Page 1

Gentechnik Grundlagen, Anwendungen, Diskussion


Vorwort

Inhaltsverzeichnis

Waren Sie in letzter Zeit krank und mussten Sie Medikamente einnehmen? Tragen Sie Kleider aus Baumwolle? Waren Sie kürzlich auf Reisen, z.B. in Nordamerika? Haben Sie schon Blut gespendet? Essen Sie Mais- und Sojaerzeugnisse? Dann waren Sie vermutlich in direktem Kontakt mit der Gentechnik. Ständig kommen wir im täglichen Leben mit gentechnischen Produkten und Anwendungen in Berührung. Die Gentechnik hat sich in unserem Alltag auf vielfältige Weise etabliert – und doch wissen viele nicht, was Gentechnik eigentlich ist. Die Gentechnik hat sich in den letzten drei Jahrzehnten zum unverzichtbaren Forschungsinstrument entwickelt. Durch die intensive Arbeit vieler Forscherinnen und Forscher ist es gelungen, das menschliche Genom zu entschlüsseln. Nun versuchen die Wissenschaftlerinnen und Wissenschaftler das Zusammenspiel der Gene in unseren Zellen zu verstehen. Die Fragen, wie die Gene die Entwicklung eines Lebewesens steuern, wie fehlerhafte Vorgänge zu Krankheiten führen und wie diesen vorgebeugt werden kann, sind faszinierend. Die Erforschung dieser komplexen Zusammenhänge geschieht heute im Verbund zahlreicher Disziplinen: Biologie, Medizin, Physik, Chemie, Mathematik und Informatik. Die Entwicklungen in der Forschung und die daraus resultierenden neuen Anwendungen führen zu ethischen und rechtlichen Fragestellungen. Gesellschaft und Gesetzgeber sind gemeinsam gefordert, sich mit den Möglichkeiten der Gentechnik auseinanderzusetzen und die anstehenden Fragen zu klären. Ausgehend von der Erfahrung, dass Missbräuchen der Gentechnik mit griffigen Gesetzen begegnet werden kann, betreibt die Schweiz Spitzenforschung und setzt gentechnische Methoden in der Medizin und in der Produktion von Alltagsgütern ein.

Grundlagen 1 Forschung

Erforschen Sie selber, was Gentechnik ist. Wir wünschen Ihnen viel Vergnügen.

Prof. Dr. Peter Gehr, Präsident

Kurt Bodenmüller, Geschäftsführer

2/3 4 /5

1.1

Wie Gentechnik funktioniert

6/7

1.2

Genomik

8/9

1.3

Transkriptomik

1.4

Proteomik

1.5

Stammzellforschung

12 / 13

1.6

Transgene Tiere

14 / 15

1.7

Nanobiotechnologie

2.1

10 / 11 12

15 16 / 17

2 Medizin Medikamente

18 / 19 19

2.2

Forschung am Menschen

2.3

Gentherapie

20 / 21

2.4

Impfstoffe und Antikörper

22 / 23

2.5

Nachweisverfahren

23

2.6

Vererbung

24

2.7

Gentests

2.8

Fortpflanzungsmedizin

2.9

Gerichtsmedizin

3 Landwirtschaft und Ernährung 3.1

Pflanzenzüchtung

3.2

Vom Labor aufs Feld

3.3

Globale Situation

25 26 / 27 27 28 / 29 30 31 32 / 33 34

3.4

Lebensmittel

3.5

Ein GV-Produkt für die Schweiz

35

3.6

Bewilligung, Deklaration, Grenzwerte

36

3.7

Neue Produkte am Horizont

37

4 Weisse Biotechnologie und Umweltschutz

Parallel zur Evolution der Gentechnik und ihrer Diskussion hat sich auch die Gentechnik-Broschüre der Stiftung Gen Suisse entwickelt. Die vorliegende dritte Auflage vermittelt das Thema Gentechnik mit Fotos und Erlebnisberichten ansprechend und ist dank detaillierten Infografiken und umfassenden Erklärungstexten auch wissenschaftlich anspruchsvoll. Die Darstellung der Gentechnik und ihrer Anwendungen aus verschiedenen Blickwinkeln ermöglicht eine vertiefte Auseinandersetzung mit der Thematik. Nicht zuletzt regen Abschnitte zu Fragen der Ethik und der Sicherheit zum Nachdenken und Diskutieren an. Unverändert blieb das Ziel der Broschüre: Gentechnik zu erklären, damit sich die Leserinnen und Leser selber ein Bild über Anwendungen und Argumente, Möglichkeiten und Grenzen machen können.

Seite

38 / 39

4.1

Biokatalyse

39

4.2

Biosynthese

40

4.3

Bioindikatoren

40

4.4

Biologische Sanierung

41

4.5

Biokraftstoffe

41

5 Gesetzgebung

42 / 43 43

5.1

Schweizerische Bundesverfassung

5.2

Internationale Abkommen

43

5.3

Gesetze im Humanbereich

44

5.4

Gesetze im Ausserhumanbereich

45

6 Glossar

46 – 48


Grundlagen

Jedes Lebewesen besteht aus Zellen Lebewesen sehen sehr unterschiedlich aus. Ob Bakterium, Sonnenblume, Katze oder Mensch – alle Lebewesen sind aus Zellen aufgebaut. Einzeller wie Bakterien bestehen aus einer einzigen Zelle. Pflanzen, Tiere und Menschen sind Vielzeller. Der menschliche Körper besteht aus Organen wie Herz und Leber. Und die Organe bestehen aus Geweben, die sich aus Zellen zusammensetzen. Neben Wasser bestehen Zellen zum grössten Teil aus Eiweissen, auch Proteine genannt. Es gibt sehr viele Arten von Proteinen. Sie erfüllen in den Zellen und damit letztlich im Körper viele lebenswichtige Aufgaben.

Pflanzenzelle

Nervenzelle

Muskelzelle

Bakterium

A

G

C

T

G

A

C

U 7. Protein-Herstellung nach Bedarf Die Gene in jeder Zelle werden nach Bedarf abgeschrieben. Sie steuern die Produktion der Eiweisse, welche die Zelle braucht, um zu wachsen und ihre Aufgaben im Körper zu erfüllen. Jede Zelle enthält das gesamte Genom. In einer Zelle der Haut werden andere Gene abgeschrieben als in einer Darmzelle. Nervenzellen beispielsweise schreiben ein Gen für ein Protein ab, das als Signalmolekül aus der Zelle geschickt wird. Und in den Muskelzellen werden gemäss dem genetischen Bauplan Motorproteine hergestellt, damit die Zellen in Bewegung bleiben.

A

C

Protein

Translation

6. Vom Gen zum Protein Zellen besitzen die Fähigkeit, Gene abzuschreiben in einen der DNA verwandten Stoff namens RNA. Dieser Vorgang heisst Transkription und geschieht im Zellkern. Die abgeschrieRNA benen Genkopien aus RNA wandern aus dem Zellkern in den Zellleib. Die meisten RNA-Moleküle dienen dort als Anleitung für den Bau von Proteinen. Dieser Vorgang nennt sich Translation.

T

G


2 /3 1. Die Gene befinden sich im Zellkern Eine einzelne Zelle ist zu klein, um sie von blossem Auge zu sehen. Sie wird erst unter dem Mikroskop sichtbar. Je nach Aufgabe der Zelle variiert auch ihr Aussehen. Eine Nervenzelle, die darauf spezialisiert ist, Signale zu empfangen und weiterzuleiten, ist stark verästelt. Eine Muskelzelle hingegen ist länglich und hat die Fähigkeit, sich zusammenzuziehen. Eines aber haben alle Zellen der Vielzeller gemeinsam: In ihrem Innern enthalten sie einen Zellkern mit den Genen. Bakterien hingegen haben keinen Zellkern. Ihre Gene liegen aufgeknäuelt im Zellleib.

3. Alle Chromosomen zusammen bilden das Genom Aus Platzgründen ist die DNA stark aufgeknäuelt. Bevor sich eine Zelle teilt, entwirrt sich das Knäuel. Dabei entstehen X-förmige Gebilde, die man Chromosomen nennt. Nicht alle Lebewesen besitzen in ihrem Zellkern gleich viele Chromosomen. Ein Mensch hat in jeder Zelle 46 Chromosomen, eine Katze 38 und ein Blumenkohl 18.

Zellleib menschliches Genom Zellkern

2. Chromosomen bestehen aus DNA Der Zellkern enthält das Erbmaterial. Erstaunlicherweise besteht das Erbmaterial Chromosom bei allen Lebewesen aus dem gleichen Stoff, der DNS. Dies ist die Abkürzung für Desoxyribonukleinsäure. Häufiger liest man DNA, was der englischen Abkürzung entspricht (A für acid = Säure). Der winzige Zellkern in jeder menschlichen Zelle enthält einen DNA-Faden von rund zwei Metern Länge.

Gen DNA

4. Ein Gen ist ein DNA-Abschnitt Die DNA ist ein fadenförmiges Molekül und besteht aus vier verschiedenen Bausteinen: den Basen Adenin, Cytosin, Guanin und Thymin, abgekürzt mit den Buchstaben A, C, G und T. Ein Gen ist ein Abschnitt auf diesem DNA-Faden. Ein menschliches Gen ist 500 bis viele Tausend Basen lang. Die Basen bilden also ein sehr langes «Wort». Schreibt man den Code eines Gens auf, so ergibt dies beispielsweise ATGAAGTTTCAGCGTCCATGG etc. Der Mensch hat in jeder Zelle etwa 25 000 Gene.

Gen

Gen

G T T

Transkription

A A C

A

G

T

A C

G T

C

A C

T C

T G

A

G

5. Die DNA ist ein Doppelstrang Die DNA kann man sich vorstellen wie eine lange Leiter, die spiralförmig gewunden ist. Die Leitertritte bestehen aus Basenpaaren. Jeweils A und T passen zusammen, sie können sich aneinanderhängen und einen Leitertritt bilden, ebenso G und C. Diese Basenpaarung ist einerseits grundlegend für den Zusammenhalt der beiden DNA-Stränge, andererseits für das Abschreiben von DNA – dem ersten Schritt im Prozess der Proteinherstellung.


1 Forschung


4 /5

Angetrieben durch die menschliche Neugier, will die Grundlagenforschung verstehen, wie die Lebewesen und unsere Natur funktionieren. Es geht darum, wissenschaftliche Theorien aufzustellen, diese experimentell zu überprüfen und innerhalb der Wissenschaft zu diskutieren. Was dies in der Gentechnik heisst, haben neun Schüler und Schülerinnen praxisnah erlebt. Sie besuchten Forschungslabors an der Universität und diskutierten mit Forscherinnen und Forschern. Im Labor wird mehrheitlich nach Grundlagen geforscht. Einer der Wissenschaftler erklärt genauer: «Wir untersuchen hier Proteine, die eine Rolle bei der Blutgerinnung spielen.» Eine Schülerin gruselt sich, als er den Wärmeschrank öffnet – sie kann kein Blut sehen. Doch der Forscher holt flache Gefässe heraus, die helles Gelee enthalten. Als er die Deckel öffnet, erkennt man Punkte auf dem Gelee. «Sind das die Eiweisse?», wirft Marcel in die Runde. «Nur indirekt. Proteine sind zu klein, um sie von blossem Auge zu sehen. Die Punkte bestehen aus Hefezellen. In diese Zellen haben wir Gene der Blutgerinnungseiweisse eingebaut.» Natürlich habe Hefe keinen Blutkreislauf, betont der Biologe. Aber es sei faszinierend, wie gut die Einzeller die neuen Gene ablesen und die Proteine herstellen würden. «Hefezellen sind einfach super», so der Wissenschaftler, «mit diesen kleinen Helfern kann ich viele Details herausfinden. Das hilft, Herz-Kreislauf-Krankheiten besser zu verstehen.» «Kommt alle her. Ich zeige euch etwas Aussergewöhnliches!», bemerkt eine Forscherin an der Tür. Sie führt die Schülerinnen und Schüler in eine andere Abteilung: «Hier ist unser kleiner Zoo. Im Moment beherbergen wir nur Mäuse, und die meisten sind erst noch k.o.» «Wie geht denn das? Schicken Sie die Tiere in den Boxring?», fragt einer der Schüler grinsend. «Nein, natürlich nicht», erwidert die Wissenschaftlerin, «Knock-out-Mäuse sind Tiere, in denen ein Gen ausgeschaltet wurde. Fehlt das Gen, wird auch das entsprechende Protein nicht mehr hergestellt. Ist z.B. plötzlich das Fell des Tieres nicht mehr braun, weiss man, dass das ausgeschaltete Gen für die Fellfarbe verantwortlich ist.» Die Forscherin schiebt ein Gefäss unters Mikroskop. In der Vergrösserung werden winzige Zellbällchen sichtbar. «Dies sind junge Mäuseembryonen», schildert die Biologin, während sie einen der Embryonen vorsichtig festhält. Mit einer feinen Kanüle bringt sie eine einzelne Zelle an den Embryo heran. Die Jugendlichen halten den Atem an. «Jetzt fügen wir die Zelle in den Embryo ein», kommentiert sie. «In der Zelle ist das Gen für ein bestimmtes Protein ‹k.o.›, also ausgeschaltet.» Ein Laborant bringt eine Maus. Das Tier hat ein Betäubungsmittel erhalten und schläft. Die Wissenschaftlerin legt es sorgfältig auf den Tisch. «Die Tischplatte ist warm, damit der kleine Körper nicht auskühlt», erklärt sie und macht der Maus einen Schnitt ins Fell. Die Maus soll Mutter der soeben gentechnisch veränderten Mäusebabys werden. Nach kurzer Zeit sind die Embryonen in die

Gebärmutter übertragen. «Die Maus ist jetzt schwanger», erklärt sie. «Einige der Jungen werden das veränderte Gen so eingebaut haben, dass das Protein, das wir untersuchen, nicht gebildet wird. So kann an den Tieren die Ursache und Behandlung von Krankheiten erforscht werden.» Die Jugendlichen recken die Hälse, schauen und nicken. Einige fasziniert, andere etwas skeptisch. Am Nachmittag besuchen die Schüler und Schülerinnen ein Gewächshaus voller Tomatenpflanzen. «Wenn ihr euch die Tomaten genau anschaut, seht ihr angefaulte Stellen», erklärt ein Forscher. «Dies ist der Pilz Botrytis cinerea, der auch Erdbeeren befällt.» Sein Forschungsteam prüft, welche Tomatensorten vom Pilz besonders stark oder kaum befallen werden. «Unser Ziel ist es, herauszufinden, worin sich diese Sorten unterscheiden. Welche Gene sind nötig, damit sich die Pflanze gegen den Pilzbefall wehren kann? Könnte man diese Gene in anfällige Sorten einbauen?» Auf dem Heimweg tauschen sich die Jugendlichen aus. «Scheint komplex zu sein, diese Gentechnik», meint eine der Jugendlichen. «Nicht ganz überzeugend», findet eine andere. «Ich müsste mehr darüber wissen, um zu entscheiden, was ich toll finde an der Gentechnik und was nicht.» Sonja nickt. «Ich hätte nie gedacht, dass die Grundlagenforschung an so vielen Orten Gentechnik einsetzt», gibt sie zu bedenken. «Und, dass das Zeug so klein ist», lacht Marcel. «Gut, sind Wissenschaftler auf die Idee gekommen, Gene in Hefezellen oder Mäusen zu untersuchen.»


1.1 Wie Gentechnik funktioniert In der Pause zieht Sonja ihren Pen aus der Tasche. Das ist eine handliche Spritze. Die Mitschülerinnen und Mitschüler sind daran gewöhnt, keiner guckt komisch. Sonja ist zuckerkrank. Um gesund leben zu können, spritzt sie sich mehrmals täglich Insulin. Früher wurde das Insulin aus Tieren gewonnen. Sonja aber verwendet menschliches Insulin, sogenanntes Human-Insulin. Doch woher kammt das? Muss ihre Familie regelmässig Insulin spenden? Nein, das geht zum Glück viel einfacher: Insulin wird im Labor gewonnen. Menschliches Insulin aus Bakterien Mit Hilfe der Gentechnik kann ein Bakterium dazu gebracht werden, ein Medikament herzustellen, zum Beispiel Insulin. Insulin ist ein Hormon, das in der Bauchspeicheldrüse jedes gesunden Menschen gebildet wird. Es ist dafür verantwortlich, dass das Blut nicht zu viel Zucker enthält. Manche Menschen produzieren zu wenig Insulin und haben daher Schwierigkeiten, ihren Blutzuckerhaushalt zu regulieren. Man spricht von Zuckerkrankheit oder Diabetes. So funktioniert die Insulin-Produktion Die Herstellung von menschlichem Insulin erfolgt im Labor. In grossen Behältern werden Bakterien gezüchtet, in deren Erbgut das menschliche Insulin-Gen eingebaut wurde. Die Einzeller lesen das Gen ab und produzieren das entsprechende Protein. Die Bakterien stellen also anhand des menschlichen Gens menschliches Insulin her. Dieses wird anschliessend aus der Bakterienkultur herausgetrennt, gereinigt und als Medika-

ment mit Hilfe eines Pens gespritzt. Da sich Bakterien rasch vermehren, kann gentechnisches Insulin problemlos in ausreichenden Mengen hergestellt werden.

4. Human-Insulin aus Bakterien Das Bakterium wächst und teilt sich. Dabei liest es die Gene ab und produziert die entsprechenden Proteine – darunter auch das menschliche Insulin. Dieses ist identisch mit dem Insulin, das gesunde Menschen in den Zellen ihrer Bauchspeicheldrüse herstellen. Es eignet sich daher zur Behandlung von zuckerkranken Personen.


Bakterium

6 /7 Plasmid

2. Der DNA-Ring-Trick Ein Teil der Gene von Bakterien befindet sich auf Plasmiden. Diese kleinen ringförmigen DNA-Stücke sind ideale Werkzeuge, um Gene in Bakterien einzuschleusen. Dazu werden die Plasmide aufgeschnitten. Man verwendet natürlich vorkommende Enzyme, die sogenannten Restriktionsenzyme. Diese arbeiten wie Scheren, die den DNARing an einer bestimmten Stelle aufschneiden.

1. Ein Gen wird isoliert Menschliche Zellen können beispielsweise leicht aus der Mundschleimhaut entnommen werden. Im Labor wird die DNA der Zelle aufbereitet. Auf dem langen DNA-Faden wird das Gen mit der Information zur Herstellung des Insulin-Proteins aufgespürt und herausgeschnitten. Das Gen wird anschliessend von der übrigen DNA getrennt und ins Erbgut des Bakteriums eingefügt.

aufschneiden (mittels Restriktionsenzym)

Insulin-Gen

heraustrennen (mittels Restriktionsenzym)

menschliche Zelle

Zellkern

einkleben (mit Hilfe des Enzyms Ligase) menschliche DNA

3. Verändertes Erbgut Die Restriktionsenzyme hinterlassen beim Durchtrennen der DNA ein charakteristisches Muster. So passt das ausgeschnittene Insulin-Gen wie ein Puzzlestück in die Lücke im Plasmid. Mit dem Enzym Ligase wird das Gen mit dem Plasmid zusammengeschweisst. Das neu kombinierte Plasmid wird anschliessend zurück ins Bakterium gebracht. Das humane Insulin-Gen ist nun Teil des bakteriellen Erbgutes.

Bakterien vermehren

Insulin aufreinigen

Insulin

Herstellung transgener Lebewesen: Durch den Einbau des menschlichen Insulin-Gens in die Bakterien werden diese gentechnisch verändert. Sie sind «transgen». Transgene Einzeller, Pflanzen oder Tiere lesen die Information des zusätzlichen Gens ab wie ihre eigene. Dies ist möglich, da die Erbsubstanz aller Lebewesen aus DNA besteht. Gemäss der Information des zusätzlichen Gens stellen sie neben den eigenen Proteinen ein zusätzliches Eiweiss her: beispielsweise eines, das natürlicherweise nur in einer seltenen exotischen Pflanze vorkommt. Oder ein Protein, das als Impfstoff eingesetzt wird. Transgene Lebewesen verfügen dank dem zusätzlichen Gen über eine neue Eigenschaft.


1.2 Genomik «Sag mal, wie viele Gene hat ein Mensch?» Marcel schaut erstaunt auf. «Phu!», meint er, «keine Ahnung. Wohl ziemlich viele. Ich frag mich nur, wie die alle Platz haben im Zellkern? Der ist doch winzig.» Imad nickt: «Ich glaube, Gene sind auch extrem klein. Sie bestehen nur aus Molekülen oder so.» Nach kurzem Überlegen meint Marcel: «Stimmt, sie setzen sich aus diesen vier Basen GACT zusammen. Klingt wie ein cooles ‹tag›. Ich glaube, wir haben Milliarden davon in jeder Zelle.» Imad ist überrascht: «Wahnsinn! Und wie viele Gene gibt das?» Die grosse Überraschung Der menschliche Körper ist äusserst komplex aufgebaut. Alle Knochen, Nervenbahnen und Organe sind gut untersucht. Die molekulare Ebene jedoch birgt noch viele Geheimnisse. Jede Zelle enthält eine riesige Zahl verschiedener Proteine, die alle gemäss den Bauplänen in den Genen hergestellt werden. Die Untersuchung der DNA beantwortet daher viele spannende Fragen: Wie funktionieren diese Baupläne? Und wie viele Gene hat der Mensch? Mit diesen Fragen beschäftigt sich das Forschungsgebiet der Genomik. Im Jahr 1990 wurde das Human Genom Project gestartet mit dem Ziel, die drei Milliarden Basenpaare der menschlichen Erbsubstanz zu analysieren. Die Forschenden rechneten mit mindestens 25 Jahren Arbeit. Dank Computertechnologie, Automatisierung und besseren Labormethoden lag der Code des menschlichen Genoms bereits im April 2003 vor. Die gesamte Abfolge der Buchstaben A, T, G, C der menschlichen DNA war entschlüsselt. Entdeckt wurden 25 000 proteincodierende Gene. Das humane Genom hat viel weniger Gene als vermutet – kaum mehr als Fadenwürmer besitzen. Dies war eine grosse Überraschung.

