Page 1

Καθημερινη ανεξαρτητη Εφημερiδα της κεντρικησ μακεδονιασ | αρ.φυλλου 793 epikera@otenet.gr www.epikeranews.gr

Επικαιρα

11

παρασκευη μαϊοσ 2012 20-28 Βαθμοί Κελσίου TIMH: 0.50

editorial

Ευ. Βενιζέλος μετά τη συνάντηση με Φ. Κουβέλη:

ΚΑΛΟΣ ΟΙΩΝΟΣ

για το σχηματισμό κυβέρνησης Σελ. 24

Τι θέλει ο λαός; Μετά τον Αντώνη Σαμαρά και ο Αλέξης Τσίπρας «επέστρεψε» στον Πρόεδρο της Δημοκρατίας την εντολή σχηματισμού Κυβέρνησης. Ο πρώτος την «κράτησε» κάποιες ώρες. Ο δεύτερος, ο Πρόεδρος του ΣΥΡΙΖΑ, δύο μέρες. Όχι πως χρειαζόταν πραγματικά τόσος χρόνος για να διαπιστώσει ότι δεν μπορεί να εξασφαλίσει την «δεδηλωμένη» από τα κόμματα της Βουλής – αρκούσαν και γι’αυτόν λίγες ώρες – αλλά ίσως ήθελε να τη χαρεί λίγο περισσότερο. Γι’αυτό και την περιέφερε σε συναντήσεις με κοινωνικούς και άλλους φορείς χωρίς να συντρέχει κανένας λόγος. Η εντολή δίδεται για διερεύνηση των προθέσεων των κομμάτων που εκπροσωπούνται στη Βουλή κι όχι οποιωνδήποτε τρίτων. Για το λόγο αυτό άλλωστε και οι κορυφαίοι φορείς ΓΣΕΕ και ΑΔΕΔΥ (όπως και η ΔΟΕ) αρνήθηκαν συνάντησή τους με τον κ. Τσίπρα ως στερούμενη αντικειμένου.

Σελ. 2

Το Χρονογράφημά

τοπικα

«Πράσινο φως» για την ανέγερση του 10ου Δημοτικού Σχολείου Νάουσας

Σελ.4

μας

τοπικα

Σελ. 9

Το Δημοτικό Συμβούλιο και πάλι

«Νίπτει τας χείρας του» για την κατασκευή ή όχι της ΜΕΑ – ΧΥΤΥ στη «Θέση 12»

Σελ. 6-7

ΣΤΑΜΠΟΥΛΗΣ Ε.Π.Ε.

τοπικα

Την Κυριακή η υποδοχή της Προτεινόμενα θέματα για τις Πανελλαδικές Ολυμπιακής Φλόγας στη Βέροια στο μάθημα της Βιολογίας Εμπορία γαλακτοκομικών & κατεψυγμένων ειδών

2ο χιλ. Νάουσας - Σ.Σ. Νάουσας

Τηλ. 23320 26904, 21981 - Fax: 23320 21981

Σελ. 14-15

ό

Σελ. 5


editorial

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Εύλογο το ερώτημα: Μα γιατί δεν μπορούν να συνεννοηθούν οι επτά αρχηγοί των κομμάτων; Η επιθυμία του λαού εκφράστηκε. Οι ηγετικές πολιτικές ελίτ δεν την καταλαβαίνουν, ζουν σ’ έναν άλλο κόσμο εκτός ελληνικής πραγματικότητας; Τα πράγματα είναι πολύ απλά ώστε να περιττεύει η πολυτέλεια – σε καιρούς μάλιστα που δεν περιμένουν - νέων εκλογών για περισσότερες «εξηγήσεις».

Α

μέσως μετά, την εντολή πήρε ο Πρόεδρος του ΠΑΣΟΚ κι αυτός θα την επιστρέψει – κατά πάσα πιθανότητα σήμερα. Έτσι θα ακολουθήσει τις αμέσως επόμενες ημέρες σύσκεψη των αρχηγών των εφτά κομμάτων της Βουλής υπό τον Πρόεδρο της Δημοκρατίας σε μια τελευταία προσπάθεια αναζήτησης συμμαχιών για τη συγκρότηση κυβέρνησης που να έχει (με ψήφο εμπιστοσύνης ή και ανοχής την στήριξη 151 τουλάχιστον βουλευτών). Είναι πιθανή μια τέτοια εξέλιξη;

Μ

οιάζει απίθανη όχι όμως και αδύνατη. Εάν πάντως δεν επιτευχθεί συμφωνία τότε θα γίνουν αναγκαστικά εκλογές εντός του επόμενου μήνα. Το ενδεχόμενο σχηματισμού κυβέρνησης ειδικού σκοπού (πχ αλλαγή εκλογικού νόμου) και περιορισμένης διάρκειας δεν αποκλείεται. Εμφανίζεται πάντως ιδιαίτερα «χλομό».

Α

λλά γιατί δεν μπορούν να βρουν ένα montus viventi και συνεργασίας τα πολιτικά μας κόμματα; Το εκλογικό σώμα με την ψήφο του έδειξε πεντακάθαρα ότι δεν θα ήθελε μονοκομματική κυβέρνηση. Το να μην πάρει κανένα κόμμα (πλην της … αποχής) πάνω από 20% μπορεί να σημαίνει: ή ότι κυριάρχησε η οργή και η απόγνωση και συνεπώς η ψήφος ήταν καθαρά τιμωρητική (για τα παλιά μεγάλα κόμματα) ή ότι ο λαός θέλει πλέον κυβερνήσεις συνεργασίας ή και τα δύο. Η επικρατούσα άποψη είναι ότι τιμώρησε τα δύο μεγάλα κόμματα, ανάλογα μάλιστα με την ευθύνη του καθενός (αφαίρεσε από

Σύμφωνα με τις διατάξεις του Ν.3548/2007, όπως ισχύει, η εφημερίδα μας «ΕΠΙΚΑΙΡΑ Κεντρικής Μακεδονίας», έχει τη δυνατότητα να δημοσιεύει τα κάτωθι: • Διακηρύξεις- δημοπρασίες Δημοτικών Επιχειρήσεων • Περιλήψεις διακηρύξεων δημοπρασιών για μίσθωση ακινήτου, όταν οι διακηρύξεις αυτές δεν προέρχονται από τον δημόσιο τομέα όπως ορίζεται με το άρθρο 51 του Ν. 1892/1990 (ΦΕΚ Α΄101), όπως αυτό συμπληρώθηκε δια

το Πασοκ πάνω από 30% και από τη ΝΔ 14,5%) για τα άδικα και σκληρά μέτρα, χωρίς ωστόσο να δώσει την εμπιστοσύνη του σε κάποιο από τα αντιμνημονιακά καλούμενα κόμματα.

Έ

δειξαν δηλαδή τα αποτελέσματα των εκλογών ότι ο λαός δεν εμπιστεύεται κανένα κόμμα ώστε να του αναθέσει τη διακυβέρνηση της χώρας. Κι αυτό είναι ολοφάνερο και αδιαμφισβήτητο από τις επιδόσεις όλων των κομμάτων. Τα κόμματα από την πλευρά τους έδειξαν αδυναμία να συνεννοηθούν. Έτσι παρέμεινε πολύ πιθανό να οδηγηθούμε σε νέες εκλογές. Με άδηλα – προς το παρόν τουλάχιστον αποτελέσματα.

Ε

ύλογα το ερώτημα: Μα γιατί δεν μπορούν να συνεννοηθούν οι επτά αρχηγοί των κομμάτων; Η επιθυμία του λαού εκφράστηκε. Οι ηγετικές πολιτικές ελίτ δεν την καταλαβαίνουν, ζουν σ’ έναν άλλο κόσμο εκτός ελληνικής πραγματικότητας; Τα πράγματα είναι πολύ απλά ώστε να περιττεύει η πολυτέλεια – σε καιρούς μάλιστα που δεν περιμένουν - νέων εκλογών για περισσότερες «εξηγήσεις». Ο λαός στην συντριπτική του πλειοψηφία είναι υπέρ της παραμονής στην Ευρωπαϊκή Ένωση και στο ευρώ. Κανένας από τους εφτά αρχηγούς – πλην βεβαίως της Αλέκας Παπαρήγα - δεν έθεσε θέμα εξόδου της χώρας από την ΕΕ. Αυτό έδειξαν οι εκλογές. Αυτό έδειξαν και όσες σχετικές έρευνες έγιναν ως τώρα. Ο Ευρωπαϊκός προσανατολισμός της χώρας είναι λοιπόν δεδομένος. Και όλοι οι πολιτικοί αρχηγοί οφείλουν πρώτα

απ’ όλα να σεβαστούν αυτή την επιθυμία και απόφαση του λαού.

Ο

λαός στην πλειοψηφία του εκδήλωσε την δίκαιη αντίδραση του στα μνημόνια. Που τον εξουθένωσαν, τον οδήγησαν σε αδιέξοδο. Οι πολιτικοί αρχηγοί άλλοι υπερτίμησαν κι άλλοι υποτίμησαν την επιθυμία αυτή του λαού μας. Ωστόσο τα αποτελέσματα των εκλογών δείχνουν τις προτεραιότητες που βάζει ο λαός. Πρώτο στη σειρά, και με μεγάλη διαφορά, είναι η ευρωπαϊκή προοπτική της χώρας. Τα κόμματα που την υποστηρίζουν πήραν συνολικά 84%.

Τ

Ε

ίναι λοιπόν σαφής η επιθυμία του λαού. Και κάποια κόμματα δεν μπορεί να την ερμηνεύουν όπως βολεύει στα μικροκομματικά συμφέροντα.

2

• Κανονιστικές των δημοτικών συμβουλίων • Περιλήψεις ανακοινώσεων- διαγωνισμοί προσλήψεων προσωπικού Δήμων • Περιλήψεις ανακοινώσεων- διαγωνισμοί προσλήψεων προσωπικού Δημοτικών Επιχειρήσεων, Γενικού Νοσοκομείου, ΤΕΙ, Πανεπιστημίου • Ανακοινώσεις προσλήψεων σε δημοτικούς παιδικούς σταθμούς • Περιλήψεις ανακοινώσεων- διαγωνισμοί προσλήψεων γενικά για τον δημόσιο τομέα

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Καθημερινη aneξαρτητη ΕφημερΙδα της Κεντρικής Μακεδονίας

κωδ. 8452

IÄÉÏÊÔÇÓÉÁ : ÅÐÉÊÁÉÑÁ EKÄÏÔÉÊÇ Á.Å. ÃÑÁÖÅÉÁ: Κεντρικής 65, ÂÝñïéá ÅÐÉÊÏÉÍÙÍÉÁ Tçë. 23310. 78080 - 6 FAX 23310. 78087 email: epikera@otenet.gr ÅÊÄÏÔÇÓ - ÄÉÅÕÈÕÍÔÇÓ: NIKOÓ ÐÁÐÁÍÉÊÏËÁÏÕ AÑ×ÉÓÕÍÔÁÊÔÑÉÁ: ÍÉÊÏËÅÔÔÁ ÖËÉÁÔÁÑÇ ÓÕÍÔÁÊÔÅÓ: ÊÙÓÔÇÓ ×ÁËÁÔÓÇÓ ΣΥΜΒΟΥΛΟΣ ΕΝΗΜΕΡΩΣΗΣ & ΔΙΑΦΗΜΙΣΗΣ ΚΥΡΙΑΚΟΣ ΤΑΧΜΑΤΖΙΔΗΣ Ó×ÅÄÉÁÓÌÏÓ: ×ÁÑÇÓ ÌÁ×ÁÉÑÁÓ HAPPY ARTISTS DESIGNER TEAM www.happyartists.gr email: info@happyartists.gr ΣΕΛΙΔΟΠΟΙΗΣΗ: ΖΗΣΗ ΟΛΥΜΠΙΑ Äéáöçìéóôéêü ôìÞìá Î. ÌÐÁÑÁËÉÁÊÏÓ -

α κατά του μνημονίου κόμματα πήραν συνολικά λιγότερο από 50%. Είναι προφανές λοιπόν ότι αυτό που προέχει, αυτό εν πάσει περιπτώσει που βάζει πρώτο ο λαός είναι η παραμονή στην Ευρωζώνη. Συνεπώς αυτό που θέλει ο λαός είναι μια κυβέρνηση συνεργασίας που να διασφαλίζει την Ευρωπαϊκή προοπτική της χώρας και παράλληλα, στα Ευρωπαϊκά πλαίσια την καλύτερη δυνατή επαναδιαπραγμάτευση του μνημονίου ώστε να μπορεί να το αντέξει η χώρα και η κοινωνία.

Επίκαιρα ΔΗΜΟΣΙΕΥΣΕΙΣ

του άρθρου 4 παρ. 8 του Νόμου 1943/1991 (ΦΕΚ Α΄50) • Περιλήψεις διακηρύξεων – προκηρύξεων διαγωνισμών (εξαιρουμένων των προσλήψεων προσωπικού) ιδρυμάτων που δεν εμπίπτουν στον ορισμό του άρθρου 51 του Ν. 1892/1990 (ΦΕΚ Α΄101), όπως αυτό συμπληρώθηκε δια του άρθρου 4 παρ 5 του Ν. 1943/1991 (ΦΕΚ Α΄50) περιπτώσεις (β) και (γ) • Περίληψη προκηρύξεων διαγωνισμών παροχής υποτροφιών ιδρυμάτων

Επiκαιρα

Ô. ÏÉÊÏÍÏÌÉÄÏÕ ÅÊÔÕÐÙÓÇ:

É. ÊïñïìÞëçò Á.Å. ÓÕÍÄÑÏÌÅÓ: Åóùôåñéêïý åôÞóéá 90 åõñþ Åîùôåñéêïý åôÞóéá äïë. 250 Ôñáðåæþí - Ïñãáíéóìþí 300 åõñþ e-mail: epikera@otenet.gr

Απαγορευεται Το σύνολο των περιεχομένων και των υπηρεσιών της εφημερίδας «ΕΠΙΚΑΙΡΑ ΤΗΣ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ διατίθεται στους αναγνώστες αυστηρά για προσωπική χρήση. Απαγορεύεται η χρήση ή επανεκπομπή του, σε οποιοδήποτε μέσο, μετά ή άνευ επεξεργασίας, χωρίς γραπτή άδεια του εκδότη.

• Ανακοινώσεις Δήμων • Ανακοινώσεις Δημοτικών Επιχειρήσεων • Ανακοινώσεις Νομαρχίας • Πράξεις χαρακτηρισμού – Προσλήψεις- Ανακοινώσεις Δασαρχείου • Παρουσίαση αποτελεσμάτων ΤΕΙ • Ανακοινώσεις Ιεράς Μητρόπολης • Ανακοινώσεις- Ψηφίσματα συλλόγων • Ανακοινώσεις ΔΕΗ- ΟΤΕ • Συνοπτική κατάσταση προϋπολογισμών Δήμων


ΣΧΟΛΙΑ 

H… βουλευτίνα Ιωάννα Σοφρόνωφ! Η προσφώνηση… «βουλευτίνα» πήγαινε και ερχόταν στα χείλη των Δημοτικών Συμβούλων Βέροιας, όπως και της Δημάρχου Βέροιας και του Προέδρου Νίκου Μαυροκεφαλίδη, όταν αναφέρονταν στο πρόσωπο της εκλεγείσας από το ΚΚΕ Ιωάννας Σοφρόνωφ, αρχηγού της Λαϊκής Συσπείρωσης στα έδρανα του Δημοτικού Συμβουλίου Βέροιας. Ωστόσο έδειξε να μην την… «αναπαύει» μέσα της ιδιαίτερα η συγκεκριμένη προσφώνηση, από ό,τι είπε η ίδια χαριτολογώντας και συμπλήρωσε: «…Σας ευχαριστούμε για τις ευχές που μας δίνετε, θέλουμε όμως να επισημάνουμε μερικά πράγματα τα οποία σας είναι γνωστά. Η ικανοποιητική αύξηση της εκλογικής επιρροής του ΚΚΕ οφείλεται πρωτίστως στη μεγάλη προσφορά και στο σκληρό αγώνα πολλών μελών, φίλων, οπαδών και συνεργαζόμενων με το κόμμα, όχι μόνο στην περίοδο την προεκλογική αλλά και σε όλες τις προηγούμενες περιόδους. Το ότι έχουμε βουλευτική έδρα στο νομό θα είναι ένα σοβαρό εργαλείο στα χέρια μας, προκειμένου για την οργάνωση και ανάπτυξη του εργατικού, λαϊκού κινήματος, για τη στήριξη των εργαζομένων, των μικρών και μεγάλων αγώνων που είμαστε σίγουροι ότι θα έρθουν…».

Άδειες… «κατσαρόλες»!

Έτσι χαρακτήρισε ο Αντιπρόεδρος του Δημοτικού Συμβουλίου Βέροιας Βασίλης Γιαννουλάκης τις ζαρντινιέρες του Δήμου που κοσμούν τους στύλους φωτισμού στο εμπορικό κέντρο της πόλης, καθώς όπως είπε – απευθυνόμενος στη Δήμαρχο – στην προ – ημερησίας συζήτηση της προχθεσινής συνεδρίασης, παρουσιάζουν εικόνα εγκατάλειψης και ή πρέπει κάτι να γίνει ή να αφαιρεθούν. «…Πριν μερικά χρόνια βάλατε σε στύλους φωτισμού κάποιες ζαρντινιέρες και πράγματι υπήρξαν καλαίσθητες. Από τον πρώτο χρόνο όμως εγκαταλείφθηκαν και κρέμονται σαν άδειες κατσαρόλες. Αν δεν είστε ικανοί να τις διατηρήσετε αφαιρέστε τις…», είπε ο κ. Γιαννουλάκης και η κ. Ουσουλτζόγλου απάντησε παροτρύνοντας τους καταστηματάρχες να ασχοληθούν στοιχειωδώς, έστω και ποτίζοντας τα φυτά, όπου υπάρχουν με ένα ποτήρι νερό, καθώς, όπως είπε, έχουν και οι ίδιοι όφελος γιατί κοσμούν και τα μαγαζιά τους, πέρα από τους δρόμους!

epikera@otenet.gr

του «πολυπόθητου» τακτικού πλέον, μετά από πολλή σχετική γκρίνια, θέματος της έκφρασης αρνητικής ή θετικής γνώμης για τη «Θέση 12». Το παράδοξο του χρονικού της υπόθεσης, φάνηκε να κορυφώνεται χθες βράδυ με το που κλήθηκε το Σώμα να αποφασίσει, πολύ μετά των τετελεσμένων πεπραγμένων μιας δεκαετίας σχεδόν, κατά την οποία το Δημοτικό Συμβούλιο, ποτέ δεν απεφάνθη για το «ναι» ή το «όχι» στη «Θέση 12». Το άκρως περίεργο όμως είναι το γιατί ο παραλογισμός μιας τέτοιας συζήτησης που αποτέλεσε το κατεξοχήν επιχείρημα απόσυρσης του θέματος, δεν υπογραμμίστηκε στις προηγούμενες πρόσφατες συνεδριάσεις, κατά τις οποίες υπήρξε η προαναφερθείσα γκρίνια για τις αναβολές της συζήτησης που λάμβανε χώρα, καθώς έλλειπαν εναλλάξ τα ηγετικά κυρίως πρόσωπα των δύο μεγάλων παρατάξεων; Η έκβαση της υπόθεσης προκάλεσε την οργή του Αντιπροέδρου του ΤΕΕ Ημαθίας Γιώργου Ουρσουζίδη που παραβρέθηκε για να εκπροσωπήσει στη συνεδρίαση το Τεχνικό Επιμελητήριο, όπως και ο εκπρόσωπος της αναδόχου εταιρίας «Ηλέκτωρ», που πριν κληθεί να… «λαλήσει» (δεν κλήθηκε τελικά λόγω της απόσυρσης) μάζεψε τα χαρτιά του και επέστρεψε στην Αθήνα!

«Παραμένω στη μάχη δυναμικός και πιο δυνατός» Μ’ αυτά τα λόγια ο Λάζαρος Τσαβδαρίδης σχολίασε το εκλογικό αποτέλεσμα της περασμένης Κυριακής που τον έφερε πρώτο σε ψήφους άλλα χωρίς έδρα, λόγω της διαστροφικότητας του εκλογικού νόμου. Τα λεχθέντα ειπώθηκαν στην προχθεσινή συνεδρίαση του Δημοτικού Συμβουλίου Βέροιας, όπου ο κ. Τσαβδαρίδης αφού συνεχάρη την Ιωάννα Σοφρόνωφ για την εκλογή της είπε επί λέξει: «…Πέρα από την προσωπική μου αδικία θεωρώ ότι αδικούνται και συμπολίτες που με ψήφισαν γιατί δεν έχουν την εκπροσώπηση που θα ήθελαν. Συνεχίζω την προσπάθειά μου πιο δυναμικά και πιστεύω ότι αυτή η αδικία θα αρθεί, είτε μέσα από νέες εκλογές που φαίνεται ότι μπορούν να γίνουν το επόμενο διάστημα, είτε όποτε αυτές γίνουν. Παραμένω στη μάχη δυναμικός και πιο δυνατός…».

Συνέλαβαν ακόμη έναν από τα κυκλώματα τοκογλυφίας Στα χέρια της ΕΛ.ΑΣ. έπεσε 37χρονος κατηγορούμενος για συμμετοχή σε ένα από τα τέσσερα κυκλώματα εκβίασης και τοκογλυφίας στη Θεσσαλονίκη. Πρόκειται για τον μικρότερο αδελφό των δύο φερόμενων ως αρχηγών μιας εκ

Πριν… «Ηλέκτωρ» λαλήσει… Στις 11.25μ.μ. και μετά από επίπονες ζυμώσεις στην συνεδρίαση του Δημοτικού Συμβουλίου Βέροιας το βράδυ της Τετάρτης, το Σώμα απεφάνθη… την απόσυρση

3

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

των εγκληματικών οργανώσεων. Ο 37χρονος συνελήφθη στο συγκρότημα κατοικιών «Τέρα Μάρε» στην Περαία Θεσσαλονίκης. Σε βάρος του εκκρεμούσε ένταλμα σύλληψης του γ’ ανακριτή Θεσσαλονίκης για τα αδικήματα της συμμετοχής σε εγκληματική οργάνωση, της εκβίασης, της τοκογλυφίας και της νομιμοποίησης εσόδων από εγκληματικές δραστηριότητες. Να υπενθυμίσουμε ότι 31 εκ των συνολικά 53 κατηγορούμενων στην υπόθεση, παραμένουν προσωρινά κρατούμενοι σε διάφορες φυλακές της χώρας, μεταξύ αυτών και οι φερόμενοι ως «εγκέφαλοι» των κυκλωμάτων. Οι υπόλοιποι αφέθηκαν ελεύθεροι με περιοριστικούς όρους και καταβολή χρηματικών εγγυήσεων, ενώ μεταξύ των κατηγορουμένων βρίσκεται και ο υποψήφιος στις τελευταίες εκλογές των ΟΤΑ Αντιπεριφερειάρχης του ΛΑΟΣ στην Ημαθία Μάρκος Καραμπέρης.

Στην… «ηλεκτρική καρέκλα» ο Νίκος Τσιαμήτρος Την ανάληψη της θέσης του Προέδρου της Αναπτυξιακής του Δήμου Βέροιας ανακοίνωσε η Δήμ α ρ χ ο ς σ τ ην προχθεσινή συνεδρίαση του Δημοτικού Συμβουλίου. Αίσθηση προκάλεσε ωστόσο η ερώτηση του Βασίλη Γιαννουλάκη: «…αν δεν κάνω λάθος ο κ. Τσιαμήτρος θα είναι ο τέταρτος Πρόεδρος της αναπτυξιακής. Θα ενημερωθούμε για ποιο λόγο μέσα σε ένα χρόνο γίνονται αυτές οι αλλαγές; Είναι τόσο …ηλεκτρική η καρέκλα του προέδρου της Αναπτυξιακής…», ρώτησε επί λέξει ο Β. Γιαννουλάκης, αλλά από όσο καταλάβαμε, απάντηση μάλλον δεν έλαβε!

Περί τρωκτικών! Αναφορές περί διαφθοράς στον ιατρικό χώρο εμπεριείχε η τοποθέτηση του επικεφαλής των Ενεργών Πολιτών Γιάννη Αγγέλογλου στη συζήτηση του θέματος στήριξης, δια ψηφίσματος, από πλευράς του Δημοτικού Συμβουλίου Βέροιας, των Νοσοκομειακών Ιατρών που βρίσκονται σε επίσχεση εργασίας για την μη καταβολή των εφημεριών τους. «…Οι γιατροί προάγουν διεκδικήσεις που αναφέρονται στον ατομικό τους φόρτο και μόνο. Να ενσωματώσουν στις διεκδικήσεις τους και να προτάξουν τις συνολικές ανάγκες της περίθαλψης αλλά κυρίως να κάνουν πρώτα την αυτοκριτική τους, κατά πόσον είναι εν γνώσει τους το ότι για ορισμένους συναδέλφους τους έχουν ήδη ασκηθεί ποινικές διώξεις, καθώς έντονα φημολογείται ότι βρέθηκαν τραπεζικοί λογαριασμοί της τάξης αρκετών εκατομμυρίων ευρώ που δεν μπορούν να δικαιολογηθούν από τον δημοσιοϋπαλληλικό τους μισθό…», είπε εν ολίγοις ο κ. Αγγέλογλου και συνέχισε χαρακτηριστικά: «… Ασφαλώς υπάρχουν και οι γιατροί που τιμούν τον όρκο τους αλλά υπάρχουν και επίορκοι. Μόνο οι γιατροί ξέρουν στο χώρο τους ποιοι γιατροί είναι …τρωκτικά, όπως συμβαίνει και σε άλλους επαγγελματικούς χώρους. Σήμερα ο Τσοχατζόπουλος πληρώθηκε η σύνταξη του… Η μόνη κάθαρση που γίνεται σε αυτή τη χώρα είναι η …αιμοκάθαρση»!!!


γνωμες

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

υ ο τ ο ί ε ν ε αφ η λ ύ ο τ ν ε Αφ

Κ

Το

Εις ώτα μη ακουόντων

α

μ γράφη

χρονο

«Σανίδα σωτηρίας»

Μυστική αποστολή! Οι εκλογές της 6ης Μαΐου πέρασαν στην ιστορία και ο εμπειροτέχνης πολιτικός αναλυτής, θείος Αφεντούλης, κάνει ένα μικρό πισωγύρισμα για να ελέγξει, αν και κατά πόσο εμπεδώσατε τις διδαχές του. «Στέρεψε την ψυχή του» - ευχαριστούμε τον Κωνσταντίνο Καραμανλή για το δάνειο της σοφής ρήσης. Θα επιστραφεί «ακούρευτη». Άτοκη, ε! – για να εκπαιδεύσει τους αναγνώστες στο φιλτράρισμα των ειδήσεων της επικαιρότητας. Παρέλαβε πεντέξι αναγνώστες, «κυκλοθυμικούς» από τον μεταπολιτευτικό λαϊκισμό. Δεν το θέλω. Μα συ είπες! Με το ζόρι διορισμό; Σταδιακά έγιναν 22 «μανιοκαταθλιπτικοί» – αύξηση 300%! – λόγω της κρίσης. Η υπεύθυνη στάση και οι επιτυχείς προβλέψεις, κατά την προεκλογική περίοδο, απέδειξαν ότι το δείγμα των 22 εκπροσωπεί επάξια το σύνολο της ελληνικής κοινωνίας και ο αριθμός πρέπει να έχει εκτοξευτεί σε αστρονομικά ύψη, άνω του 30! Σύντομα θα έχει κατ’ ιδίαν συνάντηση, στη στήλη, με έναν έκαστο των νεόκοπων αναγνωστών για να τους δώσει κωδική ονομασία – «ντράι ουντ τσβάντσιχ» (23) κ.ο.κ. – και να συνεχίσουν να επικοινωνούν επωνύμως. Προσώρας έχει άλλες καΐλες. Κάνει αξιολόγηση και απαιτεί σοβαρότητα. Η τεράστια αποδοχή της πένας του επηρεάζει τις τοπικές, ελληνικές, ευρωπαϊκές και διεθνείς εξελίξεις. Ο Πρόεδρος Ομπάμα διαβάζει Αφεντούλη, μόλις ξυπνήσει. Μάλιστα αναγκάστηκε να προσαρμόσει το μπρέκφαστ του Λευκού Οίκου στο ατίθασο ύφος τού αναλυτή. Απολαμβάνει τσάι Ολύμπου με κρητικά βουτήματα βουτύρου αλειμμένα με μέλι Υμηττού και ρουφάει Μυτιληνιό τραχανά με ξινομυζήθρα για να διατηρείτε σε φόρμα. Ο Πούτιν ρουφάει τη σοφία Αφεντούλη, μαζί με ξινόγαλο, το βράδυ, πριν πλαγιάσει για να χαλαρώσει και να καταστρώσει τα σχέδια της επόμενης ημέρας. Οι Κινέζοι διαβάζουν όποτε βρουν δοκίμιο μεταφρασμένο. Ο θείος, λόγω φόρτου εργασίας, από την αυξημένη ζήτηση «επιστημονικών αναλύσεων» ευρείας θεματογραφίας λόγω της φύσης και της υφής της πολυκέφαλης κρίσης, έχει μείνει πίσω στα κινέζικα αλλά ήδη έχει δρομολογήσει τη λύση. Μήνυσε στον κ. Χρυσοχοΐδη να στείλει έναν Κινέζο λαθρομετανάστη στο κέντρο υποδοχής της γειτονιάς για να ανταλλάξουν γλώσσες. Σε λίγο καιρό το πρώτο πιάτο στην Κίνα δεν θα έχει ρύζι. Το «κλιθαλάκι» κάνει καλό και θεραπεύει τις ελληνικές εξαγωγές! Ο Αφεντούλης «στέρεψε την ψυχή του» για να μάθει στους αναγνώστες να καθαρίζουν τις ειδήσεις από το «λαθούρι» και να κρατούν καθαρή την ουσία της «φάβας». Κουκουέ, νούμερο «ελφ» (11), σταμάτα να στουμπίζεις κρομμύδια, σε ώρα διαγωνίσματος. Δεν μοίρασε φάβα ο Περισσός για να στυλωθεί το εργατικό λαϊκό κίνημα. Αξιολόγηση κάνουμε. Ποιο ήταν το κορυφαίο γεγονός της Παρασκευής 27 Απριλίου; «Κάηκε η φακή!» πετάχτηκε η σύζυγος, κυρία

Πολυτίμη, εκτός συναγωνισμού. Ο αναλυτής δεν την έχει συμπεριλάβει στους 22, όπως και όλους τους άλλους στενούς συγγενείς, φίλους και γνωστούς, από κουμπάρους και μπατζανάκηδες μέχρι τον περιπτερά και τον χασάπη, για λόγους αμεροληψίας. Αλλιώς θα ήταν διάσημος από τότε που γεννήθηκε και δεν θα πάλευε για μια θέση στα ρεκόρ Γκίνες! «Μόνη της; Η φακή μίλαγε με τις ώρες στο τηλέφωνο για να καθοδηγήσει τη γειτόνισσα πώς θα υφαρπάξει το κουκί του ταλαίπωρου «μπενιζελικού» συζύγου υπέρ του Αντώνη σας;» εξανέστη ο θείος. «Έγινες πράκτορας και κρυφακούς στα γεράματα;» τσίριξε εκείνη. Είναι ικανή για το καλύτερο και το χειρότερο. Εκείνη την Παρασκευή αποδείχτηκε άριστη στο χειρότερο. Έκαψε το φαγητό, προκαλώντας την εύλογη απορία του δισεγγονού «Ατσιδάκη»: «Ποιος έβαλε τον σίδηρο στη φακή; Χάθηκαν τα παγωτά, τα γαριδάκια και οι σοκοφρέτες;» και τον φυσιολογικό σχολιασμό του συζύγου: «Αν μας είχαν μπουζουριάσει στον Κορυδαλλό να κάνουμε παρέα στους υψηλούς φιλοξενούμενους θα τρώγαμε καλύτερα!» Αυτά μπορεί να βοηθούν στην εξυγίανση της σιδηροβιομηχανίας αλλά είχαμε και σημαντικότερες ειδήσεις. Βρήκε κανείς την απάντηση; Ο χρόνος εξέτασης έληξε. Κρίνεστε όλοι μετεξεταστέοι και να προσέλθετε τον Σεπτέμβριο με τους κηδεμόνες σας. Ανοίξτε τα στραβά σας για να μάθετε την απάντηση. Θα την πει ο αναλυτής, μόνος! Οι Ολλανδικές αρχές έδωσαν στο ΣΔΟΕ λίστα με 104 Έλληνες που κατείχαν κότερα και την ξεσκονίζουν για να εντοπίσουν ενδεχόμενη φοροδιαφυγή. «Γι’ αυτό έπεσε η κυβέρνηση στην Ολλανδία;» απόρησε η κυρία Πολυτίμη. «Οι κυβερνήσεις πέφτουνε μα η αλήθεια μένει!» απάντησε ο σύζυγος. Τυχαία έφτασε το ΣΔΟΕ μέχρι το Ρότερνταμ; Δεν νομίζω! Στα τέλη του περασμένου Νοεμβρίου, ο αναλυτής απευθύνθηκε στο κοινό με τους στίχους του Ουράνη: «Μοιάζω στους γέρους ναυτικούς με τις ρυτιδωμένες / και τις σφιγγώδεις τις μορφές, που είδα στην Ολλανδία, / παράμερα στων λιμανιών τους φάρους καθισμένους / να βλέπουνε, αμίλητοι, να φεύγουνε τα πλοία.» Ο αναγνώστης νούμερο «ντράιτσεν» (13), απόφοιτος του σχολείου ειδικών αποστολών «Αφεντούλη», μεταμφιέστηκε και «κοπροσκύλιαζε», στα Ολλανδικά λιμάνια, να παρακολουθεί, αμίλητος, τα κότερα. Όταν συμπλήρωσε τη λίστα, κάλεσε τις Ολλανδικές αρχές και η επιχείρηση «Ρότερνταμ» με κωδικό «πίκι πίκι ραμ» είχε αίσιο τέλος. Τον λόγο έχουν οι ελληνικές αρχές. Όσοι βρεθούν παραβάτες, καλά ξεμπερδέματα. Μπορεί να ξεφύγατε από τα παραθυράκια της νομοθεσίας αλλά σας τσάκωσε η πένα του Αφεντούλη! Ιδού η προσφορά του στο κοινωνικό σύνολο. Δοξάστε τον!

