Page 1

11

Καθημερινη ανεξαρτητη Εφημερiδα της κεντρικησ μακεδονιασ | αρ.φυλλου 511 | epikera@otenet.gr

Επικαιρα

ΠΑΡΑΣΚΕΥΗ μαρτιοσ 2011 TIMH: 0.50

Χωρίς νομίατρο εδώ και πολύ καιρό η Ημαθία

editorial

Πού μας πάνε; Β΄ Η «ΜΑΓΙΚΗ» ΣΥΝΤΑΓΗ «Θα σας στύψουμε μέχρι να αδειάσετε και μετά θα σας ξαναγεμίσουμε με τους εαυτούς μας» (Τζορτζ Όργουελ, 1984) Μια μεγάλη καταιγίδα χτυπάει, από τη δεκαετία του 1970 και μέχρι σήμερα, όλο τον κόσμο. Από την Αμερικανική Ήπειρο ως την Αφρική, από την Ευρώπη ως την Ασία. Η καταιγίδα του νεοφιλελευθερισμού ή του νεοσυντηρητισμού όπως προτιμούν οι εμπνευστές της. Σελ. 2

Το Χρονογράφημά μας Σελ.4

τοπικα

ΑΛΛΑΛΟΥΜ!

Δεν μπορούν να δώσουν λύση τα εμπλεκόμενα Υπουργεία

Σελ. 5

Δημοτικό Συμβούλιο Βέροιας: Άρχισαν οι συγχωνεύσεις των ΝΠΔΔ και επιχειρήσεων

Σελ. 9

τοπικα

Νέα διαμαρτυρία γονέων και μαθητών για την διακοπή των δρομολογίων

Σελ. 5

τοπικα

Άρθρο του ιστορικού Γ. Χ. Χιονίδη: «Αι Ειδοί του Μαρτίου» μας

Σελ. 10

Νέες αρχαιολογικές ανακαλύψεις στην αγορά των Αιγών

Σελ. 7

Πρατήριο Υγραερίου Πλυντήριο Λιπαντικά Αξεσουάρ Τα «Επίκαιρα» σε συνεργασία με το φροντιστήριο «ΕΝΑ» προτείνουν θέματα για τις πανελλαδικές εξετάσεις μαζί με τις λύσεις τους Σελ. 14-15


editorial

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

Όσο για τη «μαγική» συνταγή ο Μ. Φρίντμαν έγραφε: «Μόνο μια κρίση – είτε είναι πραγματική είτε εκλαμβάνεται ως πραγματική – οδηγεί σε πραγματικές αλλαγές (…) θα εφαρμόσουμε τις πολιτικές μας με επιμονή μέχρι το πολιτικά αδύνατο καταστεί πολιτικά αναπόφευκτο». Πρόβλεψη της συνταγής είναι ότι τα όποια μέτρα, οι όποιες αλλαγές πρέπει να επιβληθούν ακαριαία ει δυνατό, πριν η κοινωνία συνέλθει από το φόβο και την ανασφάλεια. Η πρόβλεψη αυτή αποτελεί μια παραλλαγή της υπόδειξης του Μακιαβέλι «τα πλήγματα πρέπει να επιφέρονται όλα μαζί»

Μ

ια καταιγίδα που ξεκίνησε με τις καλές προθέσεις των θεωρητικών της για έναν καλύτερο κόσμο και κατέληξε στην πράξη κόλαση για τους φτωχούς, τους ταπεινούς και τους καταφρονεμένους. Που πληθύνονται αλματωδώς τόσο που η φιλανθρωπία δεν μπορεί να τους εξασφαλίσει ούτε ένα πιάτο φαγητό.

Κ

άποια αόρατα χέρια στίβουν και ξεζουμίζουν τους λαούς και τις χώρες που, από αδυναμία, άγνοια ή σκοπιμότητας, ζήτησαν τη «βοήθειά» τους «πουλώντας – στην ουσία – την ψυχή τους στο διάβολο». Τους παίρνουν ό,τι έχουν και δεν έχουν μετατρέποντας τους σε είλωτες, σε ξένους στην ίδια τους την πατρίδα.

Η

απαίσια αυτή καταιγίδα που κάποιοι την ονομάζουν και καπιταλισμό της καταστροφής, χτύπησε και τη χώρα μας, με κάποια καθυστέρηση (ως συνήθως), το 2009 και τώρα λυσσομανά. Απειλώντας μας με πλήρη καταστροφή.

Η

περίπτωση μας (όπως και αυτή της Ιρλανδίας) παρουσιάζει μερικές ιδιομορφίες με βασική το γεγονός ότι δεν βρισκόμαστε απολύτως στο, έλεος του ΔΝΤ ή της Παγκόσμιας Τράπεζας, αφού στους «σωτήρες» μας συμπεριλαμβάνεται και η Ε.Ε. πράγμα που ασφαλώς έχει τη σημασία του. Θα πρέπει ωστόσο να μην ξεχνάμε ότι ο Πρωθυπουργός μας ήταν αυτός που, σε ανύποπτο χρόνο κι ενώ εξόρκιζε την παρέμβαση του ΔΝΤ, ζήτησε πρώτα- πρώτα τη βοήθεια του ΔΝΤ και πολύ αργότερα, της Ευρωπαϊκής Ένωσης και της Ε.Κ.Τ Να μην ξεχνάμε επίσης ότι η Γερμανία πριν προχωρήσει στο Μνημόνιο ζήτησε τη συμμετοχή του ΔΝΤ, λόγω – όπως είπε – της «τεχνογνωσίας» του.

Επiκαιρα Καθημερινη aneξαρτητη ΕφημερΙδα της Κεντρικής Μακεδονίας

κωδ. 8452

IÄÉÏÊÔÇÓÉÁ : ÅÐÉÊÁÉÑÁ EKÄÏÔÉÊÇ Á.Å. ÃÑÁÖÅÉÁ: ÅëçÜò 3, ÂÝñïéá, 1ïò üñïöïò ÅÐÉÊÏÉÍÙÍÉÁ Tçë. 23310. 78080 - 6 FAX 23310. 78087 email: epikera@otenet.gr ÅÊÄÏÔÇÓ - ÄÉÅÕÈÕÍÔÇÓ: NIKOÓ ÐÁÐÁÍÉÊÏËÁÏÕ AÑ×ÉÓÕÍÔÁÊÔÑÉÁ: ÍÉÊÏËÅÔÔÁ ÖËÉÁÔÁÑÇ ÓÕÍÔÁÊÔÅÓ: ÊÙÍÓÔÁÍÔÉÍÁ ÊÁÑÁÃÉÁÍÍÇ ÊÙÓÔÇÓ ×ÁËÁÔÓÇÓ ÓÕÍÅÑÃÁÔÅÓ ÄÇÌÇÔÑÁ ÓÌÕÑÍÇ Ó×ÅÄÉÁÓÌÏÓ: ×ÁÑÇÓ ÌÁ×ÁÉÑÁÓ HAPPY ARTISTS DESIGNER TEAM www.happyartists.gr email: info@happyartists.gr PAGE DESIGNERS ÃÅÙÑÃÉÁ ÏÉÊÏÍÏÌÉÄÏÕ ÌÅËÉÍÁ ÐÏÕÔÏÃËÉÄÏÕ Äéáöçìéóôéêü ôìÞìá

Επειδή δηλ. είχε μεγάλη πείρα στη «δουλειά» αυτή. Και είχε όντως! Αυτό βλέπεις εφάρμοσε ή επέβαλε την εφαρμογή της «μαγικής» συνταγής του Μίλτον Φρίντμαν και της Σχολής του Σικάγου. Η ΣΥΝΤΑΓΗ Η συνταγή αυτή επιγραμματικά περιγράφεται θαυμάσια (προφητικά θα έλεγε κανείς) από τη φράση του Τζ. Όργουελ στο «1984». «Θα σας στύψουμε μέχρι να αδειάσετε και μετά θα σας ξαναγεμίσουμε με τους εαυτούς μας».

Α

υτό φαίνεται καθαρά από τη στρατηγική που τελειοποιούσαν, επί 30 και πλέον χρόνια, ο Μίλτον Φρίντμαν και οι πολυδύναμοι οπαδοί του (μεταξύ αυτών Πρόεδροι των ΗΠΑ, Πρωθυπουργοί της Βρετανίας, Ρώσοι ολιγάρχες, δικτάτορες του τρίτου κόσμου, Γενικοί Γραμματείς του ΚΚ της Κίνας, αξιωματούχοι του ΔΝΤ, οι τελευταίοι επικεφαλής της Τράπεζας των ΗΠΑ) τη στρατηγική: αναμονή κάποιας μείζονος κρίσης προκειμένου να εκποιήσουν τμήματα της δημόσιας σφαίρας σε ιδιώτες ενόσω οι πολίτες είναι ακόμη ζαλισμένοι από το σοκ και να μονιμοποιήσουν στη συνέχεια τις «μεταρρυθμίσεις».

Ό

σο για τη «μαγική» συνταγή ο Μ. Φρίντμαν έγραφε: «Μόνο μια κρίση – είτε είναι πραγματική είτε εκλαμβάνεται ως πραγματική – οδηγεί σε πραγματικές αλλαγές (…) θα εφαρμόσουμε τις πολιτικές μας με επιμονή μέχρι το πολιτικά αδύνατο καταστεί πολιτικά αναπόφευκτο». Πρόβλεψη της συνταγής είναι ότι τα όποια μέτρα, οι όποιες αλλαγές πρέπει να επιβληθούν ακαριαία ει δυνατό, πριν η κοινωνία συνέλθει από το φόβο και την ανασφάλεια.

2

Η πρόβλεψη αυτή αποτελεί μια παραλλαγή της υπόδειξης του Μακιαβέλι «τα πλήγματα πρέπει να επιφέρονται όλα μαζί»

Ο

πυρήνας της συνταγής είναι: «Ελεύθερες (ασύδοτες μάλλον) αγορές, χαμηλή, φορολογία για τις μεγάλες επιχειρήσεις, αποσυντονισμός της κρατικής μηχανής, διάλυση του κοινωνικού κράτους. Όσο για τα αποτελέσματα της (αύξηση των φτωχών και της φτώχειας, μείωση του αριθμού των πλουσίων με παράλληλη αύξηση του πλούτου τους) σημειώνουμε ενδεικτικά ότι: Στην Κίνα, παρά τη μεγέθυνση της οικονομίας το εισοδηματικό χάσμα μεταξύ των κατοίκων των πόλεων και των 800 εκατομμυρίων κατοίκων της υπαίθρου διπλασιάστηκε την τελευταία 20ετία. Στην Αργεντινή το 1970 τα εισοδήματα των πλουσίων (του 10% του πληθυσμού) ήταν 12 φορές μεγαλύτερο από αυτά των υπολοίπων κατοίκων. Το 2002 η διαφορά αυτή ήταν 43 φορές μεγαλύτερη! Σύμφωνα με μελέτη του ΟΗΕ «το πλουσιότερο 2% των ενηλίκων του πλανήτη κατέχει περισσότερο από το μισό παγκόσμιο κατά κεφαλή πλούτο». Και για τα «γκόλντεν μπόϊς»: Το 1980, που ο Ρέϊγκαν ξεκίνησε την εφαρμογή της «συνταγής» Φρίντμαν, οι αμοιβές των διευθυνόντων συμβούλων ήταν 43 φορές μεγαλύτερες από την αμοιβή του μέσου εργαζόμενου, το 2005 οι αμοιβές των διευθυντών συμβούλων ήταν… 411 φορές, μεγαλύτερες! Αυτό θα πει δικαιοσύνη!

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

Επίκαιρα

Î. ÌÐÁÑÁËÉÁÊÏÓ Ô. ÏÉÊÏÍÏÌÉÄÏÕ ÅÊÔÕÐÙÓÇ:

É. ÊïñïìÞëçò Á.Å. ÓÕÍÄÑÏÌÅÓ: Åóùôåñéêïý åôÞóéá 90 åõñþ Åîùôåñéêïý åôÞóéá äïë. 250 Ôñáðåæþí - Ïñãáíéóìþí 300 åõñþ e-mail: epikera@otenet.gr

Απαγορευεται Το σύνολο των περιεχομένων και των υπηρεσιών της εφημερίδας «ΕΠΙΚΑΙΡΑ ΤΗΣ ΚΕΝΤΡΙΚΗΣ ΜΑΚΕΔΟΝΙΑΣ διατίθεται στους αναγνώστες αυστηρά για προσωπική χρήση. Απαγορεύεται η χρήση ή επανεκπομπή του, σε οποιοδήποτε μέσο, μετά ή άνευ επεξεργασίας, χωρίς γραπτή άδεια του εκδότη.


ΣΧΟΛΙΑ 

epikera@otenet.gr

Γιατί όχι εδώ; Νέα ευρήματα στην αγορά των Αιγών ανακοινώνει η αρχαιολόγος και μαθήτρια του Μανόλη Ανδρόνικου Χρύσα Παλιαδέλη στην 24η Επιστημονική Συνάντηση για το Αρχαιολογικό Εργο στη Μακεδονία και τη Θράκη, που ξεκινά σήμερα στο κτήριο της παλιάς Φιλοσοφικής Σχολής του ΑΠΘ και θα διαρκέσει ώς τις 12 Μαρτίου. Τα νέα ευρήματα ακολουθούν την αποκάλυψη στο ιερό της Εύκλειας όπου βρέθηκε μεταλλικό δοχείο το οποίο περιείχε καμένα οστά, χρυσό στεφάνι βελανιδιάς και πορφυρό ύφασμα. Επίσης το 2009, σε απόσταση 5 μ. βρέθηκαν ακόμη δύο πολύτιμα αγγεία. Μια αργυρή υδρία, με ακτέριστα καμένα οστά ενήλικου ατόμου, άγνωστου φύλου και ηλικίας, και ένας μοναδικός για τον ελληνικό χώρο αργυρός παναθηναϊκός αμφορέας με επιχρύσωση και εγχαράξεις μιας αδιάγνωστης μέχρι στιγμής παράστασης. Στα νέα ευρήματα (στο εσωτερικό του αργυρού αμφορέα) συγκαταλέγονται τα καμένα οστά μικρού παιδιού ηλικίας 3-7 ετών, όπως έδειξε η οστεοαρχαιολογική μελέτη της δρος Σέβης Τριανταφύλλου. Βρήκαν, επίσης, χρυσά σκουλαρίκια με φτερωτή Νίκη, χρυσά διακοσμητικά δισκάρια που κοσμούνται με ακτίνες και γοργόνειο (κεφαλή Μέδουσας) και χρυσό στεφάνι, πιθανότατα ελιάς. Μάλιστα η εφημερίδα «Ελευθεροτυπία» που προβάλει το θέμα γράφει ότι το συγκεκριμένο στεφάνι είναι ίδιο με αυτό του Μ. Αλέξανδρου. Είναι αδιαμφισβήτητο γεγονός ότι η περιοχή της Βεργίνας κρύβει πολλά ακόμα στα σπλάγχνα της, τα οποία και θα μας εκπλήττουν και ίσως προσθέσουν νέα δεδομένα στα μέχρι τώρα ιστορικά στοιχεία Ωστόσο αυτές όλες τις σημαντικές ανακαλύψεις δεν θα έπρεπε να τις ανακοινώνουν πρώτα στο χώρο όπου βρέθηκαν, όπως έκανε ο αείμνηστος Ανδρόνικος; Αν κοιτάξει κάποιος τις τοπικές εφημερίδες εκείνης της εποχής, όταν αποκαλύφθηκε ο τάφος του Φιλίππου και μετά, θα δει ότι ο καθηγητής βρισκόταν συχνά στην αίθουσα της Στέγης Γραμμάτων και Τεχνών όπου εξηγούσε τι βρέθηκε και πως το αξιολογεί. Μήπως οι τοπικές αρχές θα έπρεπε να δουν το ζήτημα και να ζητήσουν να γίνονται εδώ οι παρουσιάσεις; Ή έστω και εδώ!

Πληγή το παραεμπόριο Σε μεγάλη πληγή όχι μόνο για το στεγασμένο εμπόριο αλλά και για τα έσοδα του κράτους αναδεικνύεται το παρεμπόριο, αφού έχει λάβει τεράστιες διαστάσεις. Σύμφωνα με στοιχεία του Ινστιτούτου του Εμπορίου και Υπηρεσιών (ΙΝΕΜΥ), της Εθνικής Συνομοσπονδίας Ελληνικού Εμπορίου το 20 με 30% του εμπορίου στη χώρα μας διακινείται μέσω του παραεμπορίου, ενώ ο τζίρος του εκτιμάται ότι ανέρχεται στα 20 δισεκατομμύρια ευρώ. Αυτό σημαίνει ότι οι απώλειες από τα έσοδα του κράτους, από ΦΠΑ και φόρους, φθάνει τα 8,5 δισεκατομμύρια ευρώ. Εν μέσω οικονομικής κρίσης, γίνονται προσπάθειες από πλευράς της κυβέρνησης, σε συνεργασία με το ΣΔΟΕ, την δημοτική και την ελληνική αστυνομία, καθώς και απ’ όλους τους αρμόδιους φορείς, για τον περιορισμό του φαινομένου και την είσπραξη των νόμιμων φόρων. Παρ΄όλα αυτά τα αποτελέσματα είναι μέχρι στιγμής πενιχρά. Στην περιοχή μας τα πράγματα είναι λίγο καλύτερα απ΄ ότι σε Αθήνα και Θεσσαλονίκη , αλλά δεν παύουν να υπάρχουν, γεγονός που δημιουργεί προβλήματα στην αγορά η οποία αυτή τη στιγμή στενάζει από την «ακινησία». Προφανώς είναι απαραίτητη μια αυστηρότερη νομοθεσία, όπως και μεγαλύτερη εγρήγορση από την Τοπική Αυτοδιοίκηση και τους Εμπορικούς Συλλόγους. Ίσως συντονισμένες κινήσεις να φέρουν καλύτερα αποτελέσματα.

Άγνοια… Μέχρι και με τον Γενικό Διευθυντή του Υφυπουργού Eσωτερικών κ. Ντόλιου, κ. Γεωργούλη, επικοινώνησαν οι Σύλλογοι Γονέων και Κηδεμόνων των Καλλικρατικών Δήμων Βέροιας και Αλεξάνδρειας, οι οποίοι προχώρησαν χθες σε κινητοποιήσεις διαμαρτυρίας με αφορμή την διακοπή των μαθητικών δρομολογίων. Οι Σύλλογοι Γονέων και Κηδεμόνων μίλησαν με τον κ. Γεωργούλη για τα προβλήματα που αντιμετωπίζει η μαθητική κοινότητα του Νομού Ημαθίας εξαιτίας της διακοπής των μαθητικών δρομολογίων αλλά όπως φάνηκε από τα λεγόμενα του, ο ίδιος μόνο ενημερωμένος δεν ήταν για τα όσα διαδραματίζονται την τελευταία εβδομάδα. Ο κ. Γεργούλης αφού ενημερώθηκε για το θέμα, τόνισε ότι μέσα την επόμενη εβδομάδα θα κατατεθεί το φορολογικό νομοσχέδιο το οποίο περιλαμβάνει ειδική ρύθμιση για τη μεταφορά οπότε και το ζήτημα θα λυθεί. Από την πλευρά τους οι γονείς δηλώνουν αποφασισμένοι να συνεχίσουν με πιο δυναμικό τρόπο τις κινητοποιήσεις τους και να μην στείλουν τα παιδιά τους σχολείο μέχρι την επόμενη Τρίτη, οπότε και θα αποφασίσουν για τις επόμενες κινήσεις τους.