Wie man Gene entschlüsselt Gene sind so klein, dass sie nicht einmal unter dem Mikroskop sichtbar sind. Um Gene zu untersuchen, müssen sie aus der Zelle herausgeholt und vervielfältigt werden. Dazu wird die DNA so lange kopiert, bis sie aufgrund der grossen Menge sichtbar wird. Dies geschieht mit Hilfe des Enzyms Polymerase, das Gensequenzen in hohem Tempo kopieren kann. Man nennt diese Technik Polymerase Chain Reaction (PCR). Doch wie kann nun die Buchstabenfolge der DNA im Labor abgelesen werden? Was der Zelle ganz leicht gelingt, war für die Forschung eine Knacknuss: Schliesslich sind die Moleküle A, G, C und T nicht sichtbar. Für die Entschlüsselung der Buchstabenfolge wird die Technik der Sequenzierung eingesetzt, die das Problem auf einem klugen Umweg löst (siehe Grafik).

trennen

auffüllen

trennen

auffüllen

trennen

auffüllen

2. PCR-Technik: exponentiell vermehren Um eine PCR durchzuführen, werden die DNA-Bausteine A, C, T, G sowie Polymerase-Enzyme und DNA-Stücke in kleine Plastikbehälter gegeben. Dieses Gemisch wird im PCRDNA-Stück Apparat zuerst erhitzt. Dabei zerfällt die DNA in Einzelstränge. Dann wird diese Mischung abgekühlt auf eine Temperatur, bei der die Polymerase besonders gut arbeitet: Dieses Enzym ergänzt die Einzelstränge auf der Grundlage DNA-Bausteine C, A, T, G der Basenpaarung zu neuen Doppelsträngen. Ein DNA-Stück wird so mit jedem Durchgang verdoppelt. 15 Durchgänge ergeben über 30 000 identische DNA-Stücke. trennen

1. Vorbereitung: DNA-Stücke isolieren Bevor die DNA in den PCR-Apparat kommt, wird sie mit Hilfe natürlicher DNA-Scheren, der Restriktionsenzyme, in kurze Abschnitte getrennt.

DNA-Stück

Polymerase


8 /9

Stop-G

+ Stopp-G

3. Sequenzierung: DNA-Fragmente mit bekannter Endung Die Reihenfolge der einzelnen DNA-Bausteine in einem Gen lässt sich durch die Kettenabbruch-Methode bestimmen. Für die PCR werden von einer Bausteinsorte zusätzlich «Stopper» beigemischt, beispielsweise Stopp-G. Baut die Polymerase nun zufällig statt eines normalen G ein Stopp-G ein, bricht der Kopiervorgang ab. Nach der PCR liegen vom zu untersuchenden DNA-Stück viele Kopien unterschiedlicher Länge vor, die alle mit einem Stopp-G enden.

Und noch viel mehr Arbeit ... Neben dem genetischen Code des Menschen sind auch die Genome einzelner Tier- und Pflanzenarten entschlüsselt. Man kennt beispielsweise den Gencode der Maus oder jenen der Malariamücke. Allerdings unterscheidet sich der genetische Code der Individuen innerhalb einer Art auch leicht voneinander. Konkret bedeutet dies, dass im gesamten DNA-Strang einzelne Basenpaare von Individuum zu Individuum variieren. Das Genom jedes Menschen ist einzigartig, so individuell wie dessen Fingerabdruck. Heute wissen die Forschenden, dass mit der Sequenzierung des menschlichen Genoms die Arbeit nicht erledigt ist. Im Gegenteil: Sie hat erst richtig begonnen. Es gilt, zu untersuchen, wie sich die genetischen Codes verschiedener Menschen unterscheiden und was dies bedeutet. Er muss erforscht werden, wie das Genom organisiert ist, wie Schäden an den Genen entstehen und wie diese von der Zelle repariert werden.

4. Elektrophorese: Sortieren nach Grösse Die erhaltenen Teilstücke sind viel zu klein, um sie direkt untereinander zu vergleichen. Sie werden vom Gentechniker oder der Gentechnikerin in ein Gel gespritzt, durch das Strom fliesst. DNA-Stücke sind negativ geladen und wandern deshalb Richtung Pluspol. Dabei kommen die kurzen DNA-Stücke weiter als die langen, da diese mehr im Gel stecken bleiben. Nach der PCR liegt jedes Teilstück tausendfach vor. Da gleich lange Stücke im Gel gleich weit wandern, kann man im Gel Banden erkennen. Jede Bande steht für ein Teilstück, das mit G endet. Liegen zwei Banden direkt beieinander, sind auch im Gen zwei G direkt nebeneinander. Sind die Banden weiter auseinander, befinden sich entsprechend viele andere Buchstaben dazwischen. Durch die Wiederholung des Vorgangs mit Stopp-A, Stopp-C und Stopp-T kann die ganze Gensequenz bestimmt werden.


1.3 Transkriptomik Damit zu einem Gen das entsprechende Protein hergestellt werden kann, wird es zuerst in einen Stoff namens RNA abgeschrieben. Dazu hat die Zelle spezielle Werkzeuge. Dieser Prozess heisst Transkription und wird vom Enzym Polymerase durchgeführt. Damit die Polymerase ein Gen auf dem zwei Meter langen DNA-Strang findet, beginnt jedes Gen mit einer StartSequenz und endet mit einer Stopp-Sequenz. Die RNA-Welt: komplex, dynamisch ... Der Begriff Transkriptom bezeichnet alle RNAs in einer Zelle. Im Gegensatz zum Genom ist das Transkriptom vielfältig und dynamisch: Während jede Zelle des Körpers das gleiche Genom besitzt, ist das Transkriptom einer Leber- oder einer Hirnzelle total verschieden. In den beiden Zelltypen sind unterschiedliche Gene angeschaltet. Die in der Zelle vorliegenden RNAs variieren somit stark. Doch damit nicht genug: Die RNA-Welt ist noch komplexer. Während es beim Genom nur eine Sorte DNA gibt, wird die RNA in verschiedene Typen eingeteilt. Die GenKopie wird als mRNA bezeichnet. «m» steht für «messenger», was Bote bedeutet. Wie ein Kurier eilt sie aus dem Zellkern hinaus und dient in der Eiweissfabrik als Bauanleitung für das Protein. Doch es gibt auch RNA-Sorten, die nie zu Proteinen umgeschrieben werden. Zu diesen RNAs gehören die ribosomalen RNAs (rRNA) und die transfer RNAs (tRNA). ... und unentbehrlich Die Forschung entdeckt immer mehr RNA-Sorten. Beispielsweise siRNAs oder snRNAs. Die snRNAs heissen mit vollem Namen small nuclear RNAs. Wie ihr Name sagt, sind sie ziemlich klein und im Innern des Zellkerns angesiedelt. Die Abkürzung siRNA steht für small interfering RNA. Diese RNAs können unter bestimmten Umständen die Zerstörung von mRNA veranlassen. Die Erforschung der Welt der RNA steht erst in ihren Anfängen. Es ist heute noch unklar, wie die Zelle sicherstellt, dass jederzeit die richtigen RNAs am richtigen Ort und in der richtigen Menge ihre anstehenden Aufgaben erfüllen. Diese Regulationsmechanismen besser zu verstehen, ist eine Herausforderung für die Forschenden.

3. Hilfsgefährten der mRNA – snRNA Die snRNAs helfen den mRNAs bei der Reifung. Denn mRNAs sind nur zu Beginn gleich lang wie die abgeschriebenen Gene. Durch den Prozess des Spleissens werden sie verändert: Unbenötigte Abschnitte werden herausgeschnitten. Die snRNAs bilden dazu Strukturen, welche die mRNA an der richtigen Stelle festhalten und schneiden. Da unterschiedliche Abschnitte herausgeschnitten werden können, gibt es ausgehend von einem Gen mehrere verschiedene, reife mRNAs. snRNAKomplex

Spleissen

2. Gene verstummen lassen – siRNA Die siRNAs üben eine Kontrollfunktion aus und fangen bestimmte mRNAs ab. Sie gehen mit passenden Abschnitten auf der mRNA Basenpaarungen ein. Dadurch wird die mRNA blockiert und schliesslich abgebaut. Dieser Mechanismus heisst RNA-Interferenz. siRNAs können also Gene verstummen lassen.

mRNA

Zelle Startsequenz

RNA

Schlusssequenz

Polymerase

siRNA

1. Die Kuriere – mRNA Jede lebende Zelle liest fortlaufend Gene ab und schreibt sie zu mRNA um. Dieser Vorgang der Transkription geschieht im Zellkern. Im Gegensatz zur zwei Meter langen DNA sind die mRNA-Moleküle nur so lang wie ein einzelnes Gen. Von einem benötigten Gen werden viele mRNA-Kopien hergestellt, die zur Eiweissfabrik, dem Ribosom, wandern.

Transkription

DNA

snRNA


10 / 11 4. Bausteine der Eiweissfabrik – rRNA rRNAs sind Teile der Proteinfabriken, der sogenannten Ribosome. Alle rRNA Lebewesen haben Gene für rRNAMoleküle. Diese werden immer wieder abgeschrieben, damit die Zelle genügend Bauteile für den Aufbau neuer Ribosom (Eiweissfabrik) Proteinfabriken hat.

Protein Translation Lysin

A AG

Alanin Aminosäure

GCU

tRNA 5. Die AminosäureSchlepper – tRNA Die tRNAs sind eine besonAnticodon ders raffinierte Sorte RNA. Sie sind am einen Ende so gestaltet, dass drei RNA-Bausteine herausragen. Man nennt sie Anticodon. Es gibt tRNAs mit allen möglichen Dreier-Variationen, z.B. AAG oder GCU. Die RNA-Base «U» entspricht dem Baustein «T» in der DNA. Dank ihrer Struktur können tRNAs an ihrem anderen Ende eine Aminosäure festhalten. Es gibt 20 verschiedene Aminosäuren. Sie sind die Elemente, aus denen alle Proteine aufgebaut sind. Jedes tRNA-Molekül angelt sich die Aminosäure, die zu seinem Dreiercode gehört, bei AAG ist das Lysin und bei GCU Alanin. Nun folgt der entscheidende Kniff: Ein Anticodon kann sich an drei passende Basen auf der mRNA binden, AAG dockt also an ein TTC auf der mRNA an. So kann die Botschaft auf der mRNA Stück für Stück in die richtige Aminosäuren-Reihenfolge übersetzt werden. Im Ribosom werden die Aminosäuren miteinander verknüpft. Die entstehende Kette faltet sich zum fertigen Protein.

«Schon seltsam, wir haben gleich viele Gene wie eine Maus.» Imad schaut seinen Kollegen prüfend an. Marcel nickt: «Ja, das ist überraschend. Aber mich fasziniert was mit den abgelesenen Genen alles passiert: zerschnippelt und neu geklebt unterwegs zur Eiweissfabrik. Oder einfach abgefangen und vernichtet! Super, dass in unseren Zellen alles funktioniert!» Imad richtet sich auf. «Hey, zum Glück stellen meine Zellen die richtigen Proteine her. Sonst würde der Blutzuckerspiegel aus dem Ruder laufen. Oder stell dir vor: Trotz vollem Training würden wir keine neuen Muskeln aufbauen!»

DNA-Chip: Zur Untersuchung des Transkriptoms wird auf die DNAChip-Technologie zurückgegriffen (auch Microarray genannt). Auf einem kleinen Glasplättchen ist jedes Gen als einzelsträngiges DNA-Stück vertreten. Nun wird eine Flüssigkeit – z.B. aus Lebergewebe – über das Plättchen gegossen. Diese enthält sämtliche mRNAs der Leberzelle. Sogleich paaren sich die Leber-mRNAs mit den zugehörigen Genen. Die Gene auf dem Chip, die frei bleiben, wurden in den Leberzellen zum Zeitpunkt ihrer Entnahme nicht zu mRNA transkribiert. Auf dem Chip erscheinen sie schwarz. Spannend ist der Vergleich der aktiven Gene bei der Verabreichung eines Medikaments. Vor und nach Einnahme der Arznei wird ein Chip erstellt und im Computer verglichen. Die Gene, die schon vor der Einnahme des Medikamentes zu mRNA transkribiert wurden, sind rot markiert, neu aktivierte Gene erscheinen grün, und vorher wie nachher aktive Gene leuchten in Gelb.


1.4 Proteomik Mehr als die Hälfte des Trockengewichts einer Zelle sind Proteine. Eiweisse sind nicht nur die Stoffe, aus denen die Zellen zum grössten Teil aufgebaut sind. Sie sind auch für fast alle lebenswichtigen Funktionen im Körper zuständig. Ihre Vielfalt ist eindrücklich: Strukturproteine wie Kollagen sind seilartig aufgebaut und verleihen unseren Knochen und Sehnen Festigkeit. Transportproteine haben eine kugelige Form. Das Protein Hämoglobin beispielsweise bindet den Sauerstoff, den wir über die Lunge einatmen, und transportiert ihn im Blut. In Form von Antikörpern schützen Proteine den Körper gegen Krankheiten, und als verformbare Elemente ermöglichen sie Muskelbewegungen. Wieder andere Proteine übermitteln Botschaften oder beschleunigen als Enzyme chemische Reaktionen. Welche Proteine in einer Zelle aktiv sind, hängt hauptsächlich davon ab, welche Gene abgelesen werden. Neben der Genexpression Modell des Strukturproteins Kollagen

beeinflussen aber auch das Vorliegen bestimmter Wirkstoffe und der Proteinabbau die Zusammensetzung des Proteoms, d.h. der Gesamtheit aller Proteine einer Zelle, eines Gewebes oder eines Lebewesens. Da anhand eines Gens mehrere verschiedene Eiweisse hergestellt werden können, übertrifft die Komplexität des Proteoms jene des Genoms bei weitem. Ausgehend von ca. 25 000 Genen schätzt man, dass der Mensch 100 000 bis 500 000 Proteine besitzt. Durch Anhängen oder Abspalten von Phosphatgruppen kann ein Protein sehr schnell von einer aktiven in eine passive Form versetzt werden. Das Forschungsgebiet der Proteomik gewinnt zunehmend an Bedeutung. Proteine sind für das gesunde Funktionieren unseres Körpers entscheidend. Ihre Entstehung und Funktionsweise zu kennen, liefert die Grundlage, um Krankheiten zu verstehen.

Modell des Bindungsproteins Ankyrin

Modell des Transportproteins Hämoglobin

1.5 Stammzellforschung Katrin und Aisha diskutieren, was sie am Abend zu Jens‘ Party mitbringen sollen. Jens wird schon 20, die meisten seiner Klassenkameraden sind erst 18. Jens war als Kind sehr krank und konnte erst später zur Schule. Jens hatte Leukämie. Dass er überlebt hat, verdankt er einer Stammzellspende. Die Knochenmark-

transplantation hat ihm das Leben gerettet. Damals stand es ernst um ihn, doch heute kann Jens locker darüber reden. Wenn im Frühling jemand zu niesen beginnt, meint er grinsend: «Tja, Heuschnupfen habe ich seit zwölf Jahren hinter mir. Meine neuen Blutzellen sind immun dagegen.»


12 / 13

Alleskönner Stammzellen haben besondere Fähigkeiten. Sie können sich durch Teilung selbst erneuern und zu verschiedenen Zelltypen ausreifen, zum Beispiel zu Herz-, Muskel- oder Leberzellen. Heute wird daran gearbeitet, nach einem Herzinfarkt das geschädigte Herzgewebe durch Stammzellen zu regenerieren. Was hier erprobt wird, ist für das Blutsystem seit langem Realität. Um Blutkrebs (Leukämie) zu behandeln, werden adulte Blutstammzellen ins Knochenmark der Patientin oder des Patienten übertragen. Neben den adulten gibt es auch embryonale Stammzellen. Sie lassen sich leicht im Labor züchten und bilden unter Zugabe von Wachstumsfaktoren alle verschiedenen Gewebetypen. Damit verfügen sie über ein riesiges Potenzial für die Entwicklung neuer Therapien. Viele schwere Krankheiten wie multiple Sklerose, Diabetes oder Alzheimer beruhen auf einem Abbau von Gewebe. Mit Stammzellen hofft man, geeignete Ersatzzellen zu züchten. Experimentelle Anwendungen zeigen, dass dies machbar ist, etwa zur Heilung von Sehnenverletzungen oder zur Überbrückung durchtrennter Nerven. Bevor Patienten und Patientinnen routinemässig mit Therapien auf der Basis embryonaler Stammzellen behandelt werden können, braucht es noch viel Forschungsarbeit.

In-vitro-Befruchtung

Ethik: Die Forschung mit embryonalen Stammzellen ist umstritten. Einerseits haben embryonale Stammzellen ein grosses Potenzial für die Behandlung schwerer Krankheiten, andererseits werden für ihre Gewinnung wenige Tage alte Embryonen zerstört. In der Schweiz arbeiten Forschende mit sogenannt überzähligen Embryonen. Ein Embryo gilt als überzählig, wenn er im Labor gezeugt wurde, der Frau aber nicht eingepflanzt werden kann. Unter welchen Voraussetzungen den überzähligen, zur Vernichtung bestimmten Embryonen Stammzellen entnommen werden dürfen, ist im Stammzellforschungsgesetz geregelt (siehe Kapitel 5.3). Einen Schritt weiter geht das therapeutische Klonen. Dabei werden Embryonen zum Zweck der Gewinnung medizinisch idealer Stammzellen geschaffen. Neue Behandlungsansätze rücken damit in den Bereich des Möglichen. Das therapeutische Klonen ist heute nur in einigen Ländern, z.B. Grossbritannien, erlaubt. Vom therapeutischen Klonen zu unterscheiden ist das reproduktive Klonen. Das Klonen zur künstlichen Erzeugung eines Menschen wird weltweit beinahe einstimmig als ethisch verwerflich abgelehnt – dies aufgrund der Problematik der Fremdbestimmung und der gesundheitlichen Gefahren für Mutter und Kind.

Eizelle

Samenzelle

einzelliger Embryo

Kerntransfer

teilen Gewinnung embryonaler Stammzellen

entkernte Eizelle

Zellkern Körperzelle

Kerntransfer: Bei diesem Forschungsansatz wird versucht, ausgehend vom Kern einer Patientenzelle embryonale Stammzellen zu gewinnen, die keine Abstossungsreaktion hervorrufen, weil sie mit dem Patienten oder der Patientin identisch sind. Die Stammzellgewinnung via Kerntransfer (auch therapeutisches Klonen genannt) ist erst bei Tieren gelungen.

Blastocyste Der Embryo entwickelt sich ca. fünf Tage im Labor. Stammzelllinien Im Blastocystenstadium entnommene Zellen können als undifferenzierte embryonale Stammzelllinien gezüchtet werden.

Spezialisierte Zellen Durch Zugabe geeigneter Wachstumsfaktoren entstehen spezialisierte Körperzellen.


1.6 Transgene Tiere Katrin ist ein Morgenmuffel. Auch heute schaffte sie es nicht rechtzeitig aus dem Bett und musste sich beeilen, was Streit gab mit der Mutter. Im Tierversuchslabor wacht sie jedoch schlagartig auf, als die Forscherin zu erzählen beginnt: «Die innere Uhr, die den Tag-Nacht-Rhythmus einer Maus bestimmt, ist durch Gene gesteuert. Doch die Ausprägung dieser Gene ist nicht bei allen Tieren gleich, was zu unterschiedlichen Aktivitätsmustern führt.» Katrin grinst zufrieden: «Das ist die Erklärung. Die Gene sind schuld daran, dass ich morgens ausschlafen und abends lange in den Ausgang will!» Tierversuche Mit Hilfe von Zellkulturen und Computersimulationen gewinnt die biomedizinische Forschung wertvolle Hinweise. Ob dieses Wissen für die Medizin nützlich ist, zeigt sich allerdings oft erst am Gesamtorganismus. Deshalb setzt die Wissenschaft Versuchstiere ein. Bei jedem Medikament muss damit gerechnet werden, dass neben der beabsichtigten Wirkung auch unerwünschte Nebenwirkungen auftreten. Medikamente zu entwickeln und diese direkt am Menschen anzuwenden, ist daher ethisch nicht vertretbar. Aus Gründen der Patientensicherheit sind Tierversuche gesetzlich vorgeschrieben. Aus ethischen Gründen unterstehen die Tierversuche strengen Regelungen. Die sogenannte 3R-Regel «replace, reduce, refine» fordert, Tierversuche wenn immer möglich durch tierfreie Methoden zu ersetzen, die Zahl der eingesetzten Tiere zu verringern und die

Tests tierfreundlich zu. Letzteres bedeutet beispielsweise, dass die Tiere für Eingriffe Schmerzmittel bekommen oder dass sie mit Artgenossen zusammenleben und ihnen im Käfig Spielmaterial zur Verfügung steht. Mit solchen Massnahmen wird der Würde des Tieres Rechnung getragen. Aus ethischer Sicht ist es entscheidend, dass nur unerlässliche Tierversuche durchgeführt werden. Dies bedingt eine sorgfältige Güterabwägung. Was wiegt mehr: das Leid der Tiere oder der Nutzen für den Menschen? Jeder Tierversuch muss in der Schweiz durch eine Kommission bewilligt werden, in der neben Forschenden auch Tierschützer und Tierschützerinnen vertreten sind. In den letzten Jahren ermöglichte der Einsatz transgener Tiere neue Forschungsarbeiten. Ein transgenes Tier trägt in all seinen Körperzellen ein verändertes Stück Erbinformation. Mit gentechnischen Methoden lassen sich bestimmte Gene, die beim Menschen eine Krankheit auslösen, in eine Maus einbringen. Diese entwickelt dann ein ähnliches Krankheitsbild wie der betroffene Mensch. Es ist auch möglich, ein bestimmtes Gen auszuschalten. Solche Mäuse nennt man Knock-out-Tiere. Die Untersuchung des Tieres lässt Rückschlüsse zu über die Funktionen des Gens. In der Krebsforschung oder in der Immunologie spielen transgene Tiere eine wichtige Rolle. Neben der Erforschung von Krankheiten und ihrer Bekämpfung liefern transgene Tiere auch Erkenntnisse über noch unbekannte Prozesse im gesunden Körper.