4

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Kαθόλου δεν έπληξε η εντολή σχηματισμού κυβέρνησης στα χέρια του Αλέξη . Την έδειξε σαν χαζομπαμπας σ’ όλο τον κόσμο ,την έπαιξε , «κουπε –πε» την γαργάλησε «γκίλι-γκίλι» για να είναι γελαστή και μετά την έβγαλε άτα. Δυστυχώς όμως οι φορείς δεν άνοιξαν την πόρτα στο κοριτσάκι , μεγάλη ντροπή τους και δικαίως τα άκουσαν από τον Αλέξη. Μετά την άφησε στα χέρια του κ. Παπαδημούλη γιατί είχε σύσκεψη με τον κ. Σαμαρά και τον κ. Βενιζέλο και φοβήθηκε μη την ματιάσουν. Τέλος την πήγε στην μάζωξη της κοινοβουλευτικής ομάδας κι εκεί να δεις χαρούλες. Την παίρνανε στα γόνατα και την χορεύανε «νταχτιρντί το λέγανε». Το βράδυ κοιμήθηκαν αγκαλίτσα αλλά το μεσημέρι του την πήρανε προς μεγάλο κακοφανισμό του. Τα είδε αυτά ο πρώην πρόεδρος της Βουλής κ. Απ. Κακλαμάνης και φρύαξε : «περιφέρει την εντολή σε άσχετες, με το σκοπό της συναντήσεις με κόμματα που δεν εκπροσωπούνται στη Βουλή, με κοινωνικούς και άλλους φορείς και πρόσωπα για προφανείς επικοινωνιακούς και μικροκομματικούς λόγους, ενόψει νέων εκλογών τις οποίες επιθυμεί να επιβάλει αδιαφορώντας για τις συνέπειες εις βάρος του λαού και της χώρας ». Βέβαια μπροστά σ’ αυτά που άκουσε ο Αλέξης τις τελευταίες μέρες αυτή ήταν φιλοφρόνηση .Που να καταλάβει τώρα ο κ. Κακλαμάνης τι ήταν αυτή η εντολή για ένα κόμμα που ήταν χρόνια στο περιθώριο. Πολλοί θεωρούν ότι είναι μια μόδα που θα περάσει . Μερικοί ονειρεύονται μετωπική αριστεράς- δεξιάς για να κουρέψουν ΠΑΣΟΚ και τον κ. Καμένο .Δεν κατάλαβαν ούτε αυτοί ούτε το ΠΑΣΟΚ τίποτε. Οι Έλληνες δεν χωρίζονται πλέον σε δεξιούς αριστερούς και Κεντρώους. Χωρίζονται σε δυο κατηγορίες. Στην πρώτη είναι όσοι κέρδισαν από την κρίση, όσοι έχασαν λίγα και δεν θέλουν να χάσουν άλλα κι όσοι έχασαν πολλά αλλά φοβούνται μην τα χάσουν όλα . Στην δεύτερη ανήκουν όσοι τα χάσανε όλα και δεν έχουν να χάσουν τίποτε κι όσοι χάσανε πολλά και δεν είναι διατεθειμένοι να τα χάσουν όλα. Από αυτή την δεξαμενή παίρ-

νει ο ΣΥΡΙΖΑ και πολλοί από αυτούς που τον ψήφισαν ανάθεμά τους κι αν ξέρουν τι είναι αυτός ο πολιτικός οργανισμός. Από την ίδια παίρνει και ο κ. Καμένος κι αν ζορίσουν τα πράγματα δεν είναι σίγουρο πως θα αντιδράσουν οι ψηφοφόροι του. Όσο για αυτούς που ψήφισαν χρυσή Αυγή μην το ψάχνετε. Αηδίασαν με το σύνολο του πολιτικού κόσμου. Όλοι αυτοί ζητούν κάποια ελπίδα κάποιο φώς. Το να τους πούμε ότι θα προσπαθήσουμε να πείσουμε τους δανειστές μας να μην σας αφήσουν να πεθάνετε τελείως δεν νομίζουμε να τους ικανοποιεί. Ούτε μπορούμε να πείσουμε όσους πήραν δάνειο για ένα κεραμίδι ότι χρηματοδοτούμε τις τράπεζες με ένα σωρό λεφτά για να τους πάρουν τα σπίτια ! Μέχρι τώρα τα δυό πρώην μεγάλα κόμματα είχαν αναγάγει σε υψηλή πολιτική την διατήρηση του Δημόσιου τομέα όπου είχαν την μεγάλη πελατεία. Αποτυχία θα ήταν γι αυτούς να απολυθεί έστω ένας υπάλληλος την ώρα που από τον ιδιωτικό απολυόταν κατά χιλιάδες. Για να το πετύχουν αυτό στέγνωσαν το ιδιωτικό τομέα και πετσόκοψαν τους μισθούς στο Δημόσιο. Η ύφεση τραβούσε την ανηφόρα και οι φοροδοτική ικανότητα την κατηφόρα. Ούτε που τους πέρασε από το μυαλό η λέξη διαπραγμάτευση . Όσες φορές κάνανε κάποια νύξη αρκούσε ένα «νάϊν» από την κ. Μέρκελ για να γυρίσουν σαν δαρμένοι σκύλοι με την ουρά στα σκέλια. Είναι αλήθεια ότι ο κ. Σαμαράς το πάλεψε αλλά δεν το απαίτησε. Απλά το έχει σαν άτυπη υπόσχεση Απέναντι σε αυτά οι κ. Τσίπρας και Καμένος μίλησαν για επαχθές χρέος για πάγωμα αντιλαϊκών μέτρων και για άλλα όνειρα θερινής νυχτός. Όμως έδιναν μια ελπίδα , ένα φως να οδηγηθούν οι χαμένοι ,κάποια σανίδα να πιαστούν οι ναυαγισμένοι .Ε λοιπόν αυτή τη σανίδα σωτηρίας δεν είναι εύκολο ούτε να την εξαφανίσουν ούτε να την υποκαταστήσουν. Παρεκτός κι αν πήραν το μάθημα και δεν θα μείνουν πάλι μεταξεταστέοι ! Ο ΠΑΡΟΙΜΙΑΣ (Κ,Δ)


ΤΟΠΙΚΑ 

epikera@otenet.gr

Φαρμακευτικός Σύλλογος Ημαθίας:

Η Ηλεκτρονική Συνταγογράφηση κατέρρευσε με …τις εκλογές

H

λειτουργία της Ηλεκτρονικής Συνταγογράφησης κρατήθηκε ‘με τα δόντια’ μέχρι την μέρα των εκλογών. Την Κυριακή 6 Μαΐου κατέρρευσε μαζί με τους εμπνευστές της, διότι δομήθηκε και λειτουργούσε με προχειρότητα, χωρίς δικλείδες ασφαλείας, την απαραίτητη υποστήριξη τεχνική και οικονομική[επίθεση χάκερς προ μηνός]. Η Η.Σ. σταμάτησε και οι ασφαλισμένοι όλων των ταμείων που σύρθηκαν αναγκαστικά στον ΕΟΠΥΥ έμειναν χωρίς την δυνατότητα προμήθειας φαρμάκων πλην μόνο από τους ιατρούς του πρώην ΙΚΑ χειρόγραφα και όσοι λίγοι του ΕΟΠΥΥ [πράσινες συνταγές] ,οι συνταγές των οποίων μέχρι σήμερα καλύπτουν το 25% περίπου των αναγκών. Το ίδιο συμβαίνει με τους ασφαλισμένους

του ΤΑΥΤΕΚΩ [ΟΤΕ, ΔΕΗ, ΟΣΕ, ΤΡΑΠΕΖΕΣ κ.α.] που ενώ καταργήθηκαν τα συνταγολόγιά τους από 01/05 δεν ενσωματώθηκαν στην Η.Σ. Καλούμε τους αρμόδιους να δώσουν άμεσα την δυνατότητα αναγραφής φαρμάκων στα παλαιά συνταγολόγια ή να χορηγήσουν συνταγολόγια του π.ΙΚΑ σε όλους τους ιατρούς. Το ερώτημα προς την ΗΔΙΚΑ [διότι ζητήθηκε να μην εκτελεστούν οι συνταγές] από φαρμακευτικούς συλλόγους εάν την 7η Μαΐου γράφτηκαν λάθος φάρμακα από το σύστημα ,μέχρι σήμερα δεν απαντήθηκε… Ταυτόχρονα ο αντιπρόεδρος του ΕΟΠΥΥ σε συνέντευξη τύπου επεσήμανε ότι ‘ενώ οι προϋπολογισμοί του 2011 των ενταχθέντων ταμείων στον ΕΟΠΥΥ ανέρχο-

νταν στο ύψος των 7,8 δις, ευρώ, φέτος δύσκολα θα ξεπεράσουν τα 5 δις. με ότι αυτό συνεπάγεται για την Υγεία των ασφαλισμένων και τις πληρωμές ,ενώ μέχρι τέλους του 2011 ο ΕΟΠΥΥ όφειλε περίπου 3,4 δις.ευρώ εκ των οποίων 200 εκατ. στους φαρμακοποιούς’! Τέλος μεγάλο πρόβλημα με τα Φ.Υ. Κόστους[αντικαρκινικά κ.α.] διότι ο μοναδικός τρόπος για να εκτελέσει μια τέτοια συνταγή ένα ιδιωτικό φαρμακείο είναι να μην έχει το φάρμακο το νοσοκομειακό φαρμακείο και να αναγράφεται στη συνταγή «στερείται». Ωστόσο, υπάρχει μία γενικότερη κατεύ-

θυνση προς τους νοσοκομειακούς φαρμακοποιούς να μην αναγράφουν τη λέξη «στερείται», αλλά να ενημερώνουν τους ασθενείς ότι θα παραγγείλουν το φάρμακό τους και να τους ζητούν να περιμένουν λίγες ημέρες μέχρι να έρθει, αν το στείλει βέβαια η εταιρεία που έχει λαμβάνειν. Έτσι προκαλείται ταλαιπωρία των ασθενών, οι οποίοι δεν είναι σε θέση να περιμένουν. Ο Πρόεδρος Κίμων Παράσχου Ο Γ.Γραμματέας Αργύρης Φουκαλάς

Μετά από αναβολή της συνεδρίασης της περασμένης Παρασκευής

Συνεδριάζει σήμερα το μεσημέρι η Επιτροπή Ποιότητας Ζωής του Δήμου Βέροιας Στο επίκεντρο του ενδιαφέροντος τα τραπεζοκαθίσματα σε πάρκα και πλατείες του Δήμου

Μ

ε δύο τακτικά θέματα συνεδριάζει σήμερα το μεσημέρι στις 13.00 η Επιτροπή Ποιότητας Ζωής του Δήμου Βέροιας, στην αίθουσα του Δημοτικού Συμβουλίου, μετά την αναβολή της σχετικής συζήτησής τους την περασμένη Παρασκευή. Τα θέματα είναι τα εξής: «Πλαίσιο αισθητικών παρεμβάσεων λειτουργίας κυρίως καταστημάτων υγειονομικού εν-

διαφέροντος με σκοπό την προστασία του αστικού περιβάλλοντος του Καλλικρατικού Δήμου Βέροιας» και «Τοποθέτηση ή μη Τραπεζοκαθισμάτων σε πλατείες και πάρκα του Δήμου Βέροιας». Ο ΠΡΟΕΔΡΟΣ ΚΩΝΣΤΑΝΤΙΝΟΣ ΒΟΡΓΙΑΖΙΔΗΣ (Αντιδήμαρχος ΠολεοδομίαςΠεριβάλλοντος & Ποιότητας Ζωής)

Την Κυριακή η υποδοχή της Ολυμπιακής Φλόγας στη Βέροια Σ

ας προσκαλούμε να παραβρεθείτε στην τελετή υποδοχής της Ολυμπιακής Φλόγας στην πόλη της Βέροιας την Κυριακή 13/5/2012 και ώρα 13:30 στο πάρκο της «Ελιάς», με αφορμή την πραγματοποίηση των ΧΧΧ Ολυμπιακών Αγώνων «ΛΟΝΔΙΝΟ 2012» ΠΡΟΓΡΑΜΜΑ ΤΕΛΕΤΗΣ • Άφιξη Ολυμπιακής Φλόγας – Αφή βωμού από λαμπαδηδρόμο • Άφιξη αντιπροσωπείας επισήμων της Ελληνικής Οργανωτικής Επιτροπής και της Οργανωτικής Επιτροπής των Ο.Α. «ΛΟΝΔΙΝΟ 2002

• Ανάκρουση των ΟΛΥΜΠΙΑΚΟΥ ΥΜΝΟΥ – ΕΘΝΙΚΟΥ ΥΜΝΟΥ Μ.ΒΡΕΤΑΝΙΑΣ – ΕΘΝΙΚΟΥ ΥΜΝΟΥ ΕΛΛΑΔΟΣ • Έπαρση σημαιών : Ολυμπιακών Αγώνων , Μ. Βρετανίας και Ελλάδος με την ανάκρουση των αντίστοιχων ύμνων • Χαιρετισμός Δημάρχου • Χαιρετισμός εκπροσώπου Οργανωτικής Επιτροπής «ΛΟΝΔΙΝΟ 2012» • Χαιρετισμός εκπροσώπου Ελληνικής Οργανωτικής Επιτροπής • Ανταλλαγή δώρων Η Δήμαρχος Χαρίκλεια ΟυσουλτζόγλουΓεωργιάδη

5

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


τοπικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Το Δημοτικό Συμβούλιο και πάλι

«Νίπτει τας χείρας του» για την κ στη «Θέ

Τ

ην απόσυρση του θέματος της συζήτησης για την έκφραση θετικής ή αρνητικής γνώμης περί της κατασκευής της ΜΕΑ – ΧΥΤΥ στη «Θέση 12» αποφάσισε κατά πλειοψηφία το Δημοτικό Συμβούλιο Βέροιας στη συνεδρίαση της Τετάρτης, παρότι είχε προηγηθεί εδώ και αρκετό καιρό, έντονος «θόρυβος» για την ένταξη του συγκεκριμένου θέματος σε τακτική συνεδρίαση του Σώματος, και επί τούτου προσήλθε στη Βέροια από την Αθήνα ο Ιωάννης Μπούκης, στέλεχος της αναδόχου «Ηλέκτωρ», προκείμενου να ενημερώσει από πλευράς της εταιρίας αλλά και να απαντήσει σε ενδεχόμενες ερωτήσεις, κάτι που τελικώς δεν έγινε. «ΑΣΤΟΧΗ Η ΣΥΖΗΤΗΣΗ» Πιο συγκεκριμένα, η πρόταση της απόσυρσης κατατέθηκε τόσο από τον αρχηγό της μείζονος μειοψηφίας Λάζαρο Τσαβδαρίδη, όσο και από τον επικεφαλής των Ενεργών Πολιτών Γιάννη Αγγέλογλου, κατά την έναρξη της συζήτησης, λόγω του ότι όπως και οι δύο υποστήριξαν, ενώ έχει προηγηθεί σχεδόν μια δεκαετία εξελίξεων και λήψης αποφάσεων εκτός Δημοτικού Συμβουλίου, με την σύμβαση κατασκευής της Μονάδας να έχει υπογραφεί προ διετίας από την προηγούμενη Διοίκηση του ΕΣΔΑ Ημαθίας, μια «κατόπιν εορτής» συζήτηση και έκφραση γνώμης για το «ναι» ή «όχι» στη «Θέση 12» θα ήταν άστοχη και άσκοπη. ΤΟΠΟΘΕΤΗΣΕΙΣ ΕΠΙ ΤΟΥ ΘΕΜΑΤΟΣ Χ. ΟΥΣΟΥΛΤΖΟΓΛΟΥ Όπως τόνισε στην σύντομη εισήγησή της η Δήμαρχος Βέροιας Χαρίκλεια Ουσουλτζόγλου, καλό θα ήταν να γίνει ένας γόνιμος διάλογος, γιατί - όπως είπε - το ζήτημα έχει νομικές εκκρεμότητες και προεκτάσεις. Ωστόσο επεσήμανε ότι τέτοια θέματα πρέπει να εξαντλούνται σε άλλες αίθουσες, συμπληρώνοντας ότι είναι πρωτίστως θέμα του ΕΣΔΑ στον οποίο έχει το Δημοτικό Συμβούλιο εκπροσώπους. Για τη «Θέση 12» είπε πως δεν είναι ιδανική για την κατασκευή της Μονάδας και με μια αυτοκριτική διάθεση επεσήμανε ότι ήταν λάθος της, όπως και άλλων αιρετών, να σταθούν πολιτικά απέναντι στο ζήτημα, ελλείψει τεχνογνωσίας, ενώ εκείνο που την ενδιαφέρει είναι η κατασκευή σαφώς μιας τέτοιας Μονάδας στα όρια του Δήμου αλλά και η πιο συμφέρουσα τιμή επιβάρυνσης του δημότη ανά τόνο, κάτι που δε φαίνεται να προκύπτει μέσα από το συγκεκριμένο έργο. «…Δεν πρέπει να ξεχνάμε ότι υπάρχει μια υπογεγραμμένη σύμβαση και δεν την υπέγραψα εγώ. Οφείλουμε όμως να δούμε κι αν τελικά δε γίνει η ΜΕΑ - ΧΥΤΥ

και παραμείνουμε στην Κοζάνη, αν αυτό μας συμφέρει, γιατί πρόκειται για μια επιβάρυνση που αφορά τα παιδιά μας…», κατέληξε η Δήμαρχος. Κ. ΒΟΡΓΙΑΖΙΔΗΣ Αν είχαν συζητηθεί όλα αυτά στην ώρα τους, είπε ο Αντιδήμαρχος Περιβάλλοντος, απευθυνόμενος στο Σώμα αλλά και στη Δήμαρχο, σήμερα δεν θα υπήρχαν τόσα προβλήματα και υπογράμμισε ότι η σύμβαση που υπεγράφη πριν δύο χρόνια δεν συζητήθηκε ποτέ στο Δημοτικό Συμβούλιο. Ο ίδιος αφού ξεκαθάρισε ότι εισηγείται το θέμα έκφρασης γνώμης ως Αντιδήμαρχος Περιβάλλοντος και όχι ως Πρόεδρος του ΕΣΔΑ (ρωτήθηκε επ’ αυτού από την αντιπολίτευση) ανακοίνωσε την αρνητική του θέση ως προς την έγκριση της «Θέσης 12» για λόγους, όπως είπε, περιβαλλοντικούς πρωτίστως αλλά και υγείας, θεωρώντας τη θέση ακατάλληλη και μίλησε ειδικότερα για την υδροδότηση της Θεσσαλονίκης από τον Αλιάκμονα και την προστασία του αρχαιολογικού χώρου της Βεργίνας. Όσον αφορά το κοστολογικό μέρος της λειτουργίας της Μονάδας, σημείωσε ότι προϋποτίθεται η προδιαλογή των οργανικών απορριμμάτων από τα νοικοκυριά του Δήμου - ένα ζήτημα που εξετάζει και ο Αντιδήμαρχος Καθαριότητας Θεόδωρος Θεοδωρίδης, ωστόσο όπως είπε, το κόστος του συγκεκριμένου κομματιού δεν αναγράφεται με σαφήνεια στη σύμβαση, ενώ το κόστος που υπολογίζεται τελικά ότι θα επιβαρύνει το δημότη αυτή τη στιγμή, ανέρχεται ήδη στα 87 ευρώ συν ΦΠΑ. «…Πού θα φτάσει λοιπόν το τελικό κόστος…;», διερωτήθηκε ο Αντιδήμαρχος, συμπληρώνοντας ότι σήμερα πληρώνουμε 38 ευρώ τον τόνο για τα απορρίμματα μετά δυσκολίας. Στα προβλήματα που εντόπισε ο ίδιος

6

προσέθεσε το ότι ο χρόνος ζωής της Μονάδας θα εξαντληθεί στη 15 ετία, κάτι που θα βάλει το Δήμο σε περιπέτεια εκ νέου εξεύρεσης λύσης, καθώς και το ότι, αν σε περίπτωση λυθεί η σύμβαση ακόμη και με υπαιτιότητα του αναδόχου, ο τελευταίος θα δικαιούται αμοιβές επί εργασιών, εφόσον γίνουν. «…Προτείνω το σώμα να εκφραστεί αρνητικά, με την ψήφο του, για τη Θέση 12, να κατατεθούν εκ νέου προτάσεις και να επανέλθουμε σε επόμενη συνεδρίαση…», ήταν τα λόγια του. Λ. ΤΣΑΒΔΑΡΙΔΗΣ Ο κ. Τσαβδαρίδης σημείωσε ότι αδικαιολόγητα έρχεται το θέμα προς συζήτηση στο Δημοτικό Συμβούλιο. «…Νομίζω ότι είναι άστοχη η επιλογή να γίνει κουβέντα για τέτοιο θέμα σήμερα με το συγκεκριμένο περιεχόμενο. Γιατί κουβεντιάζουμε για τη Θέση 12 που επιλέχθηκε όλα τα προηγούμενα χρόνια και έτρεξαν απίστευτα πράγματα και ξαφνικά έρχεται σήμερα στο Δημοτικό Συμβούλιο; Πως γίνεται, κ. Βοργιαζίδη, να έχετε στο πρόσωπό σας και την ιδιότητα του Αντιδημάρχου και του Προέδρου του ΕΣΔΑ, άλλα να μας μιλάτε μόνο με την πρώτη ιδιότητα; Ποια η σκοπιμότητα αυτής της κουβέντας και σε τι θα ωφελήσει να πούμε σήμερα ναι η όχι στη Θέση 12, αφού δεν έχουμε ουσιαστική αρμοδιότητα να κάνουμε τίποτα…», διερωτήθηκε ο κ. Τσαβδαρίδης. ΓΙΑΝΝΗΣ ΑΓΓΕΛΟΓΛΟΥ «…Δεν ωφελεί σε τίποτα να συζητηθεί αυτό το θέμα. Πρέπει μάλιστα να αποσυρθεί πάραυτα γιατί θα βλάψει κιόλας και θα δώσει διάφορα ερείσματα. Σε 15 μέρες συζητείται το θέμα στο Συμβούλιο Επικρατείας και εσείς πάτε να το συζητήσετε τώρα, ενώ δεν το συζητήσατε επί σειρά ετών; Για ποιο λόγο, τι έχετε να κερδίσε-

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

τε; Είναι θέμα του ΕΣΔΑ και προτείνω να αποσυρθεί…», είπε μεταξύ άλλων ο επικεφαλής των Ενεργών Πολιτών. ΤΗΛΕΜΑΧΟΣ ΧΑΤΖΗΑΘΑΝΑΣΙΟΥ «…Υποστηρίζω την άποψη ότι πρέπει να συζητηθεί το θέμα, γιατί ο ΕΣΔΑ ενδεχομένως να επαναδιαπραγματευτεί τη σύμβαση, οπότε θα πρέπει να έχει ένα ηθικό έρεισμα και από την άλλη για να ενημερωθεί ο κόσμος για το ποια είναι η θέση του Δημοτικού Συμβουλίου επί του θέματος…», είπε σχετικά ο κ. Χατζηαθανασίου ΔΗΜΗΤΡΗΣ ΔΑΣΚΑΛΟΣ «…Θεωρώ ότι το θέμα πρέπει να αποσυρθεί, γιατί δεν μπορεί να κριθεί εδώ. Αυτός που υπέγραψε τη σύμβαση είναι ο ΕΣΔΑ και θα έπρεπε από εκεί να ξεκινήσει και να τελειώσει η ιστορία…». ΓΙΩΡΓΟΣ ΜΙΧΑΗΛΙΔΗΣ «…Το θέμα πρέπει να αποσυρθεί. Το δημοτικό Συμβούλιο είναι αναρμόδιο παντελώς να κουβεντιάσει για μια σύμβαση, για την οποία ούτε ενημερώθηκε το ίδιο ποτέ, ούτε και την ψήφισε…», είπε ο κ. Μιχαηλίδης. ΨΗΦΙΣΜΑ ΣΥΜΠΑΡΑΣΤΑΣΗΣ ΥΠΕΡ ΤΩΝ ΝΟΣΟΚΟΜΕΙΑΚΩΝ ΙΑΤΡΩΝ Την απόφαση να στηρίξει τον απεργιακό αγώνα των Νοσοκομειακών Ιατρών της ΕΝΙΚΕΜ έλαβε κατά πλειοψηφία το Σώμα με την έκδοση σχετικού ψηφίσματος συμπαράστασης κατόπιν σχετικής αίτησης τους. Οι γιατροί βρίσκονται σε επίσχεση εργασίας λόγω μη πληρωμής των τακτικών εφημεριών τους του Φεβρουαρίου, καθώς και των έκτακτων εφημεριών αρκετών μηνών. Ο Γιάννης Αγγέλογλου


τοπικα 

epikera@otenet.gr

κατασκευή ή όχι της ΜΕΑ – ΧΥΤΥ έση 12» παρατήρησε ότι οι γιατροί προάγουν διεκδικήσεις που αναφέρονται στον ατομικό τους φόρτο αποκλειστικά και ζήτησε να ενσωματώσουν στις διεκδικήσεις τους και να προτάξουν τις συνολικές ανάγκες της υγείας, κάτι που επεσήμανε και ο Γιώργος Μελιόπουλος από τη Λαϊκή Συσπείρωση. Ο Ηλίας Τσιαμήτρος, Πρόεδρος της Δημοτικής Κοινότητας Βέροιας, ζήτησε να μην αντιμετωπιστεί απλώς και μόνο ως ένα ψήφισμα, γιατί το θέμα είναι σοβαρότερο και ρώτησε το Χρήστο Κούτρα κατά πόσο κινδυνεύουν οι πολίτες από το ενδεχόμενο μη εξυπηρέτησης επείγοντος περιστατικού, λόγω της επίσχεσης. Ο κ.Κούτρας απάντησε ότι δεν υπάρχει τέτοια περίπτωση. «…Καλύπτουμε σε κάθε περίπτωση τις ανάγκες του Νοσοκομείου έστω και με μειωμένο προσωπικό, έστω και με περικοπές των γιατρών της τάξης του 44%. Απλώς προσπαθούμε να ασκήσουμε πιέσεις για πρόσληψη προσωπικού και την καταβολή των δεδουλευμένων μας..», είπε χαρακτηριστικά. Ο Τηλέμαχος Χατζηαθανασίου υπογράμμισε ότι οι γιατροί δεν μπορούν να έχουν δεύτερη επαγγελματική ενασχόληση, ώστε να καλύψουν τις ανάγκες τους, λόγω συνθηκών της δουλειάς τους και η αίτηση έκφρασης συμπαράστασης στον αγώνα τους, μέσα από αυτό το ψήφισμα, πιστοποιεί τη μεγάλη ανάγκη τους. ΕΚΤΑΚΤΑ ΘΕΜΑΤΑ Ένα από τα σημαντικότερα έκτακτα θέματα που απασχόλησαν τη συνεδρίαση υπήρξε και η απόφαση έκδοσης ψηφίσματος συμπαράστασης σε εργαζόμενους της ΕΑΣ που βρίσκονται σε επίσχεση εργασίας από τον Απρίλιο για την μη καταβολή δεδεουλευμένων τους. Ο Πρόεδρος του Δημοτικού Συμβουλίου πρότεινε να αναλάβει τη σύνταξη του ψηφίσματος τριμελής ομάδα Συμβούλων που είναι οι ίδιοι Συνεταιριστές και εν προκειμένω ο Θωμάς Αγγελίνας, ο Αντώνης Καγκελίδης και ο Ηλίας Τσιαμήτρος, για λογαριασμό του Δημοτικού Συμβουλίου, το οποίο θα επιδοθεί στην Διοίκηση της ΕΑΣ από τη Δήμαρχο και τους επικεφαλής των παρατάξεων και ακολούθως θα ανακοινωθεί και στον τύπο. Η εισήγηση ψηφίστηκε ομόφωνα. ΠΡΟ ΗΜΕΡΗΣΙΑΣ ΘΕΜΑΤΑ Η συζήτηση περί των αποτελεσμάτων, από τις βουλευτικές εκλογές της 6ης Μαΐου, που αφορά στις πέντε υποψηφιότητες Δημοτικών Συμβούλων και εν προκειμένω της Ιωάννας Σοφρόνωφ που εξελέγη, αλλά και των κ.κ. Τσαβδαρίδη, Τσαπαρόπουλου, Αγγέλογλου και Βεσυρόπουλου, απασχόλησε σημαντικά το πρώτο ημίωρο της προ-ημερησίας συζήτησης της συνεδρίασης. Ο Πρόεδρος του Σώματος Νίκος Μαυροκεφαλίδης επεσήμανε ότι η κεντρική πολιτική σκηνή πρέπει να μπολιάζεται με άξια και ικανά

στελέχη της Αυτοδιοίκησης και ευχήθηκε στην κ. Σοφρόνωφ να έχει μια γόνιμη θητεία, υπηρετώντας το κοινοβούλιο αλλά και τον τόπο, του οποίου τα προβλήματα – όπως είπε – γνωρίζει καλά. Στον κ. Ταβδαρίδη ευχήθηκε καλή συνέχεια στον αγώνα του που έκανε μαζί με τους υπόλοιπους Συμβούλους, παρατηρώντας ότι ο εκλογικός νόμος με τις στρεβλώσεις του τον αδίκησε, στερώντας του την έδρα. «…Ευχόμαστε ό,τι ακολουθεί να είναι με κάθε επιτυχία και να μην έχει τη γεύση της αδικίας…», είπε επί λέξει. Η κ. Ουσουλτζόγλου συνεχάρη την Ιωάννα Σοφρόνωφ για την εκλογή της και ευχήθηκε στους υπολοίπους με τα εξής: «…Ελπίζω ότι και οι υπόλοιποι συνάδελφοι θα καταφέρουν να έχουν θέση στο Κοινοβούλιο και για το καλό του Δήμου και για να δικαιωθεί ο αγώνας που έδωσαν…». ΓΙΑ ΤΟΥΣ ΔΗΜΟΤΙΚΟΥΣ ΛΑΧΑΝΟΚΗΠΟΥΣ Για αυθαιρεσία που διέπει τα πολιτικά πράγματα της πόλης έκανε λόγο ο Γιάννης Αγγέλογλου αναφερόμενος στο θέμα των λαχανόκηπων του Δήμου, των δικαιούχων και της νομιμότητας των διαδικασιών. «…Γιατί το θέμα δεν πέρασε από καμιά Επιτροπή του Δήμου, από το Δημοτικό Συμβούλιο για να συζητηθεί το πως και το γιατί…», ρώτησε σχετικά. Η Δήμαρχος απάντησε ότι εξαγγέλθηκε το θέμα των λαχανόκηπων από την προηγούμενη θητεία, από το 2009 και ενημερώθηκε το Δημοτικό Συμβούλιο σχετικά. «…Δοκιμαστικά ζητήθηκαν στοιχεία για συμμετοχή, και δε θα δοθεί γη στους τσιφλικάδες αλλά πρόκειται για ένα κοινωνικό έργο…», είπε μεταξύ άλλων και συμπλήρωσε: «…Για τη σκοπιμότητα του έργου υπάρχει απόφαση Δημοτικού Συμβουλίου μέσα στο Επιχειρησιακό Πρόγραμμα, ενώ όσον αφορά τη χρήση γης, είναι χαρακτηρισμένη ως αγροτεμάχιο. Ωστόσο αν θέλετε να μπει το θέμα στο Δημοτικό Συμβούλιο με όλες τις παραμέτρους, θα μπορούσε σε επόμενη συνεδρίαση…», κατέληξε η Δήμαρχος. ΓΙΑ ΤΗΝ ΥΔΡΟΔΟΤΗΣΗ ΤΗΣ ΒΕΡΓΙΝΑΣ Η Κατερίνα Κωστογλίδου ζήτησε ενημέρωση από τον Πρόεδρο της ΔΕΥΑΒ Δημήτρη Δάσκαλο για το θέμα του προβλήματος της υδροδότησης που προέκυψε στη Βεργίνα με το κλείσιμο της γεώτρησης, όπου εντοπίστηκε πρόσφατα υπερβολική ποσότητα χρωμίου. Ρώτησε συγκεκριμένα σε ποια φάση βρίσκεται και πως υδροδοτείται η περιοχή, καθώς μετά από πληροφόρηση που η ίδια είχε, στο χωριό υπάρχει έλλειψη νερού με την αύξηση της θερμοκρασίας. Ο κ. Δάσκαλος είπε ότι στις 20 Μαρτίου, με απόφαση δική του, διακόπηκε η λειτουργία της γεώτρησης, έγιναν οι σχετικοί έλεγχοι για την άντληση νερού από