3

Η Αγορά των Λεμονιών

Χ

Ο πατέρας του Τζόρτζ ήταν Σουηδός, αλλά η μάνα του Γερμανοεβραία. Αναμενόμενο ήταν να ασχοληθεί με τα οικονομικά και μάλιστα έφθασε να γράψει ένα πόνημα με τίτλο “Η Αγορά των Λεμονιών”, όπου καταπιάστηκε με τα πώς και τα γιατί καταρρέει μια αγορά, τις αιτίες που ολόκληροι οργανισμοί και συστήματα οδηγούνται κάποτε σε ένα σπιράλ βύθισης προς την ανυπαρξία. Στην αγορά του μεταχειρισμένου αυτοκινήτου “Κεράσια” λέγονται τα κελεπούρια ενώ “Λεμόνια” σιγοψιθυρίζονται τα ψοφίμια. Ο μέσος καταναλωτής ξεκινά με καλή πίστη, έχει μέτρια ενημέρωση, και καμία σχεδόν εγγύηση. Όταν οι λεχρίτες επιτήδειοι του πασάρουν αβέρτα Λεμόνια, η πληροφορία διαχέεται αστραπιαία στην αγορά, και οι καταναλωτές κουμπώνονται ως το σαγόνι. Η πανικοβλημένη αγορά αναγκάζεται να διαφυλάξει τα ασημικά της, συστέλλεται, κι έτσι μένουν όλο και περισσότερα Λεμόνια προς πώληση, αφού οι καλοί πωλητές, περιμένουν μια κάποια ανάκαμψη για να βγουν στο έντιμο πάρε-δώσε. Εξάλλου και Κεράσια να πουλήσεις, τώρα που χάθηκε η εμπιστοσύνη, δεν θα σου τα πάρουν πάρα για το ¼ της τιμής. Όταν έτσι οι νοικοκυραίοι πωλητές κάνουν πίσω, τα Λεμόνια σαφώς περισσεύουν και το σύνολο της αγοράς των μεταχειρισμένων οδηγείται μαθηματικά στην δια στραγγαλισμού ασφυξία, στην ανυποληψία και την κατάρρευση. Παν τα κεράσια, παν τα λεμόνια, παν όλα, μια πάμπτωχη μοναξιά απομένει περίβλεπτος. Ο Τζόρτζ εκτίμησε σοφά, πως το ίδιο συμβαίνει και στην αγορά των ασφαλειών για τους ηλικιωμένους, ή λ.χ. στις πιστωτικές κάρτες για αναπτυσσόμενα κράτη όπως κάποτε π.χ. η Ελλάδα. Πλημμύρισε η αγορά από Λεμόνια συμβόλαια, αυτονόητο ήταν ότι τα Κεράσια είτε διαφυλάχθηκαν, είτε παραμερίστηκαν από τους σαλτιμπάγκους. Έτσι επιβεβαιώνεται η προφητεία του συγγραφέα αφού βλέπουμε και αυτούς τους δύο τομείς να έχουν συνθλιβεί από το ίδιο το βάρος του υπερπληθωρισμού τους, από το φορτίο της αναξιοπρέπειας. Οι ασφαλιστικές μαραζώνουν, ενώ οι πιστωτικές εξορκίζονται ως δαιμονικά. Εύλογα, νεώτερα μυαλωμένα παιδιά (Χρ. Παπαδημητρίου) κάναν μια αναγωγή στο πολιτικό σύστημα προσπαθώντας να εξηγήσουν γιατί μια χώρα όπως η δική μας έχει ηθικά καταποντιστεί, κοινωνικά διαλυθεί και οικονομικά εκπορνευθεί. Μα τελικά είναι απλό : Στην “αγορά” των Πολιτικών κυριάρχησαν τα Λεμόνια. Οι καλογυαλισμένοι φελλοί, οι ποταπά ανήθικοι, οι λυσαγμένοι αριβίστες, τα νεποτικά παράσιτα και η κομματική μαφία υπό τη σκοτεινότερη έννοιά της. Με αυτά τα δεδομένα οι καθαροί, οι ικανοί, τα αρχοντικά χέρια που θα οδηγούσαν το δοιάκι σε καθαρούς ανηφορικούς δρόμους ανάπτυξης, αποσύρθηκαν. Όλο και λιγότεροι ευγενικοί μπερδεύονται στα μπαλκονάτα .βοθρολύμματα. Ως αποτέλεσμα κλαίμε με την οδυνηρή κατρακύλα, κι ας ξεκινήσαμε οι ψηφοφόροι καλόπιστα, μετρίως ενημερωμένοι και ανεγγύητα. Η περιδίνηση κάνει τη μαύρη τρύπα που μας καταπίνει αχόρταγα, μια αιμοτραφή τσουλήθρα δίχως έξοδο κινδύνου Πιστέψαμε, αλλά σε μια φενάκη. Τώρα όλα αποτελούν λεία θανάτου, και δεν υπάρχει διέξοδος, αν δεν αναστηθεί η πολιτική αγορά ποδοπατώντας τα λαμόγια της. Να εγερθούμε και αφού διαλυθεί στα εξ ων συνετέθει το κομματικό κράτος, να βάλουμε όλοι ένα χεράκι. Εκπαραθύρωση ως στυμμένες λεμονόκουπες όσων εξασφάλισαν και την ατιμωρησία τους, κι αναζήτηση με το κερί των Κερασιών που ίσως τολμήσουν με τη δειλία των αληθινών ηγητόρων να μας βγάλουν επάνω ΥΓ. O George Akerlof , γεννημένος το 1940, είναι σήμερα καθηγητής στο καλιφορνέζικο εκ των κορυφαίων παγκοσμίως πανεπιστήμιο Berkeley, το άρθρο του “The Market for Lemons” δημοσιεύτηκε το ‘70, ενώ το 2001 του απονεμήθηκε το Νόμπελ Οικονομικών.

Χαρτογράφος

χαρτογράφος

«Ελλάς το μεγαλείο σου» ! Αγανακτισμένος φαίνεται ο Αντιπεριφερειάρχης Κώστας Καραπαναγιωτίδης, αν κρίνουμε από το ύφος της επιστολής, (ή αλλιώς υπηρεσιακού εγγράφου) που απέστειλε σε όλους τους εμπλεκόμενους φορείς σχετικά με την έλλειψη νομίατρου στην Ημαθία. Η εφημερίδα μας είχε αναδείξει το θέμα πριν καιρό, αλλά φαίνεται η πρόσκαιρη λύση που δόθηκε δεν κράτησε για πολύ. Μάλιστα ο κ. Καραπαναγιωτίδης, αφήνει στην άκρη την ξύλινη γλώσσα που συνήθως επικρατεί στην υπηρεσιακή αλληλογραφία και μιλά με τη γλώσσα που χρησιμοποιούν οι πολίτες όταν αντιμετωπίζουν προβλήματα στις συναλλαγές τους με το δημόσιο. Το ζήτημα αφορά μια μεγάλη μερίδα πολιτών που είτε θέλουν να δουλέψουν, είτε θέλουν να ανοίξουν ή να λειτουργήσουν την επιχείρησή τους και δεν μπορούν να έχουν το βιβλιάριο ασθενείας. Για την έλλειψη του οποίου, όπως πολύ σωστά αναφέρει ο Αντιπεριφερειάρχης, θα τους δοθεί πρόστιμο, έστω και αν δεν ευθύνονται. Να μην μιλήσουμε για τις υπόλοιπες υπηρεσίες που είναι απαραίτητη η συμβολή και η προσφορά του νομίατρου, όπως λόγου χάριν στους ελέγχους στα κυλικεία των σχολείων. Τι να πει κανείς πέρα από το γνωστό «Ελλάς το μεγαλείο σου» !

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011


ΤΟΠΙΚΑ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

Σύσκεψη για την εφαρμογή του προγράμματος «Διαύγεια» από το Δήμο Νάουσας

ά μ η φ ά ρ ς ονογ α ρ μ Το

Χ

Ακριβή μου Γυναίκα! «Πριν απ’ τα μάτια μου ήσουν φως. Πριν απ’ τον έρωτα, Έρωτας. Κι όταν σε πήρε το φιλί Γυναίκα» Ο ευλογημένος, ο Ελύτης, τα είπε όλα μ’ ένα επίγραμμα. Πώς να πρωτοτυπήσει, ο θείος Αφεντούλης, με την ευκαιρία της Παγκόσμιας Ημέρας της Γυναίκας; Ακούστε τώρα ερώτηση που βρήκε να κάνει ο υποβολέας. Γιατί να απευθύνει μήνυμα, ο θείος; Δεν αρκεί το γεγονός ότι έχει σύζυγο; Ο υποβολέας διευκρινίζει ότι ο ίδιος, θέλει να πιστεύει και όλοι εμείς, γνωρίζουμε την κυρία Πολυτίμη που στέκεται δίπλα, στον Αφεντούλη, για μισό και πλέον αιώνα, αληθινός… «Βράχος»! Ο θείος δεν θα τα πάει καθόλου καλά με τον υποβολέα! Αδημονεί να ακούσει περαιτέρω εξηγήσεις για τον «Βράχο»! Ποια άλλη θα ανέχονταν, τόσα χρόνια, δίπλα της, ένα «στραβόξυλο» που έχει στην τσέπη τις «εξαναστάσεις», όπως ο Αφεντούλης; Ο υποβολέας έχει χάρη επειδή ο θείος απευθύνεται σε γυναίκες. Αλλιώς θα τον «έπιανε στο στόμα», να μάθει τι θα πει «στραβόξυλο»! Είναι τυχερός γιατί αποτελεί, έναν από τους 21 αναγνώστες της στήλης, οι οποίοι «βάζουν πλάτη» για να γίνει διάσημος. Παρακαλείται λοιπόν, ο υποβολέας, να μείνει, επί του κειμένου, και να μη γίνει αιτία να επιστρέψει, ο Αφεντούλης, στην αφάνεια! Επιστροφή στις γυναίκες. Ο θείος αισθάνεται την ανάγκη να ευχαριστήσει δημοσίως, την κυρία Πολυτίμη. Ας τον συγχωρήσουν οι άλλες γυναίκες, αναγνώστριες και μη. Η θεία ανάστησε τα παιδιά, μεγάλωσε τα εγγόνια, για να δουλέψουν οι γονείς τους, και είναι έτοιμη να αναλάβει τα δισέγγονα. Αν καταφέρουν να εργαστούν τα εγγόνια! Πού να βρουν όμως δουλειά, στην εποχή της Τρόικας. Τι σόι κουμάντα έκαναν, οι συντάκτες του Μνημονίου, και τραβάει, η ανεργία, την ανηφόρα; Βγαίνουν τώρα, κάποιοι επαΐοντες, στις τηλεοράσεις, και διαπιστώνουν ότι έχει πλήξει περισσότερο τις γυναίκες; Δεν το βλέπει ο Αφεντούλης; Όλες οι εγγονές, με και χωρίς πτυχία, εισπράττουν τα «πτωχεία» της ανεργίας! Το κεντρικό σύνθημα, του θείου, είναι να φροντίσουμε όλοι ώστε να αφήσουμε άνεργη, την ανεργία, ιδιαιτέρως των νέων. Να βρει απασχόληση και η θεία, με τα δισέγγονα, και να γλιτώσει, από τη γκρίνια της, αυτός ο εξαιρετικός (Λέμε τώρα!) εμπειροτέχνης πολιτικός αναλυτής. Η ισότητα- κι αν δεν έχουν δώσει αγώνες τα γυναικεία κινήματα- ξεκινά από την εργασία. Υπάρχουν βέβαια και πολλές άλλες αδικίες. Αυτές διορθώνονται στην πορεία. Για τον Αφεντούλη, προέχει η αξιοπρεπής δουλειά με δίκαιη αμοιβή για όλες τις γυναίκες. Μια χαρά τα είπαν οι πολιτικοί ταγοί στα δικά τους μηνύματα. Αρκεί να μην ξεχαστούν, από

την επόμενη μέρα, όπως συμβαίνει συνήθως με τις Παγκόσμιες Ημέρες. Υποβολέα, έλα τώρα να αποτίσουμε φόρο τιμής, στις μεγάλες προγονικές γυναικείες μορφές. Στις ηρωίδες του Ζαλόγγου, της Αράπιτσας, της Πίνδου, στις Αντάρτισσες, στη Μπουμπουλίνα, στη Μαντώ κλπ. Τις διδαχές τους ακολουθούν σήμερα πολλές γυναίκες στην πολιτική, στην επιστήμη και στην τέχνη. Στο σημείο αυτό, ο θείος, θα αναφερθεί στη μητέρα του. Μανούλα! Το άλφα της ζωής και το ωμέγα της ανατροφής! Ο Αφεντούλης ενηλικιώθηκε στα 65. Τότε την έχασε! Για τη σύζυγο τα είπε ο υποβολέας. «Βράχος»! Χωρίς εκείνη, ο θείος, μπορεί να έψαχνε «Γεροντόβραχο»! Ο Αφεντούλης, θυμήθηκε ότι παλιότερα, τέτοια μέρα, προσφέραμε, στις κυρίες, μαζί με τα μηνύματα, και τριαντάφυλλα. Φέτος ένα κάποιο άλλοθι προσφέρει η όψιμη κακοκαιρία. Κι εσείς όμως, βρε «σπάταλες Ελληνίδες», δεν μπορούσατε να φυλάξετε τα παλιά για να αποδειχθούμε ευγενείς, όλοι εμείς οι σύζυγοι, και στους χαλεπούς καιρούς της Τρόικας; Τι ρώτησες υποβολέα; Ποια η συνεισφορά του Αφεντούλη στο φεμινιστικό κίνημα; Την πάτησες, αν νόμισες ότι ο θείος είναι μόνον λόγια. Κατά την απογραφή του ’81, αν δεν τον απατά η μνήμη του, άκουσε τον γείτονα «Μήτσο» να δηλώνει στον αρμόδιο υπάλληλο: «Στο σπίτι Μου μένουμε: Εγώ, ένα παιδί, ένα κορίτσι, 30 κότες και η γυναίκα Μου!» Εκεί να βλέπατε τι «εξανάσταση» έκανε ο Αφεντούλης. Μετά το φραστικό «καταχέριασμα», βούτηξε τον «Μήτσο», του φόρεσε ποδιά και τον έβαλε να πλύνει τα πιάτα. Τον παραξένεψαν όμως οι ευχαριστίες. Όχι της κυρίας «Μήτσαινας». Του «Μήτσου»! Ανακάλυψε μια ευχάριστη απασχόληση, την οποία συνεχίζει μέχρι σήμερα! Αυτά να τα έχουν υπόψη όλες οι γυναίκες και να εμπιστεύονται τη στήλη του θείου για έγκυρη και έγκαιρη ενημέρωση. Παρακαλείται η κυρία Πολυτίμη να σταματήσει να φωνάζει: «Κατόπιν εορτής»! Υποβολέα εδώ τελείωσε το μήνυμα. Έλα να δηλώσουμε συμπαραστάτες, στους αγώνες των γυναικών, για κοινωνική δικαιοσύνη, και, αν το ξέχασες που το ξέχασες(!), πήγαινε να προσφέρεις ένα λουλούδι στη σύζυγο. Τι είπες; Σε «άρμεξε» η Τρόικα και είσαι ρέστος; Συνάδελφε! «Μια κάποια λύσις» είναι ο ανθόκηπος συγγενών και φίλων, κατόπιν αδείας βέβαια και αν τη σκαπουλάρισε κανένα λουλουδάκι, από τον χιονιά. Προσοχή όμως στα σκυλιά! Αν σε δουν να ξερογλείφεσαι, δαγκώνουν. Νομίζουν ότι λιγουρεύεσαι το φαί τους! Κυρίες, ο θείος, παρακαλεί να δεχτείτε, εκ μέρους του, την ευγνωμοσύνη όλων.

4

Η

εφαρμογή του προγράμματος «Διαύγεια» στο Δήμο Νάουσας ήταν το θέμα της ευρείας σύσκεψης που έγινε την Πέμπτη (10/3) στο Δημαρχείο. Κατά τη διάρκεια της σύσκεψης τα Στελέχη και το προσωπικό του Δήμου, το οποίο συγκροτεί την Ομάδα Διοίκησης Έργου (ΟΔΕ) που προβλέπει ο Νόμος 3861/2010, ενημερώθηκαν για τις διαδικασίες και τον τρόπο εφαρμογής της «Διαύγειας», καθώς και για τις τεχνικές λεπτομέρειες προσαρμογής στις απαιτήσεις του προγράμματος που, μεταξύ άλλων,

επιβάλλει από 15/3 την ανάρτηση στο διαδίκτυο (internet) όλων των αποφάσεων του Δήμου και των Νομικών Προσώπων, με σκοπό την ενημέρωση των δημοτών και την διασφάλιση της διαφάνειας στη διοίκηση και τη λήψη των αποφάσεων. Στη σύσκεψη συμμετείχαν οι Αντιδήμαρχοι: κ. Ευδοξία Ιτσκάρα-Θανασούλη, κ. Μαρία-Καρυδά Μυλωνά, κ. Εμμανουήλ Βαδόλας, ο Γεν. Γραμ/τέας του Δήμου κ. Γιώργος Αδαμίδης, ο Νομικός Σύμβουλος του Δήμου κ. Ταξιάρχης Κωστής, η Δ/ντρια κ. Βασιλική Κουλτζή, προϊστάμενοι και υπάλληλοι των Υπηρεσιών του Δήμου που θα εφαρμόσουν το πρόγραμμα «Διαύγεια».

Από το Επιμελητήριο Ημαθίας και την ΚΕΠΑ-ΑΝΕΜ Ενημερωτική εκδήλωση με θέμα «Εξωστρέφεια – Ανταγωνιστικότητα των Επιχειρήσεων»

Τ

ο Επιμελητήριο Ημαθίας, μέλος της ΚΕΠΑ-ΑΝΕΜ, που είναι εταίρος του Ενδιάμεσου Φορέα Διαχείρισης του Επιχειρησιακού Προγράμματος ΑΝΤΑΓΩΝΙΣΤΙΚΟΤΗΤΑ ΚΑΙ ΕΠΙΧΕΙΡΗΜΑΤΙΚΟΤΗΤΑ 2007-2013 (ΕΠΑΝ ΙΙ) ΕΦΕΠΑΕ (με γεωγραφική ευθύνη τις Περιφέρειες της Κεντρικής και Δυτικής Μακεδονίας), σε συνεργασία με την ΚΕΠΑ-ΑΝΕΜ, συνδιοργανώνουν την Τετάρτη 23 Μαρτίου 2011 και ώρα 7:00 μμ, στην Αίθουσα Συνεδριάσεων του Επιμελητηρίου Ημαθίας, (Βέροια - Κεντρικής 3, 1ος όροφος) ενημερωτική εκδήλωση με θέμα: « Εξωστρέφεια – Ανταγωνιστικότητα των Επιχειρήσεων » Ομιλητές στην εκδήλωση θα είναι στελέχη της ΚΕΠΑ-ΑΝΕΜ και του Συνδέσμου Εξαγωγέων Βορείου Ελλάδος (Σ.Ε.Β.Ε.). Η είσοδος στο κοινό είναι ελεύθερη Ώρα Προσέλευσης 6:40 μμ Έναρξη Εκδήλωσης 7:00 μμ

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

Το έργο συγχρηματοδοτείται από την Ευρωπαϊκή Ένωση – Ευρωπαϊκό Ταμείο Περιφερειακής Ανάπτυξης και το Ελληνικό Δημόσιο ({Ε.Π. Ανταγωνιστικότητα και Επιχειρηματικότητα (ΕΠΑΝ ΙΙ)}, ΠΕΠ Μακεδονίας – Θράκης, ΠΕΠ Κρήτης και Νήσων Αιγαίου, ΠΕΠ Θεσσαλίας, Στερεάς Ελλάδας και Ηπείρου, ΠΕΠ Αττικής).


