування), так і оперативної методики лікування (шунтування алопротезом) [3,4]. Клінічний випадок. З анамнезу відомо, що пацієнт оперований з приводу тромбозу правої плечевої артерії, але чіткого магістрального кровотоку у післяопераційному періоді не було,пальпаторно пульс відсутній, хворий відзначав затерпання та похолодіння правої верхньої кінцівки. Пацієнт Ш., 58 років, поступив у лікувально-діагностичний центр «СімедГруп» з діагнозом: облітеруючий атеросклероз судин правої верхньої кінцівки ІІ-ІІІ стадії, стеноз правої підключичної артерії. При поступленні хворий скаржився на затерпання, похолодіння, блідість правої кисті, слабість правої верхньої кінцівки, втрату сили у кінцівкі та неможливість її підняти вище рівня плеча. При огляді шкірні покриви правої верхньої кінцівки бліді, дещо прохолодні. Пальпаторно пульсація на переферичних артеріях та аксілярній артерії правої верхньої кінцівки відсутня. Проведене ультразвукове сканування дозволило виявити стеноз правої підключичної атрерії. З метою дообстеження хворому проведена контраснааортографія на комп’ютерному томографі. Чітко діагностовано місце критичного стенозу більше 90%. В умовах мініінвазивної операційної під місцевим знеболенням хворому пунктовано праву загальну клубову артерію, встановлено інтродюсер 7F. За допомогою провідника підведено діагностичний катетер до місця стенозу правої підключичної артерії та виконано артеріографію (рис.1). Через стеноз проведено коронарний провідник та за допомогою балона розміром 2 мм на 10 мм проведена предилятація з метою збільшення просвіту артрерії та можливості проведення стентування (рис. 2). В ділянку стенозу заведено та встановлено металічний непокритий стент розміром 7мм на 23 мм, контрольна артреріографія, відновлено магістральний кровотік по правій підключичній артрерії (рис. 3) . Через 1 годину після оперативного лікування хворий відмітив значне покращення, відсутність затерпання кисті, підвищилась сила м’язів кінцівки. Пальпаторно пульсація на переферичних та магістральних артеріях правої верхньої кінцівки добра. Кінцівка тепла на дотик, блідо-рожевого забарвлення. Через 1 добу з метою контролю хворому проведено ульразвукове дуплексне сканування правої підключичної артерії. Результати сканування показали, що артерія прохідна, чіткий центральнийкровотік в ділянці розташування

Рис. 2. Права підключична артерія в ділянці стенозу після предилятації


Галицький лікарський вісник, 2013, Т. 20, № 4

Рис. 3. Контрольна артеріографія. Стент встановлено в ділянку стенозу, відновлена прохідність артерії

стента, положення стента без особливостей (рис. 4). Оперція завершена та інтродюсер забраний зі стегнової артерії. Проведено гемостаз шляхом притискання ділянки пункції. На праву пахову ділянку накладено давлячу асептичну пов’язку. В післяопераційному періоді проводилась дезагрегантна терапія: кардіомагніл - 1 таблетка (75 мг) 1 раз на добу ввечері; плавікс - 150 мг 1 раз на добу зранку. Через 12 годин знято давлячу асептичну пов’язку, проведено перев’язку з розчином бетадину в ділянці пункції. Вибрана ендоваскулярна тактика лікування хворого показала хороший результат. Встановленний через мініінвазивний доступ стент в ділянку стенозу дозволив відновити магістральний кровотік по правій підключичній артерії без проведення складного оперативного втручання традиційним відкритим способом. Наступного дня хворий виписаний зі стаціонару з відповідними рекомендаціями. Це свідчить на користь даного методу лікування, а саме відсутність великих розрізів шкірних покривів та травми навколишніх органів чи тканин, коротка тривалість операції та післяопераційного періоду, виражений ефект. Застосування ендоваскулярних методів лікування є сучасним та перспективним напрямком розвитку хірургії в нашому регіоні. Література 1. Гуревич В.С. Современные представления о патогенезе атеросклероза / В.С. Гуревич // Болезнисердца и сосудов. - 2006. № 4. - С. 4–8; 2.Покровський А.В. Клиническая ангиология: руководство. / под. ред. А.В. Покровского в двух томах. – М.: ОАО «Издательство «Медицина», 2004. –Т1. – С. 808. 3. Русин В.І. Результати лікування хронічної ішемії верхніх кінцівок при синдромі підключично-хребетного обкрадання головного мозку / В.І. Русин, В.В. Корсак, А.В. Левицький, М.І. Борсенко // Науковий вісник Ужгородського університету, серія «Медицина». – 2012. - №3 (45). – С. 88-93; 4. Nakamura S. Endoluminal stenting for obstructure lesions of the subclavian artery. Multicenter registry in Japan / S. Nakamura, A.Kanazawa, K.Hozawaetal. // Amer. J. Cardiol. – 2004. – TCT. – Abstr. 127 E. 1. Gurevich V.S. Modern view sonthe pathogenesis of atherosclerosis. Bolezniserdca i sosudov 2006; 4: 4-8. 2. Pokrovs’kij A.V. Clinical Angiology: aguide. / Edited Pokrovs’kij A.V. in two volumes. – Мosskov.: OAO «Izdatel’stvo «Medicina», 2004. –1. –808p. 3. RusynV.I., KorsakV.V., Levyc’kyjA.V., BorsenkoM.I. Results

Рис. 4. Ультазвукове дуплексне сканування правої підключичної артерії of treatment of chronic ischemia of the upper limb syndrome subclavian-vertebral steal the brain. Naukovyjvisnyk Uzhgorods’kogo universytetu, serija «Medycyna», vypusk 2012; 3(45): 65-68. 4. Nakamura S., Kanazawa A., Hozawa K. et al. Endoluminal stenting for obstructure lesion softhe subclavian artery. Multicenter registry in Japan . Amer. J. Cardiol 2004; TCT: Abstr. 127 . Попадюк О.Я. Стентирование правой подключичной артерии Кафедра общей хирургии Ивано-Франковский национальный медицинский університет Резюме. Атеросклеротические поражения артерий верхних конечностей является нерешенной проблемой хирургии и вызывают нарушения питания тканей конечностей, нарушение силы мышц. Такие нарушения могут привести к дистрофии, фиброзу и некрозам конечностей. Одним из эффективных методов лечения стенотических и окклюзионных поражений артерий верхних конечностей является эндоваскулярная ангиопластика. Миниинвазивным способом под рентген контролем установлено место локализации стеноза правой подключичной артерии, проведена баллонная предилятация и имплантирован стент размером 7мм на 23 мм в область стеноза. Восстановлено магистральный кровоток и кровоснабжение правой верхней конечности. На следующий день после операции больной с улучшением и соответствующими рекомендациями выписан по месту жительства. Ключевые слова: атеросклероз, стеноз артерий, ангиопластика, стентирование. O.Ya. Popadiuk Stenting of the Right Subclavian Artery Ivano-Frankivsk National Medical University, Department of general Surgery Summary. Atherosclerotic affection of the arteries of the upper extremities is the unsolved surgical problem that causes malnutrition in the tissues of the extremities and worsening of the muscle strength. These destructive changes may lead to dystrophy, fibrosis and necrosis of the extremities. One of the most effective treatments of stenotic and occlusive affections of the arteries of the upper limbs is endovascular angioplasty. Using minimally invasive method, with the help of the Xray control, we found the place of the localization of stenosis of the right subclavian artery, conducted balloon predilatation and stent (of the size 7 mm by 23 mm) implantation in the area of stenosis. The blood flow and arterial blood supply to the right extremity was restored. The next day the patient, feeling much better, was given discharge instructions and sent home. Key words: atherosclerosis, arterial stenosis, angioplasty, stenting. Надійшла 04.11.2013 року.

77


Галицький лікарський вісник, 2013, Т. 20, № 4

ÌÅÄÈ×ÍÀ ÎѲÒÀ УДК 378.147+371.21

Багрій М.М. Поетапність підготовки до складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка» Кафедра патоморфології та судової медицини (зав. каф. – проф. Михайлюк І.О.) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Система ліцензійних інтегрованих іспитів «Крок 1» є комплексом засобів стандартизованої діагностики рівня професійної компетентності, що є складовою частиною державної атестації студентів. Мета роботи: аналіз ефективності підготовки студентів ІІІ курсу медичного факультету зі спеціальності «Лікувальна справа» та «Педіатрія», які навчаються в Івано-Франківському національному медичному університеті (ІФНМУ), до складання ліцензійного інтегрованого іспиту «Крок 1. Загальна лікарська підготовка». В ІФНМУ під час проведення практичних занять використовуються, окрім усного опитування, оцінки самостійної аудиторної роботи, тестові завдання з акцентуацією на завдання типу «Крок 1». Запорукою успішного складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка» є використання на практичних заняттях і підсумкових модульних контролях тестових завдань, які входять до банку даних завдань ДО «Центр тестування професійної компетентності фахівців з вищою освітою напрямів підготовки «Медицина» і «Фармація» при Міністерстві охорони здоров’я України» і до екзаменаційних буклетів «Крок 1». Особливою формою внутрішнього контролю знань студентів в ІФНМУ є «ректорський контроль якості навчання», який проводиться в основному з метою оцінки залишкового рівня знань студентів з навчальної дисципліни або окремого її модуля з наступним аналізом та узагальненням; перевірки готовності студентів до складання ліцензійних інтегрованих іспитів «Крок» та з метою формування «групи ризику». Таким чином, поетапне тестування (практичне заняття – підсумковий модульний контроль – ректорський контроль) є запорукою успішного складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка»; проведення ректорських контролів і консультативних занять зі студентами «групи ризику» дозволяє покращити рівень підготовки до іспиту та сприяє досягненню більш високих результатів. Ключові слова: ліцензійний інтегрований іспит, тестовий контроль знань, тестування, рівень засвоєння знань.

Тестування є сучасним об’єктивним методом контролю знань студентів [4]. В умовах кредитно-модульної системи організації навчання у вищій школі зростає значення тестового контролю на кожному етапі навчання. Відповідно до результатів попереднього тестування здійснюється цілеспрямована корекція процесу навчання з урахуванням можливостей кожного студента при складанні завдань для самостійної й індивідуальної роботи. Поточне тестування проводиться на аудиторних заняттях з метою коригування навчальної діяльності студентів, стимулювання інтересу до навчання, формування почуття відповідальності. Тести тематичного контролю передбачають перевірку, оцінку та корекцію засвоєння знань. Вони проводяться після вивчення тієї чи іншої теми або змістового модуля. Підсумковий тестовий контроль проводиться в кінці кожного модуля з метою об’єктивної оцінки засвоєння знань студентів за поточний період. Проблема об’єктивної оцінки знань студентів має важливе і багатопланове значення. Достовірна і якісна інформація про кінцевий результат педагогічної діяльності потрібна також викладачам для самооцінки рівня викладання матеріалу та можливої корекції своєї навчальної і методичної діяльності. Тестовий контроль як засіб оптимізації навчального процесу набув у ВУЗах значного розповсюдження. На сьогодні доцільність використання тестів визнана у різних галузях науки і вже не є предметом дискусії. Тест – стандартизований метод визначення рівня підго-

78

товленості студента. Під час тестування всі учасники отримують однакові завдання, перебувають в однакових умовах і оцінюються згідно зі стандартними критеріями оцінювання відповідей. Такий підхід до організації контролю знань дозволить встановити відношення порядку між учасниками відповідно до їх освітнього рівня, об’єктивно визначити рейтинг кожного студента [1]. Система ліцензійних інтегрованих іспитів є комплексом засобів стандартизованої діагностики рівня професійної компетентності, що є складовою частиною державної атестації студентів, які навчаються за спеціальностями напрямів підготовки «Медицина» і «Фармація», та лікарів (провізорів), які проходять первинну спеціалізацію (інтернатуру) у вищих закладах освіти незалежно від їх підпорядкування. Ліцензійні інтегровані іспити проводяться відповідно до «Положення про систему ліцензійних інтегрованих іспитів фахівців з вищою освітою напрямів «Медицина» і «Фармація»», затвердженого наказом МОЗ України №251 від 14.08.1998, «Положення про організацію та порядок проведення державної атестації студентів», затвердженого наказом МОЗ України №53 від 31.01.2005 та відповідно до державних стандартів вищої освіти. Саме успішне складання цього іспиту визначає якість медичної освіти, відповідність державним стандартам вищої освіти та встановлює мінімальний рівень професійної компетентності фахівця відповідного освітньо-кваліфікаційного рівня [2]. Метою ліцензійного інтегрованого іспиту «Крок 1» є встановлення відповідності професійних знань і вмінь студентів мінімально необхідному рівню кваліфікації згідно з вимогами державних стандартів вищої освіти. «Крок 1» – іспит із основних фундаментальних дисциплін (біологія, нормальна анатомія, гістологія, нормальна фізіологія, біохімія, патологічна фізіологія, патоморфологія, мікробіологія, фармакологія), який складається наприкінці ІІІ курсу навчання. Окремими університетами розроблені власні підходи до організації та вдосконалення підготовки студентів для складання ліцензійних іспитів, зокрема розроблені методичні рекомендації для студентів з підготовки до ліцензійних інтегрованих іспитів [3]. Мета роботи: аналіз ефективності підготовки студентів ІІІ курсу медичного факультету зі спеціальності «Лікувальна справа» та «Педіатрія», які навчаються в Івано-Франківському національному медичному університеті (ІФНМУ), до складання ліцензійного інтегрованого іспиту «Крок 1. Загальна лікарська підготовка». Основна частина. Запорукою успішного складання будь-якого іспиту є систематична та грунтовна підготовка до практичних і семінарських занять, відвідування лекцій, участь у роботі студентських наукових гуртків, підготовка до доповідей і виступи на студентських наукових конференціях тощо. Комплекс аудиторної й позааудиторної роботи забезпечить отримання студентом грунтовних базових і фахових знань. Під час проведення практичних занять використовуються, окрім усного опитування, оцінки самостійної аудиторної роботи, тестові завдання з акцентуацією на завдання типу «Крок 1». Перевага віддається задачам, які входять у банк даних тестових завдань, що рекомендовані ДО «Центр тесту-


Галицький лікарський вісник, 2013, Т. 20, № 4

вання професійної компетентності фахівців з вищою освітою напрямів підготовки «Медицина» і «Фармація» при Міністерстві охорони здоров’я України» (ЦТ) і тестовим завданням, які наявні у щорічних екзаменаційних буклетах під час проведення іспиту. Навчально-методичні комплекси в ІФНМУ на дисциплінах, які входять до ліцензійного іспиту, 100% забезпечені даними тестовими завданнями. Відповідно до «Положення про систему оцінювання якості знань студентів в Івано-Франківському національному медичному університеті (нова редакція)», затвердженого наказом ректора ІФНМУ №507-д від 17.07.2013 року, підсумковий модульний контроль вважається зарахованим, якщо студент набрав не менше 50 балів з 80, зокрема отримав не менше 75% правильних відповідей за тестову частику підсумкового модульного контролю (ПМК). Наявність мінімального відсотку правильних відповідей на рівні 75% зумовлено, по-перше, підвищенням абсолютної величини критерію «склав» іспиту «Крок 1. Загальна лікарська підготовка» – 60,5% правильних відповідей, відповідно до п. 1.5 наказу МОЗ України від 29.01.2013 №62 «Про впровадження Протокольного рішення наради ректорів вищих медичних (фармацевтичного) навчальних закладів IV рівня акредитації та закладів післядипломної освіти МОЗ України від 15 січня 2013 року» щодо визначення у 2014 році показника успішного складання ліцензійних інтегрованих іспитів «Крок 1», «Крок 2», «Крок 3», «Крок М» та «Крок Б». По-друге, причиною встановлення порогового рівня допуску до ПМК на рівні 75% є високий показник нескладання іспиту «Крок 1. Загальна лікарська підоготовка», наприклад, у 2011-2012 н.р. – 55 студентів із 415 (13,2%) при величині критерію «склав» на рівні 50,5%, 2012-2013 н.р. – 48 із 392 (12,2%) також при величині критерію «склав» на рівні 50,5%. Запорукою успішного складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка» є використання на ПМК тестових завдань, які входять до банку даних завдань ЦТ і до екзаменаційних буклетів «Крок 1». Відповідно до «Положення про систему оцінювання якості знань студентів в Івано-Франківському національному медичному університеті (нова редакція)», затвердженого наказом ректора ІФНМУ №507-д від 17.07.2013 року, особливою формою внутрішнього контролю знань студентів є «ректорський контроль якості навчання» (РК), який проводиться з метою визначення рівня ефективності використання різних форм і методів викладання науково-педагогічними працівниками навчальних дисциплін, отримання інформації про характер пізнавальної діяльності, рівень самостійності й активності студентів, оцінки залишкового рівня знань з навчальної дисципліни, або окремого її модуля з наступним аналізом та узагальненням, належної підготовки для проходження ліцензійних і акредитаційних процедур та забезпечення максимально об’єктивного оцінювання знань студентів, перевірки якості навчального процесу на кафедрах та рівня викладання навчальних дисциплін окремими науково-педагогічними працівниками, перевірки готовності студентів до складання ліцензійних інтегрованих іспитів «Крок» та з метою формування «групи ризику». Дана форма контролю може проводитись протягом вивчення навчального курсу або після закінчення вивчення навчального модуля (модулів), а саме: упродовж семестру – за темами навчальної дисципліни, що були вивчені у поточному семестрі на момент набрання чинності наказу ректора про проведення РК; на початку семестру – за темами навчальної дисципліни, що були вивчені у попередньому семестрі (за умови, що навчальна дисципліна викладається два і більше семестри); на початку семестру, наступного після повного закінчення вивчення навчальної дисципліни, за темами, що передбачені робочою навчальною програмою; у семестрі, в якому передбачено складання студентами даного курсу ліцензійного іспиту «Крок». Ректорський контроль якості навчання проводиться

