Page 1

Gabriela Staysy Pérez Chávez

Proteínas lysozyme: >M95099.1 Bos taurus lysozyme gene (cow 3), complete cds TTACTTACCAGAAAAACTTACCAGAAAGCTTCTGAGGGTTCCAAATTTTGGAACGATAAATACATTAGAA AGGGAAAAAAGATAATATCTAGTCAAACTGTTGTTTTGTAGAGTCCTTTGGTGCTGTCTTGGGGCTGAGA AGTGTCCAGGGTTGTTGCTGATTAATTTATGCACAAATTTATGTTCAGCTTTCAGGAAGATAGGGGGAAG GCAGAGAACTTGTCTAGGATCTGTTTTTTCAGCTCAAAATAATCTTTATGCCAAAGGGGAAGATTTTGGA GTGGCATATTCTGTTATTCTTCTGTAGGTTTTACTATACAGTTTCCTTGCTTTACAATGACGCTTAGTTC TAACAGGAAAGCGAAGACTTAATGTAAATACATGTTCATCAAAGATGGGAGCTCATTTTCAGTTGAGTAA AATGTTCATTCAGGTTTTTTTTTTTCCTTTAAACTTGCTCAACTTCATAAAAATAGGAGGAAGTTCCTCT TCGGGCAATAGGTCTAACCCTGAATCTACCTGAGCAATGTCTTTATGCAATGTCATTTCATTATTTTCTG CAAGTTAATTCTTAGGATATCAGAATATCGCTCTTCAAACATAAGAAAGAAAACTGTTTAAGTATATGGA CCAATAAACTGCTCCTGTTTTTCACATGTCTCAGAGGGTGGAGCCACCAAATCAGTGAGATAAGAGGGGA GTGAAAAGATGTTAAATAGCAAGTGTGGCTCACCCTGGTCAGTCTGGACATTTGACTTCTCAGTCAACAT GAAGGCTCTCATTATTCTGGGGTTTCTCTTCCTTTCTGTCGCTGTCCAAGGCAAGGTCTTTGAGAGATGT GAGCTTGCCAGAACTCTGAAGAAACTTGGACTGGATGGCTATAAGGGAGTCAGCCTGGCAAACTGTAAGT TAATTCTTCCTCCTTCCAAACAGTTAGCCATGTGTGGAACAGATACTAATAGAGCATGAATAATAGGAAA GGGACTTTGAGTGAATGGCTCTTTTCTTTCTTGGAGGGTTTGTACATTTACAGAGGTTAAAAACAGCAAC TTATTTCTTTAGAATCCGACGCACCAGGGGAAGGAGTGAGGCATAGGAGGTTCAAATCCATATCATTTTA AGCATGTTAGGTGTGACTGTACTTGTCTAGAGCCACTAAATTTGCCAGGTGGTACAAGCAGGCTGACAAG AAAAATATTTCAGCACCTGTGATATATCTATCAAGTGTTTGACTAAACATTTTCAGTTTGGAACTTGGGT TCTGCAAGCATGAGTAAGGTAGTATTTTTCCACTTTTAACCCCCTTATCATGGTGTTGAGTTTTTAACAG CAAATTTTTAAAAAATTACTCTAAACTCTCAAAACAGGGACAGTGGGAACCTATTTCCTCTCAATTAATA TCTACATAAGGATCTCTGAAATGCACCATGAAATGATATTTTATTAATCTGACTTTAGTCCATTAATTAA TTTTCATTTTCTTCCACAGAATTCAAGGTGCACACTAAAGAAAAGTAACTGTGTATTTTAGTCCATATTT GTCAATGTCATCACTGTATTTTTCAGATTGAATTCAGACATTTCCCCTCCATAACTATTTTTGAATGAAT GAGCCAATGGCTAGATAGATGGATGGATGACATAGTCTTTTCTATTCTATGATTCCTTTGGTCTGGATTC TAATTTGATACCCAAGTTTACCTTTAGGTATCATAAGAAATTTTATTTCTCTGAGAAATTCCTTATTTTT CTTAATAAATATTTTTTAAAATAAAAGTATTTTTCCATTAGCTTATACATCTGCTGATAATGAACAAACC CATTCAACAACTCTGTTGACTTTTCTATCTTCGGCCTGCATCTTACCTGAGGGATGGGAGCAGGGGAAGA GTAACAGGAATGGCAGAAATAGCTATTTTAATGTTTTTAAAAATATGTTGTTTTGTTTCATTAGTATTAC CAAATGATTTGCTAATAAAAGAATTCTCTTAACGGAATTCTTAACATGAAGGTGTTAGAATATCTCACAA GTAAAATACATCTTTAAACTTATAAAGTTGTTACTAAAATAGAATTAGTTAAATAGAACTGATGGGGCTA TGAAGTGTAAGTCATGTCATGTTGCTGTTTATAATCAAAAAATACATTTTTTTTCAGGGTTGTGTTTGAC CAAATGGGAAAGCAGTTATAACACAAAAGCTACAAACTACAATCCTAGCAGTGAAAGCACTGATTATGGG ATATTTCAGATCAACAGCAAATGGTGGTGTAATGATGGCAAAACCCCCAACGCAGTTGACGGCTGTCATG TATCCTGCAGCGGTAAGACAAGATGATGTTGAGTGATGGTTCAGCCCCCATCTGATTATACCTATAAGAA CAGAGATTCAGTACAAATGAAAATGTCTTGAGGAGTTCATCAGGGACCTAGAAAAATTCCATCTGAACTT TTAGAACTTATTATCCTCCTCAAAATTTCTTAAGTAAAAAATTAATGAGCTGGTATCATAAAATGTTGCT GTTTGCTAACCTACAAGATTTCTGGAATGACCTGTCGTGTTATTATAACTAGACTTGTTGATGCTTTGTA AAGAACAATGCTATTCCTCTTACTTACCTGATTTGGGGAGGAGAGGGTAATTCGATTATGTGGTATTTTT CTAATCTGCCCTGATTTATTGGAAAACAAAGGATTACTAACTAACCAAAGAGGAGGACTATGTGTGGTCC TTTTAAAAATTTTGTTTTTACTTTTTATGATTAAATGTTTTAAATATATGGAAAATTAGAAACATTAATA CAATAACCTTCAATATGTTCATCATGTACTGTGACAGTTATTAATATTTGGTCATATTTATTTATCTTAT GTATATAAACTATATATATATATGGGTTTTTTTGCTGAGTGATTTAAAGTGAATTATTCACGGTGAATAG AAAATTATGACCTTTCATTTCGAAATTCTTTAGCTTGCATCTCCAAAAAGTACAGTTCCTATATGAACGT TGTCATTCTGACAAGTCAATTTATAGATCCGTTGAACTGGGGTGAAATAAATATGCTACTGAGTTCCTTT TAAAATAGAGATATGGAATCTTTAGTGCATAAAGTATTGGAGAACTAATGCAAAAATTGTTAAATTTTTA CATACTAAAATTCCTAATAGAGAAGATTAGTCTAAGAATATTCTTTTGTATGCAGTTAATTTACATAGAT AATATTTTTTATATAGTAATCTTTAGTCATTGAGTAAAAATTGTCTCTAACCCAAGATTTATGAACACTG