ΤΟΠΙΚΑ 

epikera@otenet.gr

Χωρίς νομίατρο εδώ και πολύ καιρό η Ημαθία

Αλλαλούμ! Δεν μπορούν να δώσουν λύση τα εμπλεκόμενα Υπουργεία Επιστολή καταπέλτης του Αντιπεριφερειάρχη

Ε

πιστολή για το θέμα της «τοποθέτησης ιατρού Υγειονολόγου στη Δ/νση Δημόσιας Υγείας & Κοινωνικής Μέρμνας της Περιφ. Ενότητας Ημαθίας της Περιφέρειας Κεντρικής Μακεδονίας» έστειλε ο αντιπεριφερειάρχης Κώστας Καραπαναγιωτίδης προς το Υπουργείο Υγείας και Κοινωνικής Αλληλεγγύης, τον Περιφερειάρχη Κεντ. Μακεδονίας Παναγιώτη Ψωμιάδη, την Αποκεντρωμένη Διοίκηση Μακεδονίας – Θράκης στο Γραφείο Γενικού Γραμματέα κ. Σώκου, την 3η Υγειονομική Περιφέρεια Μακεδονίας και στο αρμόδιο τμήμα της Αποκεντρωμένη Διοίκηση Μακεδονίας – Θράκης. Στην επιστολή ο κ. Καραπαναγιωτίδης αναφέρει: «Από 1/1/2011 δεν υπάρχει γιατρός Υγειονολόγος στην Υπηρεσία με αποτέλεσμα η ανοχή των πολιτών να έχει εξαντληθεί και μετατράπηκε πλέον σε ύβρεις, απειλές και κοροϊδίες. Επειδή τους πολίτες πολύ λίγο τους ενδιαφέρει αν ευθύνεται η α΄ ή η β΄ βαθμίδα διοίκησης για την έλλειψη ιατρού, παρακα-

λούμε να βρεθεί οπωσδήποτε λύση. Η Αποκεντρωμένη Διοίκηση Μακεδονίας – Θράκης προσπάθησε να δώσει λύση στο πρόβλημα και συγκεκριμένα ο Διοικητής της 3ης Υγειονομικής Περιφέρειας Μακεδονίας Ζηλίδης Χρήστος συναίνεσε στη διάθεσή της γιατρού ΕΣΥ Ευδοκίας Παπανικολάου στο να προσφέρει τις υπηρεσίες της στη Δ/νσή μας. Δυστυχώς όταν χρειάστηκε να γίνει ανάληψη καθηκόντων της κας Παπανικολάου, διαπιστώθηκε ότι πρέπει να έχει απόφαση απόσπασης από τον Υπουργό του αρμόδιου Υπουργείου, εν προκειμένου από τον Υπουργό Υγείας και Κοινωνικής Αλληλεγγύης. Σε επικοινωνία που είχαμε με το Υπουργείο μας παρέπεμψαν στο Νόμο 3833/2010, παρ. 8 του άρθρου 11. Το Υπουργείο Εσωτερικών δεν προσλαμβάνει, από το Υπουργείο Υγείας δεν επιτρέπονται αποσπάσεις, πιστέψτε μας οι υπάλληλοι μπορούν και το κάνουν, να εργάζονται και πέραν του ωραρίου, και Σάββατα και Κυριακές, αλλά δεν μπορούν να γίνουν γιατροί.

Δε νοείται να λειτουργήσει η Δ/νση Δημόσιας Υγείας χωρίς γιατρό, γιατί χρειάζεται οπωσδήποτε στην έκδοση των βιβλιαρίων υγείας, όπως και στις επιτροπές κατά νόμο: 1. Επιτροπή για τη χορήγηση άδειας και λειτουργίας φαρμακείων 2. Επιτροπή για τη χορήγηση άδειας και λειτουργίας Ιδιωτικών Κλινικών – ΜΧΑ 3. Επιτροπές Κομμωτών – Κομμωτριών 4. Επιτροπή για την ίδρυση νέων ή επέκταση παλαιών κοιμητηρίων Επειδή όπως και στην αρχή αναφέραμε η κατάσταση γίνεται έκρυθμη, όλοι γνωρίζουμε τις δυσκολίες της χώρας μας, φανταστείτε όμως πως αισθάνεται ο πολίτης όταν μετά από κόπους βρει μια δουλειά – σερβιτόρος, εργάτης σε κονσερβοποιείο, σε κρεοπωλείο, μανάβικο, κ.λ.π.– και του πούμε ότι δεν μπορούμε να σου υπογράψουμε το βιβλιάριο υγείας, αλλά ωστόσο μπορούμε να έλθουμε εμείς ή η αστυνομία και να σε ελέγξουμε αν το έχεις και αν δεν το έχεις, θα σου επιβάλλουμε και πρόστιμο. Ειλικρινά γνωρίζουμε ότι το έγγραφό μας

ξεφεύγει των στενών ορίων ενός υπηρεσιακού εγγράφου, αλλά ζώντας καθημερινά την κατάσταση και το κλίμα, έστω και με το θυμικό λειτουργώντας, οφείλουμε να σας το μεταφέρουμε.»

Νέα διαμαρτυρία γονέων και μαθητών για την διακοπή των δρομολογίων Θα απέχουν από τα μαθήματα οι μαθητές έως και την Τρίτη

Σ

ε νέα κινητοποίηση διαμαρτυρίας προχώρησαν χθες το πρωί οι Σύλλογοι Γονέων και Κηδεμόνων των Καλλικρατικών Δήμων Βέροιας και Αλεξάνδρειας με αφορμή την διακοπή μεταφοράς των μαθητών πρωτοβάθμιας εκπαίδευσης από και προς τα σχολεία. Γονείς και μαθητές συγκεντρώθηκαν στην πλατεία δημαρχείου Βέροιας και φωνάζοντας συνθήματα όπως «Χωρίς λεωφορεία, κλειστά σχολεία», ζήτησαν να δοθεί άμεση λύση στο θέμα της μεταφοράς το οποίο ταλανίζει τη μαθητική κοινότητα πάνω από μια εβδομάδα, μετά την απόφαση των τουριστικών πρακτόρων να διακόψουν τη μεταφορά των μαθητών εξαιτίας της μη υπογραφής της σύμβασης έργου.

Στη συνέχεια, αντιπροσωπεία των Συλλόγων Γονέων και Κηδεμόνων συναντήθηκε με τον ειδικό σύμβουλο το Αντιπεριφερειάρχη Ημαθίας Γιάννη Λαμπίδη αλλά και με τον Περιφερειακό Σύμβουλο Γιάννη Καλαιτζίδη. Οι γονείς τόνισαν ότι το πρόβλημα που δημιουργήθηκε λόγω της διακοπής των μαθητικών δρομολογίων είναι πολύ σοβαρό και ότι αρκετοί μαθητές αναγκάζονται να χάνουν μαθήματα λόγω έλλειψης μέσου μεταφοράς. Παράλληλα εξέφρασαν την αγανάκτηση τους για το γεγονός ότι το θέμα της μεταφοράς παραμένει άλυτο παρά τις δεσμεύσεις ότι θα λυνόταν την προηγούμενη εβδομάδα και δήλωσαν αποφασισμένοι να συνεχίσουν τις κινητοποιήσεις τους με πιο δυ-

5

ναμική μορφή. Ο κ. Λαμπίδης ενημέρωσε τους γονείς ότι η Περιφερειακή Ενότητα Ημαθίας και ο Αντιπεριφερειαρχής έχει προχωρήσει στις απαιτούμενες ενέργειες και έχει ενημερώσει τα αρμόδια υπουργεία για το θέμα που έχει προκύψει ενώ ο κ. Καλιατζίδης τόνισε ότι αρμόδιο για το θέμα της μεταφοράς είναι μόνο το Υπουργείο. ΘΑ ΑΠΕΧΟΥΝ ΑΠΟ ΤΑ ΜΑΘΗΜΑΤΑ ΟΙ ΜΑΘΗΤΕΣ ΕΩΣ ΚΑΙ ΤΗΝ ΤΡΙΤΗ Μετά από επιθυμία των Συλλόγων Γονέων και Κηδεμόνων, ο Πρόεδρος της Ένωσης Συλλόγων Γονέων και Κηδεμόνων Πρωτοβάθμιας Εκπαίδευσης Δήμου Βέροιας Παναγιώτης Χατζησάββας, επικοινώνησε

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

με τον Γενικό Διευθυντή του Υφυπουργού Eσωτερικών κ. Ντόλιου, κ. Γεωργούλη, στον οποίο περιέγραψε την κατάσταση που έχει δημιουργηθεί στο Νομό Ημαθίας. Ο κ. Γεωργούλης τόνισε ότι μέσα στην επόμενη εβδομάδα θα κατατεθεί το φορολογικό νομοσχέδιο το οποίο περιλαμβάνει ειδική ρύθμιση για τη μεταφορά οπότε και το ζήτημα θα λυθεί. Από την πλευρά τους οι Σύλλογοι Γονέων και Κηδεμόνων των νέων Καλλικρατικών Δήμων Βέροιας και Αλεξάνδρειας, αποφάσισαν να απέχουν οι μαθητές από τα μαθήματα έως και την Τρίτη, ενώ το απόγευμα της ίδιας μέρας θα πραγματοποιήσουν σύσκεψη προκειμένου να καθορίσουν τις επόμενες κινήσεις τους. Κωνσταντίνα Καραγιάννη


πολιτιστικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

Η θεατρική παράσταση «Mην παίζεις με τα χώματα» της Στέλλας Βλαχογιάννη Σήμερα στη Στέγη Γραμμάτων και Τεχνών στις 9.15 μ.μ.

Τ

ο έργο «Μην παίζεις με τα χώματα» παρουσιάζεται την Παρασκευή 11 Μαρτίου, στις 9:15, στην Αντωνιάδειο Στέγη Γραμμάτων και Τεχνών, με είσοδο ελεύθερη για το κοινό. Πληροφορίες 2331078100 Σκηνοθεσία: Σοφία Καραγιάννη – Υρώ Μιχαλακάκου Σκηνικά : Νίκος Τσιάμης Κοστούμια : Αγγελική Καραμούτσου Μουσική : Θέμης Καραμουρατίδης Κίνηση : Χρήστος Παπαδόπουλος Φωτισμοί : Νίκος Βλασόπουλος Παίζουν : Θεοδώρα Σιάρκου, Ειρήνη Μουρελάτου, Σοφία Καραγιάννη Μην παίζεις με τα χώματα!

Δε με λυπάσαι; Με φάγαν τα πλυντήρια. Αλήθεια τι ψάχνουμε, από παιδιά ακόμη, να βρούμε στο χώμα; Το παρελθόν μας ή το μέλλον μας; Τους απόντες ή τον χαμένο εαυτό μας; Ένα παιδί που θα λερωθεί πολύ παίζοντας με το χώμα κερδίζει την αθωότητά του ως ενήλικας; Πρόκειται για ένα σπονδυλωτό θέαμα με άξονες τρεις μονολόγους και συνδετικά κείμενα από το βιβλίο της Στέλλας Βλαχογιάννη «Ιατρείον ασμάτων», που πραγματεύεται την Απώλεια με σαρκασμό, χιούμορ και συγκίνηση. Το «Μην παίζεις με τα χώματα» είναι η περιπλάνηση της ανθρώπινης αγωνιάς στο χρόνο. Είναι ένα δρομολόγιο με επιβάτες τρεις γυναίκες που διανύουν πολ-

λά χιλιόμετρα μνήμης. Περνάνε από την παιδική ηλικία στην εφηβεία, από την εφηβεία στη νεότητα, από τη νεότητα στην ωριμότητα. Σε κάθε στάση αυτού του λεωφορείου ο θεατής βλέπει από τα τζάμια του ό, τι προλαβαίνει από τα σπαράγματα αυτών των γυναικών, μόνο που στο τέλος, αυτά τα τζαμιά καταλήγουν να είναι ο καθρέφτης του ίδιου μας του εαυτού. Επιβάτες αυτού του παράξενου λεωφορείου είναι μια κλοσάρ που θέλει πίσω τις ηλικίες της, μια γυναίκα που θάβει μαζί με τον αυτόχειρα αδερφό της και αλλά «οικογενειακά μέλη» και τέλος μια γυναίκα

που βιάζεται να εκτελέσει μια επιβεβλημένη αποστολή.

Με την υποστήριξη του ΟΠΑΠ.

Συναντήσεις με γονείς στη Δημόσια Βιβλιοθήκη Βέροιας

Tο Παιδί στην Εφηβεία Η

εφηβεία είναι μια περίοδος αλλαγής αλλά και ιδιαίτερης ευαισθησίας. Η μετάβαση από την παιδική ηλικία στην ενήλικη ζωή χαρακτηρίζεται από φυσιολογικές ανησυχίες που συχνά αναστατώνουν και τους γονείς. Το σύνθετο αυτό θέμα θα συζητηθεί σε δύο συνεχόμενες συναντήσεις, που απευθύνονται σε γονείς εφήβων και εκπαιδευτικούς που εργάζονται με παιδιά στην εφηβεία. Οι συναντήσεις έχουν το χαρακτήρα ομιλίας – συζήτησης, θα πραγματοποιηθούν στην αίθουσα εκδηλώσεων της Δημόσιας Κεντρικής Βιβλιοθήκης της Βέροιας και θα διαρκέσουν 2 ώρες η καθεμία τις παρακάτω ημέρες και ώρες: • Τετάρτη 16 Μαρτίου 2011, 6 το απόγευμα «Ψυχική εξέλιξη και αλλαγές του παιδιού κατά τη διάρκεια της εφηβείας» • Τετάρτη 30 Μαρτίου 2011, 6 το απόγευμα «Δυσκολίες της εξέλιξης στην εφηβεία» Συντονίστριες οι Ψυχολόγοι κ.Έφη Ζαμπούνη και κ. Ιωάννα Κουφάκη

Η κ. Εφη Ζαμπούνη εργάζεται ως ψυχολόγος στη Θεσσαλονίκη από το 1999. Εχει συνεργαστεί με το Ινστιτούτο Ψυχικής Υγείας παιδιών και ενηλίκων στην Αθήνα και στην Ξάνθη. Έχει κάνει ομιλίες για την Ψυχική Υγεία σε επαγγελματίες της υγείας, εκπαιδευτικούς και γονείς. Το θεωρητικό ενδιαφέρον και η κλινική της άσκηση είναι προσανατολισμένα στην ψυχανάλυση. H κ. Ιωάννα Κουφάκη, εργάζεται στη Θεσσαλονίκη ως ψυχολόγος με ενδιαφέρον στην ψυχαναλυτική ψυχοθεραπεία. Έχει συνεργαστεί με τη «Συμβουλευτική Υπηρεσία Παιδιού & Εφήβου», Νοσοκομείο ΑΧΕΠΑ, το «Λαϊκό Πανεπιστήμιο» (Γερμανική Σχολή Θεσσαλονίκης) και το Κέντρο Περίθαλψης Παίδων «Άγιος Δημήτριος». Επίσης έχει ασχοληθεί με το συντονισμό ομάδων γονέων σε σχολεία. Διοργάνωση: • Δημόσια Κεντρική Βιβλιοθήκη Βέροιας • Σύλλογος Γονέων και Κηδεμόνων 5ου Δημοτικού Σχο-

λείου Βέροιας • Σύλλογος Γονέων και Κηδεμόνων 2ου Γυμνασίου Βέροιας • Κέντρο Πρόληψης Ν. Ημαθίας ΠΡΟΣΒΑΣΗ Για περισσότερες πληροφορίες μπορείτε να απευθυνθείτε στη Δημόσια Κεντρική Βιβλιοθήκη της Βέροιας, Έλλης 8, Βέροια. Τηλ. 2331024494, http://www.libver.gr

Mαθήματα φωτογραφίας από την Φωτογραφική Ομάδα Βέροιας

Σύλλογος Βλάχων Βέροιας

Η

Τ

Φωτογραφική Ομάδα Βέροιας οργανώνει Τρίμηνο κύκλο φωτογραφικών μαθημάτων. Τα μαθήματα θα πραγματοποιηθούν κάθε Τετάρτη στις 19.00 στην Δημοτική Βιβλιοθήκη Βέροιας, οδός Ζωγιοπούλου, από τους Βαλάντη Λαμπριανίδη , Ιωάννα Στεφανοπουλου και Γιάννη Χατζηγεωργίου. Ο κύκλος είναι ανοιχτός σε όλους. Θα γίνουν εισαγωγικά μαθήματα φωτογραφίας, πρακτικές ασκήσεις αλλά και μαθήματα ιστορίας τέχνης από εικαστικό. Ο κύκλος περιλαμβάνει και workshop στο photoshop. Kόστος συμμετοχής : 50 ευρώ Tηλ επ. 2331070269, 2331350588

6

ΠΡΟΣΚΛΗΣΗ ο τμήμα γυναικών του Συλλόγου Βλάχων Βέροιας καλεί τις γυναίκες, φίλες και μέλη του Συλλόγου, στον χορό που θα γίνει στην λέσχη Αξιωματικών Βέροιας την Δευτέρα 14-3-2011 και ώρα 18:00. Θα γλεντήσουμε με την ορχήστρα του Δημήτρη Παράσχου.Στο τραγούδι ο Γιώργος Μανέκας. Τιμή πρόσκλησης 10€(ευρώ). Προσκλήσεις διατίθενται στα γραφεία του Συλλόγου. Για το Δ.Σ. Ο πρόεδρος Ο γεν. Γραμματέας Γιώργος Τσίρης Μιχάλης Φουνταλής

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011


ΠΟΛΙΤΙΣΤΙΚΑ 

epikera@otenet.gr

Νέες αρχαιολογικές ανακαλύψεις στην αγορά των Αιγών

Θα ανακοινωθούν στην 24η Επιστημονική Συνάντηση για το Αρχαιολογικό Εργο στη Μακεδονία και τη Θράκη

Μ

ια νέα λαμπρή ταφή, αυτή τη φορά ενός κοριτσιού, έρχεται να προστεθεί στο μυστήριο που καλύπτει την ανακάλυψη της καθηγήτριας Αρχαιολογίας στο ΑΠΘ, ευρωβουλευτή Χρυσούλας Παλιαδέλη και των συνεργατών της στην αγορά των Αιγών, στο ιερό της Εύκλειας, το 2008, όπως γράφει η εφημερίδα «Ελευθεροτυπία» στο χθεσινό της φύλλο. Ηταν η ταφή ενός νέου, ίσως του νόθου γιου του Μεγάλου Αλεξάνδρου, Ηρακλή, τον οποίο σκότωσε, μαζί με τη μητέρα του Βαρσίνη, ο Κάσσανδρος, για να πάρει το θρόνο των αρχαίων Μακεδόνων. Η ταφή του νέου άντρα, ηλικίας 15-18 ετών, βρέθηκε σε μεταλλικό δοχείο που περιείχε τα καμένα οστά, χρυσό στεφάνι βελανιδιάς και πορφυρό ύφασμα. Το 2009, σε απόσταση 5 μ. βρέθηκαν ακόμη δύο πολύτιμα αγγεία. Μια αργυρή υδρία, με ακτέριστα καμένα οστά ενήλικου ατόμου, άγνωστου φύλου και ηλικίας, και ένας μοναδικός για τον ελληνικό χώρο αργυρός παναθηναϊκός αμφορέας με επιχρύσωση και εγχαράξεις μιας αδιάγνωστης μέχρι στιγμής παράστασης. Παρόμοιος απαντά σε αρχαίο κείμενο, που περιγράφει μεγάλη εορταστική πομπή στην Αλεξάνδρεια την εποχή των Πτολεμαίων. Το περασμένο καλοκαίρι σε εργασίες συντήρησης, υπό την ευθύνη της συντηρήτριας Βανέσσας Παπαγεωργίου, ανακάλυψαν στο εσωτερικό του αργυρού αμφορέα τα καμένα οστά μικρού παιδιού ηλικίας 3-7 ετών, όπως έδειξε η οστεοαρχαιολογική μελέτη της δρος Σέβης Τρια-