відповідно до наказу ректора університету. РК організовує та проводить деканат медичного факультету та відповідний фахівець відділу ECTS та моніторингу якості освіти. Пакет завдань для проведення РК розробляється науково-педагогічними працівниками кафедр, дисципліни яких входять до іспиту «Крок 1», затверджується на засіданні відповідної циклової методичної комісії та за допомогою відповідного програмного забезпечення вноситься у базу даних інформаційно-аналітичного центру університету. РК проводиться у формі комп’ютерного тестування в умовах, що наближені до іспиту «Крок 1» – 1 хвилина на 1 запитання. Оцінювання РК здійснюється згідно з «Положенням про систему ліцензійних інтегрованих іспитів фахівців з вищою освітою напрямів «Медицина» і «Фармація»», затвердженого наказом МОЗ України №251 від 14.08.1998 р. та відповідно до п. 1.5 наказу МОЗ України від 29.01.2013 №62 «Про впровадження Протокольного рішення наради ректорів вищих медичних (фармацевтичного) навчальних закладів IV рівня акредитації та закладів післядипломної освіти МОЗ України від 15 січня 2013 року» щодо визначення у 2014 році показника успішного складання ліцензійних інтегрованих іспитів «Крок 1», «Крок 2», «Крок 3», «Крок М» та «Крок Б». Результати РК обговорюються на засіданні деканату, центральної методичної комісії, ректорату чи Вченої ради університету. З 2011-2012 н.р. рішенням ректорату та згідно з наказом ректора ІФНМУ №32-д від 13.01.2012 для студентів, які склали ректорський контроль нижче «критерію» 50,5% правильних відповідей, були впроваджені додаткові консультативні заннятя (4 цикли) з дисциплін анатомія, біологія, гістологія, фізіологія, біохімія та мікробіологія. Також згідно з наказом ректора ІФНМУ №32-д від 13.01.2012 були сформовані «групи ризику» студентів, які можуть не скласти іспит «Крок 1». Студентам із даної групи ризику були рекомендовані відвідування консультативних занять з додатковими комп’ютерними тестовими контролями (4 цикли) після кожного закінченого циклу консультацій. З метою допомоги студентам медичного факультету (спеціальності «Лікувальна справа» та «Педіатрія») у підготовці до складання медичного ліцензійного іспиту «Крок 1. Загальна лікарська підготовка» у 2011-2012 н.р. за ініціативи деканату медичного факультету з участю найбільш досвідчених викладачів дисциплін, які є складовими іспиту «Крок1», було опубліковано «Практикум для підготовки до складання ліцензійного інтегрованого іспиту Крок 1. Загальна лікарська підготовка» (2012 р., 374 с.), який затверджений центральною методичною комісією університету (протокол №2 від 07.12.2011). Аналогічний практикум виданий у 2012-2013 н.р. (2012 р., 332 с.), затверджений центральною методичною комісією університету (протокол №1 від 19.09.2012) та планується видання у 2013-2014 н.р. (протокол центральної методичної комісії №1 від 25.09.2013). До посібника останньої редакції ввійшли тестові завдання первинних банків «Крок 1. Загальна лікарська підготовка» 1997-2005, 2010-2013 років. Посібник також містить опис регламенту проведення, оцінки результатів, підготовки до складання іспиту. Окрім цього, у поточному навчальному році планується видання «Практикума для підготовки до складання ліцензійного інтегрованого іспиту Крок 1. Загальна лікарська підготовка» (частина ІІ), що затверджений центральною методичною комісією університету (протокол №1 від 25.09.2013). До частини ІІ посібника включені тести екзаменаційних буклетів «Крок 1. Загальна лікарська підготовка» 1998-2013 років з правильними відповідями. Його видання планується з метою допомоги у підготовці до складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка» та з метою самостійної перевірки засвоєння матеріалу студентами медичного факультету (спеціальності «Лікувальна справа» та «Педіатрія»). Враховуючи результати ефективності консультативних занять для студентів «групи ризику» (більше 50% студентів

79


Галицький лікарський вісник, 2013, Т. 20, № 4

у 2011-2012 н.р. та 2012-2013 н.р. успішно з першої спроби склали іспит «Крок 1») та низький відсоток відвідування занять студентами, згідно з рішенням ректорату ІФНМУ, відвідування консультативних занять студентами «групи ризику» у 2013-2014 н.р. є обов’язковими. Висновки 1. Поетапне тестування (практичне заняття – підсумковий модульний контроль – ректорський контроль) є запорукою успішного складання інтегрованого ліцензійного іспиту «Крок 1. Загальна лікарська підготовка». 2. Проведення ректорських контролів і консультативних занять зі студентами «групи ризику» дозволяє покращити рівень підготовки до іспиту та сприяє досягненню більш високих результатів. Література 1. Берещук М.Я. Тестовий контроль і рейтинг в освіті: Навчальний посібник / М.Я. Берещук, Ю.П. Бархаєв, Г.В. Стадник – Харків: ХНАМГ, 2006. – 106 с. 2. Волошинович В.М. Досвід підготовки іноземних студентів до здачі ліцензійного інтегрованого іспиту «Крок 1. Стоматологія» / В.М. Волошинович // Галицький лікарський вісник. – 2013. – Т. 20, №3. – С. 116-117 3. Методичні рекомендації з підготовки до ліцензійних інтегрованих іспитів «Крок 1» і «Крок 2» (для студентів) / [В.Ф. Москаленко, О.П. Яворовський, Я.В. Цехмістер та ін.]. – К.: НМУ, 2007. –14 с. 4. Щевелева Г.М. Диагностическое тестирование предметных знаний первокурсников / Г.М. Щавелева // Педагогика. – 2001. – №7. – С. 53-58. Багрий Н.Н. Поэтапность подготовки к сдаче интегрированного лицензионого экзамена «Крок 1. Общая врачебная подготовка» Резюме. Система лицензионных интегрированных экзаменов «Крок 1» представляет собой комплекс средств стандартизированной диагностики уровня профессиональной компетентности, является составной частью государственной аттестации студентов. Цель работы: анализ эффективности подготовки студентов III курса медицинского факультета по специальности «Лечебное дело» и «Педиатрия», которые учатся в Ивано-Франковском национальном медицинском университете (ИФНМУ), к составлению лицензионного интегрированного экзамена «Крок 1. Общая врачебная подготовка». В ИФНМУ при проведении практических занятий используются, кроме устного опроса, оценки самостоятельной аудиторной работы, тестовые задания с акцентуацией на задания типа «Крок 1». Залогом успешного составления интегрированного лицензионного экзамена «Крок 1. Общая врачебная подготовка» является использование на практических занятиях и итоговых модульных контролях тестовых заданий, входящих в банк данных задач ГО «Центр тестирования профессиональной компетентности

80

специалистов с высшим образованием направлений подготовки «Медицина» и «Фармация» при Министерстве здравоохранения Украины» и к экзаменационным буклетам «Крок 1». Особой формой внутреннего контроля знаний студентов в ИФНМУ является «ректорский контроль качества обучения», который проводится в основном для оценки остаточного уровня знаний студентов по дисциплине или отдельного ее модуля с последующим анализом и обобщением; проверки готовности студентов к сдаче лицензионных интегрированных экзаменов «Крок» и с целью формирования «группы риска». Таким образом, поэтапное тестирование (практическое занятие – итоговый модульный контроль – ректорский контроль) является залогом успешной сдачи интегрированного лицензионного экзамена «Крок 1. Общая врачебная подготовка»; проведение ректорских контролей и консультативных занятий со студентами «группы риска» позволяет улучшить уровень подготовки к экзамену и способствует достижению более высоких результатов. Ключевые слова: лицензионный интегрированный экзамен, тестовый контроль знаний, тестирование, уровень усвоения знаний. M.M. Bahrii Single-Step Preparation to the Integrated Licensed Examination ‘Krok 1. General Medical Training’ Dean’s Office of the Medical Faculty (Dean – R.I. Yatsyshyn, Dr.Med.Sci, Professor, Honoured Doctor of Ukraine) Department of Pathological Anatomy and Forensic Medicine (Head of the Department – I.O. Mykhailiuk, Dr.Med.Sci, Professor) Ivano-Frankivsk National Medical University, Ivano-Frankivsk Summary. System of integrated licensed examinations is a standard means of professional competence evaluation, which is a part of students’ state attestation. The aim: to analyse the preparation efficacy of the third-year students of the Medical Faculty (‘General Medicine’ and ‘Pediatrics’) of the Ivano-Frankivsk National Medical University to the licensed integrated exam ‘Krok 1. General Medical Training’. Practical classes include oral answers, self-reliant work and multiple testing. The priority is given to those tests, which are a part of testing database recommended by Centre for testing professional competence of workers with the higher education (‘Medicine’ and ‘Pharmacology’) at the Ministry of Healthcare of Ukraine and examination booklets. A special method of internal assessment as introduced – rector’s control of the education quality. It aims at evaluating the academic process and its outcome, analyzing the assessment system, preparing to the integrated licensed examinations and forming student ‘risk groups’. Thus, single-step testing (practical class – final module control – rector’s control) ensures successful integrated licensed examination ‘Krok 1. General Medical Training’; rector’s control and consultation sessions with the students of the ‘risk group’ can improve the level of preparation and contribute to better results. Keywords: integrated licensed examination, knowledge test control, testing, level of learning. Надійшла 04.11.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 378.14

Бойчук Л.Г. Особливості навчання в клінічній ординатурі на кафедрі акушерства та гінекології Кафедра акушерства та гінекології ФПО (зав. каф. – проф. О.М.Макарчук) Івано-Франківського національного медичного університету Резюме. У роботі відображені особливості навчання акушергінеколога в клінічній ординатурі в сучасних умовах та підвищення кваліфікації клінічних ординаторів в структурі безперервного професійного навчання лікаря. Для вироблення стійкого інтересу до навчальної та дослідницької діяльності нами використовується модель освітнього процесу у вигляді навчального модуля. Особлива увага приділяється вивченню стандартів та алгоритмів надання допомоги в акушерстві та гінекології. Ключові слова: клінічна ординатура, акушер-гінеколог, навчання.

Головна мета післядипломної освіти в Україні - поглиблення професійних знань, умінь за спеціальністю, збагачення досвіду практичної роботи. Сучасні вимоги до післядипломної медичної освіти це: відповідність потреби галузі та суспільства щодо якості підготовки та підвищення кваліфікації і кількості фахівців, ефективність між традиційною освітою й інноваціями, конкурентоспроможність на основі стандартів якості і, вкрай важливо, - безперервність [1]. Безперервний професійний розвиток для лікарів - це період їх навчання та підготовки, який починається із завершення базової медичної освіти і триває протягом всього професійного життя кожного лікаря. Безперервний професійний розвиток це глибоке поняття і охоплює весь контингент медичної освіти. Саме тому професійний розвиток розглядається, з одного боку, як професійне зобов’язання кожного фахівця, з іншого, як важлива передумова підвищення якості медичної допомоги [3]. Удосконалення післядипломної освіти лікарів вимагає відповідної нормативно-правової бази, розробки та введення такого багатоцільового освітнього механізму, як кредитно-модульна система (ЕСТS) і рейтингове оцінювання [2]. Клінічна ординатура сьогодні в нашій країні представляє собою найбільш досконалу форму підготовки лікаря-спеціаліста. Протягом двох років навчання у складі колективу висококваліфікованих фахівців дозволяє освоїти найбільш сучасні теоретичні уявлення і практичні підходи й навички в обраній спеціальності. За чинним Положенням про клінічну ординатуру, її тривалість складає два роки (для іноземних громадян також), за час якої можна отримати якісну початкову практичну підготовку. Підготовка клінічних ординаторів здійснюється відповідно до індивідуального плану, в якому не менше 80% навчального часу відводиться на освоєння основної спеціальності і 20% - на вивчення суміжних дисциплін. Навчання починається з визначення базового рівня знань за допомогою комп’ютерного тестування, що в подальшому зумовлює індивідуальний підхід до кожного ординатора. Індивідуальний план розробляється завідувачем кафедри, складається з урахуванням базової підготовки та специфіки подальшої роботи ординатора, обговорюється на засіданні кафедри і затверджується ректором. Практична підготовка клінічних ординаторів здійснюється на клінічних базах кафедри. Одні з них більш придатні для початкового навчання, інші переважно для вдосконалення знань і навичок в різних напрямках акушерства та гінекології. При складанні індивідуального плану підготовки клінічного ординатора ми завжди керуємося цими міркуваннями, щоб оптимальним чином спланувати час навчання. Клінічні ординатори несуть лікувальне навантаження в обсязі 25% навантаження лікаря, протягом місяця призначаються на одне добове або два 12 –годинні чергування. Вся робота ординатора відображається в його щоденнику який, також є офіційним документом. Теоретична підготовка клінічного ординатора базується, перш за все, на самостійному вивченні наукових джерел -

книг (список рекомендованої літератури представлений на кафедрі), журналів, web-публікацій. Основні питання програми детально обговорюються на кафедральних семінарах, що є обов’язковим для відвідування кожним з ординаторів. Крім семінарів, клінічні ординатори відвідують клінічні розбори, обходи професора, доцента, засідання науково-практичного товариства акушер-гінекологів області. В освоєнні теоретичного матеріалу клінічні ординатори активно використовують сучасні інформаційні системи і комп’ютерні технології. З метою підвищення ефективності навчання нами проводиться наступне: для підготовки в клінічній ординатурі підбираються кандидати з гуртківців, студенти, які активно цікавляться акушерством та гінекологією і рекомендовані кафедрою. Поряд з класичними методиками навчання використовуються і такі нетрадиційні методи, як семінари у вигляді дискусій та круглих столів, ділові ігри, аналіз історій хвороб, клінічні розбори, демонстрації хворих. Самостійна робота організовується забезпеченням оптимального поєднання навчальної, професійно практичної та наукової діяльності. Індивідуалізація навчання базується на рівні загальної підготовки і використання демократичного підходу у відносинах вчителя і учня. Крім обов’язкової участі в клінічних і патолого-анатомічних конференціях, обходах клінічні ординатори залучаються до консультативних прийомів, які проводяться провідними фахівцями кафедри і клініки. Вивчення лікування гінекологічних захворювань у контексті появи нових груп лікарських препаратів, використання в процесі навчання діагностично-лікувальних алгоритмів для формування логічного лікарського мислення і прийняття правильного рішення. Використання комп’ютерних навчальних атестаційних програм. Дана модель забезпечує вирішення професійно освітніх та особистісно-розвиваючих завдань, розширює діапазон комунікативних дій, необхідних для вирішення професійно орієнтованих завдань. Клінічні ординатори здають заліки з розділів основної спеціальності та суміжних дисциплін. Ординатори звітують на кафедрі два рази на рік. В кінці другого року навчання вони допускаються до здачі підсумкового кваліфікацйного іспиту. Клінічним ординаторам надаються канікули тривалістю з відпустку у практичних лікарів. Після закінчення навчання клінічниму ординаторові видається посвідчення про закінчення ординатури. Висновки 1. Сучасний розвиток медичної науки і практики, соціально-економічні зміни в суспільстві та реформування охорони здоров’я зумовлюють необхідність вносити системні корективи у підготовку та підвищення кваліфікації клінічних ординаторів з наближенням до вимог міжнародних стандартів і першочерговим забезпеченням якості їх навчання та рівня практичних умінь. 2. Реалізація викладених положень етапної системи викладання дисципліни і підготовки лікаря – акушер-гінеколога сприяє формуванню клінічного мислення, поглибленому засвоєнню клінічного матеріалу і оволодінню практичними навичками, що відповідає сучасним вимогам підготовки і дає можливість підготувати висококваліфікованих лікарів-фахівців акушер-гінекологів. Література 1. Вища медична и фармацевтична освіта Украї-ні на сучасности етапі / В.В.Лазорішінець,М.В.Банчук, О.П.Волосовець [та

81


Галицький лікарський вісник, 2013, Т. 20, № 4 ін.]: Матеріа-Чи III Всеукр. фармацевт. конф. «АПТЕКА-2008 Осінь »- МОЗ України. - 2008. - С.10. 2. Москаленко В.Ф. Участь у розбудові віщоїмедичної освіти України / В.Ф.Москаленко:матеріали VIII міжнар. виставки Навчальнихзакладів «Сучасна освіта в Україні». - 2005. -С.21-35.3. Попков В.А. Дидактика вищої школи /В.А.Попков, А.В.Коржуев - М., 2010. - С.136. Бойчук Л.Г. Особенности обучения в клинической ординатуре на кафедре акушерства и гинекологии Резюме. В работе отражены особенности обучения акушергинеколога в клинической ординатуре в современных условиях и повышения квалификации клинических ординаторов в структуре непрерывного профессионального обучения врача. Для выработки устойчивого интереса к учебной и исследовательской деятельности нами используется модель образовательного процесса в виде учебного модуля. Особое внимание уделяется изучению стандартов и

алгоритмов оказания помощи в акушерстве и гинекологии. Ключевые слова: клиническая ординатура, акушергинеколог, обучение. L.H. Boichuk Peculiarities of the Clinical Residency Training at the Department of Obstetrics and Gynecology Summary. This paper reflects features of training obstetrician-gynecologist at the clinical residency in modern conditions and improving the qualification level of medical residents in the structure of continuing professional education for physicians. To induce a steady interest to the studies and the research, we use an educational process model in the form of an academic module. Special attention is paid to learning the standards and algorithms of the obstetric and gynecologic assistance. Keywords: clinical internship, obstetrician-gynecologist, training. Надійшла 28.10.2013 року.