GGTAATTTTTGGAATTACAGCTTCTTTCACAATATACATCACTCATGGACATGAATATAAAACTATATTA TGCACATTTGTACCCACATACAAACATGTAAGCAATGTGTTTCAACAAAAATGAAATTGTACTAAATATT CTGCCTTATAATATGCTCTTTATTGCCCAAAATTATATTATCAGCAAACACCAATCTTTATTATATATCA AGATGAATAAATTTCACTAAATATATATTCTATAATTTATCAATCCAATGCACACTGTTAATGCACTTAG ACTATATTTCCTTTTTATTTTCCCCTATGAATCATTTTGTACACACATCTTTGGGGATATCTCATTAAAC AGAAAGTGAAAGTGAAGTCACTCAGTCGTGTCCGACTCTTTGCAACCCCATGACCTGTAGCTTACCAGGC TCCTCCATCCATGGGATTCTCCAGGCAAGAGTATTAGAGTGGGTTGCCATTTCCTTCTCCAATTACAGAA TTGCTGAGCAAAAAATTGCTAGACCGGTTTCTGCTTGTTTGTTTTAGTTTTGTTTTGATTTTCTGGTCCC TAGTAGAAGAGAACCTTCCATCACATTAGTTAATAGTTCCAGAGCTGCCAGTGACTTTGGTAAATGAGAA ACAGAATGCTTTATTTCATGCCAAATAGGATGGAAAAAAGAAAGAGTTTTCCCTCAACATTCACAGATAC ATGGACTCATAAAAAACAAAATTTTGGTTGTTCTTTGCTCAGCCTAAGAAAACAAAGCTGATCGAACTTA AACTTATAATGAAATTTCTATGAATGTTGTCTTCATTTCTTACCATCTCCTTTTCAGAATTAATGGAAAA TGACATCGCCAAAGCGGTAGCATGTGCAAAGCATATTGTCAGTGAGCAAGGCATTACAGCATGGTATGTT TTGGGTTTTTTTCTCCCCTATTCCAGTTCTACTGAAATGTAATTGACATACATCACTGTAGAAGTTTAAA CTACACAGCAAAATGATTTGACTTACATACATTGTGAAATTATTGTCACAATAAGTTTAGTGAACATCCA TCATGTCATATGCTGCTGCTGCGGCTAAGTCGCTTCAGTCGTGTCTGACTCTGTGCGACCCCACAGACGG CAGCCCACCAGGCTCCCCCATCCCTGGGATTCTCCAGGCAAGAGCACTGGAGTGGGTTGCCATTTCTTTC TCCAATGCATGAAACTGAAAAGTGAAAGTGAAGTCACTCAGTCATGTCCGACTCTTTGCGACCCCCTGGA CTGCAGCCAACCAGGCTCCTCTGTCCATGGGATTTTCAAGGCAAGAGTACTGGAGAGGGTTGCCATTGCC TTCTCCATTATGTCATATAGATACAAACAAAGAAATAGAAGAAAAACTTTGTGTGTGTGATGAAAAGTCT TAAGCTTTATTCTTTTAACGATCTTCATATACAACATATATCAGTGTTAATTGTATATATTACCACATAC ATTACATCCCCAGTATTCATTATCTTATACCTAGAAGTTTGTAAGAATTTTGACTGACTTCATCTAATTC CCCACCCTCATCCCCTCCCACTACCCCTACCTATGATAACCACATATTGACCTCTTTTCCTATGATTTTG TTTGGATGTATGTGTTTGAAGTATAATGGACTTACACTATGTAAGTTCCTATTACAGAGCATGGTATGTG TTAAGCATGAAAGAGGAGATCTGGGGACTTGCCTGGCCATCCAGTTGATAAGACTTTGTGCTTCAATGCG GGGGTTGCTGGACAGGGAACTGCATGCCATTAGATGCGGCCAAAAAAATAAGGGGAGGATGGAGAACTGG GGGTTTTGGTAGTGCCTTTGGGCACCTAGGATTTTAGCCTCCTACCTAACTACCAGGAATATACCCCAAT ATTGGAGGGGTGGAGTCTTAACCACTGGACCTCCAGAGAGCTGTTTTACCCTACTGTTATGAATGAAGCA AAGGAATATATTCCCAAAGACCAAAATATGCTACTGAGGACTGAAAATTGCAGCTTTGTTTGTGTGTTCC GTCAGTAAGTCATATCTGACTCTTTGTGACCCCATGGACTGTAGAACACAGGCTTCCCTGTCCTTCATTA TCTCCTGGAGTATGCTCTAATTCATGTCCATTGAGTTGGTGAAGCTATCTAAGCGTCTCATCCTCTGCCA TACCCTCTTTTTTTGCCTTCAATCTTTCCCAACATCAGGGTCTTTTCCAATGAGTCGGCTTTTCAGGACA CCTGGCCAAAGTATTAGAACTTCAGCTTCAGCATCAGTCCTTCCAATGAATATTCAGGATTGATTCCCTT TAGGATTGACTGGTTTGATTTCCTTGCTGTCAAAGGACTGTCAAGAGTCTTCTCCAGCACCACTATTCAA AAGCATCAATTCTCAGGCACTCAGCTTCTTTATGGTCCAGCTGTCACATCTGTACATGACTACTGGAAAA ACTATAGCTTTGACTATAGGAAACTTTGTCGTCAAAGTGATGTCTTTGGTTTTGAATACACTATCTAGGC TTGCCACAGCTTTTCTTGCAAAGAGCAAGTGTCTTAATTTCATGGCTGCAGTCACAAACCACAGTGATTT TGGAGCACAAGAAAATAAGATCTGTCACTGCTTCCACATTTTCCCCTTCTATTTGCCATGAAGTGATGGG ACCAGATGCCATGATCTTAGTTTTTTGAATGCTAAGTTTTAACCAGCTTTTCCACTCTTCTTTCACACTC ATCAAGAGGCTCTTTAGTTCCTCTTCACTTTCTGCCATTAGAGTGGTATCATCTGCATATCTGCGGTTGT TGATATTTCTCTTGGCAATGTTGATTCCAGCCTGTGATTCATCCAGCCCAGCATTTTGCATAATATACTC TGCATATAAGTTAAATAAACAGGATGACAATATATAGCCTTGTCATACTGATTTCCCAATTTTGAACCAA TGAGGTCGGTCCATGTAAGTTCTGACTGTTGTTTCTTGACCTATATGCATGTTTCTCAGCAGACAGACAA GGTAATCTGGTATTCCCATCTCTTTAAGAATTTTCCACAGTTTGCTGTGATCCATAGCACAGTTTGCTTG TATATCCATACAAGGCTTAAGCATAGTCTATGAAGCAGAAGTAGATGTTTTCTAATAAATTCCCTTGCTT TTCCTATGATCCAACGGATGTTGGCAATTTGATCTCTTGTTCCTTTGCCTTTTCTAAATCCAACTTGTAC ATTTGGAAGTTTTCGGTTCATGTACTGCTGAAACCTAGCTTGAAGGACTCTGAGCACAACCTTACTAGCA TGGGAAATGTGCTATGTGAAATGTGGAAGGAGCACAATTGTACGATATTTTGAACAGTCTTTGGCACTGT CCTACTTTGGAATTGGAATGAAAACTGATCTTTTTGAGTCCTGTGGCCACTGCTGAGTTTTCCAAATTTG CTTACATATTGAGTCAGCACTTGAAGAGCATTATTCTTTAGATTTATGCTGAACAATGTATTATATAGAA ACAGTTTATTTTAATTGAATCAAAATCTTATTCTGTTATTCCTCAGTTTATTTTAGGGGATTCTAGAGGG TTTAAAATTCTCTCTCTTCTATCAATTACTTGTCATATCTTGAAATTATTTTGGAATTAAGTAAATGTGG AATGCACTCTGCAGTTGTGTTGTGGACTACACAGGACTCAACATTTGTGTTCAGCATTCTGTGCTCTAGT GAAGGCTTGATGGAGATGTGAAGTCCTTGGTATACATACCTCCGGTTAATAAATAGTGATACTTGGAACT GTCTATAGTCTCTATTTCATGTATTGATAAGCTATTTTGTTCTGCCAAAGAATTTGAATATGTTTATTAC AGTATCACTATGTTTAAGTCCTATTACCATATGTTTCATCTTTCTCCACAGGGTGGCATGGAAAAGTCAC TGTCGAGACCATGACGTCAGCAGTTATGTTCAGGGTTGCACCCTGTAACTGTGGAGTTATCATTCTTCAG