νταφύλλου. Βρήκαν, επίσης, χρυσά σκουλαρίκια με φτερωτή Νίκη, χρυσά διακοσμητικά δισκάρια που κοσμούνται με ακτίνες και γοργόνειο (κεφαλή Μέδουσας) και χρυσό στεφάνι, πιθανότατα ελιάς. «Στεφάνι ελιάς φοράει ο Μ. Αλέξανδρος στην τοιχογραφία του κυνηγιού, στην πρόσοψη του τάφου του Φιλίππου Β'. Το στεφάνι ελιάς παραπέμπει στους νικητές των αγώνων και το συγκεκριμένο δείχνει ότι αυτό το κορίτσι ήταν ξεχωριστό», υπογραμμίζει η Χρυσούλα Παλιαδέλη. Σύμφωνα με την αρχαιολόγο Αθανασία Κυριάκου, το κορίτσι, όπως και τα άλλα δύο άτομα του ταφικού συνόλου, δέχτηκαν εξαιρετικές τιμές κατά την ταφή (καύση, πορφυρό ύφασμα, μεταλλικό σκεύος, χρυσά κοσμήματα και στεφάνια), παρά το ότι φαίνεται ότι έγινε κρυφά -δεν τοποθετήθηκαν σε τάφο. Σύμφωνα με τον Ρωμαίο συγγραφέα Ιουστίνο, ο Κάσσανδρος είχε δώσει διαταγή ο Ηρακλής και η Βαρσίνη να δολοφονηθούν και να ταφούν χωρίς μνήμα ή σήμα (επιτύμβια στήλη, τύμβο ή άλλη ένδειξη ταφής). «Ομως, όποιος έθαψε τα τρία άτομα τήρησε κατά γράμμα το τυπικό και απέδωσε όλες τις τιμές, χωρίς καμία έκπτωση», τονίζει. Το χρυσό στεφάνι, αν και είναι μάλλον ελιάς και όχι βελανιδιάς, όπως του νέου άντρα, αλλά και του Φίλιππου Β' και του Πρίγκιπα, δείχνει ότι το κορίτσι κατείχε ξεχωριστή θέση στην κοινωνία. Το στεφάνι φτιάχτηκε όταν το κορίτσι ήταν εν ζωή και το φορούσε σε τελετές. «Οι ταφές του ενηλίκου και του κοριτσιού δεν έρχονται

Το στεφάνι όπως βρέθηκε στον αμφορέα σε αντιπαράθεση με την υπόθεση εργασίας για την ταύτιση του πρώτου νεκρού με τον Ηρακλή, νόθο γιο του Μ. Αλεξάνδρου και της Βαρσίνης. Απλώς προσθέτουν στο πολύτιμο αυτό ταφικό σύνολο δύο νέα πρόσωπα, που προφανώς συνδέονται με τον τελευταίο των Τημενιδών, χωρίς να είμαστε σε θέση να τα ταυτίσουμε με συγκεκριμένα ιστορικά πρόσωπα», καταλήγει η Α. Κυριάκου. Στοιχεία για τη λύση του μυστηρίου ελπίζουν ότι θα δώσει η αποκάλυψη της παράστασης του αμφορέα. Η νέα ανακάλυψη θα ανακοινωθεί στην 24η Επιστημονική Συνάντηση για το Αρχαιολογικό Εργο στη Μακεδονία και τη Θράκη, που άρχισε χθες στο κτήριο της παλιάς Φιλοσοφικής Σχολής του ΑΠΘ και θα διαρκέσει ώς τις 12 Μαρτίου.

Απο την ΚΕΠΑ Δήμου Βέροιας

Το πρόγραμμα εκδηλώσεων για τους μήνες Μάρτιο – Απρίλιο ΜΑΡΤΙΟΣ 2011 • Παρασκευή 11 Μαρτίου, 9μ.μ Θεατρική Ομάδα GAFF - Κ.Ε.Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ - ΔΗ.ΠΕ.ΘΕ ΒΕΡΟΙΑΣ Θεατρική παράσταση «ΜΗΝ ΠΑΙΖΕΙΣ ΜΕ ΤΑ ΧΩΜΑΤΑ» Αντωνιάδειος Στέγη Είσοδος ελεύθερη με την ευγενική υποστήριξη της ΟΠΑΠ Α. Ε. • Δευτέρα 14 Μαρτίου 6μ.μ ΙΕΡΑ ΜΗΤΡΟΠΟΛΗ Βιβλιοπαρουσίαση «18 ημέρες στο Κονγκό» του π. Γεωργίου Χρυσοστόμου Αντωνιάδειος Στέγη είσοδος ελεύθερη 7.30μ.μ Κ.Ε.Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ – ΔΗΜΟΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ ΖΩΓΙΟΠΟΥΛΟΥ Βιβλιοπαρουσίαση «Σμύρνη συγγνώμη» κ. Θεόδωρου Δεύτου Δημοτική Βιβλιοθήκη είσοδος ελεύθερη • Σάββατο 19 Μαρτίου , 9μ.μ MOTUS TERRAE - Κ.Ε.Π.Α ΔΗΜΟΥ ΒΕ-

ΡΟΙΑΣ -ΔΗ.ΠΕ.ΘΕ ΔΗΜΟΥ ΒΕΡΟΙΑΣ Θεατρική παράσταση «ΕΓΩ ΕΛΠΙΖΩ ΝΑ ΤΗ ΒΟΛΕΨΩ» Αντωνιάδειος Στέγη Είσοδος 10€ με την ευγενική υποστήριξη της ΟΠΑΠ Α. Ε. • Κυριακή 20 Μαρτίου – Τρίτη 22 Μαρτίου Κ.Ε.Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ - ΦΕΣΤΙΒΑΛ ΚΙΝΗΜΑΤΟΓΡΑΦΟΥ ΘΕΣΣΑΛΟΝΙΚΗΣ 13ο ΦΕΣΤΙΒΑΛ ΝΤΟΚΙΜΑΝΤΕΡ ΘΕΣΣΑΛΟΝΙΚΗΣ – εικόνες του 21 ου αιώνα Προβολή των Ντοκιμαντέρ The Tillman story σκηνοθεσία Amir Bar – Lev One lucky elephant σκηνοθεσία Leesa Liman Αφιέρωμα Γυναίκες στο μικρό Παρίσι σκηνοθεσία Κυριακή Μάλαμα Κυψέλη σκηνοθεσία Ομάδα Ντοκιμαντέρ Πολιτιστικού Οργανισμού Δήμου Αθηναίων Η Θεσσαλονίκη αλλιώς σκηνοθεσία Χρήστος Νικολέρης ‘Ένα Μουσείο γεννιέται σκηνοθεσία Άννα Κεσίσογλου

7

Αντωνιάδειος Στέγη Είσοδος ελεύθερη • Τετάρτη 23 Μαρτίου , 7μ.μ Κ.Ε.Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ – ΔΗΜΟΤΙΚΗ ΒΙΒΛΙΟΘΗΚΗ ΖΩΓΙΟΠΟΥΛΟΥ Βιβλιοπαρουσίαση «Το παραμύθι της μάγισσας γιαγιάς» & «Το ημερολόγιο της Δώρας» της.Κικής Δημητριάδη Αντωνιάδειος Στέγη Είσοδος ελεύθερη • Πέμπτη 24 Μαρτίου, 10π.μ ΜΟΥΣΙΚΟ ΣΧΟΛΕΙΟ ΒΕΡΟΙΑΣ «Επετειακή εκδήλωση για την 25η Μαρτίου» Αντωνιάδειος Στέγη Είσοδος ελεύθερη

ΑΠΡΙΛΙΟΣ 2011 • 12 – 13Απριλίου , 9μ.μ Κ.Ε Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ ΔΗ.ΠΕ.ΘΕ ΔΗΜΟΥ ΒΕΡΟΙΑΣ - ΔΗ.ΠΕ.ΘΕ ΚΟΖΑΝΗΣ Θεατρική παράσταση «Εμιγκρέδες» Αντωνιάδειος Στέγη είσοδος:15€ & φοιτητικό – μαθητικό 10€

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

• Σαββατο 16 Απριλίου, 9μ.μ Κ.Ε.Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ Σαβίνα Γιαννάτου μία μουσική συνομιλία με την Ευγενία Καρλαύτη (πιάνο-φωνή) Οργάνωση Παραγωγής : Prospero Αντωνιάδειος Στέγη είσοδος 15€ • 27 – 30 Απριλίου Κ.Ε Π.Α ΔΗΜΟΥ ΒΕΡΟΙΑΣ – ΔΗΜΟΤΙΚΟ ΩΔΕΙΟ 10ο ΔΙΕΘΝΕΣ ΦΕΣΤΙΒΑΛ ΚΙΘΑΡΑΣ


τοπικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

Κάθαρση στον Ευρωπαϊκό αθλητισμό 110 Ευρωβουλευτές, μέχρι σήμερα, στηρίζουν την πρωτοβουλία Παπαστάμκου

Τ

ην ολοένα και περισσότερο σθεναρή υποστήριξη των Μελών του Ευρωπαϊκού Κοινοβουλίου γνωρίζει η πρωτοβουλία του Ευρωβουλευτή της Νέας Δημοκρατίας Καθηγητή Γιώργου Παπαστάμκου για την καταπολέμηση της διαφθοράς στον Ευρωπαϊκό Αθλητισμό. 110 Ευρωβουλευτές έχουν μέχρι σήμερα υπογράψει την Γραπτή Δήλωση 07/2011 η οποία καλεί την Ευρωπαϊκή Επιτροπή, από κοινού με τα κράτη μέλη, να ρίξει φως ειδικά στη διαπλοκή της δραστηριότητας του οργανωμένου εγκλήματος με τα νόμιμα και παράνομα στοιχήματα, τους εκπροσώπους των αθλητών, τους διαιτητές, τα στελέχη της διοίκησης των ομάδων και τους αθλητές, με στόχο το «στήσιμο» αποτελεσμάτων αθλητικών αγώνων. Ο Πολωνός Ταντέους Ζιέφκα και ο Ιρλανδός Γκάι Μίτσελ από το Ευρωπαϊκό Λαϊκό Κόμμα, ο Ιταλός Ζιανλούκα Σούστα από τους Σοσιαλιστές, και ο Γάλλος Λουκ Μπεναμίας από τους Φιλελευθέ-

ρους, συγκαταλέγονται μεταξύ των Ευρωβουλευτών που συνέταξαν από κοινού με τον κ. Παπαστάμκο την Γραπτή Δήλωση. Η ενέργεια αυτή έχει ως στόχο να αναδείξει τον εξαιρετικά σοβαρό κίνδυνο που διατρέχει ο Ευρωπαϊκός Αθλητισμός να απεκδυθεί της ακεραιότητας και της αξιοπιστίας του, εξαιτίας των αλλεπάλληλων κρουσμάτων διαφθοράς που εμφανίζονται στον ευρωπαϊκό επαγγελματικό αθλητισμό. Μαζί με την χρήση αναβολικών ουσιών και τον ρατσισμό, η διαφθορά μολύνει κάθε εκδήλωση του επαγγελματικού αθλητισμού. Η υποβολή της Γραπτής Δήλωσης για την καταπολέμηση της διαφθοράς στον Ευρωπαϊκό Αθλητισμό συμπίπτει με την πρόσφατη (προ διμήνου) Ανακοίνωση της Ευρωπαϊκής Επιτροπής για την ενίσχυση της κοινωνικής, οικονομικής και οργανωτικής διάστασης του αθλητισμού. Η Συνθήκη της Λισαβόνας, και συγκεκριμένα το άρθρο 165 (ΣΛΕΕ) καθιστά την προαγωγή του ευ αγωνίζεσθαι και του ανοικτού χαρακτήρα των αθλητικών αναμετρήσεων τομέα συντονιστικής ευ-

ρωπαϊκής αρμοδιότητας. Η Ευρωπαϊκή Επιτροπή καλείται να ρυθμίσει κανονιστικώς τα επιγραμμικά (online) στοιχήματα προς όφελος της ακεραιότητας και της βιώσιμης ανάπτυξης του Ευρωπαϊκού Αθλητισμού, μέσω εγκεκριμένων φορέων, ειδικών μέτρων για την καταπολέμηση του προκαθορισμού των αποτελεσμάτων και μέσω της διασφάλισης δικαίων προσόδων για τον ερασιτεχνικό αθλητισμό. Για τον κ. Παπαστάμκο, η Ευρωπαϊκή Επιτροπή οφείλει να συνειδητοποιήσει ότι εάν δεν έχουμε «καθαρές» διοργανώσεις, το προϊόν του αθλητισμού θα χάσει την αξία του, και το σπουδαιότερο, θα πλήξει ανεπανόρθωτα την κοινωνική, εκπαιδευτική και πολιτιστική αποστολή του. Επ’ αυτού επισημαίνεται η απόφαση

της ΕΕ ότι «οι αθλητικές οργανώσεις και τα κράτη μέλη έχουν πρωταρχική ευθύνη για τη διαχείριση των αθλητικών υποθέσεων, ενώ καίριος είναι ο ρόλος των αθλητικών ομοσπονδιών.»

Οι ιερές ακολουθίες της Μεγάλης Σαρακοστής για νέους και εργαζόμενους

Θ

α τελεστεί και κατά τη φετινή Μεγάλη Σαρακοστή η δεύτερη (βραδινή) ακολουθία των Χαιρετισμών της Παναγίας, για την εξυπηρέτηση των νέων και των εργαζομένων, που δεν μπορούν να εκκλησιαστούν κατά την απογευματινή ακολουθία, που αρχίζει στις 7.00 μ.μ. Ετσι λοιπόν, η δεύτερη (βραδινή) ακολουθία των Χαιρετισμών θα τελείται κάθε Παρασκευή 9.00 – 10.30 βράδυ, στους παρακάτω Ιερούς Ναούς: ΣΤΗ ΒΕΡΟΙΑ Ιερός Ναός Αγίου Αντωνίου Ιερός Ναός Αγίων Αναργύρων Ιερός Ναός Αγίου Σάββα Κυριωτίσσης Ιερός Ναός Αγίας Παρασκευής (Καλλιθέα) Ιερός Ναός Παναγίας Δεξιάς (Ενορίας Αγίου Γεωργίου) Ιερός Ναός Αναλήψεως – Αγίου Νεκταρίου (Παπάγου0 ΣΤΗ ΝΑΟΥΣΑ Ιερός Ναός Τιμίου Προδρόμου (μέσα Πρόδρομος Ενορίας Αγίου Μηνά) ΣΤΗΝ ΑΛΕΞΑΝΔΡΕΙΑ Ιερός Μητροπολιτικός Ναός Κοιμήσεως Θεοτόκου Αλεξάνδρειας Επίσης, υπενθυμίζεται ότι στη Βέροια κάθε Κυριακή στις 10.30 – 12.00 τελείται Θ. Λειτουργία, για τη διευκόλυνση των μητέρων με μικρά παιδιά, των νέων, των εργαζομένων και όσων άλλων αδυνατούν να εκκλησιαστούν νωρίτερα. Η Θ. Λειτουργία τελείται στον Παλαιό Ιερό Ναό Αγίων Αναργύρων Βεροίας.

Ιερός Ναός Αγίων Αναργύρων Βεροίας

ΑΝΑΚΟΙΝΩΣΗ Κάθε Δευτέρα της Μεγάλης Σαρακοστής, 6.00 – 7.00 το απόγευμα στον Παλαιό Ιερό ναό Αγίων Αναργύρων, θα τελούνται οι κατανυκτικές ακολουθίες της Τριθέκτης και της Παννυχίδας, εκ περιτροπής. Οι ακολουθίες αυτές ανήκουν στο βυζαντινό τυπικό. Τελούνταν στους ενοριακούς ναούς κατά τη διάρκεια της Μεγάλης Σαρακοστής του Πάσχα και σε άλλες περιόδους νηστειών. Η γενικευμένη τέλεσή τους σταμάτησε την περίοδο της Τουρκοκρατίας. Σε ένα από τα λίγα αρχαία χειρόγραφα, που διασώζουν το κείμενο των βυζαντινών αυτών ακολουθιών, αναφέρεται ότι τελούνται «υπέρ λύτρου και αφέσεως των αμαρτιών». Κατά τη διάρκεια της ακολουθίας θα μοιράζεται, κάθε φορά, το κείμενο της ακολουθίας για την καλύτερη συμμετοχή των εκκλησιαζομένων.

8

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011


ΤΟΠΙΚΑ

epikera@otenet.gr

Δημοτικό Συμβούλιο Βέροιας

Άρχισαν οι συγχωνεύσεις των ΝΠΔΔ και επιχειρήσεων Στον «αέρα» κολυμβητήριο και ο δρόμος Σέλι - Άνω Σέλι

Τ

ο θέμα των συγχωνεύσεων Νομικών Προσώπων Δημοσίου Δικαίου, των Σχολικών Επιτροπών αλλά και των Δημοτικών Κοινωφελών Επιχειρήσεων του Δήμου Βέροιας κυριάρχησε στη συνεδρίαση του Δημοτικού Συμβουλίου. Η Δήμαρχος, Χαρίκλεια Ουσουλτζόγλου τόνισε εξ αρχής ότι στόχος είναι να γίνουν οι αλλαγές στα Νομικά Πρόσωπα και στις Δημοτικές επιχειρήσεις όπως ακριβώς ορίζει ο νόμος αλλά με την προϋπόθεση να μην απολυθεί κανένας εργαζόμενος. Το γενικό πλαίσιο των συγχωνεύσεων παρουσίασε ο Διευθυντής της ΚΕΠΑ Γιάννης Καμπούρης, ενώ το «παρών» στη συνεδρίαση έδωσαν εργαζόμενοι στους Βρεφονηπιακούς Σταθμούς και σε άλλες επιχειρήσεις του Δήμου. Ο κ. Καμπούρης τόνισε ότι τα νομικά πρόσωπα που προτείνονται να λειτουργήσουν στα πλαίσια του νέου διευρυμένου Δήμου είναι τα ακόλουθα: ένα ΝΠΔΔ με αντικείμενα, την κοινωνική προστασία και αλληλεγγύη, την παιδεία και αθλητισμό ΚΑΠΗ Δήμου Βέροιας στο οποίο εντάσσονται μεταξύ άλλων το ΚΑΠΗ Δήμου Βέροιας, η Ολυμπιακή Στέγη Δ. Βικέλα και τα ΔΑΚ – ΝΠΔΔ, ένα ΝΠΙΔ – Κοινωφελή με αντικείμενα τον πολιτισμό και το περιβάλλον στο οποίο εντάσσονται τα ακόλουθα νομικά πρόσωπα που ήδη λειτουργούν και συγκεκριμένα η ΚΕΠΑ Δήμου και η ΔΗΚΕΑΠ , ένα ΝΠΙΔ – ΔΗΠΕΘΕ, ένα ίδρυμα και συγκεκριμένα το ίδρυμα «Βρεφονηπιακός σταθμός Θ. Ζωγιοπούλου», το οποίο και παραμένει ως έχει, μία Α.Ε. και συγκεκριμένα η Αναπτυξιακή, ένα ΝΠΔΔ – σχολική επιτροπή Α΄ βάθμι-

ας εκπαίδευσης στο οποίο ενσωματώνονται όλες οι σχολικές επιτροπές που αναφέρονται σε σχολικές μονάδες πρωτοβάθμιας εκπαίδευσης, ένα ΝΠΔΔ – σχολική επιτροπή Β΄ βάθμιας εκπαίδευσης και μία ΔΕΥΑ. ΕΝΗΜΕΡΩΣΗ ΓΙΑ ΤΟ ΚΟΛΥΜΒΗΤΗΡΙΟ ΚΑΙ ΤΟ ΕΡΓΟ ΣΕΛΙ-ΑΝΩ ΣΕΛΙ Κατά τη διάρκεια της συνεδρίασης, η Προϊσταμένη του Τμήματος Προγραμματισμού του Δήμου Βέροιας Μαρούλα Γεωργιάδου, μετά από αίτημα του κ. Τσαβδαρίδη, έκανε μια ενημέρωση για το έργο του κολυμβητηρίου καθώς και για το έργο Σέλι-Άνω Σέλι. Η κ. Γεωργιάδου σημείωσε μεταξύ άλλων ότι παρόλο που το έργο ξεκίνησε ευοίωνα, οι εργασίες διακόπηκαν καθώς δεν υπήρξε χρηματοδότηση από τη Γενική Γραμματεία Αθλητισμού. Σε ερώτηση του κ. Τσαβδαρίδη για το εάν υπάρχει δυνατότητα να χρηματοδοτηθεί το έργο από άλλο φορέα, διευκρίνισε ότι το συγκεκριμένο έργο μπορεί να χρηματοδοτηθεί μόνο από τη Γενική Γραμματεία Αθλητισμού. Ειδικότερα για το κολυμβητήριο μίλησε και η Δήμαρχος, η οποία αναφέρθηκε στην αίτηση παράτασης που κατάθεσε ο εργολάβος σχετικά με την παράδοση του έργου, στις ενέργειες που έκανε η ίδια καθώς και στις επαφές που είχε με τη Γεν. Γραμμ. Αθλητισμού για τη συνέχιση του έργου. Αναφορικά με το έργο Σέλι-Άνω Σέλι, η κ. Γεωργιάδου τόνισε ότι ο εργολάβος έχει κηρυχθεί έκπτωτος και ότι απομένει η εκταμίευση των χρημάτων. Απαντώντας σε σχετική ερώτηση του κ. Νεστορόπουλου, ανέφερε ότι το συγκεκριμένο έργο ήταν ενταγμένο στο Γ΄ Κοινοτι-

κό Πλαίσιο Στήριξης. ΔΥΟ ΦΟΡΤΗΓΑ ΓΙΑ ΤΗΝ ΜΕΤΑΦΟΡΑ ΑΠΟΡΡΙΜΜΑΤΩΝ ΣΤΟ ΔΗΜΟ ΒΕΡΟΙΑΣ Αρκετά ήταν και τα έκτακτα θέματα τα οποία τέθηκαν επί τάπητος κατά τη διάρκεια της συνεδρίασης. Ένα από αυτά ήταν και το θέμα της μεταφοράς των απορριμμάτων για το οποίο μίλησε ο αντιδήμαρχος Καθαριότητας του δήμου Βέροιας Θεόδωρος Θεοδωρίδης. Όπως σημείωσε ο κ. Θεοδωρίδης, μετά από έρευνα που πραγματοποίησε, κατάφερε να εξασφαλίσει για τον Δήμο Βέροιας την δωρεάν παραχώρηση από τον ΟΔΔΥ δύο φορτηγών, τα οποία από τον Ιούλιο θα μεταφέρουν τα κοντέινερς με τα απορρίμματα. Ο κ. Θεοδωρίδης εξουσιοδοτήθηκε εν τέλει από το Σώμα για να προχωρήσει στην υπογραφή προγραμματικής σύμβασης με την Αποκεντρωμένη Διοίκηση Μακεδονίας-Θράκης.