14 / 15

Transgene Alzheimer-Mäuse Alzheimer ist eine der häufigsten Alterskrankheiten. Innerhalb von 5 bis 15 Jahren verlieren die Patienten und Patientinnen unaufhaltsam ihre geistigen Fähigkeiten. Es treten Störungen des Gedächtnisses, der Sprachfähigkeit und der Orientierung auf, bis die Betroffenen vollständig pflegebedürftig werden. Die Krankheit hängt mit einem fortschreitenden Verlust von Nervenzellen im Gehirn zusammen. Früher konnte die Krankheit nur an Verstorbenen studiert werden. Heute arbeitet die Forschung mit transgenen Mäusen und kann so Teilaspekte der Krankheit im lebenden Modell studieren. Aus der Untersuchung von Verstorbenen weiss man, dass sich in den betroffenen Hirnzellen verschiedene Proteine falsch verhalten. Ein Beispiel ist das Protein Tau, das sich zu Bündeln verklebt. An transgenen Mäusen, welche das Tau-Protein im Übermass herstellen, kann dieser Vorgang untersucht werden. Von den Erkenntnissen erhofft man sich Ansatzpunkte für vorbeugende Massnahmen und medikamentöse Behandlungen der Alzheimerkrankheit.

Transgene Mäuse ohne Jetlag Im Laufe der Evolution hat sich das Leben dem rhythmischen Wechsel von Tag und Nacht angepasst. Sogenannte innere Uhren steuern unzählige Lebensfunktionen im Tagesrhythmus. Diese Uhren umzustellen, ist nicht ganz einfach, wie Nachtschichtarbeit oder das Phänomen des Jetlags nach einer langen Flugreise zeigen. In der Forschung werden Knock-out-Mäuse benutzt, um die molekularen Mechanismen zu verstehen, die hinter dem natürlichen Rhythmus stehen. Durch das gezielte Ausschalten bestimmter Gene lässt sich anhand von Verhaltensänderungen im Tagesablauf der Mäuse festmachen, welchen Platz diese Gene in der natürlichen Rhythmik einnehmen. Fehlen bestimmte Gene, verlieren die Mäuse ihren Rhythmus leichter. Sie können sich aber auch besser an eine Veränderung anpassen. Das Wissen um die genauen Abläufe hilft, Schlafstörungen zu verstehen, aber auch Betriebsunfälle während der Nachtschicht zu vermeiden.

1.7 Nanobiotechnologie Die Nanotechnologie beschäftigt sich mit dem fast unvorstellbar Winzigen. Ein Nanometer entspricht einem Millionstel Millimeter. In der Nanowissenschaft wird untersucht, wie Atome und Moleküle als Bausteine benutzt werden können, um Materialien und Strukturen mit neuen Eigenschaften hervorzubringen. Die Nanobiotechnologie ist ein Teilgebiet der Nanowissenschaften. Sie befasst sich mit Biomolekülen, dazu gehören DNA, Proteine, Hormone und Antikörper. Durch die neuen Erkenntnisse erhofft sich die Forschung vor allem Fortschritte in der Medizin. Da viele Krankheiten im Bereich der Moleküle entstehen, führen Untersuchungen auf der Nanoebene zu rascheren Diagnosen.

Dies hilft, Krankheiten bereits im Frühstadium nachzuweisen, etwa Krebs, Herz-Kreislauf-Krankheiten oder Infektionen mit Viren. Doch auch neuartige Therapien mit Hilfe von Biomolekülen werden entwickelt. Weltweit arbeiten Forscherinnen und Forscher daran, Nanoteilchen als Transportmittel für Medikamente zu gebrauchen. Der Wirkstoff wird in einen Nanocontainer verpackt und erst am Einsatzort freigelassen. Damit die Nanoteilchen an den richtigen Ort gelangen, werden sie auf der Aussenhülle mit speziellen Molekülen versehen, beispielsweise Antikörpern. Auf diesen Gebieten wird heute intensiv geforscht. Klinische Anwendungen sind allerdings noch in weiter Ferne.


2 Medizin


16 / 17

Die Medizin befasst sich mit der Vorbeugung, Erkennung und Behandlung von Krankheiten und Verletzungen. Aber auch mit Fortpflanzung, Schwangerschaft, Geburt und Tod. Die biomedizinische Forschung versucht, die Ursachen und Mechanismen einer Krankheit zu verstehen, um neue Therapien zu entwickeln. Die Gentechnik spielt dabei eine immer wichtigere Rolle. Einblicke in die moderne Medizin geben fünf Personen, die einen Allgemeinpraktiker aufsuchen. «Es ist auf jeden Fall richtig, dass du dich beim Arzt angemeldet hast, Silvio.» Silvio ist seinem Freund dankbar für die Unterstützung. Aber das mulmige Gefühl bleibt. Wie konnte er nur so dumm sein. Hastig trinkt er den Kaffee aus. «Schau», fährt dieser fort «wenigstens machst du dir Gedanken darüber. Du kanntest die Frau nicht, und ihr habt kein Kondom benutzt. Das war wirklich blöd. Aber noch schlimmer wäre, nun keinen HIV-Test zu machen.» Silvio nickt. «Ich muss los, in zehn Minuten muss ich dort sein.» Auf der Strasse schiessen ihm tausend Gedanken durch den Kopf. Was, wenn ich mich wirklich angesteckt habe? Wenn der Test nur schon vorbei wäre und ich ein negatives Resultat hätte. Wenigstens muss man heute nicht mehr wochenlang warten, da die Viren dank Gentechnik schnell nachweisbar sind. Wenn sie nur keine finden! Im Wartezimmer spielt ein Mädchen. Eine Frau blättert unkonzentriert in einer Zeitschrift. Sie ist zu unruhig, um die Artikel zu lesen. So kurz vor dem Arztbesuch macht sich Frau Fritsche wieder Sorgen. Vielleicht ist der Befund doch nicht so erfreulich, wie der Spezialist gemeint hat? Sie denkt zurück an ihre Unsicherheit, als der Hausarzt sie vor einem Jahr zur Abklärung überwies. Die Diagnose war ein Schock: Brustkrebs. Das konnte einfach nicht sein. Ausgerechnet sie, die so viele Pläne hatte. Damals war sie gerade in eine neue Wohnung gezogen. Und sie hatte vereinbart, ab April einmal die Woche ihren Enkel zu hüten. Würde sie sich noch darum kümmern können? Die Angst war gross. Nun, die Ärztinnen und Ärzte hatten sie gut informiert, und die Operation des Tumors verlief ohne Komplikationen. Allmählich wuchs ihre Zuversicht, aber die erste Zeit war schwierig. Sie musste lernen, sich mit der Krankheit auseinanderzusetzen. Der Austausch mit Betroffenen und die Begleitung durch Fachleute halfen ihr. Frau Fritsche staunt im Nachhinein über die Vielfalt an Behandlungsmöglichkeiten. Neben Operation, Chemotherapie und Bestrahlung wird in der Krebsbehandlung auch eine Vielzahl von Medikamenten eingesetzt. Das Ärzteteam hatte ihren spezifischen Krebs sehr genau untersucht. Sogar die Genaktivität in den Tumorzellen wurde analysiert. Dabei wurde festgestellt, dass Frau Fritsche zu dem Viertel der Brustkrebspatientinnen gehört, deren Tumorzellen einen auffälligen Wachstumsrezeptor produzieren, wodurch sich der Tumor schnell vermehrt. Es konnte ihr ein gentechnisch hergestelltes Medikament verabreicht werden,

das diese gefährlichen Oberflächenstrukturen auf den Krebszellen unschädlich macht und die Zerstörung der Tumorzellen durch das Immunsystem fördert. Die auf sie zugeschnittene Behandlung verlief sehr gut. Frau Fritsche denkt daran, wie viel sich in den letzten 50 Jahren verändert hat. Auch ihr Grossvater war an Krebs gestorben. Damals hatte man das noch nicht so genau gewusst und kaum etwas dagegen unternehmen können. Nicht einmal gegen einfache Infektionskrankheiten war man zu dieser Zeit gewappnet. Wie ihre Grosstante starben viele junge Frauen nach der Geburt an einer Infektion. Und all die Kinder, die an einer Lungenentzündung starben! Wirklich, es hat sich einiges gewandelt. Sie lächelt dem spielenden Mädchen zu. Die Praxisassistentin kommt ins Wartezimmer und ruft einen Patienten auf. Silvio muss noch warten. Er nimmt sich eine Broschüre vom Tisch, in welcher der Einsatz von Gentechnik in der Medizin thematisiert wird. Die Überschriften erstaunen ihn. Er weiss, dass Gentests Erbkrankheiten diagnostizieren und bei der Suche nach Krankheitserregern helfen. Doch die Broschüre enthält sechs weitere Kapitel. Da geht es um die Untersuchung, welche Medikamente jemand verträgt, oder um die Abklärung von Identitätsund Verwandtschaftsfragen. Ein weiteres Kapitel erläutert, wie Tests helfen, vermutete Krankheiten zu diagnostizieren bzw. auszuschliessen. Die letzten drei Kapitel thematisieren Gentherapien, gentechnikgestützte Erforschung von Krankheiten sowie gentechnisch hergestellte Medikamente und Impfstoffe. Silvio ist überrascht. Gentechnik scheint in vielen Bereichen der Medizin routinemässig im Einsatz zu sein. Das war ihm nicht bewusst.


2.1 Medikamente Die Gentechnik ist ein unentbehrliches Werkzeug für die Entwicklung und Herstellung von Arzneimitteln. Bei der Suche nach neuen Antibiotika liefern die Genomanalyse und die Proteomik beispielsweise wichtige Hinweise, wo die Bakterien angreifbare Schwachpunkte haben. Viele Arzneien werden gentechnisch hergestellt. Seit 25 Jahren ist gentechnisch erzeugtes Insulin zur Behandlung von Diabetes zugelassen. Gentechnisch hergestellte Proteine sind auch für Menschen mit der Krankheit Hämophilie entscheidend. Den Betroffenen fehlt ein Blutgerinnungsfaktor, wodurch einfache Verletzungen zu bedrohlichen Blutungen führen. Früher erhielten sie den Gerinnungsstoff aus Spenderblut, was zu mehreren Aids-Ansteckungen führte. Dank der Gentechnik ist diese Gefahr gebannt. Neben der Sicherheit wurde auch die Produktionskapazität erhöht. Der weltweite Jahresbedarf an Insulin liegt bei 2000 kg. Früher erfolgte die Gewinnung aus Schlachtvieh. Aus einer Tonne tierischen Bauchspeicheldrüsen lassen sich jedoch nur 125 g Insulin gewinnen. Eine Produktion für alle Diabetikerinnen und Diabetiker wäre kaum möglich. Therapeutische Proteine dank Gentechnik Gentechnisch hergestellte Proteine können in Krankheitsmechanismen eingreifen. Das Hormon Erythropoietin, kurz Epo genannt, wurde zur Behandlung von Nierenversagen entwickelt und wird heute in mehreren Formen zur Therapie gegen Blutarmut eingesetzt. Die Lebensqualität von Dialyse-Patientinnen und -Patienten hat sich dadurch stark verbessert. Ein anderes Gentech-Medikament ist Interferon, das Infektionen und Tumorzellen bekämpft. Interferone werden bei der Behandlung von Krebs, Hepatitis oder multipler Sklerose eingesetzt. Bei der Schuppenflechte, einer chronischen Erkrankung der Haut, stoppt ein Protein aus transgenen Zellkulturen die falsch alarmierten

Immunzellen, die in der Haut zu den Krankheitssymptomen führen. Heute sind in der Schweiz rund 100 gentechnisch hergestellte Arzneimittel zugelassen. Fachleute schätzen, dass ein Drittel der Medikamente, die zurzeit entwickelt werden, auf Gentechnologie basieren. Da auch von biotechnologischer Herstellung gesprochen wird, nennt man sie Biologika oder Biologics. Wirkstoffe aus Tier- und Pflanzenzellen Die Produktion von menschlichen Proteinen in transgenen Bakterien war revolutionär. Trägt das Protein jedoch komplexe Oberflächenstrukturen, z.B. angehängte Zuckerketten, geraten die Bakterien als relativ simple Proteinfabriken an ihre Grenzen. In diesem Fall werden Hefe- oder Säugetierzellen verwendet. Eine andere Möglichkeit bietet das Pharming (auch Farming), bei dem Pflanzen und Tiere als Produktionsstätte dienen. Geforscht wird zurzeit an Tabakpflanzen, deren Zellen einen Wirkstoff gegen Borreliose, eine von Zecken übertragene Infektionskrankheit, herstellen. Auch könnten schon bald Medikamente auf den Markt kommen, die in der Milch von transgenen Ziegen produziert wurden. Seit Tagen überlegt Frau Fritsche, ob sie an einer Studie zu einer neuartigen Krebsbehandlung teilnehmen soll. Die Möglichkeit, dass ihr Brustkrebs trotz der Operation nicht ganz besiegt ist und unbemerkt noch Tumorzellen vorhanden sein könnten, beschäftigt sie. Die neue Behandlung verspricht, die Gefahr eines erneuten Ausbruchs zu senken. Frau Fritsche ist sich jedoch bewusst, dass auch Nebenwirkungen auftreten können. Allmählich reift ihr Entschluss. Sie hat die Chancen und Risiken aus ihrer persönlichen Lebenssicht abgewogen und entscheidet sich zur Teilnahme an der Studie.


Sonde

1. Gewebeprobe entnehmen Gewebeproben mit Krebszellen werden der Patientin entnommen und im Labor untersucht.

2. Den Tumor vergleichen In Biobanken archivierte Proben anderer Patientinnen erlauben den Vergleich mit ähnlichen Tumorzellen. Auch die krankhaft veränderte DNA in den Krebszellen wird verglichen. Die mit den Proben gespeicherten Informationen geben Auskunft, welche Behandlung bei welchem Tumortyp erfolgreich ist.

3. Genetischer Typ des Tumors Wird als Ursache der Zellwucherung eine bestimmte Genmutation vermutet, kann mit einer Sonde das fehlerhafte Gen nachgewiesen werden.

Krebszelle

Rezeptor

Wachstumsfaktor mRNA

4. Biologische Krebsbehandlung Bei bestimmten Krebserkrankungen führt die Genmutation dazu, dass die Zelle zu viele Proteine herstellt, die als Andockstellen (Rezeptoren) für Wachstumsfaktoren auf der Zelloberfläche liegen. In der Folge teilt sich die Zelle viel zu häufig und beginnt zu wuchern. Die Verabreichung eines therapeutischen Antikörpers, der spezifisch an die Rezeptoren bindet, bringt das übermässige Zellwachstum zum stoppen. Im Gegensatz zur operativen Tumorentfernung oder zur physikalischen Bestrahlung der Krebszellen werden hier biologische Mechanismen für die Therapie eingesetzt.

therapeutischer Antikörper

2.2 Forschung am Menschen Dank des medizinischen Fortschritts können heute unzählige Krankheiten und Verletzungen behandelt oder geheilt werden. Neue Therapien werden – nachdem sie im Labor und an Tieren geprüft wurden – in klinischen Studien getestet. Aufgrund der Patientensicherheit und ethischer Überlegungen untersteht solche Forschung am Menschen strengen Richtlinien, den sogenannten «Good Clinical Practice». Vom Nutzen biologischer Sammlungen Forschung am Menschen hilft, Krankheiten zu verstehen. Zum Beispiel multifaktorielle Krankheiten, bei denen sowohl Gene als auch äussere Faktoren wie der Lebensstil eine Rolle spielen. Um den Einfluss der einzelnen Krankheitsfaktoren zu analysieren, werden Patientendaten (Alter, Gewicht, Gewohnheiten etc.) und Gewebeproben gesammelt. Eine systematische Sammlung von Proben wie Blut, Tumorgewebe oder DNA und zugehörige medizinische Angaben bezeichnet man als Bio-

18 / 19

bank. Die Auswertung der Daten erlaubt, das Auftreten von Krankheiten wie Krebs, Herz-Kreislauf-Leiden oder Asthma besser zu verstehen. Bestimmung der individuellen Medikamentendosis Medikamente treten im Körper mit vielen Proteinen in Kontakt. Enzyme können Medikamente binden und sie in der Leber deaktivieren. Die Aktivität der einzelnen Enzyme ist je nach genetischem Code von Mensch zu Mensch verschieden. Daher wird ein Medikament bei einer Person langsam und bei einer anderen schnell abgebaut. Im zweiten Fall muss eine höhere Dosis verschrieben werden, damit die Arznei richtig wirkt. Dieses Gebiet heisst Pharmakogenetik. Zu welcher Kategorie ein Mensch gehört, kann der Arzt oder die Ärztin mit einem DNA-Chip testen, der die Genvarianten bestimmter Leberenzyme untersucht.


2.3 Gentherapie Das Prinzip einer Gentherapie ist in der Theorie einfach: Krankheiten, die entstehen, weil ein Gen defekt ist, werden durch Einschleusen eines gesunden Gens in die Zelle geheilt. Man unterscheidet zwischen der somatischen Gentherapie, die nur Körperzellen gentechnisch verändert, und der Keimbahntherapie. Eine Keimbahntherapie, die auch Ei- und Samenzellen betrifft, würde Auswirkungen auf alle Nachkommen haben. Sie wird aus ethischen Überlegungen abgelehnt. Viren als Gentaxis Es gibt zwei Arten der Gentherapie: Bei der Ex-vivo-Therapie werden dem Patienten oder der Patientin Zellen entnommen. Die gentechnische Behandlung der Zellen erfolgt im Labor. Bei der In-vivo-Therapie werden die Gene direkt im Körper in die Zellen eingeschleust. Bei beiden Verfahren dient ein Virus als Gentaxi. Viren können Zellen dazu bringen, die Viren-DNA ins Genom einzubauen. Diese Fähigkeit wird genutzt, um das therapeutische Gen in die kranken Zellen zu transportieren.

Hoffnungsvoller Weg mit Rückschlägen Die erste Gentherapie wurde 1990 in den USA an einem vierjährigen Mädchen durchgeführt, das an einer angeborenen Immunschwäche litt. Verursacht wird diese Krankheit durch einen Gendefekt des Enzyms Adenosin-Deaminase (ADA). Fehlt dieses Enzym, sammeln sich im Blut schädliche Abbauprodukte an, wodurch wichtige Zellen des Immunsystems zerstört werden. Dadurch wird jede Infektion lebensgefährlich. Mit Hilfe der Gentherapie konnten betroffene Kinder geheilt werden. Allerdings erkrankten einige in der Folge an Leukämie, worauf die Behandlungen gestoppt wurden. Dieses Beispiel zeigt, wie wichtig es ist, vor jeder Gentherapie Nutzen und Risiken sorgfältig abzuwägen. Inzwischen wurden die Zusammenhänge untersucht und Verbesserungen der Therapie vorgenommen.

defektes ADA-Gen

blutbildende Stammzelle 1. Zellen mit defektem Gen Blutbildende Stammzellen mit fehlerhaften ADA-Genen werden dem kranken Kind entnommen. Die Zellen können, ohne dass sie Schaden nehmen, im Labor aufbewahrt werden.

5. Das neue Gen wirkt Zurück im Körper des Kindes bauen die gentechnisch veränderten Blutstammzellen eine gesunde Immunabwehr auf. Das Kind ist von der lebensbedrohlichen Krankheit geheilt.


20 / 21

2. Gesundes Gen isolieren Aus den Zellen eines gesunden Spenders oder einer Spenderin wird die DNA isoliert und das Gen für die Adenosin-Deaminase (ADA) herausgeschnitten. Dieses Gen wird in ein abgeschwächtes Virus geschleust, das keine Infektionen mehr auslösen kann.

gesundes ADA-Gen

Schwere Immunschwäche:

Virus mit eingebautem ADA-Gen

Personen mit einem schwer kranken Immunsystem müssen von allen Krankheitserregern abgeschirmt werden. Im Gegensatz zur Isolation eines ansteckenden Patienten geht es bei der Umkehrisolation um die Sicherheit der Patientin. Diese lebt in einem keimfreien Raum, und alle Personen, die mit ihr in Kontakt treten, müssen sich steril einkleiden. In besonders schweren Fällen wird das Kind in einem sterilen Zelt untergebracht und nur über in die Zeltwand eingebaute Handschuhe gepflegt. Diese Kinder haben nur eine Chance auf ein normales Leben, wenn ein passender Knochenmarkspender gefunden wird oder eine Gentherapie erfolgreich ist.