7

συγκεκριμένο βάθος και διαπιστώθηκε ότι το χρώμιο βρίσκεται πολύ βαθιά, στα 190 μέτρα περίπου. Για την εξυπηρέτηση των αναγκών της περιοχής, επεσήμανε ότι υποβλήθηκε Μελέτη στη Διαχειριστική Αρχή της Περιφέρειας και περιμένει η Υπηρεσία για την έκβαση της. «…Δεν ήρθαν κάποιες παρατηρήσεις άρα περιμένουμε την υπογραφή Ψωμιάδη. Έγινε μια υπέρβαση στη μελέτη, για να κατασκευαστεί ο αγωγός από τα σώματα μέχρι τη Βεργίνα, μήκους 11χλμ. Πιστεύω ότι όλα θα πάνε καλά και μέσα στο καλοκαίρι θα ξεκινήσουμε με τη δημοπράτηση του έργου…», κατέληξε ο κ. Δάσκαλος. ΥΠΟΘΕΣΗ ΕΚΠΛΕΙΣΤΗΡΙΑΣΜΟΥ ΠΕΡΙΟΥΣΙΑΣ ΤΟΥ Λ. ΒΑΛΑΒΑΝΗ Η υπόθεση του εκπλειστηριασμού ακίνητης περιουσίας του πρώην Δημάρχου Αποστόλου Παύλου Λευτέρη Βαλαβάνη από το Δήμο Βέροιας, κατόπιν καταλογισμού που του έγινε για μη έκδοση παραστατικών σε εξωλογιστικά έξοδα, κατά τη θητεία του, ήρθε ως θέμα στην προημερησίας συζήτηση. Ο κ. Βαλαβάνης έστειλε σχετική επιστολή προς το Σώμα, ζητώντας να συζητηθεί το προσωπικό του ζήτημα, κατά το οποίο, όπως υποστήριξε στην τοποθέτησή του, αδικείται πρωτίστως ηθικά, με την διάχυση εντυπώσεων περί υπεξαίρεσης χρημάτων, κάτι το οποίο ποτέ δεν έπραξε, και αφετέρου υπόκειται σε ενέργεια, κατά την

οποία ο Δήμος φαίνεται να πειθαρχεί σε κατοχικό νόμο (εποχή Τσολάκογλου) περί πλειστηριασμών. «…Δεν απαιτώ οίκτο, από πλευράς Δημοτικού Συμβουλίου αλλά αποκατάσταση της αλήθειας…», είπε ο κ. Βαλαβάνης. Έθεσε επίσης ηθικό θέμα αφήνοντας αιχμές κατά του Αποστόλου Νεστορόπουλου για τις ενέργειες παραπομπής του στη δικαιοσύνη, μιλώντας για εμπάθεια. Ο κ. Νεστορόπουλος, σε απάντηση του, είπε ότι αν ο κ. Βαλαβάνης παρουσίαζε τα καταλογισθέντα ποσά δε θα υπήρχε κανένα θέμα σήμερα. Τέλος η Δήμαρχος Βέροιας είπε, απευθυνόμενη στον κ. Βαλαβάνη, ότι υπάρχουν καταλογισμοί σε όλους τους Δήμους από παλιά, όπως και για το Δήμο Βέροιας και τη Νομαρχιακή Αυτοδιοίκηση. «… Όταν διενεργείται ο καταλογισμός, δυστυχώς ο λόγος δεν ανήκει στους αιρετούς αλλά τους υπηρεσιακούς παράγοντες οι οποίοι πρέπει να πράξουν το καθήκον τους. Ωστόσο οι αιρετοί μπορούν να υπερασπιστούν οποιονδήποτε συνάδελφο τους πολιτικά και είμαι διατεθειμένη να το κάνω αυτό οπότε και εφόσον με χρειαστείτε…», είπε η κ. Ουσουλτζόγλου. Ωστόσο, όπως σημείωσε ο κ. Μαυροκεφαλίδης, δεν μπορεί να αλλάξει κάτι σε σχέση με το θέμα του εκπλειστηριασμού, αν δεν ολοκληρωθεί πρώτα η εκδίκαση της υπόθεσης. Κωστής Χαλάτσης

Από το Δημοτικό Συμβούλιο Βέροιας

Δημόσιος έπαινος στην αθλήτρια Σοφία Υφαντίδου Τ

ο Δημοτικό Συμβούλιο Βέροιας με την 228/09-05-2012 ομόφωνη απόφασή του, εκφράζει θερμά συγχαρητήρια στην αθλήτρια της πόλης Υφαντίδου Σοφία, για τη σημαντική επιτυχία της πρόκρισης της στους Ολυμπιακούς Αγώνες του Λονδίνου, στο αγώνισμα του επτάθλου. Σε δύσκολους καιρούς, αναδεικνύεται σε λαμπρό παράδειγμα για τη νεολαία και πρέσβειρα του Ολυμπιακού ιδεώδους, του ευ αγωνίζεσθε και του πολιτισμού. Η Σοφία Υφαντίδου ανήκει σε εκείνες τις νέες που με γνώση, μέθοδο, συστηματική και κοπιώδη προσπάθεια κατακτούν υψηλούς στόχους των ξεκάθαρων και ανοιχτών οριζόντων της ζωής. Το Δημοτικό Συμβούλιο απευθύνει δημόσιο έπαινο στην αθλήτρια και στον προπονητή της Μηνά Κυριάκο και της εύχεται να πετύχει την υψηλότερη δυνατή διάκριση και στους Ολυμπιακούς

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Αγώνες του Λονδίνου Για το Δημοτικό Συμβούλιο Ο Πρόεδρος Νικόλαος Μαυροκεφαλίδης


τοπικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Εκπαιδευτικό Πρόγραμμα για την διαχείριση των Μεταναστευτικών Ροών 2007-2013

Τελετή αποφοίτησης Αξιωματικών, Λιμενικού Σώματος – Ελληνικής Ακτοφυλακής Σήμερα στις 11:00 π.μ. στις εγκαταστάσεις της Αστυνομικής Ακαδημίας στο Πανόραμα Βέροιας

Α

πό τη Σχολή Μετεκπαίδευσης και Επιμόρφωσης Ελληνικής Αστυνομίας Βόρειας Ελλάδος της Αστυνομικής Ακαδημίας (Kέντρο Επιμόρφωσης της Ελληνικής Αστυνομίας), ανακοινώνεται, ότι σήμερα στις 11:00π.μ., στις εγκαταστάσεις της Σχολής στο Πανόραμα Βέροιας, θα πραγματοποιηθεί τελετή αποφοίτησης των Αξιωματικών, Λιμενικού Σώματος – Ελληνικής Ακτοφυλακής, του εκπαιδευτικού προγράμματος για την διαχείριση των Μεταναστευτικών Ροών 2007-2013, υλοποίηση των εκπαιδευτικών δράσεων έτους 2010 στο πλαίσιο του Ευρωπαϊκού Ταμείου Εξωτερικών

Συνόρων, με τίτλο: «Γλωσσική Κατάρτιση Προσωπικού της Ελληνικής Αστυνομίας και του Λιμενικού Σώματος της Ελληνικής Ακτοφυλακής στην Αλβανική και Τουρκική γλώσσα», με τη συμμετοχή τριάντα εννέα (39) σπουδαστών κατά το χρονικό διάστημα από 09-01-2012 έως 11-05-2012. Όλοι οι εκπαιδευόμενοι υπηρετούν σε Υπηρεσίες της Ελληνικής Αστυνομίας και του Λιμενικού Σώματος και έχουν ως έργο τον έλεγχο των συνόρων, την υποδοχή των μεταναστών, τον έλεγχο της νομιμότητάς τους και την μετέπειτα «διαχείριση» αυτών. Με την ανωτέρω εκπαίδευση οι σπουδαστές θα είναι σε θέση να επικοινωνήσουν στη γλώσσα εκμάθησης (να κατανοήσουν, να ομιλήσουν και να γράψουν) ως προς τα ακόλουθα: Λήψη καταχώρησης ατομικών και υπηρεσιακών στοιχείων, ενημέρωση περί του έργου και της αποστολής τους, παροχή πληροφοριών ως προς τα δικαιώματα και τις επιλογές του εισερχόμενου αλλοδαπού, καθώς και την εξυπηρέτηση ατόμων σε περίπτωση ατυχήματος ή έκτακτης ιατρικής

ή άλλης ανάγκης, διενέργεια συνεντεύξεων για την εξέταση της νομιμότητας εισόδου– της νόμιμης βάσης τυχόν καταγγελλομένων– την εξιστόρηση της κατάστασής τους και την επισήμανση ιδιαιτεροτήτων αυτής, ενημέρωση ως προς την ισχύουσα εθνική και διεθνή νομοθεσία σχετικά με τους αλλοδαπούς, έλεγχος νομιμότητας εγγράφων – σύνταξη εντύπων και αναφορών, εντολές σε αντιμετώπιση καταστάσεων βίας. Οι ανωτέρω εκπαιδεύτηκαν από εξειδικευμένους διδάσκοντες καθηγητές γλωσσολόγους του Πανεπιστημίου Μακεδονίας, και του Ιδρύ-

ματος Μελετών Χερσονήσου του Αίμου. Με το πέρας της εκπαίδευσης τους θα είναι σε θέση να αναλάβουν καθήκοντα μεταξύ άλλων και στην επιτήρηση των χερσαίων και των εναερίων συνόρων (αεροδρόμια) της χώρας – στον έλεγχο των σημείων διέλευσης και εισόδου αλλοδαπών στη χώρα, στην αντιμετώπιση της διασυνοριακής εγκληματικότητας, στον διαβατηριακό έλεγχο των εισερχομένων αλλοδαπών στην ελληνική επικράτεια, στην διαχείριση θεμάτων νόμιμης και παράνομης μετανάστευσης, κατ΄ εφαρμογή των εθνικών και διεθνών νομοθετημάτων και κανονισμών.

Μετά από απόφαση του Δημοτικού Συμβουλίου Νάουσας

Χώρος στάθμευσης τεσσάρων θέσεων ταξί κατά τη λειτουργία της λαϊκής αγοράς Α

πό αύριο, Σάββατο 12 Μαΐου, στη συμβολή των οδών Χατζηγρηγοριάδη και Χρ. Λαναρά (επί της οδού Χατζηγρηγοριάδη, πρώην Ταχυδρομείο) δημιουργείται χώρος στάθμευσης τεσσάρων (4) θέσεων ΤΑΞΙ, με σκοπό την εξυπηρέτηση των πολιτών την ημέρα και τις ώρες λειτουργίας της λαϊκής αγοράς. Πρόκειται για εφαρμογή σχετικής απόφασης του Δημοτικού Συμβουλίου (αρ.αποφ. 928/28-2-2012), η οποία εγκρίθηκε πρόσφατα από την αρμόδια υπηρεσία της Περιφέρειας Κεντρικής Μακεδονίας (αρ.πρωτ. 4487/7-5-2012) και το μέτρο τίθεται άμεσα σε εφαρμογή.

Αριθμός 2895 Περίληψη Κατασχετήριας Έκθεσης Ακίνητης Περιουσίας Στις 30 Μαΐου 2012 ημέρα Τετάρτη και από τις ώρες 16.00 έως και 17.00 στο Κατάστημα του Ειρηνοδικείου Βέροιας, με τον συμβολαιογράφο Πρόδρομο Παπαχρυσάνθου, θα βγει σε πλειστηριασμό η περιουσία κατά του οφειλέτη Γεώργιου Καλπάκη που επισπεύδεται από την εταιρεία «Ι. & Δ. ΔΕΜΕΡΤΖΙΔΗΣ Ο.Ε.». 1) Ένα διαμέρισμα του 3ου πάνω από το ισόγειο όροφο οικοδομής εμβαδού 146,00 τ.μ. 2) Το με αριθμό δύο (2) κλειστό χώρο στάθμευσης εμβαδού 31,80 τ.μ. 3) Το με αριθμό τρία (3) κλειστό χώρο στάθμευσης. Όλα τα παραπάνω ακίνητα βρίσκονται σε οικοδομή που χτίστηκε στο 515β Ο.Τ., που βρίσκεται στη συνοικία «Καλλιθέα» επί των οδών Κομνηνών, Καπετάν Γκόνα και Καπετάν Γάκη, του Δήμου Βέροιας. Υπάρχουν δύο υποθήκες. Πρώτη προσφορά το 1ο ακίνητο 97.650,00 ευρώ, το 2ο ακίνητο 8.000,00 ευρώ, το 3ο ακίνητο 5.750,00 ευρώ.

Ο Δικ. Επιμελητής Ανδρέας Κοκκαλιάρης

Αριθμός 2896 Περίληψη Κατασχετήριας Έκθεσης Ακίνητης Περιουσίας Στις 30 Μαΐου 2012 ημέρα Τετάρτη και από τις ώρες 16.00 έως και 17.00 στο Κατάστημα του Ειρηνοδικείου Βέροιας, με τον συμβολαιογράφο Πρόδρομο Παπαχρυσάνθου, θα βγει σε πλειστηριασμό η περιουσία κατά των οφειλετών 1. Παναγιώτη Καλπάκη και 2. Ελένης Δαληγκάρου, που επισπεύδεται από τον Γεράσιμο Καλλιγά. 1) Το με διακριτικό αριθμό (2) διαμέρισμα του 2ου ορόφου εμβαδού 82,00 τ.μ. 2) Το με αριθμό δύο (2) κλειστό χώρο στάθμευσης του ισογείου ορόφου εμβαδού 43,20 τ.μ. Όλα τα παραπάνω ακίνητα βρίσκονται σε οικοδομή που χτίστηκε στο 515β Ο.Τ., στη συνοικία «Καλλιθέα» επί των οδών Κομνηνών, Καπετάν Γκόνα και Καπετάν Γάκη, του Δήμου Βέροιας. Υπάρχει μία υποθήκη. Πρώτη προσφορά το 1ο ακίνητο 51.500,00 ευρώ και το 2ο ακίνητο 10.500,00 ευρώ.

ΚΕΝΤΡΙΚΗΣ 24

Ο Δικ. Επιμελητής Ανδρέας Κοκκαλιάρης

8

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


αθλητικα

epikera@otenet.gr

Δήλωση του Αντιπροέδρου του Ευρωπαϊκού Κοινοβουλίου Γιώργου Παπαστάμκου

Ευρωπαϊκό μεταρρυθμιστικό μέτωπο για την υπέρβαση της κρίσης Όχημα η Ευρωπαϊκή Πρωτοβουλία Πολιτών

Τ

ρία έτη μετά την εμφάνιση της παγκόσμιας χρηματοπιστωτικής κρίσης, η Ευρωζώνη, με επίκεντρο τις νότιες χώρες, εξακολουθεί να δοκιμάζεται με όρους βαθιάς κρίσης. Η έξοδος από τον φαύλο κύκλο λιτότηταύφεση, νέα μέτρα λιτότητας-νέα ύφεση συνιστά το αγωνιώδες και επείγον αίτημα των λαών που πλήττονται από την κρίση. Η παρατεινόμενη κρίση δεν είναι μόνο οικονομική, αλλά και κρίση της οικονομικής αντίληψης, της οικονομικής συνταγής. Η ηγεσία της ΕΕ πρέπει να απαλλαγεί από τον θεσμικό και πολιτικό της εγωισμό και να αλλάξει πορεία. Οι μονωδίες των ηγεσιών μερίδας των πολιτικών δυνάμεων που αναδείχθηκαν στις πρόσφατες εθνικές εκλογές υπό τη μορφή επιστολών με αποδέκτες τους εκπροσώπους υπερεθνικών θεσμικών εταίρων μας (ΕΕ, ΕΚΤ, ΔΝΤ), καίτοι εμπνεόμενες από «ριζοσπαστισμό», διακρίνονται για τον παρωχημένο

και εκ των προτέρων ατελέσφορο χαρακτήρα τους, με προφανές το πρόσκαιρο επικοινωνιακό όφελος. Οι κοινωνίες των πολιτών του ευρωπαϊκού οικονομικού Νότου δύνανται να συνενώσουν τη φωνή τους και, ικανοποιώντας τις τυπικές προϋποθέσεις για την υποβολή μιας Ευρωπαϊκής Πρωτοβουλίας Πολιτών, να αναλάβουν προ-νομοθετική δράση. Αντικείμενο μίας τέτοιας Πρωτοβουλίας θα μπορούσε να είναι η αντιμετώπιση της ανεργίας, ιδίως των νέων, και η ενίσχυση της οικονομικής μεγέθυνσης μέσω της εφαρμογής στοχευμένων και αποτελεσματικών πολιτικών ενός κοινού ενωσιακού βηματισμού και αλληλεγγύης. Έχει καταστεί πλέον σαφές ότι η εκ των άνω μετεξέλιξη της ΕΕ έχει αγγίξει τα όριά της. Η θέσμιση της Ευρωπαϊκής Πρωτοβουλίας Πολιτών (ΕΠΠ) από 1ης Απρίλιου, έχει προσδώσει στον νομοπαραγωγικό μηχανισμό της Ένωσης μια πρόσθετη κινητήριο δύναμη πέραν των πρωτοβουλιών των θεσμικών οργάνων της. Το Ενωσια-

κό πρότυπο διακυβέρνησης ανταποκρίνεται, έστω και με καθυστέρηση, στο αίτημα για ενεργό συμμετοχή των Ευρωπαίων Πολιτών στη διαδικασία λήψης αποφάσεων. Ο καταπονημένος, λόγω των συστημικών, λειτουργικών και πολιτικών αδυναμιών της κοινής υπερεθνικής κατασκευής, φέρων οργανισμός του Ενωσιακού οικοδομήματος έχει ανάγκη από την «εκ των κάτω προς τα άνω» ενίσχυσή του.

Υπεγράφη χθες η σύμβαση από τον Αντιπεριφερειάρχη Ημαθίας

«Πράσινο φως» για την ανέγερση του 10ου Δημοτικού Σχολείου Νάουσας Η

σύμβαση για την υλοποίηση του έργου ανέγερσης του 10ου δημοτικού σχολείου Νάουσας υπογράφηκε χθες από τον Αντιπεριφερειάρχη Ημαθίας Κώστα Καραπαναγιωτίδη και τους εκπροσώπους της αναδόχου εταιρείας, παρουσία του Προϊσταμένου Τμήματος Δομών Περιβάλλοντος της Διεύθυνσης Τεχνικών Έργων της Περιφερειακής Ενότητας Ημαθίας Γιώργου Ρίστα. Το έργο έχει προϋπολογισμό 3.360.000 ευρώ. Στο οικόπεδο των 2.605 τ.μ. της περιο-

χής ‘Κερασιά’, θα υλοποιηθεί διώροφο κτίριο με υπόγειο, συνολικής δόμησης 1.794 τ.μ. Η δυναμικότητα του νέου εξαθέσιου Δημοτικού Σχολείου θα είναι 150 μαθητών. Στο έργο προβλέπεται επίσης η διαμόρφωση του αύλειου χώρου, συνολικού εμβαδού 1.832 τ.μ. Συμβατική υποχρέωση παράδοσης του έργου είναι περίπου δύο χρόνια. Το έργο χρηματοδοτείται από το Περιφερειακό Επιχειρησιακό Πρόγραμμα ‘ΜακεδονίαΘράκη’ 2007-2013 (ΕΣΠΑ).

Από τη Διεύθυνση Δημόσιας Υγείας και Κοινωνικής Μέριμνας Ημαθίας

Ενημέρωση για την προστασία των μαθητών από τα κουνούπια Διοργανώνει διήμερες εκδρομές στην Αλβανία για να γνωρίσετε την Β. Ήπειρο

Γ

ια το θέμα των κουνουπιών ενημέρωσε τους διευθυντές σχολικών μονάδων πρωτοβάθμιας και δευτεροβάθμιας εκπαίδευσης της Ημαθίας με εντολή του Αντιπεριφερειάρχη Ημαθίας Κώστα Καραπαναγιωτίδη, η Διεύθυνση Δημόσιας Υγείας και Κοινωνικής Μέριμνας Ημαθίας, έχοντας ως απώτερο σκοπό την προστασία των μαθητών από τα νύγματα κουνουπιών. Η πρωτοβουλία λήφθηκε με αφορμή την εμφάνιση κρουσμάτων του ιού του Δυτικού Νείλου τα δύο προηγούμενα χρόνια, αλλά και λόγω της επανεμφάνισης κρουσμάτων ελονοσίας σε διάφορες περιοχές της χώ-

ρας μας. Η ενημέρωση πραγματοποιήθηκε στο κτίριο της Δημόσιας Κεντρικής Βιβλιοθήκης Βέροιας, χθες και προχθές.

Επίσης, για την καλύτερη ενημέρωση του κοινού, πρόκειται να γίνει ευρεία συνεργασία με την Ιερά Μητρόπολη Βέροιας, Καμπανίας και Νάουσας.

9

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Άγ. Σαράντα - Αργυρόκαστρο (Τιμή συμμετοχής 80€) Περιλαμβάνει βραδινό φαγητό με ζωντανή μουσική και πρωινό. Για σωματεία και συλλόγους. Συζητήσιμη τιμή.

Τηλ.: 23310 27120 - 24655


αθλητικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Ντέρμπι την Κυριακή για την Μικτή Προπαίδων Ημαθίας

Ε

πιστροφή και πάλι στην δράση για τους φίλους του ποδοσφαίρου, την Κυριακή 13 Μαρτίου, όπου η Μικτή ομάδα Προπαίδων της ΕΠΣ Ημαθίας, στον τελευταίο αγώνα του πρωταθλήματος GOOD LEAGUE ΟΠΑΠ Εθνικών Ομάδων, στο ντέρμπι κορυφής που θα δώσει στο γήπεδο των Παλατιτσίων με ώρα έναρξης 11 το πρωϊ, θα προσπαθήσει να κερδίσει και να καταλάβει έτσι την πρώτη θέση του ομίλου, κάτι για το οποίο όλοι, από τον προπονητή και τους παίκτες, αλλά και όσους έχουν παρακολουθήσει τους προηγούμενους αγώνες της Ημαθίας, πιστεύουν ότι μπορεί να επιτευχθεί. Αντίπαλός της η αντίστοιχη ομάδα της ΕΠΣ Κοζάνης, που φιγουράρει στην πρώτη θέση της βαθμολογίας με εννέα βαθμούς, που προέρχονται από τρεις ισάριθμες νίκες και μάλιστα με μεγάλα σκορ επί των αντιπάλων ομάδων των υπολοίπων

Ενώσεων. Η ομάδα της ΕΠΣ Ημαθίας βρίσκεται δυο βαθμούς πίσω στην βαθμολογία και πιθανή νίκη θα δώσει δικαίωμα στους Προπαίδες να πανηγυρίσουν την πρωτιά. Επομένως το κίνητρο για τους «πιτσιρικάδες» του Αντώνη Λυμούση, είναι σαφώς και μεγαλύτερο σε σχέση με τα προηγούμενα παιχνίδια και υπολογίζεται να έχουν και την συμπαράσταση των φιλάθλων στον τελευταίο αυτό αγώνα. Δικαίως μέχρι τώρα όλοι οι αντίπαλοι προπονητές των άλλων Ενώσεων, μόνο καλά λόγια έχουν να πούνε για τις δυο ομάδες, πράγμα που κάνει τον αγώνα ακόμη πιο ενδιαφέρον. Αγωνιστικά η ομάδα των Προπαίδων της Ημαθίας αντιμετωπίζει δυο προβλήματα. Θα στερηθεί των βασικών του παικτών, Ποζιάδη και του Μελιόπουλου, που δεν μπόρεσαν για διάφορους λόγους να ενσωματωθούν στην αποστολή. Οι υπόλοιποι παίκτες που έχει στην διάθεσή του ο ενωσιακός προπονητής ήδη προετοιμά-

ζονται εντατικά για το παιχνίδι. Η τελευταία προπόνηση θα γίνει την Πέμπτη στις 4.30 στα Παλατίτσια, όπου ο προπονητής της Ένωσης θα προσπαθήσει μέσα από αγωνιστικές διαδικασίες, αυτοματισμούς και στημένες φάσεις να δώσει την εικόνα με την οποία η ομάδα μας θα

αντιμετωπίσει την Κοζάνη. Στην συνέχεια θα ανακοινωθεί και η αποστολή του αγώνα, όπου αυτή θα πρέπει να βρίσκεται στο γήπεδο των Παλατιτσίων την Κυριακή 13 Μαίου στις 9.30 το πρωί έχοντας τον απαραίτητο αθλητικό εξοπλισμό.

Γρεβενά Αεράτα - Λευκάδια: 1-1 Ι

σόπαλοι 1-1 αναδείχτηκαν Γρεβενά Αεράτα και Λευκάδια, με τους γηπεδούχους να κρατούν τις αποστάσεις από τη γραμμή του υποβιβασμού. Τα Λευκάδια ευτύχησαν να προηγηθούν στο 7’, χάρη σε πέναλτι που κέρδισε ο Συμπεθέρης από τον Βίδρα. Ο παθών ανέλαβε την εκτέλεση και έκανε το 0-1. Στο δεύτερο ημίχρονο όμως η ομάδα των Λευκαδίων έμεινε με δέκα παίκτες. Στο 57’ ο Τζεϊρανίδης δέχτηκε την δεύτερη κίτρινη κάρτα και αποβλήθηκε. Η ισοφάριση

για τα Αεράτα ήρθε στο 75’, επίσης με πέναλτι. Ο Κουβατσίδης έκανε χέρι μέσα στην περιοχή και ο Νασιόπουλος από την άσπρη βούλα ισοφάρισε σε 1-1, που ήταν και το τελικό σκορ. ΓΡΕΒΕΝΑ ΑΕΡΑΤΑ: Βίδρας, Δημητριάδης, Στεργιόπουλος, Νασιόπουλος, Λάλλος Θ., Ιωαννίδης (57’ Καραγιάννης), Χαματάι, Ντινόπουλος, Δημόπουλος (72’ Χρηστούλης), Μπαλοδήμος, Λάλλος Π. ΛΕΥΚΑΔΙΑ: Κωνσταντινόπουλος, Μωυσιάδης, Τζεϊρανίδης, Κουβατζίδης, Σίμος, Ορδουλίδης, Συμπεθέρης (88’ Παντζής), Ζούρκος (90+4’ Ξενίδης), Κοτσαχρήστος, Γιαουτζής, Ηλιάδης (89’ Λέτσκας)

Από το Αθλητικό τμήμα ΚΑΠΑ του Δήμου Βέροιας

Πραγματοποιήθηκαν δύο ημερίδες με θέμα Άθληση & Παχυσαρκία Π

ραγματοποιήθηκαν από το Αθλητικό τμήμα του ΚΑΠΑ Δήμου Βέροιας, την 24/4 και στις 8/5/2012, στην αίθουσα «ΟΛΥΜΠΙΑΔΑ» του ΦΙΛΙΠΠΕΙΟΥ Γυμναστηρίου δύο ημερίδες με θέμα Άθληση & Παχυσαρκία, από την διατροφολόγοδιαιτολόγο Δέσποινα Τσανακσίδου , με πρωτοβουλία της ΚΦΑ Μαραντίδου Ελένης , γυμνάστριας του Μαζικού Αθλητισμού , με την συμμετοχή των μαθητών/τριών της 4ης και 5ης τάξης του 5ου Δημοτικού σχολείου Βέροιας. Οι μικροί μαθητές είχαν την ευκαιρία να γνωρίσουν τα μυστικά του πιγκ-πογκ και να παίξουν . Μετά το παιχνίδι ακολούθησε η ημερίδα στην κεντρική σάλα με θέμα τη διατροφή που με μεγάλο ενδιαφέρον παρακολούθησαν όλοι οι συμμετέχοντες

10

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


αθλητικα 

epikera@otenet.gr

Εθνική Ανδρών: Οι κλήσεις των «λεγεωνάριων»

Ο

ομοσπονδιακός εκλέκτορας, Φερνάντο Σάντος, ανακοίνωσε την προεπιλογή των ποδοσφαιριστών που ανήκουν σε ομάδες του εξωτερικού, εν όψει της οριστικής συγκρότησης της αποστολής για την τελική φάση του ευρωπαϊκού πρωταθλήματος. Στους παίκτες προς τους οποίους ο Πορτογάλος τεχνικός απηύθυνε πρόσκληση

περιλαμβάνεται ο Διονύσης Χιώτης, που «εξαργυρώνει» την καταπληκτική χρονιά του με τον ΑΠΟΕΛ και τις εμφανίσεις του στο τσάμπιονς λιγκ. Οι υπόλοιποι «λεγεωνάριοι» είναι οι Τζόρβας, Μόρας, Κυριάκος Παπαδόπουλος, Παπασταθόπουλος, Τζαβέλλας, Κονέ, Πέτσος, Τζιόλης, Φορτούνης, Γκέκας και Σαμαράς. Ο Ίβηρας προπονητής θα ανακοινώσει την αποστολή της εθνικής, που θα μεταβεί στην Αυστρία για προετοιμασία ενόψει του Euro 2012, την Πέμπτη 17 Μαΐου 2012.

Μήνυμα ενότητας από Ίβκοβιτς και Ομπράντοβιτς

Κ

οινή συνέντευξη Τύπου ενόψει της συμμετοχής των ομάδων τους στο φάιναλ-4 της Ευρωλίγκας παρέθεσαν οι τεχνικοί του Ολυμπιακού και του Παναθηναϊκού, Ντούσαν Ίβκοβιτς και Ζέλιμιρ

Ομπράντοβιτς, παρουσία αθλητών των δύο ελληνικών συλλόγων. Η εκδήλωση πραγματοποιήθηκε στα γραφεία της ΟΠΑΠ Α.Ε., που είναι μέγας χορηγός «ερυθρόλευκων» και «πράσινων».

Οι δύο φίλοι και κουμπάροι εμφανίστηκαν βέβαιοι για την ετοιμότητα των παικτών τους, ευχόμενοι η παρουσία των δύο ομάδων στο φάιναλ-4 να εμπνεύσει τους Έλληνες φιλάθλους και να αλλάξει τη συμπεριφορά τους. «Είναι μεγάλη η χαρά που θα έχουμε δύο εκπροσώπους από την Ελλάδα. Αυτό δεν έγινε ούτε στην ισχυρή Ισπανία, ούτε στην Τουρκία που επένδυσε πολλά στο άθλημα, ούτε στην Ιταλία. Εμείς έχουμε κάνει ό,τι μπορούσαμε για να είμαστε έτοιμοι και πιστεύω ότι θα παίξουμε καλό μπάσκετ», δήλωσε ο κ. Ίβκοβιτς. Από την πλευρά του, ο κ. Ομπράντοβιτς υπογράμμισε ότι η παρουσία των δύο σωματείων «είναι μεγάλο επίτευγμα, όμως εμείς θέλουμε το καλύτερο δυνατό για την ομάδα μας. Θα συγκεντρωθούμε και θα προσπαθήσουμε να κερδίσουμε την ΤΣΣΚΑ προκειμένου να περάσουμε στον τελικό».

MotoGP: Δεν αποσύρεται ο Ρόσι

Ο

ργιάζουν οι φήμες σχετικά με το μέλλον του Βαλεντίνο Ρόσι στη Ducati και γενικότερα στα MotoGP. Τα τελευταία δημοσιεύματα αναφέρουν ότι σκέφτεται σοβαρά το ενδεχόμενο να αποχωρήσει στο τέλος της φετινής σεζόν.

Κάτι τέτοιο το διέψευσε κατηγορηματικά ο ίδιος λέγοντας ότι δεν είναι αλήθεια. Η βρετανική όμως εφημερίδα Daily Telegraph ανέφερε σε άρθρο της πως ο «γιατρός» έχει αποκαλύψει στο στενό του κύκλο ότι δεν θα τρέξει μετά το 2012. Ο Ιταλός επτά φορές Παγκόσμιος πρωταθλητής χαρακτήρισε αβάσιμες αυτές τις φήμες και αρνήθηκε να κάνει οποιαδήποτε συζήτηση πάνω σε αυτό το θέμα. Οι φήμες ξεκίνησαν από την αρνητική κριτική που είχε εκφέρει εναντίον της ομάδας του μετά τον πρώτο αγώνα στο Κατάρ. «Δε μπορώ να οδηγήσω αυτή τη μοτοσικλέτα. Δε μπορώ να κάνω τη διαφορά, τι άλλο να πω;», είχε διερωτηθεί ο Ρόσι μετά το τέλος του αγώνα. Αλλωστε ο πρώην παγκόσμιος πρωταθλητής μετακινήθηκε στην Ducati με την προοπτική να πετύχει κι άλλες νίκες και να κερδίσει έναν ακόμη τίτλο. Κάτι τέτοιο όπως έχει παραδεχθεί, είναι δύσκολο, διότι χρειάζεται ακόμη να γίνει αρκετή δουλειά ώστε η φετινή μοτοσικλέτα να φτάνει στα επίπεδα των Honda και Yamaha, αντίστοιχα.

11

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Οι τέσσερις αποστολές θα καταλύσουν στο ίδιο ξενοδοχείο, όμως αυτό κάθε άλλο παρά πρόβλημα αποτελεί για τους δύο κορυφαίους τεχνικούς. «Θα είναι πολύ καλό που θα είμαστε όλοι μαζί. Δεν υπήρξε ποτέ πρόβλημα ανάμεσα σε εμάς ή τους παίκτες. Όλοι θυμούνται το φάιναλ-4 του Βερολίνου, όταν δεν συνέβη τίποτα. Ελπίζω να γίνει αυτό και στην Ελλάδα, στο ΟΑΚΑ ή στο ΣΕΦ», σχολίασε ο κ. Ομπράντοβιτς, για να προσθέσει ο κ. Ίβκοβιτς ότι «είμαστε, ήμασταν και θα είμαστε το παράδειγμα. Είμαι πολύ αισιόδοξος ότι σύντομα θα γίνουν με ανοικτές πόρτες παρουσία και των δυο φιλάθλων οι αγώνες. Είναι η πρώτη ευκαιρία πριν τους τελικούς του ελληνικού πρωταθλήματος, που θα είναι οι φίλαθλοι μαζί. Όλοι πρέπει να υποστηρίξουν τις ελληνικές ομάδες. Θα είναι σαν πρώτο βήμα. Είμαι αισιόδοξος».


πολιτιστικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Έκθεση έργων τέχνης

H τέχνη της «Αλήθειας, Καλοσύνης, Ανεκτικότητας»

Η

Ελληνική Ένωση Φάλουν Ντάφα παρουσιάζει στην Βέροια, για πέμπτη φορά στην Ελλάδα, την έκθεση έργων τέχνης, με τίτλο «Η Τέχνη της Αλήθειας, Καλοσύνης, Ανεκτικότητας», της οποίας η παρουσίαση σε πολλές περιοχές του κόσμου, έχει επανειλημμένα γίνει αντικείμενο πιέσεων από την κινεζική κυβέρνηση με στόχο την ματαίωσή της. Η έκθεση «Η Τέχνη της Αλήθειας, Καλοσύνης, Ανεκτικότητας» έχει παρουσιαστεί σε πάνω από διακόσιες πόλεις του κόσμου, όπου και απέσπασε τα θετικότερα σχόλια: Γερμανία, Η.Π.Α., Μ. Βρετανία, Αυστραλία, Ιαπωνία, Γαλλία, Σουηδία, Ελβετία κ.α. Στην έκθεση συμμετέχουν 18 καλλιτέχνες, ασκούμενοι του Φάλουν Ντάφα (παραδοσιακή κινέζικη εξάσκηση για το νου και το σώμα) από 5 χώρες. Η έκθεση «Η Τέχνη της Αλήθειας, Καλοσύνης, Ανεκτικότητας» ξεκίνησε με πρωτοβουλία του καθηγητή Τζανγκ

Κουνλούν, μετά την διάσωσή του από τις κινεζικές φυλακές το 2001, όπου είχε κρατηθεί επειδή ήταν ασκούμενος του Φάλουν Ντάφα. Σε συνεργασία με άλλους καλλιτέχνες και ασκούμενους του Φάλουν Ντάφα, που είχαν παρόμοιες εμπειρίες, αποκαλύπτουν στο κοινό μέσω της τέχνης τους, τις απάνθρωπες συνθήκες κράτησής τους, το μέγεθος της καταπάτησης των ανθρωπίνων δικαιωμάτων και την σύνθλιψη κάθε αξιοπρέπειας που υπέστησαν ως ασκούμενοι του Φάλουν Ντάφα, από τις κινεζικές αρχές. Η έκθεση , θα λάβει χώρα από 12 Μαΐου – 19 Μαΐου στην Αντωνιάδεια Στέγη Γραμμάτων και Τεχνών του Δήμου Βέροιας. Εγκαίνια: Σάββατο 12 Μαΐου, στις 8:00 μ.μ. Ώρες λειτουργίας της έκθεσης : καθημερινά 9 π.μ. – 2.00 μ.μ. και 5 μ.μ. – 9 μ.μ. Σάββατο: 9 π.μ. – 2 μ.μ. Η έκθεση διοργανώνεται από την Ελληνική Ένωση Φάλουν Ντάφα. Για περισσότερες πληροφορίες επικοινωνήστε με τα παρακάτω τηλέφωνα:

- Ελληνική Ένωση Φάλουν Ντάφα: 6987148953 - Ελισάβετ Μαρκοβίτη: 6934364004 Για περαιτέρω πληροφόρηση επισκεφτεί-

τε τις ακόλουθες ιστοσελίδες: www.falunart.org www.falundafa.gr www.faluninfo.net

Δημοτικό Ωδείο Βέροιας:

H «Γαλάζια Ραψωδία» του George Gershwin στη Στέγη Γραμμάτων και Τεχνών στις 13 Μαΐου Τ

ο γνωστότερο από τα έργα του George Gershwin, που είναι την ίδια στιγμή ένα από τα πιο αγαπημένα έργα της Μουσικής, έργο που από άλλους θεωρείται πως ανήκει στη λόγια Μουσική (με την ευρύτερη έννοια), ενώ από άλλους αποδίδεται στη Τζαζ φιλολογία, θα παρουσιαστεί την Κυριακή 13 Μαΐου στη Στέγη Γραμμάτων και Τεχνών στις 8:30μμ. Συγκεκριμένα, για έβδομη χρονιά το τμήμα πιάνου της Πόπης Φιρτινίδου παρουσιάζει, υπέρ του συλλόγου καρκινοπαθών Ν. Ημαθίας «ο Άγιος Παρθένιος», συναυλία στο πλαίσιο της πιανιστικής διοργάνωσης το πιάνο, μακρινός φίλος, οικείος

ξένος. Στην ετήσια συναυλία της διοργάνωσης αυτής, που γίνεται πάντα στη μνήμη της πρώτης καθηγήτριας πιάνου του Δημοτικού Ωδείου Πόπης Χατζηδήμου, παίρνουν μέρος –ανάλογα με το αντικείμενο που αγκαλιάζει κάθε φορά- αρχάριοι ή προχωρημένοι μαθητές, απόφοιτοι του Ωδείου, αλλά και η ίδια η καθηγήτρια Πόπη Φιρτινίδου. Η φετινή χρονιά είναι αφιερωμένη στη Τζαζ, όπως πολύ εύγλωττα περιγράφει ο τίτλος «all that Jazz» που φέτος επελέγη για να περιγράψει το περιεχόμενο του προγράμματος. Τα υπόλοιπα έργα που θα παιχτούν, ανήκουν σε πολλές από τις εποχές και τα ρεύματα της Τζαζ, και με

Την Κυριακή 20 Μαΐου

την πολυρρυθμία, τον αρμονικό τους πλούτο και την ποικιλία των συναισθηματικών αποχρώσεων που αποδίδουν, δίνουν μια αντιπροσωπευτική εικόνα αυτής της μουσικής, τόσο πολύ από τόσο πολλούς. Συγκεκριμένα εκτός από την πασίγνωστη Γαλάζια Ραψωδία θα ακουστούν: Take five (Paul Desmond), Ragtime (Scott Joplin), The little negro (Debussy), The man I love (George Gershwin), Fly me to the moon (Burt Howard), Jazz Waltz (Shostakovich), My baby just cares for me (Donaldson). Η γενική είσοδος είναι 5 €.

Αυτό το Σάββατο στη Δημόσια Βιβλιοθήκη

Παρουσίαση δύο βιβλίων στο Café Star από την «Άνεμος Εκδοτική» Η «άνεμος Εκδοτική» πρόκειται να παρουσιάσει την Κυριακή 20 Μαΐου στις 8μ.μ. στον όροφο του cafe Στάρ, το βιβλίο του Πέτρου Κουμπλή «12 ιστορίες, που ονειρεύονται να γίνουν παραμύθια» και το βιβλίο «Ζωή Με λες» του Γιάννη Φιλιππίδη.

12

Αντιστρέφοντας τους ρόλους 11.00-13.00 το πρωί Αντιστρέφοντας τους ρόλους. Οργανώνουμε παρέα τον τρύπιο μπουφέ! Καθένας που θέλει να συμμετάσχει συνεισφέρει μ’ ένα τρύπιο έδεσμα. Παράλληλα δημιουργούμε με τρύπιες χάντρες!! Εργαστήριο προσανατολισμένο σε μεγαλύτερες ηλικίες (ενήλικες και έφηβοι) όπου τα παιδιά έως 12 ετών μπορούν να έχουν βοηθητικό ρόλο. Στα Μαγικά Κουτιά της Βιβλιοθήκης.

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


πολιτιστικα 

epikera@otenet.gr

Κοινωφελής Επιχείρηση Πολλαπλής Ανάπτυξης Δήμου Βέροιας Έκθεση στο Δημαρχείο Βέροιας

«Ενάλιος νύμφη» η Γοργόνα ως έκφραση συλλογικής επιθυμίας και φόβου συνάμα

Μ

έσα από το δισυπόστατο πρόσωπο της Γοργόνας που είναι μισή ψάρι-μισή γυναίκα, η έκθεση αναδεικνύει τη διπλή όψη της ιστορικής πορείας του Ελληνισμού που μια γαληνεύει και μια αναστατώνεται από ποικίλες τρικυμίες. «Αυτή είναι η Ελλάδα», λέει για τη Γοργόνα , στα ΄΄Λόγια της πλώρης΄΄ ο Καρκαβίτσας, «μισή στεριά-μισή θάλασσα». Προσδιορίζει τη σχέση και την ταύτιση της Γοργόνας με την ίδια την Ελλάδα, της αέναης αναζήτησης με τον καημό της Ρωμιοσύνης. Ολόκληρος ο μύθος μετουσιώνει μέσα από ένα ερώτημα (Ζει ο βασιλιάς Αλέξανδρος;), μέσα από μια επιθυμητή και απαιτητή απάντηση (Ζει και βασιλεύει…) και δυο πρόσωπα-σύμβολα (της Γοργόνας, σύμβολο στέρησης και αέναης αναζήτησης του επιθυμητού, και του Αλέξανδρου, σύμβολο του Οραματικού, του Μείζονος Ελληνικού Ελληνισμού- κατά τον Σεφέρη), το θεμέλιο μιας εθνικής συνείδησης και μαζί μιας αυταπάτης. Μέσα σ’ αυτά τα πλαίσια κινούμενοι οι δυο δημιουργοί, Δέσποινα Περηφανοπούλου και Δημήτρης Κατσαβός, αφήσα-

νε για λίγο τα οικεία για αυτούς πρόσωπα της Πάναγνης Θεοτόκου, του Ιησού και των Αγίων Μορφών των εικονοστασίων, με τον ίδιο χρωστήρα όμως, τα ίδια χρώματα και την ίδια τεχνική-της ορθόδοξης βυζαντινής εικονογραφίας, σμιλέψανε την καλλικέλαδο Γοργόνα, αδερφή του Μεγαλέξανδρου. όπως σχηματοποιήθηκε και πήρε μορφή μπρος στα μάτια του μυαλού και της καρδιάς τους, μέσα από κείμενα και στίχους σημαντικών Ελλήνων λογοτεχνών και ποιητών (Καρκαβίτσας, Μυριβήλης, Σεφέρης, Ελύτης…), ανταποκρινόμενοι στο κάλεσμα της αγαπημένης, γενέθλιας πόλης που γιορτάζει τα 100 χρόνια Ελευθερίας της. Εγκαίνια : Παρασκευή 11 Μαΐου 8.30μ.μ Διάρκεια Έκθεσης : 11 Μαΐου έως 20 Μαΐου 2012 Ώρες επισκέψεων : 6.00μ.μ έως 10.00μ.μ ΟΙ ΔΗΜΙΟΥΡΓΟΙ (βιογραφικό) ΔΕΣΠΟΙΝΑ ΠΕΡΗΦΑΝΟΠΟΥΛΟΥ ΔΗΜΗΤΡΙΟΣ ΚΑΤΣΑΒΟΣ Γεννήθηκαν στη Βέροια όπου ζουν και εργάζονται με σκοπό τη διατήρηση, συνέχιση και εξέλιξη της Ορθόδοξης Βυζαντινής Παράδοσης. Στην 20ετή και πλέον πορεία τους στα μονοπάτια της Βυζαντινής Εικονογραφίας έχουν ιστορήσει με τοιχογραφίες ιερούς

ναούς (Αγ. Αλέξανδρος, Αγ. Αικατερίνη Σύρου…) και με φορητές εικόνες τέμπλα εκκλησιών (Μαρούσια, Αγ. Νικόλαος ο Λαμαρινάς- παλιά βυζαντινή εκκλησία της Βέροιας). Ξεχωριστή στιγμή στη δημιουργία τους αποτελεί η ιστόρηση του τέμπλου της Ιεράς Μονής Αγ. Γεωργίου του Χοτζεβά στα Ιεροσόλυμα. Έργα τους υπάρχουν και κοσμούν ιδιωτικές συλλογές και δημόσιους χώρους όπως η Δημοτική Πινακοθήκη Κυκλάδων, το Λαογραφικό Μουσείο Κοζάνης, το Δημοτικό Κέντρο Τεχνών Λευκωσίας, η Ελληνική πρεσβεία στην Ουάσιγκτον… Τις ανησυχίες τους και τις απόψεις τους για την τέχνη της Ορθοδόξου Βυζαντινής Εικονογραφίας (αντιγραφή, εξέλιξη, ελευθερία δημιουργού) παρουσίασαν με έργα τους σε 20 και πλέον ατομικές εκθέσεις στην Ελλάδα, (Ερμούπολη, Βέροια, Έδεσσα, Καστοριά, Θεσσαλονίκη (Δημήτρια, (Αλατζά Ιμαρέτ), Μονή Βλατάδων, Βαφοπούλειο Πνευματικό Κέντρο…), και στο εξωτερικό (Αγγλία, Γερμανία…) καθιερώνοντας έτσι ένα έντονο προσωπικό στοιχείο προσαρμοσμένο πάντοτε όμως στο πνεύμα της διατήρησης και του σεβασμού στην Ορθόδοξη Βυζαντινή Παράδοση. Το έργο τους έχει αποσπάσει θετικές κρι-

τικές από σημαντικούς δημιουργούς της εποχής μας (Ι. Βράνος…), θεσμικούς παράγοντες (Υπουργείο Πολιτισμού, 2001, Ιερά Μητρόπολη Βεροίας , Καμπανίας και Ναούσης…) καθώς επίσης υπήρξε και πηγή έμπνευσης και επαναλαμβανόμενης συνεργασίας με τον μαΐστορα , συνθέτη και ερευνητή της Βυζαντινής μουσικής κ. Χριστόδουλο Χάλαρη.

ΧΟΡΕΥΤΙΚΟ ΕΡΓΑΣΤΗΡΙ ΗΜΑΘΙΑΣ « ΚΥΚΛΟΣ ΕΡΑΤΕΙΝΟΣ»

«Του κύκλου τα γυρίσματα»

Μουσικοχορευτικη παράσταση το Σάββατο 12 Μαΐου, ώρα 8.30 μ.μ. στο Χώρο Τεχνών του χοροδιδάσκαλου Αντώνη Κελεπούρη, πραγματοποιεί εκδήλωση που φέρει τον τίτλο «Του κύκλου τα γυρίσματα». Τίτλος που φυσικά δεν είναι τυχαίος, αλλά παρμένος από το όνομα του σωματείου , μα ταυτόχρονα και από το κυριότερο χαρακτηριστικό των παραδοσιακών μας χορών, τον ‘κυκλο’.

Στον κύκλο χορεύεται η πλειοψηφία των παραδοσιακών μας χορών αλλά και ο κύκλος είναι το στοιχείο που χαρακτηρίζει την ίδια μας τη ζωή:’’κύκλος είναι και γυρίζει....’’ ή ‘’έχει ο καιρός γυρίσματα...’’ Σαν τα ‘’παραμύθια της Γιαγιάς’’ λοιπόν, όπου τα λόγια των παραμυθιών αντικαθιστούν οι κυκλικοί χοροί και τα τραγού-

δια, θα κυλήσει η εκδήλωσή περιδιαβαίνοντας από διάφορες περιοχές του τόπου μας. Είστε όλοι καλεσμένοι. Προπώληση εισιτηρίων: ΚΑΘΗΜΕΡΙΝΑ , 10.00 π.μ – 13.00 στο φουαγιέ του Χώρου Τεχνών Πληροφορίες : 2331078100

ΠΛΥΝΤΗΡΙΟ - ΛΙΠΑΝΤΗΡΙΟ

Αξεσουάρ Καλύματα Καθαρισμός Σαλονιών

Τ

* Πλύσιμο μέσα-έξω μόνο 10 €

ο χορευτικό εργαστήρι Ημαθίας «Κύκλος Ερατεινός» υπό την επιμέλεια

13

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


ΘΕΜΑΤΑ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Βιολογία Γ΄ Λυκείου Θετικής Κατεύθυνσης ΘΕΜΑ Α

Μονάδες 10 (5 για Σ – Λ + 5 αιτιολόγηση)

Α1. Στις ερωτήσεις 1-5 να γράψετε τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Αν το 30% των βάσεων ενός δίκλωνου τμήματος DNA είναι αδενίνη – θυμίνη, ποιο θα είναι το ποσοστό των βάσεων γουανίνη – κυτοσίνη στο mRNA που θα δημιουργηθεί από τη μεταγραφή του τμήματος αυτού; α. 40% β. 80% γ. 35% δ.70% Μονάδες 3 2. Σε μια κλειστή καλλιέργεια οι μικροοργανισμοί παράγουν χρήσιμα προϊόντα κατά τη διάρκεια: α. μόνο της στατικής φάσης ανάπτυξής τους β. της εκθετικής και της στατικής φάσης ανάπτυξής τους γ. μόνο της εκθετικής φάσης ανάπτυξής τους δ. της λανθάνουσας και εκθετικής φάσης ανάπτυξής τους Μονάδες 3 3. Ένας γαμέτης του καλαμποκιού περιέχει 10 χρωμοσώματα. Σε ένα σωματικό κύτταρο του φυτού αυτού που βρίσκεται στο στάδιο της μετάφασης υπάρχουν…. κεντρομερίδια. α. 0 β. 5 γ. 10 δ.20 Μονάδες 3 4. Ο χαρακτήρας γραμμή τριχοφυίας με κορυφή στον άνθρωπο καθορίζεται από: α. αυτοσωμικό επικρατές γονίδιο β. φυλοσύνδετο επικρατές γονίδιο γ. αυτοσωμικό υπολειπόμενο γονίδιο δ. φυλοσύνδετο υπολειπόμενο γονίδιο Μονάδες 3 5. Οι DNA πολυμεράσες: α. είναι τμήματα DNA β. παράγονται στον πυρήνα γ. καταλύουν την μεταγραφή δ. παράγονται στο κυτταρόπλασμα

Μονάδες 3

Α2. Να σημειώσετε ποιες από τις επόμενες προτάσεις είναι σωστές και ποιες λανθασμένες. Να αιτιολογήσετε σύντομα την απάντησή σας στις λανθασμένες προτάσεις. 1. Στο κυτταρόπλασμα ενός ευκαρυωτικού κυττάρου είναι δυνατόν να εντοπιστούν όλα τα είδη του RNA. 2. Το φύλο στον άνθρωπο καθορίζεται από το ζεύγος χρωμοσωμάτων ΧΧ και ΧΥ. 3. Ο καταστολέας και ο επαγωγέας του οπερονίου της λακτόζης αποτελούνται από αμινοξέα. 4. Τα βακτήρια του γένους Lactobacillus αναπτύσσονται σε pH 4- 5. 5. Τα ατελώς επικρατή αλληλόμορφα εκφράζονται και τα δύο, με αποτέλεσμα τα ετερόζυγα άτομα να εμφανίζουν ενδιάμεσο φαινότυπο, από το φαινότυπο των δύο ομόζυγων γονέων τους.

ΘΕΜΑ Β Β1. Να περιγράψετε τη διαδικασία παραγωγής ενός διαγονιδιακού φυτού της ποικιλίας Bt. Μονάδες 8 Β2. Απομονώνουμε ένα μόριο mRNA από ένα πολυκύτταρο ευκαρυωτικό οργανισμό και το τοποθετούμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε ότι συντέθηκε μια πρωτεΐνη, η οποία αν και αρχικά είχε την ίδια αλληλουχία αμινοξέων μ’ αυτή που αναμέναμε, ωστόσο από ένα σημείο και μετά η αλληλουχία των αμινοξέων ήταν διαφορετική από την αναμενόμενη. Να εξηγήσετε γιατί το ευκαρυωτικό mRNA μεταφράστηκε στο εκχύλισμα των βακτηριακών κυττάρων, καθώς και γιατί η νεοσυντιθέμενη πρωτεΐνη αρχικά ήταν όμοια με την αναμενόμενη ενώ μετά τροποποιήθηκε η αλληλουχία των αμινοξέων. Μονάδες 6

και να εξηγήσετε τις επιπτώσεις στο γονιδιακό προϊόν που οδήγησαν στην εκδήλωση της ασθένειας. (Μονάδες 6) Το άτομο που πάσχει υποβάλλεται σε γονιδιακή θεραπεία. Ποια είναι η διαδικασία που θα ακολουθηθεί; (Μονάδες 4) Μονάδες 10 Γ3. Να εξηγήσετε πόσα είδη mRNA και πόσα είδη πολυπεπτιδικών αλυσίδων παράγονται από το οπερόνιο της λακτόζης του βακτηρίου E. coli, όταν το βακτήριο αναπτύσσεται απουσία και παρουσία λακτόζης. Μονάδες 7 ΘΕΜΑ Δ Δ1. Δίνεται το παρακάτω γενεαλογικό δέντρο των μελών μιας οικογένειας όπου με μαύρο χρώμα παριστάνονται τα άτομα που πάσχουν από μια κληρονομική μονογονιδιακή ασθένεια:

Β3. Ποιοι παράγοντες μπορεί να δράσουν ως μεταλλαξογόνοι και με ποιο τρόπο τα κύτταρα αντιμετωπίζουν τις αλλαγές που εμφανίζονται από τη δράση τους; Μονάδες 5 Β4. Να περιγράψετε που θα συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος. Μονάδες 6 ΘΕΜΑ Γ Γ1. Να εξηγήσετε τι είναι ανιχνευτής και να περιγράψετε τις διαδικασίες που θα ακολουθηθούν προκειμένου ένας ανιχνευτής να υβριδοποιήσει την κατάλληλη αλληλουχία DNA από μία γονιδιωματική ή από μία βιβλιοθήκη. (Μονάδες 5) Να εξηγήσετε ποιον από τους παρακάτω ανιχνευτές θα χρησιμοποιήσετε για να υβριδοποιήσετε σε μια γονιδιωματική βιβλιοθήκη ένα γονίδιο που περιέχει στην κωδική του αλυσίδα την εξής αλληλουχία βάσεων (Μονάδες 3): 5΄...GGACTCAGATGAACATGCAGACATCGG...3΄ α. Ανιχνευτής 1: 3΄ TCAACAAATG 5΄ β. Ανιχνευτής 2: 3΄ CGAUGUCUGC 5΄ γ. Ανιχνευτής 3: 5΄ UUCAAAUGUA 3΄ δ. Ανιχνευτής 4: 5΄ CGAUGUCUGC 3΄ Μονάδες 8 Γ2. Έστω ένα γονίδιο το οποίο εκφράζεται σε κύτταρα του αιμοποιητικού συστήματος (συγκεκριμένα σε μία κατηγορία των λευκών αιμοσφαιρίων) και καθορίζει τη σύνθεση μίας πολύ σημαντικής πρωτεΐνης της πλασματικής μεμβράνης. Μετάλλαξη στο συγκεκριμένο γονίδιο προκαλεί σοβαρότατη νόσο του αιμοποιητικού συστήματος. Απομονώσαμε από ένα υγιές άτομο και από ένα άτομο που ασθενεί το mRNA που προκύπτει από τη μεταγραφή του γονιδίου. 5’ GAUCCGAUGACAAGAGGGUCCUAACCAAA 3’ (υγιές άτομο) 5’ GAUCCGAUGACAUGAGGGUCCUAACCAAA 3’ (ασθενές άτομο ) Να προσδιορίσετε το είδος της γονιδιακής μετάλλαξης

14

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Το άτομο ΙΙΙ6, που γνωρίζει ότι πάσχει από την ασθένεια, παντρεύτηκε με μια γυναίκα που δεν πάσχει. Το ζευγάρι, πριν την απόκτηση κάποιου παιδιού, απευθύνθηκε σε ένα γενετιστή για να μάθει ποια είναι η πιθανότητα να αποκτήσει παιδί που να πάσχει. Ο γενετιστής που επισκέφθηκαν τους είπε πως, αν δε συμβεί κάποια μετάλλαξη, τότε όλα τους τα παιδιά θα είναι σίγουρα υγιή. Να εξετάσετε τον τρόπο κληρονόμησης του γονιδίου που καθορίζει την έκφραση της ασθένειας και να γράψετε τους γονότυπους των ατόμων ΙΙΙ6 και ΙΙΙ7 (χωρίς να λάβετε υπόψη σας την περίπτωση μετάλλαξης). Μονάδες 12 Δ2. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση πριν προχωρήσουν στην απόκτηση απογόνων; Μονάδες 4 Δ3. Όταν η γυναίκα βρίσκεται στην 13η εβδομάδα της κύησης να περιγράψετε αναλυτικά τις διαδικασίες που θα ακολουθηθούν προκειμένου να πραγματοποιηθεί προγεννητικός έλεγχος για την ύπαρξη αριθμητικών ή δομικών χρωμοσωμικών ανωμαλιών. Μονάδες 9 Επιμέλεια: Λαζαρίδης Γιάννης, Μανιάτση Στεφανία, Καραγεωργίου Γεσθημανή Τις λύσεις των θεμάτων θα τις βρείτε στο site του φροντιστηρίου.


ΘΕΜΑΤΑ 

epikera@otenet.gr

Βιολογία Γ΄ Λυκείου Γενικής Παιδείας ΘΕΜΑ Α Α1. Στις ερωτήσεις 1-5 να γράψετε τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Το συμπλήρωμα είναι: α. κατηγορία πρωτεϊνών, που παράγονται από τα Β λεμφοκύτταρα β. μια σειρά πρωτεϊνών, που βρίσκονται στο πλάσμα και συμμετέχουν στη μη ειδική άμυνα γ. μια σειρά πρωτεϊνών που ενεργοποιούνται μόνο σε περίπτωση μόλυνσης από βακτήρια δ. κατηγορία κυττάρων που παράγουν αντισώματα Μονάδες 5 2. Η θεωρία του Λαμάρκ υποστηρίζει: α. τη φυσική επιλογή β. την αρχή της χρήσης και της αχρησίας γ. τη σταθερότητα των ειδών δ. την ομοιομορφία των οργανισμών Μονάδες 5 3. Σ’ ένα χερσαίο οικοσύστημα παρατηρούνται 3 τροφικά επίπεδα καταναλωτών. Εάν η συγκέντρωση μιας μη βιοδιασπώμενης ουσίας στους παραγωγούς είναι 5 mg / kg, τότε στους κορυφαίους καταναλωτές θα είναι: α. 50 mg / kg β. 500 mg / kg γ. 5000 mg / kg δ. 5 mg / kg

προκαλείται από την αύξηση αυτή (Μονάδες 1). Ποιες θα είναι οι περιβαλλοντικές επιπτώσεις του φαινομένου αυτού (Μονάδες 3); Μονάδες 10 Β3. Να εξηγήσετε γιατί δεν είναι πάντοτε εύκολη η κατάταξη των καταναλωτών στα τροφικά επίπεδα. Μονάδες 3 Β4. Κατά τη θεωρία της εξέλιξης μέσω της φυσικής επιλογής, ως μονάδα εξέλιξης θεωρείται ο πληθυσμός και όχι τα μεμονωμένα άτομα. Πώς δικαιολογείται η παραπάνω διαπίστωση; (Μονάδες 4) Να εξηγήσετε γιατί η θεωρία της φυσικής επιλογής είναι τοπικά και χρονικά προσδιορισμένη. (Μονάδες 3) Μονάδες 7 Θέμα Γ Γ1. Να περιγράψετε το μηχανισμό μη ειδικής άμυνας που ενεργοποιείται μόνο σε περίπτωση μόλυνσης από ιούς. Μονάδες 6 Γ2. Στο ακόλουθο τροφικό πλέγμα να βρείτε ποιοι οργανισμοί είναι παραγωγοί, ποιοι είναι καταναλωτές (και τι τάξης) και ποιοι είναι αποικοδομητές. (Μονάδες 3) Να γράψετε τις τροφικές αλυσίδες. (Μονάδες 3)

Μονάδες 5 4. Μπορούμε να έχουμε ανεστραμμένη τροφική πυραμίδα, όταν αυτή αναφέρεται: α. στον πληθυσμό β. στην ενέργεια γ. στη βιομάζα δ. σε όλες τις προηγούμενες περιπτώσεις Μονάδες 5 5. Στην καταπολέμηση ποιας από τις παρακάτω ασθένειες δε θα είχε καμία επίδραση η χορήγηση αντιβιοτικού; α. ασθένεια του ύπνου β. χολέρα γ. γονόρροια δ. κρυολόγημα Μονάδες 5 Θέμα Β Β1. Σε ποια κατηγορία νοσημάτων ανήκει η ηπατίτιδα Β και από τι είδους μικρόβιο προκαλείται; (Μονάδες 1). Με δεδομένο ότι η ηπατίτιδα μπορεί να μεταδοθεί και με τα παράγωγα του αίματος ποιες είναι οι προφυλάξεις που πρέπει να λαμβάνονται για να περιοριστεί η εξάπλωση της; (Μονάδες 4) Μονάδες 5 Β2. Τα τελευταία χρόνια υπάρχει μία τάση για βαθμιαία αύξηση της συγκέντρωσης του διοξειδίου του άνθρακα στην ατμόσφαιρα. Να περιγράψετε τους λόγους που οδηγούν στην αύξηση αυτή (Μονάδες 6). Να αναφέρετε το φαινόμενο που

ότι το φως του ήλιου μπορεί να φτάσει μέχρι τα 20 μέτρα και ότι ο κύκλος του αζώτου λειτουργεί ανάλογα στα χερσαία και στα υδάτινα οικοσυστήματα να εξηγήσετε: α) εάν το διαλυμένο στο νερό οξυγόνο είναι περισσότερο στην περιοχή 1 ή στην περιοχή 2 της λίμνης. (Μονάδες 6) β) εάν τα διαλυμένα στο νερό νιτρικά ιόντα είναι περισσότερα στην περιοχή 1 ή στην περιοχή 2 της λίμνης. (Μονάδες 6)

Μονάδες 6 Γ3. Πολλά βακτήρια απειλούν την υγεία μας μέσω ουσιών που παράγουν. Πώς ονομάζονται οι ουσίες αυτές, σε ποιες διακρίνονται και πώς βλάπτουν την υγεία μας; Μονάδες 5 Γ4. Τι ονομάζεται ομοιόσταση; (Μονάδες 2) Τι ρυθμίζουν οι ομοιοστατικοί μηχανισμοί στον ανθρώπινο οργανισμό; (Μονάδες 3) Κάθε διαταραχή της ομοιόστασης μπορεί να προκαλέσει την εκδήλωση διαφόρων ασθενειών. Σε τι μπορεί να οφείλονται οι διαταραχές αυτές; (Μονάδες 3) Μονάδες 8 Θέμα Δ 1. Το παρακάτω σχήμα αναπαριστά ένα υδάτινο οικοσύστημα και πιο συγκεκριμένα μία λίμνη. Με δεδομένο

15

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Δίνεται ότι: • η περιοχή 1εκτείνεται από την επιφάνεια μέχρι τα 20 μέτρα βάθος • η περιοχή 2 εκτείνεται από τα 20 μέτρα μέχρι τον πυθμένα • το υδάτινο οικοσύστημα βρίσκεται σε κατάσταση ισορροπίας Μονάδες 12 2. Μετά από κάποιο χρονικό διάστημα τριγύρω στη λίμνη δημιουργούνται μεγάλες εκτάσεις καλλιεργειών, στα οποίες γίνεται συστηματική χρήση λιπασμάτων. Μεγάλες ποσότητες λιπασμάτων καταλήγουν στη λίμνη παρασυρόμενες από το νερό της βροχής, διαταράσσοντας την ισορροπία του υδάτινου οικοσυστήματος. Να περιγράψετε το φαινόμενο το οποίο οδηγεί στη διαταραχή αυτή. Μονάδες 7 3. Κατά την καλλιέργεια των φυτών στους αγρούς δίπλα στη λίμνη χρησιμοποιήθηκαν μεγάλες ποσότητες μη βιοδιασπώμενου εντομοκτόνου. Από μετρήσεις που έγιναν στην περιοχή βρέθηκε μεγάλη συγκέντρωση από το συγκεκριμένο εντομοκτόνο σε πολλά από τα ψαροπούλια της λίμνης. Να εξηγήσετε το φαινόμενο. Μονάδες 6 Επιμέλεια: Λαζαρίδης Γιάννης, Μανιάτση Στεφανία, Καραγεωργίου Γεσθημανή Τις λύσεις των θεμάτων θα τις βρείτε στο site του φροντιστηρίου.