УДК 614.253+378

Василишин У.Р. Актуальні питання формування толерантності в майбутніх лікарів-стоматологів у системі післядипломної освіти України Кафедра стоматології факультету післядипломної освіти (зав. каф. – проф. М.М. Рожко) Івано-Франківського національного медичного університету Резюме. У статті розглянуті основні проблеми формування особистісних рис лікаря-інтерна-стоматолога, зокрема його толерантної свідомості згідно з суттю вибраної професії та вимогами щодо освітньо-виховного процесу у вищій медичній школі. Висвітлені основні аспекти поняття «толерантність», її види, критерії, передумови та обґрунтована актуальність цієї проблеми. Закцентовано увагу на змістовій специфіці комунікативної толерантності лікаря-стоматолога та на найважливіших психологічних особливостях його діяльності, що має велике значення для вирішення професійних завдань та реалізації деонтологічних функцій у професійному спілкуванні. На підставі оцінки специфіки професійної діяльності лікаря-стоматолога сформульовані основні вимоги до його комунікативної толерантної поведінки. Визначено основну ідею формування освітнього процесу, в межах якого повинна реалізуватися нова система толерантних установок, а також запропоновано перспективні напрямки роботи у вирішенні зазначених проблемних питань. Особлива роль відведена педагогу-наставнику, котрий повинен володіти методологічними підходами та соціально-педагогічним впливом на розвиток усіх сфер толерантної особистості лікаря-інтерна. Застосування комплексного підходу до формування толерантної особистості інтерна з урахуванням специфіки його майбутньої професійної діяльності розвиває загальні позитивні установки, переконання, цінності, необхідні для взаємодії з людьми. Ключові слова: навчально-виховний процес, толерантність, лікар-інтерн, професійна діяльність.

Розвиток сучасного суспільства ставить високі вимоги до рівня освіти у вищій медичній школі [1,2]. Для виконання соціального замовлення підготовки майбутніх фахівців особливе місце посідає післядипломна освіта. Серед важливих аспектів навчально-виховного процесу заслуговує на увагу формування у лікарів-інтернів толерантності, яка обумовлюється самою суттю вибраної ними професії з її визначальною гуманістичною спрямованістю, що передбачає наявність у професіоналів таких рис як щиросердне, душевне ставлення до пацієнта, розуміння особливостей його анормального фізичного та психічного стану, співчуття, співучасті і причетності до його проблем, терпимості до негативу в спілкуванні і поведінці [3].

82

Мета дослідження: висвітлити проблему виховання толерантності лікарів-інтернів, обґрунтувати її актуальність, провести огляд методологічних підходів до виховання зазначеної якості особистості. Педагогічний аспект феномену толерантності сучасними науковцями розглядається не тільки як характеристика індивідуальної свідомості, але й як особистісна риса, що може бути вихована відповідною педагогічною взаємодією. Відтак, важливе значення у вихованні толерантності відводиться медичним університетам, зокрема, закладам післядипломної освіти [1], які повинні будувати навчально-виховний процес таким чином, щоб лікарі-інтерни, в майбутньому лікарістоматологи, стали взірцем толерантної поведінки, адже лише толерантний лікар зможе побудувати толерантні стосунки з пацієнтами, колегами та персоналом. У післядипломній освіті разом із забезпеченням професійних знань, навичок, вмінь оволодівати новими медичними технологіями, удосконаленням кваліфікації, навчанням лікарів умінню адаптуватися в умовах швидкої зміни поколінь техніки й технології та переглядати під час короткого періоду свої професійні знання, пріоритетним завданням є формування цілісної творчої особи, духовно багатої і вихованої за канонами високих моральних принципів та ідеалів. Освіта є саме тим соціальним інститутом, у межах якого може формуватися толерантна свідомість і поведінка молодих лікарів як через систему виховної роботи, так і через зміст освіти, різних форм організації навчання, які б допомагали розвивати в них практичні навички толерантної взаємодії. Проблема виховання толерантності молодого покоління складна та багатоаспектна. Більшість молодих лікарів не мають достатнього рівня розуміння самого поняття «толерантність». Основні критерії терміну «толерантність» (від лат. Tolerantia – терпіння) можна визначити, виходячи з тлумачення самого поняття «толерантність» – активна моральна позиція і психологічна готовність до терпимості заради позитивної взаємодії з людьми [4].


Галицький лікарський вісник, 2013, Т. 20, № 4

Толерантність є необхідною складовою професій “людина-людина”, тобто в системі міжособистісних стосунків. У медичній практиці толерантність відіграє важливу роль, особливо це стосується лікарів - інтернів, які ще вчора були студентами, а зараз вийшли на новий рівень спілкування професійної діяльності, необхідності самостійно діяти та приймати рішення. У цьому випадку толерантність є обов’язковою умовою формування професіоналізму. Є дослідження, які доводять, що для успішної професійної діяльності лікарів важливою є емоційна толерантність (стійкість), деякі дослідники пишуть про необхідну комунікативну толерантність лікаря [5]. Термін «комунікативна толерантність» запровадив у наукову практику В.В.Бойко, розуміючи його як відображення в поведінці позитивної комунікативної установки [6]. До складу комунікативної толерантності входять спрямованість особистості як системи її цінностей і стосунків, біологічні (сенсорні) компоненти, емоційні, характерологічні та інтелектуальні складові. Комунікативна толерантність є професійно важливою для лікаря як компонент комунікативної компетентності і полягає у терпимості, поблажливості в спілкуванні з хворими, відсутності догматизму та прагнення до домінування, що проявляється в здатності до колегіальності, співпраці та ін. Хоча толерантність є іманентною, тобто внутрішньо притаманною рисою лікаря, вона не є суто вродженою, під час навчання у ВНЗ майбутній лікар засвоює культуру толерантної поведінки. І.І. Просвиркіною застосований і всебічно проаналізований термін «толерантна комунікативна особистість» [7], якою є учасник толерантного комунікативного акту, що реально діє, здатний застосовувати в процесі мовного спілкування вербальні й невербальні засоби, що дають можливість порозумітися співбесідникам. Толерантна комунікативна особистість майбутнього лікаря – складне утворення, яке передбачає готовність до - продуктивного інтеркультурного професійного спілкування; - ефективної між- і внутрішньо корпоративної комунікації (лікар - лікар); - коректного спілкування з представниками різних професійних, гендерних, релігійних й інших соціальних груп (лікар - пацієнт). Таким чином, толерантну комунікативну особистість медика можна уявити у вигляді системи його якостей, які ґрунтуються на знаннях, навичках, уміннях, здібностях й ініціативах, що зумовлює взаєморозуміння з представниками інших національних, соціальних, особистісних культур [8,9]. Успіх лікування багато в чому залежить від здатності лікаря оцінити соціально-психологічний статус пацієнта, провести експрес-діагностику психологічного типу особистості пацієнта. Головна складність полягає в тому, що провести цю експрес-діагностику в умовах стоматологічного прийому необхідно під час короткотривалого контакту з хворим. Виховуючи комунікативну толерантність у лікарівінтернів, викладач повинен не лише впевнитися у наявності психологічних знань про типи особистості, способи переживання і реагування на стрес людей залежно від типу темпераменту, специфіку зв’язку між типами статури та особливостями психічного складу особистості і т. п., але і стимулювати формування деяких спеціальних навичок: уміння встановлювати контакт, слухати, «читати» невербальну мову комунікації, будувати бесіду, формулювати питання. Адекватна комунікація передбачає правильне розуміння хворого і відповідне реагування на його поведінку. Комунікативна компетентність та толерантність лікарястоматолога має змістову специфіку внаслідок того, що контакт «лікар – пацієнт» супроводжується безліччю проблемних ситуацій, а довіра й готовність до співпраці є необхідною психологічною основою для надання ефективної стоматологічної допомоги. До найбільш істотних психологічних

особливостей діяльності стоматолога слід віднести [9]: - монотонію і роботу в замкнутому просторі з контингентом людей, що зазнають проблем зі здоров’ям, своєю зовнішністю та перебувають у стані емоційного дискомфорту; - роботу в безпосередній близькості до пацієнта, в інтимній зоні людини, що викликає мимовільний опір, напругу і психологічний захист; - необхідність співпраці з пацієнтом, який, як правило, не володіє знаннями зі стоматології і не може повною мірою адекватно оцінити процес, результат і прогноз стоматологічної допомоги; - постійну взаємодію з людиною, яка відчуває біль, страх і тривогу, що впливає і на психологічне самопочуття самого лікаря. У ситуації реального прийому, в який потрапляє лікарінтерн, стоматолог має ряд функцій: діагноста, психотерапевта, організатора, менеджера, лікаря та ін., виконання яких в межах стислого часового інтервалу і за умови високої відповідальності за якість і результат стоматологічних маніпуляцій створює стресогенне середовище. Тому викладач повинен не тільки удосконалювати навики інтерна, необхідні безпосередньо для прийому пацієнта, а й розвивати здатність швидко й самостійно приймати рішення, брати на себе відповідальність і усвідомлювати те, що його професійні дії можуть мати віддалені наслідки для пацієнта [6,10]. Сучасна освіта у вищій медичній школі є найбільш технологічною сферою діяльності, безпосередньо пов’язаної з розвитком майбутнього лікаря і формуванням духовних і моральних цінностей людського суспільства. До найбільш важливих складових системи професійної освіти відноситься її культурологічна спрямованість та світоглядний синтез у формуванні професійної та особистісної культури майбутніх медиків. Засвоєння культури в процесі професійної освіти у вищій медичній школі є основним засобом виховання і розвитку молодих спеціалістів. Виходячи з цього виникає необхідність формування нової системи толерантних установок і поведінки, якій властиві навички терпимості і взаємоповаги, готовність до співпереживання, компромісу, безконфліктної поведінки в складних ситуаціях. Виховання толерантності в інтернів є доцільним і актуальним, оскільки сьогодні вони є суб’єктами навчального процесу, а завтра – кваліфікованими фахівцями, чия діяльність повинна бути не тільки безпечною за стилем поведінки, але і мати соціальну та психологічну результативність і ефективність. Головна ідея, на основі якої слід будувати процес взаємодії усіх суб’єктів освітнього процесу післядипломної практики – створення умов для реалізації суб’єктності лікаря-інтерна і формування у нього соціальної відповідальності, моральних переконань і готовності до професійної діяльності [9]. Серед функцій педагога-наставника важливою є аналітична, яка полягає у вивченні інтересів та можливостей молодих фахівців, у створенні умов для прояву їх здібностей, реалізації завдань соціального захисту і формування готовності до соціального самозахисту, профілактики конфліктної поведінки. На особливу увагу заслуговує відсутність толерантності у відносинах між інтернами всередині групи, коли можливі сформовані домінантні відносини, неповага тощо неприпустимі між ними, а також у присутності інших суб’єктів педагогічного та лікувального процесів [11]. Вони свідчать не лише про професійну некомпетентність окремого лікаря-інтерна, але й про педагога, і створюють негативне враження про заклад у цілому. Молоді спеціалісти, котрі відчули себе самостійними лікарями, часто нетолерантно і зверхньо ставляться до молодшого медичного персоналу, вважаючи його «обслугою». Така ситуація безпосередньо залежить від педагога, котрий повинен не тільки вчасно провести профілактику такої поведінки, але й самому бути взірцем толерантних взаємовідносин у колективі, критеріями яких є взаємоповага, доброзичливість і співпраця.

83


Галицький лікарський вісник, 2013, Т. 20, № 4

З метою забезпечення формування у лікарів-інтернівстоматологів професійної толерантності та компетентності викладацькому складу слід застосовувати активні методи соціально-педагогічного розвитку, що здійснюють комплексний вплив на розвиток усіх сфер толерантної особистості: свідомості, почуттів, якостей і властивостей толерантної поведінки (групова дискусія як метод обговорення проблем толерантної взаємодії; соціально-психологічні тренінги толерантності; рольові, імітаційні ігри; прийоми «обмін думками», «мозковий штурм», діалогічне спілкування, відповідні тести, ситуаційні завдання, аналіз клінічних випадків, дискусії), в яких у інтернів формується готовність вирішувати проблеми і протиріччя, що виникають, на паритетних началах, не застосовуючи тиску та агресії, а також набувається досвід вирішення можливих професійних конфліктів, знаходження компромісу в “гострих” ситуаціях, що необхідно для продуктивного функціонування професійного мікросоціуму. Виховання толерантності майбутніх фахівців не обмежується засвоєнням понять «толерантність» і «толерантна особистість». Необхідно розвивати соціальний і емоційний інтелект особистості і такі їх складові, як емпатія, довіра, уява, співчуття, співпереживання, розуміння суті відмінності від інших. Аналіз результатів численних досліджень дозволяє визначити три групи умов успішного формування особистості лікаря-інтерна, що забезпечуються: - самим інтерном; - викладачами і керівниками ВНЗ; - спільною діяльністю лікарів-інтернів і викладачів [10]. Застосування перерахованих методик дозволяє розвинути в інтернів загальні позитивні установки стосовно навколишнього світу, переконання і цінності, істотні для взаємодії з навколишніми людьми з урахуванням специфіки їх майбутньої професійної діяльності. Висновки 1. Культура толерантності є однією з необхідних умов ефективної реалізації моделі формування професійноособистісної культури лікаря, яка повинна супроводжувати усі аспекти його професійної діяльності. 2. У зв’язку з цим актуальним є системно-ціннісний підхід у формуванні змісту освіти лікарів-інтернів, головна ідея якого полягає в створенні умов для реалізації суб’єктності лікаря-інтерна і формування у нього соціальної відповідальності, моральних переконань і готовності до професійної діяльності. Перспективи подальших досліджень Не викликає сумніву необхідність здійснення ґрунтовного аналізу філософської, соціологічної, психологічної і педагогічної літератури з метою визначення ключових понять дослідження проблеми виховання толерантності та адаптування їх у системі післядипломної освіти. Література 1. Жигалев, Б.А. Педагогическая система оценки качества образования в современном вузе (теоретико-методологический аспект): монография / Б.А. Жигалев. – Нижний Новгород: Нижегородский государственный лингвистический университет им. Н.А. Добролюбова, 2007. –115 с. 2. Гершунский Б.С. Толерантность в системе ценностно-целевых приоритетов образования / Б.С. Гершунский // Педагогика. – 2002. – № 7. – С. 3 – 12. 3. Соловьева С.Л. Личность врача (учебно-методическое пособие) / С.Л. Соловьева. – С – Петербург: Издательство, 2004. с 15 – 18. 4. Бондырева С.К. Толерантность. Введение в проблему / С.К. Бондырева, Д. В. Колесов. – М. – Воронеж, 2003. – 273 с 5. Ясько Б.А. Экспертный анализ профессионально важных качеств врача / Б.А.Ясько //Психологический журнал – 2004. – Том 25 – №3. – С.26-32 6. Бойко В.В. Доверие пациента: зоны и средства завоевания/ В.В.Бойко // Институт стоматологии – 2002. —№3( 16). – С. 10 – 13 7. Просвиркина И.И. Лингводидактический аспект толерантной

84

речевой коммуникации / И.И. Просвиркина. – Оренбург : ОГУ, 2006. – 247 с. 8. Plasschaert A.J.M. Профиль и компетентность современного европейского стоматолога (в свете решений Болонской декларации) / A.J.M. Plasschaert, W.P. Holbrook, E. Delap // Cathedra: Стоматологическое образование в России. – 2006. – Том 5, N1. – С. 70 – 71 9. Кипиани А. И. Развитие коммуникативной компетентности врача-стоматолога как условие профессиональной успешности: Дисс…канд. психол. Наук: 19.00.13/ А. И. Кипиани– Ставрополь, 2006. – 214 с 10. Марданова Ш.С. Развитие коммуникативной компетентности студентов-стоматологов / Ш.С. Марданова // Вестник КазНМУ. – 2011, №2. – С.91 – 93 11. Батурина О.С. Межличностная толерантность студенческой молодежи / О.С.Батурина // Казанский педагогический журнал. – 2008. – № 8. – С.62 – 67. Василишин У.Р. Актуальные вопросы формирования толерантности в будущих врачей-стоматологов в системе последипломного образования Украины Резюме. В статье рассмотрены основные проблемы формирования личностных качеств врача-интерна-стоматолога, в частности его толерантного сознания согласно с сущностью избранной профессии и требованиями образовательно-воспитательного процесса в высшей медицинской школе. Освещены основные аспекты понятия «толерантность», ее виды, критерии, предпосылки и обоснована актуальность этой проблемы. Сакцентировано внимание на смысловой специфике комуникативной толерантности врача-стоматолога и самых важных психологических особенностях его деятельности, имеющих большое значение для решения профессиональных задач и реализации деонтологических функций в профессийном общении. На основе оценки специфики профессиональной деятельности врачастоматолога сформулированы основные требования к его коммуникативному толерантному поведению. Определена основная идея формирования образовательного процесса, в пределах которого должна реализироваться новая система толерантных установок, а также предложены перспективные направления работы в решении указанных проблемных вопросов. Особенная роль отведена педагогу-наставнику, который должен владеть методологическими подходами и социально-педагогическим влиянием на развитие всех сфер толерантной личности врача-интерна. Применение комплексного подхода к формированию толерантной личности интерна с учетом специфики его будущей профессиональной деятельности развивает общие позитивные установки, убеждения, ценности, необходимые для взаимодействия с людьми. Ключевые слова: учебно-воспитательный процесс, толерантность, врач-интерн, профессиональная деятельность. U.R. Vasylyshyn Urgent Questions of Forming the Tolerance of Future DoctorsDentists in the System of Postgraduate Studies of Ukraine Summary. The article describes the main problems of forming the personal traits of the medical intern- dentist, in particular his tolerant consciousness in accordance with the essence of the chosen profession and requirements to the educational training process in the higher medical school. The author highlights the principal aspects of the concept «tolerance», its kinds, criteria, preconditions and actuality of the problem. The attention is focused on the content specifics of the communicative tolerance of the doctor-dentist and the most important psychological peculiarities of his activities. That is significant precondition for solving professional tasks and realization of the dental functions in the professional interactions. The main requirements to his communicative tolerant behavior are formulated taking into account the specifics of his medical professional activities. The main idea of forming the educational process was set, and the new system of tolerant behavior should be realized within this process. Besides the perspective ways of solving the problem tasks were proposed. The special role is given to the educator- tutor, who must be able of using methodological techniques and providing social and pedagogical influence on the development of all aspects of the tolerant personality of medical intern. Application of complex methods of forming the tolerant personality of the medical intern in accordance with the specifics of his future professional activities develops common positive attitudes, believes and values needed for interaction with people. Key words: educational training process, tolerance, medical intern, professional activities. Надійшла 25.11.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 371.322+378.147+616.314

Кривенький Т.П. Впровадження інноваційних форм навчання на кафедрі стоматології факультету післядипломної освіти Івано-Франківського національного медичного університету Кафедра стоматології факультету післядипломної освіти (зав. каф. - проф. М.М. Рожко) ДВНЗ „Івано-Франківський національний медичний університет” Kryvenkyj-T@yandex.ru Резюме. У статті представлено досвід впровадження новітніх методик навчання на кафедрі стоматології факультету післядипломної освіти ДВНЗ „Івано-Франківський національний медичний університет”. На кафедрі використовуються сучасні методи візуалізації, засоби теленавчання, дистанційні інтернет-технології, інтерактивне навчання. Для підвищення якості підготовки фахівців на базі стоматологічного факультету створено профільний навчально-практичний центр (НПЦ) «Стоматологія», який обладнаний сучасною апаратурою, муляжами, фантомами. НПЦ об’єднує 4 фантомні та 9 залів різного функціонального призначення. Чотири з яких (кабінет комп’ютерної томографії, кабінет функціональної діагностики, клінічний зал дентальної імплантації, лабораторія) знаходяться на базі кафедри стоматології факультету післядипломної освіти. Відзначено, що новітні методики навчання (зокрема, інтерактивне навчання, яке передбачає проведення міждисциплінарних семінарів), а також використання сучасної апаратури сприятимуть безперервному професійному росту лікарівінтернів та підготовці висококваліфікованих фахівців-стоматологів. Ключові слова: навчально-практичні центри, новітні технології, лікарі – інтерни, стоматологія.