CTCATTTTGTCTCTTTTTCACATTAAGGAAGTAGTAGTTGAGTGAAAGTTTATACCACCATTCCTTCAAA CAAATAATATTTTTACAGAAACAGGAGCATATGGTCCTTCTTCTAAGAGGCTTAATGTTTACCTGATGCG TTAACTGTTTGTTAATAGGCCTACAATATTATTCAGTGTGCTAACAGAACTAATGTTGGTAAATATTTAT CTAAACTCTCAATTATCAAATATATCTCCAGTACATTCAGTTCTTAATCAAAGAAAGATCACTTATACAT CTTGTTGATCATGAAGGAATATAAAGAGGGATTAGAAGACCTGTTTCTTTTCCTTAATTTTATTATCATA GATTCATGCATTATGACTAAATTCAGATGAGATTGCCAGTATTGAAATAATTGCTAATTAACTATAGATA TGAAATGATGCATCTGTAAAAAATACAGACATTTTCATTAAAAACCTTGCAGTTCATACCTTGTCTGTCT TTGTTTAGAGCTATTTAGTGTCTCTGAAGAATACATATGTATATATACAGGAAAAAATGATACTTAATAT TTACAACATCTTTATCTATACCCAAACAGATGGATATTGCTGAAGAAAAATCCATAAGCATGCTGACAGT TCTTATAATTATTATTATTATTTTTTTTTTTTTTGGCTGAGCTGATCAGCTTGTGGGATCTTAGTTCCCC AATCGGGGATTGAACCCACACCCTCAACAGTGAAAGATCAAAGTCCTAACCACAAGATTCCCAGGGAATT C

Hemoglobin: >M85050.1 Pseudoterranova decipiens (frameshift mutated) hemoglobin complete cds GGAACCATTATGCACTCTTCAATAGTTTTGGCCACCGTGCTCTTTGTAGCGATTGCTTCAGCATCAAAAA CGCGAGAGCTATGCATGAAATCGCTCGAGCATGCCAAGGTTGGCACCAGCAAGGAGGCGAAGCAGGACGG CATCGACCTCTACAAACATATGTTCGAGCACTATCCAGCAATGAAGAAATACTTCAAGCATCGTGAAAAT TATACACCGGCCGATGTCCAAAAGGATCCCTTCTTTATTAAACAAGGTCAAAATATCTTGCTCGCCTGTC ACGTTTTGTGCGCCACATACGACGATCGTGAGACATTCGACGCGTACGTTGGTGAGCTGATGGCACGACA CGAGCGGGACCATGTTAAAGTACCGAATGATGTTTGGAATCACTTCTGGGAACATTTCATCGAGTTTCTG GGAAGTAAGACCACGTTGGACGAGCCAACCAAGCACGCATGGCAAGAGATCGGTAAAGAATTCTCACATG AAATCAGCCACCACGGTCGACATTCGGTTCGCGACCATTGCATGAACTCGTTGGAGTATATCGCGATCGG CGATAAGGAACATCAAAAGCAGAATGGCATTGACCTTTACAAGCATATGTTCGAGCATTATCCACATATG AGAAAGGCATTCAAGGGACGCGAAAACTTCACGAAAGAAGACGTTCAAAAGGACGCATTCTTCGTTAACA AGGACACAAGATTCTGTTGGCCCTTCGTATGCTGTGACTCCTCATACGATGACGAGCCAACATTCGACTA TTTTGTTGATGCCCTAATGGATCGTCATATCAAAGATGATATTCATCTACCTCAGGAACAATGGCATGAG TTCTGGAAATTGTTTGCCGAATATTTGAACGAAAAGAGTCACCAACATTTGACAGAAGCCGAGAAACATG CATGGAGTACAATAGGTGAGGACTTCGCGCATGAGGCCGATAAGCATGCAAAGGCCGAAAAAGACCATCA TGAAGGAGAGCACAAAGAGGAACACCACTGAACCAACCCGTCGTCGTTCAACTTAAGCCTTCAGCTTAAG CTCGAGCTAAAGCCTCAGCTTGAGCTCAATCTTATGTCCTCAGGCCTAAACTTGAATTTTAAAAGCATTT TGTTGAAGCAGTGCTAGCCAATCTCTTATCTTATCGGTGCTATTATCAATTTACTCTATGCCACCCCCCC CCCCCTCTCTCTGTTCTCTATTTGATATTCTGTTCTTTTAGTGCCAGATGTTAGTACCAGATGTTATTTT CTGCATAATTTTCTTCTCTTTACTTCGTTATTTTTTCGTTCTTCTATTTTTATGGCCAATTTTTGTGATG TCGAAGTCAATAAAACCATTTTT