3. Mittels Virus in die Zelle Die blutbildenden Stammzellen des Kindes werden im Labor mit den transgenen Viren zusammengegeben. Wie eine Art Gentaxi reist das Virus in die Zelle und schleust das gesunde ADA-Gen in den Zellkern ein.

4. Zellen mit Extra-Gen Mit etwas Glück baut sich das ADA-Gen ins Erbmaterial der Blutstammzellen ein. Die erfolgreich behandelten Zellen werden im Labor vermehrt.

blutbildende Stammzelle

Fortschritte trotz Hürden In den letzten 15 Jahren hat die Gentherapie zahlreiche Verbesserungen erfahren. Am idealen Gentaxi wird aber immer noch geforscht. Eine der Herausforderungen ist das Einschleusen der therapeutischen Gene in die Körperzellen. Zudem darf die Integration ins Genom die Funktion anderer Gene nicht beeinträchtigen. Heute gibt es Behandlungen, die ohne Viren als Gentaxi auskommen. Ein Beispiel ist die Behandlung des Greisenbrandes. Bei dieser Krankheit verschliessen sich die Blutgefässe in den Beinen, wodurch das Gewebe abstirbt. In der gentherapeutischen Behandlung wird ein Gen für einen Blutgefäss-Wachstumsfaktor direkt in den Muskel gespritzt. Studien zeigen, dass dank dieser Gentherapie nur noch halb so viele Beinamputationen vorgenommen werden müssen. Weltweit wurden bislang etwa 6000 Menschen im Rahmen von Forschungsstudien mit Gentherapien behandelt.


2.4 Impfstoffe und Antikörper Vorbeugen ist besser als heilen oder anders gesagt: Impfen ist besser als krank werden. Vor allem bei lebensbedrohlichen Krankheiten. Es gibt zwei Arten von Impfungen. Bei der aktiven Immunisierung wird der Körper angeregt, Antikörper gegen den Erreger aufzubauen. Die passive Impfung ist eine Notfallmassnahme. Hier werden direkt Antikörper gespritzt, z.B. wenn eine Starrkrampfinfektion droht. Früher mussten die Antikörper aus menschlichen Blutspenden gewonnen werden. Heute werden sie auf gentechnischem Weg hergestellt. Man spricht von monoklonalen Antikörpern. Mit Hilfe der Gentechnik können auch die für die aktive Immunisierung benötigten Bruchstücke des Erregers (Antigene) im Labor hergestellt werden. 1985 wurde der erste gentechnisch hergestellte Impfstoff zugelassen. Er schützt die geimpften Personen vor Hepatitis B, die unbehandelt zu Gelbsucht und Leberkrebs führt. Antikörper helfen neuerdings auch bei der Behandlung von chronischen Krankheiten. Bereits sind 18 gentechisch hergestellte Antikörper als Therapeutika zugelassen, etwa gegen Rheuma oder Allergien. Ein weiteres Beispiel ist ein Antikörper, der krankhafte Veränderungen im Auge bremst und damit das Sehvermögen bei älteren Menschen erhält. Anna findet impfen doof. Doch Papa hat erklärt, dass die Spritze vor einer Krankheit schützt, bei der sie im Bett bleiben müsste und vielleicht eine gefährliche Gehirnentzündung bekäme. Anna versteht das nicht ganz. Aber Papa hat ihr auch gesagt, dass sie ein neues Bilderbuch bekommt, wenn sie beim Impfen tapfer sei. Das hat Anna sehr gut verstanden.

Optimierte Impfungen Die Forschung versucht laufend, Impfstoffe zu verbessern. Zum Beispiel gegen Malaria, an der jährlich drei Millionen Menschen sterben. Hier liefert die Sequenzierung des Erbgutes des Erregers die Grundlage für neue Wirkstoffziele. Nicht zuletzt dank Gentechnik kann heute auch effizienter auf neue Erreger wie Sars oder (Vogel-)Grippe-Viren reagiert werden. Ein neuer Ansatz erprobt, DNA-Stücke des Erregers als Impfstoff zu verwenden. DNA-Vakzine haben den Vorteil, dass sie nur einmal verabreicht werden müssen und einfacher lagerbar sind. Für die Länder des Südens wäre dies von grosser Bedeutung. Impfen gegen Krebs Impfungen kennen wir vor allem gegen Kinderkrankheiten und als Schutzmassnahme bei Auslandreisen. Doch die Forschung arbeitet auch an Impfungen gegen Krebs, Diabetes oder Alzheimer, um nur einige zu nennen. Seit kurzem ist eine Immunisierung gegen Gebärmutterhalskrebs möglich. Dies ist die zweithäufigste Krebsart bei Frauen, im Schnitt erkrankt in der Schweiz täglich eine Frau. Das Spezielle an diesem Krebs: Er wird grösstenteils vom Papilloma-Virus (HPV) ausgelöst. Der gentechnisch hergestellte Impfstoff schützt gegen vier Virentypen und verhindert rund 70 % der Krebsfälle. Allerdings wirkt die Impfung nur bei Frauen, die noch nicht mit dem Virus in Kontakt gekommen sind, so dass eine Immunisierung vor dem ersten Geschlechtsverkehr stattfinden sollte.


22 / 23 Bakterium Gewebezelle 2. Der Körper reagiert Die Erreger werden von Fresszellen (Makrophagen) bekämpft. Nach dem Verdau des Antigen Erregers präsentiert der Makrophage bestimmte Oberflächenstrukturen des Erregers – die Antigene – auf seiner Zelloberfläche.

Makrophage

3. Das Immunsystem wird aktiviert Eine Helferzelle dockt an ein Antigen auf der Makrophagenzelle an und aktiviert dadurch eine B-Zelle. Dies veranlasst die B-Zelle, sich zu teilen. Es bilden sich einerseits B-Zellen, die Antikörper freisetzen. Die Antikörper blockieren die Erreger und leiten ihre Beseitigung ein. Andererseits entstehen Gedächtniszellen, welche sich die Struktur des Antikörpers gegen einen spezifischen Erreger (z.B. gegen das Rötel-Virus) merken. Personen, welche die Krankheit durchgemacht haben, sind nun gegen eine Neuinfektion geschützt, da ihr Immunsystem rasch mit Antikörpern reagieren kann. Gedächtnis B-Zelle

1. Der Körper wird attackiert Wird eine Person von einem Krankheitserreger befallen, löst dieser im Gewebe eine Entzündungsreaktion und Beschwerden wie Fieber, Durchfall, Schmerzen etc. aus.

Antikörper Helferzelle

aktivierte B-Zelle Antikörper freisetzende B-Zelle

Aktive Impfung: Bei der aktiven Immunisierung besteht der Impfstoff aus abgeschwächten Erregern oder Bruchstücken davon. Die Makrophagen fressen die Teilchen, die keine Krankheit auslösen, aber als Antigene wirken. Die Immunisierung, das heisst die Herstellung von spezifischen Antikörpern und Gedächtniszellen, läuft ab, ohne dass die Person die (lebensgefährliche) Krankheit erleiden muss. Der Körper ist gegen eine zukünftige Infektion gewappnet, da er sofort reagieren kann.

Erreger-Bruchstücke

Passive Impfung: Die passive Impfung verabreicht Antikörper, die allerdings nur während einiger Tage bis Wochen im Körper zirkulieren und die geimpfte Person schützen. Es werden keine Gedächtniszellen gebildet, die auch nach Jahren noch rasch gegen eine Infektion reagieren können. Das Immunsystem wird nicht aktiviert. Antikörper

2.5 Nachweisverfahren Zur Diagnose von Infektionskrankheiten müssen Erreger aus dem Blut, Urin oder Stuhl des Patienten oder der Patientin gezüchtet oder spezifische Antikörper identifiziert werden. Diese Verfahren sind teilweise sehr langwierig. Heute kommen oft gentechnische Verfahren zum Einsatz, die das Erbmaterial des Erregers nachweisen. Diagnosen können so schneller und zuverlässiger gestellt werden. Ein Beispiel: Zwischen dem Zeitpunkt einer HIV-Infektion und dem nachweisbaren Auftreten von HIV-Antikörpern können einige Wochen verstreichen.

Demgegenüber ist der gentechnische Test, bei dem DNAStücke des HI-Virus aufgespürt werden, bereits kurze Zeit nach der Ansteckung zuverlässig. Auch wenn der Erreger bekannt ist, ist die Anwendung gentechnischer Methoden hilfreich. Die Analyse der HI-Viren zeigt beispielsweise, ob es sich um eine genetische Variante des Virus handelt, die gegen bestimmte Medikamente resistent ist. Dadurch kann die Behandlung angepasst werden.


2.6 Vererbung Familienmitglieder gleichen sich. Kinder sehen aber nie gleich aus wie ihre Eltern. Der Grund liegt in der Neukombination der elterlichen Gene bei der Vererbung. Beide Elternteile liefern in der Ei- bzw. Samenzelle einen halbierten Chromosomensatz. Durch die Verschmelzung von Ei- und Samenzelle erhält das Kind wieder ein vollständiges Genom. Entscheidend ist, dass Gene in verschiedenen Varianten vorliegen können, man spricht von Allelen. Beim Gen, das die Blutgruppe bestimmt, unterscheidet man z.B. drei Allele: A, B, Null. Da wir Gene vom Vater und von der Mutter erben, liegt jedes Gen zwei Mal vor – die Allelausprägung kann zwei Mal gleich oder verschieden sein, also z.B. AA oder A0. Das dominante Allel A setzt sich gegenüber dem rezessiven Allel Null durch. Ein Kind mit den Allelen A und Null hat daher die Blutgruppe A. Blutgruppe Null tritt nur auf, wenn das Kind zwei Allele Null geerbt hat. Mutationen als Motor der Evolution Jedes Gen besteht aus DNA-Bausteinen in einer bestimmten Reihenfolge. Wird diese geändert, ist das Gen mutiert, was zu einer Krankheit führen kann. Mutationen entstehen durch Kopierfehler bei der Zellteilung oder infolge von äusseren Einflüssen wie radioaktiver Strahlung. Ab und zu verändert eine Mutation ein Gen so, dass ein verbessertes Eiweiss entsteht.

Zum Beispiel ein Protein, das mehr Sauerstoff speichern kann. Dadurch wird das Lebewesen fitter. Im Laufe der Evolution haben Mutationen zu neuen Lebensformen geführt. Tiere mit einer Genveränderung für weisses Fell hatten beispielsweise einen Vorteil in schneebedeckten Gebieten und bildeten mit der Zeit eine neue Art. Das Ehepaar Schneider ist besorgt. Sie wissen, dass sie Träger der Erbanlage für cystische Fibrose sind. Von dieser rezessiven Krankheit ist eine von 2500 Personen betroffen. Ob das Kind, das sie erwarten, auch dazugehört? Betroffene leiden an einer Verschleimung der Lungen, was zu Atemproblemen und schweren Entzündungen führt. Ob der Fötus das mutierte Gen trägt, kann mit einem Gentest geprüft werden. Schneiders sind unsicher, ob sie das wollen. Sie hoffen, im Gespräch mit einer Fachperson für medizinische Genetik Klarheit zu erhalten.

dominanter Erbgang

rezessiver Erbgang Eltern

Mutter gesund

Vater krank

Mutter gesund, Trägerin

Vater gesund, Träger

Samenzelle Keimzellen

Eizelle

Kinder

krank

gesund

gesund

Beim dominanten Erbgang ist das Kind betroffen, sobald eine der beiden Genkopien in der Zelle das defekte Gen trägt. Dieses kann von einem betroffenen Vater oder von einer betroffenen Mutter vererbt werden. Im Durchschnitt erkrankt jedes zweite Kind. Ein Beispiel für eine dominant vererbte Krankheit ist die Huntington-Krankheit.

krank

krank

gesund

Im Fall des rezessiven Erbgangs müssen die Chromosomen beider Eltern die Mutation aufweisen und ans Kind vererbt werden. Im Schnitt erkrankt jedes vierte Kind. Jedes zweite Kind erbt nur ein mutiertes Gen und kann die Krankheit weitervererben, obwohl es gesund ist. Es ist Träger einer defekten Genkopie. Die cystische Fibrose ist ein Beispiel für eine rezessive Erbkrankheit.

gesund, Träger

gesund, Träger


24 / 25

2.7 Gentests Die meisten Gentests werden an Personen durchgeführt, die Krankheitssymptome aufweisen. Das Wissen um die genetischen Ursachen hilft, die Krankheit zu verstehen und ihren Verlauf abzuschätzen. In der Krebsbehandlung spielen diagnostische Gentests eine wichtige Rolle. Denn je nach Gendefekt sprechen die Krebszellen auf andere Medikamente an. Neben den diagnostischen gibt es auch prädiktive (vorausschauende) Tests. Diese spüren Krankheiten auf, die noch nicht ausgebrochen sind, etwa die dominant vererbte Huntington-Krankheit. Diese führt zu einem Nervenabbau mit schweren Beeinträchtigungen für die Betroffenen. Da es keine Vorbeugung gibt, ist das Wissen um die Mutation äusserst belastend, kann aber für die Lebensplanung wichtig sein. Bei Erbkrankheiten, deren Ausbruch sich verhindern lässt, sind prädiktive Gentests ein grosser Vorteil. Z.B. bei der Stoffwechselkrankheit Phenylketonurie, auf die in der Schweiz alle Neugeborenen untersucht werden. Genetische Tests vor der Geburt Unter pränataler Diagnostik versteht man Untersuchungen, um gewisse Krankheiten beim ungeborenen Kind nachzuweisen bzw. auszuschliessen. Gibt es in der Verwandtschaft Erbkrankheiten oder liegt ein anderweitiger Verdacht vor, kann das Erbmaterial des Fötus untersucht werden. Im Falle eines krankhaften Befundes haben die Eltern in der Regel nur zwei Möglichkeiten: Sie entscheiden sich für das Leben mit dem kranken oder behinderten Kind oder für einen Schwangerschaftsabbruch.

Ethik: Gentests unterscheiden sich von anderen medizinischen Diagnosen: Ihre Aussagen sind über lange Zeiträume gültig und können auch Verwandte betreffen. Das durch Gentests erworbene Wissen um eine schwere Erbkrankheit hat Folgen für die persönliche Lebens- und Familienplanung. Der Umgang mit Krankheitsprognosen ist individuell sehr verschieden. Es gibt Betroffene, welche die Möglichkeit von Gentests schätzen und diese als Zunahme ihrer selbstbestimmten Lebensführung erleben. Andere ziehen es vor, nicht abzuklären, ob sie das Risiko tragen, am schweren Erbleiden in ihrer Familie zu erkranken. Aus ethischer Sicht ist zu fordern, dass sich Betroffene nur nach gründlicher Information für oder gegen einen Test entscheiden (informed consent). Denn es gibt auch ein Recht auf Nichtwissen. Betroffenen muss eine umfassende ärztliche Beratung und Begleitung angeboten werden. Liegen Resultate aus Gentests vor, die eine spätere Erkrankung erwarten lassen, ist zu gewährleisten, dass diese nicht zu Diskriminierungen im Versicherungswesen und auf dem Arbeitsmarkt führen. Diese Grundsätze sind in der Schweiz gesetzlich verankert.


2.8 Fortpflanzungsmedizin Seit 30 Jahren ist die In-vitro-Fertilisation für kinderlose Paare eine Möglichkeit, eine Schwangerschaft herbeizuführen. Bis heute sind drei Millionen im Labor gezeugte Kinder auf die Welt gekommen. In der Schweiz ist es eins von hundert Kindern. Die In-vitro-Fertilisation ist keine Anwendung der Gentechnik, sondern ermöglicht die Zeugung durch direktes Zusammenbringen von Eizelle und Spermium. Um die Zeugung im Labor durchzuführen, werden die Eizellen der Frau via Operation entnommen. Ein bis drei Embryonen werden einige Tage nach der Befruchtung in die Gebärmutter übertragen. Wie auch bei der natürlichen Fortpflanzung nistet sich nicht jeder Embryo in der Gebärmutter ein. Die Forschung arbeitet daran, die Behandlung zu verbessern.

Anwendungen der Präimplantationsdiagnostik Gibt es in der Familie Erbkrankheiten, kann untersucht werden, ob der Embryo das mutierte Gen trägt. Mit Hilfe der PID können betroffene Paare Embryonen auswählen, welche die Krankheit nicht tragen. Die anderen Embryonen sterben im frühesten Entwicklungsstadium ab. Die PID-Untersuchung zeigt auch, ob zu viele oder zu wenige Exemplare eines Chromosoms vorliegen. Die meisten dieser Auffälligkeiten, Monosomien und Trisomien genannt, führen zum Absterben des Embryos während der Schwangerschaft. Die PID ermöglicht, Embryonen ohne Überlebenschance zu erkennen und nicht in die Gebärmutter einzupflanzen. Damit wird die Zahl der Fehlgeburten nach einer In-vitro-Fertilisation gesenkt.

Untersuchung des Allerkleinsten Im Gegensatz zu Embryonen im Mutterleib können Embryonen in vitro im frühesten Entwicklungsstadium vom Arzt oder der Ärztin untersucht werden. Neben der äusserlichen Untersuchung unter dem Mikroskop – die Embryonen sind zu klein, um sie von blossem Auge zu sehen – gibt es genetische Tests. Das Verfahren heisst Präimplantationsdiagnostik (PID). Dem wenige Tage alten Embryo wird eine Zelle entnommen, deren Erbmaterial auf genetische Auffälligkeiten untersucht wird. Der Embryo entwickelt sich trotz des Zellverlustes weiter.

Die Präimplantationsdiagnostik erlaubt auch die Zeugung sogenannter Retter-Babys, auch Designer-Kinder genannt. Diese Kinder sind nicht gentechnisch verändert, wie der Name andeutet. Vielmehr wird mit Hilfe der PID ein Embryo ausgewählt, dessen Gewebe zu einem bereits geborenen schwerkranken Geschwister passt. Nach der Geburt des Retter-Babys werden Zellen aus seinem Nabelschnurblut oder aus dem Knochenmark für die Heilung des kranken Geschwisters eingesetzt.

Ethik: Die Präimplantationsdiagnostik (PID) ist eine noch junge Technik. In der Schweiz ist sie bislang nicht erlaubt. Es wird intensiv diskutiert, für welche Anwendungen die PID gerechtfertigt ist und zugelassen werden sollte. Aus ethischer Sicht müssen wichtige Gründe vorliegen, um Embryonen bei einem negativen Resultat absterben zu lassen, anstatt sie in die Gebärmutter einzupflanzen. Handelt es sich dabei um Embryonen ohne Entwicklungschancen oder mit tödlich verlaufenden Krankheiten, stellt sich die ethische Frage anders, als wenn gesunde Embryonen verworfen werden, um einem kranken Geschwister eine Zelltransplantation zu ermöglichen. Eine weitere wichtige Frage ist die Einschätzung der PID im Vergleich zur Pränataldiagnostik (PND). Bei der PID wird ein im Labor gezeugter kranker oder behinderter Embryo von der Übertragung in die Gebärmutter ausgeschlossen. Im Gegensatz dazu wird eine Pränataldiagnostik während der Schwangerschaft durchgeführt. Wird beim Embryo oder Fötus im Mutterbauch eine schwere Krankheit oder Behinderung diagnostiziert,

entscheidet sich das Paar in den meisten Fällen für eine Abtreibung. Die ethische Beurteilung von PID und PND unterscheidet sich in wesentlichen Punkten. Etwa bei der Belastung für die Frau, die möglichst zu vermeiden ist, oder bei der unterschiedlichen Situation der Entscheidung über einen Embryo ausserhalb der Gebärmutter oder im Mutterleib. Für Paare mit schweren Erbkrankheiten kann die PID ein Segen sein. Auch die Anzahl Fehlgeburten nach In-vitroFertilisationen wird durch PID gesenkt. Diese neuen Möglichkeiten mit Nutzen für Patientinnen und Kinder verlangen angepasste Regelungen. Doch wie sollen die Argumente für und gegen die PID im Einzelfall verantwortungsvoll gewichtet werden? Besteht die Gefahr, dass die PID mit der Zeit auf immer mehr, auch weniger schwere Krankheiten ausgeweitet wird? Wer soll entscheiden, ob die Anwendung der PID für die konkrete Situation eines Paares gerechtfertigt ist oder nicht?


26 / 27

Präimplantationsdiagnostik: Das Bild zeigt einen menschlichen Embryo ungefähr am dritten Tag seiner Entwicklung, dem mit einer Saugpipette eine Zelle entnommen wurde. Das Foto wurde mit Hilfe eines Mikroskops gemacht. Von blossem Auge ist der Embryo unsichtbar oder höchstens als winziges Pünktchen zu erkennen. Anhand des Erbmaterials der entnommenen Zelle kann ein im Labor gezeugter Embryo vor der Übertragung in die Gebärmutter genetisch untersucht werden.