ΤΟ ΘΕΜΑ ΤΗΣ ΜΕΤΑΦΟΡΑΣ ΤΩΝ ΜΑΘΗΤΩΝ Το θέμα που ξεχώρισε από τα ημερήσιας διάταξης, πέραν από το θέμα των συγχωνεύσεων Νομικών Προσώπων Δημοσίου Δικαίου, των Σχολικών Επιτροπών αλλά και των Δημοτικών Κοινωφελών Επιχειρήσεων του Δήμου, ήταν το ζήτημα της μεταφοράς των μαθητών. Μετά από αίτημα των Συλλόγων Γονέων και Κηδεμόνων σχολείων Αγ. Βαρβάρας, Άμμου, Ασωμάτων, Βεργίνας, Παλατιτσίων, Τριλόφου, Αγ. Μαρίνας, Ν. Νικομήδειας, Ν. Λυκογιάννης, και αφού προηγήθηκαν τοποθετήσεις των δημοτικών συμβούλων αλλά και του Προέδρου του Συλλόγου Γονέων και Κηδεμόνων Α/θμιας εκπαίδευσης Βέροιας, το Σώμα εξέφρασε την συμπαράσταση του στον αγώνα των Συλλόγων Γονέων και Κηδεμόνων για τη διασφάλιση της μεταφοράς των μαθητών από και προς τα σχολεία τους. Κωνσταντίνα Καραγιάννη

Μιχάλης Χαλκίδης: «Το Υπουργείο Αγροτικής ανάπτυξης

δεν προβλέπει τροποποίηση του Μέτρου 144, ώστε να ενταχθούν και οι καπνοπαραγωγοί στις ρυθμίσεις του» Α

πάντηση στην ερώτηση του Βουλευτή Ημαθίας της Νέας Δημοκρατίας, κ. Μιχάλη Χαλκίδη, σχετικά με το ζήτημα του αποκλεισμού των καπνοπαραγωγών από το Μέτρο 144 έδωσε ο Υπουργός Αγροτικής Ανάπτυξης και Τροφίμων, κ. Κώστας Σκανδαλίδης. Στην απάντησή του ο Υπουργός αναφέρει ότι δεν υπάρχει λόγος αλλά ούτε και πρόθεση να τροποποιηθεί Μέτρο 144. Πιο συγκεκριμένα, η απάντηση έχει ως εξής : «Σύμφωνα με το άρθρο 35» του Καν. (ΕΚ) 1698/2005 του Συμβουλίου, η στήριξη μέσω του Μέτρου 144 «Εκμεταλλεύσεις σε διαδικασία αναδιάρθρωσης λόγω μεταρρύθμισης σε κοινή οργάνωση αγοράς» καταβάλλεται σε γεωργούς, των οποίων οι άμεσες ενισχύσεις έχουν μειωθεί από το 2010, σε ποσοστό μεγαλύτερο του 25 % σε σύγκριση με το 2009. Από τα παραπάνω γίνεται φανερό ότι ο εν δυνάμει δικαιούχος του Μέτρου 144 θα πρέπει να: • Ενεργοποίησε, το 2009 και το 2010, δι-

καιώματα προερχόμενα από τον καπνό στις περιοχές καπνοπαραγωγής της χώρας (προϋπόθεση για να υπάρξει μείωση των άμεσων ενισχύσεων το 2010 σε σχέση με το 2009 είναι να έχουν ενεργοποιηθεί δικαιώματα προερχόμενα από τον καπνό το 2009 και το 2010). • Έχουν μειωθεί οι άμεσες ενισχύσεις από το 2010, σε ποσοστό μεγαλύτερο του 25%, σε σύγκριση με το 2009 και η μείωση αυτή οφείλεται αποκλειστικά στη μείωση της αξίας των δικαιωμάτων που προέρχονται από τον καπνό (όχι μειώσεις οι οποίες οφείλονται σε ποινές, μεταβιβάσεις ή πωλήσεις δικαιωμάτων), • Καταθέσει τριετές επιχειρηματικό σχέδιο (ΕΣ) για την αναδιάρθρωση των δραστηριοτήτων της εκμετάλλευσης του, περιλαμβανόμενης και της διαφοροποίησης εκτός γεωργίας. Τα παραπάνω κριτήρια επιλογής είναι απολύτως γνωστά στους ενδιαφερόμενους καθώς: • καθορίζονται στον αριθμ. 1698/2005 Κανονισμό του Συμβουλίου,

9

• αναφέρονται στο Πρόγραμμα Αγροτικής Ανάπτυξης 2007-2013, • περιγράφονται στα κριτήρια επιλογής του Μέτρου 144, όπως αυτά εγκρίθηκαν με την αριθμ. 8174/17-11-2010 Απόφαση της Επιτροπής Παρακολούθησης, • δημοσιοποιήθηκαν στις ημερίδες που πραγματοποιήθηκαν (Αγρίνιο, Γιαννιτσά, Τιθορέα, Αταλάντη, Κομοτηνή και Κατερίνη, όπου και διανεμήθηκε ενημερωτικό υλικό), • είναι αναρτημένα στην ηλεκτρονική σελίδα www.agrotikianaptixi.gr Διευκρινίζεται ότι, οι περιπτώσεις μεταβίβασης δικαιωμάτων εντός της οικογένειας, λόγω της οικογενειακής διάρθρωσης των αγροτικών εκμεταλλεύσεων της χώρας μας, όπως έχει ήδη αναφερθεί, θα εξεταστεί κατά περίπτωση με αίτηση του ενδιαφερόμενου. Ο περιορισμός της μείωσης του 25% των άμεσων ενισχύσεων αφορά Κανονιστικά μόνο στο Μέτρο 144 (άρθρο 35» Καν. (ΕΚ) 1698/2005) και όχι στο Μέτρο 121 «Εκσυγχρονισμός γεωργικών εκμε-

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

ταλλεύσεων» - Σχέδια Βελτίωσης, κατ’ επέκταση γι’ αυτό και δεν τέθηκε τέτοιος περιορισμός. Ως εκ τούτου καθώς η ΚΥΑ 7730 /727/2010 (ΦΕΚ 1935 /14-12-201 Ο/Β’) είναι απόρροια της νομικής βάσης του Μέτρου 144, δεν υπάρχει λόγος αλλά ούτε και πρόθεση να τροποποιηθεί στο σημείο αυτό. Για την εφαρμογή του Μέτρου και όπου αυτό είναι σύννομο και εφικτό θα πραγματοποιηθούν βελτιώσεις του θεσμικού πλαισίου του».


Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

Σύλλογος Βλάχων Βέροιας:

γνωμη -

«Αι Ειδοί του Μαρτίου» μας 1.Δεν είναι απαραίτητο να γνωρίζεις του Βελγίου (με τον πολύγλωσσο, με άριστα και λεπτομερώς την ιστορία των τον διφυλή και με τον διγενή, ιδιόρρυθΡωμαίων και συγκεκριμένως και ειδι- μο πληθυσμό του), όπου πανηγυρίζουν κώς τα αφορώντα στη δολοφονία του οι περισσότεροι κάτοικοι της χώρας (Γάϊου) Ιουλίου Καίσαρα (τη 15η Μαρτί- τους, επειδή δεν κατόρθωσαν να συμου του 44 π.Χρ.), του στρατιωτικού, πο- φωνήσουν για τον σχηματισμό κυβερλιτικού, συγγραφέα και δικτάτορα, που νήσεως από τα δύο, σχεδόν ισοδύναμα, ονομάστηκαν «Αι Ειδοί του Μαρτίου» κόμματα. Και έτσι γιόρτασαν κιόλας τα (σας θυμίζει τούτο τα σημερινά γεγονότα πρώτα γενέθλια της ακυβερνησίας τους στη Λιβύη κυρίως και στίς λοιπές χώ- (οι τυχεροί!!), με πρόσφατες καρναβαλιρες της Αφρικής;), αφού πλησιάζει πολύ κές μεταμφιέσεις σε… κότες. Η αχρησία η ημέρα του θανάτου του (15 Μαρτίου) του θεσμού αποδεικνύει και την προϊαλλά συγχρόνως και οι κρίσιμες, τωρι- ούσα αχρηστία, όπως και την κάκιστη νές ημερομηνίες 11και 24- 25 Μαρτίου, σχέση και τον χαλαρότατο δεσμό μεταξύ Γράφει ο Γιώργος Χ. Χιονίδης οπότε θα αποφασισθεί στις ευρωπαϊκές, του λαού και της κυβερνήσεως, όπως κοινοτικές Βρυξέλλες και θα κριθεί το συμβαίνει, άλλωστε, διεθνώς και σιγά – (οικονομικό και το πολιτικό) μέλλον - η σιγά και στην Ελλάδα. ρους, όταν τον μεταφέρουν κρίσιμα και τύχη και της χώρας μας. 3. Ελπίζω να μην υπάρξουν δυσμενέ- σπουδαία μηνύματα, για τα περιβόητα Και βέβαια ο Γεώργιος Α. Παπανδρέου στερες καταστάσεις, για τη χώρα μας και «Μνημόνια» κ.τ.λ. δεν είναι σύγχρονος καίσαρ, αν και δι- τον λαό της, γιατί δεν υπάρχουν πλέον Άλλωστε, δεν ταιριάζει στην εποχή αθέτει και ασκεί ιδιόρρυθμα πάμπολλα περιθώρια αντοχής, υπομονής και ανο- μας να φέρεται ως αγέρωχος ηγεμόδικαιώματα, ως κυρίαρχος κάτοχος του χής τους. νας, χωρίς να συμβουλεύεται τα μέλη αξιώματος του πρωθυπουργού στο εδώ Ας πάρει το μήνυμα «ο εξ απογραφής» της κυβερνήσεώς του ( αφού «Πρωθυπρωθυπουργοκεντρικό σύστημα αξι- (λόγω επιθέτου και της ονειρώδους και πουργός», εξάλλου, πάει να πει απλώς ών και δικαιωμάτων της χώρας μας, θεληματικής επιμονής της μητέρας του) πρώτος Υπουργός μεταξύ ίσων Υπουρμε βάση και το Σύνταγμα – «κουρελού», Πρωθυπουργός. Και ας αγνοούν και οι γών.) Αλλιώς, αργά ή γρήγορα, θα καπου ισχύει στα τελευταία 16 χρόνια και δύο, ακόμα και την ορθή χρήση της νε- ταλάβει γιατί μένει τελικά ολομόναχος ύστερα, με τις τροποποιήσεις του αρχι- οελληνικής γλώσσας!! συχνά όποιος αρέσκεται να αποκού κειμένου του 1975 από τον πατέ- Δεν υπάρχει φασίζει κυριαρχικώς και απορα του, τον Ανδρέα. Ακόμα, δεν είκλειστικά μόνος ή να δέχεται και ναι συγκρίσιμα τα ι α να ακούει μονάχα όσους επιδιώκ τός μεγέθη του (Γάϊου) σ κουν να είναι σκόπιμα υμνητές α β Ιούλιου, Καίσαρα ι σε τω σ α τ έ του, πολύ περισσότερο αφού ( ε γίν της και του σημερινού έ α γ ν υποσχέθηκε ρητά, ο ίδιος, ότι η η .χ. Πρωθυπουργού της οιος , για π ς π ι θα διάλεγε για συνεργάτες του ο ά α λ κ Τέ ος Ελλάδας, αφού, ο ς είν μ ι ω ο κ.λ.π τους άριστους και όχι σ λ π ί γ ς, ό μεν Ρωμαίος στρατιαξιό α ι ρ πολο μονάχα τους αρεστούς κόλαα ώ υ ν εί οωτικός κ.λ.π. διακρία ής χ ρ ν ρ π κες. Στη δεύτερη περίπτωση κ ι ι θηκε επανειλημμένως τείτα ολλά ι και μ π α ο οιοσδήποτε ηγέτης συνδυε π ς, μ σε κρίσιμες μάχες ποα) α ο δ ά ν ά κ άζει μέχρι και συνταυτίζει το έ ι λ Ελ τημ ματ λέμου, σε συνωμοσίες ο . υ ) ρ ε ς μέλλον τούτου και της ποκ ν ιπ συγ ζέλο και εμφύλιους σπαραγα ι , κ ς ν ε ο λιτείας, οπότε έχουμε «αρά γ χικ α ος Β μούς, ενώ Γ.Α.Π. ξεχώι υ ι ε ρ ψ π έ , χήν ενός ανδρός», όπως – έ α ρισε απλώς, τελικά γιατί λευθ οπρ ι Ε σόντ ξ δυστυχώς- συνέβαινε και ο α ,η ρειεπιβλήθηκε μεταξύ πολλ.χ. ς χ ο ς υ θ στην αρχαία Αθήνα, ακόω ο οή άτ (όπ τ ι λών άλλων, ως μοναδιε , θ ς ά μα και στην εποχή του σπ ο θέ νο κό, πρόσφατο δε (του ρ σ π ο Περικλή, ο οποίος, όμως, Τ δης 21ου αιώνα), παράδειγμα ώ . γ ε ρ τ ήταν αναμφισβήτητα χαε πολιτικού, σε δημοκρατιδήπο σ και η ω ρισματική προσωπικόπ κή χώρα, (η οποία είναι ται ο ν τητα και όχι ηγετίσκος ο ζ ά και η πατρίδα της Δημομιας οποιασδήποτε συκρατίας) και έτσι… « τρίνηθισμένης σειράς των τωσε το κακό», δηλαδή να απειράριθμων μετριοτήτων. πρωθυπουργεύει, αλλεπαλΤέλος, για να γίνεται σεβαστός και υπολήλως και σχεδόν συνεχώς λογίσιμος κάποιος ηγέτης (έστω και μικαι τρίτη γενιά γόνων της ίδιας οι- πλέον καιρός. Ας φοβηθεί ο Γ.Α.Π., επικρής χώρας, όπως είναι π.χ. η Ελλάδα) κογένειας. Επίσης, κατόρθωσε , αντιθέ- τέλους, «τας Ειδούς του Μαρτίου» (που απαιτείται να είναι αξιόλογος, συγκροτως, ο νυν Πρωθυπουργός, να επιβληθεί συμπίπτουν με τον φετινόν εορτασμόν τημένος, με πολλά προσόντα, ψυχικά τέτοια οικονομική αφαίμαξη εισοδημά- της εθνικής γιορτής μας). και πνευματικά ( όπως λ.χ. ο Ελευθέτων, ώστε να δυστυχούν, ταυτοχρόνως- Ας μη συμβεί πάλι, π.χ. «στάση πληριος Βενιζέλος). Το σθένος , το ήθος, η συγχρόνως, τόσο οι άνθρωποι όσο και ρωμών» (βλέπε στην «Οικονομική» αξιοπρέπεια και η εργώδης προσπάθειά οι αριθμοί, διαψεύδοντας τον πρώτο Γε- της «Καθημερινής» της Παρασκευής, του χρειάζονται οπωσδήποτε. ώργιο (τον παππού του) Παπανδρέου Α’, 4/3/2011 σελ.23) ούτε και λίγων στιγΆλλωστε, το ίδιο συμβαίνει και με τους αλλά και τον Παπανδρέου Β’ (τον πατέ- μών της ημέρας. ρα του), καθώς τα «υπερήφανα γηρα- Ας προσέξει ο Γ.Α.Π. τους δυσμενέστα- λαούς και τα κράτη, αφού, σύμφωνα με τειά» του, ζουν πλέον ή καλύτερα επι- τους οιωνούς, ώστε να μη χρειαστεί τον μέγιστο ποιητή μας: βιώνουν απλώς αλλά αισθάνονται πολύ ένας καινούργιος ποιητής όπως υπήρξε ταπεινωμένα και με μόνιμα παθητικόν ο Κ. Π. Καβάφης, ο οποίος στιχούργησε «Ἡ μεγαλοσύνη τῶν ἐθνῶν προϋπολογισμόν- απολογισμόν, όντας ( στην κρίσιμη επίσης χρονιά του 1911) δὲ μετριέται μὲ τὸ στρέμμα. Μὲ τῆς καρδιᾶς τὸ πύρωμα σε απόγνωση. ποίημα με τον αυτόν τίτλο (: « Μάρτιαι 2. Δεν γνωρίζω τι θα γίνει τελικά στις Ειδοί) και ούτε πρέπει να αγνοεί τους μετριέται καὶ τὸ αἷμα.» Βρυξέλλες, στην όμορφη πρωτεύουσα όποιους ανήσυχους, τίμιους Αρτεμίδω(Κωστής Παλαμάς)…

10

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

«Η βλάχικη γλώσσα δεν καθιστά τους Βλάχους μειονότητα στην Ελλάδα» Ανακοίνωση σχετικά με όσα ειπώθηκαν κατά την επίσκεψη του Γάλλου ποδηλάτη στη Βέροια σχετικά με τις μειονοτικές γλώσσες ο Σύλλογος Βλάχων Βέροιας εξέδωσε απαντητική ανακοίνωση, στην οποία αναφέρει τα ακόλουθα: «Με αφορμή το θόρυβο που ξέσπασε όσον αφορά στην ανακοίνωση του Δήμου Βέροιας τη σχετική με την επίσκεψη του Γάλλου/Βρετόνου ποδηλάτη, ο Σύλλογος Βλάχων Βέροιας δηλώνει ότι: 1. Η βλάχικη γλώσσα είναι μια αυτόνομη νεολατινική γλώσσα, με τις δικές της διαλέκτους και τα δικά της ιδιώματα, με ιστορία πάνω από 15 αιώνες,, η οποία μιλιέται και σήμερα στην Ελλάδα και γενικότερα στη νότια Βαλκανική. Σε αυτό η επιστημονική κοινότητα έχει δώσει την απάντηση. 2. Η βλάχικη γλώσσα είναι μια από τις ολιγότερο ομιλούμενες γλώσσες στη χώρα μας και συμπεριλαμβάνεται στο Χάρτη των Ολιγότερο Ομιλούμενων Γλωσσών στην Ευρώπη, στις οποίες συμπεριλαμβάνονται και τα ελληνικά (γκρεκάνικα) της Κάτω Ιταλίας και άλλες περίπου σαράντα γλώσσες στη Ευρώπη.. 3. Η βλάχικη γλώσσα δεν καθιστά τους Βλάχους μειονότητα στην Ελλάδα, στον τόπο τους δηλαδή και στην πατρίδα τους, για την οποία τόσα πολλά προσέφεραν και προσφέρουν. Ως εκ τούτου, η έκφραση μειονοτικές γλώσσες δεν αφορά τη βλάχικη Γλώσσα, αλλά ίσως άλλες γλώσσες, σε άλλες ευρωπαϊκές χώρες, που υπόκεινται σε αυτό το καθεστώς, και τις οποίες συνάντησε ο Γάλλο/Βρετόνος ποδηλάτης, που επισκέφθηκε 28 ευρωπαϊκές χώρες στο ταξίδι του που διήρκεσε ένα χρόνο. Για το Δ.Σ. Ο πρόεδρος Γιώργος Τσίρης Ο Γ. Γραμματέας Μιχάλης Φουνταλής

Υ.Γ. Ο θόρυβος που προέκυψε από παρανόηση ή από λανθασμένη μετάφραση στην ανακοίνωση του Δήμου Βέροιας δεν είναι αδικαιολόγητος. Μπορεί όμως και να ευαισθητοποιήσει επάνω σε μια πραγματικότητα: Η βλάχικη γλώσσα , μέρα με τη μέρα, χάνεται αβοήθητη, και μαζί της και ο πολιτιστικός πλούτος που μεταφέρει από τη συνύπαρξη δυο μεγάλων πολιτισμών, του ελληνικού και του λατινικού. Σε αυτή την πραγματικότητα τι κάνει η Πολιτεία, η τοπική Αυτοδιοίκηση, ο Τύπος και ο καθένας μας χωριστά; ; Είναι προς τιμήν του Δήμου Βέροιας που χωρίς τα φοβικά σύνδρομα του παρελθόντος και χωρίς εθνική ανασφάλεια υποδέχεται ευρωπαίο πολίτη που αγωνίζονται για τη διάσωση της μητρικής του γλώσσας, της βρετόνικης. Όλοι δε θέλουν το κακό μας!