mRNA,

Hexokinase: >NM_001272455.2 Drosophila melanogaster hexokinase A, transcript variant C (Hex-A), mRNA ATGCCATTTGTGGACCCCTCAGCGTCGCACATATACACGCCATATCTCCAACCATGCCGCCCCAAAACCG ATTTTCAGTTTTTGACCTTCAAGGTTCCTTCACGGCGAGCGAGAGAGAGAGAGAGTGAGAGTGTGAGCGC GGCTCGCAGTCGCGGTCGGCGCCGGCAGCGCAGCAGCAGCGACAGCGAAAAGTGAGCACCAGTCGGCGAG TGAATTTAATTTCGTAAAAAACGTTCCGAGCGTTTGGACGCGTGCAGCGGACGAAAATAAAACACGGCGA GAGCGAGAATCGTGTGTGTGGACACTCAAAGACTCAAAATTGAAACCAACTCGAAAAGGTTGCACTGCAA ATGCCCAAGTAGAAAAGCCAACGCGAGTGTGCACATCGAATACGAAAATTGTAAACGTTTTTTTTTTGCC GTGTGAGTGCAAGCGCATAAGATCGAAGAAAAACAGCCAGAGCAAGAAAGAACCGAAAAAAGGCAGAGAG AATCAAAAAAGAAAAAAGGAAAAAAAAAACAAGCAGGAAAACACCAACATAATAATGGATCGGGAGCTGA ACGGGGCGATGAAGAGCGTGTCCATAAATAGCGCCCAACTGAATGGTCACAATAACGGTGGCGGGCTAGA TGAAACGGACCGCGTGGGCGTGGCACAGGGGGCGGCACTGAGTGCAACAGAGAAAATTACAACAACGACG GCGGCAGCTACAAAATCAGCGACAGCGACCACAAATGCAACCACAGCAACAGCCACAACCACAAATCTTA CAACTCACAGCCCGCAGCAAATTGCACTCTTATCCGCTGCAGAGAAAAGTAAGATGGTGCACGAGTTATG TCAGCAGCTGCTTCTAACGGACGAACAGGTGCAGGAGCTGTGCTACCGCATCCTGCACGAGCTGCGCCGC