2.9 Gerichtsmedizin Die Polymerase Chain Reaction (PCR) dient der Herstellung messbarer DNA-Mengen (siehe Kapitel 1.2). Mit der PCR-Methode können winzige Spuren von DNA vervielfältigt und dadurch einer Analyse zugänglich gemacht werden. In der Gerichtsmedizin wird dieses Verfahren angewandt, um eine kriminelle Person aufgrund ihres genetischen Fingerabdrucks zu überführen bzw. eine unschuldige Person zu entlasten. Wird eine Person verdächtigt, ein Sexualverbrechen begangen zu haben, wird ihre DNA analysiert. Der Vergleich ihres genetischen Profils mit jenem aus Blut- oder Samenzellen, die beim Opfer gefunden wurden, gibt eine zweifelsfreie Antwort. Das auch DNA-Fingerprinting genannte Verfahren wird auch zur Abklärung umstrittener Vaterschaften eingesetzt. Der DNA-Vergleich zeigt, ob eine fragliche Person der leibliche Vater des Kindes ist. Information zwischen den Genen Der genetische Fingerabdruck ist ein spezifisches Bandenmuster, das nach Durchführung einer PCR und Elektrophorese angefärbt und im Gel sichtbar wird. Das charakteristische Muster

ist für die Gerichtsmedizin deshalb so aussagekräftig, weil die Wahrscheinlichkeit, dass zwei Individuen dieselben Banden zeigen, verschwindend gering ist (ausgenommen eineiige Zwillinge). Untersucht werden nicht die Gene, sondern kleine repetitive Abschnitte im Erbgut. Diese liegen auf der DNA zwischen den Genen und werden nicht zu RNA abgeschrieben. Nebeneinanderliegende, sich vielfach wiederholende DNA-Stücke kommen im Genom aller Menschen vor, doch die Anzahl der Wiederholungen unterscheidet sich von Individuum zu Individuum. Diese Unterschiede werden beim genetischen Fingerabdruck untersucht. Werden mehrere dieser Regionen analysiert und die Resultate kombiniert, ist es äusserst unwahrscheinlich, dass zwei Menschen verwechselt werden. Im Gegensatz zur Sequenzierung von Genen lassen sich aus dem Fingerprinting, das nur die Länge und die Wiederholungen ausgewählter Fragmente untersucht, keine Eigenschaften des Individuums ableiten wie die Veranlagung für eine Krankheit.


3 Landwirtschaft und Ern채hrung


28 / 29

Die Anwendung der Gentechnik in Pflanzenzucht, Landwirtschaft und Ernährung wird als grüne Gentechnik bezeichnet. Während transgene Pflanzen in verschiedenen Regionen der Welt seit Jahren auf riesigen Flächen angebaut werden, herrscht in Europa Zurückhaltung und Skepsis gegenüber der neuen Technologie. Sind gentechnisch veränderte Lebensmittel nun ein Nutzen oder ein Risiko für die Menschheit? Eine Frage, über die nicht nur Fachleute, sondern auch die vier Bewohner und Bewohnerinnen einer Wohngemeinschaft intensiv diskutieren. «Habt ihr Hunger?», erkundigt sich Marc bei seinen Mitbewohnern. «Wie ein Bär!», erwidert Stefan. «Lass uns ein paar Spaghetti mit Salat machen. Das geht schnell und schmeckt immer.» Kopfnickend holt Marc eine Packung Teigwaren aus dem Schrank. «Schon bedenklich», wirft Cécile in die Runde, «hier steht, dass ein unbewilligter Gentech-Mais in die Schweiz importiert wurde. Konsumentenschutzorganisationen warnen vor gesundheitlichen Risiken.» Stefan, der seit vier Jahren Pflanzenbiotechnologie studiert, versucht zu beschwichtigen: «Ach, schon wieder so eine Zeitungsmeldung. Auch diese Suppe wird wohl nicht so heiss gegessen, wie sie gekocht wird.» Cécile schüttelt den Kopf: «Genfood ist gefährlich, das weiss doch jeder. Ich jedenfalls will damit nichts zu tun haben.» «Dann hast du aber ein Problem.» Stefan erklärt Cécile, dass Gentechnik heutzutage im Alltag überall präsent ist: «Dein Pulli und deine Jeans wurden womöglich aus Fasern von Gentech-Baumwolle hergestellt. Beim Waschen verwendest du Gentech-Enzyme, und in unserer Schokolade hats Lecithin aus gentechnischer Soja drin. Von den Medikamenten ganz zu schweigen.» In diesem Moment betritt Andrea die Küche. Ihre Augen bleiben bei Céciles Gesichtsausdruck hängen: «Gibts ein Problem?» Marc grinst: «Nö. Bloss eine kleine Debatte. Setz dich doch. Essen ist parat.» Während des Abendessens geht die Diskussion weiter. Cécile schaut sich die Spaghettiverpackung näher an: «Gut haben wir bei uns eine Deklarationspflicht für Genfood. Dann kann man wenigstens beim Essen selber wählen. Diese Spaghetti hier sind jedenfalls natürlich.» «Was ist denn schon natürlich?», entgegnet Marc. «Gute Frage, Marc, diese Teigwaren könnte man als Mutantenfood bezeichnen.» Stefan fängt nach dieser Bemerkung einen bösen Blick von Cécile ein: «Du übertreibst!» «Nein», fährt Stefan fort, «die heutigen Hartweizensorten entstanden durch Mutationszüchtung. Es wurde radioaktive Strahlung angewendet, um das Erbgut des Weizens zu verändern. Und daraus entstanden neue Sorten. Kein Mensch weiss, was mit diesen Pflanzen genau passiert ist.» «Und kein Hahn kräht danach», ergänzt Marc, «aber schmecken tun die Dinger.» Cécile gibt sich unbeeindruckt: «Also mir vergeht gleich die Lust am Essen. Morgen koche ich wieder. Dann gibts wenigstens Bio, da hats keine Gentechnik drin.» Marc zuckt mit den Schultern: «Guten Appetit.»

Beim Abwasch greift Stefan das Thema wieder auf: «Ich kann dich gut verstehen, Cécile, dass du Mühe hast mit Genfood. Man hört ja auch ständig Negatives darüber.» «Eben», erwidert seine Mitbewohnerin. Stefan erklärt: «Aber vieles davon stimmt nicht. Es gibt keine Belege, dass die Gentechnik gefährlich ist.» «Sagst du. Aber du bist ja hier schliesslich der Experte ...», stichelt Cécile. «Was weiss denn die Forschung heute über mögliche negative Langzeitfolgen?» Während Marc für alle einen Kaffee macht, holt er aus: «Das ist ein wichtiger Punkt, den die Wissenschaft ständig im Auge behalten muss. Noch etwas: Wir bewegen uns hier nicht im rechtsfreien Raum. Die grüne Gentechnik ist bei uns gesetzlich sehr streng geregelt – viel strenger als in den meisten anderen Ländern.» «Und was, wenn nebenan in Frankreich etwas passiert?», erwidert Cécile. «Ein gentechnisch veränderter Organismus, der sich unkontrolliert ausbreitet, macht keinen Halt vor unserer Landesgrenze.» «Ich brauche noch etwas Süsses. Haben wir Schokolade im Haus?», fragt Andrea. «Ja, gentechnisch veränderte!», hänselt Marc. Andrea nimmt eine Tafel und fängt an, die Zutatenliste zu lesen: «Sojalecithin ist drin, aber von Gentechnik steht hier nichts.» «Das heisst aber nicht, dass überhaupt kein Lecithin aus gentechnisch veränderter Soja enthalten ist. Spuren davon könnten in der Schokolade drin sein. Und man kann sie im Labor nicht einmal nachweisen, da es das haargenau gleiche Lecithin ist wie bei einer normalen Sojabohne.», weiss Stefan. Andrea ist überrascht: «Das heisst, ich esse hier vielleicht unbewusst Bestandteile einer gentechnisch veränderten Sojapflanze?» «Kann sein. Diese sind aber genauso unbedenklich für die Gesundheit wie die Gensoja selber.», beruhigt Stefan.«Wie auch immer», entgegnet Cécile, «ich will keinen Genfood essen. Basta.» «Du hast ja deinen Biofood», meint Marc. «Ich leg mal ein bisschen Sound auf. Irgendwelche Wünsche an den DJ?»


3.1 Pflanzenzüchtung Kulturpflanzen bilden die wichtigste Nahrungsgrundlage für Mensch und Tier. Trotz Pflanzenschutzmassnahmen gehen weltweit 25 – 40 % der Ernte durch Schädlinge, Krankheiten und Unkräuter verloren. Die Züchtung widerstandsfähiger und ertragreicher Sorten ist daher ein wichtiges Ziel der Landwirtschaft. Seit der Mensch vor 10 000 Jahren begann, Ackerbau zu betreiben, wählte er jedes Jahr die besonders wertvollen Pflanzen aus und vermehrte diese weiter. Durch diesen steten Eingriff in die Natur entstand über die Jahrtausende eine Vielzahl von Kulturpflanzen, die sich von ihren Vorfahren, den Wildpflanzen, grundlegend unterscheiden. «Was machst du eigentlich genau im Labor?», erkundigt sich Andrea bei ihrem Tischnachbarn. «Wir wollen verstehen, wie sich eine Kartoffelpflanze gegen Pilzbefall schützt. Wildkartoffeln können das. Wir versuchen nun, Resistenzgene zu finden und sie auf krankheitsanfällige Kultursorten zu übertragen», erklärt Stefan. «Tönt sehr technisch. Gibts da keine Probleme für die Natur?», doppelt Andrea nach. «Ein wichtiger Punkt. Zum Glück ist gerade die Kartoffel ökologisch wenig problematisch. Sie vermehrt sich durch Knollen, nicht Pollen. Die eingefügten Gene können daher nicht in andere Pflanzen auskreuzen. Unser Ziel ist eine Kartoffel, die sich selber schützt. Dann brauchts weniger Chemie, weniger Spritzmittel.» Stefan bringt seine Haltung auf den Punkt: «Also ich betrachte mich als modernen Grünen.»

Methoden der Biotechnologie Die Zuchtmethoden wurden in den letzten 100 Jahren laufend erweitert: kontrollierte Bestäubung (z.B. Weizen), Züchtung von Hybridsaatgut zur Ertragssteigerung durch die Vermehrung des Chromosomensatzes (z.B. Mais) oder Mutationszüchtung, d.h. die Behandlung von Pflanzen mit erbgutverändernden Chemikalien oder radioaktiver Strahlung (z.B. Nektarine). Die Einführung biotechnologischer Methoden erlaubte es, Pflanzen aus Zellkulturen im Labor zu züchten. Diese Technik wird etwa zur Vermehrung virusfreier Kartoffelsetzlinge eingesetzt. Allen Zuchtverfahren liegt ein gemeinsamer Prozess zugrunde: die dauerhafte Veränderung des pflanzlichen Genoms. 1983 gelang es erstmals, eine transgene Pflanze zu züchten: Ein Forschungsteam konnte ein Gen aus einem Bakterium in eine Tabakpflanze transferieren. Dieser Schritt eröffnet ganz neue Perspektiven in der Züchtung. Auch artfremde Gene – beispielsweise aus anderen Pflanzenarten, Pilzen, Tieren oder Bakterien – lassen sich ins pflanzliche Genom einbauen.

1. Ein Bakterium als Gentaxi Agrobakterium Agrobacterium tumefaciens ist ein Bodenbakterium, das Teile seines Erbguts ins Genom von Pflanzen Ti-Plasmid transferieren kann. Die übertragenen Gene veranlassen die Wirtspflanze, Proteine herzustellen, die das Bakteeinzubauendes Gen rium zum Leben benötigt. Markergen

3. Ein Unkraut steht Modell Bei den im Labor verwendeten Pflanzen handelt es sich oft um die Ackerschmalwand (Arabidopsis thaliana). Dank ihrem kleinen Genom und ihrer einfachen Kultivierung dient sie seit den 1940er-Jahren als ideale Modellpflanze für die Wissenschaft.

2. Das Gentaxi wird vorbereitet Agrobakterien besitzen sogenannte Ti-Plasmide. Diese DNA-Ringe dienen der Forschung als Instrument, um gewünschte Gene einzubauen. Mit Hilfe von Markergenen können nach dem Gentransfer jene Pflanzenzellen aufgespürt werden, welche die zuvor ins Plasmid eingefügten Fremdgene ins Genom eingebaut haben.

Blattscheibchen der Ackerschmalwand

Ackerschmalwand

4. Bakterien- und Pflanzenzellen werden zusammengebracht Die Agrobakterien mit den Zusatzgenen im Plasmid werden mit Blattscheibchen der Ackerschmalwand zusammen kultiviert.


3.2 Vom Labor aufs Feld

30 / 31

Gemäss dem Schritt-für-Schritt-Konzept werden gentechnisch veränderte Organismen (GVOs) vor ihrer Freisetzung umfangreichen Sicherheitsprüfungen unterzogen. Erst wenn nach dem aktuellen Stand der Wissenschaft gesichert ist, dass eine transgene Pflanze ebenso unbedenklich ist wie andere Gewächse, folgt der Schritt ins Freiland. Kontrollierte Feldversuche sind entscheidend, denn nur im Freiland zeigt sich, ob sich eine transgene Pflanze unter den komplexen Bedingungen der Natur bewährt. Neben der Wirksamkeit der gentechnisch eingefügten Eigenschaft werden mögliche unerwünschte Auswirkungen auf die Gesundheit von Mensch und Tier sowie auf die Umwelt überprüft. Bis eine GV-Sorte die Zulassung für den kommerziellen Anbau erhält, vergehen durchschnittlich 10 bis 15 Jahre. Situation in der Schweiz Die ersten Freisetzungsversuche in der Schweiz wurden 1991/92 von der landwirtschaftlichen Forschungsanstalt in Changins mit transgenen, virusresistenten Kartoffeln durchgeführt. Dem dritten und vorläufig letzten Feldversuch – ein Forschungsteam der ETH Zürich testete eine pilzresistente Weizensorte – ging ein jahrelanges politisches Seilziehen voraus. Auch nach erfolgter Bewilligung wurde der Versuch von Protesten gentechnisch-kritischer Kreise begleitet. Mit der Annahme der Gentechfrei-Initiative im November 2005 wurde der kommerzielle Anbau transgener Pflanzen in der Schweiz für fünf Jahre verboten. Weiterhin erlaubt sind Feldversuche zu Forschungszwecken.

Sicherheit: Die Schweiz verfügt über eines der weltweit strengsten Regelwerke für transgene Pflanzen. Wird eine transgene Pflanze kommerziell angebaut, sind Langzeituntersuchungen – man spricht von Monitoring – vorgeschrieben. Die Biosicherheitsforschung konzentriert sich auf Fragestellungen wie: Beeinträchtigen insektenresistente Kulturpflanzen neben dem Schädling auch andere Organismen auf dem Feld oder im Boden? Können sich Transgene via Pollenflug auf verwandte Wildarten ausbreiten? Führt ein solcher Gentransfer zu negativen ökologischen Auswirkungen? Die bisher vorliegenden Erkenntnisse aus weltweit Tausenden von Feldversuchen und jahrelangem kommerziellem Anbau liefern allerdings keine Hinweise, dass transgene Kulturpflanzen zu Umweltschäden geführt haben. Bislang deutet nichts darauf hin, dass die Gentechnik neue, aus der klassischen Züchtung nicht bekannte und möglicherweise unkontrollierbare Probleme hervorrufen könnte.

5. Einschleusen der Gene Die verletzten Pflanzenzellen am Scheibchenrand locken die Bakterien an und veranlassen sie, ihre DNA durch einen kleinen Verbindungskanal in die Pflanzenzelle zu spritzen. Einige der Pflanzenzellen bauen die gewünschten Gene in ihr Genom ein. Pflanzenzelle

6. Kleiner Unterschied, grosse Wirkung Das Markergen verleiht den Pflanzenzellen die Fähigkeit, die Zuckerart Mannose als Nahrung zu nutzen. Normalerweise kann dies die Pflanze nicht. Enthält das Nährmedium Mannose statt Rohrzucker, überleben nur jene Zellen, welche das Markergen besitzen. Aus diesen Zellen werden ganze Pflanzen regeneriert, die dank dem eingebauten Fremdgen über eine neue Eigenschaft verfügen.

Ackerschmalwand mit Fremdgen


3.3 Globale Situation Seit 1996 werden transgene Kulturpflanzen kommerziell angebaut. Und seither hat sich die grüne Gentechnik weltweit imposant entwickelt: Im Jahre 2006 wurden in 22 Ländern auf einer Fläche von 102 Millionen Hektar gentechnisch veränderte Sorten angepflanzt. Dies entspricht etwa der gemeinsamen Fläche von Deutschland, Frankreich und Italien. Zu den bedeutendsten Anbauländern gehören die USA, Argentinien, Brasilien, Kanada, Indien und China. Die gentechnisch veränderten Pflanzen der ersten Generation konzentrieren sich primär auf vier Arten – Soja, Mais, Baumwolle und Raps – und zeichnen sich durch verbesserte Anbaueigenschaften aus. Bei Soja beträgt der Anteil transgener Pflanzen mittlerweile 64 % der Welternte, bei Baumwolle 38%. Über zehn Millionen Bäuerinnen und Bauern, grösstenteils aus Entwicklungsländern, kultivierten 2006 transgene Kulturpflanzen. In Europa sind die Anbauflächen vergleichsweise bescheiden. In der Schweiz wurden noch nie transgene Pflanzen kommerziell angebaut. Beiträge zur Sicherung der Welternährung Weltweit leiden über 850 Millionen Menschen an Unterernährung und Hunger. Das ist jeder achte Mensch. Gemäss Prognosen der UNO wird die Weltbevölkerung bis ins Jahr 2025 auf neun Milliarden Menschen anwachsen. Gleichzeitig schrumpft vielerorts die landwirtschaftliche Nutzfläche durch Erosion, Versalzung oder Zersiedelung. Damit die Menschheit

langfristig ausreichend mit Lebensmitteln versorgt werden kann, braucht es neben einer Umverteilung der Güter auch Ertragssteigerungen auf den verfügbaren Anbauflächen. Eine weitere Herausforderung besteht darin, Kulturpflanzen zu züchten, die auch bei Hitze, Dürre oder auf salzhaltigen Böden gedeihen können. Schliesslich gilt es Pflanzen mit verbessertem Nährstoffgehalt zu züchten, um Mangelernährung entgegenzuwirken. Es ist unbestritten, dass die Gentechnik alleine das komplexe Hungerproblem nicht lösen kann. Handlungsbedarf besteht auf sozialer, politischer und ökonomischer Ebene sowie bei der Ausbildung, insbesondere von Frauen. Gentechnische Zuchtmethoden können aber einen Beitrag leisten, um die drei genannten Ziele zu erreichen. Cécile hat sich in ihr Zimmer zurückgezogen. Auf dem Bett liest sie einen Brief von Saranya, ihrer indischen Freundin. Zweimal schon ist Cécile durch Indien gereist. Sie ist fasziniert von dieser Kultur. Aber auch deprimiert angesichts der Armut und des Hungers, den sie dort vorfand. Stefan hat ihr vom «Goldenen Reis» erzählt. Einem Reis, der helfen soll, Vitamin-A-Mangel in Entwicklungsländern zu bekämpfen. Cécile ist nachdenklich. Könnte es sein, dass dieser Gentech-Reis vielleicht doch sein Gutes hat? Ich frage mal Saranya, was sie davon hält. Ihr Onkel ist ja Bauer. Denkt sie und beginnt zu schreiben.


32 / 33

Weltweiter Anbau von GV-Pflanzen Quelle: International Service for the Acquisition of Agri-biotech Applications (ISAAA), www.isaaa.org

Entspricht 100 000 ha Anbaufläche für transgene Pflanzen

Insektenresistente Baumwolle Baumwollpflanzen liefern die Hälfte der Rohstoffe für die globale Textilindustrie. Ihr Hauptschädling ist der Baumwollkapselbohrer, gegen den grosse Mengen an Insektiziden gespritzt werden müssen. Analog zum Mais (siehe Folgeseiten) wurden transgene Baumwollsorten gezüchtet, die in ihren Zellen das Bt-Protein bilden. Dieses Eiweiss schützt die Pflanzen gegen Frassinsekten wie den Baumwollkapselwurm. In verschiedenen Studien wurden die Erfahrungen der Bauern mit Bt-Baumwolle untersucht, insbesondere in China und Indien. Ergebnisse aus Indien von 2001 bis 2006 zeigen für die Landwirte deutliche Vorteile gegenüber dem Anbau herkömmlicher Sorten: Der Einsatz chemischer Pflanzenschutzmittel konnte bei Bt-Baumwolle um bis zu 70 % gesenkt werden. Damit sank nicht nur die ökologische Belastung auf den Feldern, sondern sanken auch die gesundheitlichen Risiken für die Produzentinnen und Produzenten durch Insektizidvergiftungen. Gleichzeitig stiegen die Erträge im Durchschnitt um knapp die Hälfte. Der Reingewinn der Landwirte wuchs um durchschnittlich zwei Drittel. Diese Zahlen variieren allerdings je nach Land, Anbauregion und -saison.