ΤΥΠΟΣ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Επιμέλεια Νικολέττα Φλιάταρη

Από τη στήλη με τίτλο «Καθημερινά»

Κυβέρνηση χρειάζεται, όχι εκλογές Αυτή τη φορά η κάλπη απέδειξε ότι ήταν πραγματικά «γκαστρωμένη», για να θυμηθούμε τη φράση του Χαρίλαου Φλωράκη. Από την πρώτη στιγμή που «γεννήθηκε» το αποτέλεσμα των εκλογών, ήταν φανερό ότι πολύ δύσκολα θα βρισκόταν λύση για τη διακυβέρνηση της χώρας και μάλιστα σε μία τόσο κρίσιμη συγκυρία, που τα χρονικά περιθώρια είναι ελάχιστα, η εξάρτηση από τους εταίρους δανειστές μέγιστη και η παραμονή στην Ευρωζώνη η μοναδική ελπίδα οικονομικής και κοινωνικής σταθερότητας. Ο λαός με την ψήφο του έδειξε ότι θέλει την παραμονή της Ελλάδας στην Ευρωζώνη, όπως ακριβώς το εξέφραζε και στις δημοσκοπήσεις. Είναι λανθασμένη η επικρατούσα άποψη ότι ψήφισε οργισμένος για να τιμωρήσει τα πρώην μεγάλα κόμματα εξουσίας. Ο Eλληνας είναι πιο πονηρός. Ψήφισε για να επιβάλει μία φαντασιακή πραγματικότητα παραμονής στην Ευρωζώνη, χωρίς όμως όρους, δεσμεύσεις και με το χρήμα να ρέει άφθονο για να διατηρηθεί το μοντέλο της ανέμελης κατανάλωσης, δίχως υποχρεώσεις. Θέλει να είναι «Eυρωπαίος» για την ετικέτα και τα οφέλη, αλλά ταυτόχρονα να διατηρήσει την «ελληνική πραγματικότητα» του οθωμανο - αραβο - βαλκανικού περιβάλλοντος που έχει δημιουργήσει και διατηρεί από τη σύσταση του νεοελληνικού κράτους. Τη συντήρηση της συλλογικής φαντασίωσης καλλιεργεί ο Αλ. Τσίπρας, απευθυνόμενος ως νέος Ανδρέας Παπανδρέου στους πραγματικούς ή δήθεν «μη προνομιούχους Eλληνες» της εποχής, παίζοντας το πολιτικό παιχνίδι με δικούς του κανόνες πλέον. Αποκλείεται να μη γνωρίζει ότι όσα λέει και πρεσβεύει οδηγούν με μαθηματική ακρίβεια στην έξοδο από την Ευρωζώνη και πιθανότατα αυτός είναι ο κρυφός στόχος του. Η φανερή επιδίωξή του είναι να κυριαρχήσει στον χώρο της αριστεράς σε πρώτη φάση, βοηθώντας ταυτόχρονα στην επανασυσπείρωση της κεντροδεξιάς για να επικρατήσει ο διπολισμός στη θέση του δικομματισμού. Αλλωστε, ο Α. Σαμαράς άδραξε την ευκαιρία και επιδιώκει και ο ίδιος κάτι τέτοιο. Που σημαίνει ότι η ελληνική κοινωνία θα πολωθεί με άγνωστες συνέπειες.

Από τη στήλη με τίτλο «Βηματοδότης»

Αλ. Τσίπρας: Οι μεγάλοι σχηματισμοί δίνουν άλλη δυναμική Το 1996, παραμονές εθνικής επετείου της 25ης Μαρτίου, έξι νέοι, επιλεγμένα τυχαίως συζήτησαν στο «Βήμα» το καυτό θέμα της «αντεπανάστασης των νέων», σ΄ ένα ρεπορτάζ που και σήμερα έχει τη σημασία του. Ανάμεσα στους νέους ήταν και ένας 21χρονος, που έμενε στους Αμπελοκήπους, φοιτητής (τότε) στο Τμήμα Πολιτικών Μηχανικών του ΕΜΠ, που πρόλαβε και έκανε ένα «πέρασμα» από την ΚΝΕ και που συμμετείχε στην ίδρυση της παράταξης «Εγκέλαδος». Το όνομα αυτού Αλέξης Τσίπρας. Πέρασαν από τότε 16 χρόνια και ο κ. Τσίπρας αποδεικνύεται ότι εξακολουθεί να έχει ακόμα τις ίδιες σκέψεις και προτάσεις για την πολιτική που είχε και το 1996! Στην ερώτηση τι συμφέρει να υπάρχουν λίγα μεγάλα κόμματα ή πολλά μικρά, ο νικητής των εκλογών της περασμένης Κυριακής λέει: «Σημασία έχει τι θέλουν να εξυπηρετήσουν τα κόμματα και όχι αν είναι πολλά ή λίγα. Θεωρώ πάντως ότι αν έχουμε έναν πολυκερματισμό κομμάτων, τα οποία όμως στο σύνολό τους δεν λένε τίποτα το διαφορετικό, δεν αλλάζει τίποτα. Θεωρώ όμως ότι αν κάποιες απόψεις είναι λί-

γο διαφορετικές μεταξύ τους και υπάρχει δυνατότητα συμμαχιών να γίνεται. Όχι, επειδή πρέπει σώνει και καλά να υπάρχουν μεγάλα κόμματα, αλλά επειδή νομίζω ότι οι πιο μεγάλοι σχηματισμοί δίνουν μια άλλη δυναμική. Αν έχεις έναν πολιτικό φορέα που εκφράζει κάποια ιδανικά, είναι υγεία». Όπως βλέπετε δεν έχει αλλάξει ιδέες από τότε ο κ. Τσίπρας, πλην ίσως την κόμμωση του, αφού τότε εμφανιζόταν με μικρή... κοτσίδα. Αλλά, ίσως τότε ποτέ δεν θα πίστευε ότι θα ηγείτο ενός συνασπισμού που θα γινόταν «μεγάλο κόμμα». και θα έστελνε επιστολές στους μεγάλους της Ευρώπης... Ο «Πανίκας» από τη Θεσσαλονίκη ετοιμάζεται (πάλι) για να δημιουργήσει δικό του κόμμα, παρά τον τηλεοπτικό εναγκαλισμό που είχε με τον κ. Κ. Καραμανλή, την περασμένη Κυριακή. Άλλωστε έτοιμος ήταν να ανακοινώσει το κόμμα του πριν από τις εκλογές, αλλά ο κ. Παν. Ψωμιάδης την τελευταία στιγμή έκανε πίσω. Τώρα όμως, με τις εξελίξεις για την πανστρατιά, ποιος αλήθεια μπορεί να τον συγκρατήσει; Είπε λοιπόν ο κ. Ψωμιάδης: « Δεν σας κρύβω ότι πριν την δημοσιοποίηση της ίδρυσης Δικτύου ΠΑΤΡΙ.Δ.Α» ήμουν έτοιμος να ανακοινώσω κόμμα. Όμως τη συγκεκριμένη στιγμή αποφάσισα να μην προχωρήσω. Αλλά η κοινωνία δείχνει τον δρόμο. Οι πολιτικές εξελίξεις θα οδηγήσουν την απόφασή μου...» Στο νέο κόμμα λέει μάλλον ναι ο «Πανίκας», πλην όμως στο μυαλό του έχει πάντοτε τον κ. Καραμανλή λέγοντας για άλλη μία φορά ότι «το κεφάλαιο Καραμανλή δεν έκλεισε. Αλλά δεν έχει έρθει ακόμη η ώρα του Καραμανλή...».

Η γελοιογραφία της ημέρας

Από τη στήλη με τίτλο «Καλά τώρα»

Οι οίκοι... οίκοι Να επιστρέψουμε λιγάκι στην σκληρή καθημερινότητα, γιατί να σας πω την αλήθεια το βαρέθηκα αυτό με τους πολιτικούς. Αφού είτε έτσι, είτε αλλιώς, θα πληρώσω. Αλλα είναι τα επείγοντα. Θυμάστε εκείνο με τις οροθετικές ιερόδουλες; Το AIDS ντε. To λέω γιατί κάποιοι νομίζουν ότι μετά τις εκλογές, θεραπεύτηκαν. Καθόλου. Εχουμε φτάσει στις 31 οροθετικές. Και από τους 100 πελάτες που εξετάστηκαν, οι 5 βρέθηκαν θετικοί. Οι οποίοι μπορεί να έχουν ήδη μεταδώσει τον ιό σε άλλους. Από τους 350 περίπου οίκους ανοχής στην Αθήνα, έχουν ελεγχθεί μόνο 36. Για την υπόλοιπη Ελλάδα κουβέντα. Λες κι εμείς οι υπόλοιποι δεν έχουμε πουτάνες. Α βέβαια. Οι δικές μας, δηλαδή των υπόλοιπων, είναι μια χαρά. Μετά θα μας έρθει η τρομάρα. Αυτοί δε οι οίκοι των Αθηνών είναι στην πλειοψηφία τους παράνομοι. Ναι, αλλά δεν κλείνεις ένα μπουρδέλο σε προεκλογική περίοδο διότι θα σου εναντιωθεί ο πελάτης. Είδατε τι λένε για τον ακατονόμαστο. Εχει οίκο. Πας εκεί, πηδάς, εκτονώνεσαι, ψηφίζεις. Εναν τόλμησαν να κλείσουν, άνοιξε ξανά τιμή και δόξα. Εκεί είχε βρεθεί η πρώτη οροθετική. Ψιλά γράμματα. Αφού λένε να εντοιχίσουν επιγραφή. «Εδώ βρέθηκε η πρώτη με AIDS». Μεγάλη τιμή για τον οίκο. Είναι βλέπετε μπερδεμένες οι Αρχές. Είναι και πολλές. Οι Αρχές. Κι όταν ανακατεύονται πολλές Αρχές το αποτέλεσμα είναι...

16

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

Από το Έθνος αρχή διά νόμου. Ο νόμος πάνω απ’ όλα. Να πάει το Υγειονομικό, να εμπλακεί ο Δήμος, να πάρει τηλέφωνο το Αστυνομικό Τμήμα την τσατσά, να πάρει τηλέφωνο η τσατσά τον προστάτη, να λείπει στη Μόσχα ο προστάτης, μετά να πάρει τηλέφωνο ο ιδιοκτήτης του σπιτιού συνάδελφό του πολιτικό... είναι πολλά, τι να λέμε τώρα. Στο κάτω - κάτω ανάπτυξη δεν θέλαμε; Εχουμε ανάπτυξη στο AIDS. Πληρώνεις, πηδάς, τελείωσες.

Από τη στήλη με τίτλο «Γραφικότητες»

Να δουν τι ψήφισαν! Καθώς η διαδικασία των διερευνητικών εντολών πλησιάζει στο τέλος της, αυξάνεται ο προβληματισμός για τη συνάντηση των πολιτικών αρχηγών υπό τον Πρόεδρο της Δημοκρατίας, κυρίως λόγω των δυσκολιών που δημιουργεί το ενδεχόμενο της παρουσίας του αρχηγού της Χρυσής Αυγής. Παρά τις αρχικές σκέψεις που υπήρξαν (καθώς με μια ακραία διασταλτική ερμηνεία του άρθρου 37 παρ. 3 του Συντάγματος δεν επιβάλλεται η πρόσκληση όλων των αρχηγών), τελικά κρίνεται ότι και πολιτικά δεν είναι φρόνιμο να δοθεί επιχείρημα στον Ν. Μιχαλολιάκο να κάνει φασαρία για τον «αποκλεισμό» του. Εξάλλου, οι εμπειρίες των τελευταίων εβδομάδων έδειξαν ότι είναι απολύτως χρήσιμο οι πολίτες να βλέπουν ποιον και τι ψήφισαν... Εν τω μεταξύ, έξω από τα δόντια μίλησε ο υπουργός Εσωτερικών Τ. Γιαννίτσης για την εκπροσώπηση φιλοναζιστικών δυνάμεων στη Βουλή, σε δήλωσή του με την ευκαιρία της επετείου λήξης του Β’ Παγκοσμίου Πολέμου. «Είναι σημαντικό ότι μπορούμε να τιμάμε σήμερα τη μνήμη της λήξης του Β’ Παγκοσμίου Πολέμου και των εκατοντάδων χιλιάδων θυμάτων του στην Ελλάδα και των εκατομμυρίων θυμάτων του στην Ευρώπη», υπογράμμισε ο υπουργός Εσωτερικών. «Τσακίστηκε τότε ο ναζισμός», πρόσθεσε και εξέφρασε την ελπίδα να μη ζήσουμε «την ειρωνεία της Ιστορίας», την ανάδειξη στο μέλλον παρόμοιων φαινομένων στη χώρα μας. Να κηρυχτεί εκτός νόμου η Χρυσή Αυγή, όπως έχει συμβεί και με το ναζιστικό κόμμα στη Γερμανία, ζήτησε ο Γ. Μπουτάρης, σε διπλή παρέμβασή του χθες στη Θεσσαλονίκη, με αφορμή την είσοδο του ακραίου ναζιστικού κόμματος στη Βουλή.


ΣΤΗΛΗ ΙΑΤΡΩΝ



epikera@otenet.gr

ΧΡΗΣΙΜΑ ΤΗΛΕΦΩΝΑ ΙΑΤΡΩΝ ΝΟΜΟΥ ΗΜΑΘΙΑΣ Πέτρος Ι. Σαρρηγιαννίδης Ορθοπαιδικός Χειρουργός Αθλητίατρος

Προφήτου Ηλία 15 - 3ος όροφος (πεζόδρομος Αγοράς) - Βέροια, 59 100 τηλ. ιατρείου: 23310 21545 - κινητό: 6973 887429

e-mail:doctorpetros@gmail.com www.ortho-veria.gr

Γιαννούτσου Σταυρούλα Ψυχοθεραπεία - Συμβουλευτική

3Δέχεται ραντεβού καθημερινά Ελιάς 11, Βέροια

1 όροφος ος

Τηλ.: 2331076300 - 6937.331.846

e-mail: stavroulagiannoutsou@gmail.com

Μπαλατσινού Λουκία Ιατρός Αλλεργιολόγος 3 Αλλεργική ρινίτιδα 3 Αλλεργικό βρογχικό άσθμα 3 Τροφική και Φαρμακευτική αλλεργία 3 Ατοπικό έκζεμα 3 Δερματίτιδα εξ επαφής 3 Αλλεργία σε σφήκα/μέλισσα

ΔΕΡΜΑΤΙΚΑ ΤΕΣΤ ΚΑΙ ΑΝΟΣΟΘΕΡΑΠΕΙΑ

ΛΑΦΑΖΑΝΗΣ Π. ΓΕΩΡΓΙΟΣ ΕΙΔΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ

ΣΥΓΧΡΟΝΟ ΚΑΡΔΙΟΛΟΓΙΚΟ ΕΡΓΑΣΤΗΡΙΟ

Σύμβαση με Ταμεία: - Στρατιωτικών - Τμήμα Συγκοινωνιών

Τηλ. Για ραντεβού: 23310 76061

Βενιζέλου 26, 3ος όροφος Βέροια

Μ. Καρακωστή 16, Βέροια e-mail:lucybalatsinou@yahoo.gr

Τηλ: 2331300212 - 6975858211

ΒΑΧΤΣΕΒΑΝΟΥ ΘΕΟΔΩΡΑ ΙΑΤΡΟΣ ΜΙΚΡΟΒΙΟΛΟΓΟΣ ΒΙΟΠΑΘΟΛΟΓΟΣ l Δέχεται και με ραντεβού Δέχεται & με ραντεβού

Βενιζέλου 31 Βέροια (2ος όροφος)

e-mail: dr.george.lafazanis@gmail.com

ΚΩΝΣΤΑΝΤΙΝΟΣ ΕΜ. ΣΑΛΙΑΓΚΑΣ ΧΕΙΡΟΥΡΓΟΣ

τ. Δ/ντής Χειρουργικής Κλινικής Νοσοκομείου Κοζάνης

Κλασική Λαπαροσκοπική Χειρουργική Δέχεται καθημερινά

Πρωί: 9 - 1 Δευτέρα έως Παρασκευή Απόγευμα: 6 - 8 καθημερινά εκτός Τετάρτης & Παρασκευής

Τηλέφωνο: 2331120313 Αντ. Καμάρα 1 Βέροια (πεζόδρομος ΟΤΕ) Φαξ: 2331120314 Κινητό: 6973550713 Τηλ - Fax: 2331071851 Κιν.: 6944523104 e-mail: vahteo@gmail.com

e-mail: kos.saliagas@gmail.com

Αντώνιος Π. Τσιτλακίδης ΦΩΤΟΠΟΥΛΟΥ Θ. ΠΑΡΑΣΚΕΥΗ Ψυχολόγος

Παιδίατρος

Πτυχιούχος Αριστοτελείου Πανεπιστημίου Θεσσαλονίκης

l

ραντεβού

MSc Kλινικής Ψυχολογίας

Universita degli Studi di Parma - Italia l l

Μ. Αλεξάνδρου 27 (2ος όρ.), Βέροια Τηλ: 2331063155 - Κιν. 6946936704 e-mail: anttsit@gmail.com

ΩΡΑΡΙΟ ΙΑΤΡΕΙΟΥ

Συμβουλευτική ενηλίκων, εφήβων, παιδιών Συμβουλευτική επαγγελματικού προσανατολισμού

Δέχεται με ραντεβού

Δέχεται με και χωρίς

9:00 - 13:00 π.μ., 17:30 - 20:30 μ.μ.

Αριστοτέλους 2 (Βενιζέλου γωνία) Βέροια - 3ος όροφος

Τηλ & Fax: 2331071740 - Κιν. 6932707255 e-mail: vivi_veria@yahoo.gr

3 Συμβουλευτική (ατομική, ζευγαριών, γονέων, φροντιστών ασθενών με νόσο Alzheimer) 3 Συμβουλευτική Επαγγελματικού Προσανατολισμού 3 Οργάνωση χρόνου μελέτης (μαθητές-φοιτητές) 3 Αξιολόγηση προβλημάτων μνήμης, προσοχής και προσανατολισμού

Δέχεται με ραντεβού Προφήτη Ηλία 15 (2ος όροφος) Βέροια τηλ. 23310 60883, Κιν. 6945 929810

e-mail: alexiastergiou@yahoo.gr

Φαρμακεία

Ημέρα Από-Έως Φαρμακείο Παρασκευή 13:30-17:30 ΠΟΡΦΥΡΗ ΑΝΝΑ ΚΑΡΑΤΑΣΟΥ 19 (κοντά στο 6ο Δημοτικό σχολείο) Παρασκευή 21:00-01:00 + διαν. ΤΣΑΚΝΑΚΟΠΟΥΛΟΥ ΦΩΤΕΙΝΗ ΒΕΝΙΖΕΛΟΥ 30 Σάββατο 08:00-14:30 Σ Ι Μ ΟΥ Μ Ι Μ Ι Κ Α ΚΑΠΠΟΥ 4 (πεζόδρομος αγοράς) Σάββατο 08:00-14:30 ΖΕΡΗΣ ΓΕΩΡΓΙΟΣ ΚΟΝΙΤΣΗΣ 15 ΚΑΙ ΕΜΜ. ΖΑΧΟΥ ΓΩΝΙΑ (περ. ΚΤΕΛ) Σάββατο 08:00-14:30 ΧΑΤΖΗΓΕΩΡΓΙΟΥ ΑΝΔΡΕΑΣ ΤΡΕΜΠΕΣΙΝΑΣ 6 (πλατεία αστικών,δίπλ. στα ΚΤΕΛ) Σάββατο 14:30-20:30 ΠΑΠΑΔΟΠΟΥΛΟΥ ΒΑΣΙΛΙΚΗ ΒΕΡΜΙΟΥ 10 (παρ. ζαχαροπλαστείου ΕΛΙΤ) Σάββατο 18:00-01:00 + διαν. ΦΟΥΚΑΛΑΣ ΑΡΓΥΡΗΣ ΜΗΤΡΟΠΟΛΕΩΣ 65 ΚΑΙ ΒΕΝΙΖΕΛΟΥ

www.epikeranews.gr

17

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

SUDOKU

Σαν σήμερα... 1916: γεννιέται ο Μίλτον Μπάμπιτ, Αμερικανός συνθέτης της ηλεκτρονικής μουσικής.

αναλαμβάνει καθήκοντα πρωθυπουργού, μετά τον εξαναγκασμό σε παραίτηση του Νέβιλ Τσαμπερλέιν.

1920: στη Νέα Υόρκη, το Σοσιαλιστικό Εργατικό Κόμμα εκλέγει τον Γ.Γ. Κοξ ως πρόεδρο και τον Α. Τζιλχάουζ ως αντιπρόεδρο.

1941: απαγορεύονται στην Ελλάδα οι προβολές αγγλικών και αμερικανικών ταινιών, ενώ ζητείται η παράδοση των ραδιοφωνικών πομπών.

1924: ο Έντγκαρ Χούβερ γίνεται επικεφαλής του FBI.

1942: ο ;Aξονας αναστέλλει τις επιθέσεις κατά της Μάλτας μετά από αρκετές βδομάδες και 11.000 απώλειες.

1933: η Παραγουάη κηρύσσει επίσημα τον πόλεμο κατά της Βολιβίας 1933: στη Γερμανία, οι Ναζιστές επιβάλλουν λογοκρισία, ρίχνοντας στη φωτιά χιλιάδες βιβλία. 1938: γεννιέται ο Ρώσος συνθέτης Μαξίμ Σοστακόβιτς. 1939: στην Ελλάδα, σημειώνονται σοβαρά επεισόδια από πολίτες εναντίον της Αγγλοαμερικανικής Τράπεζας, η οποία κήρυξε πτώχευση. 1940: στη Βρετανία, ο Ουίνστον Τσόρτσιλ

τα

1943: στην Αλάσκα, αμερικανικές δυνάμεις κάνουν απόβαση στις Αλεούτιες Νήσους, τις οποίες κατέχει από τον Ιούνιο του 1942 η Ιαπωνία. 1947: ψηφίζεται από την αμερικανική Βουλή το σχέδιο Τρούμαν για την παροχή οικονομικής βοήθειας προς την Ελλάδα.

1957: γεννιέται ο μπασίστας των «Sex Pistols», Σιντ Βίσιους. 1959: ολοκληρώνεται η επίσκεψη του πρωθυπουργού Κωνσταντίνου Καραμανλή και του υπουργού Εξωτερικών Ευάγγελου Αβέρωφ στην Τουρκία, σε επισφράγιση της προσέγγισης, που επήλθε μεταξύ των δύο χωρών μετά την υπογραφή των επί του Κυπριακού, Συμφωνιών. 1960: γεννιέται ο τραγουδιστής του συγκροτήματος U2, Μπόνο. 1962: ο Αμερικανός Πρόεδρος Τζον Κένεντι διατάζει πλοία και 1.800 πεζοναύτες να αντεπιτεθούν στην Ινδοκίνα. 1965: γεννιέται ένα από τα πιο διάσημα μοντέλα του κόσμου, η Λίντα Εβαγγελίστα.

1955: γεννιέται ο δολοφόνος του Τζον Λένον, Μαρκ Ντέιβιντ Τσάπμαν.

1969: στο πλαίσιο του πολέμου στο Βιετνάμ, ξεκινά αμερικανική επιχείρηση με την ονομασία «Χιόνι των Απάτσι».

1955: εισάγεται το πάγιο τέλος σε λογαριασμούς ΟΤΕ, ΔΕΗ και ΟΥΛΕΝ.

1971: η Γαλλία χαλαρώνει τους όρους για την είσοδο της Βρετανίας στην ΕΟΚ.

1972: στη Σαϊγκόν, ενώ οι ΗΠΑ συνεχίζουν το βομβαρδισμό στο βορρά, ο Θιέου επιβάλει στρατιωτικό νόμο. 1977: πεθαίνει η Αμερικανίδα ηθοποιός Τζόαν Κρόφορντ. 1979: οι Ομόσπονδες Πολιτείες της Μικρονησίας γίνονται αυτοδιοικούμενες. 1979: στο Σαν Σαλβαδόρ, 24 άτομα σκοτώνονται όταν η αστυνομία ανοίγει πυρ εναντίον διαδηλωτών. 1980: αναστατώνεται η Αθήνα από εκρήξεις 18 αυτοσχέδιων βομβών. 1985: πεθαίνει ο Τσέστερ Γκουλτν, «πατέρας» του γνωστού καρτούν Ντικ Τρέισι. 1989: ελεύθερος για λόγους υγείας και υπό βαρείς όρους αφήνεται ο Γιώργος Λούβαρης, ο οποίος κατηγορείται για ανάμιξη στο σκάνδαλο Κοσκωτά. 1992: στον Καναδά, 11 ανθρακωρύχοι σκοτώνονται από έκρηξη σε ορυχείο της Νέας Σκοτίας.

μιλούν Κριος

Μπορείς να βάλεις στόχους και να τους πετύχεις. Οι δυνατότητες που έχεις είναι πάρα πολλές. Για σήμερα θα σε συμβούλευα να έχεις καλύτερη και πιο ποιοτική επικοινωνία με τον περίγυρό σου, ώστε να μπορέσεις δρομολογήσεις κάποιους στόχους σου. Η διάθεσή σου θα είναι πολύ καλή και η δυναμικότητά σου θα καταπλήξει τους γύρω σου.

Λεων

Η είσοδος του Ερμή στον Ταύρο θα τονίσει τον επαγγελματικό σας τομέα για τις επόμενες δυο εβδομάδες, όπου θα δώσει την ευκαιρία για διάφορες επαφές, γνωριμίες, συζητήσεις κι επιτυχημένες συμφωνίες, σε καλό κλίμα. Σήμερα ωστόσο, οι δύσκολες όψεις της Σελήνης προκαλούν ένταση κι εμπόδια στον εργασιακό χώρο.

Τοξοτης

Η αλλαγή ζωδίου του Ερμή από σήμερα, δραστηριοποιεί τον εργασιακό σας οίκο, κι έτσι για ένα δεκαπενθήμερο θα έχετε την ευκαιρία για επαφές, συζητήσεις και επιτυχημένες συμφωνίες, σε θετικό κλίμα. Επίσης τονίζει θέματα υγείας, κι έτσι είναι περίοδος για τσεκ-απ, για μια νέα δίαιτα.

Ταυροσ

Σήμερα εισέρχεται ο επικοινωνιακός Ερμής στο ζώδιό σας, ο οποίος μέχρι τις 24/5 που θα καθίσει θα φέρει την ευκαιρία για γνωριμίες, συζητήσεις, πολλές ιδέες, θετικές συμφωνίες, αρκετές μετακινήσεις, ενώ η ζωή σας αποκτά ευχάριστη κινητικότητα. Ο νους σας δυναμώνει.

Παρθενος

Θετική για το ζώδιό σας η διέλευση του Ερμή απ’ τον Ταύρο από σήμερα και για ένα δεκαπενθήμερο, η οποία θα τονώσει το νου και την επικοινωνιακή σας ικανότητα. Καλή εποχή για σπουδές, διάβασμα, εξετάσεις, γράψιμο κλπ. Ταυτόχρονα, θα δώσει την ευκαιρία για ταξίδια ή επαφές με το εξωτερικό.

Αιγοκερως

Ευνοεί το ζώδιό σας η διέλευση του επικοινωνιακού Ερμή απ’ τον Ταύρο για ένα δεκαπενθήμερο, ο οποίος θα φέρει κοινωνικότητα, χαρά, δημιουργικότητα, πολύ φλερτ και ερωτικές γνωριμίες. Ελαφραίνει η διάθεση, ωστόσο σήμερα η Σελήνη απ’ το ζώδιό σας σχηματίζει δύσκολες όψεις.

18

ΔΙΔΥΜΟΙ

Με τη διέλευση του Ερμή απ’ τον τελευταίο σας οίκο για ένα δεκαπενθήμερο, θα έχετε την ευκαιρία να κλείσετε με επιτυχία ορισμένα ζητήματα, γραφειοκρατικά, σπιτιού, ακινήτων και άλλα. Επίσης ίσως υπάρχει λίγη περισσότερη ανάγκη για ύπνο κι απομόνωση, ενώ προσέξτε τα όνειρά σας.

Ζυγος

Η αλλαγή ζωδίου του Ερμή σάς βάζει σε κάπως πιο εσωστρεφή και λιγότερο κοινωνική φάση για το επόμενο δεκαπενθήμερο. Θα τονίσει ζητήματα οικονομικά, όπου μπορεί να κάνετε επιτυχημένες οικονομικές συμφωνίες, αγορές, πωλήσεις, επενδύσεις κλπ.

Υδροχοος

Σήμερα αλλάζει ζώδιο ο Ερμής, ενώ θα δώσει έμφαση σε θέματα σπιτιού και οικογένειας για τις επόμενες δυο εβδομάδες. Ιδανική περίοδος για μετακομίσεις, ανακαινίσεις, ενοικιάσεις, επισκευές, και για συμφωνίες ή επαφές σε σχέση με ακίνητα. Το σπίτι σας αποκτά ζωή.

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

ΚΑΡΚΙΝΟΣ

Η αλλαγή ζωδίου του Ερμή θα δραστηριοποιήσει τον οίκο της φιλίας και της δικτύωσης για ένα δεκαπενθήμερο, όπου θα έχετε την ευκαιρία για νέες γνωριμίες και για επαφή με ομάδες και συλλόγους. Πολλές συζητήσεις κι επαφές και μέσα απ’ τα online social media.

Σκορπιος

Σε μια κοινωνική περίοδο σάς βάζει η είσοδος του Ερμή στον Ταύρο, ο οποίος για ένα δεκαπενθήμερο θα φέρει την ευκαιρία για ερωτικές γνωριμίες, για συζητήσεις, συμφωνίες και νέες συνεργασίες, και για πολύ socializing. Βγαίνετε απ’ το καβούκι σας και γνωρίζετε νέους και ευχάριστους ανθρώπους που σάς μαθαίνουν πολλά.

ΙΧΘΕΙΣ

Η είσοδος του Ερμή στον Ταύρο βάζει το ζώδιό σας σε μια επικοινωνιακή περίοδο. Έτσι για ένα δεκαπενθήμερο θα έχετε την ευκαιρία για γνωριμίες, επαφές, ιδέες, συζητήσεις, βόλτες και πολλές μετακινήσεις, ίσως και αγορά οχήματος. Επίσης δίνει θετική έμφαση σε μαθήματα, σεμινάρια, εξετάσεις.


αγγελιεσ 

epikera@otenet.gr

ΜΙΚΡΕΣ

Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα Επικαιρα Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΕΝΟΙΚΙΑΣΕΙΣ Ενοικιαζεται διαμέρισμα στο κέντρο της Βέροιας. Επιπλωμένο, με κεντρική θέρμανση, air-condition & τζάκι. Τιμή 250 ευρώ. Τηλ.: 23310 25308 ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα απέναντι από το γήπεδο Βέροιας Σταδίου 35, 80 τ.μ, δωμάτιο, σαλόνι, κουζίνα, ασανσέρ. Τηλ. Επικοινωνίας: 23310-21204 Ενοικιάζεται διαμέρισμα στη Θεσσαλονίκη 45 τ.μ, πλήρως ανακαινισμένο, 2ος όροφος.Τηλ: 6942595995 Ενοικιάζεται κατάστημα 50 τ.μ με υπόγειο πατάρι, WC, δίπλα στο Επιμελητήριο Βέροιας. ΤΗΛ: 2331061594 ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα στη Θεσ/νίκη 75 τ.μ. για φοιτητές κοντά στα πανεπιστήμια. τηλ: 2331023804, κιν: 6972834596 ΕΝΟΙΚΙΑΖΕΤΑΙ: 2ος όροφος, γκαρσονιέρα 1Δ.Κ.ΜΠ. Τιμή: 250,00 € Τηλ.: 693.246.6.6333 ΕΝΟΙΚΙΑΖΕΤΑΙΔιαμέρισμα στην Καλλιθέα 100τμ, Σ, Κ, 2Δ, WC, 2Ος όροφος (ευκαιριακό ενοίκιο) Τηλ. Επικοινωνίας: 6946491573

100 τ.μ. αποθήκη. Mε αυλή και κήπο σε χαμηλή τιμή. Στον Περιφερειακό έναντι μάρκετ METRO. Πληροφορίες απογευματινές ώρες και Σαββατοκύριακο. Κυρία Σοφία. Τηλ: 6987028122 (what’s up) 2310601916 Ενοικιάζεται διαμέρισμα 90 τ.μ. περιοχή Πασακιόσκι 2Δ, Σαλοτραπεζαρία, μπάνιο, parking. Ανακαινισμένο, οικονομ. ενοίκιο, θέρμανση με ωρομετρητή. Τηλ: 6981646898. Κυρ. Μαρία ΕΝΟΙΚΙΑΖΕΤΑΙ γωνιακό διαμέρισμα στη Βέροια επί της Οδού Ολύμπου αριθ. 2, δεύτερος όροφος, πάνω από 70 τ.μ/ ΣΚ2Δ, ατομικό καλοριφέρ. Τιμή 200 ευρώ. Τηλ. Επικοινωνίας: 6943671469

Ενοικιάζεται κατάστημα 40 τ.μ. με πατάρι στην Αλεξάνδρεια στο κέντρο έναντι Κτελ. Σε πολύ καλή κατάσταση και οικονομικό ενοίκιο. Τηλ: 2331061174 Κιν: 6972986414 Κυρ. Λίτσα

ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα 90 τ.μ. κοντά στο ΙΚΑ Βέροιας. Μεσιτικό γραφείο: 6974747117

Ενοικιάζεται διαμέρισμα στο Μακροχώρι, 100 τ.μ., 2Δ,Σ,Κ,ΜΠΑ, αποθήκη. Επάνω στον κεντρικό δρόμο. 1ος όροφος με αυτόνομη θέρμανση. Τιμή 230 ευρώ. Τηλ.: 6976968274

Ενοικιάζεται διαμέρισμα 80 τ.μ. στον Πρ. Ηλία. 1ος όροφος, διαμπερές, χωρίς πολλά κοινόχρηστα, Aircondition. 2 δωμάτια – σαλόνι – κουζίνα (καθημερινό). Τηλ: 6984535358, 2331065386

ΕΝΟΙΚΙΑΖΕΤΑΙ γκαρσονιέρα καινούργια, επιπλωμένη, ένα δωμάτιο, WC, κουζίνα 28 τ.μ. με θέα σε πάρκο, περιοχή Μπότσαρη Θεσ/νίκης. Κατάλληλο για φοιτητές ή ειδικευμένο γιατρό. Πληροφορίες στο τηλ. 6944 529650.