ΤΟΠΙΚΑ 

epikera@otenet.gr

Με απεργία και καταλήψεις αντιδρούν οι εργαζόμενοι στην απόφαση πώλησης της ΕΒΖ Σε 24ωρη απεργία κατέρχονται από σήμερα οι εργαζόμενοι στην Ελληνική Βιομηχανία Ζάχαρης (ΕΒΖ), οι οποίοι θα πραγματοποιήσουν την ίδια ημέρα συμβολική κατάληψη των κεντρικών υπηρεσιών της εταιρίας και του υποκαταστήματος της ATEBank στην πλατεία Αριστοτέλους, αντιδρώντας στην πρόθεση της τράπεζας να πουλήσει τη συμμετοχή της - άνω του 80% - στην επιχείρηση.

Τ

ις σχετικές αποφάσεις έλαβε ομόφωνα στις 9 Μαρτίου η Ομοσπονδία Εργαζομένων, όπως δήλωσε ο πρόεδρός της Μανόλης Λαγογιάννης, διευκρινίζοντας ότι οι συνδικαλιστές θα επιδιώξουν συνάντηση ενημέρωσης και με τον πρόεδρο της ΝΔ Αντώνη Σαμαρά, η οποία δεν αποκλείε-

ται, πάντως, να γίνει τελικά στην Αθήνα. Σημειώνεται πως αντίστοιχες συναντήσεις έχουν ήδη πραγματοποιηθεί, την προηγούμενη εβδομάδα, με τη γενική γραμματέα του ΚΚΕ Αλέκα Παπαρήγα και τον πρόεδρο του Συνασπισμού Αλέξη Τσίπρα. Στο μεταξύ, το στόχο της διοίκησης της ΕΒΖ να λειτουργήσουν φέτος και τα τρία εργοστάσιά της, σε Ορεστιάδα, Πλατύ και Σέρρες, γνωστοποίησε σε δημοσιογράφους ο πρόεδρος της εταιρίας, Χρυσόστομος Γερούκης. «Στόχος μας είναι να λειτουργήσουν και τα τρία εργοστάσια και δεν έχει ληφθεί απόφαση για κλείσιμο κανενός από αυτά», ξεκαθάρισε ο κ. Γερούκης, διαψεύδοντας φήμες, σύμφωνα με τις οποίες τα στρέμματα που τελικά θα σπαρθούν με τεύτλα, δεν θα επαρκούν για να παραμείνουν σε λειτουργία όλες οι μονάδες, με αποτέλεσμα να επίκειται προσωρινό λουκέτο σε αυτή των Σερρών. Σύμφωνα με τον κ. Γερούκη, τα μέχρι στιγμής συμβόλαια τευτλοκαλλιέργειας αντιστοιχούν στη σπορά έκτασης 160.000 στρεμμάτων, έναντι στόχου για 150.000 φέτος. Ωστόσο, «συμβόλαιο δεν σημαίνει και

σπορά», όπως χαρακτηριστικά είπε. «Η όλη διαδικασία έχει τρία στάδια: αιτήσεις, συμβόλαια και σπορά, η οποία γίνεται προς το τέλος Μαρτίου. Κάποιος παραγωγός, που έχει συμβόλαιο, μπορεί ανά πάσα στιγμή να αλλάξει γνώμη και να μη σπείρει τελικά», επεσήμανε. Ερωτηθείς αν η καλλιέργεια τεύτλων θα είναι τελικά μειωμένη, εξαιτίας της απόφασης της ΑΤΕBank να ανακοινώσει λίγο πριν τη σπορά την απόφασή της να πουλήσει την ΕΒΖ, ο κ. Γερούκης απάντησε: «δεν είμαι ούτε αισιόδοξος, ούτε απαισιόδοξος. Αυτό θα φανεί στην πορεία». Εν αναμονή των εξελίξεων, περίπου 80 εργαζόμενοι του εργοστασίου της Ορεστιάδας πραγματοποίησαν συμβολική κατάληψη του τοπικού υποκαταστήματος της ΑΤΕΒank, επί περίπου μία ώρα, διαδηλώνοντας την αντίθεσή τους στον σχεδιασμό της τράπεζας για την ΕΒΖ. Στη δε Βέροια, με πρωτοβουλία του Επιμελητηρίου Ημαθίας, έχει προγραμματι-

στεί για τη Δευτέρα 14 Μαρτίου ευρεία σύσκεψη πολιτικών, κοινωνικών και παραγωγικών φορέων της κεντρικής και δυτικής Μακεδονίας, με θέμα «η πώληση της ΕΒΖ». Στη σύσκεψη, που θα ξεκινήσει στις 6 το απόγευμα, στις εγκαταστάσεις του επιμελητηρίου, έχουν προσκληθεί φορείς από τους νομούς Φλώρινας, Κοζάνης, Πέλλας, Ημαθίας, Πιερίας, Θεσσαλονίκης, Κιλκίς και Λάρισας, βουλευτές, περιφερειάρχες, αντιπεριφερειάρχες, δήμαρχοι, εκπρόσωποι της ΑΤΕ, του υπουργείου Αγροτικής Ανάπτυξης, ενώσεων αγροτικών συνεταιρισμών (ΕΑΣ), τευτλοπαραγωγών και εργαζομένων.

9ο Περιβαλλοντικό Συνέδριο της Ενωσης Ελλήνων Φυσικών στη Νάουσα Θέμα “Φυσικό και Ανθρωπογενές Περιβάλλον”

Η

Ένωση Ελλήνων Φυσικών στο πλαίσιο των περιβαλλοντικών δράσεων που έχει αναπτύξει τα τελευταία χρόνια και ειδικότερα μέσα από την επιτυχή διοργάνωση οκτώ Περιβαλλοντικών Συνεδρίων, φιλοδοξεί να συμβάλλει στον περαιτέρω προβληματισμό για τη δυνατότητα διατύπωσης ενός βιώσιμου μοντέλου Αειφόρου Ανάπτυξης, περιβαλλοντικά και πολιτισμικά ευσυνείδητης αλλά και κοινωνικά ευαίσθητης, αναδεικνύοντας και αναζητώντας τις επιστημονικές μεθοδολογίες και τεχνολογικές προσεγγίσεις που θα καθιστούσαν εφικτή μια τέτοια πορεία. Κάτω από αυτό το πρίσμα η ΕΕΦ διοργανώνει το 9ο Περιβαλλοντικό Συνέδριο με θέμα: «Φυσικό και Ανθρωπογενές περιβάλλον», στον Άγιο Νικόλαο Νάουσας , μία περιοχή που έχει αποσπάσει το ειδικό βραβείο της Ευρωπαϊκής Ένωσης στα πλαίσια του θεσμού των Ευρωπαϊκών Βραβείων αστικού και περιφερειακού σχεδιασμού.

Η ΕΕΦ θεωρεί πολύ σημαντική τη συμμετοχή, στις εργασίες του συνεδρίου όλων των περί το περιβάλλον προβληματισμένων πολιτών, ειδικά των εκπαιδευτικών και σας παρακαλεί να παραβρεθείτε

στην έναρξη των εργασιών του συνεδρίου την: Παρασκευή 11η Μαρτίου 2011, ώρα 17.00 μ.μ. στο «Ξενοδοχείο ΒΕΡΜΙΟ» στον Αγιο Νικόλαο Νάουσας.

ΦΙΛΑΝΘΡΩΠΙΚΟΣ ΜΗ ΚΕΡΔΟΣΚΟΠΙΚΟΣ ΣΥΛΛΟΓΟΣ ΓΟΝΕΩΝ ΚΑΙ ΚΗΔΕΜΟΝΩΝ Α.Μ.Ε.Α. Ν. ΗΜΑΘΙΑΣ

Η επιλογή του χώρου διεξαγωγής του συνεδρίου, μέσα σε ένα αιωνόβιο πλατανόδασος λίγα χιλιόμετρα έξω από την πόλη της Νάουσας, υποδηλώνει με έμφαση τη δυνατότητα ύπαρξης οικονομικά βιώσιμων και βαθιά οικολογικών προτάσεων στο κρίσιμο ερώτημα της αρμονικής συμβίωσης του Ανθρώπου με το Περιβάλλον. Το συνέδριο πραγματοποιείται υπο την αιγίδα της Περιφερειακής Διεύθυνσης Α/ θμιας και Β/θμιας Εκπαίδευσης Κεντρικής Μακεδονίας, του Δήμου Νάουσας και σε συνεργασία με το ΚΠΕ Νάουσας.

11

ΠΡΟΣΚΛΗΣΗ ΣΕ ΓΕΝΙΚΗ ΣΥΝΕΛΕΥΣΗ Το Δ.Σ. του Φιλανθρωπικού μη Κερδοσκοπικού Συλλόγου Γονέων και Κηδεμόνων Ατόμων με Ειδικές Ανάγκες Ν. Ημαθίας, καλεί τα μέλη του σε Γενική Συνέλευση λόγω επαναληπτικών αρχαιρεσιών (εκλογών) του Συλλόγου, που θα γίνει στις 16 Μαρτίου 2011, ημέρα Τετάρτη και ώρα 5:00 μ.μ. , στο χώρο των ΠΑΙΔΙΩΝ ΤΗΣ ΑΝΟΙΞΗΣ στην ΑΛΕΞΑΝΔΡΕΙΑ . Η παρουσία όλων των μελών του συλλόγου, κρίνεται απαραίτητη (θέμα απαρτίας όπως ορίζει το καταστατικό του συλλόγου). Σε περίπτωση μη απαρτίας, η Γενική Συνέλευση μετατοπίζεται την επόμενη εβδομάδα, στις 23 Μαρτίου 2011, στις 5 :00 μ.μ. , στον ίδιο χώρο. Παρακαλούμε να παρευρεθείτε όλοι. Τηλέφωνο επικοινωνίας 23330 27212. Με εκτίμηση για το Δ.Σ. του Συλλόγου Ο Πρόεδρος Η Γενική Γραμματέας ΕΜΜΑΝΟΥΗΛ ΝΙΚ. ΓΙΟΒΑΝΟΠΟΥΛΟΥ ΑΙΚ.

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011


αθλητικα > τοπικα

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

ΧΑΝΤΜΠΟΛ ΕΘΝΙΚΗ ΑΝΔΡΩΝ

ΠΡΩΤΗ ΝΙΚΗ ΤΗΣ ΕΘΝΙΚΗΣ ΑΝΔΡΩΝ

Επικράτησε στα Χανιά της Ολλανδίας 30-23

Σ

τον τρίτο της αγώνα για τον 6ο όμιλο του Πανευρωπαϊκού Πρωταθλήματος, που η τελική φάση θα γίνει το 2012, η Εθνική Ανδρών κέρδισε εύκολα θα λέγαμε την Ολλανδία με 30-23 ημ. 14-12. Έτσι έκανε την πρώτη της νίκη, στον όμιλο και πήρε τους δυο πολύτιμους βαθμούς. Η εθνική μας ξεκίνησε πολύ καλά και προηγήθηκε στο πρώτο 10λεπτο με 6-2 και στο 17 λεπτό με 10-4. Δεν συνέχισε όμως και έδωσε το δικαίωμα στους Ολλανδούς να αντιδράσουν και στο 25ο λεπτό να φέρουν το παιχνίδι στα ίσια (11-11) και στο 27ο λεπτό σε 12-12. Στα τελευταία όμως 3 λεπτά του ημιχρόνου με ένα σερί 2-0 πήγαν στην ανάπαυλα προηγούμενοι με 14-12. Στο β΄ ημίχρονο και μέχρι το 38ο λεπτό το παιχνίδι ήταν αμφίρροπο και ισόπαλο με 17-17. Μετά όμως η Εθνική μας ανέλαβε τα ηνία του αγώνα και περιόρισε τους Ολλανδούς σε παθητικό ρόλο. Ετσι στο 45ο λεπτό με ένα σερί 6-1, προηγήθηκε με μια διαφορά 5 τερμάτων (23-18). Αντέδρασαν όμως και πάλι οι Ολλανδοί και στο 50 λεπτό μείωσαν τη διαφορά στα 3 γκολ (24-21). Το τελευταίο όμως 10λεπτο ανήκε αποκλειστικά στους Έλληνες παίκτες. Με ένα σερί 6-2 τελείωσαν το παιχνίδι

νικητές και με μια διαφορά 7 τερμάτων (30-23). Πρώτος σκόρερ της Εθνικής ήταν ο Γιώργος Χαλκίδης με 7 γκολ. Πολύ καλή εμφάνιση έκανε επίσης και ο τερματοφύλακας της Εθνικής μας Κώστας Τσιλιμπάρης, που είχε 20 αποκρούσεις σε 42 σουτ των αντιπάλων του. Ενώ διακρίθηκε επίσης και ο Χριστόφορος Μπακαούκας (33 ετών) που σημείωσε 6 τέρματα, χωρίς φυσικά να υστερήσουν και οι υπόλοιποι παίκτες που αγωνίσθηκαν. Τον αγώνα διαιτήτευσαν οι Ούγγροι Αντόρκα και Χούκερ. Τα 10λεπτα ήταν: 6-2, 10-5, 14-12 (ημ.), 18-17, 24-21, 30-23 (τελικό). ΣΤΑΤΙΣΤΙΚΑ Δίλεπτα: Ελλάς 3, Ολλανδία 3 Πέναλτι: Ελλάς 1/3, Ολλανδία 3/3 ΕΛΛΑΣ (Ν. Μάντζος): Τσιλιμπάρης, Παπαδόπουλος 1, Τζιμούρτος 3, Μαστορογιάννης 5, Ριγανάς 2, Ζαραβίνας, Μπαλωμένος, Βακάλης, Ευαγγελίδης 3, Τζούφρας, Κουλούρης, Χαλκίδης 7, Αλβανός 3, Μπακαούκας 6, Κεσίδης, Κοκολοδημητράκης. ΟΛΛΑΝΔΙΑ (Τ. Σμιτς): Ζβίερς, φαν ντε Μόρτελ, Βονγκ 1, Λίντερς 1, Φαν Σκίε, Ανταμς 2, Σνίντερς, Λόχτντενμπεργκ 8, Σάγκεν, Βερνόι, Σούελμαν, Μπουλτ 1, Βέριανς 6, Μπούμχουβερ, Ρέμερ 2, Κόνιτζ 2. * Στο άλλο παιχνίδι του ομίλου η Τσεχία

12

επικράτησε της Νορβηγίας με 29-26. H ΒΑΘΜΟΛΟΓΙΑ (σε 3 αγώνες) 1. Τσεχία....................... 94-71...................... 6 2. Νορβηγία................. 93-84...................... 4 3. Ελλάδα..................... 75-87...................... 2 4. Ολλανδία................. 78-58...................... 0 ΔΗΛΩΣΕΙΣ Νίκος Μάντζος (προπονητής Εθνικής Ελλάδας): «Ήταν ένα αμφίρροπο παιχνίδι. Εμείς ήμασταν παρά πολύ σοβαροί. Η ομάδα ήταν πολύ καλή στα πρώτα δυο δεκάλεπτα. Είχε πάθος που έπαιξε μεγάλο ρόλο. Και στο τελευταίο δεκάλεπτο δείξαμε σοβαρότητα. Παίζοντας με αντεπιθέσεις, καταφέραμε να πάρουμε τη νίκη, Θέλαμε μια νίκη για να αλλάξει η ψυχολογία μας. Θα προσπαθήσουμε να μείνουμε προσγειωμένοι και να πάμε στην Ολλανδία, ώστε να διεκδικήσουμε και εκεί τη νίκη. Θέλουμε να πάρουμε και άλλους βαθμούς. Θα προσπαθήσουμε για ότι καλύτερο. Μου άρεσε η ομαδικότητα και το κλίμα που είχε η ομάδα μας. Παίξαμε και αυτό είναι πολύ σημαντικό σε ένα ευχάριστο γήπεδο, ο κόσμος ήταν πολύ ευχάριστος και όλα αυτά συνέβαλαν στην επιτυχία». Nίκος Ριγάνας (δεξιός ίντερ Εθνικής Ελλάδας): «Ήταν μια μεγάλη νίκη, μετά τα αρνητικά αποτελέσματα που είχαμε. Ήταν μια νίκη που μας δίνει ώθηση, για το ματς στην Ολλανδία αλλά και τα παιχνίδια τον Ιούνιο. Σήμερα παίξαμε σαν

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

ομάδα, πολύ ομαδικά, δείξαμε από την αρχή ότι έπρεπε να πάρουμε το ματς και το καταφέραμε. Θεωρώ ότι το ματς κρίθηκε στην άμυνα. Μας βοήθησε πολύ ο κόσμος, μας έδωσαν ώθηση οι φίλαθλοι. Ο κόσμος που βρέθηκε στο γήπεδο, είχε πολύ μεγάλη ενέργεια μέσα του» . Τζίνο Σμίτς (προπονητής Εθνικής Ολλανδίας): «Όταν κάνεις τόσα πολλά τεχνικά λάθη, όσα εμείς, δεν μπορείς να διεκδικήσεις κάτι καλύτερο από ένα παιχνίδι. Η Ελλάδα είχε σε καλή ημέρα τον τερματοφύλακα της, εμείς χάσαμε πολλά σουτ πάνω του και πρέπει να βελτιώσουμε τον τομέα αυτόν αν θέλουμε να έχουμε τύχη στο παιχνίδι του Σαββάτου». Λουσιέν Ζβιέρς (τερματοφύλακας Εθνικής Ολλανδίας): «Κάναμε πολλά λάθη στις επιθέσεις μας, αλλά και στις αντεπιθέσεις που κερδίζαμε. Έτσι το έργο των Ελλήνων έγινε ευκολότερο. Όταν το ματς ήταν στα 2 γκολ, είχαμε ενέργεια και ψυχολογία για να κυνηγάμε αλλά όταν έφθασε στα έξι γκολ, νοητικά και σωματικά ήταν δύσκολο να ακολουθήσουμε. Δεν μπορούμε να κρυφτούμε πίσω από την ταλαιπωρία με το ταξίδι, αφού είχαμε τις ευκαιρίες ακόμη και με αυτές τις συνθήκες να κάνουμε κάτι καλύτερο. Μου άρεσε παρά πολύ το γήπεδο, ήταν πολύ όμορφο να παίζεις εδώ». Στεφ. Οικονομόπουλος


ΑΘΛΗΤΙΚΑ > ΤΟΠΙΚΑ 

epikera@otenet.gr

Κάλεσμα-ανακοίνωση του Φίλιππου Βέροιας

Χωρίς απουσίες η προετοιμασία Το τμήμα καλαθοσφαίρισης του Φίλιππου Βέροιας καλεί όλους τους φιλάθλους της Βέροιας να ενισχύσουν την ομάδα μας στον κρίσιμο Κυριακάτικο αγώνα (13/3 ) που θα γίνει στο ΔΑΚ Μακροχωρίου στις 5 το απόγευμα κόντρα στην ομάδα της Λευκάδας.