Пріоритетним завданням реформування галузі охорони здоров’я є підготовка кваліфікованих фахівців, адже від ступеня підготовки лікаря залежить рівень надання допомоги населенню [2]. Якісна підготовка медичних кадрів дозволить також забезпечити конкурентноспроможність випускників вищої школи як на вітчизняному, так і на зарубіжному ринках праці. З цією метою в Україні реалізується інтеграція вищої медичної освіти до Болонського процесу, що передбачає перехід до системи міжнародних освітніх стандартів [4, 5]. Цей процес потребує оптимізації післядипломної підготовки спеціалістів медичного профілю. Мета та головне завдання післядипломного навчання – підготовка спеціаліста, який володіє необхідними практичними навиками та може самостійно займатися професійною діяльністю. Оцінити рівень підготовки лікаря-інтерна дозволяє проведення комплексного іспиту, який включає складання комп’ютерного контролю, здачу практичних навичок, усного іспиту, а також складання інтегрованого тестового ліцензованого іспиту „Крок-3”. Для забезпечення підготовки висококваліфікованого фахівця на кафедрі стоматології факультету післядипломної освіти (ФПО) ДВНЗ „Івано-Франківський національний медичний університет” лікарями-інтернами протягом першого року навчання виконується практично орієнтована робота, яка є однією із форм навчання. Головна її мета полягає в умінні лікарями-інтернами застосовувати на практиці знання із різних стоматологічних дисциплін, систематизувати набуті впродовж навчання в університеті уміння та навики. Практично орієнтована робота належить до інтерактивних методів навчання, що дозволяє виробити у лікарів-інтернів здатність застосовувати знання у нестандартних ситуаціях. Перевага цієї форми навчання полягає в тому, що вона розвиває клінічне мислення, а також дозволяє передавати власний досвід колегам. Загалом впровадження такої форми навчання дає змогу краще пізнати явища та процеси, значною мірою сприяє усвідомленню патогенезу патологічних процесів, а отже, має вплив на формування та фахову підготовку лікаря. Важливою формою щоденного контролю знань інтернів є усне фронтальне опитування, вирішення тестових завдань різного ступеня важкості. Постійне проведення тестового

контролю дає можливість підвищити якість написання ліцензійного інтегрованого іспиту „Крок 3. Стоматологія”. З метою активізації та інтенсифікації знань впродовж післядипломного навчання інтернам пропонується моделювання та вирішення наближених до клініки ситуаційний задач, розв’язання проблемних питань. Запорукою глибокого розуміння та засвоєння спеціальності є наявність якісного національного підручника „Стоматологія” у двох книгах за редакцією професора М.М. Рожка, який виданий у 2013 році. Колектив кафедри постійно працює над удосконаленням навчально-методичної літератури, про що свідчить значна видавнича діяльність кафедри. Тільки за останні роки колектив кафедри видав підручники „Ортопедична стомотологія” та „Зубопротезна техніка”, навчальні посібники „Місцеве знеболення при амбулаторних стоматологічних втручаннях”, „Довідник з ортопедичної стоматології”, „Клінічний довідник лікаря-стоматолога загального профілю” та інші. Кращому засвоєнню матеріалу сприяє використання сучасних технологій при підготовці лікарів-інтернів, що дозволяє глибше інтегруватися у самостійну позааудиторну роботу та адаптуватися до роботи у медичному закладі. З цією метою на кафедрі використовуються засоби теленавчання, дистанційні інтернет-технології, інтерактивне навчання, сучасні методи візуалізації [1, 3]. Для підвищення якості підготовки фахівців на базі стоматологічного факультету створено профільний навчально-практичний центр (НПЦ) „Стоматологія”, який об’єднює 13 кабінетів різного функціонального призначення. На кафедрі стоматології ФПО знаходяться кабінет комп’ютерної томографії, кабінет функціональної діагностики, клінічний зал дентальної імплантації, лабораторія. Клінічний зал функціональної діагностики обладнаний сучасною апаратурою, яка включає електронейроміограф «Нейро-ЕМГ-мікро» (ООО «Нейрософт», Росія), автоматизовану систему аналізу прикусу «T-scan III» («Tеkscan», США), апарат для визначення каріозних порожнин та твердих і м’яких під’ясенних зубних відкладень «Diagnodent» («Kavo», Німеччина) та аналізатор лазерної мікроциркуляції крові «Лакк-02» (Росія). Кабінет функціональної діагностики оснащений апаратурою, що дозволяє діагностувати зміни з боку щелепно-лицевої ділянки та запобігати розвитку патологічних процесів [6]. Клінічний зал комп’ютерної томографії облаштований панорамним рентгенівським апаратом із функціями комп’ютерного томографа «Veraviewepocs» фірми Morita (Японія), який використовується для рентгенологічної діагностики стану зубо-щелепової системи, щільності кісткової тканини, а також сучасним комп’ютерним класом із відповідним програмним забезпеченням. Клінічний зал дентальної імплантації містить спеціальне обладнання: стоматологічне крісло (AJAX, Китай), сучасний автоклав (TANDA IIC-18L GRANUM, Китай), безтіньовий світильник (СРП 54-4, Україна), фізіодиспенсер (WDН, Японія), що необхідне для проведення операцій по встановленню імплантів. У лабораторії лікарі-інтерни мають змогу оволодівати наступними практичними навичками: - підрахувати кількість лейкоцитів і еритроцитів у камері Горяєва, визначити вміст гемоглобіну, ШОЕ, підрахувати формулу крові;

85


Галицький лікарський вісник, 2013, Т. 20, № 4

- визначити вміст глюкози в крові; - провести реакцію мікропреципітації; - провести швидкі тести на ВІЛ; - робити мазок зі слизової оболонки ротової порожнини і фарбувати його за Романовським-Гімзе, Цілем-Нільсеном, за Грамом; - визначити електричні потенціали в ротовій порожнині; - виміряти рН слини; - навчитись працювати з мікроскопом; - описати дані мікроскопії гістологічного та цитологічного препаратів; - аналізувати лабораторні дані; - вносити дані лабораторних досліджень в документацію. Усі практичні навики обговорено і затверджено на засіданні циклової методичної комісії факультету післядипломної освіти університету (протокол №20 від 14.01.2013 року). Для проведення даної роботи НПЦ обладнаний електронним мікроскопом Carl Zeiss (Німеччина) з цифровою камерою (Xintu Photonics Co., Ltd., Tucsen), нетбуком ACER (Китай), монітором SHARP (Тайвань), рН-метр Аквілон 402 (Росія), лічильником лабораторним С-5 (Україна), центрифугою 889 (Росія), фотометром КФК-3 (Росія), термостатом ТС-80 М-2 (Росія), міліамперметром (Україна), глюкометр (Рош Діагностик, Німеччина). Отже, у НПЦ „Стоматологія” на кафеді стоматології ФПО є необхідне сучасне обладнання, на якому інтерни мають можливість засвоювати та опрацьовувати практичні навички з різних розділів профільних стоматологічних дисциплін. Висновки Впровадження сучасних методів навчання, формування потужної матеріально-технічної бази є запорукою фахової підготовки лікарів-стоматологів. Доцільним є створення профільних навчально-практичних центрів для впровадження в навчальний процес питань доказової медицини, нанотехнологій, вивчення досвіду зарубіжних колег та впровадження нових ефективних методів навчання. Література 1. Кондрин О.Є.Міждисциплінарний семінар і «кейс»-метод: взаємнодоповнюючі форми проблемного навчання / О.Є. Кондрин, М.М. Багрій, І.Ю. Ванджура [та ін.] // Галицький лікарський вісник. – 2010. – Т. 17, №2, Ч. 1. – С. 121-125. 2. Марченко В.Г. Короткотривалі цикли тематичного удосконалення – один із шляхів упровадження безперервного професійного розвитку лікарів / В.Г. Марченко, О.А. Цодікова, С.С. Бринцова // Медична освіта.- 2010.- №3.- С. 39-40. 3. Побуцький О.О. Застосування інноваційних методів унаочнення та візуалізації у підготовці медичний кадрів / О.О. Побуцький // Галицький лікарський вісник. – 2010. – Т. 17, №2, Ч. 1. – С. 126-128. 4. Попадинець О.Г. Інтеграція навчального процесу у вищих медичних закладах / О.Г. Попадинець, Н. М. Воронич-Семченко, М.М. Багрій, А.С. Дмитренко, Н.М. Грибінчак / Вісник проблем біології і медицини. -2010.- Випуск 3.- С. 209-211. 5. Хвисюк О.М. Інтеграція в європейський освітній простір як шлях покращення післядипломної підготовки лікарів / О.М. Хвисюк, В.Г. Марченко, І.А. Жадан // Медична освіта.- 2010.- №3.- С. 77-78. 6. Штурмак В.М. Оптимізація роботи кабінету функціональної діагностики в навчально-практичній діяльності кафедри стоматології факультету післядипломної освіти / Штурмак В.М.// Галицький лікарський вісник. – 2013. – Т. 20, №3. – С. 131-132.

86

Кривенький Т.П. Внедрение инновационных форм обучения на кафедре стоматологии факультета піследипломного образования ГВУЗ „Ивано-Франковский национальный медицинский университет” Кафедра стоматологии факультета последипломного образования (зав. каф. - проф. Н.М. Рожко) ГВУЗ „Ивано-Франковский национальный медицинский университет” Kryvenkyj-T@yandex.ru Резюме. В статье представлено опыт внедрения современных методик обучения на кафедре стоматологии факультета последипломного образования ГВУЗ „Ивано-Франковський национальный медицинский университет”. На кафедре используются современные методы визуализации, средства телеобучения, дистанционные интернет-технологии, интерактивное обучение. Для повышения качества подготовки специалистов на базе кафедры оборудован профильный учебно-практический центр (УПЦ) «Стоматология», который оснащен современной аппаратурой, муляжами, фантомами. УПЦ объединяет 4 фантомные и 9 залов различного функционального предназначения. Четыре из них (кабинет компьютерной томографии, кабинет функциональной диагностики, клинический зал дентальной имплантации, лаборатория) находятся на кафедре стоматологии факультета последипломного образования. Отмечено, что новейшие методики обучения (в часности, интерактивное обучение, которое предполагает проведение междисциплинарных семинаров), а также использование современной аппаратуры будут содействовать непрерывному профессиональному росту врачей-интернов и подготовке высококвалифицированных специалистов-стоматологов. Ключевые слова: учебно-практические центры, современные технологии, врачи–интерны, стоматология. T.P. Kryvenkyi Introduction of the Innovative Forms of Studying at the Dentistry Department of the Postgraduate Education Faculty of the State Higher Educational Institution “Ivano-Frankivsk National Medical University” Dentistry Department of the Postgraduate Education Faculty (Head of the Department, Doctor of the Medical Science, Professor M.M. Rozhko) SHEI „Ivano-Frankivsk National Medical University”, KryvenkyjT@yandex.ru Summary. The article describes the experience of the introduction of the innovative methods of studying at the dentistry department of the postgraduate education faculty at the state higher educational institution “Ivano-Frankivsk national medical university”. The department utilizes modern methods of visualization, uses televisions as means of teaching, distant internet technologies and interactive studying. In order to improve the quality of the training of the specialists the profile educational-practical centre (EPC) “Dentistry” has been created on the premises of the dentistry department. It is equipped with modern devices, waxworks and phantoms. The center includes 4 phantom and 9 halls of different functional use. The 4 of those (offices of computed tomography, functional diagnostics, clinical hall for dental implantation and laboratory) are located at the dentistry department of the postgraduate education faculty. The article points out that the innovative methods of teaching (in particular, the interactive teaching involving the conduction of the interdisciplinary seminars), and also the use of the modern devices will support the continuous professional growth of the doctors-interns and the training of the highly qualified dentists. Key words: scientific-practical centers, innovative technologies, doctors-interns, dentistry. Надійшла 02.12.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК: 371.322+378.147+616-002.5

Макойда І.Я., Островський М.М. Самостійна робота студента – метод підготовки висококваліфікованого спеціаліста Кафедра фтизіатрії і пульмонології з курсом професійних хвороб (зав. каф. - проф. М.М. Островський) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. У статті викладені основні погляди на процес навчання у вищій школі. Беззаперечним фактом є необхідність виростити та випустити зі стін університету висококваліфікованого спеціаліста, який би не тільки володів глибокими базисними знаннями, але й умів приймати швидкі неординарні рішення. Євроінтеграційна спрямованість України потребує зміни не тільки зовнішніх політичних векторів, а також базисних моментів самої основи розуміння життя суспільства. Стаття окреслює основні принципи та можливості болонської системи навчання у формуванні клінічного мислення майбутнього висококваліфікованого лікаря. Одним з методів розвитку самостійності у вирішенні ситуаційних проблем залишається такий тип занять, як семінари. У статті відображена методика організації самостійної роботи студена на кафедрі „Фтизіатрії і пульмонології з курсом професійних хвороб” Івано-Франківського національного медичного університету. Подано характеристику підвидів самостійних занять, принципи вибору та моделювання клінічних ситуацій, схематичність та етапність їх вирішення та методологія проведення їх контролю і оцінювання. Ключові слова: болонський процес, самостійна робота, фтизіатрія.

З часів прадавньої медицини пріоритетом лікаря було не тільки вилікувати людину, зцілити її від недуги та повернути до повноцінного життя, але й передати свої знання учням. А ті, в майбутньому, на основі отриманих знань проводитимуть власні дослідження, прославляючи таким чином себе і своїх вчителів. Людина навчалась завжди. Нові знання піднімали її на все вищий щабель існування, давали нові можливості розуміння законів всесвіту та буття. Отже, навчання невід’ємна складова існування людства. У наш час новітніх технологій, процес отримання знань настільки різноманітний, що молода людина губиться серед розмаїття можливостей. Їй важко створити необхідний і психологічно адаптований алгоритм навчання, який давав би змогу охопити ту велику кількість інформації, кристалізувати з неї правильну послідовність дій для досягнення тієї чи іншої мети [4]. Безумовно, методика здобування знань закладається в нас ще з шкільної лави. І все залежить від того, яким був наш перший вчитель: що дозволяв, як навчав, яке дав розуміння самого процесу а не тільки усвідомлення кінцевого результату. Самостійне отримання правильної відповіді шляхом спроб і помилок і є одним з методів формування всебічно розвинутої молодої людини. Яскрава особистість, бажання перемогти, досягнути цілі - ось основні характеристики, якими повинен володіти лікар для досягнення успіху у вибраній професії [3,5]. 2005 рік у медичній освіті ознаменувався початком впровадження якісно нової системи навчання, яка є одним з інтеграційних чинників України у світову наукову спільноту. Болонська система навчання, із загальною для всіх системою оцінювання та конвертацією балів в міжнародну шкалу ECTS, дає можливість використовувати міжнародні ресурси, розширювати діапазон знань за рахунок обміну досвідом, стажування в закордонних вузах [1,2]. З метою підготовки кваліфікованого спеціаліста, готового до швидких, часом нестандартних рішень, потрібно надавати студенту можливість самому вирішувати задачі, що виникли в процесі навчання. Таким методом є самостійна робота. Види самостійної роботи, що використовуються при викладанні предмету фтизіатрія на кафедрі „Фтизіатрії і пульмонології з курсом професійних хвороб” ІФНМУ