Ενοικιάζεται διαμέρισμα ρετιρέ με απεριόριστη θέα και σε πολύ καλή κατάσταση. 100 τ.μ, θέρμανση με ορομετρητή. Τηλ:2331070926, 6946098247

Ενοικιάζεται γκαρσονιέρα επιπλωμένη στο Ρολόι. Τηλ: 2331070926,6946098247 Ενοικιάζεται γκαρσονιέρα επιπλωμένη στην Καλλιθέα, καινούρια, θέρμανση με ορομετρητή. Τηλ:2331070926, 6946098247 Ενοικιάζεται διαμέρισμα 85 τ.μ με ατομική θέρμανση, στον 3ο όροφο στην Οδό Σοφίας 50, στο δρόμο προς το Νοσοκομείο.Τηλ: 23310-29457, 27406 ΕΝΟΙΚΙΑΖΕΤΑΙ για επαγγελματική χρήση χωραφοοικόπεδο δύο στρεμμάτων στην περιοχή της λαχαναγοράς Βεροίας (πιο κάτω από τα Λύκεια). Πληροφορίες στα τηλ: 23310 29416 και 69773919 06. Ενοικιάζεται γκαρσονιέρα στην Πλατεία Ωρολογίου 45 τ.μ Ανακαινισμένη, τιμή προσιτή. Τηλ: 6975900184 κυρ. Κατερίνα Ενοικιάζεται κατάστημα 100τ.μ. στη διεύθυνση Καλής Παναγιάς 12.Τηλ επικοινωνίας: 23310 23765 ΕΝΟΙΚΙΑΖΟΝΤΑΙ ΤΡΙΑ ΚΑΤΑΣΤΗΜΑΤΑ 70 τ.μ. το καθένα με 5,30 μ. ύψος με δυνατότητα ένωσις των δύο επί της οδού Καλής Παναγίας 13. Βρίσκονται πάνω στον καινούργιο διαπλατυσμένο δρόμο Πολύ καλή ευκαιρία. τηλ.6947120444 τηλ.οικίας.2331024091 ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα 50 τμ 1 Δ,Σ,Κ,WC, με αυτόνομη θέρμανση αέριο, περιοχή Ιπποκράτειο στη Θεσσαλονίκη. Πληρ. τηλ. 6945293775 Ενοικιάζεται μονοκατοικία 100 τ.μ. και

Ενοικιάζεται Γκαρσονιέρα 35 τ.μ. στο κέντρο, οδός Ανοίξεως 9, 1ος όροφος, ανακαινισμένη και επιπλωμένη, 1 δωμ., κουζίνα, WC. Τιμή: 170 ευρώ. Τηλ.: 6975906112 - 6975906111 Ενοικιάζεται γκαρσονιέρα 32 τ.μ. στην Κυριώτισσα, 2ος όροφος, δωμ., κουζ., σε καλή κατάσταση. Τιμή ενοικίου ευκαιρία. Κιν.: 6942892320

ΕΝΟΙΚΙΑΖΕΤΑΙ Οικόπεδο στη Νέα Περιφερειακή Οδό, δύο στρέμματα, περιφραγμένο με κεντρική είσοδο μπροστά στην άσφαλτο δίπλα από την ΕΚΟ. Τηλ:2331027683 κ. Σταύρος

ΕΝΟΙΚΙΑΖΕΤΑΙ Κατάστημα καινούργιο 100τ.μ. στην οδό Καλής Παναγιάς 12. Τιμή 250€. Τηλ. 23310-23765

Ενοικιάζεται κατάστημα 100τ.μ. στη διεύθυνση Καλής Παναγιάς 12.Τηλ επικοινωνίας: 23310 23765

ΕΝΟΙΚΙΑΖΕΤΑΙ Στη Θεσ/νίκη γκαρσονιέρα ρετιρέ, κοντά στα ΚΤΕΛ Μακεδονία (2Δ,Σ,Κ,WC) θέρμανση με ωρομετρητή, πάρκιγνκ. Τιμή 300 €. Τηλ. 2332023001 και 6979521178.

ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα στη Θεσσαλονίκη στον 6ο όροφο με 2 δωμάτια, κουζίνα, μπάνιο, ατομική θέρμανση φυσικού αερίου, ντουλάπες, τέντες, μπόιλερ, κλιματισμό, ψυγείο, ηλεκτρική κουζίνα και θωρακισμένη πόρτα. Το διαμέρισμα βρίσκεται στην Πλατεία Ιπποδρομείου 17(πλησίον Ναυαρίνου). Τηλ.επικοινωνίας: 23310-61739 και 6948004677

ΕΝΟΙΚΙΑΖΕΤΑΙ Γραφείο ανακαινισμένο Βενιζέλου 27, 35 τ.μ, 2 Δ, WC,κλιματιστικό Τηλ. Επικοινωνίας: 6978244410

ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα 34 τ.μ. πλήρως εξοπλισμένη και ανακαινισμένη με κεντρική θέρμανση, στο κέντρο. τηλ: 2331024302 και 6945669786

ΕΝΟΙΚΙΑΖΕΤΑι μικρό διαμέρισμα (στούντιο) στο κέντρο του Παρισιού για την περίοδο από 13 Ιουλίου έως 17 Αυγούστου. Είναι πλήρως επιπλωμένο, διαθέτει Internet και δωρεάν τηλεφωνική σύνδεση με 100 χώρες του κόσμου. Η τιμή για όλη την περίοδο είναι 800 Ε και για μια εβδομάδα 270 Ε. Πληρ. τηλ. 2351028346 ή 0033183961077 και 0033634302582

βεστιάριο, στην οδό Ζωγιοπούλου 5 (Δημοτική Βιβλιοθήκη) στον Α’ όροφο 150 τ.μ.. Τιμή ευκαιρίας. Πληροφορίες τηλ.: 6970665558, 6944670719 και 2331060331. Μπορεί να γίνει και κατοικία.

ΕΝΟΙΚΙΑΖΕΤΑΙ Οροφοδιαμέρισμα, φρεσκοασπρισμένο, ηλιόλουστο και ευάερο με πανοραμική θέα. Βρίσκεται μέσα στην Έδεσσα (Πλατεία Γρανικού), 70 τ.μ., 3ος όροφος με αυτόνομη θέρμανση και ΧΩΡΙΣ κοινόχρηστα. Τιμή 200,00 €. Πληροφορίες στα τηλέφωνα : 23810 27222, 698 9625905. *Κατάλληλο και για ΦΟΙΤΗΤΕΣ.

Ενοικιάζεται διαμέρισμα 70 τ.μ. 1ος όροφος, ατομική θέρμανση και Air-condition. Υπ. Σαλ. Κουζίνα, wc. Εξωτερικές πόρτες αλουμινίου. Στο κέντρο της Αλεξάνδρειας έναντι Κτελ. Τηλ: 6972153508 Κυρ. Γιώτα

ΕΝΟΙΚΙΑΖΕΤΑΙ Στη Θεσ/νίκη - Πανεπιστήμια στούντιο επιπλωμένο 4 ετών 280 ευρώ. Τηλέφωνο επικοινωνίας 6977233555 και 2331023222.

για ΠΑΡΚΙΝΓΚ - Ηλεκτρικά Ρολλά Ασφαλείας - Έτοιμη Φωτεινή Επιγραφή στην Είσοδο ) τηλ. 2331073363 6974474691

Ενοικιάζεται γκαρσονιέρα 52 τ.μ. περιοχή Πασα κιοσκι. Οδός Προύσσης 25, 1ος όροφος, κεντρική θέρμανση. Τηλ: 6936522740 ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα επιπλωμένη στο κέντρο της Βέροιας. Τηλ. 23310 70926 – 6946098247. ΕΝΟΙΚΙΑΖΕΤΑΙ: γκαρσονιέρα 1Δ.Κ.ΜΠ. ανακαινισμένη Τιμή: 280,00 € Τηλ.:693.246.6.633 Ενοικιάζεται στο Μακροχώρι διαμέρισμα 1ος όροφος επάνω στον κεντρικό δρόμο δίπλα στα παλιά ΚΕΠ. 100 τ.μ. ΣΚ2Δ ΜΠ Αποθήκη 250 ευρώ. Τηλ: 2331020531 - 6976968274 Ενοικιάζεται επαγγελματικός χώρος με άδεια φροντιστηρίου έτοιμος για λειτουργία στο κέντρο της πόλης. Τηλέφωνο επικοινωνίας :6988074096 Διαμέρισμα ενοικιάζεται στη Θεσσαλονίκη, Σ. 2Δ.Κ. ΜΠ, 1Ος όροφος για δύο φοιτητές/τριες ή εργαζόμενους, σε καλή κατάσταση και καλή τιμή. Οδός Μπαλταδώρου 3, περιοχή Βενιζέλου. Τηλ. 2310 82090323310 64643- 6982943869 ΕΝΟΙΚΙΑΖΕΤΑΙ Η ΠΩΛΕΙΤΑΙ Κατάστημα Θεσ/ νίκης 43, 100τ.μ. και υπόγειο 100 τ.μ. τηλ: 2331029321

ΕΝΟΙΚΙΑΖΟΝΤΑΙ 2 διαμερίσματα 106 τ.μ. και 80 τ.μ. (Καλιθέα), επιπλωμένα ή όχι. τηλ: 2331070926 και 2331062347, κιν: 6946098247 και 6943697645 Eνοικιάζονται και πωλούνται στο Μακροχώρι Αριστοτέλους 123 (κεντρικό – γωνία) γραφεία Τηλ. 6988141980 κ. Αντώνης ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα επαγγελματικός χώρος Μ. Μπότσαρη (πρώην Φροντιστήρια Καράμπελα – Σαμαρά). Κιν. 6972848470.

Ενοικιάζεται: Διαμέρισμα στο κέντρο, σε καλή κατάσταση, 60 τ.μ., με μπαλκόνια, 1 δωμάτιο, 1 σαλοτραπεζαρία, 1 κουζίνα, wc, σε πολύ καλή τιμή. Περιοχή πίσω από το Δημαρχείο. Κιν: 6974095988 Κυρ. Βέτα Ενοικιάζεται: Μικρό διαμέρισμα 2 δωμάτια, σαλοτραπεζαρία, κουζίνα, μπάνιο 55 τ.μ. Αυτόνομη θέρμανση με ωρομετρητή στην Μητροπόλεως (απέναντι από τον Βερόπουλο) στη Βέροια. Πληροφορίες τηλ. 2331060331, 6970665558, 6944670719, με πολύ οικονομικό ενοίκιο. Ενοικιάζεται επαγγελματικός χώρος 450 τ.μ. στην κεντρική οδό της Μελίκης. Τηλ. 6979790757

Αναλαμβάνουμε Διανομές & παραδόσεις εντός πόλης

Ελλάδα Εξωτερικό

16ης Οκτωβρίου 2 Βέροια Τηλ. 2331024624 - 73730 Fax: 2331076210 www.cityexpress.gr

Ενοικιάζεται διαμέρισμα στον Προμηθέα, Τραπεζούντος 34, 2ος όροφος, 2 δωμ., σαλοκουζ., τουαλέτα και μπάνιο, φαρδιά βεράντα, αποθήκη στο υπόγειο. Ενοικιάζεται γραφείο (2 χώροι) Βεροής 1 (πλ. Ωρολογίου), 1ος όροφος. Κ. Κώστας 2331066909 - 6948751731 ΕΝΟΙΚΙΑΖΕΤΑΙ στο ΜΑΚΡΟΧΩΡΙ ( 50 μ. μετά την Εκκλησία του Τιμίου Προδρόμου - στον Κεντρικό δρόμο προς ΔΙΑΒΑΤΟ ) ΝΕΟΚΤΙΣΤΟ - ΕΞΑΙΡΕΤΙΚΗΣ ΚΑΤΑΣΚΕΥΗΣ Κατάστημα 75 τ.μ. που συνδέεται με ΑΣΑΝΣΕΡ μεταφοράς εμπορευμάτων με το ΥΠΟΓΕΙΟ περίπου 100 τ.μ.- (προαύλιος χώρος

19

ΕΥΚΑΙΡΙΑ στην

πατριδα

Ενοικιάζεται κατάστημα 100τ.μ. στη διεύθυνση Καλής Παναγιάς 12.Τηλ επικοινωνίας: 23310 23765

Ενοικιάζεται κατάστημα 200 τ.μ. με 200 τ.μ. υπόγειο, εσωτερική σκάλα και ανεξάρτητες εισόδους στην Πατρίδα έναντι κοινότητας κατάλληλο για βιοτεχνία - εργαστήριο - αποθήκη.

Ενοικιάζεται 170 τ.μ. μαγαζί με 180 τ.μ. υπόγειο και αυλή, καινούριο, άριστης κατασκευής, επάνω στην Αριστοτέλους. Κ. Αντώνης. Τηλ.: 6944833396

Τηλ..: 6974.357.937 Κυρ. Κώστας

ENOIKIAZETAI διαμέρισμα στη Θεσσαλονίκη (επί της Μαρτίου), 2 δωμάτια, σαλόνι, αποθήκη, WC. Πληροφορίες τηλ. 6944945165

Ενοικιάζεται Μονοκατοικία στη Βέροια. 100 τ.μ., με κήπο, κοντά στην Opel (Περιφερειακός Βέροιας). 330 ευρώ, τιμή συζητήσιμη. Κα. Σοφία. Τηλ.: 6987028122 2310601916 Ενοικιάζεται διαμέρισμα 90 τ.μ. Κρόνου 3 (Πιερίων). Σαλόνι, 2 υπνοδ/τια, κουζίνα μεγάλη, χολ, μπάνιο, ατομική θέρμανση. Οικονομική τιμή. Τηλ.: 2331025160 Ενοικιαζεται κατάστημα 45 τ.μ., Μαλακούση 1 κατάλληλο για επαγγελματικό χώρο. Τηλ. Πληρ.: 2331024109 Ενοικιάζεται Επαγγελματικός χώρος ενιαίος δυνάμενος να χωρισθεί με δύο τουαλέτες, κουζίνα,

Ενοικιάζεται διαμέρισμα σε πολύ καλή κατάσταση, με πολύ θέα, πολύ μεγάλο μπαλκόνι, 108 τ.μ., 2Δ, 1 Σαλοκουζίνα, WC. Αυτόνομη θέρμανση στον 3ο όροφο. Καζαντζάκη 3.

Τηλ..: 2331026672 - 2331028492 Κυρ. Χρήστος

ΠΩΛΗΣΕΙΣ

ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα 50 τ.μ. Πλουτάρχου 20. τηλ: 2331065187 ΕΝΟΙΚΙΑΖΕΤΑΙ γκαρσονιέρα 35τ.μ κοντά στο Δημαρχείο. Έχει σαλοδωμάτιο, κουζίνα, χωλ, w.c .Λίγα κοινόχρηστα, τιμή προσιτή. Τηλ. 2331070853 & 6974297043

Ενοικιάζεται κατάστημα στο κέντρο της αγοράς, Κεντρικής 120, 42 τ.μ., ισόγειο, 42 τ.μ. πατάρι με όψη σε 2 δρόμους. Πληρ. Τηλ.: 6937106652

ΠΩΛΕΙΤΑΙ καντίνα πλήρης εξοπλισμένη, περασμένη ΚΤΕΟ και υγειονομικό, σε τιμή ευκαιρίας. Πληροφορίες στο τηλ. 6995845825 κ. Γιώργο. ΠΩΛΟΥΝΤΑΙ σε 4,5 στρ. μπροστά στην θάλασσα στην αμμώδη Παραλία Κορινού Πιερίας συγκρότημα 6 ανεξάρτητων διόρωφων κατοικιών. Κάθε κατοικία είναι 85 τμ σε κήπο 500 μέτρων. Παραδίδονται στα τούβλα ή τελειωμένες. Πληρ. τηλ. 23510 47497, 6976 760579, 6944 865855 ΠΩΛΕΙΤΑΙ μονοκατοικία μεζονέτα σε οικόπεδο 470 τ.μ. στη Μελίκη. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ οικόπεδο 280 τ.μ. στη Σωζόπολη Χαλκιδικής. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ διαμέρισμα ημιυπόγειο 80 τ.μ. στο κέντρο της Βέροιας. Μεσιτικό γραφείο: 6974747117 Πωλείται ΙΣΟΓΕΙΟ κεντρικό κατάστημα επί της Κεντρικής 68 τ.μ. προσιτή τιμή (ευκαιρία). Τηλ. 6977332084 Πωλείται παντοπωλείο λόγω συνταξιοδότησης. Τηλ. 2331067760 Πωλείται: Τροχόσπιτο μάρκας Fendt εισαγωγής σε πολύ καλή κατάσταση και σε πολύ καλή τιμή, χρώμα άσπρο 7,5 μέτρα με διπλό άξονα. Τηλ: 23310212046946779366 & με όλα τα αξεσουάρ. Πωλούνται:. Σύνθετο στυλ αντίκα . Σαλόνι 3-2-1 με τραπεζάκι, κρεβατοκάμαρα με 2 κομοδίνα, Συρταριέρα κομπλέ Όλα σε τιμή ευκαιρίας λόγω αναχώρησης στο εξωτερικό. Τηλ: 2331121148, 6976665497 κ. Κώστας Ευκαιρία - Πωλείται Μηχανή Kawasaki Z.X.R. Χρώμα πράσινο-άσπρο, μοντέλο 98-99 750 c.c. 130 ίπποι, σε πολύ καλή κατάσταση, έχει γίνει service. Δεκτός κάθε έλεγχος. Κιν.: 6980933545 Πωλείται ταξί Avensis και η άδεια, μοντέλο 2004, με έδρα την Αλεξάνδρεια. Σε τιμή ευκαιρίας. Τηλ.:

ΕΥΚΑΙΡΙΑ Πωλείται

Επαγγελματικός εξοπλισμός πιτσαρίας κ μεμονωμένα. Ελαφρώς μεταχειρισμένα και σε καλή κατάσταση.

Τηλ. πλ.: 6982.655.665

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

6973460481 Πωλείται ROVER 214 S1, 1400 cc, 105 άλογα, τιμή 1300 ευρώ (συζητήσιμη). Βαλάντης. Τηλ.: 6973460481

ΕΥΚΑΙΡΙΑ Πωλείται

Σαλόνι σε άριστη κατάσταση τεμ. τριθέσιο-διθέσιο. Μπρεζέρα σκαμπό τραπεζάκι κρύσταλλο με μεγάλα μαξιλάρια και δώρο το φωτιστικό. Ευκαιρία όλο το σετ. Μόνο 900 ευρώ. Κατοικία στο Πλατύ Ημαθίας σε οικόπεδο 180 τ.μ. με αυτόνομη θέρμανση, με πρόσοψη στον πεζόδρομο, σε πολύ καλή κατάσταση, ο όροφος 70 τ.μ., ισόγειο 70 τ.μ. (είναι κατάστημα με αποθηκευτικό χώρο). ΕΥΚΑΙΡΙΑ. Μόνο 70.000 ευρώ.

Τηλ. πλ.: 28213004676956029637 Κυρ. Μάγρα

ΕΥΚΑΙΡΙΑ Πωλείται 120 τ.μ. στο κέντρο κοντά στη Μητρόπολη, με ατομική θέρμανση, σε πολύ καλή κατάσταση, χωρίς κοινόχρηστα, στον 4ο όροφο, διαμπερές, 2 υπνοδ/τια, 2 μπάνια, σαλοκουζ., σαλοτραπεζ., αποθηκευτικός χώρος. (Τιμή ευκαιρίας) Μόνο 70.000 ευρώ Τηλ.: 2331028644 Κιν.: 6976320394 Κα. Έφη


αγγελιεσ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

ΜΙΚΡΕΣ Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα

Επικαιρα

Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr ΖΗΤΗΣΗ ΕΡΓΑΣΙΑΣ

Βοηθός λογιστή / υπάλληλος γραφείου με 4 ετή εμπειρία σε λογιστικές υπηρεσίες,πολύ καλή γνώση Η/Υ, κάτοχος διπλώματος, με εκπληρωμένες στρατιωτικές υποχρεώσεις ζητάει εργασία. Τηλ.6983149358 κ. Αλέξανδρος Νοσοκόμα αναλαμβάνει τη φύλαξη ηλικιωμένων πρωινές ώρες.Τηλ:6987347068 Οδηγός με δίπλωμα Β,Γ και Ε κατηγορίας, με προϋπηρεσία στο χώρο, ζητά εργασία. Τηλ:2331028798, 6984594045 Κ. Σάκης Κυρία πωλήτρια με εμπειρία στο χώρο ζητά εργασία σε λαική αγορά, πρατήρια άρτου, φούρνους ή ζαχαροπλαστεία Τηλ: 2331028798, 6984594045 Κ. Ευγενία Καθηγήτρια, πτυχιούχος της Γαλλικής Γλώσσας και Φιλολογίας του Αριστοτελείου Πανεπιστημίου Θεσσαλονίκης, παραδίδει ιδιαίτερα μαθήματα γαλλικών σε μαθητές όλων των επιπέδων. Παράλληλα μπορεί να αναλάβει την καθημερινή προετοιμασία των μαθητών δημοτικού σε όλα τα σχολικά τους μαθήματα. Τιμές προσιτές. Τηλ. Επικοινωνίας: 6979911364 καθηγήτρια πτυχιούχος ελληνικής φιλολογίας του Α.Π.Θ.

παραδίδει ιδιαίτερα μαθήματα σε μαθητές γυμνάσιου και λυκείου σε προσιτές τιμές. τηλ. επικοινωνίας 6973504555 κα Χριστίνα ΚΑΘΗΓΗΤΡΙΑ Αγγλικών του Α.Π.Θ. παραδίδει ιδιαίτερα μαθήματα όλων των επιπέδων. Τιμές προσιτές. Τηλ. 6972021231 Καθηγήτρια Πληροφορικής παραδίδει μαθήματα σε μαθητές Λυκείου, ΕΠΑΛ, ESDL & Μαθηματικά ΓυμνασίουΔημοτικού. Πληρ. Κιν: 6944582057. Κυρ. Τασούλα. Όλη μέρα Αναλαμβάνουμε καθαρισμό γραφείων, κήπων και καθαρισμό σκαλών και λοιπών χώρων. Τηλ. 6982751266 Κυρία αναλαμβάνει φύλαξη ηλικιωμένων. Τηλ. 6982751266 Κυρία Ελληνίδα Ζητάει εργασία με προϋπηρεσία στο χώρο της φύλαξης με φροντίδα σε ηλικιωμένα άτομα, και στην καθαριότητα σε χώρους όπως γραφεία-οικίες-Δημ. χώρουςΣούπερ μάρκετ. Τηλ.: 6980136042 Κυρ. Αλεξάνδρα. Μαθηματικός παραδίδει ιδιαίτερα μαθήματα σε μαθητές Γυμνασίου και Λυκείου. Τηλ.: 6945439505 Τεχνίτης: γκρεμίσματα, χτισίματα, σοβάδες,

ζητουνται συνεργατεσ Από την εφημερίδα

Επικαιρα

ΤΗΣ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ ζητούνται άτομα Για εργασία στο χώρο στο τμήμα Συνδρομητών του Ν. Ημαθίας & των Δημόσιων Σχέσεων Αμοιβή & ωράριο πολύ καλό. Τηλ. επ.: 6977372775, Κυρ. Κυριάκος

ελαιοχρωματισμούς και κάθε είδους τεχνική εργασία στις καλύτερες τιμές της αγοράς. Μέχρι 50% έκπτωση. Τηλ. 6939435435, Κυρ. Στέφανος Μαθηματικοσ με πτυχίο Braille παραδίδει ιδιαίτερα μαθήματα σε μαθητές με τύφλωση. Τηλ. 6993273011 ΑΝΑΛΑΜΒΑΝΩ κάθε είδους οικοδομικά μερεμέτια και διαρρυθμίσεις οικιών και καταστημάτων, έλληνας τεχνίτης. Κιν. 6945974197. ΖΗΤΕΙ ΕΡΓΑΣΙΑ Κύριος τίμιος σοβαρός, μη καπνιστής, ελεύθερος, με πολυετή πείρα σε διανομές-πωλήσεις και EX-VANσε τρόφιμα κ.α., σε Αθήνα-επαρχίανησιά. Δυνατότητα ταξιδιών και διαμονής παντού ζητεί εργασία. Είναι αυτοασφάλιστος. Τηλ. 6970954486 Κυρία, Ελληνίδα, έμπειρη ΖΗΤΑ ΕΡΓΑΣΙΑ για καθορισμό σπιτιών, γραφείων κ.λ.π. Αναλαμβάνει επίσης τη φροντίδα ηλικιωμένων. Επικοινωνία στο τηλ. 6945 975452 κ. Βάσω. Κυρία Ελληνίδα αποκλειστική νοσοκόμα αναλαμβάνει τη φροντίδα ηλικιωμένων με προϋπηρεσία στο χώρο (κάνει και ενέσεις). Ή πρωί ή βράδυ για φύλαξη. Κιν: 6937670106 Τηλ: 2331075093 Κυρ. Σοφία Καθηγήτρια φιλόλογος παραδίδει ιδιαίτερα μαθήματα σε μαθητές Δημοτικού – Γυμνάσιου και Λυκείου. Τιμές προσιτές. Τηλ. επικοινωνίας 6984063563 Τελειόφοιτος του Τμήματος Μαθηματικού Ιωαννίνων παραδίδει μαθήματα σε παιδιά Δημοτικού, Γυμνασίου, Λυκείου. Τιμές λογικές. Τηλ επικ: 6955540910. email: klio55349@yahoo.gr ΖΗΤΕΙ ΕΡΓΑΣΙΑ κυρία με προϋπηρεσία στο χώρο της φροντίδας ηλικιωμένων και της φύλαξης μικρών παιδιών, ζητά εργασία. Μόνο σοβαρές προτάσεις. Τηλ: 6976665497 κ. Μιχαέλα. ΖΗΤΕΙ ΕΡΓΑΣΙΑ οδηγός επαγγελματίας με προϋπηρεσία στο χώρο και με δίπλωμα 5ης κατηγορίας, ζητά εργασία σε οποιοδήποτε τομέα. Τηλ:2331121148 κ. Κώστας Κάτοχος Proficiency (CEF C2) και με παρακολούθηση σεμιναρίων εκπαίδευσης καθηγητών παραδίδει κατ’ οίκον μαθήματα Αγγλικών σε παιδιά δημοτικού και γυμνασίου. Άριστη επικοινωνία με τα παιδιά. Τιμές πολύ προσιτές. Τηλ: 6986002875 Ώρες επικοινωνίας: μετά τις 11 πμ Ελληνίδα Κυρία ζητάει εργασία στη φύλαξη ηλικωμένων ατόμων, τη μέρα ή τη νύχτα. Τηλ. 6972345625. Κυρ. Παναγιώτα

Έλληνας συνταξιούχος ζητάει εργασία ως κηπουρός, οξυγονοκολλητής και παντώς τύπου εργασίες. Τηλ.: 2331063664 - 6986871225. Κυρ. Δημήτρης Κυρία Ελληνίδα με πείρα αναλαμβάνει καθαρισμό σπιτιών, γραφείων και δημοσίων χώρων. Κα. Αναστασία. Τηλ.: 6947813460 Κοπελα με μεγάλη εμπειρία και χωρισ υποχρεωσεισ ΑΝΑΛΑΒΑΝΕΙ καθαρισμό σπιτιών και επαγγελματικών χώρων. Τηλ.: 6972688217 ΚΥΡΙΑ με μεγάλη εμπειρία ζητά εργασία για καθαρισμό σπιτιών - γραφείων κ.λ.π. Επίσης φροντίζει και ηλικιωμένους. Ωράριο ελεύθερο. Κιν. 6973917652, κα Γιάννα. ΟΔΗΓΟΣ Με Γ’ κατηγορία δίπλωμα με γνώση Γερμανικών και Αγγλικών, ψάχνει εργασία. Κιν. 6934798786. Καθηγήτρια με εμπειρία παραδίδει ιδιαίτερα μαθήματα σε παιδιά δημοτικού σε πολύ χαμηλές τιμές. Πληροφορίες στο τηλ: 6973292661 ΠΤΥΧΙΟΥΧΟΣ με 20ετη εμπειρία στο χώρο του Marketing και των Πωλήσεων σε επιχειρήσεις της Αθήνας. στο χώρο της διαφήμισης και του επισιτισμού, με άριστη γνώση αγγλικής και Η/Υ. αναζητά εργασία στο νομό Ημαθίας ή στην ευρύτερη περιοχή. ΤΗΛ.6940848513 Λογίστρια με 10ετή εμπειρία στο χώρο και κάτοχος Επαγγελματικής άδειας τάξης Γ’, καλή γνώση Η/Υ και λογιστικών προγραμμάτων Singular ζητά εργασία. Πληρ. Κ. Ελένη Τηλ. 6984887501 Καθηγήτρια πτυχιούχος Αγγλικού πανεπιστημίου με πείρα και μεταδοτικότητα παραδίδει ιδιαίτερα μαθήματα. Τιμές προσιτές. Τηλ: 6971715721 μετά τις 10 π.μ Μαθηματικός απόφοιτος Πανεπιστημίου Ιωαννίνων παραδίδει ιδιαίτερα μαθήματα σε μαθητές Γυμνασίου και Λυκείου. Τιμές προσιτές & συζητήσιμες. Τηλ: 6974756055 Καθηγήτρια, φιλόλογος, πτυχιούχος της Ελληνικής Φιλολογίας του Αριστοτελείου Πανεπιστημίου Θεσσαλονίκης με μεταπτυχιακές σπουδές στη Νεοελληνική Φιλολογία (Α.Π.Θ.) παραδίδει μαθήματα σε μαθητές γυμνασίου και λυκείου. Τιμές προσιτές. Τηλ. 6977985328 ΒΙΒΛΙΟΔΕΤΡΙΑ επαγγελματίας ζητάει εργασία (τυπογραφεία) σε βιβλιοδετεία, εργαστήρια, εκδοτικούς οίκους. Κιν.6993033111. Νηπιαγωγός, απόφοιτη του Αριστοτέλειου Πανεπιστήμιου Θεσσαλονίκης, με πεντάχρονη υπηρεσία σε νηπιαγωγείο και παιδικό σταθμό, αναλαμβάνει τη φύλαξη παιδιών και παραδίδει

Χαρίζονται κουτάβια Χαρίζονται δυο αρσενικά καθαρόαιμα γερμανικά τσομπανόσκυλα, τεσσάρων μηνών περίπου, προστατευόμενα από ζωόφιλη. Θα γίνουν μεσαίου μεγέθους, είναι κατάλληλα για φύλακες και πολύ καλή συντροφιά για παιδάκια. Επίσης, ένα αρσενικό κοκόνι, κατάλληλο για μέσα στο σπίτι ή για αυλή και δύο κυνηγετικά σκυλιά, αρσενικό και θηλυκό, έτοιμα για οικογένεια. Το μόνο που ζητάνε τα κουτάβια είναι ένα σπιτάκι και πολύ αγάπη.Τηλ. επικ.: 6943-671469

20

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

μαθήματα σε παιδιά δημοτικού. Τηλ:2331070428, 6987755089 Φιλόλογος παραδίδει ιδιαίτερα μαθήματα σε μαθητές Δημοτικού, Γυμνασίου & Λυκείου με υπευθυνότητα και μεταδοτικότητα για κάλυψη κενών και προετοιμασία μαθημάτων. Παρέχεται δωρεάν εκπαιδευτικό υλικό. Τηλ. 6984784195 ΒΡΕΦΟΝΗΠΙΟΚΟΜΟΣ Τ.Ε.Ι. με εμπειρία σε ιδιωτικό και δημόσιο παιδικό σταθμό αναλαμβάνει την φύλαξη, ψυχαγωγία και διαπαιδαγώγηση βρεφών και παιδιών, καθώς και το διάβασμα τους στις τάξεις του δημοτικού. Τηλέφωνο επικοινωνίας : 6979540515. καθηγήτρια φιλοσοφίας - παιδαγωγικής- ψυχολογίας (ειδ. μαθησιακές δυσκολίες) με πολυετή εμπειρία, αναλαμβάνει την μελέτη μαθητών δημοτικού, γυμνάσιου, λυκείου. οργανωμένες σημειώσεις. προσιτές τιμές. τηλ. 2331074034 κιν. 6945362637 Κυρία Ελληνίδα αναλαμβάνει τον καθαρισμό οικιών - γραφείων - σκάλες και σούπερμαρκετ. Τηλ: όλη μέρα 6986619334 Κυρ. Κυριακή Ζητάω εργασία σε φορτηγό κατηγ. Γ & Ε. Εμπειρία και γνώση στο οδικό δίκτυο πανελλαδικά. Κυρ. Δημήτρης, Τηλ: 6932377561 Φιλόλογος Πτυχιούχος Δ.Π.Θ. με ειδίκευση στην Κλασική Φιλολογία παραδίδει ιδιαίτερα μαθή,ατα σε προσιτές τιμές. Τηλ: 2331066491 - Κιν. 6936409970 Καθηγήτρια Αγγλικών απόφοιτος Α.Π.Θ. με διδακτική εμπειρία σε όλα τα επίπεδα παραδίδει ιδιαίτερα μαθήματα. Τιμές προσιτές. Τηλ.: 6984066130 Μαθηματικός απόφοιτη του Α.Π.Θ. παραδίδει ιδιαίτερα μαθήματα μαθηματικών, φυσικής και χημείας σε μαθητές δημοτικού, γυμνασίου και λυκείου. Τιμές προσιτές. Τηλ. 6978003217 Φυσικός παραδίδει ιδαίτερα μαθήματα Φυσική, Μαθηματικά, Χημεία σε μαθητές ΓυμνασίουΛυκείου. Τιμές προσιτές. Κιν: 6976859403. Κυρ. Θεόδωρος Κοπελα με μεγάλη εμπειρία και χωρισ υποχρεωσεισ ΑΝΑΛΑΒΑΝΕΙ την φροντίδα παιδιών. Τηλ.: 6972688217 Καθηγήτρια Φιλόλογος με φροντιστηριακή πείρα, παραδίδει ιδιαίτερα

μαθήματα σε μαθητές Γυμνασίου και Λυκείου. Τιμές προσιτές. Τηλ: 6938473201 κ. Κική Αναλαμβάνω μεταφράσεις κειμένων, εργασιών, βιβλίων κ.λπ από Αγγλικά σε Ελληνικά και από Ελληνικά σε Αγγλικά. Γνώση εξειδικευμένων ορολογιών. Επίσης αναλαμβάνω τη σύνταξη εργασιών (πτυχιακών κλπ) και διορθώσεις κειμένων στα Ελληνικά και στα Αγγλικά Τιμές εξαιρετικά προσιτές, κ. Απόστολος τηλ. 6943879175 Εργατοτεχνίτης με εργασία στους ελαιοχρωματισμούς, σοβάδες, χτισίματα, γκρεμίσματα, σε πολύ καλές τιμές μέχρι 50% έκπτωση. Τηλ. καθημερ. 6939435435, Κυρ. Στέφανος Κυρία αναλαμβάνει εργασία επιδιόρθωσης ρούχων , με εμπειρία, μόνο απογευματινές ώρες. κ. Κική. Τηλ: 6979691599 Ζήτηση εργασίας Ζητώ δουλειά ως οδηγός ή πωλητής. Κατέχω Επαγγελματικό Δίπλωμα Γ΄ Κατηγορίας, εμπειρία και άριστες γνώσεις του οδικού δικτύου. κ.Χρήστος: 6974325285 Πτυχιούχος: Αγγλικής Φιλολογίας του Α.Π.Θ. παραδίδει ιδιαίτερα μαθήματα σε παιδιά δημοτικού και Γυμνασίου ή εργασία σε φροντιστήριο. Τιμές προσιτές. Τηλ: 6949689191. Κυρ. Χρύσα Κυρία Ελληνίδα Ζητάει εργασία στη φύλαξη ηλικιωμένων, μέρα ή νύχτα με πρωί παρέα στο χώρο. Κυρία Τούλα. Τηλ.: 2331039504 Ζήτηση Εργασίας Ζητάω δουλεία ως καθαρίστρια. Μπορώ να καθαρίζω σπίτια, σκάλες, γραφεία και επαγγελματικούς χώρους. Τηλ. επικοινωνίας: 6979260569 Κυρία με άμεση ανάγκη για εργασία στο χώρο της καθαριότητας σε οικίες, σιδέρωμα και ότι έχει σχέση σε αυτό. Κιν. 6977641489. Κυρ. Πόπη Ζευγάρι αναλαμβάνει τη φύλαξη ηλικιωμένων ατόμων. Τιμή λογική. Τηλ: 6944294123. Κυρ. Μαρία, όλη μέρα

ΧΑΘΗΚΕ ΘΗΛΥΚΟΣ ΓΕΡΜΑΝΙΚΟΣ ΠΟΙΜΕΝΙΚΟΣ 9ΕΤΩΝ ΑΚΟΥΕΙ ΣΤΟ ΟΝΟΜΑ ΕΡΗ ΚΑΙ ΦΟΡΑΕΙ ΤΣΙΠΑΚΙ. ΕΧΕΙ ΠΡΟΒΛΗΜΑ ΣΤΑ ΠΙΣΩ ΠΟΔΙΑ ΚΑΙ ΦΟΡΑΕΙ ΑΛΥΣΙΔΑ.ΤΗΛ. ΕΠΙΚΟΙΝΩΝΙΑΣ 6936905045

ΓΡΑΦΕΙΟ ΤΕΛΕΤΩΝ ΒΕΡΟΙΑΣ ΣΤΕΦΑΝΙΑ - ΣΤΟΛΙΣΜΟΙ ΜΝΗΜΟΣΥΝΩΝ

ΕΥΑΓΓΕΛΟΣ ΚΟΥΡΕΑΣ Αναλαμβάνουμε την τελετή του αγαπημένου σας προσώπου με σεβασμό - εξυπηρέτηση ποιότητα και ΟΙΚΟΝΟΜΙΑ. Μεταφορές των προσφιλών σας σε όλη την Ελλάδα και από εξωτερικό. Λειτουργούμε όλο το 24ωρο και με ανοιχτή γραμμή ΒΟΗΘΕΙΑΣ.