Anbaufläche transgener Pflanzen 1996 Zunahme Anbaufläche transgener Pflanzen bis 2001 Zunahme Anbaufläche transgener Pflanzen bis 2006

«Goldener Reis» Ein Beispiel, wie die grüne Gentechnik helfen kann, der Mangelernährung in Entwicklungsländern zu begegnen, ist der Provitamin-A-Reis. Reis wird vorwiegend geschält gegessen, da er ohne Schale nicht ranzig wird und besser gekocht werden kann. Geschälter Reis enthält jedoch kein Provitamin A (Beta-Karotin). Deshalb leiden Menschen, die sich fast ausschliesslich von Reis ernähren, häufig an Vitamin-A-Mangel. Bei Kindern führt dies zu einer erhöhten Infektionsanfälligkeit sowie Sehstörungen und Blindheit. Millionen von Menschen sind davon betroffen. Forschern der ETH Zürich und der Universität Freiburg im Breisgau ist es gelungen, durch die Übertragung von drei Genen aus einem Bakterium und der Osterglocke eine Reissorte zu entwickeln, die im Korn selber Provitamin A produziert. Dies verleiht dem Reiskorn eine gelbgoldene Farbe, weshalb die Sorte unter dem Namen «Goldener Reis» bekannt wurde. Der Provitamin-A-Reis soll als humanitäres Projekt den Kleinbäuerinnen und Kleinbauern in Entwicklungsländern kostenlos zur Verfügung stehen. Die beteiligten Unternehmen haben weitgehend auf ihre Patentansprüche verzichtet. Aufgrund der langwierigen Zulassungsverfahren wird noch einige Zeit vergehen, bis die Bäuerinnen und Bauern den «Goldenen Reis» anpflanzen und damit die Versorgung der lokalen Bevölkerung mit Vitamin A verbessern können.


3.4 Lebensmittel In der Schweiz sind einige gentechnisch veränderte Pflanzen sowie verschiedene Produkte aus transgenen Mikroorganismen als Lebensmittel bzw. als Bestandteile von Nahrungsmitteln zugelassen.

um empfindliche Frischprodukte wie Fleisch vor dem Verderb zu bewahren, indem sie krankheitserregende Keime am Wachstum hindern. Die Forschung erprobt gentechnische Methoden zur Optimierung von Starter- und Schutzkulturen.

Enzyme und Zusatzstoffe Enzyme sind spezielle Proteine, die chemische Reaktionen beschleunigen. Sie kommen als Verarbeitungshilfsstoffe in der Lebensmittelproduktion seit Jahrzehnten zum Einsatz. Beispiele aus der Praxis sind das Enzym Chymosin (Labferment) zur Herstellung von Käse oder Pektinasen zur Produktion von Fruchtsäften. Mehr als 90 % der eingesetzten Enzyme stammen heute aus gentechnisch veränderten Mikroorganismen. Diese erlauben es, die Enzyme reiner, effizienter und umweltfreundlicher herzustellen. Auch Zusatzstoffe wie Vitamine, Süssstoffe, Farbund Konservierungsstoffe werden zunehmend mit gentechnisch veränderten Mikroorganismen gewonnen.

Soja mit integrierter Herbizidtoleranz Seit 1996 ist bei uns eine transgene herbizidtolerante Sojabohne als Nahrungs- und Futtermittel zugelassen. Tausende Lebensmittel enthalten Sojaerzeugnisse, beispielsweise Lecithin als Emulgator in Süsswaren. Grosse Schwierigkeiten beim Sojaanbau bereiten Unkräuter, die nur durch Spritzen von Unkrautbekämpfungsmitteln in Schach zu halten sind. Um die Unkrautkontrolle zu vereinfachen, züchteten Forschende eine Sojasorte, die unempfindlich ist gegen Glyphosat. Glyphosat ist ein Herbizid, das im Boden rasch abgebaut wird. Werden die transgenen Sojafelder mit Glyphosat besprüht, werden die Unkräuter vernichtet, während die Sojapflanze weiter gedeiht. Die Bäuerinnen und Bauern müssen daher das Spritzmittel erst dann einsetzen, wenn die Konkurrenz der Unkräuter für die Sojapflanzen zu gross wird. Die transgene Soja erlaubt zudem eine pfluglose Bodenbearbeitung der Felder, was der Bodenerosion entgegenwirkt. So spart der Landwirt nicht nur Zeit, Energie und Spritzmittel, sondern schont auch die Umwelt.

Mikroorganismen Mehr als ein Viertel unserer Nahrungsmittel wird mit Hilfe von Mikroorganismen hergestellt. Als Starterkulturen werden Hefen zur Produktion von Brot, Wein und Bier eingesetzt, Milchsäurebakterien helfen bei der Herstellung von Joghurt oder Sauerkraut. Zudem finden Mikroorganismen Verwendung als Schutzkulturen,

Maiszünsler

Bacillus thuringiensis (Bt)

1. Ein gefürchteter Schädling 3. Das Bt-Protein nützen Der Maiszünsler ist ein HauptAus den Bt-Bakterien isolieren die schädling im Maisanbau. Die Pflanzenforscher und -forscherinnen Raupen bohren sich in den das Gen mit dem Bauplan für das Stängel und fressen sich Bt-Eiweiss und bauen es ins Genom durch die Maispflanze. von Maispflanzenzellen ein. Bei Jährlich vernichtet Pflanzen ist es möglich, ausgeder Schädling hend von einem Blatt oder sogar weltweit 7 % der einzelnen Zellen wieder eine Maisernte. ganze Pflanze heranwachsen zu lassen. Bt-Protein

Bt-Protein

toter Maiszünsler Maispflanzenzelle Bt-Gen 2. Ein Eiweiss mit Wirkung Das Bodenbakterium Bacillus thuringiensis (Bt) stellt natürlicherweise ein Protein her, das für bestimmte Insektenraupen tödlich ist. Für die allermeisten anderen Insekten sowie für Mensch und Tier ist das Bt-Eiweiss unbedenklich.

junge Maispflanze


34 / 35 4. Mais mit eingebautem Schädlingsschutz Die Pflanzen stellen nun in ihren Zellen das Bt-Protein her. Fressen die Raupen an den Blättern und Stängeln, bekommen sie die Wirkung des Bt-Toxins zu spüren – der Befall mit Schädlingen geht stark zurück. Bei neueren Bt-Maissorten wird das Bt-Toxin nur in den grünen Pflanzenteilen, nicht aber in den Körnern produziert.

Bt-Mais

3.5 Ein GV-Produkt für die Schweiz Der Pilz Phytophtora infestans löst die Kraut- und Knollenfäule aus und vernichtet jährlich rund ein Fünftel der weltweiten Kartoffelernte. Im Schweizer Kartoffelanbau werden jedes Jahr 50 Tonnen Fungizide (Pilzbekämpfungsmittel) gegen diese Krankheit gespritzt. Im Biolandbau verwenden die Bäuerinnen und Bauern bis zu 4 kg Kupfer pro Hektar. Kupfer reichert sich im Boden an und kann diesen auf die Dauer unfruchtbar machen. In Südamerika existieren Phytophtora-resistente Wildformen der Kartoffel. Bisherige Versuche, die Resistenzeigenschaften der Wildarten mit traditionellen Zuchtmethoden in kommerzielle Kartoffelsorten einzukreuzen, waren nur wenig erfolgreich. Der Forschung ist die Isolierung einiger der zugrunde liegenden Resistenzgene gelungen. Eine transgene Sorte mit zwei Resistenzgenen wurde 2006 in Deutschland in Feldversuchen getestet. Die Gene lösen in den Kartoffeln Abwehrreaktionen aus, welche die Ausbreitung des Pilzes erschweren. Transgene, pilzresistente Kartoffeln wären auch für Schweizer Bauern eine interessante Option, um den Fungizideinsatz bedeutend zu reduzieren.

5. Erfahrungen vom Acker Bt-Mais bringt in der Regel höhere Erträge, da weniger Pflanzen dem Schädling zum Opfer fallen. Zudem spart der Landwirt Treibstoff und chemische Pflanzenschutzmittel. Weiter zeigte sich, dass Nützlinge wie der Monarchschmetterling in BtMaisfeldern mehr geschont werden als in konventionellen, mit Spritzmitteln behandelten Feldern.

konventioneller Mais

Sicherheit: Gentechnisch veränderte Lebensmittel gehören zu den bestuntersuchten Nahrungsmitteln überhaupt. Sie durchlaufen umfassende Sicherheitsprüfungen. Dazu gehört die Abklärung, ob die neu gebildeten Proteine Allergien auslösen können. Zur Beantwortung dieser Frage stehen verlässliche Computer-, Labor- und Hauttests zur Verfügung. Ein zweiter wichtiger Aspekt ist die Toxikologie: Sind transgene Eiweisse oder andere Inhaltsstoffe giftig für Mensch und Tier? Wichtiges Element dieser Prüfungen sind Fütterungsstudien an Tieren. Nur wenn sämtliche Untersuchungen zeigen, dass ein GV-Produkt gleich sicher ist wie ein herkömmliches Lebensmittel, wird es zugelassen. Seit über zehn Jahren werden gentechnisch veränderte Lebensmittel weltweit von Millionen von Menschen konsumiert, ohne dass bisher irgendein gesundheitliches Problem aufgetaucht ist. Übrigens: Gene zu essen, ist nichts Neues. Wir nehmen täglich mit unseren Nahrungsmitteln – ob gentechnisch verändert oder nicht – etwa ein Gramm DNA auf.


3.6 Bewilligung, Deklaration, Grenzwerte Eine Mehrheit der Schweizerinnen und Schweizer steht der Gentechnik in Landwirtschaft und Ernährung skeptisch oder gar ablehnend gegenüber. Die Gründe dafür sind vielschichtig. Tatsache ist, dass die bisher zugelassenen GVO-Erzeugnisse den Konsumentinnen und Konsumenten keine direkten Vorteile bringen. Fakt ist auch, dass die Diskussion um GV-Pflanzen und GV-Nahrungsmittel häufig von undifferenzierter Kritik und hypothetischen Gefahrenszenarien geprägt ist. Und dies, obwohl sich die bisher zugelassenen GV-Produkte als sicher für Mensch, Tier und Umwelt erwiesen haben. Genau dies ist im Gentechnikgesetz und im Lebensmittelgesetz vorgeschrieben: GV-Produkte werden von den Behörden erst bewilligt, wenn nach dem Stand der Wissenschaft eine Gefährdung der Gesundheit und der Umwelt ausgeschlossen werden kann. Wahlfreiheit dank Kennzeichnung Zweiter zentraler Eckpfeiler neben dem Gesundheitsschutz ist der Täuschungsschutz der Konsumentinnen und Konsumenten: GV-Produkte müssen in der Schweiz gekennzeichnet werden. Die Lebensmittelverordnung schreibt vor, dass ein Nahrungsmittel als «gentechnisch bzw. genetisch verändert» deklariert werden muss, wenn es mehr als 0,9 % GVO-Anteil enthält. Da sich bei Ernte, Transport oder Verarbeitung unbeabsichtigte Ver-

mischungen von herkömmlichen mit GV-Produkten nicht restlos vermeiden lassen, wurde eine solche Deklarationslimite eingeführt. Bei Futtermitteln beträgt dieser Wert ebenfalls 0,9 %, bei Saatgut liegt der Schwellenwert bei 0,5 %. Koexistenz heisst nebeneinander Auch die landwirtschaftliche Produktion ohne gentechnisch veränderte Organismen ist per Gesetz geschützt. Es ist unbestritten, dass ein Nebeneinander von Anbausystemen mit und ohne Gentechnik in der kleinräumigen Schweizer Landwirtschaft hohe Anforderungen an die Umsetzbarkeit stellt. Verschiedene Studien haben jedoch gezeigt, dass die Koexistenz – je nach Pflanzenart – durchaus möglich ist. Bei Kartoffeln zum Beispiel ist eine Auskreuzung durch Pollenflug kein Problem, da sich Kartoffeln via Knollen vermehren. Auch Weizen ist als Selbstbefruchter unproblematisch. Bei Mais reicht ein Isolationsabstand von 50 Metern zwischen einem Feld mit und einem ohne GVO, um die Auskreuzungsrate unter 0,5 % zu halten. Daneben existieren Kulturen wie Roggen, deren Pollen sehr weit fliegen, ohne ihre Fruchtbarkeit zu verlieren. Hier ist eine saubere Trennung problematisch. Nötig ist auch eine strikte Warenflusstrennung bei Ernte und Verarbeitung.


3.7 Neue Produkte am Horizont Längst arbeiten die Pflanzenbiotechnologinnen und -biotechnologen an der zweiten und dritten Generation transgener Kulturen. Die Fortschritte der funktionellen Genomik und Proteomik sowie Automatisierungen und die Bioinformatik ermöglichen detaillierte molekulare Einsichten in die Pflanzenzelle. Zunehmend können mit der Gentechnik auch komplexere Zielsetzungen verfolgt werden. Drei Beispiele zeigen dies exemplarisch auf: Optimierte Kartoffelstärke Die Kartoffel ist nicht nur ein wichtiger Stärkelieferant für die Ernährung, sondern auch ein bedeutender Rohstofflieferant für die Papier-, Textil- und Klebstoffindustrie. Kartoffelstärke besteht aus Amylose und Amylopektin. Deutsche Forschende züchteten eine transgene Kartoffel, bei der das Gen für die Amylosebildung abgestellt ist. Dadurch enthält ihre Stärke praktisch nur noch Amylopektin, einen idealen Ausgangsstoff für vielfältige industrielle Verwendungszwecke. Pflanzenbasierte Arzneimittel Seit Jahren wird an Pflanzen gearbeitet, die Medikamente oder Impfstoffe produzieren. Von diesen pflanzlichen Pharmafabriken erhoffen sich die Forscherinnen und Forscher eine

Ethik: Gentechnisch veränderte Lebensmittel werden von der US-amerikanischen Bevölkerung anders bewertet als von den Europäerinnen und Europäern. Während die Gentechnik in den USA auch in der Ernährung als grundsätzlich positive Entwicklung angesehen wird, sind viele Menschen in Europa neuen Techniken gegenüber skeptisch eingestellt, gerade auch in der Lebensmittelproduktion. Zentral in der ethischen Beurteilung von GV-Lebensmitteln ist – neben der Sicherheit für Mensch, Tier und Umwelt – die Wahlfreiheit der Konsumentinnen und Konsumenten. Diese ist bei uns durch Deklarationsvorschriften und regelmässige Kontrollen gewährleistet. Deklarationslimiten sind Vorraussetzung für die praktische Umsetzbarkeit der Vorschriften. Angesichts des Beispiels Provitamin-A-Reis, der möglicherweise einen wichtigen Beitrag zur Bekämpfung des Vitamin-A-Mangels in Entwicklungsländern leisten kann, und der umweltschonenden Wirkungen vieler GV-Pflanzen, stellt sich aber auch die Frage, ob es ethisch gerechtfertigt ist, auf den potenziellen Nutzen der grünen Gentechnik zu verzichten.

36 / 37

kostengünstige Herstellung in grossen Mengen. In transgenen Tabakpflanzen, Tomaten oder Disteln werden Impfstoffe gegen Cholera oder Sars sowie Medikamente wie Insulin oder Interferon hergestellt. Mehrere davon werden derzeit in klinischen Studien am Menschen getestet. Trockenheitsresistente Gewächse Ägyptische Wissenschaftler testen gentechnisch optimierte Weizensorten in Freilandversuchen, die gegenüber herkömmlichen Sorten mit deutlich weniger Wasser auskommen. Ein zusätzliches Gen aus der Gerste machts möglich. «Schau mal, was ich hier habe.» Stefan drückt Marc eine Bierflasche in die Hand. «Maisbier?», meint dieser erstaunt. «Ja, und erst noch ein Spezielles: gebraut aus Gentech-Mais», antwortet Stefan. «Ich habe die Flasche an einer Ausstellung über die grüne Gentechnik erhalten.» «Au ja, da stehts: GVO – gentechnisch veränderte Organismen. Und was soll ich jetzt damit?», reagiert Marc. «Probier mal. Ist gar nicht übel», schlägt Stefan vor. «Es ist das erste Mal, dass ich bewusst ein Gentech-Produkt in den Händen halte. In den Läden habe ich Genfood noch nie gesehen.» Marc nimmt einen kräftigen Schluck: «Hmm, tatsächlich. Gar nicht so schlecht. Schmeckt wie Bier.» «Ist es ja auch», erwidert Stefan.


4 Weisse Biotechnologie und Umweltschutz


38 / 39

Unter weisser Biotechnologie versteht man industrielle Produktionsverfahren, die natürliche oder gentechnisch optimierte Enzyme, Zellen oder Mikroorganismen einsetzen. Die biotechnologischen Verfahren bieten wirtschaftlich und ökologisch interessante Alternativen zu chemischen Prozessen. Die Zahl der auf solche Produkte spezialisierten Firmen nimmt ständig zu. Besuch in einem Biotech-Unternehmen. Beim Fermenter hinten links blinkt es. Dirk Bächler schaut auf den Monitor und kontrolliert die Einstellungen der Produktionsanlage. Die Bakterien im Tank, die ein Lipase-Enzym herstellen, reagieren sehr sensibel auf Wechsel in ihrer Umwelt wie Temperaturoder Nährstoffschwankungen. Das computergesteuerte Programm schlägt Anpassungen vor, die Dr. Bächler bestätigt. Während er darauf wartet, dass sich die Signale auf dem Bildschirm angleichen, widmet er sich wieder den Unterlagen aus der gestrigen Sitzung: «Die Biotechnologie verspricht, einen bedeutenden

Beitrag zur Lösung grundlegender Umweltprobleme zu leisten, indem sie beispielsweise (...) eine verbesserte Trinkwasserversorgung, effizientere Industrieprozesse für die Rohstoffumwandlung, Unterstützung für nachhaltige Aufforstungs- und Wiederaufforstungsverfahren und die Entgiftung gefährlicher Abfälle ermöglicht.» Herr Bächler ist verblüfft, als er liest, woher das Zitat stammt: Dieser Satz wurde an der Umweltkonferenz in Rio de Janeiro festgehalten. Er steht in Kapitel 16 der «Agenda 21», des umweltpolitischen Aktionsprogramms. Für Dirk Bächler ist klar, dass die weisse Gentechnik einen grossen Beitrag zum Umweltschutz leistet. Aber er merkt immer wieder, wie schwierig es ist, dies seiner Familie und seinen Freunden zu erklären. Industrielle Verfahren bringen viele Leute automatisch mit Umweltverschmutzung in Verbindung. Dank den Enzymen, die seine Firma herstellt, sind Verfahren möglich, die im Vergleich zu den herkömmlichen chemisch-synthetischen Techniken massiv Energie, Abfall und Abwasser einsparen.

4.1 Biokatalyse Enzyme sind biologische Katalysatoren – sie beschleunigen chemische Reaktionen. Sie arbeiten nicht nur sehr schnell und genau, sondern auch umweltfreundlich: in wässrigem Milieu, bei gemässigtem pH-Wert, Druck und gemässigter Temperatur. Der grosstechnische Einsatz der Biokatalyse löst daher viele umweltbelastende Verfahren ab, etwa in der Papier-, Lederund Textilindustrie sowie bei der Herstellung von Reinigungsmitteln und anderen Chemikalien. Die Produktion von Enzymen erfolgt heute fast ausnahmslos mit gentechnisch veränderten (GV) Organismen. Die gentechnische Produktion ist bedeutend umweltschonender als alle herkömmlichen Methoden. Für die Gewinnung des Enzyms Glucosidase z.B. werden dank gentechnisch veränderter Hefe 80 % weniger Strom verbraucht, und die Produktionsabfälle sind um 97 % reduziert. Waschen und Entrosten In unserem Alltag setzen wir Enzyme beispielsweise in der Waschküche ein. Die handelsüblichen Waschmittel enthalten Enzyme, die darauf spezialisiert sind, Fette, Stärke und Eiweisse abzubauen, wodurch die Sauce- und Spaghetti-Flecken verschwinden. Dank dieser Enzyme konnte die Waschtemperatur von 90 auf 40 Grad reduziert und die Waschleistung verbessert werden. In der Textilindustrie kommen Enzyme bei der Bleichung von Jeans zum Einsatz. Statt umweltschädlicher chlorhaltiger Substanzen wird das gentechnisch hergestellte

Enzym Laccase eingesetzt, um «stonewashed» Jeans herzustellen. Ein anderes Beispiel kommt aus dem Bereich des Metallbaus: Die zur Entrostung eingesetzten Stoffe enthalten gesundheits- und umweltschädliche Chemikalien. Es gibt Mikroorganismen mit der Fähigkeit, Rostschichten abzutragen. Die Forschung arbeitet daran, diesen Vorgang zu verbessern und eine umweltfreundliche Entrostungsalternative zu entwickeln.


4.2 Biosynthese

4.3 Bioindikatoren

Ein weiterer Einsatz der Gentechnik für den Umweltschutz ist die Biosynthese. Die Herstellung hochwertiger Stoffe mit Hilfe transgener Organismen wird vor allem in der pharmazeutischen Industrie angewendet. Doch GV-Organismen werden auch dazu eingesetzt, Produkte statt aus fossilen Rohstoffen wie Erdöl oder Erdgas aus erneuerbaren Ressourcen herzustellen. In einem gross angelegten Projekt in Frankreich arbeiten Forschende z.B. daran, chemische Produkte auf der Basis von Getreide zu entwickeln. Zu den möglichen Anwendungsgebieten gehören Lösungsmittel, Kunststoffe oder innovative Strassenbeläge.

Arsen ist als giftige Substanz im Grundwasser eine grosse Bedrohung. In Entwicklungsländern wird das Wasser vielerorts mit Handpumpen gefördert und ohne Kontrolle und Aufbereitung konsumiert, was bei belastetem Wasser zu Arsenvergiftungen und Krebs führt. Da die Menge des Giftes stark schwankt, muss das Wasser in den Brunnen regelmässig kontrolliert werden. Dazu ist ein einfaches und billiges Nachweisverfahren nötig. Dies bietet ein Bioindikator, der auf gentechnisch veränderten Bakterien beruht. Bioindikatoren erlauben den Nachweis von Chemikalien in einer Luft-, Boden- oder Wasserprobe. Der Arsennachweis beruht auf der Fähigkeit von Darmbakterien, Arsen zu erkennen und mit der Produktion eines Abwehrproteins zu reagieren. Forschenden ist es gelungen, die Bakterien so zu verändern, dass sie in Reaktion auf Arsen ein Enzym produzieren, das eine farblose Substanz in einen blauen Farbstoff umwandelt. Die transgenen Bakterien werden auf Papierstreifen aufgetragen. Wird der Teststreifen mit Brunnenwasser benetzt, kann an der Blaufärbung der Arsengehalt abgelesen werden. Das preisgekrönte Verfahren wird bereits in der Praxis eingesetzt.