студентам медикам на 4 курсі, можна розділити на три основних підвиди: а) самостійну роботу студентів на аудиторних заняттях; б) позааудиторну самостійну роботу (самостійні заняття студентів); в) самостійну роботу студентів під контролем викладача (індивідуальні заняття з викладачем). Роль викладача в даній методиці здобування знань опосередкована, і полягає у створені умов навчальної діяльності. Основний постулат, який використовується: не диктуй, а направляй. У цьому лозунгу проявляється розуміння педагогом необхідності співробітництва з студентом, усвідомлення його здібностей цілеспрямовано діяти, набувати адекватних кількості та якості виконаних дій результатів [4]. Даючи можливість студенту самостійно працювати з хворим, отримувати інформацію з перших уст, співставляючи її з написаним в книгах, ми даємо можливість провести диференціальну діагностику захворювання в реальних умовах з описом в літературі. Це призводить до побудови міцного діагностичного алгоритму, який базується, безумовно, на фундаментальних теоретичних знаннях і буде використовуватись у подальшій практичній діяльності. Оцінювання такої діяльності проводиться за розробленою та затвердженою на засіданні кафедри кредитно-модульною системою. Окрім роботи на практичному занятті, широко використовується методика позааудиторної самостійної роботи. В даному випадку, студентам пропонується реальна клінічна ситуація, описана в методичних рекомендаціях, з пропозицією самостійного вирішення проблеми. Кінцевий результат представляється на практичному занятті, з відповідною тематикою, у вигляді персоналізованого відображення (ролевої гри) проблематичної ситуації, чи презентації її у вигляді мультимедійної доповіді. Якщо у ході вирішення проблемної задачі у студентів виникають запитання, то вони можуть отримати консультацію викладача. Проте необхідно відзначити, що педагог не дає відповідей, а спрямовує до їх пошуку за допомогою необхідних інформаційних ресурсів. Таким чином, навчаючи студентів правильно розставляти пріоритети першочерговості та необхідності, викладач формує когорту майбутніх спеціалістів із гнучким клінічним мисленням. Для ряду студентів, які з тої чи іншої причини не встигають осягнути запропонований матеріал під час аудиторних годин, або хочуть поглибити cвої знання з певних розділів фтизіатрії, пропонуються години індивідуальної роботи з викладачем. Вони є в переліку обов’язкового педагогічного навантаження і проводяться згідно з графіком затвердженого на засіданні кафедри. Студент отримує можливість персоніфікованого навчання, що пробуджує в ньому розуміння не тільки значимості науки для нього, але і його для науки. Для низки майбутніх спеціалістів - це можливість віднайти себе у більш глибокому вивченні дисципліни і в подальшій реалізації свого потенціалу на теренах наукової діяльності. Висновок Таким чином, даючи можливість самостійного навчання, ми розвиваємо в майбутніх лікарів, впевненість в собі, уміння швидко, правильно вирішувати проблеми. І головне даємо розуміння, що після закінчення медичного вузу вони тільки починають вчитись бути лікарями. І вчитись будуть все життя. Література 1. Aleksandruk D.P. The integration of the Bologna process in

87


Галицький лікарський вісник, 2013, Т. 20, № 4 higher medical education / D.P. Aleksandruk, V.V. Kapechuk, M.M. Vacy‘k [ta in.] // Hаlytskyi likarskyi visnyk. – 2006. – Т.13, №4. – S. 106 – 108. 2. Aseev A.A. The use of information technology in teaching of Phthisiopulmonology in medical school [Text] / A.A. Aseev // Тuberkulez i bolezni lehkikh. — 2011. — No 4. — С. 41"46.2. 3. Міlеrian V.Ye. Methodological Basis of preparation and conducting classes in medical colleges: a handbook / V.Ye. Міlеrian. 6 К.: Vyshchа shkola, 2004. 6 353 s. 4. Pometun О. І. Modern lesson: Interactive Training Technologies: Methodological manual / О. І. Pometun, L. V. Pyrozhenko. – К.: А.S.К., 2005; 2006. – 192 s. 5. Pulmonology and phthisiology (in two volumes) [text]: National textbook for medical interns universities IV level of accreditation / pid red. Yu. І. Feshchenka, V. P. Меlnikа, І. H. Іlnytskoho. – Кiiv-Lviv : PRАТ “Lvivska knyzhkova fabryka “Аtlas”, 2011. – 1363 s. Макойда И.Я., Островский М.М. Самостоятельная работа студента - метод подготовки высококвалифицированного специалиста Резюме. В статье изложены основные взгляды на процесс обучения в высшей школе. Несомненным фактом является необходимость вырастить и выпустить из стен университета высококвалифицированного специалиста, который бы не только обладал глубокими базовыми знаниями, но и умел принимать быстрые иногда неординарные решения. Евроинтеграционная направленность Украины требует изменения не только внешних политических векторов, а также базисных моментов самой основы понимания жизни общества. Статья определяет основные принципы и возможности болонской системы обучения в формировании клинического мышления будущего высококвалифицированного врача. Одним из методов развития независимости и мобильности в решении ситуационных проблем остается такой тип занятий, как самостоятельная подготовка. В статье отражена методика организации самостоятельной работы студента на

кафедре “Фтизиатрии и пульмонологии с курсом профессиональных болезней” ИФНМУ. Дана характеристика подвидов самостоятельных занятий, принципы выбора и моделирования клинических ситуаций, схематичность и этапность их решения и методология проведения их контроля и оценки. Ключевые слова: Болонский процесс, самостоятельная работа, фтизиатрия. I.Ya. Makoida, M.M. Ostrovskyi Students’ Self-Reliant Work – a Method of Preparing Highly Qualified Specialists Department of Tuberculosis and Pulmonology with the Course in Occupational Diseases (Head of Department – Prof. M.M. Ostrovskyi) Ivano-Frankivsk National Medical University, Ivano-Frankivsk Summary. The article outlines the main views on studying at the higher educational establishment. The absolute fact is the need to grow up the highly qualified specialists, who have not only a deep basic knowledge, but are also able to make quick decisions during the learning process. Orientation of European Integration of Ukraine requires changes of not only foreign political vectors but also of the basic points of understanding the society. The basic principles and features of the Bologna system of education consist in shaping the future of clinical thinking of a highly qualified doctor. One of the methods of the selfreliance in solving situational problems is such type of training as independent work. The article displays the methods of self-reliant work at the Department of Tuberculosis and Pulmonology with the Course on Occupational Diseases, IFNMU. In the article there have been demonstrated characteristic subspecies of self-study principles, selection and modeling of clinical situations and schematic stages of their decision, and the methodology of their monitoring and evaluation. Keywords: science, self-study, phthisiology. Надійшла 30.09.2013 року.

УДК 159.938+159.923

Мотрюк В.Б. Значення тестового контролю при вивченні пропедевтики педіатрії Івано-Франківський національний медичний університет e-mail: motryukvera@ukr.net Резюме. Для покращення навчального процесу у вищих навчальних закладах країни, що навчаються за Болонською системою, введено тестовий контроль. Ефективність цього виду контролю доведена як теоретичними засадами, так і світовою практикою. Застосування тестового контролю сприяє як об’єктивному оцінюванню знань студентів, так і покращенню навчального процесу. У статті проведено аналіз сучасних видів тестового контролю, що використовуються в оцінці знань студентів з дисципліни “Пропедевтика педіатрії”. Ключові слова: пропедевтика педіатрії, тестовий контроль, навчання.

Основним завданням при вивченні дисципліни “Пропедевтика педіатрії” у вищих навчальних закладах України є навчити студентів, користуючись знаннями доклінічної та клінічної підготовки, виявити відхилення у функціонуванні дитячого організму, вміти правильно оцінити отримані дані, причому в різноманітних ситуаціях реального життя. Рівні володіння предметом на кожному з етапів вивчення визначаються державним освітнім стандартом з предмету “Педіатрія”, в якому формулюються параметри рівня володіння на кожному етапі. Такого рівня студенти мають досягти після завершення того чи іншого курсу навчання у ВУЗі. Для того, щоб дізнатися, чи володіють студенти-медики предметом згідно з вимогами національного стандарту, необхідно здійснити точний та об’єктивний контроль знань, під час якого і

88

визначається рівень навчальних досягнень студентів з предмету. На сьогоднішній день в Україні визначення рівня навчальних досягнень з пропедевтики педіатрії здійснюється під час проведення практичних занять та підсумкового модульного контролю. Відповідь студента на практичних заняттях оцінюється викладачем, а підсумковий контроль проводиться професором або доцентом. В умовах навчання за Болонською системою оцінювання студентів проводиться за багатобальною системою, оскільки п’ятибальна система оцінювання не задовільняє викладачів через низьку чутливість до якості засвоєння навчального матеріалу [2, 5]. Крім того, зрозуміло, що така оцінка є надто суб’єктивною, щоб свідчити про дійсний рівень володіння предметом. Саме з цієї причини однакові оцінки, отримані студентами в різних вищих медичних навчальних закладах, не можуть порівнюватися, оскільки невідомо, який рівень володіння предметом кожна з них відображає. Проблеми покращення навчального процесу на клінічних кафедрах можуть бути в деякій мірі вирішені шляхом включення тестових завдань на практичних заняттях та модульних контролях, що буде сприяти поглибленню засвоєння навчального матеріалу студентами та більш об’єктивному оцінюванню знань. За Р.С. Немовим [3], від інших методів дослідження тести відрізняються тим, що передбачають


Галицький лікарський вісник, 2013, Т. 20, № 4

стандартизовану, вивірену процедуру збирання та обробки даних, а також їх інтерпретацію. Позитивна сторона тестів полягає у тому, що їх можна застосовувати і до осіб, які мають неоднаковий життєвий досвід [1, 6]. Для повноцінної перевірки знань студентів тести повинні відповідати наступним вимогам: валідність, надійність, однозначність і точність. Особливої уваги при складанні тестів слід надавати валідності, що означає: “повноцінний”, “придатний”, “відповідний”. Зазвичай валідність тестів перевіряється і уточнюється в процесі їх досить тривалого використання [3, 6]. Тому тести в процесі роботи слід постійно поновлювати і вдосконалювати. Переваги застосування тестового контролю в навчанні предметів як клінічної, так і доклінічної підготовки, доведено як в теорії, так і світовою практикою. Успіх вивчення будьякої теми (розділу або курсу) залежить від ступеня засвоєння тих понять, термінів, положень, які вивчалися на попередніх етапах навчання. Якщо інформації про це у викладача немає, то він позбавлений можливості проектування і управління учбовим процесом, вибору оптимального його варіанту. Необхідну інформацію викладач отримує, застосовуючи попередній контроль знань. Останній потрібний ще і для того, щоб зафіксувати початковий рівень знань студента. Порівняння початкового рівня знань з кінцевим дозволяє визначити “приріст” знань студента [4, 6]. У процесі навчання в медичних закладах застосовуються різні види контролю: поточний, тематичний, рубіжний, підсумковий. Відповідно до цих видів контролю можна виділити види тестового контролю або види тестування. Перевірка і оцінка знань виконує три основні функції: контролюючу, повчальну і виховну. За допомогою тестів забезпечується попередній, поточний і підсумковий контроль знань [4]. Кожний із згаданих видів тестування реалізується за допомогою спеціально розроблених тестів як стандартизованих (широко або локально стандартизованих), так і нестандартизованих. Поточний тестовий контроль проводиться систематично на практичних заняттях у процесі навчання з метою отримання викладачем інформації про успішність засвоєння студентами нового матеріалу (як вихідного рівня знань, так і заключного) та формування у них навичок та умінь, а також інформації про доцільність застосування тих чи інших методів і прийомів навчання. Результати, отримані викладачем в ході поточного контролю, дозволяють стежити за ефективністю процесу навчання і своєчасно корегувати недоліки. Провідними функціями поточного контролю є функція зворотного зв’язку та корегуюча. Поточний тестовий контроль реалізується за допомогою нестандартизованих тестів, спрямованих на перевірку володіння новим матеріалом, окремими навичками та вміннями. Питання, як часто проводити поточне тестування, що перевіряти та інші, вирішуються викладачем відповідно до методичних розробок для викладачів, затверджених методичною комісією. Поточне тестування передбачає використання різних тестів: виявлення вихідного рівня знань, кінцевого рівня знань, клінічних задач. Досвід викладання предмету пропедевтики педіатрії доводить доцільність використання поточного тестового контролю під час кожного практичного заняття. Специфіка поточного тестового контролю визначається тим, що: в тестах переважають завдання, спрямовані на перевірку окремої навички чи вміння, а відповіді, здебільшого, вибіркові; тести розробляються самим викладачем, або використовуються тести з навчально-методичного комплексу;  викладач проводить тестування своїх студентів та підраховує його результати;  результати поточного тестування не можуть бути використані для офіційної (заключної) оцінки роботи сту-

дента. Це пояснюється тим, що поточний контроль спрямовується на визначення проміжних, а не кінцевих результатів володіння предметом . Тематичний тестовий контроль здійснюється після циклу практичних занять після завершення роботи над конкретною темою. Завданням тематичного контролю є перевірка рівня володіння студентами знаннями, навичками в межах теми, що вивчалася. Тести для проведення тематичного контролю можуть розроблятися викладачем, якщо вони відсутні в навчально-методичному комплексі. Специфіка тематичного тестового контролю зумовлена тим, що:  тест може містити від 20 до 50 запитань, завдань різних типів з усіх розділів теми, що вивчалася; в тесті переважають завдання інтегративного характеру, але можуть включатися окремі завдання дискретного характеру; тестові завдання об’єднуються загальною темою та розташовуються в певній послідовності; обов’язковою умовою якості спілкування на цьому етапі є здійснення локальної стандартизації даного тексту; за результатами тематичного тестування студентам виставляється оцінка за роботу над даною темою. Рубіжний контроль здійснюється на певному часовому рубежі. Це може бути кінець семестру, навчального року. Питання доцільності та частоти проведення рубіжного контролю з предмету “Пропедевтика педіатрії” вирішується на засіданні кафедри. Складання тесту для здійснення рубіжного контролю здійснюється групою спеціально підготовлених викладачів, які працюють як команда експертів з відбору матеріалу, типів і видів тестових завдань, що включаються до тексту. Мета рубіжного контролю – отримати об’єктивні й точні результати навчальних досягнень студентів з предмету, що вивчався за конкретний відрізок навчального процесу, які можуть бути офіційно оцінені із занесенням відповідної оцінки в документи (журнал) і служити підставою для переходу до наступного терміну навчання. За результатами рубіжного тестування можна також прогнозувати подальшу успішність даного студента в оволодінні предметом протягом наступного терміну навчання. Специфіка рубіжного тестового контролю полягає в тому, що тест має бути локально стандартизованим. В тесті має бути представлений узагальнений матеріал з усіх тем, що вивчались студентами в даний період навчання. За обсягом тест збільшується і може включати від 50 до 60 завдань. За структурою тест може включати субтести, які розрізняються за рівнем складності тестових завдань. Тестові завдання мають інтегративний характер, тобто спрямовані на перевірку інтегрованих умінь студентів у різних видах діяльності. Підсумковий тестовий контроль здійснюється в кінці кожного рівня навчання у вищому навчальному закладі (мова йде про ліцензовані інтегровані іспити Крок-1, Крок-2). Іншими словами, проводиться підсумкове тестування за період навчання у вищому навчальному закладі. Для проведення підсумкового тестового контролю тести розробляються незалежними від конкретного навчального закладу структурами. Такі тести повинні проходити широку стандартизацію і мати статус офіційних. Тестування має проводитись спеціально підготовленим персоналом у визначеному порядку. Провідними функціями підсумкового контролю є оціночна та констатуюча функції. Підсумкове тестування спрямоване на визначення рівня навчальних досягнень в оволодінні предметом за період навчання на даному ступені відповідно до вимог державного освітнього стандарту. Тому оцінка результатів тестування може мати статус перевідної або випускної і виставлятися в офіційний документ про закінчення ступеня навчання у ВУЗі або закінчення такого закладу.

89


Галицький лікарський вісник, 2013, Т. 20, № 4

Враховуючи все зростаючі вимоги до оцінювання знань студентів, порядок оцінювання тестового контролю повинен бути відповідний. Згідно рішення Центральної методичної комісії від 24.04.2013 року, ухваленого Вченою радою університету, з метою покращення підготовки студентів до складання ліцензійних інтегрованих іспитів «Крок», в університеті з весняного семестру 2012/13 навчального року введено мінімальний поріг для складання тестової частини підсумкових модульних контролів не менше як 75% правильних відповідей. Отже, дана запропонована структура тестового контролю може забезпечити ефективний, об’єктивний і точний контроль у вивченні дисциплін педіатричного профілю у вищих навчальних закладах і визначити рівень навчальних досягнень студентів в оволодінні предмету на кожному ступені навчання.

Директор школы. - 2003. - № 9. - С. 6-13. Мотрюк В.Б. Значение тестового контроля при изучении пропедевтики педиатрии Ивано-Франковский национальный медицинский університет e-mail: motryukvera@ukr.net Резюме. Для улучшения учебного процесса в высших учебных заведениях стран, обучающих по Болонской системе, введено тестовый контроль. Эффективность этого вида контроля доведена как теоретически, так и мировой практикой. Использование тестового контроля способствует как объективному оцениванию знаний студентов, так и улучшению учебного процесса. В статье проведено анализ современных видов тестового контроля, которые используются при оценивании знаний студентов по дисциплине “Пропедевтика педиатрии”. Ключевые слова: пропедевтика педиатрии, тестовый контроль, обучение.

Література 1. Галузинський В.М. Основи педагогіки та психології вищої школи в Україні. Навчальний посібник / Галузинський В.М., Євнух М.Б. Київ, ІНТЕЛ, 1995.- 166 с. 2. Наумов А.П. Методика работы с современной информацией // Информатика и образование. — 2001. — № 4. — С. 56-61. 3. Немов Р.С. Психология. М.: ВЛАДОС, 2001. - 632 с. 4. Подготовка тестовых заданий для компьютерного аттестационного экзамена / [Батман Ю.А., Левченко Л.А., Линчевский Г.Л., Головко О.К. ] // Медико-социальные проблемы семьи. - 2012. - T. 17, №3-4. - С. 137-138. 5. Тестовий контроль як один із засобів оптимізації навчального процесу на кафедрі гістології та ембріології / Л.І. Хананаєв, О.І. Дєльцова, Т.Г.Тарнавська [та ін.] // Галицький лікарський вісник. - 2000.- №1. - С.100-102. 6. Шестернинов Е.Е. Педагогические тесты: надежный способ оценки и повышения уровня знаний / Шестернинов Е.Е. //

V.B. Мotriuk The Importance of Testing in the Study of Propedeutics of Pediatrics SHEE “Ivano-Frankivsk National Medical University” Summary. To improve the educational process in the higher educational establishments of the country, which work according to the Bologna system, testing is introduced. The effectiveness of this type of testing is well proved by both theoretical principles and world practice. The use of tests ensures both the objective evaluation of the knowledge of the students and the improvement of the educational process. The analysis of the modern types of tests, used in the evaluation of the students’ knowledge of the subject “Propedeutics of pediatrics”, is carried out in this article. Key words: propedeutics of pediatrics, test control, studies. Надійшла 04.11.2013 року.