ΚΕΝΤΡΙΚΗΣ 153 - ΒΕΡΟΙΑ ΤΗΛ. 23310 74222, ΚΙΝ. 6947934834, 6932 464356


αγγελιεσ 

epikera@otenet.gr

ΜΙΚΡΕΣ

Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα Επικαιρα Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΠΡΟΣΦΟΡΑ ΕΡΓΑΣΙΑΣ Γνωστή Κατασκευαστική Εταιρία με έδρα τη Βέροια-Ημαθίας, ζητά εξωτερικούς συνεργάτες-πωλητές. Αποστολή Βιογραφικών Σημειωμάτων στα: 23310.73080 (Fax) ή archikatt@ gmail.com (e-mail) κ’ Γνωστή Κατασκευαστική Εταιρία με έδρα τη Βέροια-Ημαθίας, ζητά ηλεκτρολόγους με εμπειρία στις εγκαταστάσεις φωτοβολταϊκών συστημάτων. Αποστολή Βιογραφικών Σημειωμάτων στα: 23310.73080 (Fax) ή archikatt@gmail.com (e-mail) ΖΗΤΟΥΝΤΑΙ ΑΤΟΜΑ ΓΙΑ ΕΡΓΑΣΙΑ ΣΕ ΣΟΥΒΛΑΤΖΙΔΙΚΟ ΜΕ ΠΡΟΫΠΗΡΕΣΙΑ. ΠΛΗΡ. 6932235034, 2351025252: Φώντα (εστιατόριο αχινός) Zητείται κοπέλα για εργασία σε καφετέρια. Να γνωρίζει την εργασία του σέρβις. Τηλ. Πληρ: 6936631657 Ζητούνται συνεργάτες για εταιρεία

ΠΩΛΗΣΕΙΣ

ΠΩΛΕΙΤΑΙ

ΜΕΓΑΛΗ ΕΥΚΑΙΡΙΑ Διαμέρισμα σε πολύ καλή κατάσταση περιοχή Κυριώτισσα, ισόγειο, 93 τ.μ. Τιμή ευκαιρία λόγω ανάγκης. 2Δ, 1Σ, 1Κ με τραπεζαρία, WC & αποθήκη.

Τηλ..: 23310 21200 Κιν.: 6972.334.319 ΠΩΛΕΙΤΑΙ Οικία 100 τ.μ. στον τρίλοφο, μονοκατοικία, 3 ετών καινούρια με 2 οικόπεδα 600 τ.μ. ατομική θέρμανση. τηλ:2331093480, κιν: 6979939697 ΠΩΛΕΙΤΑΙ ΕΞΟΠΛΙΣΜΟΣ fast food (2 μηνών) κομπλέ, τύπου Goody’s πολυτελειας μαζί με παγωτομηχανή. Τηλ: 6984152882 ΠΩΛΕΙΤΑΙ Επιχείρηση Κέντρο Αισθητικής Spa στο κέντρο της Βέροιας, προσφάτως πλήρως ανακαινισμένη. Τηλ. επικοινωνίας 2331070117 από 20.00μ.μ. έως 22.00μ.μ Πωλείται οικόπεδο στην Οδό Καλή Παναγιά 380 τ.μ σύνολο οικοδομήσιμο σε καλή τοποθεσία Τιμή Ευκαιρίας Τηλ:2331023765 ΠΩΛΕΙΤΑΙ διαμέρισμα ανακαινισμένο στη Θεσσαλονίκη κοντά στα Πανεπιστήμια απέναντι από τη Ροτόντα. Διαθέτει δύο δωμάτια, σαλόνι, κουζίνα, WC. Τιμή 95.000 Ε. Πληρ. τηλ. 6979 985665, 6972 823840 ΠΩΛΕΙΤΑΙ Διαμέρισμα 75 τ.μ. Μανδυλάρα 43 στη Βέροια, 2ος όροφος. τηλ: 6940006656 Πωλείται οικόπεδο 240τ.μ. το οποίο περιλαμβάνει οίκημα εντός, στην διεύθυνση Ετεοκλή 6 – Βέροια. Τηλ επικοινωνίας: 23310 23765 ΠΩΛΕΙΤΑΙ Οικόπεδο άρτιο και οικοδομήσιμο 375τμ στην Αλεξάνδρεια Ημαθίας, στους Αμπελότοπους με 15μ πρόσοψη επί της οδού Δυτικής Μακεδονίας. Τηλέφωνο: 693 29 811 29 Πωλείται 2όροφη μονοκατοικία στο Κάτω Μακροχώρι από 115 τ.μ. ο όροφος, σε 500 τ.μ. οικόπεδο. 3 υπνοδ/τια, μπάνιο, σαλοτραπεζ. μεγάλη. Πωλείται ταμειακή μηχανή σε καλή τιμή. Πωλείται μηχάνημα ελέγχου πλαστών χαρτονομισμάτων. Τιμή 40 ευρώ. Πωλουνται ξύλινα ράφια σε πολύ οικονομική τιμή.

Τηλ.: 6982751266

παροχής υπηρεσιών που δραστηριοποιείται σε αποκλειστικά είδη προώθησης δικτύου (Γερμανικά προϊόντα Aloe-Vera). Κέρδη ικανοποιητικά. Τηλ: 6972378742. Κυρ. Κυριάκος Πολυεθνική με 15ετή παρουσία στην Ελλάδα και 50ετή στην παγκόσμια αγορά που δραστηριοποιείται στο χώρο του μάρκετινγκ πολλαπλών επιπέδων προωθώντας οικολογικά προϊόντα άριστης ποιότητας, αναζητά άτομα δραστήρια και προσφέρει εργασία με ευέλικτο ωράριο και πολύ ικανοποιητικές αμοιβές. Τηλ.: 6973531150 What’s Up: 6984740195 Από Όμιλο Φροντιστηρίων ζητούνται για συνεργασία στην περιοχή σας: α) Άτομα δραστήρια για δημιουργία και διαχείριση Φροντιστηρίων και β) Καθηγήτριες Ξένων Γλωσσών. Τηλ: 2310-827106 fax: 2310819424 e-mail: alsschools@yahoo.com ΖΗΤΕΙΤΑΙ ΟΔΗΓΟΣ ΤΑΞΙ ΜΕ ΕΙΔΙΚΗ ΑΔΕΙΑ ΤΗΛ.2331071553-6936905045

ΠΩΛΕΙΤΑΙ Τσιμισκή με Γούναρη στη Θεσ/νίκη διαμέρισμα 145 τ.μ. 2Δ, Σ, ΣΚ, αποθήκη, μπάνιο, WC, 3ος όροφος, κατάλληλο και για επαγγελματική στέγη. τηλ: 2310222777 και 2392052883 ΠΩΛΕΙΤΑΙ SCONTA FABIA Χρώμα μαύρο, μοντέλο 2004 1400 κυβικά. Σχεδόν καινούριο, κάθε έλεγχος δεκτός Τηλ:6977262582 κυρ. Γιάννης ΠΩΛΕΙΤΑΙ Οικόπεδο στα Ριζώματα και δομήσιμο. Τηλ:6944546553 Πωλείται ή ενοικιάζεται διαμέρισμα στην περιοχή Προμηθέα με θέα και ατομική θέρμανση. Τηλ. Επικοινωνίας 23310 259056972842070 ΠΩΛΕΙΤΑΙ διαμέρισμα 93 τ.μ. στο (κέντρο) πολύ καλό. Τιμή 90.000 ευρώ. Μεσιτικό γραφείο: 6974747117

ΖΗΤΕΙΤΑΙ ΗΛΕΚΤΡΟΝΙΚΟΣ ΚΑΙ ΜΗΧΑΝΙΚΟΣ ΑΥΤΟΚΙΝΗΤΩΝ ΤΗΛ 2331071553-6936905045 Ζητείται μηχανικός αυτοκινήτων με άδεια ασκήσεως επαγγέλματος για συνεργάτης σε συνεργείο αυτοκινήτων. Τηλ. 6944860080 6937184144

ΠΩΛΕΙΤΑΙ οικιακός εξοπλισμός (έπιπλα σαλονιού, ψυγείο, πλυντήριο, χαλιά και όλα όσα χρειάζονται για ένα σπίτι. Σε τιμή ευκαιρίας. Τηλ: 6956029638, 6972381385 ΠΩΛΕΙΤΑΙ Άδεια ΤΑΧΙ (μόνο άδεια ή με το όχημα μαζί) Τηλ. Επικοινωνίας: 6977947813 κ.Τάσος ΠΩΛΕΙΤΑΙ Οικόπεδο 308 τ.μ. στην πλατεία του Σταυρού. τηλ: 6947328265 ΠΩΛΕΙΤΑΙ τουριστική επιχείρηση από 10 καινούργιες γκαρσονιέρες στην Παραλία Λεπτοκαρυάς. Πληρ. Τηλ. 6906 584427 ΠΩΛΕΙΤΑΙ Οικόπεδο 220 τ.μ. με 2όροφο κτίσμα, πίσω από το γήπεδο της Βέροιας Τηλ. επικοινωνίας 6977691662 κ. Νίκος Πωλείται οικόπεδο 240 τ.μ το οποίο περιλαμβάνει οίκημα εντός του. Τιμή ευκαιρίας. 85.000 ευρώ. Ετεοκλή 6 προς Καλή Παναγιά. Τηλ: 2331023765 Πωλείται χαρτί απόσυρσης. Τηλέφωνο 6937113039 ΠΩΛΕΙΤΑΙ διαμέρισμα στη Βασ. Όλγας (πλησίον Μπότσαρη) με αέριο, ανατολικό όλο στο φως, 6ος όροφος (2Δ, ΣΛ, Κ, WC), κατάλληλο για κατοικία ή ιατρείο. Πληροφορίες στο τηλ. 6930 561762. ΠΩΛΕΙΤΑΙ στο Πλατύ οικοδομή με κατάστημα στο ισόγειο και διαμέρισμα στον 1ο όροφο ΕΒΔΟΜΑΔΙΑΙΟ με αποθήκη, σε οικόπεδο 180τ.μ. στο κέντρο του Πλατέος. Τιμή συζητήσιμη. Πληροφορίες στο τηλ. 6956029638 - 6972381385

ΞΥΛΟΚΑΡΒΟΥΝΑ ΚΑΥΣΟΞΥΛΑ ΔΙΑΝΟΜΗ ΚΑΤ΄ΟΙΚΟΝ

ΓΚΑΡΑΒΕΛΗΣ ΚΩΝ/ΝΟΣ Κιν: 6978338603 Τηλ: 23310-28.895 3ο ΧΙΛ. ΒΕΡΟΙΑΣ - ΑΓΙΑΣ ΒΑΡΒΑΡΑΣ

ΠΩΛΕΙΤΑΙ διαμέρισμα 100 τ.μ. περίπου την περιοχή Αντ. Καμάρα (κέντρο) Βέροια. Μεσιτικό γραφείο: 6974747117 Πωλείται αυτοκίνητο μάρκας Citroen Saxo, χρώμα μπεζ μεταλλικό, spor coupe. 1600 cc. 125 Άλογα. Πολλά έξτρα, κάθε έλεγχος δεκτός. Μοντέλο 2000 (11ος). Τιμή ευκαιρία. Τηλ. 6932330062 Κυρ. Γιώργος ΠΩΛΕΙΤΑΙ οικόπεδο 330 τ.μ. στό Δ. Βέροιας, τοποθεσία Βικέλα. τηλ. 6977933532

χωρίς κοινόχρηστα, περιοχή ΚΤΕΛ, δωμ. με 1 κουφωτή ντουλάπα, κουζίνα μεγάλη με καινούρια ντουλάπα, λουτρό με μπανιέρα. Κ. Τέλης, τηλ.: 6937106652

ΠΩΛΕΙΤΑΙ Αντίκα σαλόνι, σκαλιστό Λουδοβίκου ελαφρώς μεταχειρισμένο. Μόνο σοβαρές προτάσεις Τηλ: 2331027683 (ώρες καταστήματος) κ.Σταύρος

Πωλείται ημιυπόγειος χώρος 325 τ.μ., εντός σχεδίου πόλεως Βέροιας. Ο χώρος ήδη νοικιάζεται προς 300 ευρώ μηνιαίως. Τηλ. 6944860080 6937184144

Πωλείται - Ευκαιρία επιχείρηση κομμωτηρίου στο κέντρο της Βέροιας. Πληρ.: 6957.179892

Πωλείται οικοδομή στο Μακροχώρι επάνω στον κεντρικό δρόμο. Περιλαμβάνει τρία διαμερίσματα. 100 τ.μ., 100 τ.μ., 75 τ.μ.. Δύο μαγαζιά. 40 τ.μ., 30 τ.μ. και υπόγειο αποθήκη 200 τ.μ. Τιμή 500.000 ευρώ. Τηλ.: 6976968274

Πωλείται μονοκατοικία στην Ξεχασμένη Ημαθίας (2όροφη). Ο 1ος όροφος είναι οικία. Ο κάτω χώρος είναι αποθηκευτικός με αλλαγή ρύθμισης χώρου. Πάνω από 100 τ.μ. σε πολύ καλή κατάσταση με το οικόπεδο αυλόγυρος. Τηλ.: 2333028096. Ώρες απογευματινές, Κυρ. Μαρία Πωλείται αυτοκίνητο Huindai Accent, 1300 cc, μοντέλο ‘95. Air-condition και ηλεκτρικά παράθυρα. Τηλ.: 6987025884 Πωλείται αυτοκίνητο Huindai Coupe, S145, 1600 cc, μοντέλο 2004. Τηλ.: 6987025884 Πωλείται Scoda octavia τελευταίο μοντέλο σε αρίστη κατάσταση 12.000 ευρώ.Τηλ. 6944856972 Πωλείται γκαρσονιέρα 36 τ.μ. στον 2ο όροφο,

ΑΛΕΞΑΝΔΡΕΙΑ

οδός Σχολείων κοντά στο δημαρχείο πωλούνται διαμπερή διαμερίσματα, μικρά και μεγάλα, εξαιρετικής κατασκευής σε 3όροφη οικοδομή με άνετους εξώστες, ημιυπαίθριους, ιδιωτικό πάρκινγκ και κήπο - χωρίς ΦΠΑ - από ιδιοκτήτες. Τηλ. 6944-

312455, 6946-584834, 2310920185

ΠΡΟΓΡΑΜΜΑ ΔΗΜΟΤΙΚΟΥ ΙΑΤΡΕΙΟΥ ΒΕΡΟΙΑΣ 7-11/05/2012

ΠΩΛΕΙΤΑΙ Οικία στο πανόραμα 240 τ.μ. 3ος όροφος, με γκαράζ και πανοραμική θέα με προσιτή τιμή. τηλ: 6974322308 ΠΩΛΕΙΤΑΙ Μονοκατοικία στα Ριζώματα 90 τ.μ Ημιτελής, καινούρια Σε τιμή ευκαιρίας Τηλ: 6944546553, κ. Γιώργος ΠΩΛΕΙΤΑΙ Στο Λιτόχωρο Πιερίας βίλα 234 τ.μ. με υπόγειο πάρκινγκ, αποθήκη, με 2,5 στρ. οικόπεδο, πανοραμική θέα βουνό-θάλασσα. τηλ: 6976391864

Για περισσότερες πληροφορίες οι ενδιαφερόμενοι μπορούν να τηλεφωνούν στο 23310-74113 ή να επισκέπτονται το Δημοτικό Ιατρείο στην οδό Καπετάν Άγρα 7 στον 1Ο όροφο.

21

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012


αγγελιεσ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

ΜΙΚΡΕΣ

Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα Επικαιρα Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΠΩΛΗΣΕΙΣ ΠΩΛΕΙΤΑΙ BMW ελαφρώς μεταχειρισμένη, χρώμα κόκκινο, 1600 cc μοντέλο 11-1996, φουλ έξτρα, σε πάρκινγκ, 2πορτο κουπέ. Τηλ. 23310 27683 (εκτός Κυριακής). Πωλείται διαμέρισμα στο κέντρο Εμ. Ζάχου. 97 τ.μ. σε πάρα πολύ καλή κατάσταση 1ος όροφος με ασανσέρ. Κεντρική θέρμανση. Τηλ: 2331091098 Πωλείται στις Βαρβάρες οικόπεδο με εσωτερικό χτίσμα σπίτι. Σύνολο οικοπέδου 462 τ.μ. και το σπίτι 47 τ.μ. σε καλή κατάσταση με κατασκευή υπόστεγου στην είσοδο. Τηλ καθημερ. 2331091098 Κυρ. Δημήτρης Πωλείται: Διαμέρισμα 93 τ.μ. επί της Εθνικής Αντίστασης 9 σε πολύ καλή κατάσταση. Τιμή ευκαιρίας. Τηλ: 2331021200 - 6972669311 ΠΩΛΟΥΝΤΑΙ Ελαφρώς μεταχειρισμένα: 1 σαλόνι γωνία, 1 τραπεζαρία με τζάμι και 6 καρέκλες, 1 τραπεζάκι σαλονιού κεντρικό, 1 μπουφές με καθρέφτη και κρυσταλιέρα, 1 ψυγείο PITSOS σχεδόν καινούργιο πωλούνται λόγω μετακόμισης σε άλλη πόλη. Όλα σε τιμή ευκαιρίας. Τηλ.: 6948880903 κ. Γεωργία ολοήμερα Πωλούνται δύο μονόκανα κυνηγετικά Τηλ: 6945974197 Πωλείται διαμέρισμα 100τ.μ. στη Θεσσαλονίκη (περιοχή Λαογραφικό Μουσείο) 3Δ.Σ.Κ.WC σε τιμή ευκαιρίας. Πληροφορίες στο τηλ. 6944529650 ΠΩΛΕΙΤΑΙ Χωραφοοικόπεδο στην περιοχή (Δαίου Πλαστικά) όπισθεν Βενζινάδικου100 μέτρα από τον κεντρικό δρόμο.Τιμή ευκαιρίας-συζητήσιμη Τηλ: 23320-43226 και 6977598329 ΠΩΛΕΙΤΑΙ Μοτοσυκλέτα CAGIVA RAPTOR, χρώμα κόκκινο 125cc.. Σχεδόν καινούργια και σε πολύ καλή κατάσταση. Τιμή συζητήσιμη. Δεκτός κάθε έλεγχος. Τηλ: 6976183243 καθημερινά. Πωλείται αγροικία 1 στρέμμα οικόπεδο στον Κοπανό Ναούσης.Τιμή 90.000 ευρώ. Τηλ. επικοινωνίας: 6946780770 ΠΩΛΕΙΤΑΙ χωράφι στη Νικομήδεια 11.560 στρ., 200 μ. πριν το χωριό με ρεύμα, πομόνα, αποθήκη. Σταματίου Αντώνης Τηλ:2331041141-6938407005 ΠΩΛΕΙΤΑΙ χωραφο-οικόπεδο έκτασης 1.850 τ.μ. (πρόσοψη 75μ. και βάθος 25μ.) οικοδομήσιμο επί του κεντρικού δρόμου από Μακροχώρι προς Ν.Λυκογιάννη (απέναντι ακριβώς από το δημόσιο ΚΤΕΟ) Τηλ. 2331073363 - 6974474691 ΠΩΛΕΙΤΑΙ οικόπεδο 195 τμ (στον οικισμό «ΟΛΥΜΠΙΑ») στην πρώτη σειρά μπροστά στη θάλασσα. Πληρ. τηλ. 6977686580 Πωλείται: HUIDAI LADRA 1600cc Μοντέλο 97. 160.000 χλμ, χρώμα μπλέ σε πολύ καλή κατάσταση με ΗΧΟ ΦΩΤΑ ΧΕΝΟΝ, Συναγερμό Parktronic. Υδρογόνο. Μόνο 1600 Ευρώ. Κιν: 6984116118. Κυρ. Πάνο. Όλη μέρα Πωλείται τροχοβίλα μάρκας ΑΝΤΡΙΑ διαστάσεων 3μ. χ 8μ. με όλο τον εξοπλισμό, κουζίνα, κρεβάτια, καυστήρα υγραερίου κτλ. 3ετίας, σε άριστη κατάσταση. Κινητό: 6982373375 Πωλείται διαμέρισμα στον 6ο όροφο στην πλατεία Πλατάνων 90 τ.μ. με ατομική θέρμανση, τζάκι, ηλιακό θερμοσίφωνα, αποθήκη, πλήρες ανακαινισμένο. Τηλ. Επικοινωνίας: 6974193344 Κ. Λαμπρινή Πωλείται ΣΟΜΠΑ ΠΕΛΛΕΤ ΙΤΑΛΙΚΗ MORETTI 7 KW ΚΑΙΝΟΥΡΓΙΑ ΑΠΟ 1500Ε ΝΕΑ ΤΙΜΗ 1300Ε ΔΩΡΟ ΜΠΟΥΡΙΑ ΚΑΙ ΠΕΛΛΕΤ ΔΩΡΕΑΝ ΑΠΟΣΤΟΛΗ ΟΙΚΟΝΟΜΙΚΗ ΛΕΙΤΟΥΡΓΙΑ 350Ε ΚΑΥΣΙΜΟ / ΣΑΙΖΟΝ 6987 - 170785

ΠΩΛΕΙΤΑΙ ΜΕΓΑΛΗ ΕΥΚΑΙΡΙΑ

Γκαρσονιέρα στον 1ο όροφο 36 τ.μ. σε άριστη κατάσταση και σε πολύ ωραία περιοχή.

Τηλ.: 6943671469 Κυρ. Μελίνα

ΔΑΣΚΑΛΟΠΟΥΛΟΣ Δ. ΑΝΤΩΝΗΣ

ΜΕΣΙΤΙΚΟ ΓΡΑΦΕΙΟ

Αγορές- Πωλήσεις –Ενοικιάσεις -Αντιπαροχές-Ανακαινίσεις Βενιζέλου 16 Νάουσα Τηλ. 2332501376 Κιν. 6948948689 - 6944345646 www.daskalopoulos-realestate.gr E-mail: antonisdas@gmail.com ΠΩΛΗΣΕΙΣ ΟΙΚΟΠΕΔΑ ΠΟ302 140τμ στον Μάντζαλο 0,8σδ τιμή 35.000 ΠΟ319 220τμ στον Μουσταφά 1,2σδ τιμή 80.000 ΠΟ328 120τμ προς Λαζαράσκα 0,8σδ τιμή 25.000 ΠΟ329 1100τμ επέκταση 0,8σδ τιμή 110.000 ΠΟ337 160τμ Μουσταφά 0,8σδ τιμή 30.000 ΠΟ360 550τμ στην επέκταση 1,6σδ τιμή 200.000 ή αντιπαροχή ΠΟ361 400τμ στο γήπεδο 0,5σδ τιμή 180.000 ΠΟ363 90τμ Αγία Παρασκευή γωνιακό 0,8σδ τιμή 20.000 ΠΟ365 290τμ Βρυσάκι 0,8σδ τιμή 40.000 ΠΟ656 300τμ Κουτσούφλιανη σε πλαγιά,θέα, άρτιο 32.000 ΠΟ390 640τμ επέκταση 0,8σδ τιμή 200.000 ΠΟ403 300τμ Βάλια 0,8σδ τιμή 45.000 ΧΩΡΑΦΟΟΙΚΟΠΕΔΑ ΠΧΟ335 8,500τμ Μηλίτσα απεριόριστη θέα ΠΧΟ340 3,311τμ Μπλάνα άρτιο ΠΧΟ356 4,000τμ Χώρας Νερό άρτιο θέα ΠΧΟ357 5,000τμ στον δρόμο Κοπανού 36μ πρόσοψη ΠΧΟ367 10,000τμ χέρσο περιοχή Στενημάχου ΠΧΟ381 4,000τμ Κουλούκι πάνω στον δρόμο ΠΧΟ382 4,000τμ Χώρας Νερό θέαρεύμα-νερό ΠΧΟ404 1,000τμ πάνω στον δρόμο γέφυρα Καστανιώτη ΠΩΛΗΣΕΙΣ ΑΓΡΩΝ ΠΑ343 9,000τμ με μηλιές προς Αρκοχώρι ΠΑ344 4,000τμ περιοχή Στενημάχου ΠΑ347 4,000τμ ροδάκινα Τζουμέλα ΠΑ350 4,000τμ + 4,000στρ Χοντροσούγκλα ΠΑ355 4,000τμ περιοχή Στενημάχου ΠΑ373 10,000τμ Χαριέσσα, παλμέτα, 3 ποικιλίες, μπεκάκια, 110μ πρόσοψη ΠΑ391 7,000τμ στο Εφτάμιση ΠΑ417 4,00τμ δρόμος προς Κουκούλι κεράσια-μήλα ΠΑ423 20,000τμ ροδάκινα Μονόσπιτα ΠΑ429 5,000τμ προς Στενήμαχο ΠΑ484 22,000τμ χέρσο Τσιφλίκι ΔΙΑΜΕΡΙΣΜΑΤΑ ΠΔ306 110τμ ατομική 2δ,Σ/Κ, μπάνιο, ατομική Παναγία ΠΔ323 75 τμ ατομική, ανακαινισμένο, 3ος , 2Δ, Σ/Κ, μπάνιο Μαντρί ΠΔ324 75τμ +σοφίτα+ αέρας, 2ος, Κέντρο ΠΔ331 100τμ 1ος , 2Δ, Σ,Κ, μπάνιο ,WC, κλειστό γκαράζ, απεριόριστη θέα, ατομική, Άγ.Θεολόγος ΠΔ372 115τμ, 1ος, 3Δ, Σ/Κ, μπάνιο, διαμπερές, πάρκινγ, ατομική, Κέντρο ΠΔ378 95τμ, 2ος, 2Δ, Σ/Κ, μπάνιο ατομική, ανακαινισμένο, Γεννηματά ΠΔ394 70τμ 5ος, ασανσέρ, ατομική, 2Δ, Σ,Κ, μπάνιο, Παναγούλη ΠΔ406 90τμ, 3ος, ασανσέρ, ατομική, κλιματισμός, 2Δ, Σ,Κ, μπάνιο, Μακεδο-

νίας ΠΔ411 65τμ, 1ος, καινούριο, ατομική, 1Δ, Σ/Κ, μπάνιο,Υπαπαντή ΠΔ442 85τμ 2ος, ατομική, ηλιακός, αποθήκη, 2Δ, Σ,Κ, μπάνιο Μπουρδάνου ΠΔ451 75τμ, 3ος, ατομική, ηλιόθερμο, τέντες,ανακαινισμένο, 1Δ,Σ/Κ, μπάνιο ΠΔ460 128τμ 1ος, ατομική ,ασανσέρ, 3Δ,Σ/Κ ,μπάνιο , Γήπεδο ΜΟΝΟΚΑΤΟΙΚΙΕΣ ΠΜΟ311 240τμ σε 2 επίπεδα , σε οικόπεδο 440τμ, Βάλια ΠΜΟ330 180τμ σε 2 επίπεδα, πολυτελείας στο Αρκοχώρι ΠΜΟ376 96τμ στην Λουντέμη ΠΜΟ385 100τμ, γωνιακή, Ευαγγελίστρια ΠΜΟ395 220τμ, σε 2 επίπεδα, Βύρωνος ΠΜΟ400 80τμ, παλιά , Μάντζαλος ΠΜΟ415 220τμ, στα μπετά σε 2 επίπεδα, Χαιδευτού ΠΜΟ425 100τμ,, σε 1στρέμμα, στα Λευκάδια ΠΜΟ452 75τμ και σοφίτα 35τμ, Γεννηματά ΠΜΟ461 120τμ σε 2 επίπεδα, υπό ανέγερση ,Βάλια ΠΜΟ529 95τμ ανακαισμένη Εργατικό Κέντρο ΕΝΟΙΚΙΑΣΕΙΣ Διαμέρισμα 100τμ, 1ος, ατομική , Κέντρο Διαμέρισμα 90τμ, 2ος, ατομική, 5ο δημοτικό Οροφοδιαμέρισμα 84τμ, 2ος, ατομική, Κέντρο Γκαρσονιέρα 60τμ, 1ος, Πάνω Εργατικές Διαμέρισμα 80τμ, ισόγειο, ατομική, Θεμελή Διαμέρισμα 110τμ, διαμπερές, ατομική, 3ος, Θεμελή Διαμέρισμα 90τμ, Γήπεδο Διαμέρισμα 3ος, 85τμ, κεντρική, Αρ. Κοκκίνου Γκαρσονιέρα 70τμ, 1ος, Παναγία Διαμέρισμα 90τμ ,3ος, διαμπερές, κεντρική, πάρκινγ, Πάνω Εργατικές Διαμέρισμα 90τμ, ισόγειο, ατομική, Καραϊσκάκη Διαμέρισμα 80τμ, ανακαινισμένο, ατομική, τζάκι, ντουλάπες, 2ος, Τρικολάν Διαμέρισμα 78τμ, επιπλωμένο, ατομική, 2ος, Βάρναλη Στούντιο, επιπλωμένο, ατομική Πουλιάνα Διαμέρισμα 100τμ, 2ος, ατομική Αριστοτέλους Γκαρσονιέρα 50τμ,1ος, 5ετίας, Μπατάνια Διαμέρισμα επιπλωμένο 90τμ, 2ος, ατομική, Κέντρο Γκαρσονιέρα 40τμ, 3ος, ατομική, ανακαινισμένη, Θεμελή Διαμέρισμα, επιπλωμένο, 1ος, ατομική Κέντρο Διαμέρισμα 90τμ, διαμπερές, ανακαινισμένο, ατομική, τζάκι, κλιματισμός,2ος, Κέντρο Κατάστημα 65τμ, ισόγειο Βενιζέλου Κατάστημα 140τμ, ισόγειο Β. Φιλίππου ΣΤΟ ΓΡΑΦΕΙΟ ΜΑΣ ΘΑ ΒΡΕΙΤΕ ΑΚΟΜΑ ΜΕΓΑΛΥΤΕΡΗ ΓΚΑΜΑ ΑΚΙΝΗΤΩΝ ΠΟΥ ΘΑ ΚΑΛΥΠΤΟΥΝ ΟΛΕΣ ΤΙΣ ΑΝΑΓΚΕΣ ΣΑΣ.