GGCCTGGCCAAGGATACACATCCCAAGGCGAATGTCAAGTGCTTCGTAACGTATGTGCAGGATCTGCCCA ATGGCAATGAGCGTGGCAAGTTCTTGGCCTTGGATCTGGGTGGCACCAACTTCCGGGTGCTGCTCATCCA TCTGCAGGAGAACAACGATTTTCAAATGGAGTCCCGCATCTATGCCATACCGCAGCACATTATGATTGGA TCGGGTACACAGCTATTCGATCACATCGCCGAATGTCTGTCCAACTTTATGGCCGAGCACAATGTGTACA AGGAGCGTTTGCCACTCGGTTTCACCTTCTCGTTCCCGCTGCGCCAATTGGGTCTGACCAAGGGCCTGCT GGAGACCTGGACCAAGGGCTTCAACTGCGCTGGCGTCGTCAACGAGGATGTTGTCCAGTTGCTAAAGGAT GCCATCGCACGGCGCGGCGATGTCCAGATCGATGTGTGTGCCATACTCAATGACACCACTGGCACGCTGA TGAGCTGCGCCTGGAAGAATCACAACTGCAAGATCGGTCTGATTGTCGGCACCGGTGCAAATGCCTGCTA TATGGAGCGTGTGGAGGAGGCGGAGCTCTTCGCCGCCGAGGATCCGCGCAAGAAGCACGTCCTGATCAAC ACGGAATGGGGCGCATTCGGCGACAATGGCGCACTGGACTTTGTGCGCACCGAATTCGATCGGGACATCG ATGTGCACAGCATCAATCCGGGCAAGCAGACGTTCGAGAAGATGATATCGGGCATGTATATGGGCGAGCT GGTGCGTCTGGTGCTGGTGAAGATGACCCAGGCGGGTATACTCTTCAATGGACAGGATTCCGAAGTGCTA AACACCCGCGGACTGTTCTTCACCAAGTATGTGAGCGAAATTGAAGCTGACGAGCCAGGCAACTTCACCA ATTGCCGCCTGGTGCTGGAGGAGCTCGGTCTGACCAATGCCACCGACGGGGACTGCGCCAATGTGCGGTA CATCTGCGAGTGCGTCTCGAAACGGGCTGCCCACCTGGTGTCCGCCGGCATTGCCACGCTGATCAACAAA ATGGACGAGCCAACGGTGACGGTGGGCGTCGATGGCAGTGTGTACCGCTTCCATCCCAAGTTCCATAACC TGATGGTCGAGAAGATCTCGCAGCTGATCAAGCCGGGCATCACCTTCGATCTGATGCTGTCCGAGGACGG TTCCGGTCGTGGAGCTGCCCTGGTGGCGGCCGTCGCCTGTCGCGAAGACATACTCAATGGCAAGAAGTAG GATGGATAGGGAGCTGGAGCTGGATCAGGAACCAGGAGGAGGAGCCGCTGGAGCAGCTGGAGCAGTCCTA AGAGATACAGCAACACACCCACACAACCACAAAAACAGCAGAGCAAATGAGAAATACCTAGTAAACGGCC ACGGTGGCGTATGCGTAATAATTACAGTAGAGCCACGCTAACTCACAAAAGCCCTATAGCCAAACGATAT GAAAAAATGAAGCTGCCACGACGAAAAGTAATCGAAAAGCCCACGAAAAACTTATATGTGCATACGTAGG GCATTTGTGAGTTGGCGCGACTTGGCTTTAGTATTTTAATTAGGCAAAAACCAGGTTTTTCACTACAAAC ACAAGCGTAACAGAAACCCCCCCACTAAGAGACAGAAGATCTGTGGCATTCTATCTCTTTCTCTCCTAGT AAAAGAAAACAAAGAAGAAGAAAAAACACTATGCTTAATGATTATGGATCGATTTTCGATTTTTGTTGAA AATTTGTTATGCTATTATATATATATATATTTTACAAGAAAACATAATATACACACACTAAAAACATAAT GTATATGTTTGCGTATATATAGTACAATTTGTGAAGCGAATTTCTTTTCGATTTCGATTGAAACAACAAA TTTTTTTTGGTAATTCCCTGCCCAAAAGACCCCTGAAACCCCCCTAAAAAAACGGAGATACTTAAGAGCA AGTGAGAAAAGAAACTGTTATACTACTGTGCTACAAGCATTCTAGCATATCCTGCAGGACAACGGAAAGA GAAACTGTAAAACCGCACATTGTTAAAGCAAAAACGAAAACGAAAAAAGCAACAAAAAACAAGCCGCTAG AGAAGAGACAGAAACAGAGGGATAGAAAGGAAGAGAGCGAGAGAGAGCGAGCGAGAGAAAGAGAGAGAGG ATTACTAGGTAATGCTACGGTGTCCTTTCTGTAATTGTAAATGTTTATATAGAACCTATTACGAAGCGTT ATATGATAATACTGCATACATATATATAAATATAAATATGATATATTTAGCCACTATATTACTGATTTTT TTTTTTGTAATGTATTGCTTGTCTTTGTTTAGTGAATTTGTTTGTTGTTAACACTTAAGCAGGTAAACTC TAAACAAAAATAAACTGTTTTTTTTTTTCCTTTTGATATAGAAACGCACTTTGTGAGCTATTATTTATGT AATTGTACATTTGACCTAGTTTAGTGTTTAGTTCTTATCTTAGTTTCTAAATGTCGTCGAAGAAGCCAGC AATACAACCAATATAATACCCCCACCCCAAAAAAAAAACCCAACCCACGCAGCCCTTAATTATATTTAAT TATTGTTTACGAACAACAAACGAAGAGAATGCGAGAAGCTAAAAGGCAAATAAGCAAAATGGAAAGCAAA TAAAATTTGTTCTTAATTCATACACAAGTAGTTGTTACTTATTTCTCCCAAATTAATTGGTTTTCCAAAG TGATTAGGTTTTTTCCAGATTGATTTCAGTATGATTTGATCTGTTTTCCATATGATTCGGTATCATTTGA TCATTTTTGCAGCTGCTGGCCGGCATGCTCAGTCAACACAAAAACTTAAACAATTCGCAATTGAGGCAAA ACGAAGATACATTTTTTTGGTCTAATACTAAGCGGAGAATGAGCCTAACCTAAGAGATATGTTATAATAA ATGGCGGGAGCAGCGAACCAGTGTTTCTATTTTTCAAGAAAGAAAAAAACGAAAAACAAGAAGAATGTAA TATAAACTTAGCCCATGTTAAAATGAAAATTGAAAACCAATTAAAAACTCTCGTTATCAAAAGGCGATTC AAACATAAATTGCTAAGAACAAACAAACACAAATCGAAGGCTTGAAAGTGCAGATGAGATGAATTTAGTA AATGATATAAACAAATGGAATGTTTGTCAACAGTGAAGCAAAATAAAGACGATTGAACCAAACAACAGAG AAGCAAATC

RNA POLIMESARA: >M84806.1 Andean potato mottle virus RNA polymerase mRNA, 3' end GGTATTCATGTTGCAGGAGGCAGAGGCAAAGGATATGCTTGTCTGATGCCACCATTGCGACCAAAAGCAC AGGCACAATCTGCACAGGAGCATTTTGAAATTTTCCCGTATGAGCAGGAGACAAATGCTGGTTTGGCTCT CGTTGGAGAATTGAAGCAAGGAGTTTATGTAAGTTGTCCAACCAAGACAAGTTTTGAAAGGACTCCTGAG AGTTATCATTTAGGTCTTCCTTGTGAGAAAGAGCCAAGCATTTTGTCTTCACATGATCCTCGGATTCCTG AACATGTTGAGGGGTATTGCCCTTTTAGAGCTGGCATTCAGAAGTATGCAAATCCAATGGGACATTTGGA TCATGATTTAATGTATGAAGTGGCCCATGATATGCAGGAAAGCTGGCATGATTGTGTGCAGGATTTTACT TTTCCTGAAGTGGATTTGGAAACAGCAATAAATGGAATTGATATGGTTGAGTATATGGAGTGTATACCCA