УДК: 371.321+615.273+378.147

Струтинський Г.М. Науково-методичні аспекти викладання фармакології антикоагулянтів за кредитно-модульною системою навчання Кафедра фармакології (зав. каф. - проф. Шеремета Л.М.) Івано-Франківського національного медичного університету Резюме. Розвиток кредитно-модульної системи в контексті Болонського процесу, медичної науки в цілому та фармакології, зокрема, вимагають цілеспрямованого впровадження міжнародних стандартів у систему підготовки лікарів. Впровадження в лікувальну практику нових антикоагулянтів відкриває нові можливості для профілактики і лікування тромбозів із позицій доказової медицини. Кредитно-модульна система навчання дає можливість опанувати як програмні лікарські засоби, так і нові представники препаратів- антикоагулянтів (НМГ, фондапаринукс, біліварудин тощо). Важливим є мотивованість студентів до самостійної позааудиторної роботи, вміння проводити порівняльну характеристику різних антикоагулянтів, розвиток практичних навичок щодо рекомендацій препаратів для лікування та профілактики тромбозів з урахуванням їх доведеної ефективності, безпеки та можливих побічних ефектів. Ключові слова: фармакологія, антикоагулянті засоби, кредитно-модульна система навчання.

Болонський процес та розвиток кредитно-модульної системи організації навчального процесу (КМСОНП) сприяють інтеграції вітчизняної медичної освіти в європейський освітній простір. Швидкі темпи розвитку медицини та фармакології, зокрема, вимагають цілеспрямованого впровад-

90

ження міжнародних стандартів у систему підготовки лікарів [3,4,5,7]. На сьогоднішній день отримані дані великих рандомізованих міжнародних досліджень ефективності та безпеки нових антикоагулянтів, які лягли в основу міжнародних та вітчизняних рекомендацій, консенсусів щодо профілактики та лікування тромбоемболічних ускладнень в медичній практиці [1,2,6]. На практичному занятті з фармакології захворювань згортальної системи крові студенти, згідно з робочою навчальною програмою із фармакології, вивчають антикоагулянти прямої дії –гепарин (нефракціонований гепаринНФГ), низькомолекулярний гепарин- надропарин кальцію (фраксипарин, НМГ), та антикоагулянти непрямої дії- антагоністи вітаміну К- неодикумарин. Для ознайомлення студентів ІІІ-го курсу і поглиблення знань про препарати, що входять в групу сучасних антикоагулянтів, на заняттях обов’язково подається розширена інформація про механізми дії та основні ефекти цих препаратів, зокрема, НМГ, фондапаринукс, біліварудин тощо. На підготовчому етапі заняття при постановці навчальних цілей з метою підвищення мотивації у студентів і продуктивності навчання необхідно звертати увагу на знання процесу згортання крові та основних


Галицький лікарський вісник, 2013, Т. 20, № 4

факторів згортальної системи, роз’яснити значення таких клінічних дефініцій, як тромбоз, тромбоемболія легеневої артерії (ТЕЛА), гострий коронарний синдром (ГКС), профілактика та лікування тромбоемболічних ускладнень при оперативних втручаннях. Основою для глибокого засвоєння даної теми є рівень і ступінь набутих знань на фундаментальних кафедрах, який оцінюється при проведенні тестового контролю вихідного рівня знань. На цьому етапі заняття демонструються короткі навчальні мультимедійні відеофільми, які дають студентам загальну уяву про механізми розвитку тромбозу та роль факторів згортальної системи крові (тромбоз глибоких вен, ТЕЛА тощо). З появою нових антикоагулянтів залежно від рівня дії препаратів на каскад коагуляції їх поділяють наступним чином [1]: непрямі інгібітори коагуляції (для їх повної дії потрібен антитромбін): непрямі інгібітори тромбіну- НФГ, НМГ; непрямі інгібітори Xa фактора - НМГ, фондапаринукс. Прямі інгібітори коагуляції розділяють на: прямі інгібітори фактора Ха- рівароксабан, апіксабан, отаміксабан; прямі інгібітори тромбіну- бівалірудин, дабігатран. З прямих інгібіторів Ха-фактора призначають рівароксабан, а з інгібіторів тромбіну- бівалірудин. Для більш глибшого розуміння механізмів дії окремих препаратів слід звернути увагу студентів на значення та участь в процесі згортання крові основних факторів. Так, у більшості випадків припинення активації Х-фактора запобігає додатковому утворенню тромбіну й гальмує гемокоагуляційний каскад. У подальшому найбільш активним учасником коагуляції є ІІа-фактор згортання — тромбін. Взаємовідношення активності цих двох основних факторів із можливостями їх нейтралізації визначає результат атеротромботичного процесу. Отже, антикоагулянтна терапія має бути направлена на пригнічення саме ІІа- та Ха-факторів гемостазу [10]. При цьому необхідно зазначити, що переважання в механізмі дії препарату впливу на ІІа-фактор призводить до збільшення частоти геморагічних ускладнень. Прикладом цього можна вважати НФГ, що впливає переважно на активність ІІа-фактора, тому тривалість його застосування обмежена, при його використанні необхідний контроль активованого часткового тромбопластинового часу (АЧТЧ), часу згортання крові. Препарати, які блокують Ха-фактор, більше наближені до ідеального співвідношення безпеки та ефективності в переважній кількості випадків ГКС (особливо у хворих із середнім та високим ризиком виникнення геморагічних ускладнень). Так, чим більшим є співвідношення активності анти-Ха-антиІІа антикоагулянтного препарату, тим краще. На сьогодні таким препаратом, що селективно зв’язує антитромбін ІІІ і непрямо інгібує Ха-фактор згортання крові, є фондапаринукс, який пригнічує фактор коагуляції Ха шляхом зворотного і нековалентного зв’язування з антитромбіном з високою афінністю, каталізує антитромбін-опосередковане інгібування фактора Ха, тим самим запобігаючи синтезу тромбіну. Як результат дії фондапаринуксу, постійно пригнічується початкова фаза гемостазу, що є найбільш ефективним з точки зору профілактики тромботичних ускладнень [10]. Проте, відсутність антидоту до фондапаринуксу вимагає постійного лікарського контролю під час його призначення. На сьогоднішній день в клінічній практиці широко використовують НМГ(еноксапарин, надропарин, дельтапарин тощо), які з позицій доказової медицини продемонстрували свої переваги над НФГ в профілактиці і лікуванні тромбоемболічних ускладнень [8,9]. Порівняно з НФГ, низькомолекулярні гепарини характеризуються посиленою активністю проти фактора Ха порівняно з активністю проти фактора ІІа (антитромбінова активність). Крім того, НМГ менш чутливі до тромбоцитарного фактора ІУ і мають більш передбачуваний антикоагулянтний ефект, з меншою ймовірністю виникнення тромбоцитопенії. Ці препарати можна призначати підшкірно, доза залежить від ваги пацієнта; при цьому

немає потреби у лабораторному контролі. Отримано дані на користь еноксапарину, порівняно з НФГ при призначенні як початкового засобу лікування, у хворих на ГКС[ 1,6 ]. Упродовж тривалого часу вивчались декілька прямих інгібіторів тромбіну, але тільки бівалірудин отримав дозвіл для застосування під час проведення стентувань у хворих на ГКС. Бівалірудин безпосередньо зв’язується з тромбіном (фактор ІІа) і блокує перетворення фібриногену у фібрин. Він інактивує як вільний, так і зв’язаний із фібрином тромбін. Оскільки бівалірудин не зв’язується з білками плазми, його антикоагулянтний ефект більш передбачуваний. Проте, біліварудин має обмежені покази та призначається при проведенні стентувань та черезшкірної транслюмінальної коронарної ангіопластики. Для довготривалої профілактики тромботичних ускладнень призначають пероральний антикоагулянт непрямої діїварфарин. Варфарин є синтетичним похідним 4 - гідроксикумарину, який діє, запобігаючи утворенню в печінці активних факторів згортання II, VII, IX та X , інгібуючи вітамін К-залежне гамма-карбоксилювання попередників білків. Слід наголосити, що дози препарату підбирають індивідуально з урахуванням індивідуальної реакції кожного пацієнта на прийом варфарину на підставі співвідношення протромбінового часу/МНВ (міжнародне нормалізоване відношення), як правило,на рівні 2,0-3,0 [ 6 ]. Під час проведення заняття лікарські засоби вивчаються згідно з алгоритмом даної теми методичної вказівки. Важливим є самостійна позааудиторна підготовка студентів до заняття, виконання письмової домашньої роботи (власноручне написання рекомендованих до заняття рецептів, заповнення таблиць з класифікацією лікарських засобів, показаннями та протипоказаннями для них, розв’язання фармакологічних завдань). Враховуючи специфіку даної теми та наявність низки нових препаратів, студентам пропонується на вибір підготовити коротку мультимедійну презентацію та представити її на практичному занятті, що сприяє більшій залученості до вивчення теми та сприяє розвитку мотивації. На занятті демонструються колекції препаратів антикоагулянтного ряду та їх форми випуску, при цьому слід вияснити переваги для медичного персоналу лікарської форми НМГ та фондапаринуксу, які представлені в попередньо заповнених шприцах. Для глибокого засвоєння матеріалу заняття студентам пропонується вирішення ситуаційних і фармакологічних задач, які включають обґрунтування раціонального вибору антикоагулянта з урахуванням конкретної клінічної ситуації (гепарин, еноксапарин, фондапаринукс, біліварудин, варфарин), фармакотерапевтичний аналіз виписаних рецептів (наприклад, антикоагулянт для тривалої профілактики тромбозу, антикоагулянт для лікування ГКС, для профілактики тромбозу при проведенні оперативних втручань і т.д.), задачі/ алгоритми з невідкладної допомоги (стенокардія, інфаркт міокарду, ТЕЛА, антидотна терапія при передозуванні антикоагулянтами). На даному занятті студенти повинні оволодіти новими практичними навичками: вміти провести розподіл лікарських засобів за їх фармакологічними групами, надати конкретні рекомендації щодо раціонального застосування антикоагулянтів в конкретній клінічній ситуації з врахуванням особливостей механізму дії лікарських засобів, фармакокінетики та фармакодинаміки, безпеки препаратів та можливих ускладнень. Рівень засвоєння матеріалу заняття закріпляється заключним тестуванням. Раціональним є також ознайомлення студентів з вибором найефективніших лікувально-діагностичних заходів з використанням основних принципів доказової медицини. Згідно з міжнародними рекомендаціями вони розподіляються на три класи: 1. Клас І — користь та ефективність препаратів встановлена. 2. Клас ІІ — користь та ефективність препаратів дискутабельна: клас ІІа — більше доказів щодо ефективності

91


Галицький лікарський вісник, 2013, Т. 20, № 4

препарату; клас ІІb — менше доказів щодо ефективності препарату. 3. Клас ІІІ — ефективність препарату не є визнаною. Вірогідність доказів базується: А — на результатах багатоцентрових рандомізованих клінічних досліджень; В — результатах рандомізованих досліджень, але з малою кількістю пацієнтів; С — на думці експертів, рівень доказовості низький. На практичних заняттях студентів слід націлювати на те, що кожен лікар має дотримуватись сучасної, обґрунтованої з позицій доказової медицини, стратегій лікування. Так, наприклад, при лікуванні ГКС рекомендується застосування антикоагулянтної терапії додатково до антитромбоцитарного лікування якомога швидше при надходженні хворого до стаціонару (клас ІА). Для пацієнтів, яким планується призначення консервативного лікування, антикоагулянтами з доведеною ефективністю є еноксапарин або НФГ (клас ІА) та фондапаринукс (клас ІВ). Фондапаринукс має переваги перед застосуванням еноксапарину та НФГ через менший ризик виникнення кровотеч (клас ІВ). Для пацієнтів, яким планується застосування інвазивної тактики лікування лікування ГКС, антикоагулянтна терапія є доведеною та ефективною (клас ІА). Препаратами вибору є НФГ (клас ІА), еноксапарин (клас ІА), фондапаринукс (клас ІВ) та бівалірудин (клас ІВ) [1,8]. Основними складовими успішного засвоєння основних положень теми даного заняття є наступні: сумлінна самостійна позааудиторна підготовка студентів до заняття, яка включає вивчення матеріалу за підручником, лекційного матеріалу, рекомендованої літератури відповідно до переліку теоретичних питань методичних вказівок до заняття. Висновки 1.КМСОНП дає можливість правильно організувати навчальний процес зі студентами і допомагає створювати сприятливі умови для оптимального засвоєння навчальної програми з фармакології антикоагулянтів. 2.При проведенні практичних занять слід приділяти постійну увагу на розвиток знань та практичних навичок вибору сучасних стратегій лікування пацієнтів, розвивати положення доказової медицини із врахуванням майбутньої спеціальності студентів. Перспективи подальших досліджень У подальшому планується розвивати основні положення КМСОНП, направлені на оптимізацію навчального процесу при вивченні фармакології. Література 1.Нетяженко В.З. Сучасні підходи до антикоагулянтної терапії при гострому коронарному синдромі / В.З. Нетяженко// Здоров’я України. 2010.-№4.-С.3. 2. Мішалов В.Г. Низькомолекулярні гепарини в комплексній профілактиці тромбоемболічних ускладнень у хворих хірургічного профілю (Огляд вітчизняних і зарубіжних методичних рекомендацій) / В.Г.Мішалов, Н.Ю.Літвінова // Хірургія України.- 2012.№1.- С.113-119 3.Посохова К.А. Викладання фармакології – деякі підсумки і перспективи/ К.А.Посохова, О.М.Олещук, О.О.Шевчук// Медична освіта.- 2012.- №1.- С.-146-150. 4.Рожко М.М. З досвіду впровадження кредитно-модульної системи організації навчального процесу в Івано-Франківському національному медичному університеті /М.М. Рожко, Г.М.Ерстенюк, В.В. Капечук// Медична освіта.- 2012.-№2.- С.69- 71. 5.Туманов В.А. Практичне заняття з фармакології засобів із стимулюючим типом дії / В.А.Туманов, Н.О.Горчакова, О.Г.Тимченко [та інш.] // Медична освіта.- 2011.- С.91-93. 6. Український національний консенсус. Артеріальні, венозні

92

тромбози та тромбоемболії. Профілактика та лікування.- К.: ЗАТ «Віпол».-2006.- 72с. 7.Чекман І.С. Науково-методичні основи викладання фармакології блокаторів кальцієвих каналів та І-адреноблокаторів згідно з кредитно-модульною системою організації навчального процесу/ І.С.Чекман, Н.О.Горчакова, А.М.Пузиренко // Медична освіта.2011.- С.55-56. 8. Anderson J.L., Adams C.D., Antman E.M. et al. ACC /AHA 2007 guidelines for the management of patients with unstable angina / nonST-elevation myocardial infarction: a report of the American College of Cardiology /American Heart Association Task Force on Practice Guidelines (Writing Committee to Revise the 2002 Guidelines for the Management of Patients With Unstable Angina /Non-ST-Elevation Myocardial Infarction). J Am Coll Cardiol 2007; 50: р.1-157. 9.Prevention of Venous Thromboembolism. American College of Chest Physicians Evidence-Based Clinical Practice Guidelines (8th Edition) // Chest.- 2008.- 133.-P.381-453. 10. Shamir R. Mehta. Clinical benefit and practical use of Fondaparinux in the invasive management of patients with acute coronary syndromes // Eur. Heart J. — 2008. — 10. — P. C14-C21. Струтинский Г.М. Научно-методические аспекты преподавания фармакологии антикоагулянтов в условиях кредитно-модульной системы обучения Ивано-Франковский национальный медицинский университет Резюме. Развитие кредитно-модульной системы в контексте Болонского процесса, медицинской науки в целом и фармакологии, в частности, требуют целенаправленного внедрения международных стандартов в систему подготовки врачей. Внедрение в лечебную практику новых антикоагулянтов открывает новые возможности для профилактики и лечения тромбозов с позиций доказательной медицины. Кредитно-модульная система обучения дает возможность овладеть как программными лекарственными средствами, так и новыми представителями препаратов-антикоагулянтов (НМГ, фондапаринукс, биливарудин т.д.). Важным является мотивированность студентов к самостоятельная внеаудиторная работа, умение проводить сравнительную характеристику различных антикоагулянтов, развитие практических навыков рекомендаций препаратов для лечения и профилактики тромбозов с учетом их доказанной эффективности, безопасности и возможных побочных эффектов. Ключевые слова: фармакология, антикоагулянты, кредитно-модульная систем. H.M. Strutynskyi Scientific and Methodical Aspects of Teaching the Pharmacology of the Anticoagulants According to the CreditModular Educational System Department of pharmacology (chairman- prof. L.M. Sheremeta) of the Ivano-Frankivsk National Medical University Summary. Development of the credit-modular system in the context of the Bologna process, medical science as a whole and pharmacology, in particular, requires the purposeful implementation of the international standards into the system of the doctors’ training. The implementation of the new anticoagulants into the medical practice opens new possibilities for the prophylaxis and treatment of thromboses in terms of the evidence-based medicine. The credit-modular educational system enables the students to learn both traditional medications as well as the new types of drugs - anticoagulants (LMWH, fondaparinux, bilivarudin and others). The students’ motivation towards independent extracurricular work, ability to carry out the comparative description of the different anticoagulants, the development of the practical skills of recommending the medication for the treatment and prophylaxis of thromboses, taking into account their effectiveness, safety and possible side effects are very important. Keywords: pharmacology, anticoagulant medications, creditmodular educational system. Надійшла 09.09.2013 року.