Kompostierbare Shampooflaschen Einige Mikroorganismen bilden in kleinen Mengen plastikartige Reservestoffe. Durch Gentechnik kann die mikrobielle Produktion gelenkt und gesteigert werden. Als biologisch abbaubares Plastik sind die Stoffe ideal für kurzlebige Güter wie Tragtaschen oder Shampooflaschen. In den USA gibt es bereits Unternehmen, die im industriellen Stil Bioplastik herstellen, etwa Polylactid. Das kompostierbare Plastik wird vor allem für die Verpackung von Lebensmitteln eingesetzt. Es findet sich aber auch in Wasserflaschen, Teppichen, Telefonkarten und Autos – seit 1998 baut Toyota Bioplastik-Bauteile in einige Fahrzeugmodelle ein. Spinnenseide: stärker als Stahl Spinnen produzieren für ihre Netze einen Seidenfaden aus Proteinen. Der Forschung ist es gelungen, das Gen dafür ins Erbgut eines Bakteriums einzubauen. In grossen Fermentern produzieren die Mikroorganismen das Material, das sich durch eine äusserst hohe Zugfestigkeit und Elastizität auszeichnet. Ähnlich wie Wolle vermag Spinnenseide Wasser aufzunehmen und wieder abzugeben und ist biologisch abbaubar. Der gentechnisch erzeugte Stoff kann in der Textilindustrie, für Oberflächenbeschichtungen oder in der Medizintechnik eingesetzt werden.

Sicherheit: Als 1973 die erste gentechnische Veränderung eines Bakteriums gelang, war die Wissenschaftswelt nicht nur fasziniert, sondern auch wachsam. Forscherinnen und Forscher aus aller Welt trafen sich im kalifornischen Asilomar, um Risiken der Gentechnik zu diskutieren. Die erarbeiteten Richtlinien bildeten die Basis für sicheres Arbeiten mit GV-Organismen. Seither wurden sie laufend erweitert. Bereits vor der Zeit der Gentechnik arbeiteten Forscherinnen und Forscher mit Mikroorganismen, teils auch mit gefährlichen wie dem Pockenvirus. Diese Erfahrung im sicheren Umgang mit Bakterien und Viren war sehr nützlich für das Handhaben gentechnisch veränderter Organismen in Laboratorien und Produktionsanlagen. Bei den Verfahren der weissen Gentechnik wie Biokatalyse und Biosynthese werden keine GV-Organismen in die Umwelt freigesetzt. Die Produktion erfolgt in geschlossenen Systemen. Im Endprodukt findet sich keine DNA, sondern nur das Enzym (etwa beim Waschmittel). Strenge Vorschriften über die technischen Vorkehrungen wie Sicherheitsfilter oder Abwasserbehandlungen gewährleisten die Sicherheit im Labor und in den biotechnologischen Produktionsstätten.


4.4 Biologische Sanierung

4.5 Biokraftstoffe

Die Reinigung von Abwasser und Abluft und die Sanierung von Altlasten sind zentrale Anliegen im Umweltschutz. Teilweise geschehen sie über biologische Verfahren. Der klassische Fall des Einsatzes von Mikroorganismen findet sich in Kläranlagen. Das Stoffwechselpotenzial von Bakterien, Hefen und Pilzen ist so vielfältig, dass es sich zum Abbau von Schadstoffen zu unproblematischen Substanzen eignet. Mikroorganismen können sogar Erdöl abbauen. Nach dem Tankerunglück der Exxon Valdez reinigten Mikroorganismen rund 1800 km der Küste Alaskas von ungefähr 40 Millionen Litern Öl.

Die Umstellung von fossilen Ausgangsstoffen auf der Basis von Erdöl und Erdgas auf nachwachsende Rohstoffe ist weltweit eine Herausforderung. Zwei flüssige Biotreibstoffe sind bereits breit auf dem Markt: Biodiesel und Bioethanol. Dieselmotoren wurden ursprünglich für den Betrieb mit pflanzlichen Ölen entwickelt, etwa mit Rapsöl. Eine Idee, die nun erneut aufgegriffen wird. Zur Gewinnung von Bioethanol (Alkohol) werden stärkeund zuckerhaltige Pflanzen vergärt. In mehr als 30 Ländern wird heute Bioethanol in grossem Stil aus Biomasse gewonnen. In Brasilien liegt der Marktanteil von Bioethanol am gesamten Kraftstoffverbrauch schon bei 16 %. In Europa hat Schweden die Vorreiterrolle inne.

Mikroben und Pflanzen als Aufräumtruppe Die Mikroorganismen in Kläranlagen sind nicht gentechnisch verändert. Es gibt jedoch Anwendungen der biologischen Sanierung, wo Gentechnik sinnvoll wäre. Beispielsweise für die Eliminierung von Substanzen wie langkettigen Kohlewasserstoffen oder Dioxin, die bislang nicht biologisch abbaubar sind. Zahlreiche Projekte befassen sich mit der Erforschung geeigneter Stoffwechselwege in Mikroorganismen. Andere Teams arbeiten daran, Schwermetall transformierende Pflanzen zu verbessern. Bereits ist es gelungen, Senfpflanzen mit Hilfe der Gentechnik so zu verändern, dass sie aus dem Boden Quecksilber aufnehmen und in eine unproblematischere Form umwandeln.

GV-Mais und Stroh im Tank Die Gentechnik unterstützt die Produktion von Biokraftstoffen zweifach. Einerseits hilft sie, geeignete Pflanzensorten zu züchten. In den USA wird ein GV-Mais erprobt, der in den reifen Körnern ein Stärke spaltendes Enzym produziert, das die Körner vorverdaut. Dadurch kann bei der Ethanolherstellung ein Viertel der Energie eingespart werden. Zudem sind dank Gentechnik Enzyme in grossen Mengen herstellbar. Um bisher nicht nutzbare (Abfall-)Stoffe wie Stroh, Maisstängel oder Holzabfälle für die Gewinnung von Biokraftstoff zu nutzen, muss die Cellulose in den Pflanzen enzymatisch aufgeschlossen werden. Die billige Produktion geeigneter Enzyme in GV-Mikroorganismen ist die Voraussetzung dafür.

Herstellung eines Enzyms zur Blutzuckerbestimmung

Herkömmliche Produktion im Bakterium Leuconostoc

Verbrauch an Nährstoffen

6400 kg = 100 %

Verbrauch an Trinkwasser

120 m3 = 100 %

Einsatz von Ammoniumsulfat

13 000 kg = 100 %

Produktion im gentechnisch veränderten E. coli-K12-Bakerium

2,5 % = 160 kg

0,8 % = 1m3

1,5 % = 200 kg

Verbrauch an Kühlwasser

1500 m3 = 100 %

2,0 % = 30 m3

Abwassermenge

1200 m3 = 100 %

0,02 % = 0,2 m3

Stromverbrauch

4000 kWh = 100 %

Quelle: Bayerisches Staatsministerium für Umwelt, Gesundheit und Verbraucherschutz

2,5 % = 100 kWh

40 / 41


5 Gesetzgebung


42 / 43

Die Gentechnik betrifft viele Bereiche unseres Lebens. Entsprechend ist die Regelung der Gentechnik in zahlreichen Gesetzen festgeschrieben und immer wieder im Umbruch. Das Volk entscheidet beim Prozess der Gesetzgebung mit. Dass dies nicht immer einfach ist, zeigt sich beim öffentlichen Vortrag «Gentechnik im Einkaufskorb – was ist zugelassen?». Der Saal ist gut gefüllt. Nach einer Einführung über Gentechnik kommt die Referentin auf die Gesetzgebung zu sprechen. In diesem Zusammenhang erwähnt sie drei Schweizer Abstimmungen zum Thema: die Verfassungsartikel über Gentechnologie 1992, die Genschutzinitiative 1998 und das Stammzellforschungsgesetz 2004. Die Rednerin wendet sich ans Publikum: «Denken Sie an eine der Abstimmungen zurück. War das Ausfüllen des

Stimmzettels für Sie eine einfache Entscheidung?» Etwa die Hälfte des Publikums nickt, die anderen schütteln die Köpfe. «Das ist verständlich», fährt sie fort, «solche Vorlagen sind komplex und nicht einfach zu beurteilen.» Doch die Abstimmungen haben ein klares Bild ergeben: Das Stimmvolk hat sich in den letzten 15 Jahren immer wieder gegen generelle Verbote und für eine kontrollierte Nutzung der Gentechnik ausgesprochen. Das heisst, Missbräuche sollen verhindert und Risiken möglichst ausgeschlossen werden. Diese Abstimmungen stellten die Weichen für die Gentechnik-Gesetzgebung in der Schweiz. Die Referentin betont: «In Ihren Einkaufskörben liegen daher verschiedene zugelassene gentechnisch hergestellte Produkte, darunter Medikamente, Fruchtsaft, Waschmittel oder T-Shirts.»

5.1 Schweizerische Bundesverfassung Die Grundlage für die Gentechnikregelung in der Schweiz bilden zwei Abschnitte in der Bundesverfassung. Artikel 119 regelt die Gentechnologie im Humanbereich und die Fortpflanzungsmedizin, Artikel 120 die Gentechnologie bei Tieren, Pflanzen und Mikroorganismen. Diese Verfassungsbestimmungen wurden vom Stimmvolk mit einer grossen Mehrheit von 74 % gutgeheissen. Die Artikel schützen den Menschen vor Missbräuchen, schreiben aber auch mehrere Verbote fest. So ist jede Art des Klonens von Menschen untersagt, und es ist nicht erlaubt, Embryonen gentechnisch zu verändern. Neben den Verboten enthalten die Artikel einen Auftrag. Sie weisen den Bund an, unter Einhaltung der Menschenwürde und der Würde der Kreatur Vorschriften über den Umgang mit Erbgut

zu erlassen. Ziel ist es, die Sicherheit von Mensch und Umwelt zu wahren sowie die genetische Vielfalt zu schützen. Um den Auftrag der Bundesverfassung zu erfüllen, wurde in den 90erJahren das Gesetzespaket «Gen-Lex» vorbereitet. Gleichzeitig reichten verschiedene Organisationen die Genschutzinitiative ein. Diese forderte, die Herstellung transgener Tiere, die Patentierung im Gentechnikbereich und die Freisetzung von gentechnisch veränderten Organismen (GVO) zu verbieten. Im Juni 1998 kam die Initiative vors Volk und wurde mit einer Zweidrittelmehrheit abgelehnt. Das Stimmvolk wollte keine generellen Verbote, sondern eine klare Regelung der Gentechnik, wie sie die Gen-Lex anstrebte.

5.2 Internationale Abkommen Die Gentechnik wird weltweit und länderübergreifend angewandt. Diverse europäische Regelungen und internationale Abkommen sind auch für die Schweiz relevant. Beispielsweise hat die Schweiz wie viele andere Länder das Übereinkommen über Menschenrechte und Biomedizin (Bioethikkonvention) unterschrieben. Darin ist jede Form von Diskriminierung einer Person aufgrund ihres Erbmaterials verboten. Weiter ist festgesetzt, dass Veränderungen des menschlichen Erbgutes nur zu therapeutischen Zwecken erlaubt sind und nicht, um gentechnisch veränderte Nachkommen zu erzeugen. Im Bereich der Landwirtschaft regelt das Cartagena-Protokoll den Umgang und Import von gentechnisch verändertem Saatgut, Tierfutter und GV-Lebensmitteln. Diese wichtige internati-

onale Vereinbarung, die von der Schweiz mitgetragen wird, verhindert, dass GV-Organismen ohne Genehmigung staatlicher Stellen grenzüberschreitend gehandelt werden. Ziel ist es, allfällige Risiken für Mensch, Tier und Umwelt gemäss dem Vorsorgeprinzip zu minimieren. Grundsätzlich strebt die Schweiz auch bei den nationalen Gesetzen im Bereich Gentechnik eine Harmonisierung mit dem europäischen Recht an. Ohne dringenden Grund soll von diesem nicht abgewichen werden. Da Insellösungen angesichts einer weltweit angewandten Technik wenig Sinn machen, setzt sich die Schweiz europaweit und international für eine strenge und praktikable Gentechnikregelung ein.


5.3 Gesetze im Humanbereich Die Gesetzgebung über genetische und gentechnische Anwendungen beim Menschen im Bereich der Biomedizin ist in den letzten Jahren durch mehrere Bundesgesetze vervollständigt und konkretisiert worden. Einige Regelwerke sind noch in Arbeit. Genetische Untersuchungen Für die gesetzliche Regelung von Gentests wurde das Gesetz über genetische Untersuchungen beim Menschen geschaffen. Es regelt Genuntersuchungen im medizinischen Bereich sowie die Handhabung von Vaterschaftstests. Für Strafverfahren kommt das DNA-Profil-Gesetz zur Anwendung. Im Gesetz über genetische Untersuchungen werden alle zentralen Aspekte der Tests geregelt, etwa die Rechte der betroffenen Personen und die Durchführung der genetischen Beratung. Die Qualität der Gentests ist durch eine behördliche Aufsicht der Laboratorien gesichert. Forschung am Menschen Noch in Arbeit befinden sich das Humanforschungsgesetz und ein zugehöriger neuer Artikel der Bundesverfassung. Dieses Gesetz regelt die Forschung am Menschen noch umfassender, als sie heute schon geregelt ist. Darunter fallen Studien mit Erwachsenen, Kindern und Föten sowie die Forschung an menschlichem Material wie Blutproben und mit Personendaten. Zentrale Anliegen des Humanforschungsgesetzes sind der Schutz von Würde und Persönlichkeit des Menschen und die Beachtung der Forschungsfreiheit. Damit Forschung erlaubt ist, müssen Betroffene aufgeklärt werden und ihr Einverständnis geben (informed consent).

Umgang mit Embryonen und Stammzellen Die Leitplanken für den Umgang mit Embryonen ausserhalb des Mutterleibs finden sich im Fortpflanzungsmedizingesetz. Es setzt fest, wann eine Befruchtung im Labor zulässig ist, und verbietet missbräuchliche Anwendungen der Gentechnologie. Verboten sind das Klonen, die Keimbahntherapie und das Verschmelzen von menschlichem und nichtmenschlichem Erbgut. Die Untersuchung des Embryos durch die Präimplantationsdiagnostik ist ebenfalls unzulässig. Nach intensiven Diskussionen erwägt der Gesetzgeber, dieses Verbot teilweise aufzuheben. Im Jahr 2004 haben zwei Drittel der Bevölkerung dem Stammzellforschungsgesetz zugestimmt, das die Gewinnung embryonaler Stammzellen regelt. Embryonale Stammzellen dürfen nur aus Embryonen gewonnen werden, die im Rahmen der medizinisch unterstützten Fortpflanzung gezeugt wurden, aber nicht zur Herbeiführung einer Schwangerschaft verwendet werden können. Aus den überzähligen Embryonen dürfen Stammzellen gewonnen werden, wenn das Paar sein Einverständnis dazu gibt und die Behörden sowie die Ethikkommission ebenfalls zustimmen.

Ethikkommissionen im Humanbereich: Angesichts der Aktualität medizinethischer Themen hat der Bundesrat die Nationale Ethikkommission im Bereich Humanmedizin (NEK) eingesetzt. Sie verfolgt die Entwicklung der Biomedizin und äussert sich aus ethischer Sicht zu den auftretenden Fragen. Zu den Aufgaben der Kommission gehört es, die Öffentlichkeit zu informieren und die Diskussion über ethische Fragen zu fördern. Zudem erarbeitet sie Empfehlungen für die medizinische Praxis und macht die Politik auf Gesetzeslücken aufmerksam. Die Beurteilung von einzelnen Forschungsprojekten, z.B. Medikamentenstudien, erfolgt durch kantonale Ethikkommissionen. Diese prüfen, ob die Richtlinien der «Good Clinical Praxis» eingehalten werden.


5.4 Gesetze im Ausserhumanbereich Die Schweiz verfügt über sehr strenge Massstäbe für die Regelung gentechnischer Anwendungen bei Tieren, Pflanzen und in der Umwelt. Da die Gentechnik im Ausserhumanbereich viele verschiedene Bereiche umfasst, mussten sowohl bestehende Gesetze ergänzt als auch neue geschaffen werden. Transgene Tiere Das Tierschutzgesetz verfolgt das Ziel, den Schutz der Würde und das Wohlergehen von Tieren zu sichern. Tierversuche sind verboten, wenn sie – gemessen am erwarteten Erkenntnisgewinn – dem Tier unverhältnismässiges Leiden zufügen oder wenn geeignete Alternativmethoden zur Verfügung stehen. Für das Erzeugen, Züchten und Halten von gentechnisch veränderten Tieren schreibt das Gesetz eine Bewilligungspflicht vor.

Sicherheitskommission EFBS: Vor zehn Jahren setzte der Bundesrat die Eidgenössische Fachkommission für biologische Sicherheit (EFBS) ein, der Personen aus Universitäten, der Industrie sowie von Konsumentinnen- und Umweltorganisationen angehören. Damit sind sowohl die erforderlichen Fachkenntnisse in Gentechnik, Ökologie und Medizin verfügbar als auch die verschiedenen Interessenkreise mit ihren Standpunkten vertreten. Die EFBS arbeitet bei der Vorbereitung von Gesetzen mit und unterstützt die Umsetzung: Bevor zum Beispiel ein Freilandversuch mit gentechnisch veränderten Pflanzen bewilligt wird, muss die Stellungnahme der EFBS eingeholt werden.

Ethikkommission EKAH: Die Eidgenössische Ethikkommission für Gentechnik im ausserhumanen Bereich (EKAH) wurde im Jahr 1998 gegründet. Ihre Aufgabe ist es, die Entwicklungen und Anwendungen der Gentechnik bei Pflanzen, Tieren und in der Umwelt zu beobachten und dazu aus ethischer Sicht Stellung zu beziehen. Insbesondere prüft sie gesetzliche Vorlagen und Gesuche betreffend Umgang mit gentechnisch veränderten Organismen. Bei ihrer Prüfung wägt die Ethikkommission die betroffenen Güter gegeneinander ab. Dabei achtet sie auf die Einhaltung von Grundsätzen wie die Achtung der Würde der Kreatur und den Schutz der genetischen Vielfalt der Tier- und Pflanzenarten. Das Spektrum der in der Kommission vertretenen Standpunkte ist gross und widerspiegelt die unterschiedlichen Meinungen in der Öffentlichkeit.

44 / 45

Landwirtschaft und Lebensmittel Lebensmittel aus gentechnisch veränderten Organismen müssen von den Behörden bewilligt und deklariert – also klar gekennzeichnet – werden. Dies schreiben das Lebensmittelgesetz und verschiedene Verordnungen vor, um den Gesundheits- und Täuschungsschutz zu garantieren. Massgebend für die Erteilung von Bewilligungen ist die Sicherheit für den Menschen und für die Umwelt. Eine Bewilligung wird nur erteilt, wenn alle Vorschriften des Umwelt- und Tierschutzgesetzes erfüllt sind. Bestehende Lücken in der Gesetzgebung werden laufend geschlossen. Ein Beispiel ist die Arbeit an der Koexistenzverordnung. Diese wird das Nebeneinander von gentechnischen und konventionellen Anbaumethoden regeln und schreibt z.B. Schwellenwerte für GV-Anteile im herkömmlichen Anbau vor. GVOs in der Umwelt Seit 2004 ist das Gentechnikgesetz in Kraft. Dessen Ziel ist es, bei der Anwendung der Gentechnologie dem Wohl von Mensch, Tier und Umwelt zu dienen. Zentrale Punkte des Gesetzes sind der Schutz der biologischen Vielfalt, der Schutz der landwirtschaftlichen Produktion ohne gentechnisch veränderte Organismen und die Sicherstellung der Wahlfreiheit für alle Beteiligten. Bis 2010 besteht in der Schweiz ein fünfjähriges Moratorium für den Anbau von GVO in der Landwirtschaft. Das Volk stimmte 2005 der Initiative «Für Lebensmittel aus gentechnikfreier Landwirtschaft» mit 56 % Ja-Stimmen zu. Die Frist wird genutzt, um Chancen und Risiken des Anbaus von GV-Pflanzen in der Schweiz zu überprüfen. Unter den Forschungsprojekten befinden sich auch Freisetzungsversuche, welche das Moratorium nicht verbietet.


6 Glossar

A Adulte Stammzelle = Undifferenzierte ªStammzelle im Körpergewebe, z.B. Blutstammzelle. Agrobakterium = Bodenbakterium, das Pflanzen befällt und ªGene ins ªGenom der Pflanze übertragen kann. Aids = Englisch Acquired immune deficiency syndrome. Erworbene Immunschwäche, die durch das ªHI-Virus übertragen wird. Allel = Eine von mehreren Ausprägungen eines ªGens. Für das Gen der Blutgruppe gibt es z.B. drei verschiedene Ausprägungen, die Allele Null, A und B. Es gibt ªrezessive und ªdominante Allele. Aminosäure = Baustein der ªProteine. Es gibt 20 verschiedene Aminosäuren. Antibiotika = Stoffe aus ªMikroorganismen, die auf andere ªBakterien wachstumshemmend oder abtötend wirken. Anticodon = Drei ªBasen (z.B. GUA), die sich an einem Ende einer gefalteten ªtRNA befinden. Während der ªTranslation haftet sich das Anticodon an ein passendes ªCodon auf der ªmRNA (im Beispiel an CAU).