AGTCAACTTCAGAGGGTTTTCCTCATGTTCTGTCCAGAGCACCAGGAGAGAAAGGGAAAATGAGGTTTCT TGAAGGAGATGGGGAGAAGTTTTCTTTGAGAGAAGGAACCAGTGTCAAGAAGGCCTATGATTTGTTACAA GAGGAGATAGATAGGTCTGTTCCTACTTTGGTTGCAATAGAATGTCCCAAAGACGAAAAATTGCCTCTGA GAAAAATATACACCAGTCCTAAGACAAGATGTTTTTCCATTCTTCCAATGGAGTATAATTTGCTTGTGAG GCAAAAGTTTCTACATTTTGTTCGGTTTATGATGAAACGTAGGGATGTTTTACCAAGTCAAGTTGGAGTT AATCCATACAGTTTGGAATGGGGTGCTATTGCAAGAAGATTGCAGGAGGTTGGTAATTCCATTCTCTGTT GTGATTATTCAAGTTTTGATGGGCTGATGTCAAGTCAAGTGATGTCATGTATAGCAGATACAATGAATGA TTTTATGGGAGGGGATGTGAGCTTAAAGAGGCAACGGAAAAATCTTCTTATGGCTTGTTGTTCAAGATTT TCTGTTGTTAAAGGAAATGTTTGGCGAGTTGAAGGAGGAATCCCTTCAGGTTTTCCCCTTACAGTTGTTA TGAATGGCATTTTTAATGAGTTGCTTGTCAGATACTGTTTCAAGAAAATAATGAGGGAGGGAGGAGCAAC ACCCTTGGAGTGTAGTGCCTTCGACAGTTACATTCGTTTTGTTGTCTATGGTGATGACAATTTGATAAGT GTTTCTCCTGTGATACATGACAAGTTTAACGGGAAACTTTTGAAGGAGTGCATGGCACGATTTGGAGTTA CAATTACTGATGGTAAGGACAAAACGTTGCCTACACTTGAGTTTAGGCCCTTGGAAGATTGTGACTTTCT CAAAAGAGGTTTCATTCAAAGATCTGAACTTGTGTGGGATGCCCCTGAGGAAAGGAGTAGTTTGTACACT CAACTCCATTATGTGTCAACAAAAATGCAAAGCCTTGAAGATGCATATACTGGAAATCTTGTGAATGTTA TCAGAGAATTGTATATGCATTCCCCAAAGGAAGCATCTGACCTGCGCAGAAAAGCACTGAGGGATTTGCC GTGGTTGTCTAGGAGTAAGATTGGCACGATGGAAAATGTTCAAGCTTTTTATGCTATGCAAAGAGCAGGG TATAGAATGGATGAATCCATTGATGTCATTTGTGATTTGGCTAAGCTTGGTAAATATGTTAAAGGTGAGG CTTGTAAGGAGATTGTTTGGCTTACACCTACTGTTGGGGCCTGTGATTTGAGGTATTTTGATTGGCAGAA TGCTAAGGTTGATGAATTCTGGGTTCTTTGTCAAACAAATTACCATGAATTTGATGAAAACAGGGTTATG CAATTGTGCTGGACACCAGGTTCTGGAAGGGGAGGCTTACCAACAGCACATTGGCTTAGAACTTGTATGC TACTTGAGAAAGGAAATGTGAGGAAGAAACTTCATTGGGCTATGGCAGAAAAGAAAAAGATCATTTTTTG TGCTAAAGGAGGGGTGTTAATACCAACTGTGATGGCTGGCATTTTCCTGAGTAAAGAAGATCCAATGTTA AACTTGGCAGGAGTTTCGACTTTAACATGTGCCATGGAGTCTGTCAAGACATTGGGATTCCTTAAAGAAG GAAATTTGAATTTATTTTAATTTTATTTTGCTTTGTGTTTTGAAATAAGTTTTCACGTCACTGAGCTTAG GCCCTTGTGAGAACATTTGTGTGAATTTTATAATCTACGTATTTTGGTTTGCATTTGTGTTTTAAAAAAA AAAAAAAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Alipoliprotein: >M18421.1 Chicken apoB mRNA encoding apolipoprotein, partial cds ATTCCTGGACTGTCTGAAAAGTATACAGGTGAAGAATTATACCTTATGACTACAGAGAAGGCTGCAAAAA CTGCAGATATATGCCTTTCAAAACTTCAGGAGTACTTTGATGCCTTGATTGCAGCTATCAGTGAACTGGA AGTCAGAGTTCCTGCTTCTGAAACCATCCTCAGAGGTCGTAATGTACTTGATCAAATTAAGGAAATGCTG AAACATTTGCAGGAGAAAATCAGGCAGACCTTTGTTACTCTCCAAGAAGCTGACTTCGCAGGAAAGCTTA ACCGACTGAAGCAAGTGGTGCAAAAAACTTTTCAGAAGGCAGGAAATATGGTTAGAAGCTTGCAGTCCAA AAATTTTGAGGACATCAAAGTCCAAATGCAACAGCTGTACAAGGACGCAATGGCTTCAGACTATGCACAC AAACTTAGATCCTTGGCAGAAAATGTTAAAAAGTACATTTCTCAGATCAAAAATTTTAGCCAGAAGACAT TACAGAAGCTTTCAGAAAATCTGCAGCAGCTGGTCCTCTATATAAAGGCATTGCGGGAGGAATACTTTGA TCCTACTACACTTGGATGGTCAGTGAAATACTATGAAGTAGAAGACAAGGTACTAGGATTGCTAAAGAAT CTAATGGATACACTAGTCATTTGGTACAATGAATATGCTAAAGATCTTTCTGACTTGGTTACACGCCTCA CAGACCAAGTAAGAGAGCTGGTGGAAAACTACAGGCAGGAATATTACGACCTTATAACTGATGTTGAAGG AAAAGGAAGACAGAAGGTTATGGAGCTCTCATCCGCTGCTCAAGAAAAAATCCGATATTGGTCTGCAGTT GCTAAAAGGAAAATCAATGAGCATAACAGGCAAGTTAAAGCAAAACTCCAGGAGATATATGGGCAGCTTA GTGATTCTCAAGAAAAGCTAATCAATGTGGCCAAAATGTTAATTGATCTAACTGTAGAAAAGTACTCTAC ATTCATGAAGTACATCTTTGAGCTTCTTCGTTGGTTTGAGCAAGCAACAGCTGACAGCATAAAACCATAT ATAGCTGTTCGTGAAGGAGAGCTTAGAATAGATGTGCCGTTTGACTGGGAGTACATTAACCAAATGCCAC AGAAAAGCAGAGAGGCACTCAGAAATAAAGTGGAACTAACACGCGCGCTAATTCAGCAAGGCGTTGAACA AGGCACCAGGAAATGGGAAGAAATGCAAGCATTCATTGATGAACAACTTGCCACTGAGCAGCTGAGTTTT CAGCAGATTGTGGAAAACATACAGAAGCGCATGAAGACCTGAATGAACATGCAGAAGACGAGAAATAATA AGTTTGTACCGCAATGTATTTAAATGTAACAGCAATTAACATACTGGAACTTCAAGTAGATACTGTTTGA ATCTGAATTTATAACTGAAAACTAAATAATCTACAGTAGGTTATTTTAATAAGCTTAATAACACAATAAA TGAGTTCTTTATTA