Галицький лікарський вісник, 2013, Т. 20, № 4 УДК 378.147.88+615.015

Федоровська М.І. Роль практичних навичок при вивчені дисципліни «Промислова технологія лікарських засобів» Кафедра організації та економіки фармації і технології ліків (зав. каф. – д.фарм.н., доц. Д.В.Семенів) ДВНЗ «Івано-Франківський національний медичний університет» Резюме. Висвітлено роль практичних навичок при вивчені предмету «Промислова технологія лікарських засобів» в умовах запровадження засад Болонської декларації для формування професійного мислення, навичок і умінь майбутнього фахівця фармацевтичної галузі. Обґрунтовано переваги оцінювання за кредитномодульною системою практичної роботи студентів на заняттях, підсумковому модульному контролі, державній атестації з врахуванням кожного компонента практичних навичок. Показана важливість навчальної практики з ПТЛЗ, позакласної підготовки в центрі практичної фармації у здобутті та вдосконаленні умінь і навичок з виробництва, фармако-технологічного контролю якості, забезпеченні умов зберіганні готових лікарських засобів. Ключові слова: практичні навички, промислова технологія лікарських засобів, професійна компетентність.

У новітній час фармацевтична промисловість — це та сфера діяльності, яка не тільки відповідальна за здоров’я людей, але i може внести суттєвий вклад в економічний розвиток країни та зайнятість її громадян. Підготовка фармацевтичних фахівців є соціально важливою функцією для держави, оскільки головним завданням професії провізора є здійснення якісного медикаментозного забезпечення населення, лікувально-профілактичних закладів, підприємств, установ і організацій тощо [7]. Розвиток сучасної фармацевтичної освіти пов’язаний з впровадженням у вищих медичних та фармацевтичних закладах кредитно-модульної системи навчання відповідно із положеннями Болонської декларації [2]. Нова освітня система передбачає використання передових технологій навчання, спрямованих на підвищення якості підготовки спеціалістів, знання та вміння яких повинні повністю відповідати вимогам міжнародного ринку праці. Левову частку в навчальній програмі фармацевтичної освіти займає комплекс фармацевтичних дисциплін, серед яких промислова технологія лікарських засобів (ПТЛЗ) відіграє важливі функції. Промислове виробництво ліків тісно пов’язано з їх якістю, оскільки якість фармацевтичної продукції формується при здійсненні технологічних процесів [8]. Тому ключовим завданням у вивченні ПТЛЗ є набуття студентами базових практичних навичок з промислового виробництва ЛЗ та здійснення постадійного фармако-технологічного контролю. Застосування новітніх підходів до виконання практичної роботи на заняттях, під час підсумкового модульного контролю (ПМК), проходженні навчальної практики з ПТЛЗ дозволить сформувати компетентного фахівця, здатного реалізуватись у різних сферах фармацевтичної діяльності. Мета роботи. Розкриття ролі практичних навичок при вивченні предмету ПТЛЗ у формуванні професійної компетентності спеціалістів фармацевтичної галузі. Відповідно до концепції розвитку фармацевтичного сектору, що затверджений наказом МОЗ України №838 від 18.12.2007 р. велику увагу необхідно приділяти підвищенню ефективності практичної підготовки фармацевтів в області промислового виробництва ЛЗ [1]. ПТЛЗ є однією із основних профільних дисциплін, що формує професійні компетенції провізора. На сьогодні викладання ПТЛЗ, як і будь-якої навчальної дисципліни, здійснюється на основі типової програми, що була розроблена опорною кафедрою заводської технології ліків національного фармацевтичного університету (2012 рік). Програма з ПТЛЗ для вищих фармацевтичних закладів освіти України III-IV рівнів акредитації складена для спеціальностей 7.12020101 «Фармація», відповідно з освітньо-кваліфікаційною характеристикою (ОКХ) і освітньо-професійною

програмою (ОПП) підготовки фахівців, затвердженими наказом МОН України, експериментальним навчальним планом, розробленим на принципах Європейської кредитнотрансферної системи (ЕСТS) [2, 4]. Дисципліна є складовою ліцензійного інтегрованого іспиту «Крок-2» та інтегрованого практично-орієнтованого державного іспиту. Роль предмету ПТЛЗ у формуванні професійних навичок і умінь майбутнього спеціаліста визначається фактом, що ЛЗ промислового виробництва на фармацевтичному ринку становлять абсолютну більшість та характеризуються широким різноманіттям ЛФ [8]. Препарати закордонного виробництва значно перевищують за кількістю вітчизняні, відповідно постає потреба в розширенні вітчизняного виробництва ліків. Часті випадки фальсифікації ЛЗ вимагають підвищеної уваги до контролю за фармацевтичною продукцією як за фізико-хімічними, так і фармако-технологічними показниками якості. Нинi в переважнiй бiльшостi країн свiту офiцiйно визнанi вимоги до органiзацiї i ведення процесу виробництва ЛП, які ґрунтуються на стандартах GMP (Good Manufacturing Practice – Належна виробнича практика). Відповідно, впровадження GMP на фармацевтичних підприємствах України є необхідністю, що відкриває можливості експорту продукції вітчизняних підприємств на ринки країн, які вступили в систему сертифiкацiї якості ЛЗ для міжнародної торгівлі. Ключовим завданням фахової підготовки майбутніх спеціалістів фармацевтичної галузі полягає у формуванні їх професійної компетентності, а саме здатності використовувати отриманні знання і вміння на робочому місці при виконанні реальних практичних функцій. Тому при вивченні ПТЛЗ основна увага приділяється практичним навичкам, які студенти набувають на усіх етапах навчання: при засвоєнні теми практичного заняття, в ході підсумкових модулів, при проходженні навчальної практики і державної атестації [5, 6]. Враховуючи вищевказане, важливим етапом при освоєнні предмету ПТЛЗ є навчити студентів в умовах фармацевтичного виробництва з врахуванням вимог GMP готувати різні види ЛФ, проводити їх стандартизацію та аналіз технологічних показників, визначати вплив фармацевтичних факторів на терапевтичну ефективність ЛП і забезпечувати правильне їх зберігання. При засвоєнні предмету необхідні глибокі знання з попередньо вивчених загальних (фізика, фізична та колоїдна хімія) та базових фармацевтичних (аптечна технологія ЛЗ, фармакогнозія, фармацевтична хімія, фармакологія) дисциплін [3, 4]. Студенти ІV курсу фармацевтичного факультету ІваноФранківського національного медичного університету вивчають предмет ПТЛЗ на кафедрі організації та економіки фармації і технології ліків. На заняттях з ПТЛЗ робота проводиться в групах; студенти здійснюють базові технологічні операції з виготовлення ЛФ (з твердим, рідким, пружнопластичним дисперсним середовищем, екстрактивних, ін’єкційних та асептичних ліків, препаратів, що перебувають під тиском тощо), проводять контроль їх якості та оформляють протокол відповідно із виконаним завданням. Використання рейтингової системи дозволяє підбирати критерії оцінки кожного компонента практичних навичок: - складання робочого пропису при виготовленні, порошків, таблеток, капсул, мазей, ін’єкційних розчинів тощо; - здійснення базових технологічних операцій (отримання грануляту методом вологого гранулювання, одержання тритураційних таблеток, приготування водно-спиртового роз-

93


Галицький лікарський вісник, 2013, Т. 20, № 4

чину відповідної концентрації, приготування емульсії, виготовлення настойки методом мацерації, завантаження перколятора та одержання настойки методом перколяції тощо); - проведення контролю якості напівпродукту на проміжних технологічних стадіях чи виготовленого ЛП (визначення насипної маси, сипкості та кута природного відхилення сипучих матеріалів; оцінювання міцності таблеток на стирання та стиснення, середньої маси і розпадання твердих дозованих ЛФ; вимірювання концентрації водно-спиртового розчину; встановлення ступення дисперсності внутрішньої фази емульсії; визначення якості ампульного скла, герметичності запаювання ампул та відсутності механічних домішок в ін’єкційному розчині; визначення сухого залишку, концентрації етанолу в настойках та ін.); - складання технологічної схеми виробництва ЛФ із врахуванням стадій, апаратури та контролю якості на кожному етапі технології; - оформлення протоколу, в якому відображена виконана робота, в тому числі із наведеним рівнянням матеріального балансу виробництва ГЛЗ та прихідно-розхідною таблицею. Для удосконалення у освоєні практичних навичок на кафедрі відкрито центр практичної фармації, де після занять студенти мають можливість удосконалювати свої практичні навички з дисциплін технологічного напрямку. Для практичного навчанні студенти мають можливість використовувати прилади та обладнання (електронні ваги, електричний подрібнювач для порошків, траворізка, стандартний набір сит, термостат «ТС-80», мікроскоп із вмонтованою камерою «Delta Optical Genetic Pro», гомогенізатор для приготування мазей та емульсій МИ-2, рН-метр «рН-150 МИ», скляні спиртоміри, пікнометри, денсиметри, лабораторні перколятори, барабанний фріабілятор та ін.), розроблені таблиці і схеми, електронні матеріали технологічних процесів виробництва ліків на фармацевтичних підприємствах. Закріплення і набуття нових практичних навичок відбувається під час проходження студентами навчальної практики з ПТЛЗ, яка відповідно до Болонської системи вивчається та оцінюється як самостійний предмет. Робоча програма практики складена відповідно до навчальної програми, розробленою опорною кафедрою заводської технології ліків НФаУ. Практика з ПТЛЗ 2012-2013 навчального року (1-8 липня 2013 р.) була спланована таким чином, що кожного дня група студентів (14-18 осіб) відвідувала та брала активну участь у роботі підприємств м. Івано-Франківська та області: - ЗАО «Завод тонкого органічного синтезу «Барва», що здійснює виробництво допоміжних речовин для фармацевтичної промисловості (ПЕГ-200, ПЕГ-1500, ПЕГ-2000, ПЕГ4000, проксанол-268, твін-80); - ТОВ “Фармацевтична фабрика” – виготовляє ЛП у формі водних та спиртових розчинів для зовнішнього застосування (водний розчин хлоргекседину біглюконату, пероксиду водню, спиртові розчини кислоти борної, саліцилової та ін.); виробництво ЛЗ на критичних стадіях здійснюється у «чистому приміщенні» класу D відповідно з вимогами GMP; - Івано-Франківська обласна станція переливання крові (виробництво ліофілізованого людського альбуміну, 5 і 10% розчину альбуміну для інфузій); - ТОВ «Фітолік», що здійснює виробництво ЛЗ на основі лікарської рослинної сировини (ЛРС) (обліпихова олія, свічки з олією обліпихи, фасована ЛРС, рослинні збори та ін.); - Науково-виробнича фірма, ПП «Елітфіто», що здійснює виробництво рослинних жирних олій (гарбузова, кавуна, розторопші, лляна, кедрова, грецького горіха, обліпихи, амаранта, зародків пшениці тощо), біодобавок з відпрацьованого жмиху у формі фасованого порошку тощо. Отже, навчальна практика з ПТЛЗ дає студентам можливість ознайомитись з нормативною документацією, виробничими приміщеннями та обладнанням, технологічними процесами при виробництві ГЛЗ та допоміжних фармацев-

94

Таблиця 1. Місце праці фахівця фармацевтичної галузі, де застосовують практичні навички з ПТЛЗ Місце праці Практична діяльність в галузі фармації Аптека Забезпечення належних умов зберігання ЛП в залежності від виду ЛФ та властивостей ЛР; здійснення фармацевтичної опіки хворих – підбір раціональної ЛФ з урахуванням складу допоміжних речовин. Виробнича аптека Складання технологічних інструкцій та здійснення технологічних операцій при малосерійному виробництві ліків; забезпечення належних умов зберігання ГЛЗ. Аптечна база Забезпечення належних умов зберігання ЛП в залежності від виду ЛФ та властивостей ЛР. Сфера виробництва Участь у розробці ліків та нормативно-техЛП (фармацевтична нічної документації; робота у виробничих фабрика, завод цехах і лабораторіях з контролю якості ЛЗ тощо) фармацевтичного підприємства. Станція Виробництво та контроль якості ЛП, одерпереливання крові жаних з людської крові (наприклад: ліофілізованого порошку альбуміну, 5%розчину альбуміну для інфузій та ін.). Науково-дослідна Проведення наукових досліджень з розустанова медичного робки складу і промислової технології ЛФ, та фармацевтичного вивчення біофармацевтичних, фармако-техпрофілю нологічних показників якості ЛЗ, що розробляються. Лабораторія з Проведення контролю якості ГЛЗ за фарконтролю якості ЛЗ мако-технологічними показниками.

тичних субстанцій. Набуті практичні навички з ПТЛЗ студенти-випускники повинні представити на інтегрованому практично-орієнтованому державному іспиті (технологія ліків, фармацевтична хімія, фармакогнозія). На екзамені з «Технології ліків» оцінюються типові задачі діяльності відповідно до вимог ОКХ як аптечного, так і промислового виробництва ліків: виробництво ЛФ в умовах промисловості, визначення основних показників якості ГЛЗ, забезпечення раціонального застосування ЛП. Демонстрування основних умінь і навичок проводиться в декілька етапів відповідно до отриманого завдання: - складання робочого пропису, матеріального балансу для ЛФ, характеристика технологічних стадій, апаратурного обладнання, встановлення показників якості, особливостей упакування та маркування ГЛЗ; - оснащення технологічного процесу приладами та апаратами при виробництві різних ЛФ: дати правильну назву приладу, пояснити призначення апарату, конструктивні особливості та принцип дії; - забезпечення якості ГЛЗ – провести оцінку якості ЛП за фармако- технологічними показниками. Таким чином, при засвоєнні тем практичних занять, підсумкових модульних контролів, при проходженні навчальної практики, практично-орієнтованого іспиту з дисципліни «Технологія ліків» здійснюється навчання та об’єктивна й всебічна оцінка рівня засвоєння практичних навичок з ПТЛЗ, що є важливим в аспекті майбутньої професійної діяльності (табл. 1). Висновки 1. У роботі розкрито важливість набуття практичних навичок з базової фармацевтичної дисципліни ПТЛЗ, які безпосередньо впливають на формування професійних якостей спеціалістів фармації. 2. Навчання за кредитно-модульною системою дозволяє підбирати критерії оцінки кожного компонента практичних навичок і ранжувати отримані знання та вміння. 3. Набутий практичний досвід під час всього періоду навчання дозволить майбутнім працівникам реалізуватись у різних галузях фармацевтичного спрямування.


Галицький лікарський вісник, 2013, Т. 20, № 4

Література 1. Наказ МОЗ України від 18.12.2007 р. № 838 «Про затвердження Концепції розвитку фармацевтичного сектору галузі охорони здоров’я України». 2. Новікова Л.М. Болонський процес у дії. Кредитно-модульна система навчання: Навч. посібник / Л.М. Новікова. – Павлоград, 2006 – 100 с. 3. Практикум з промислової технології лікарських засобів для студентів спеціальності «Фармація» /О.А. Рубан, Д.І. Дмитрієвський, Ю.С. Маслій [та ін.]; під ред. О.А.Рубан. – Х.: Вид. НФаУ, 2011. – 342 с. 4. Програма навчальної дисципліни «Промислової технології лікарських засобів» (для студентів вищого фармацевтичного навчального закладу та фармацевтичних факультетів вищих медичних навчальних закладів ІІІ-ІVрівнів акредитації спеціальності «Фармація»). – К: МОЗ України. Центральний методичний кабінет з вищої медичної освіти, 2012. – 36 с. 5. Одинцова В.М. Роль практичних навичок при вивченні фармакогнозії / В.М. Одинцова // Актуальні питання фармацевтичної і медичної науки та практики. – 2012. – №3. – С.107-108. 6. Формирование компетенции студентов в системе профессиональной подготовки у фармацевтическом ВУЗе / И.Л. Андреева, А.Н. Пивоваров, Т.Б. Уткина и др. // Фармация. – 2010. – №1. – С. 53-57. 7. Чупандина Е.Е. Качество фармацевтического образования: понятия, модели и оценка // 2011. – №5. – С. 48-50. 8. Ярных Т.Г. Преподавание технологии лекарств – опыт зарубежных стран / Т.Г. Ярных // Провизор. – 2008. – №12. (www.provisor.com.ua). Федоровская М.И. Роль практических навыков при изучении дисциплины «Промышленная технология лекарственных средств» Резюме. Показана роль практических навыков при изучении предмета «Промышленная технология лекарственных средств» в условиях введения принципов Болонской декларации для фор-

мирования профессионального мышления, навыков и умений будущего специалиста фармацевтической отрасли. Обоснованы преимущества оценки по кредитно-модульной системе практической работы студентов на занятиях, итоговых модульных контролях, государственной аттестации с учетом каждого компонента практических навыков. Показана важность учебной практики по ПТЛС, внеклассной подготовки в центре практической фармации в получении и совершенствовании умений и навыков по производству, фармако-технологическому контролю качества, обеспечении условий хранении готовых лекарственных средств. Ключевые слова: практические навыки, промышленная технология лекарственных средств, профессиональная компетентность. M.І. Fedorovska The Role of Practical Skills in Studying the Subject “Manufacturing Technology of Drugs” Department of Organization and Economy of Pharmacy and Drug Technology (Head of Department – dok.pharm.sc., assoc. prof. D.Semeniv) “Ivano-Frankivsk National Medical University” Summary. The article is devoted to the role of practical skills in studying the subject “Manufacturing technology of drugs” according to the principles of the Bologna Declaration in order to form the professional thinking, abilities and skills of a future specialist in the pharmaceutical field. The article demonstrates the advantages of the credit-modular system of assessment of the students’ practical work during the classes, final modular tests and state examination with regard to each component of the practical skills. The study shows the importance of the educational practice in the MTD, extracurricular training in the Center of Practical Pharmacy in acquiring and improving the abilities and skills of production, pharmacotechnological quality control, ensuring the proper storage conditions of the drugs. Key words: practical skills, manufacturing technology of drugs, professional competence. Надійшла 21.10.2013 року.