Bt-Mais/Bt-Baumwolle = ªTransgene Pflanzen mit einem ªGen aus dem Bodenbakterium Bacillus thuringiensis, aufgrund dessen die Pflanzenzellen ein Insektengift produzieren. Die Pflanzen sind dadurch gegen bestimmte Insektenschädlinge geschützt.

Freisetzungsversuch = Ausbringen gentechnisch veränderter Organismen (ªGVO) vom geschlossenen Forschungslaboratorium in die Umwelt.

C

Gen = Abschnitt auf der ªDNA, der die Information zur Herstellung einer ªRNA enthält. Die meisten RNAs dienen als Bauanleitung für ªProteine. Gene sind die Grundelemente der Vererbung.

Chromosom = Unter dem Mikroskop sichtbare, im ªZellkern zu Stäbchen aufgeknäulte ªDNA. Der Mensch hat 46 Chromosomen bzw. 23 Chromosomen-Paare pro ªZelle. Codon = Abfolge von drei ªBasen (z.B. CGA) der ªDNA oder ªRNA. Das Codon enthält den Code für eine ªAminosäure oder für ein Stopp- bzw. Startsignal, welche Anfang bzw. Ende des ªGens markieren.

D DNA/DNS = Desoxyribonukleinsäure (englisch -acid für -säure). Chemischer Stoff, aus dem die ªGene aufgebaut sind. DNA-Chip ªMicroarray.

Antikörper = ªProteine, die als Abwehrstoffe des ªImmunsystems dienen.

Dominanter Erbgang = Vererbung eines ªAllels, das sich gegen ein ªrezessives Allel durchsetzt und als Körpermerkmal erscheint. Dominante Allele zeigen sich im ªPhänotyp immer.

B

E

Bakterium = Einzeller ªMikroorganismus.

Elektrophorese = Die Wanderung elektrisch geladener Teilchen (z.B. ªDNA) in einem Gel, durch das Strom fliesst. Ermöglicht die Trennung unterschiedlich langer DNA-Stücke.

Base = Die Basen Adenin (A), Guanin (G), Cytosin (C) und Thymin (T) sind die Bausteine der ªDNA. In der ªRNA findet sich Uracil (U) statt Thymin. Basenpaar = Aufgrund ihrer chemischen Struktur paaren sich die Basen A und T (bzw. U) sowie C und G. Die Basenpaarung ermöglicht z.B. das Abschreiben der ªDNA zu ªRNA (ªTranskription) und die Paarung von ªCodon und ªAnticodon. Biobank = Sammlung von Körperproben wie Blut, Tumorgewebe oder ªDNA verknüpft mit den zugehörigen Daten zu Gesundheit und Lebensstil des Probenspenders. Bioindikator = Biologisches System (meist ªBakterien) zum Aufspüren von Umweltgiften und anderen Stoffen. Bioinformatik = Wissenschaft, die sich mit der computergestützten Speicherung und Auswertung biologischer Daten befasst. Biologika, Biologics = Bio- bzw. ªgentechnisch hergestellte ªProteine, die als Medikamente eingesetzt werden. Biotechnologie = Einsatz von ªgentechnisch veränderten oder unverändertenªMikroorganismen, ªZellen und ªEnzymen zur Stoffumwandlung und Stoffproduktion.

Fungizid = Chemischer Stoff, der Pilze abtötet.

G

Genetik = Wissenschaft der Vererbung. Genetischer Code = Bezeichnet die vorgegebene Zuordnung der ªCodons der ªDNA bzw. ªRNA zu den 20 ªAminosäuren. Der genetische Code ist bei allen Lebewesen identisch. Genetischer Fingerabdruck = Bestimmte Abschnitte des Erbmaterials, die für jeden Menschen charakteristisch sind. Die Untersuchung und der Vergleich des genetischen Fingerabdrucks ist eine Methode zur eindeutigen Identifikation einer Person. Genom = Gesamtheit der Erbinformation, d.h. aller ªGene, einer ªZelle oder einer Art. Genomik = Wissenschaft, welche das ªGenom eines Lebewesens entschlüsselt und untersucht. Genotyp = Genetische Ausstattung eines Individuums. Im Gegensatz zum ªPhänotyp, der nur die körperlich ausgeprägten Merkmale bezeichnet, wird der Genotyp an die Nachkommen weitervererbt. Gentechnik = Wissenschaft, die sich mit der Untersuchung, der Isolierung und der Neukombination von Erbmaterial (ªDNA) befasst.

Embryo = Die frühe Entwicklungsform eines Lebewesens, beim Menschen die ersten acht Wochen. Danach spricht man vom Fötus.

Gentechnologie = Die gesamten Kenntnisse, Verfahren und Anwendungen, die auf ªGentechnik beruhen.

Embryonale Stammzelle = Aus dem wenige Tage alten ªEmbryo gewonnene undifferenzierte ªZelle, die sich im Labor zu praktisch allen Zelltypen des Körpers entwickeln kann.

Gentest = Untersuchung von ªDNA, um Rückschlüsse auf verschiedene Aspekte eines Individuums zu ziehen, z.B. Krankheitsursachen oder Verwandtschaft.

Enzym = ªProtein, das als biologischer ªKatalysator Stoffwechselvorgänge (chemische Prozesse) auslöst und beschleunigt.

Gentherapie = Behandlung einer ª(Erb-)Krankheit durch Einschleusen eines ªGens in die ªZellen. Man unterscheidet zwischen ªsomatischer und ªKeimbahn-Gentherapie.

Erbkrankheit = Durch einen Genfehler (ªMutation) ausgelöste oder begünstigte Krankheit. Evolution = Entwicklung aller Lebewesen aus einfachen Urformen nach dem Prinzip der natürlichen Auslese: Aufgrund ihrer ªGene und ihres Verhaltens besonders gut angepasste Organismen überleben eher und haben daher mehr Nachkommen. Exon = Codierender Bereich eines ªGens, der beim ªSpleissen nicht weggeschnitten wird.

F Farming ªPharming. Fermenter = Reaktionsgefäss, in dem ªMikroorganismen und andere ªZellen gezüchtet werden.

Gentransfer = Übertragung von ªGenen in Empfängerzellen. Good Clinical Practice = Ethisch überprüfte Regeln für die Durchführung von medizinischen Behandlungen und ªklinischen Studien. Grüne Gentechnik = Umgangssprachliche Bezeichnung für die ªGentechnik in der Pflanzenzucht und in der Landwirtschaft. Güterabwägung = Methode der Ethik zur Entscheidungsfindung. Alle Argumente für und gegen eine umstrittene Frage werden gesammelt und gewichtet.


46 / 47

GVO = Gentechnisch veränderter Organismus, auch ªtransgener Organismus genannt.

H Herbizid = Chemisches Unkrautvertilgungsmittel, Pflanzen abtötender Stoff. HIV = Englisch Human Immunodeficiency Virus. ªVirus, das die Krankheit ªAids auslöst. Hormon = ªProtein, das als Botenstoff dient und in ªZellen Reaktionen auslöst (z.B. Insulin). Hybridsorte = Kultursorte (z.B. Getreide), die durch die Kreuzung von zwei genetisch weit entfernten Organismen entstanden ist. Erbringt dank vervielfältigtem ªChromosomensatz höhere Erträge.

Klon = Genetisch identisches Lebewesen. Z.B. sind durch Zellteilung entstandene ªBakterien Klone. Auch eineiige Zwillinge sind genetisch identische Klone. Knock-out-Tier = Maus oder anderes Labortier, bei dem mittels eines gentechnischen Eingriffs ein ªGen deaktiviert wurde.

Krebs = Bösartige Zellwucherungen (Tumore), die durch unkontrollierte Zellteilungen entstehen.

P

L Leukämie = ªKrebs des blutbildenden Systems. Ligase = ªEnzym, das ªDNA-Stücke miteinander verklebt.

Intron = Bereich eines ªGens, der beim ªSpleissen aus der ªmRNA ausgeschnitten wird. In vitro = Lateinisch «im Glas». Vorgang im Reagenzglas, der im Labor durchgeführt wird. In-vitro-Fertilisation (IvF) = Künstliche Befruchtung der Eizelle ausserhalb des Körpers. Der ªEmbryo wird anschliessend in die Gebärmutter eingepflanzt. In vivo = Lateinisch «im Lebenden». Vorgang im lebenden Organismus.

K Katalysator = Reaktionsbeschleuniger. Keimbahn-Gentherapie = ªGentechnischer Eingriff in Ei- und Samenzellen. In der Schweiz verboten. Keimzelle = Überbegriff für Ei- und Samenzelle. Keimzellen enthalten nur 23 ªChromosomen. Kerntransfer = Verschmelzung des ªZellkerns einer Körperzelle mit einer entkernten Eizelle zur Herstellung eines ªKlons, der mit dem ZellkernSpender bzw. der -Spenderin genetisch identisch ist. Klinische Studie = Wissenschaftliche Untersuchung einer (neuen) medizinischen Behandlung unter kontrollierten Bedingungen.

N Nanobiotechnologie = Wissenschaft, die Methoden der ªBiotechnologie mit der Nanotechnologie (Technologie im Bereich von Milliardsteln Metern) kombiniert.

Immunsystem = System zur Abwehr körperfremder Substanzen und Organismen wie Pollen, ªBakterien oder ªViren.

Insektizid = Chemisches Schädlingsbekämpfungsmittel, Insekten abtötender Stoff.

Mutation = Spontane oder durch äussere Einflüsse (z.B. Strahlung, Chemikalien) erzeugte Veränderung des Erbmaterials.

Koexistenz = Gleichzeitiges Vorhandensein verschiedener Systeme. In der grünen ªGentechnik das Nebeneinander von Feldern mit ªGV-Pflanzen und solchen mit herkömmlichen Sorten.

I

Informed consent = Zustimmung zur Durchführung einer Behandlung, die Betroffene geben, nachdem der Arzt oder die Ärztin (bzw. die verantwortliche Person eines Experimentes) die Betroffenen ausführlich über die Behandlung informiert und aufgeklärt hat.

Multifaktoriell = Durch mehrere Ursachen ausgelöst.

Lipase = ªEnzym, das Fette abbaut.

M Markergen = ªGen, das einem Organismus eine leicht erkennbare Eigenschaft vermittelt. Z.B. ein Gen für ein ªEnzym, das einem ªBakterium die Fähigkeit verleiht, eine farblose Substanz in eine farbige umzuwandeln. Meiose = Zellteilung bei der Bildung von Ei- und Samenzellen. Die Meiose halbiert den Chromosomensatz in den ªZellen. Beim Menschen von 46 ªChromosomen in einer Körperzelle auf 23 Chromosomen in den Ei- und Samenzellen. Microarray = DNA-Chip. Liefert Informationen über die ªGen-Aktivität einer ªZelle durch Aufspüren der ªmRNAs. Mikroorganismen = ªBakterien, ªViren, einzellige Pilze und Algen. Mitose = Mechanismus bei der Zellteilung. Die ªDNA wird verdoppelt und an beide Tochterzellen weitergegeben. Molekularbiologie = Wissenschaft, die sich mit den molekularen Vorgängen in einer ªZelle befasst. Monogenetische Erkrankung = Von einem einzigen ªGen ausgelöste ªErbkrankheit. Monoklonaler Antikörper = Im Labor hergestellter ªAntikörper. Die Produktion erfolgt in ªZellen, die aus der Verschmelzung einer antikörperbildenden Zelle mit einer Krebszelle entstanden sind. Monosomie = Fehlen eines ªChromosoms. Statt als Chromosomenpaar liegt ein Chromosom im ªZellkern nur ein Mal vor. mRNA = Englisch messenger RNA. Einzelsträngige Kopie eines ªGens, welche die Anleitung für den ªProteinaufbau trägt. Auch Boten-RNA genannt.

Patent = Schutzrecht des geistigen Eigentums, das die zeitlich befristete kommerzielle Nutzung einer Erfindung regelt. Die Erkenntnisse werden offen gelegt. PCR = Englisch Polymerase Chain Reaction. Labormethode zur Vervielfältigung von ªDNA-Stücken. Phänotyp = Gesamtheit der äusserlichen Merkmale eines Organismus wie Grösse, Augenfarbe, Blutgruppe etc. Wird vom ªGenotyp und der Umwelt bestimmt. Pharmakogenetik/-genomik = Wissenschaft, welche die vererbbaren Besonderheiten der Verstoffwechselung von Medikamenten untersucht, z.B. die durch ªEnzyme bestimmte Geschwindigkeit des Abbaus einer Arznei in der Leber. Pharming = Produktion von ªEnzymen und Arzneimitteln in gentechnisch veränderten Pflanzen und Tieren. Auch Farming genannt. Plasmid = Kleines ringförmiges ªDNA-Stück, das vor allem in ªBakterien vorkommt. Polymerase = ªEnzym, das den Aufbau von ªDNA- oder ªRNA-Molekülen ermöglicht. Prädiktive Diagnostik = Vorausschauende Untersuchung. ªGentests zur Vorhersage der Wahrscheinlichkeit, mit der eine Krankheit auftreten wird. Präimplantationsdiagnostik (PID) = ªGentest am ªin vitro gezeugten ªEmbryo im Labor. Gesunde Embryonen werden anschliessend in die Gebärmutter übertragen. Pränataldiagnostik (PND) = Untersuchungen am ªEmbryo bzw. Fötus während der Schwangerschaft. Protein = Eiweiss. Aus ªAminosäuren aufgebauter Naturstoff, aus dem alle ªZellen aufgebaut sind. Proteine erfüllen im Körper verschiedenste Aufgaben. Proteom = Gesamtheit aller Proteine in einer Zelle oder in einem Gewebe. Je nach Lebensphase oder Zustand (krank, gesund) ist das Proteom aus unterschiedlichen Eiweissen zusammengesetzt. Proteomik = Wissenschaft, welche das ªProteom untersucht. Analysiert wird z.B. das Zusammenspiel von ªProteinen bei der Entstehung einer Krankheit.


R Rekombination = In der ªGentechnik die Verknüpfung von ªDNA-Stücken, auch von verschiedenen Lebewesen. Reproduktives Klonen = Durchführung eines ªKerntransfers mit dem Ziel, ein geklontes Kind heranwachsen zu lassen. In der Schweiz verboten. Resistenz = Widerstandskraft eines Organismus gegen negative äussere Einflüsse, z.B. gegen Trockenheit, Schädlinge oder Krankheiten. Resistenzgen = ªGen, das für ein ªProtein codiert, welches den Organismus gegen bestimmte Umwelteinflüsse z.B. Schädlinge, Gifte oder Kälte widerstandsfähig macht. Restriktionsenzym = ªEnzym, das die ªDNA an bestimmten Stellen zerschneidet. Rezessiver Erbgang = Vererbung von ªAllelen, die nur als Merkmal erscheinen, wenn sie in doppelter Kopie vorliegen, da sie von ªdominanten Allelen unterdrückt werden. Ribosom = Eiweissfabrik. Komplex aus ªrRNA und ªProteinen, welcher unter Verwendung einer ªmRNA als Vorlage den Proteinaufbau aus ªAminosäuren steuert. RNA/RNS = Ribonukleinsäure (englisch -acid für -säure). ªmRNA, ªrRNA, ªtRNA, ªsiRNA. rRNA = Ribosomale RNA, Bestandteil der ªRibosomen. RNA-Interferenz = Mechanismus, der den Aufbau bestimmter ªProteine hemmt. Dabei binden sich kurze ªsiRNA-Stücke an die ªmRNA und veranlassen deren Abbau. Rote Gentechnik = Umgangssprachliche Bezeichnung für die ªGentechnik in der Medizin.

S Sars = Englisch Severe acute respiratory syndrome. Durch einen ªVirus ausgelöste Krankheit, die 2002 erstmals auftrat. Das Virus stammt vermutlich von einem Erreger ab, der zuvor nur Tiere befallen hatte. Screening = Das Durchsuchen grosser Mengen verschiedener Gewebeproben oder einer Bevölkerungsgruppe nach bestimmten ªMutationen oder Genvarianten. Sequenzierung = Methode zur Entschlüsselung der ªBasenreihenfolge eines ªGens bzw. des ganzen ªGenoms. siRNA = Englisch small interfering RNA. Kurze ªRNA-Stücke die sich an ªmRNA binden und durch den Mechanismus der ªRNA-Interferenz die Gen-Aktivität regulieren. Somatische Gentherapie = Gen-Übertragung in Körperzellen (ªKeimzellen ausgenommen) zur Behandlung von ªErb- und anderen Krankheiten.

Spleissen = Das Herausschneiden bestimmter Sequenzen aus der ªmRNA nach der ªTranskription. Stammzelle = ªZelle, die sich selbst erneuert und zu verschiedenen Zelltypen ausreifen kann.

T Täuschungsschutz = Verpflichtung zur ausreichenden Kennzeichnung (Deklaration) von Lebensmitteln und anderen Produkten, damit Konsumentinnen und Konsumenten im Einklang mit ihrer Weltanschauung einkaufen können. Therapeutisches Klonen = Durchführung eines ªKerntransfers mit dem Ziel, für den ZellkernSpender bzw. die -Spenderin genetisch identische ªembryonale Stammzellen zu gewinnen und diese zur Reparatur defekter ªZellen einzusetzen. Transgen = ªGentechnisch verändert. Transgene Lebewesen = ªGentechnisch veränderte ªMikroorganismen, Tiere oder Pflanzen. Transkription = Umschreibung von ªDNA zu ªRNA. Auf dem Prinzip der ªBasenpaarung beruhende Synthese von einzelsträngiger ªRNA, basierend auf der Vorlage doppelsträngiger ªDNA. Translation = Umsetzung der ªBasensequenz der ªmRNA in die ªAminosäurenreihenfolge des ªProteins. Der Vorgang findet an den ªRibosomen statt. Transkriptom = Die Gesamtheit der zu einem bestimmten Zeitpunkt in einer ªZelle vorliegenden ªRNA-Moleküle. Transkriptomik = Erforschung der ªRNAMoleküle. Z.B. wird die Frage untersucht, zu welchem Zeitpunkt und in welchen ªZellen bestimmte ªGene aktiv sind, d.h. ihre ªmRNA vorliegt. Trisomie = Vorliegen eines überzähligen ªChromosoms. Am häufigsten ist das dreifache (statt doppelte) Vorliegen des Chromosoms Nummer 21, was zum Down-Syndrom führt. Betroffene Menschen haben eine geistige und teilweise auch körperliche Behinderung. tRNA = Transfer-RNA. An eine der 20 verschiedenen ªAminosäuren gebundene ªRNA, die sich mit ihrem ªAnticodon an ein ªCodon auf der ªmRNA bindet und so den korrekten Einbau der entsprechenden Aminosäure ins entstehende ªProtein sicherstellt.

V Virus = Kleiner Partikel (ªMikroorganismus) aus ªProteinen und ªDNA bzw. ªRNA, der sich nur mit Hilfe lebender ªZellen vermehren kann. Häufig Krankheitserreger.

W Wahlfreiheit = Die Möglichkeit, sich zwischen mehreren Angeboten zu entscheiden. Z.B. zwischen herkömmlichen und GV-Lebensmitteln. Weisse Gentechnik = Umgangssprachliche Bezeichnung für die ªGentechnik in der industriellen Produktion.

Z Zelle = Kleinste selbständig lebensfähige Einheit. Grundelement aller Vielzeller (Mensch, Tiere, Pflanzen). Zellkern = Umhüllter Bereich im Innern von Tier- und Pflanzenzellen, welcher das genetische Material enthält.


Herausgeber: Stiftung Gen Suisse, Bern Konzeption und Text: Sibylle Ackermann, Kurt Bodenmüller, Daniela Stebler, Geschäftsstelle Gen Suisse Fotos: Carmela Odoni, Bern. Ausgenommen S. 21 © Prof. Reinhard Seger, Kinderspital Zürich, S. 26 © Dr. Lev Levkov, Karolinska Institute, Stockholm. Gestaltung und Illustration: Burson-Marsteller, Bern Druck: Stämpfli Publikationen AG, Bern 4. Auflage: 63 000 Exemplare in deutscher, französischer und italienischer Sprache © Gen Suisse, Bern 2008 Dank: Wir danken den folgenden Institutionen, die uns freundlicherweise für die Fotoaufnahmen zur Verfügung standen: Institut für Pflanzenbiologie der Universität Fribourg, Institut für Biochemie der Universität Fribourg, Praxis Dr. Beat Herrmann, Bern, Bioengineering AG, Wald ZH. Zudem danken wir allen Protagonistinnen und Protagonisten für ihre Rollen als WG-Bewohner, Patientinnen, Maturanden, Arzt etc.


ÂŤDer Dialog ist unser Ziel.Âť Stiftung Gen Suisse Postfach, CH-3000 Bern 14 Tel.: +41 (0)31 356 73 84 Fax: +41 (0)31 356 73 01 kontakt@gensuisse.ch www.gensuisse.ch

Basisbroschüre Gentechnik  

Basiswissen, Anwendungen und Diskussionen rund um die Gentechnik

Read more
Read more
Similar to
Popular now
Just for you