Glutamine: >X76736.1 B.napus mRNA for cytosolic glutamine synthetase isoform (BnGSR1-1) related to the A-genome type of Brassica campestris


CAAAAACCACATTATCCGAGATTTGAGTATATTTCATTGCAACCTTCTTGTCATTTTCTCTGTAACCATG AGTCTTCTGACCGATCTCGTTAACCTTGACCTCTCAGACAACACTGAGAAAATCATCGCTGAATACATAT GGGTTGGTGGTTCAGGAATGGATATGAGAAGCAAAGCCAGGACTCTCCCTGGACCTGTGACCGATCCATC AAAGCTCCCAAAATGGAATTATGATGGTTCAAGCACTGGCCAAGCTCCTGGTGAAGACAGCGAAGTGATC TTATACCCTCAAGCGATTTTCAAAGATCCGTTCCGTAGAGGCAACAACATTCTTGTCATGTGTGATACTT ACACCCCTGCGGGTGAACCAATCCCTACGAACAAGAGACATGCTGCAGCTCAGATCTTTAGCAACCCTGA TGTTGTTGCTGAAGTGCCATGGTATGGAATCGAACAAGAATACACTCTGTTGCAGAAAGATGTGAATTGG CCTGTCGGATGGCCCATTGGTGGATTCCCCGGCCCTCAGGGACCATACTACTGCAGTGTTGGAGCTGACA AATCTTTTGGAAGAGACATTGTTGATGCTCACTACAAGGCTTGTTTGTATGCTGGAATTAACATCAGTGG AATCAATGGAGAAGTCATGCCTGGTCAGTGGGAGTTCCAAGTCGGACCGTCGGTTGGTATCTCAGCTGCT GATGAAGTGTGGATTGCTCGTTTTATTTTGGAGAGGATCACAGAGATTGCTGGTGTGGTTGTATCTTTTG ACCCAAAACCAATTCCGGGTGACTGGAACGGAGCTGGTGCTCACACCAATTACAGTACTAAATCGATGAG GGAGGAAGGAGGATACGAGATAATCAAGAAGGCAATTGATAAGCTCGGACTGAGACACAAGGAGCACATT TCTGCTTACGGTGAAGGCAACGAGCGTCGTCTCACTGGACACCATGAAACTGCTGATATCAACACTTTCA AATGGGGTGTTGCAAACCGTGGAGCATCAATCCGTGTAGGACGTGACACGGAGAAGGAAGGGAAAGGATA CTTTGAGGATAGGAGGCCAGCTTCCAACATGGACCCTTACACTGTAACTTCCATGATTGCAGAGACTACA CTTCTTTGGAATCCTTGAAGAAATATGACAATAATATAACTTGAATCTGGTTTCAAGTTTGTGTTTCTAC AGTTTATTAAGCAATTACCGGGTTGATACTGCCGGAGTTTGTGGTTTGAGGCCTTTCTTTTAATCTCTTT GTGTTTTGGGGTTTGTGATTGGAGCAAAAGCCCTGATTTGCTCTGTTTCTTTGACCTTTTATTTGAACCC TTTGTATTTGTATTAATAAGGCGATCTGAAAAGGCCTTTTCATGTTTCTATCAAAAAAAAAAAAAAAAAA

Arginine: >KX539445.1 Dictyostelium polycarpum strain OhioWILDS arginine (argC) gene, complete cds GTAACAGATGTTGAAAAGAAAGTACGTGCACAACCAATCATTGAAAAGACTACAGCATCATCGACTAGCA TTGCATTTGGAGCGAGTTCAAACTACTCAAAGAACGTAAAGTTGACAGAGGGCAAGTCCATTGTCTTGGT AAAGATTGGTGGAGGTGTCATTGAGCATGACATTAGCGCTTTGATCTCATCATTGAACTTCTTGCGCAAG ATTGGTCTCTACCCAATCGTCGTGCACGGAGGTGGTCCACAGTTGAACGCTGAGCTTGCTGCTGCCAAGG AGCCAGCCGAATATGTCGAGGGACTTCGTGTCACTCCACCCTCGGTATTGGCAATTGCACAGCGTGTCTT TGCTCGTGAGAATCTCAAGATTGTCGAGGCTCTCGAGGCTAGCGGCACACGTGCTCGTCCCATCACACAA GGTGTCTTCCAGGCAACACCACTCGATCCAGCTGTCTATGGATTCGTTGGTAACGTCACCAAGATTCTCA CTGACGCCATTGCCTCCTGTATCTCTGGTGACTATGTCCCAGTCGTATCGAGTCTTGCAATGACCCCAGA GGGTCAGGTACTCAACATCAACGCCGACGTTGCTGCATTAGAGTTGGCCCGCGCCATCAGCCCACTCAAG ATTGTCTTTATCAACACCACTGCCGGTATGAAGGACGGCGAGGGTCGCGTCATGCGCCACATTGTTCTCG ACCAACAATACGACGAGCTCATGAAACAACCATGGGTCAAGCATGGCACCAAGCTCAAGCTCAAGGAGTT TAAGAACTGTCTCGACCATTTGCCACGCTCCACCTCGATCACCATCACCAGTCCCGCCTTGCTCCAAACA GAGCTCTTTGCCAAGAATGGCAGCGGTACAACTGTCGAGCGTGGAAACGCCATCCTTACAAACGACTCTG TCTGCTTTGACCGTCTCTCATCGCTCTTGCCAGCCGGCTCGGCCAACGCCACTCAAATCCGCTCACAGGT CGACCGTGACAAGCTCAAGGTATTTGCCAACGCCGACTACTCTGCCGCCGTCATTGTCCGCGCTCTTCCA GCCTCACCATCTGTCCATTACGTCGAGCGCTTCCTCGTCTCTTCGGCATCGATTTCCGACGAATCAGCTG ACGCTGTTTTCGCCGCTGCCGCCACACACTGCCCAGGCCTCATCTGGCGCGCCGAGTCCACCGACGACGC TGCCACCGTCTCGTGGTACCGCAAGATTGCCTCTGGATTCAATCGCGAGGGATCTGCACAAGAGGTCTTT TGGACTGGCATATCTTTGGCCGACGTCGCTCGTCCCCTCCAACAAGCACTCAACATGGGAACCAGCACAT TTGGTGAGACTCCAGCATCTGCTGCCTCTGAGGCACTCGTTGCCAACAAAGCCACCAAGAAGCGTATCGG TCTTCTTGGCGCTCGTGGATTCACTGGTGGTCACCTTGTTGGCCTCATTGAGCAACACCCATCGCTCGAG CTCGCTCTTGCCGCCTCGTCTACCAACTATGGAAAGCCCGTCACCACCGAGTTCCCCAACCTCCGCAACA AGTCAATGCTCTTTGCCGAGATCAAGCCAGACAACATTGCCGAGCAAACCATGCAACAAGGCATTGACGG TTGGTTCATGGCCCTCCCAGACCTCATCTCCAAGCCATACGTTGACGCCATTGACCGTGCTCCTCGCCAA CCACATCTTGTCGACTTGAGTGCCGACCACCGTTTCGACTCATCCTGGATCTATGGATCACCAGAGACTA ACCGTGCTCGCATCAGTGGAGCTCTTCGTATTGCCAACCCTGGCTGCTACGCCACCGGAATGTACCTGTC GCTCACACCATTCGTCAAGGCTGGTCTCCTCGCTGGCCCTCCATCATGCTTTGGTATCTCTGGATACAGT GGTGCCGGCTCCAAGCCCTCTGAAAAGAACGACATGAACAACCTCCGCGACAACATTCTACCCTACAAGC TCGTCCAACACACCCACGAGAAGGAGGTATCCCATCAACTTGGCTCACCCATCTACTTTATGCCCCACGT CGGACAGTTCTTCCAAGGCATCACACTCACCATCTCTATGAGACTCAACCGTGCCATCACTAAAGAGGAG GTCATTTCAATGTACGAGCGCCACTATGCCAATGAGCCACTCATCAAGATCGTCAAGGACGCTATCCCCG AGGTCCGCGCCAACGCCAACAAGCACACCGTCTCTATTGGTGGTATCACTGTCCACGATAACCATGTCGT