Η

παρουσία σας στο γήπεδο θα μας δώσει ιδιαίτερη ώθηση για την επίτευξη του στόχου που δεν είναι άλλος από τη νίκη.Συνεχίζεται η προετοιμασία:

Χωρίς απουσίες και με πρωτοφανή ενθουσιασμό και διάθεση συνεχίζεται η προετοιμασία της ομάδας για το κυριακάτικο εντός έδρας παιχνίδι με τη Λευκάδα στις 17:00 . Ο Φίλιππος τα παίζει όλα για όλα καθώς το παιχνίδι αυτό χαρακτηρίστηκε από τον πρόεδρο της ομάδας κ. Τραπεζανλίδη ως «το ματς της χρονιάς» δίνοντας έτσι το έναυσμα για αντεπίθεση διαρκείας. Παίχτες και προπονητικό τιμ δηλώνουν έτοιμοι να δώσουν τη μάχη μέχρι να εξαντληθεί κάθε πιθανότητα για τη παραμονή της ομάδας στη κατηγορία. Εν τω μεταξύ μεγάλη αναμένεται η προσέλευση του κόσμου στο ΔΑΚ Μακροχωρίου γεγονός που θα ενισχύσει κατά πολύ τη ψυχολογία των παιχτών για την επίτευξη της νίκης.

ΜΠΑΣΚΕΤ Α΄ΑΝΔΡΩΝ ΕΚΑΣΚΕΜ

ΔΕΣΠΟΖΕΙ ΤΟ ΗΜΑΘΙΩΤΙΚΟ ΠΑΙΧΝΙΔΙ ΜΕΤΑΞΥ ΑΟΚ ΒΕΡΟΙΑΣ – ΖΑΦΕΙΡΑΚΗ

Ο ΓΑΣ Μελίκης συναντά στην έδρα του την Κατερίνη και ο ΓΑΣ Αλεξάνδρειας εκτός τον Σκυδραϊκό

Μ

ε τους αγώνες της 17ης αγωνιστικής, συνεχίζεται το Σάββατο 12/3 το πρωτάθλημα της Α΄κατηγορίας ανδρών της ΕΚΑΣΚΕΜ. Εχουμε και πάλι ένα Ημαθιώτικο παιχνίδι. Ο ΑΟΚ Βέροιας στο ΔΑΚ «Δ. Βικέλας» συναντά τον Ζαφειράκη Νάουσας. Οι γηπεδούχοι έχουν 29 βαθμούς και είναι στην 3η θέση της βαθμολογίας και οι φιλοξενούμενοι 23 βαθμούς στην 6η θέση. Ενώ ο ΓΑΣ Μελίκης με 29 βαθμούς και αυτός (1ος) παίζει στην έδρα του με ΣΦΣ Κατερίνης (12ος – τελευταίος, με 19 βαθμούς). Τέλος ο ΓΑΣ Αλεξάνδρειας (2ος με 29 βαθμούς) αντιμετωπίζει στη Σκύδρα τον τοπικό Σκυδραϊκό (11ος με 20 βαθμούς). Στα άλλα παιχνίδια έχουμε. Στο «ντέρμπι» της Αριδαίας ο ΦΟ Αριδαίας (4ος με 26

βαθμούς), τυπικά φιλοξενούμενος να παίζει με τον ΦΟ Σωσάνδρας (7ος με 23 βαθμούς). Η ΑΕΚ Καρυώτισσας (5η με 26 βαθμούς) στην Κατερίνη να αντιμετωπίζει τον Βατανιακό – Σάρισα (10ος με 21 βαθμούς). Τέλος ο ΓΑΣ Κορινός (21 βαθμούς) στην Κατερίνη να συναντά τον ισόβαθμό του στην 8η θέση, ΑΟΚ Γουμένισσας. Όπως βλέπουμε οι 3 πρωτοπόροι και ισόβαθμοι, δίνουν εύκολα παιχνίδια και αναμένεται να παραμείνουν στην κορυφή του βαθμολογικού πίνακα. Στεφ. Οικονομόπουλος

13

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

ΠΛΥΝΤΗΡΙΟ - ΛΙΠΑΝΤΗΡΙΟ Αξεσουάρ Καλύματα Καθαρισμός Σαλονιών


Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

ΒΙΟΛΟΓΙΑ Γ΄ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΕΚΦΩΝΗΣΕΙΣ ΘΕΜΑ 1ο Στις ερωτήσεις 1-5 να γράψετε τον αριθμό της ερώτησης και δίπλα το γράμμα που αντιστοιχεί στη σωστή απάντηση. 1. Ποια από τις παρακάτω τριπλέτες δεν αποτελεί αντικωδικόνιο; α) 5’ CUA 3’ β) 5’ UAA 3’ γ) 5’ GUA 3’ δ) 3’ UCA 5’ Μονάδες 5 2. Ποιο από τα παρακάτω μόρια αποτελείται από δεοξυριβονουκλεοτίδια; α) η DNA ελικάση β) ο καταστολέας του οπερονίου της λακτόζης γ) ο χειριστής του οπερονίου της λακτόζης δ) η τρανσακετυλάση Μονάδες 5 3. Μόριο DNA περιέχει 2.000 νουκλεοτίδια, εκ των οποίων 800 περιέχουν ως αζωτούχο βάση την αδενίνη και 400 την κυτοσίνη. Επίσης ανάμεσα στα νουκλεοτίδια σχηματίζονται 2.000 φωσφοδιεστερικοί δεσμοί. Το μόριο θα είναι: α) μονόκλωνο κυκλικό β) δίκλωνο κυκλικό γ) μονόκλωνο γραμμικό δ) δίκλωνο γραμμικό Μονάδες 5 4. Ο γονότυπος ενός άνδρα με Α ομάδα αίματος, του οποίου ο πατέρας είχε Ο ομάδα αίματος είναι: α) IΑIΒ β) ii γ) IΑIΑ δ) IΑi Μονάδες 5 5. Η ορμόνη ινσουλίνη: α) χορηγείται στην ασθένεια του εμφυσήματος β) παράγεται από ειδικά κύτταρα του ήπατος γ) προκειμένου να γίνει λειτουργική απαιτεί μετα – μεταφραστικές τροποποιήσεις δ)ρυθμίζει το μεταβολισμό των λιπιδίων Μονάδες 5 ΘΕΜΑ 2ο Α) Σε περίπτωση που θέλετε να μελετήσετε τον υποκινητή του γονιδίου της ινσουλίνης, τι είδους βιβλιοθήκη θα κατασκευάσετε; Να αιτιολογήσετε την απάντησή σας. Μονάδες 2 Β) Να περιγράψετε συνοπτικά μία μέθοδο για την παραγωγή της ινσουλίνης μέσα σε βακτήρια Μονάδες 5 2. Να περιγράψετε πού θα συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος. Μονάδες 7 3. Σε περίπτωση που μια γυναίκα είναι στην 10η εβδομάδα της κύησης, να περιγράψετε αναλυτικά τις διαδικασίες που ενδείκνυται να ακολουθήσει, ώστε να γίνει προγεννητικός έλεγχος για αριθμητική ή δομική χρω-

μοσωμική ανωμαλία.

Μονάδες 8 4. Να αναφέρετε τα ένζυμα που καταλύουν τη δημιουργία 3’ – 5’ φωσφοδιεστερικών δεσμών. Μονάδες 3 ΘΕΜΑ 3ο 1. Να περιγράψετε το πείραμα του Griffith. Μονάδες 4 2. Α) Ποια βήματα απαιτούνται για την παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από ένα διαγονιδιακό ζώο (Μονάδες 4); Ποια πλεονεκτήματα παρουσιάζει η χρησιμοποίηση διαγονιδιακών ζώων για τη βελτίωση της ζωικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων (Μονάδες 2); Μονάδες 6 Β) Δίνεται μικρό τμήμα της μητρικής αλυσίδας καθώς και η νεοσυντιθέμενη θυγατρική αλυσίδα που σχηματί-

ζεται κατά την αντιγραφή του μορίου. Να βρείτε το μήκος του πρωταρχικού τμήματος (Μονάδες 3) καθώς και πόσοι δεσμοί υδρογόνου θα διασπασθούν κατά την απομάκρυνσή του (Μονάδες 1), αιτιολογώντας την απάντησή σας. Μονάδες 4 3. Να περιγράψετε τις χαρακτηριστικές μορφές με τις οποίες εμφανίζεται το γενετικό υλικό του πυρήνα ενός ευκαρυωτικού οργανισμού, ανάλογα με το στάδιο του κυτταρικού κύκλου, στο οποίο βρίσκεται. Μονάδες 6 4. Ένας άνδρας που πάσχει από κυστική ίνωση και υποβάλλεται σε γονιδιακή θεραπεία παντρεύεται γυναίκα που είναι φορέας της ίδιας ασθένειας. Να βρείτε την πιθανότητα να γεννηθεί παιδί που α πάσχει από την ίδια ασθένεια και να αιτιολογήσετε την απάντησή σας. Μονάδες 5 ΘΕΜΑ 4ο Δίνεται το παρακάτω τμήμα μορίου DNA, το οποίο απομονώθηκε από προκαρυωτικό κύτταρο. 5’ GGAATTCATAAATGCCGGTGTACTAAGAATTCCGG 3’ 3’ GGCCTTAAGTATTTACGGCCACATGATTCTTAAGGCC 5’

1. Το παραπάνω μόριο DNA���������������������������� ������������������������������� τέμνεται με την περιοριστική ενδονουκλεάση EcoRI, προκειμένου να ενσωματωθεί σε κατάλληλο πλασμίδιο που έχει κοπεί με το ίδιο ένζυμο, με σκοπό να εισαχθεί στο βακτήριο E.coli για την παραγωγή ενός ολιγοπεπτιδίου σε μεγάλες ποσότητες. Πόσοι δεσμοί υδρογόνου και πόσοι φωσφοδιεστερικοί δεσμοί δημιουργούνται κατά την ένωση του τμήματος DNA με το πλασμίδιο; (Μονάδες 2). Να βρείτε τη σειρά των αμινοξέων στο παραγόμενο ολιγοπεπτίδιο (Μονάδες 11) . Δίνεται ο γενετικός κώδικας. Μονάδες 13

14

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

2. Δίνεται η κωδική αλυσίδα γονιδίου ευκαρυωτικού κυττάρου, το οποίο κωδικοποιεί τη σύνθεση ενός ολιγοπεπτιδίου. AACCGGATGGAGCATCTAAGTTGAACCC

Να εξετάσετε τις μεταβολές στη σύνθεση και τη λειτουργία του πεπτιδίου εάν, με κατεύθυνση από τα αριστερά προς τα δεξιά, συμβούν οι παρακάτω γονιδιακές μεταλλάξεις: α) το 9ο νουκλεοτίδιο αντικαθίσταται από νουκλεοτίδιο που έχει ως αζωτούχο βάση την C Μονάδες 4 β) το 23ο νουκλεοτίδιο αντικαθίσταται από νουκλεοτίδιο που έχει ως αζωτούχο βάση την Α Μονάδες 3 γ) το 11ο νουκλεοτίδιο αντικαθίσταται από νουκλεοτίδιο που έχει ως αζωτούχο βάση την Τ Μονάδες 5 Σε κάθε ένα από τα παραπάνω ερωτήματα να αιτιολογήσετε την απάντησή σας. ΘΕΜΑ 1ο 1: α 2: γ

ΑΠΑΝΤΗΣΕΙΣ 3: α

4: δ

5: γ

ΘΕΜΑ 2ο 1) Α) Γνωρίζουμε ότι η γονιδιωματική βιβλιοθήκη περιέχει το συνολικό DNA�������������������������������� ����������������������������������� ενός οργανισμού δότη, ενώ η cD��� NA����������������������������������������������� βιβλιοθήκη αντίγραφα των ��������������������� mRNA����������������� όλων των γονιδίων που εκφράζονται σε συγκεκριμένα κύτταρα και έχει το πλεονέκτημα απομόνωσης μόνο των αλληλουχιών που μεταφράζονται σε αμινοξέα, δηλαδή των εξωνίων. Επιπρόσθετα, γνωρίζουμε ότι ο υποκινητής είναι αλληλουχία DNA, η οποία αποτελεί ρυθμιστικό στοιχείο της μεταγραφής αλλά δε μεταγράφεται και προφανώς ούτε μεταφράζεται. Συνεπώς για τη μελέτη του υποκινητή θα κατασκευάσουμε γονιδιωματική βιβλιοθήκη. Β) Σχολικό βιβλίο σελ. 118 - 119 «Μια από τις μεθόδους που χρησιμοποιούνται … μετατρέπεται σε ινσουλίνη». 2) Σχολικό βιβλίο σελ. 126 «Η ανάλυση του ανθρώπινου γονιδιώματος … στη βιομηχανία, στη γεωργία και στην κτηνοτροφία». 3) Εφόσον η γυναίκα είναι στη 10η εβδομάδα της κύησης τότε για τη λήψη εμβρυϊκών κυττάρων θα γίνει λήψη χοριακών λαχνών. Σχολικό βιβλίο σελ. 100 «Εναλλακτική μέθοδος προγεννητικού ελέγχου … όπως στη δρεπανοκυτταρική αναιμία». Επίσης αφού θέλουμε να μελετήσουμε την περίπτωση αριθμητικής ή δομικής χρωμοσωμικής ανωμαλίας, θα




epikera@otenet.gr

πρέπει να γίνει κατασκευή και μελέτη καρυοτύπου. Σχολικό βιβλίο σελ. 20 «Η μελέτη των χρωμοσωμάτων είναι δυνατή … με ειδικές χρωστικές ουσίες και παρατηρούνται στο μικροσκόπιο». Σχολικό βιβλίο σελ. 20 «Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος. Η απεικόνιση αυτή αποτελεί τον καρυότυπο».

άτομο με γονότυπο κκ σχηματίζονται μόνο γαμέτες με το κ υπολειπόμενο αλληλόμορφο. Οι απόγονοι προκύπτουν από τον τυχαίο συνδυασμό των γαμετών. Άρα η πιθανότητα να γεννηθεί ασθενής απόγονος, με γονότυπο κκ, είναι ½ ή 50%.

4) ��������������������������������������������������� i�������������������������������������������������� ) DNA��������������������������������������������� ������������������������������������������������ πολυμεράση, ii������������������������������ �������������������������������� ) DNA������������������������� ���������������������������� δεσμάση, ��������������� iii������������ ) επιδιορθωτικά ένζυμα, iv������������������������������������� ��������������������������������������� ) πριμόσωμα, ������������������������ v����������������������� ) αντίστροφη μεταγραφάση, vi) RNA πολυμεράση, vii) τα ριβονουκλεοπρωτεϊνικά σωματίδια που αποτελούνται από snRNA και πρωτεΐνες και λειτουργούν ως ένζυμα.

1) Το ένζυμο EcoRI αναγνωρίζει την αλληλουχία:

ΘΕΜΑ 3ο 1) Σχολικό βιβλίο σελ 13 « Το 1928 ο Griffith … για το πώς γίνεται αυτό». 2) Α) Σχολικό βιβλίο σελ. 135 «Συνοψίζοντας, θα μπορούσαμε να πούμε ότι τα βήματα που απαιτούνται … και καθαρισμός της φαρμακευτικής πρωτεΐνης». Σχολικό βιβλίο σελ. 135 «Είναι φανερό ότι η χρησιμοποίηση … σε σχέση με παραδοσιακές τεχνικές». Β) Οι DNA πολυμεράσες, που είναι τα κύρια ένζυμα που συμμετέχουν στην αντιγραφή του DNA, δεν έχουν την ικανότητα να αρχίσουν τη διαδικασία αυτή. Για το λόγο αυτό, το πριμόσωμα, ένα σύμπλοκο ενζύμων, συνθέτει στις θέσεις έναρξης της αντιγραφής μικρά τμήματα RNA, συμπληρωματικά προς τις μητρικές αλυσίδες, τα οποία ονομάζονται πρωταρχικά τμήματα. Επομένως, εφόσον τα πρωταρχικά τμήματα είναι RNA τμήματα, στη συγκεκριμένη περίπτωση το πρωταρχικό τμήμα αποτελείται από 7 βάσεις ή από 7 ριβονουκλεοτίδια. Αυτό γιατί μετά το 7ο ριβονουκλεοτίδιο, ακολουθεί δεοξυριβονουκλεοτίδιο, εφόσον φέρει ως αζωτούχο βάση τη Τ. Ανάμεσα στην Α και την U αναπτύσσονται 2 δεσμοί υδρογόνου και ανάμεσα στην �������������������������� C������������������������� και την ���������������� G��������������� 3 δεσμοί υδρογόνου. Επομένως έχουμε: Δ.Η = 2 x 4 + 3 x 3 = 17 3) Σχολικό βιβλίο σελ 18 - 19 « Αν παρατηρήσουμε το γενετικό υλικό … υλικού παραμένει αμετάβλητη ». 4) Γνωρίζουμε ότι η κυστική ίνωση κληρονομείται με αυτοσωμικό και υπολειπόμενο τρόπο. Έστω: Κ: επικρατές φυσιολογικό αλληλόμορφο κ: υπολειπόμενο αλληλόμορφο υπεύθυνο για την εκδήλωση της κυστικής ίνωσης. Συνεπώς ο γονότυπος του άνδρα θα είναι κκ και της γυναίκας που είναι φορέας της ασθένειας Κκ. Για την πραγματοποίηση της διασταύρωσης και την εύρεση της πιθανότητας να γεννηθεί ασθενής απόγονος ο γονότυπος του άνδρας παραμένει κκ καθώς το φυσιολογικό αλληλόμορφο που εισάγεται στους ασθενείς δε μεταβιβάζεται στους απογόνους. Σχολικό βιβλίο σελ. 125 «Με τις μεθόδους της γονιδιακής θεραπείας … δε μεταβιβάζεται στους απογόνους». Έτσι έχουμε: Διασταύρωση P: Κκ (X) κκ Γ: Κ, κ κ F1: Κκ, κκ Οι γαμέτες προκύπτουν σύμφωνα με τον 1ο νόμο του Mendel, ο οποίος αποτελεί την κατανομή των αλληλομόρφων στους γαμέτες και τον τυχαίο συνδυασμό τους. Με βάση το νόμο αυτό, κατά τη μείωση όπου σχηματίζονται οι γαμέτες, διαχωρίζονται τα δύο ομόλογα χρωμοσώματα και συνεπώς και τα δύο αλληλόμορφα γονίδια. Έτσι στο άτομο που έχει γονότυπο Κκ σχηματίζονται δύο ειδών γαμέτες Κ και κ σε ίση αναλογία ενώ στο

ΘΕΜΑ 4ο

5΄GAATTC 3΄ 3΄CTTAAG 5΄

5’ GAAUUCAUAAAUGCCGGUGUACUAAGAAUUC3’

και κόβει κάθε αλυσίδα μεταξύ του ������������������� G������������������ και του Α (με κατεύθυνση 5΄ → 3΄), προκαλώντας τη διάσπαση 2 φωσφοδιεστερικών δεσμών και 8 δεσμών υδρογόνου, αφήνοντας μονόκλωνα άκρα από αζευγάρωτες βάσεις στα άκρα. Οι θέσεις αναγνώρισης της EcoRI������������������ ����������������������� στο μόριο ������� DNA���� είναι: 5’ CCGGAATTCATAAATGCCGGTGTACTAAGAATTCCGG 3’ 3’ GGCCTTAAGTATTTACGGCCACATGATTCTTAAGGCC 5’

Μετά την επίδραση με την ������������������������ EcoRI������������������� προκύπτουν 3 θραύσματα και αυτό που μας ενδιαφέρει είναι το ακόλουθο: 5’ 3’

AATTCATAAATGCCGGTGTACTAAG GTATTTACGGCCACATGATTCTTAA

3’ 5’

Με το ίδιο ένζυμο περιορισμού κόβουμε και το φορέα κλωνοποίησης, δηλαδή το πλασμίδιο.