22

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

ΚΑΤΟΙΚΙΑ ΠΩΛΕΙΤΑΙ Μεζονέτα 120μ2 στο Λιτόχωρο Πιερίας ΠΩΛΕΙΤΑΙ Μεζονέτα 120 μ2 στο Κέντρο ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 μ2 κάτω από τα στρατόπεδα. ΠΩΛΕΙΤΑΙ Μεζονέτα Νεόδμητη 115 μ2 περιοχή Βίλλα Βικέλα. ΠΩΛΕΙΤΑΙ Μεζονέτα 110 μ2 στο Πανόραμα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 60 μ2 στο κέντρο. ΠΩΛΕΙΤΑΙ Μεζονέτα 80 μ2 στη Νικήτη Χαλκιδικής. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 μ2 περιοχή Βίλλα Βικέλα. ΠΩΛΟΥΝΤΑΙ Διαμερίσματα 100 και 100 μ2 στην Αλεξάνδρεια. ΠΩΛΕΙΤΑΙ Διαμέρισμα 100 τ.μ. κοντά στην Πλ. Ωρολογίου. ΠΩΛΕΙΤΑΙ Μεζονέτα Νεόδμητη 100 τ.μ. στο Καλαμίτσι Χαλκιδικής. ΠΩΛΕΙΤΑΙ Διαμέρισμα 100 τ.μ. περιοχή Κύπρου. ΠΩΛΕΙΤΑΙ Διαμέρισμα 65 τ.μ. στη Νικήτη Χαλκιδικής. ΠΩΛΕΙΤΑΙ Μεζονέτα 95 τ.μ. στην Καλλιθέα. ΠΩΛΕΙΤΑΙ Γκαρσονιέρα 25 τ.μ. στο κέντρο. ΠΩΛΕΙΤΑΙ Διαμέρισμα 116 τ.μ. περιοχή Προμηθέα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 85 τ.μ. περιοχή Κέντρο. ΠΩΛΕΙΤΑΙ Διαμέρισμα 95 τ.μ. περιοχή Καλλιθέα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 85 τ.μ. επί της οδού Θεσ/νικης. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 τ.μ. στο Τσερμένι. ΠΩΛΕΙΤΑΙ Διαμέρισμα 165 τ.μ. περιοχή Προμηθέα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 95 τ.μ. περιοχή Κέντρου. ΠΩΛΕΙΤΑΙ Διαμέρισμα 105 τ.μ. περιοχή Παπάγου. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 τ.μ. πάνω από τα Παπάκια. ΠΩΛΕΙΤΑΙ Ημιτελής Μονοκατοικία 130 τ.μ. στο κέντρο. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 τ.μ. πίσω από το Βυζαντινό Μουσείο. ΠΩΛΟΥΝΤΑΙ Μονοκατοικίες 65 τ.μ. στην Λεπτοκαρυά. ΠΩΛΕΙΤΑΙ Μονοκατοικία 130 τ.μ. στο Μακροχώρι. ΕΝΟΙΚΙΑΣΕΙΣ ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα μερικώς επιπλωμένο, σε άψογη κατάσταση, με Ατ. Θέρμανση στη Τούμπα Θεσ/νίκης

ΕΝΟΙΚΙΑΖΟΝΤΑΙ Διαμερίσματα, Καταστήματα, Γραφεία, Αποθηκευτικοί - Βιομηχανικοί χώροι σε όλες τις περιοχές και τα εμβαδά ΕΠΑΓΓΕΛΜΑΤΙΚΗ ΣΤΕΓΗ ΠΩΛΕΙΤΑΙ κατάστημα 107 τ.μ. σε υπόγειο 128,41 τ.μ. πλησίον της οδού Θεσ/νικης. ΠΩΛΕΙΤΑΙ κατάστημα 100 τ.μ. περιοχή φανάρια Κύπρου. ΠΩΛΕΙΤΑΙ κατάστημα 100 τ.μ. με 100 τ.μ. υπόγειο και 60 τ.μ. πατάρι στο κέντρο. ΠΩΛΕΙΤΑΙ ημιυπόγειος χώρος 170 τ.μ. κοντά στην Ανοίξεως. ΠΩΛΕΙΤΑΙ κατάστημα 104 τ.μ. επί της Κεντρικής. ΠΩΛΕΙΤΑΙ κατάστ. 107 τ.μ. με υπόγειο 90 τ.μ. στο κέντρο της Βέροιας. ΠΩΛΕΙΤΑΙ κατάστημα 160 τ.μ. περιοχή οδού Θεσ/νικης. ΠΩΛΕΙΤΑΙ γραφείο 100 τ.μ. στη Μ. Αλεξάνδρου. ΠΩΛΕΙΤΑΙ γραφείο 50 τ.μ. στη Μ. Αλεξάνδρου. ΠΩΛΕΙΤΑΙ κατάστημα 100 τ.μ. πλησίον του Αγ. Αντωνίου. ΠΩΛΕΙΤΑΙ κατάστημα – γραφείο 55 τ.μ. επί της οδού Μ. Αλεξάνδρου. ΟΙΚΟΠΕΔΑ – ΑΓΡΟΙ ΠΩΛΕΙΤΑΙ Αγροοικόπεδο 6.800 μ2 στα Καβάκια ΠΩΛΕΙΤΑΙ Οικόπεδο 390 μ2 στη Ραχιά ΠΩΛΕΙΤΑΙ Αγροοικόπεδο 4.000 μ2 στο Λοζίτσι ΠΩΛΕΙΤΑΙ Οικόπεδο 260 μ2 στο Κέντρο της Βέροιας ΠΩΛΕΙΤΑΙ Οικόπεδο 500 μ2 στη Σκοτίνα Πιερίας ΠΩΛΕΙΤΑΙ Οικόπεδο 500 μ2 στο Εργοχώρι ΠΩΛΕΙΤΑΙ Αγροοικόπεδο 4.00 μ2 στο Εργοχώρι ΠΩΛΕΙΤΑΙ Οικόπεδο 1.000 τ.μ. στη Βεργίνα. ΠΩΛΕΙΤΑΙ Οικόπεδο 1.000 τ.μ. στα Ασώματα. ΠΩΛΕΙΤΑΙ Οικόπεδο 1.000 τ.μ. στους Γεωργιανούς. ΠΩΛΕΙΤΑΙ Οικόπεδο 500 τ.μ. στη Βεργίνα. Κωττουνίου 18, Βέροια 59100 Τηλ. – Fax.: 23310 65564 Κιν. 6972 808878


αγγελιεσ 

epikera@otenet.gr

Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα Επικαιρα Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΣΤΕΓΑΣΤΙΚΕΣ ΛΥΣΕΙΣ

ΒΕΝΙΖΕΛΟΥ 27(3ος όροφος), ΒΕΡΟΙΑ

Αγορές Πωλήσεις

ΤΗΛ. 2331500786 ΚΙΝ. 6934888738

Ενοικιάσεις

ΔΙΑΜΕΡΙΣΜΑΤΑ Π Ω Λ ΟΥ Ν ΤΑ Ι

Ανοίξεως 28 τ.μ. 23.000 € Τσερμένη 45 τ.μ. καινούριο 1ος όροφος 46.000 € Προμηθέας 45 τ.μ. ανακαινισμένο ατομική θέρμανση 38.000 € Κέντρο 65 τ.μ. 53.000 € Πριμηθέας 80 τ.μ. ανακαινισμένο 58.000 € Εληά 100 τ.μ. καλή θέα 160.000 € Μουσείο 95 τ.μ. 1ος όροφος. Ευκαιρία 52.000 € Τσερμένη 96 τ.μ. καινούριο 3 Δωμάτια, κλειστό γκαράζ, ευκαιρία 108.000 € Καλλιθέα 60 τ.μ. καλό 30.000 € Μητρόπολη 96 τ.μ. και 20 τ.μ. αποθήκη 39.000 € Τσερμένη 110 τ.μ. 3 Δωμάτια, γκαράζ καινούριο 140.000 € Προμηθέας 120 τ.μ. καινούριο 3 Δωμάτια, γκαράζ 140.000 € Τσερμένη Μεζονέτα 160 τ.μ. καινούριο με θέα, γκαράζ 230.000 € Πιερίων Μεζονέτα 170 τ.μ. καινούρια 260.000 € ΚΤΕΛ 110 τ.μ. ανακαινισμένο 85.000 € Προμηθέας 65 τ.μ. 4ος όροφος με θέα 55.000 €

μονοκατοικιεσ Ραχιά μονοκατοικία καινούρια 85 τ.μ. χτίζει από πάνω άλλο τόσο με οικ. 900 τ.μ. καινούριο 190.000 € Φανάρια – Κύπρου μονοκατοικία σε 205 τ.μ. οικόπεδο 78.000 € Προμηθέας μονοκατοικία σε 250 τ.μ. οικ. 75.000 € Επισκοπή Βεροίας 80 τ.μ. σε 210 τ.μ. οικ. 45.000 € Πανόραμα μονοκατοικία 170 τ.μ. ημιτελές χτίζει άλλα 140 τ.μ. σε 430 τ.μ. οικ. 140.000 € Φλαμουριές μονοκατοικία παλιά σε 1.000 τ.μ. οικ. 50.000 € Πεζόδρομο μονοκατοικία σε 170 τ.μ. οικοπ. 120.000 € Κέντρο μονοκατοικία 120 τ.μ. σε 2 επίπεδα διατηρητέο 90.000 € Δοβρά 130 τ.μ. θέα σε 5.000 τ.μ. οικ. 250.000 € Πασακιόσκι 220 τ.μ. καινούριο, θέα 270.000 € Εληά 60 τ.μ. μονοκατοικία 40.000 €

επαγγελματικοι χωροι - γραφεια Γραφείο Ρολόι 25 τ.μ. 1ος γωνιακό 25.000 € Γραφείο Αγ. Αντώνιος 110 τ.μ. 1ος 160.000 € Μαγαζί Κεντρικής 30 τ.μ. 90.000 € Μαγαζί Κεντρικής 20 τ.μ. 25.000 € Μαγαζί ΚΤΕΛ 15 τ.μ. 20.000 € Μαγαζί ΚΤΕΛ 25 τ.μ. 35.000 € Μαγαζί Κέντρο 45 τ.μ. 90.000 € Μαγαζί Κέντρο 35 τ.μ. με προαύλιο χώρο 78.000 € Μαγαζί περιφερειακός 150 τ.μ. 240.000 € Μαγαζί Ρολόι 45 τ.μ. καινούριο 160.000 € Μαγαζί Μητροπόλεως 70 τ.μ. με 500 τ.μ. υπόγειο 290.000 € Μαγαζί Πανόραμα 140 τ.μ. σε οικόπεδο 420 τ.μ. χτίζει άλλα 140 τ.μ. ευκαιρία 150.000 € Μαγαζί Ρολόι 90 τ.μ. 190.000 € Μαγαζί Κεντρικής 70 τ.μ. καλό ευκαιρία 135.000 € Μαγαζί Βενιζέλου κεντρικότατο 70 τ.μ. με υπόγειο 70 τ.μ. (Δίνει ενοίκιο 1.700 €)

διαμερισματΑ Ε Ν Ο Ι Κ Ι Α Ζ Ο Ν ΤΑ Ι Αγ. Αντώνιος 30 τ.μ. ρετιρέ lux επιπλωμένο θέα απεριόριστη 230 € Τσερμένη 45 τ.μ. καλό 3ος όροφος 160 € Πασακιόσκι 35 τ.μ. ατομική θέρμανση καινούριο 220 € ΚΤΕΛ 28 τ.μ. καλό 140 € Προμηθέας 45 τ.μ. καινούριο ατομική θέρμανση 250 € Εληά 35 τ.μ. καλό 190 € Παπάκια 45 τ.μ. μπαλκόνι, θέα 160 € Βενιζέλου 60 τ.μ. επιπλωμένο πλήρες 240 € Ανοίξεως 45 τ.μ. ανακαινισμένο 180 € Κεντρικής 25 τ.μ. επιπλωμένο 180 € Κέντρο 35 τ.μ. καλό 180 € Στέγη 60 τ.μ. πάρκινγκ 180 € Μουσείο 110 τ.μ 5 ετών τζάκι, 3 Δωμάτια, πάρκινγκ 340 €

Πιερίων 100 τ.μ. 5 ετών πάρκινγκ 330 € Αγ. Παρασκευή 100 τ.μ. ατομική θέρμανση επιπλωμ. καλό 300 € Εληά κάτω 90 τ.μ. καινούριο 2 Δωμάτια, τζάκι, γκαράζ 350 € Εληά κάτω 110 τ.μ. καινούριο 3 Δωμάτια, τζάκι, αποθήκη, 2 γκαράζ 450 € Μητροπόλεως 90 τ.μ. ανακαινισμένο ατομική θέρμανση 230 € Γήπεδο 100 τ.μ. ατομική θέρμανση 220 € Προμηθέας 100 τ.μ. 2 Δωμάτια, ατομική θέρμανση, επιπλωμένο 270 €

επαγγελματικοι χωροι - γραφεια ΚΤΕΛ 140 τ.μ. ατομική θέρμανση 320 € Εδέσσης 60 τ.μ. με υπόγειο 50 τ.μ. 600 € Εδέσσης 40 τ.μ. με πατάρι 15 τ.μ. 280 € Βενιζέλου 40 τ.μ. 290 € Τσερμένη 50 τ.μ. 280 € Πιερίων 40 τ.μ. με πατάρι 370 € Ρολόι 50 τ.μ. σε καλό σημείο και υγειονομικού ενδιαφέροντος 350 € Αγ. Αντώνιο 67 τ.μ. με υπόγειο 67 τ.μ. καλό 1.000 € Μητροπόλεως Roma-pizza 30 τ.μ. υπόγειο 100 τ.μ. 240 € Ανοίξεως 40 τ.μ. υγειονομικού ενδιαφέροντος 210 € Προφ. Ηλία 50 τ.μ. 850 € Πεζόδρομος 70 τ.μ. 450 € Θεσσαλονίκης 90 τ.μ. και υπόγειο 90 τ.μ. γωνιακό 600 € Βενιζέλου 25 τ.μ. κεντρικό 130 € Βενιζέλου 30 τ.μ. lux 170 € Εληά 110 τ.μ. 1ος 400 € Μητρόπολη 40 τ.μ. 150 € Αγ. Αντώνιος 110 τ.μ. 1ος όροφος, 4 χώροι 400 € Αγ. Αντώνιος 40 τ.μ. 1ος 230 € Μ. Αλεξάνδρου 90 τ.μ. καλό 300 €

οικοπεδα Ραχιά οικόπεδο 2.200 τ.μ. 75.000 € Φανάρια Κύπρου οικόπεδο 204 τ.μ. 75.000 € Ραχιά Καβάκια αγροτεμάχιο πάνω στο δρόμο 5.700 120.000 € Εληά οικ. κάτω με άδεια 225 τ.μ. 85.000 € Πανόραμα οικ. θέα 680 τ.μ. 160.000 € Δοβρά οικ. επάνω στο δρόμο 6.000 τ.μ. 90.000 € Δοβρά αγροτεμάχιο περιφραγμένο με θέα 5.000 τ.μ. 120.000 € Πατρίδα οικ. με θέα 2.600 τ.μ. 125.000 € Παλατίτσια οικ. στο χωριό μέσα 750 τ.μ. 24.000 € Παπάκια οικόπεδο 230 τ.μ. 70.000 € Πανόραμα οικ. παιδικός σταθμός 690 τ.μ. 160.000 € Εργοχώρι οικοπ. Εργοχώρι πάνω 5.850 τ.μ. 130.000 € Ραχιά οικόπεδο στο γήπεδο κοντά 2.700 τ.μ. 110.000 € Ραχιά οικόπεδο στην είσοδο της Ραχιάς 2.200 τ.μ. 80.000 € Εργοχώρι οικόπεδο Καλής Παναγιάς 388 τ.μ. 125.000 € Ραχιά αγροτεμάχιο με διάφορα καρποφόρα δέντρα 2.800 τ.μ. 23.000 € Κουλούρα κόμβος 7.300 τ.μ. 110.000 € Πατρίδα οικόπ. Προς Γήπεδο 2.540 τ.μ. 100.000 € Νικομήδεια χωραφοοικόπεδο 13 στρέμματα 60.000 € Τρίλοφο οικόπεδο στο χωριό μέσα 1.430 τ.μ. 43.000 € Μετόχι οικόπεδο 1.157 τ.μ. 50.000 € Μακροχώρι οικόπεδο 1.965 τ.μ. 50.000 € Γεωργιανή οικόπεδο 1.965 τ.μ. 50.000 € Κουλούρα αγροτεμάχιο 12.000 τ.μ. 130.000 € Πατρίδα οικόπεδο κεντρικό 6.000 τ.μ. 70.000 €

ΓΙΑ ΤΟΥΣ ΠΕΛΑΤΕΣ ΤΟΥ ΓΡΑΦΕΙΟΥ ΜΑΣ ΖΗΤΟΥΝΤΑΙ ΑΜΕΣΑ ΓΙΑ ΑΓΟΡΑ ΟΙΚΟΠΕΔΑ ΚΑΙ ΔΙΑΜΕΡΙΣΜΑΤΑ

ΠΩΛΗΣΕΙΣ ΠΩΛΕΙΤΑΙ Στον Τρίλοφο διόροφη κατοικία 84 τ.μ. οικόπεδο 550 τ.μ. τηλ: 2331093377 ΠΩΛΕΙΤΑΙ διαμέρισμα 115 τ.μ. καινούργιο στο Μακροχώρι Βέροια. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ SUZUKI SAMURAI, μοντέλο 91, cabrio, κιν:6942480058

ΠΩΛΕΙΤΑΙ Εξοπλισμός καφετέριας σε πολύ καλή τιμή Τηλ. επικοινωνίας 6949449615 ΠΩΛΕΙΤΑΙ: Πίνακας του DORIS. Διαστάσεις 92Χ72 χωρίς την κορνίζα.Είναι έργο του 1940 Τηλ:6977275357 Πωλείται: Τροχόσπιτο μάρκας Tabbert εισαγωγής μήκος 6,5 μ.ετρα σε πολύ καλή κατάσταση και σε πολύ καλή τιμή με διπλό άξονα & με όλα τα αξεσουάρ, χρώμα άσπρο. Τηλ: 2331021204 & 6946779366

Πωλείται: Στα Καβάκια 6 Στρέμματα κτήμα με ροδάκινα και αναδομήσιμο. Ευκαιρία. Πωλείται: Περιοχή Κάτω Χώρα 4,5 Στρέμματα κτήμα ροδάκινα και αναδομήσιμο. Ευκαιρία. Πωλείται: Στη Λευκόπετρα 2,5 Στρέμματα οικόπεδο δομήσιμο σε τιμή ευκαιρίας. Πωλείται: κατάστημα Σούπερ Μάρκετ 170 τ.μ. περιοχή Αγαθια στο κέντρο και οικία στον επάνω όροφο 100 τ.μ. σε πολύ καλή κατάσταση σε τιμή ευκαιρίας. Τηλ. Πληρ.: 6941481652 2331062927

23

Πωλούνται Ραπτομηχανές παντός τύπου, επαγγελματικής και οικιακής χρήσεως. Service ραπτομηχανών. Ζήσης Σιμόπουλος, Εμμ. Παππά 27, Τηλ:2331065396 ΠΩΛΕΙΤΑΙ έτοιμη επιχείρηση με είδη δώρων στο κέντρο της Βέροιας. Τιμή 9.500 Ευρώ. Τηλ. 2331024999. Κιν. what’s up 6988364223 Πωλείται 140 τ.μ. σπίτι, 3 υπνοδ/τια, 2 WC, καινούριο, άριστης κατασκευής, επάνω στην Αριστοτέλους. Κ. Αντώνης. Τηλ.: 6944833396 Πωλείται διαμέρισμα 120 τ.μ. στο κέντρο κοντά στη Μητροπόλεως με ατομική θέρμανση σε πολύ καλή κατάσταση. 4ος όροφος, 2 ΥΠ - 2 WC - Σαλοτραπεζαρία, Σαλοκουζίνα & αποθήκη (τιμή ευκαιρίας). Τηλ: 2331028644 6976320394 Κυρ. Έφη

Γερμανίας Τιμή 1500 η μία 2.500 και οι δύο Τηλ. Επικοινωνίας: 6972842984

Πωλείται: Χωράφι 3 στρέμ. με 120 δέντρα κεράσια με παραγωγή κάθε χρόνο, περιφραγμένο και νερό πόσιμο (περιοχή Τριπόταμου ΛΟΖΙΤΣΗ) σε τιμή ευκαιρίας. Τηλ: 2331023270 Κυρ. Γεράσιμος

ΠΩΛΕΙΤΑΙ Διαμέρισμα 74 τ.μ. (Σ,Κ,2Δ,WC) στον 3ο όροφο, Βουλγαροκτόνου 2 στον Προμηθέα. Τιμή 72.000 €. Κιν. 6970959780. Πωλείται οροφοδιαμέρισμα 108 τμ. Ημιτελές. Περιοχή Μπαρμπούτα πιο πάνω από τη Γέφυρα. 3 υπ, 1 σαλοτραπεζαρίακουζίνα, 1 wc. Τηλ: 2331025446 Κιν: 6973227071 Κα Χριστίνα ΠΩΛΕΙΤΑΙ γραφείο 67 τ.μ. με ανεξάρτητη είσοδο και κλιματισμό στο κέντρο της Θεσ/νίκης. Μεσιτικό γραφείο: 6974747117 ΠΩΛΟΥΝΤΑΙ 2 κοτοπουλιέρες σαραντάρες, ανοξείδωτες

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

ΠΙΕΡΙΩΝ 24 ΤΗΛ. 23310 67400, KIN. 6936 631658 ΒΕΡΟΙΑ ΒΕΡΓΙΝΑ ΤΗΛ. 23310 66300


ελλαδα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 793

Ευ. Βενιζέλος μετά τη συνάντηση με Φ. Κουβέλη:

Kαλός οιωνός για το σχηματισμό κυβέρνησης

Τ

ον σχηματισμό οικουμενικής κυβέρνησης με πολιτικά φερέγγυα πρόσωπα που θα σέβεται το μήνυμα της λαϊκής ετυμηγορίας πρότεινε ο πρόεδρος της Δημοκρατικής Αριστεράς, Φώτης Κουβέλης, αμέσως μετά τη συνάντησή του χθες με τον πρόεδρο του ΠΑΣΟΚ, Ευάγγελο Βενιζέλο. Ο Φ. ΚΟΥΒΕΛΗΣ «Προτείνω συγκρότηση οικουμενικής κυβέρνησης με ισχυρή λαϊκή και κοινοβουλευτική στήριξη, η οποία θα κρατήσει την Ελλάδα ζωντανή στην Ευρώπη» είπε και κάλεσε όλες τις δυνάμεις να ανταποκριθούν με αίσθημα ευθύνης. Τόνισε ότι η κυβέρνηση αυτή θα πρέπει να έχει δεσμευτικό πρόγραμμα και χρονικό ορίζοντα μέχρι τις ευρωεκλογές του 2014. Υπογράμμισε, ακόμη, ότι βασικοί της στόχοι θα πρέπει να είναι η παραμονή της Ελλάδας στο ευρώ και η σταδιακή απαγκίστρωση από το μνημόνιο. «Καταθέτουμε αυτήν την πρόταση με απόλυτη συνείδηση της κρισιμότητας των στιγμών που περνάει η χώρα και καλούμε όλες τις δυνάμεις να ανταποκριθούν με συναίσθηση της ευθύνης τους απέναντι στον τόπο» είπε. «Δεν διεκδικούμε τίποτα πέραν από την ικανοποίηση να έχουμε συμβάλλει στην έξοδο από την κρίση προς όφελος του λαού και της χώρας» κατέληξε ο πρόεδρος της Δημοκρατικής

Αριστεράς. Ο ΕΥ. ΒΕΝΙΖΕΛΟΣ Για καλό οιωνό μίλησε ο πρόεδρος του ΠΑΣΟΚ Ευ.Βενιζέλος μετά τη συνάντησή του με τον πρόεδρο της ΔΗΜΑΡ, στο πλαίσιο των διερευνητικών επαφών του. «Η πρόταση Κουβέλη για οικουμενική κυβέρνηση σχεδόν συμπίπτει με τη δική μας πρόταση» είπε ο κ. Βενιζέλος, χαρακτηρίζοντάς την «υπεύθυνη και συγκεκριμένη». Συμφωνούμε, όπως εξήγησε, στους στόχους για παραμονή πάση θυσία της χώρας στην ευρωζώνη και το ευρώ και για υπέρβαση του μνημονίου. Το ΠΑΣΟΚ λέει ότι η απαλλαγή από το μνημόνιο μπορεί να γίνει σε ορίζοντα τριετίας. Ο κ. Βενιζέλος είπε ότι θα συνεχίσει τις επαφές του στο πλαίσιο της διερευνητικής εντολής που έλαβε. Για σήμερα το πρωί έχει προγραμματιστεί η συνάντηση του προέδρου του ΠΑΣΟΚ με τον πρόεδρο της ΝΔ, Αντ.Σαμαρά. “ΟΧΙ” ΤΟΥ Π. ΚΑΜΜΕΝΟΥ Tην πρόθεσή του να μην ανταποκριθεί σε πρόσκληση του Ευ. Βενιζέλου για συνάντηση στο πλαίσιο των διερευνητικών εντολών, εξέφρασε ο πρόεδρος των Ανεξάρτητων Ελλήνων Π.Καμμένος. Mιλώντας στην τηλεόραση του ΑΝΤ1, o κ. Καμμένος εξέφρασε την άποψη ότι οι διερευνητικές εντολές έπρεπε να έχουν τελειώσει εδώ και δύο

μέρες. «Το μόνο που έχει νόημα πλέον είναι η σύσκεψη υπό τον πρόεδρο της Δημοκρατίας» εξήγησε, προσθέτοντας ότι για να σχηματιστεί κυβέρνηση θα πρέπει να αποσύρουν τις ενυπόγραφες δεσμεύσεις τους οι Ευ.Βενιζέλος και Α.Σαμαράς. Κομισιόν: «Φτιάξτε κυβέρνηση!» «Καλούμε τα ελληνικά πολιτικά κόμματα να δουλέψουν από κοινού σε πνεύμα συνεργασίας για το σχηματισμό κυβέρνησης στην Ελλάδα», επανέλαβε χθες η εκπρόσωπος του πρόεδρου Μπαρόζο, Πία Αντερκίλντε Χάνσεν, κατά την καθημερινή ενημέρωση των συντακτών. Η εκπρόσωπος τόνισε ότι θέση της Επιτροπής παραμένει ίδια: «αναμένουμε από την επόμενη κυβέρνηση να σεβαστεί και να τιμήσει τις πρότερες δεσμεύσεις στο πλαίσιο του προγράμματος οικονομικής προσαρμογής». Ξεκαθάρισε, μάλιστα, ότι αυτός είναι ο μόνος δρόμος για την οικονομική ανάκαμψη της χώρας. ΝΕΕΣ ΠΙΕΣΕΙΣ ΣΟΪΜΠΛΕ

Νέα προειδοποίηση προς τη χώρα μας, σε πιο ήπιους τόνους σε σχέση με χθες, απηύθυνε ο Γερμανός υπουργός Οικονομικών Βόλφγκανγκ Σόιμπλε. Όπως ανέφερε, η Ευρώπη και το Διεθνές Νομισματικό Ταμείο (ΔΝΤ) είναι αποφασισμένοι να κάνουν ό,τι είναι δυνατό για να βοηθήσουν την Ελλάδα, υπό την προϋπόθεση ότι αυτή θα τηρήσει το μνημόνιο. «Η ΕΕ, η ευρωζώνη και το ΔΝΤ είναι αποφασισμ ένες να κάνουν το παν για να βοηθήσουν την Ελλάδα. Αλλά μόνο ο ελληνικός λαός μπορεί να αποφασίσει εάν η Ελλάδα είναι έτοιμη να κάνει ό,τι απαιτείται» σημείωσε χαρακτηριστικά.

Πρώτη μετεκλογική δημοσκόπηση

Κυβέρνηση συνεργασίας ζητούν δύο στους τρεις, πρώτο κόμμα εμφανίζεται ο ΣΥΡΙΖΑ Π

ρώτο κόμμα στην πρόθεση ψήφου αναδεικνύει τον ΣΥΡΙΖΑ η πρώτη μετεκλογική δημοσκόπηση που είδε το φως της δημοσιότητας την Πέμπτη. Εντούτοις, δύο στους τρεις ερωτηθέντες ζητούν κυβέρνηση συνεργασίας και μόνο ένας στους τρεις να γίνουν επαναληπτικές εκλογές. Σύμφωνα με δημοσκόπηση της εταιρείας Marc για τον τηλεοπτικό σταθμό Alpha, η εικόνα της πρόθεσης ψήφου σε επαναληπτικές εκλογές είναι η εξής: ΣΥΡΙΖΑ 23,8%, ΝΔ 17,4%, ΠΑΣΟΚ 10,8%, Ανεξάρτητοι Έλληνες 8,7%, ΚΚΕ 6%, Χρυσή Αυγή 4,9%, ΔΗΜΑΡ 4,2%, ΛΑΟΣ 2%, Οικολόγοι Πράσινοι 1,5%, ΔΗΣΥ 1,3%, Δράση 1,1%. Στο 11,8% οι αναποφάσιστοι. Με βάση την πρόθεση ψήφου, η κατανομή εδρών στη Βουλή είναι: ΣΥΡΙΖΑ 128 έδρες, ΝΔ 57, ΠΑΣΟΚ 36, Ανεξάρτητες Έλληνες 29 έδρες, ΚΚΕ 20, Χρυσή Αυγή 16 και Δημοκρατική Αριστερά 14 έδρες. Με τις αναγωγές η εκτίμηση ψήφου έχει ως εξής: ΣΥΡΙΖΑ 27,7%, ΝΔ 20,3%, ΠΑΣΟΚ 12,6%, Ανεξάρτητοι Έλληνες 10,2%, ΚΚΕ 7%, Χρυσή Αυγή 5%, ΔΗΜΑΡ 4,9%, ΛΑΟΣ 2,3%, Δημιουργία Ξανά 1,8%, Οικολόγοι Πράσινοι 1,7%, ΔΗΣΥ 1,5%, Δράση 1,3%. Σύμφωνα με την έρευνα, το εκλογικό αποτέλεσμα της 6ης Μαΐου βρίσκει τους ψηφοφόρους ελάχιστα ή καθόλου ικανοποιημένους κατά 53,2%. Αντίθετα πολύ ή αρκετά ικανοποιημένο δήλωσε το 44,8%. Στην πλειοψηφία το εκλογικό (36,3%) προκάλεσε «ανησυχία», στο 21,5% των ερωτηθέντων προκάλεσε «απογοήτευση», στο 21,9% «συγκρατημένη αισιοδοξία», στο 15% «ελπίδα» και στο 5,3% «αδιαφορία».Το 85,9 % των

ερωτηθέντων δήλωσε ότι αν γνώριζε το αποτέλεσμα των εκλογών, θα ψήφιζε το ίδιο κόμμα. Όμως, ένα ποσοστό 12,8% (μεταφράζεται σε περίπου 800.000 ψηφοφόρους) θα ψήφιζε άλλο κόμμα. Στην ερώτηση Ποιο κόμμα θα ψηφίζατε αν γνωρίζατε το αποτέλεσμα, το 23,2% απάντησε ΣΥΡΙΖΑ. Στο ίδιο ερώτημα: ΝΔ 19,6%, ΠΑΣΟΚ 1 2 , 5 % , Αν ε ξάρτητοι Έλληνες 10,4%, ΚΚΕ 6,9%, Χρυσή Αυγή 5,9%, ΔΗΜΑΡ 5,6%. Στο δίλημμα «επαναληπτικές εκλογές ή σχηματισμός κυβέρνησης συνεργασίας» δύο στους τρεις (62,7%) προτιμά κυβέρνηση συνεργασίας. Επαναληπτικές εκλογές ζητά το 32%. Στο ερώ-

24

τημα ποια κυβέρνηση συνεργασίας επιθυμείτε περισσότερο η πλειοψηφία (30,4%) επιθυμεί οικουμενική κυβέρνηση χωρίς τη Χρυσή Αυγή. Το

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΪΟΥ 2012

28,1% προτιμά συνεργασία των κομμάτων της Αριστεράς και το 24,7% κυβέρνηση ΝΔ, ΠΑΣΟΚ, ΣΥΡΙΖΑ και ΔΗΜΑΡ.

ΕΠΙΚΑΙΡΑ - 11 ΜΑΙΟΥ 2012  

ΕΠΙΚΑΙΡΑ - 11 ΜΑΙΟΥ 2012