УДК 614.253.52:61.001.6

Шатило В.Й. Підходи до організації наукових досліджень в медсестринстві Житомирський інститут медсестринства ztims@yandex.ru shygonska@mail.ru Резюме. Метою статті є виокремлення та аналіз основних підходів щодо організації наукових досліджень у медсестринстві крізь призму обґрунтування їхньої доцільності та подальшого визначення основних методологічних принципів, що у свою чергу передбачає системне вирішення актуальних проблем, пов’язаних як із удосконаленням форм і методів реалізації наукових досліджень, так і вирішенням актуальних питань у практичній діяльності медичних сестер. Для вирішення поставленої мети було застосовано методи системного аналізу та синтезу. Результати дослідження представлені чіткою методологічною базою організації та проведення наукових досліджень з тематики актуальних проблем медсестринства, що включають як проблеми організації навчально-виховного процесу підготовки медичних сестер у ВМНЗ, так і отримання нових наукових даних, спрямованих на удосконалення профілактичних, лікувальних та реабілітаційних заходів, які відносяться до медсестринської компетенції. Висновки. Основними науково-практичними результатами медсестринських досліджень стали вдосконалення системи професійної підготовки медичних сестер на всіх етапах та обґрунтування та запровадження інноваційних підходів до надання медсестринської допомоги у лікувально-профілактичних закладах. Ключові слова: медсестринська освіта, наукові дослідження, магістр медсестринства.

Постановка проблеми і аналіз останніх досліджень. У більшості країн Європи, США, Канади центральною фігу-

рою в процесі підготовки молодших медичних спеціалістів є медична сестра з вищою медсестринською освітою (магістр, доктор філософії). Фахівці з таким рівнем підготовки займають посади менеджерів лікувальних закладів, проводять науково-дослідницьку роботу з проблем медсестринства, здійснюють фахову педагогічну діяльність у вищих медичних навчальних закладах, де проводиться підготовка медсестер. Питання професійної підготовки медичних сестер розглядалися та досліджувалися різними науковцями. Зокрема, Шатило В.Й., Свиридюк В.З. та Яворський П.В. наголошували на важливості включення наукової складової у систему ступеневої сестринської освіти як важливого елементу процесу удосконалення професійної підготовки [1]. У свою чергу, Шегедин М.Б., Іванов В.А. та Алтинбекова З.Б. визначили, що елементи наукової діяльності є невід’ємною частиною практичної діяльності медичних сестер [2]. Марч М. наголошувала, що уміння організовувати та проводити наукові дослідження у медсестринстві сприяє підвищенню професійного рівня медичних сестер як на етапі підготовки, так і у практичній діяльності [1, 2]. Метою статті є визначення та аналіз основних підходів щодо організації наукових досліджень у медсестринстві та їхнього подальшого розвитку.

95


Галицький лікарський вісник, 2013, Т. 20, № 4

Методологічну основу дослідження становить системний аналіз перспективних проблем у медсестринстві, що потребують подальшого вирішення, обґрунтування основних методологічних та методичних принципів організації та реалізації досліджень в медсестринстві як на теоретичному, так і практичному рівнях. Результати дослідження представлені чіткою методологічною базою організації та проведення наукових досліджень з тематики актуальних проблем медсестринства, що включають як проблеми організації навчально-виховного процесу підготовки медичних сестер у ВМНЗ, так і отримання нових наукових даних, спрямованих на удосконалення профілактичних, лікувальних та реабілітаційних заходів, які відносяться до медсестринської компетенції. Обговорення Обґрунтування доцільності проведення наукових досліджень в медсестринстві: – Багатий досвід наукових досліджень в медсестринстві закордонних колег, де медсестринство інтенсивно розвивається з середини минулого століття; – Наявність численних недосліджених проблемних питань в медсестринстві України. Основні напрямки наукових досліджень для забезпечення сталого розвитку медсестринства: - наукові дослідження проблем медсестринської освіти; - дослідження теоретичних та організаційних основ медсестринства,; - розробка стандартів надання медсестринських послуг; - нормативно-правова база розвитку медсестринства; - медико-соціальні наслідки медсестринської діяльності; - шляхи підвищення якості діяльності медсестринських служб у системі охорони здоров’я. - обґрунтування діагностично-лікувальної та профілактичної допомоги, найбільш доцільних форм медсестринської діяльності, медсестринських втручань; - обґрунтування розмежування функцій медичної сестри залежно від рівня освіти, етапів надання медичної допомоги [3]. Тематику та напрями наукових досліджень в медсестринстві затверджено на Вченій раді інституту. Ці та інші питання потребують дослідження і наукового обґрунтування з подальшою імплементацією в медичну освіту і практику та підготовки нормативної бази подальшого розвитку медсестринства України. На даному етапі в Житомирському інституті медсестринства розроблено більше 70 тем і напрямків досліджень в медсестринстві, які проводяться з участю магістрів. Наше бачення на перспективу - значна питома вага цих досліджень буде виконуватись медсестрами з повною вищою освітою – Магістрами. Це покладає на нас відповідальність за підготовку медсестер-магістрів не тільки як професіоналів, але і як спеціалістів, здатних творчо мислити і володіти методами наукових досліджень. Основні принципи підготовки магістрів сестринської справи: - динамічний характер навчання, що забезпечується постійним корегуванням змісту освіти відповідно до досягнень світової і вітчизняної науки, практики організації медичної справи та потребами розвитку сфери охорони здоров’я України; - відкритість системи підготовки магістрів сестринської справи, що передбачає створення інноваційних навчальних програм, які реалізують передові інформаційні технології навчання; - поєднання теорії і практики на всіх рівнях підготовки магістрів сестринської справи. Впровадження багаторівневої медсестринської освіти з

96

акцентом на науково-дослідну роботу сприяє піднесенню та затвердженню сестринської справи як самостійної ланки в системі охорони здоров’я України. Умови успішної реалізації магістерської програми: - створено Вчену раду інституту; - створено дві кафедри: “Природничих та соціальногуманітарних дисциплін” та фахової підготовки “Сестринська справа”; - Вчена рада інституту затверджує наукових керівників магістерських робіт із числа провідних наукових кадрів; - затверджено Положення про магістратуру Житомирського інституту медсестринства; - затверджено Положення “Про порядок виконання і підготовки до захисту магістерських робіт”; - затверджено Положення “Про комісію з біоетики Житомирського інституту медсестринства”; - на завершальному етапі виконання магістерської роботи проводиться її рецензування двома науковцями зі спеціальності за напрямом досліджень. Магістерська робота – це самостійне наукове дослідження, виконане студентом, яке є завершальним етапом навчання. Магістерська робота є кваліфікаційною науковою працею, яка характеризується єдністю змісту і свідчить про можливість вирішення магістрантом конкретних наукових завдань. Основна мета виконання магістерської роботи та її захисту — показати й довести свою готовність як науковця та професіонала працювати на успіх розвитку медичної освіти і науки та удосконалення організаційних основ медсестринства в практичній охороні здоров’я. Важливо, щоб під час виконання наукового дослідження магістри дотримувались наступних вимог: - вивчення (або поглиблення) та узагальнення теоретикометодологічних засад з обраного напряму дослідження; - проведення всебічної діагностики ситуації із застосуванням сучасного методичного інструментарію; - розробка та оцінка альтернативних підходів до вирішення визначених проблем; - обґрунтування запропонованих рішень з використанням ситуаційного аналізу; - підготовка доповіді та наочних матеріалів, що передають основний зміст роботи та пропозиції автора, з подальшим їх публічним захистом [4]. Дотримання вказаних вимог забезпечують вірогідні науково-обґрунтовані результати дослідження. Етапи виконання магістерської роботи: І. Вибір, обґрунтування і захист теми дослідження на засіданні кафедри; ІІ. Затвердження наукових керівників; ІІІ. Виконання роботи; ІV. Апробація (з‘їзди, конгреси, НПК, публікації, тощо). V. Заслуховування ходу виконання на засіданні кафедри; VІ. Відгуки рецензентів; VІІ. Відгук наукового керівника; VІІІ. Рекомендація кафедри, Вченої ради до захисту; ІХ. Публічний захист перед державною екзаменаційною комісією. Основні методи та інструменти дослідження, які забезпечують високу якість і достовірність наукового дослідження: 1) бібліосемантичний; 2) системного аналізу; 3) клініко-статистичний; 4) факторного та кластерного аналізу; 5) експертних оцінок; 6) описового та комп’ютерного моделювання тощо. Даними методами дослідження оволодівають всі магістри і успішно самостійно використовують в ході виконання магістерської роботи. Також, значну допомогу в ході виконання дослідження надає науково-методична лабораторія.


Галицький лікарський вісник, 2013, Т. 20, № 4

Таблиця 1. Апробація результатів досліджень у медсестринстві на конгресах, науково-практичних конференціях за участю студентів-магістрів (2009-2012 рр.) Конгреси, науковоКількість практичні конференції доповідей м. Жезов (Польща) 3 25 м. Ломже (Польща) 2 29 м. Іглава (Чехія) 2 15 м. Тернопіль 4 32 м. Житомир 15 228

Впродовж 2009-2012 років магістри опублікували 262 наукові праці та презентували 329 матеріалів досліджень в медсестринстві на з’їздах, конгресах, симпозіумах, науковопрактичних конференціях та інших наукових форумах міжнародного, державного та регіонального рівнів, що свідчить про достатньо інтенсивну науково-пошукову і дослідну роботу (див. табл. 1). Свідоцтвом високого наукового рівня результатів досліджень магістрів є 22 дипломи І-ІІ ступенів, отриманих на НПК та Міжнародних конгресах студентів та молодих вчених. Висновки Основними науково-практичними результатами медсестринських досліджень стали: - отримання нових наукових даних в різних розділах медицини; - удосконалення профілактичних, лікувальних та реабілітаційних заходів, які відносяться до медсестринської компетенції; - запровадження інноваційних підходів до надання медсестринської допомоги, що сприятиме збереженню та поліпшенню здоров’я, покращенню догляду за пацієнтами різних вікових груп; - вдосконалення системи медичної освіти через формування професійно-педагогічної компетентності медсестервикладачів. Перспективи подальших досліджень у даному напрямку вбачаємо у обґрунтуванні спеціальності «Сестринська справа» як наукової спеціальності з можливістю захисту наукових ступенів; розширенні тематики досліджень у медсестринстві у відповідності до процесу реформування галузі охорони здоров’я і розширення функцій та компетенцій медичних сестер. Література 1. Шатило В.Й., Свиридюк В.З., Яворський П.В. Перспективні підходи до удосконалення підготовки медсестер в Україні // Вища освіта в медсестринстві: проблеми і перспективи. Зб. наук. праць – Житомир: – ТОВ 505, 2013. -328 с., С. 3-7. Shatylo V., Svyrydjuk V., Javorskyj P.V. The perspective approaches as for improving the nurses’ education in Ukraine // Higher education in Ukraine: problems and prospects. - ТОВ 505, 2013. -328 p., P. 3-7. 2. Шегедин М.Б., Іванов В.А., Алтинбекова З.Б. Стандарти медсестринської діяльності та медсестринський процес // Магістр медсестринства. – 2013. – №1(9). – С. 5-9 Shegedyn M.B., Ivanova V.A., Altynbekova Z.B. Nursing activity standards and nursing process // Master of Nursing. – 2013. – №1(9). – P. 5-9. 3. Махновська І.Р. Гордійчук С.В., Свиридюк В.В., Свиридюк О.В. Cтановлення та перспективи розвитку медсестринської освіти в України // Освітні технології. – 2012. - №71. – С.140-158. Machnovska I., Gordijchuk S, Svyrydjuk V., Svyrydjuk O. Stagnation

and prospects of nursing education development in Ukraine // New educational technologies. 2012, № 71, P.140-158. 4. Шатило В.Й., Жовнерчук В.Р., Свиридюк В.З. Організація роботи студентського наукового товариства Житомирського інституту медсестринства // Магістр медсестринства. – 2011. – №2(6). – С. 94-97. Shatylo V., Zhovnerchuk V., Svyrydjuk V., The work organization of students’ scientific society in Zhytomyr nursing institute // Master of Nursing. 2012, № 2(6), P.94-97. Шатило В.Й. Подходы к организации научных исследований в медсестринстве Житомирский институт медсестринства ztims@yandex.ru, shygonska@mail.ru Резюме. Целью статьи является выделение и анализ основных подходов относительно организации научных исследований в медсестринстве сквозь призму их целесообразности и дальнейшего определения основных методологических принципов, которые в свою очередь предусматривают системное решение актуальных проблем, связанных как с усовершенствованием форм и методов реализации научных исследований так и решением актуальных вопросов в практической деятельности медицинских сестер. Для решения поставленной задачи были использованы методы системного анализа и синтеза. Результаты исследования представлены четкой методологической базой организации и проведения научных исследований по тематике актуальных проблем в медсестринстве, которые включают в себя как проблемы организации учебно-воспитательного процесса подготовки медицинских сестер в ВУМЗ, так и получении новых научных данных, нацеленных на усовершенствование профилактических, лечебных и реабилитационных мероприятий, которые можно отнести к компетенции медицинских сестер. Выводы. Основными научно-практическими результатами исследований в медсестринстве стали: усовершенствование системы профессиональной подготовки медицинских сестер на всех этапах, а так же обоснование и внедрение инновационных подходов к оказанию медсестринской помощи в лечебно-профилактических учреждениях. Ключевые слова: медсестринское образование, научные исследования, магистр медсестринства. V.Y. Shatylo Approaches to the Organization of Scientific Researches in Nursing Zhytomyr Nursing Institute ztims@yandex.ru shygonska@mail.ru Summary. The purpose of the article is to find and analyze the main approaches to the organization of scientific researches in nursing in terms of their expediency and define the methodological principles, which in their turn help to solve the urgent problems regarding both the improvement of the forms and methods of carrying out the researches and dealing with urgent issues of the nurses’ practical activities. To fulfill our task we used the methods of system analyses and synthesis. The results of the research are presented in the accurate methodological database of providing the urgent researches in nursing that include the problems of organization of the educational process of nurses’ training in higher medical institutions and getting new scientific data aimed at improving the preventive, therapeutic and rehabilitation actions that belong to the nurse’s scope of practice. Conclusions. The main scientific and practical results of our research in nursing are: improving of the nurses’ professional training at all educational stages and implementation of innovative methods of providing the nurses’ service in the treatment and rehabilitation facilities. Key words: nursing education, scientific researches, Master of Nursing. Надійшла 25.11.2013 року.

97


Галицький лікарський вісник, 2013, Т. 20, № 4

ÎÐÃÀͲÇÀÖ²ß ÎÕÎÐÎÍÈ ÇÄÎÐÎÂ’ß УДК 616-082+61

Геник С.М. Проблеми в реорганізації медичної допомоги в Україні Кафедра загальної хірургії (зав. каф. - проф. Гудз І.М.) Івано-Франківського національного медичного університету Резюме: Подальше удосконалення і реформування охорони здоров’я – шлях до зміцнення здоров’я українців. Зміна і модифікація способу життя, зменшення негативного впливу факторів ризику, а також вирівнювання ліпідного обміну, без ліків, проводячи оздоровчі засоби від малюкового до похилого віку можна радикально зменшити захворюваність на хронічні неінфекційні захворювання. Ключові слова: захворюваність, здоров’я, оздоровчі заходи, здоровий спосіб життя, гіпертонія.

Сьогодні здоров’я населення розглядається як дуже важливий результат суспільного розвитку. Відношення до охорони здоров’я стрімко змінюється. Проблеми охорони здоров’я обговорюють ООН, Всесвітній банк та інші авторитетні організації, не кажучи про ВООЗ. В травні 2012 року на ювілейній 65-ій асамблеї ВООЗ головною проблемою сучасної охорони здоров’я розглядалася проблема серцевосудинних, злоякісних та ендокринних захворювань. На ній генеральний директор ВООЗ Маргарет Чен попередила людство про те, що якщо не буде змінена стратегія боротьби з цими захворюваннями, то в найближчий час світову систему охорони здоров’я чекає фінансова криза. Адже лікування і спасіння від смертельного наслідку цих недуг коштує дуже дорого, а суттєвого відновлення здоров’я очікувати не доводиться. Основний акцент в політиці «Здоров’я-2020», вказує м. Чен, повинен ґрунтуватися на перебудові стратегічного керівництва охорони здоров’я таким чином, щоб основна роль належила профілактиці цих видів патології. Політика «Здоров’я-2020» повинна пропонувати ясні варіанти дії, що сприятимуть вирішенню питань, пов’язаних із здоров’ям, на державному рівні. Значить удосконалювати охорону здоров’я і її реформувати – це шлях до зміцнення здоров’я українців. Теперішній напрям до удосконалення лікувально-діагностичного процесу не зробить радикального впливу на показники захворюваності і смертності, бо низький рівень здоров’я таблетками лікується дуже слабо. Парадоксом є той факт, що для вирішення проблеми збереження здоров’я населення фінанси витрачаються на найбільш непродуктивне з точки зори кінцевого результату направлення – на власне медицину. Згідно з даними експертів ВООЗ роль медицини у вирішенні проблеми збереження здоров’я населення дуже скромна – всього 8-10%, а спосіб життя – 50% і більше. І скільки б не вкладати в медицину грошей, реальних успіхів у стані здоров’я населення не варто очікувати, якщо основна увага не буде звернена на формування здорового способу життя. Це не значить, що не слід удосконалювати лікувально-діагностичні заходи і подавати допомогу страждущим. Це також потрібно. Але щоб зменшити кількість страждущих і менше проводити радикальні заходи в запущених станах треба зайнятися профілактикою. Надіятися на рекомендації країн Європейського співтовариства по боротьбі з хронічними неінфекційними захворюваннями і впроваджувати їх в нашій країні, це практично продовжувати ту саму лінію. Адже вони рекомендують більше половини державного фінансування виділяти на діагностичну апаратуру і ліки. Тобто лікувати вже хвору людину. У структурі смертності серцеві хвороби згідно зі статистикою займають майже 66%. Від гіпертонії – найпоширенішого захворювання системи кровообігу нині потерпають понад 12 мільйонів українців – фактично кожен четвертий. А підвищений артеріальний тиск, якщо його ігнорувати і не

98

вдаватися до профілактики і лікування, призводить до інфарктів та інсультів. Часто гіпертонію провокують куріння та неправильне харчування. Сьогодні українці їдять не якісні, збагачені різними добавками м’ясні і молочні продукти, а також забагато солі, а це одна із причин п