CGTCATTGCCACCCTCGACAATCTCCTCAAGGGAGCTGCCACTCAAGCTCTTCAAAACATGAACCTATGT CTTGGACTCAACGAGCTCGATGGAATTAATTTGTAG

Valina: >MF132522.1 Celiptera valina voucher 1426-240703-AR cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial TTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGAGCAGAA TTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTA TTATAATTTTTTTTATAGTAATACCAATCATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATT AGGAGCACCTGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGATTACTACCCCCTTCTTTAACT CTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTACCCTCCTCTTTCAT CTAATATTGCTCATAGAGGAAGTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTC TATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTAATATTTGATCAA ATACCCCTATTTGTTTGAGCAGTAGGAATTACTGCATTTTTATTACTCTTATCACTACCTGTATTAGCAG GAGCTATTACTATATTATTAACAGATCGAAACTTAAATACTTCATTTTTTGACCCTGCTGGTGGAGGAGA NCCAATTCTATACCAACATT

Phenylalanine: >Z38099.1 G.hybrida mRNA for phenylalanine (partial) AACTCCTATTGGTGCTTCCATGGACAACACACGTCTAGCCATTGCCTCGATTGGGAAACTCATGTTTGCT CAATTCTCCGAGCTTGTAAACGATTTCTACAACAATGGGTTGCCATCAAATCTCTCTGGCGGGCGAAACC CTAGCTTGGATTACGGGTTCAAAGGTGGAGAAATTGCGATGGCTTCTTATTGTTCCGAGCTCCAGCTTCT TGCCAATCCGGTTACAAATCA

Tubulin >LM994880.1 Foraminifera sp. LAPG-2014 partial tubulin gene for tubulin CAATGTGGTAACCAAATTGGTAATGCTTTTTGGAATACTATGTGTGTTGAGCATCAACTTGAAGCTGCTT CTGGAAAATTTCAAGCATCAAAAGATAAAGTAAATGATACTCAAAGACTTTCTAAAGTTGATGTATATTT TAAAGAATCTGGAAAAGGAAGATATGTTCCACGTTCAGTATTAGTTGATCTTGAACCTGGTACTTTAGAT GTAATTAAAGCATCAGCAACTGGAAAACTTTTTAAACCTGATAATTTTTGTTTTGGTGCATCTGGAGCAG GAAATAATTGGGCAAAAGGTCATTATACAGAAGGTGCAGAACTTATTGATGAAGTTGTTGATATTATTAG AAAAGAAACAGAAGCATGTAATTGTCCACAAGGATTTCAAGTTACACATTCAATTGGTGGTGGTACAGGA TCTGGTATGGGAACTCTTCTTCTTTTAAAAATTAGAGATAATTATCCTGATAGAATTACATGTACTTATT CTGTATTTCCATCACCAAAAGTATCTGATGTTGTTGTTGAACCATATAATGCTACACTTTCAATTCATCA ATTATTAGAAAATTCTGATGAAACATTTGTTATTGATAATGAAGCTTTATATAATATTTCACATAATTTA CTTAAACAAAAAGAACCAAAATATAATGAATTAAATGGTGTTGTTGCACAAGTTATGAGTGGTATTACAG CTTCATTAAGATTTAGTGGTAAACTTAATGGTGATTTAAGAAAAATGGGTGTAAATTTAGTACCATTTCC TCGTTTACATTTTTTTTTAATTGCACAAGCACCAATTTTTTCAAATCAAAATAAAGGTAAAGTTAATTTA GATGTAAAAGAAGTTACAAGTCAAATGTGGTCACAAAGTAATTTTTTAGCAAATGTAAAATCAGATGAAG GTAAATATTTAAGTGCAGCTTGTATGTATCGTGGTAATATGGGTACACAAGAAGTTGATGATGCTGTAGC AAAAGTACAATCAAAAATGGCTGATGATTTTGTAACATGGATTCCAAATAATATTAAATCATCAATTATT TCAGTATCACCTGATGGTACAAAAATGAGTGGTACTTTTGTTGCAAATACAACTTCTTTAAAAAGTGTTT TTCAACGTATTTCAGCACAATTTGCTAAAATGTATAAAAGAAAAGCATTTTTACATTGGTATAAAGGTGA AGGTATGGATGAAATGGAATTTCAAGAAGCTGATAAAAATTTAAGAGATTTAGTTACTGAATATCAAGAC AAACAAGATG

Gabriela staysy perez chavez  
Gabriela staysy perez chavez  
Advertisement