Τα δύο είδη ��������������������������������������� DNA������������������������������������ , του πλασμιδίου και του προκαρυωτικού κυττάρου, αναμιγνύονται και επειδή έχουν συμπληρωματικά (μονόκλωνα) άκρα, ενώνονται μεταξύ τους με τη μεσολάβηση του ενζύμου ����������������������� DNA�������������������� δεσμάση. Το ανασυνδυασμένο μόριο DNA που προκύπτει είναι: 5’ 3’

GAATTCATAAATGCCGGTGTACTAAGAATTC CTTAAGTATTTACGGCCACATGATTCTTAAG

3’ 5’

(Ενώνουμε τα άκρα του μορίου με γραμμές ούτως ώστε το μόριο να φαίνεται δίκλωνο και κυκλικό). Εφόσον το κωδικόνιο έναρξης του mRNA είναι το AUG με κατεύθυνση 5’AUG 3’, η αντίστοιχη τριπλέτα, λόγω συμπληρωματικότητας των βάσεων (συμπληρωματικές βάσεις είναι η T με τη Α, η Α με την U και η G με την C και αντίστροφα), στη μεταγραφόμενη αλυσίδα του DNA (μη κωδική) θα είναι το TAC και λόγω του γεγονότος ότι οι δύο αλυσίδες είναι αντιπαράλληλες θα έχει κατεύθυνση 3’ TAC 5’. Επίσης, εφόσον τα κωδικόνια λήξης του mRNA είναι τα 5’ UAG 3’, ή 5’ UGA 3’, ή 5’ UAA 3’, οι αντίστοιχες τριπλέτες στη μεταγραφόμενη αλυσίδα του DNA θα είναι τα 3’ ATC 5’, ή 3’ ACT 5’, ή 3’ ATT 5’. Τέλος, οι βάσεις ανάμεσα στο κωδικόνιο έναρξης και το κωδικόνιο λήξης, χωρίς να υπολογίζουμε το εσώνιο, θα πρέπει να διαβάζονται ανά τριάδες (κώδικας τριπλέτας), συνεχόμενα χωρίς να παραλείπεται κάποιο νουκλεοτίδιο (συνεχής), καθώς κάθε νουκλεοτίδιο ανήκει σε μία μόνο τριπλέτα (μη επικαλυπτόμενος). Συνεπώς η μεταγραφόμενη αλυσίδα είναι η κάτω με κατεύθυνση από αριστερά προς τα δεξιά. Η RNA πολυμεράση προσδένεται στον υποκινητή με τη

15

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

βοήθεια μεταγραφικών παραγόντων και προσθέτει συμπληρωματικά ριβονουκλεοτίδια έναντι των δεοξυριβονουκλεοτιδίων της μη κωδικής αλυσίδας ενώνοντάς τα με 3’ – 5’ φωσφοδιεστερικό δεσμό. Απέναντι από Α προσθέτει U, απέναντι από Τ προσθέτει Α και απέναντι από G προσθέτει C και αντίστροφα. Το ���������������������������������������������� mRNA������������������������������������������ συντίθεται με κατεύθυνση 5΄ → 3΄ με μεταγραφή της μη κωδικής αλυσίδας με βάση τον κανόνα της συμπληρωματικότητας και της αντιπαραλληλίας. Έτσι το mRNA που συντίθεται είναι:

Στο παραπάνω μόριο mRNA εντοπίζουμε 5 κωδικόνια. Το κωδικόνιο λήξης δεν κωδικοποιεί κανένα αμινοξύ. Συνεπώς το παραγόμενο πεπτίδιο αποτελείται από τέσσερα αμινοξέα τα οποία με βάση το γενετικό κώδικα έχουν ακόλουθη αλληλουχία: NH2 – μεθειονίνη – προλίνη – βαλίνη – τυροσίνη – COOH 2. Γνωρίζουμε ότι τόσο η κωδική αλυσίδα του DNA όσο και το mRNA��������������������������������������� ������������������������������������������� , είναι συμπληρωματικά προς τη μεταγραφόμενη αλυσίδα του DNA�������������������������� ����������������������������� . Έτσι, η μόνη τους διαφορά είναι ότι όπου στην κωδική αλυσίδα υπάρχει Τ στο mRNA υπάρχει U. Εφόσον το κωδικόνιο έναρξης του mRNA είναι το AUG με κατεύθυνση 5’AUG 3’, το αντίστοιχο κωδικόνιο στην κωδική αλυσίδα του DNA������� ���������� θα είναι το ATG και θα έχει κατεύθυνση 5’ ATG 3’. Επίσης, εφόσον τα κωδικόνια λήξης του mRNA είναι τα 5’ UAG 3’ ή 5’ UGA 3’ ή 5’ UAA 3’, τα αντίστοιχα κωδικόνια στην κωδική αλυσίδα του DNA θα είναι τα 5’ ΤAG 3’ ή 5’ ΤGA 3’ ή 5’ ΤAA 3’. Τέλος, οι βάσεις ανάμεσα στο κωδικόνιο έναρξης και το κωδικόνιο λήξης θα πρέπει να διαβάζονται ανά τριάδες (κώδικας τριπλέτας), συνεχόμενα χωρίς να παραλείπεται κάποιο νουκλεοτίδιο (συνεχής), καθώς κάθε νουκλεοτίδιο ανήκει σε μία μόνο τριπλέτα (μη επικαλυπτόμενος). Με βάση τα παραπάνω θα έχουμε για την κωδική αλυσίδα 5’ AACCGGATGGAGCATCTAAGTTGAACCC 3’ α. Πρόκειται για γονιδιακή μετάλλαξη αντικατάστασης βάσης στο κωδικόνιο έναρξης της μετάφρασης, το οποίο πλέον τροποποιείται. Έτσι δε θα γίνει η έναρξη της μετάφρασης και κατ’ επέκταση και η σύνθεση του ολιγοπεπτιδίου. β. Πρόκειται για γονιδιακή μετάλλαξη αντικατάστασης βάσης στο κωδικόνιο λήξης. Το νέο κωδικόνιο είναι και πάλι κωδικόνιο λήξης κι έτσι δεν παρατηρείται καμία μεταβολή στη σύνθεση του ολιγοπεπτιδίου. γ. Πραγματοποιείται γονιδιακή μετάλλαξη αντικατάστασης της 2ης βάσης του 2ου κωδικονίου, με αποτέλεσμα να τροποποιείται το 2ο κωδικόνιο. Το φυσιολογικό κωδικόνιο, που είναι το ��������������������������������� G�������������������������������� Α������������������������������� G������������������������������ , κωδικοποιεί το αμινοξύ γλουταμινικό οξύ, ενώ το τροποποιημένο κωδικόνιο είναι το G������������������������������������������������� �������������������������������������������������� Τ������������������������������������������������ G����������������������������������������������� , το οποίο κωδικοποιεί το αμινοξύ βαλίνη. Συνεπώς, το πρωτεϊνικό μόριο που παράγεται τροποποιείται κατά ένα αμινοξύ. Η αλλαγή αυτή μπορεί να έχει ελάχιστη επίδραση στη στερεοδιάταξη της πρωτεΐνης και κατ’ επέκταση και στη λειτουργία της (ουδέτερη μετάλλαξη). Υπάρχουν όμως περιπτώσεις, όπως στη δρεπανοκυτταρική αναιμία, στις οποίες η αλλαγή ενός και μόνο αμινοξέος άλλαξε τη στερεοδιάταξη της πρωτεΐνης και συνεπώς και τη λειτουργία της, με δυσάρεστα αποτελέσματα. Επίσης σε περίπτωση που το πρωτεϊνικό μόριο αποτελεί ένζυμο, μπορεί το διαφορετικό αμινοξύ να βρίσκεται στο ενεργό του κέντρο ή κοντά σε αυτό, με αποτέλεσμα να ελαττωθεί ή και να μηδενισθεί η ενεργότητα του.

Επιμέλεια : Λαζαρίδης Ιωάννης


ΣΤΗΛΗ ΙΑΤΡΩΝ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

ΧΡΗΣΙΜΑ ΤΗΛΕΦΩΝΑ ΙΑΤΡΩΝ ΝΟΜΟΥ ΗΜΑΘΙΑΣ Μπαλατσινού Λουκία Ιατρός Αλλεργιολόγος l

ΚΥΡΤΣΙΟΣ ΚΩΝΣΤΑΝΤΙΝΟΣ

ΔΙΑΓΝΩΣΤΙΚΟ ΚΕΝΤΡΟ Βασιλική Λ. Ορδουλίδου - Νάτσκου Ιατρός Μικροβιολόγος - Βιοπαθολόγος

Σύμβαση με ταμεία Δημοσίου, ΟΓΑ, ΤΥΔΚΥ, ΤΕΒΕ (ΟΑΕΕ), TΑΞΥΠ

- Μικροβιολογικό - Αιματολικό - Βιοχημικό - Ορμονολογικό

ΧΕΙΡΟΥΡΓΟΣ - ΟΔΟΝΤΙΑΤΡΟΣ l

l

Δέχεται καθημερινά με ραντεβού

Τηλ. Iατρείου 23310 76061 Μ. Καρακωστή 16, Βέροια e-mail:lucybalatsinou@yahoo.gr

ΜΗΤΡΟΠΟΛΕΩΣ 12 (1ος όροφος) ΒΕΡΟΙΑ τηλ. ιατρ. 2331073111 κιν. 6979721307 e-mail:kyrtsioscom@hotmail.com

Πέτρος Ι. Σαρρηγιαννίδης Ορθοπαιδικός Χειρουργός

- Ανοσολογικό Βενιζέλου 34 Βέροια (1ος όροφος) τηλ. Ιατρ.: 23310 67062 - fax: 23310 67063

ΒΑΝΑ ΔΗΜΗΤΡΙΑΔΟΥ - ΜΠΡΟΥΣΚΕΛΗ

ΙΑΤΡΕΙΟ ΟΡΘΟΠΑΙΔΙΚΗΣ & ΤΡΑΥΜΑΤΟΛΟΓΙΑΣ

ΧΕΙΡΟΥΡΓΟΣ ΩΤΟΡΙΝΟΛΑΡΥΓΓΟΛΟΓΟΣ ΕΙΔΙΚΕΥΘΕΙΣΑ ΣΤΟ ΒΙΟΪΑΤΡΙΚΟ ΒΕΛΟΝΙΣΜΟ ΕΠΕΜΒΑΣΕΙΣ ΠΑΙΔΩΝ & ΕΝΗΛΙΚΩΝ ΕΛΕΓΧΟΣ ΒΑΡΗΚΟΪΑΣ - ΙΛΙΓΓΟΥ - ΕΜΒΟΩΝ ΒΙΝΤΕΟΝΥΣΤΑΓΜΟΓΡΑΦΙΑ ΕΝΔΟΣΚΟΠΙΚΗ ΔΙΑΓΝΩΣΤΙΚΗ ΩΤΟΣ - ΡΙΝΟΣ - ΛΑΡΥΓΓΑ ΕΙΔΙΚΕΥΘΕΙΣΑ ΣΤΑ ΑΚΟΥΣΤΙΚΑ ΒΑΡΗΚΟΪΑΣ

Σύμβαση με ταμεία

Δημοσίου, ΟΓΑ, ΤΥΔΚΥ, ΤΕΒΕ (ΟΑΕΕ)

ΕΡΓΑΣΤΗΡΙΟ: ΙΑΤΡΙΚΟΥ ΒΕΛΟΝΙΣΜΟΥ - ΗΛΕΚΤΡΟΒΕΛΟΝΙΣΜΟΥ - ΩΤΟΒΕΛΟΝΙΣΜΟΥ - ΤΕΣΤ ΔΥΣΑΝΕΞΙΑΣ ΤΡΟΦΩΝ l

Προφήτου Ηλία 15 - 3ος όροφος (πεζόδρομος Αγοράς) - Βέροια, 59 100 τηλ. ιατρείου: 23310 21545 - κινητό: 6973 887429

Δέχεται με ραντεβού

Σύμβαση με ταμεία Δημοσίου, ΟΓΑ, ΟΑΕΕ

Αλ. Παπάγου 19 & Βετσοπούλου γωνία

ΔΡ. ΓΕΩΡΓΙΟΣ Α. ΕΥΓΕΝΙΑΔΗΣ ΟΡΘΟΠΑΙΔΙΚΟΣ ΧΕΙΡΟΥΡΓΟΣ

l

l

Δέχεται καθημερινά με ραντεβού Σύμβαση: Δημόσιο, ΟΓΑ, ΤΥΔΚΥ, ΕΤΑΑ, Στρατιωτικών

(απέναντι απο την είσοδο της Αστυνομίας)

e-mail:doctorpetros@gmail. com

Τηλ. Ιατρ. 23330 28222 | κιν. 6942 017405 ΑΛΕΞΑΝΔΡΕΙΑ

16ης Οκτωβρίου 1 (Πλ. Ωρολογίου) Βέροια Τηλ.Ιατρ: 2331500570 - Κινητό: 6980406666 e mail: g.evgeniadis@mail.gr

ΜΕΤΑΦΟΡΑ ΙΑΤΡΕΙΟΥ

ΑΝΑΣΤΑΣΙΟΣ ΑΝΤ. ΚΑΤΣΑΜΑΚΑΣ

Δημήτρης Αν. Αποστολίδης

ΤΖΙΚΟΠΟΥΛΟΣ Γ. ΙΩΑΝΝΗΣ

ΙΑΤΡΟΣ ΔΕΡΜΑΤΟΛΟΓΟΣ - ΑΦΡΟΔΙΣΙΟΛΟΓΟΣ

ΧΕΙΡΟΥΡΓΟΣ ΟΔΟΝΤΙΑΤΡΟΣ

EΠΕΜΒΑΣΕΙΣ LASER

Ειδικός Παθολόγος MSc Επιστημονικός Συνεργάτης Α΄Παθολογικής Κλινικής Γ.Ν. Παπαγεωργίου

1. Αποτρίχωση 2. Ακμή - Ουλές Ακμής

Δέχεται με ραντεβού

3. Ρυτίδες - Σύσφιξη Προσώπου (fraxel) 4. Κυτταρίτιδα - Σύσφιξη Σώματος l

ΤΗΛ. ΙΑΤΡΕΙΟΥ 23310 70707 ΚΙΝ. 6973 046662 ΙΠΠΟΚΡΑΤΟΥΣ 32, 1ος ΟΡΟΦΟΣ, ΒΕΡΟΙΑ e-mail: dent_jik_71@yahoo.com

Εμφυτεύματα: Botox - Υαλουρονικό l

ΔΕΧΕΤΑΙ ΜΕ ΡΑΝΤΕΒΟΥ

ΤΗΛ. ΙΑΤΡΕΙΟΥ 23310 23919 ΕΛΗΑΣ 13, ΒΕΡΟΙΑ

ΨΩΜΙΑΔΟΥ I. ΜΑΡΙΑ

IΑΤΡΟΣ l

Δέχεται με ραντεβού

Καραολή Κυπρίου 3 (ισόγειο) - Mακροχώρι Τηλ. ιατρ.: 2331041797 - Κιν.: 6944817701

email: mpsomiadou@gmail.com

16

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

l

Σύμβαση: Δημόσιο,

ΟΓΑ, ΤΥΔΚΥ, TΑΞΥΠ Προφήτη Ηλία 15 (2ος όροφος) Βέροια τηλ. 23310 73555, Κιν. 6945 542579 e-mail: dcapostolidis@gmail.com


ΤΥΠΟΣ



epikera@otenet.gr

Επιμέλεια Νικολέττα Φλιάταρη ΑΔΕΣΜΕΥΤΟΣ ΤΥΠΟΣ: «Η κυβέρνηση νομιμοποιεί τους 300». ΑΥΡΙΑΝΗ: «Βάρεσαν διάλυση στο υπουργείο Οικονομικών». ΔΗΜΟΚΡΑΤΙΑ: «Κατέλαβε τη Θράκη ο Νταβούτογλου». ΕΘΝΟΣ: «Φάμπρικα διδακτορικών έναντι... 8.000 ευρώ!». ΕΛΕΥΘΕΡΗ ΩΡΑ: «Σεραφείμ: Ο νόμος Καστανίδη υπηρετεί τον εωσφόρο!». ΕΛΕΥΘΕΡΟΣ: «Φρενοκομείο η κυβέρνηση «Ξυπόλητος» ο Γ.Α.Π. στην Ευρώπη». ΕΛΕΥΘΕΡΟΤΥΠΙΑ: «Δισκέτες-φωτιά για το ποδόσφαιρο». ΕΛΕΥΘΕΡΟΣ ΤΥΠΟΣ: «Χρεοκοπία Παπα-

... ομία

ντ υ σ Εν

. μία.. υντο Εν σ

κωνσταντίνουΡαγκούση». ΕΣΤΙΑ: «Καταστρέφουν την οικονομία» Η ΑΥΓΗ: «Μνημόνιο ανεργίας». Η ΒΡΑΔΥΝΗ: «Προγράμματα ασπιρίνες για την ανεργία». Η ΚΑΘΗΜΕΡΙΝΗ: «Ο Ρεν πιέζει να μειωθεί ταχύτερα το έλλειμμα». Η ΝΙΚΗ της Δημοκρατίας: ««Παράθυρο» για 92.000 προσλήψεις»». Ο ΛΟΓΟΣ: «Ανεργία 14,8% ΣΟΚ και Δέος». ΡΙΖΟΣΠΑΣΤΗΣ: «Κοροϊδεύουν τους ανέργους με τις «κοινωνικές επιχειρήσεις»». ΤΑ ΝΕΑ: «Οι κασέτες της σαπίλας». Το ΠΟΝΤΙΚΙ: «Γιώργο έχεις πακέτο». City Press: «Πώς καταλήξαμε σε ΔΝΤ - μνημόνιο». METRO: «Αντισυνταγματική η έκτακτη εισφορά». ΜΑΚΕΔΟΝΙΑ: «Εχουμε προτάσεις για να βγούμε από την κρίση». Η ΝΑΥΤΕΜΠΟΡΙΚΗ: «Δίχτυ προστασίας εταιρειών από το κύμα πτωχεύσεων». ΕΞΠΡΕΣ: ««Εργαλείο» για διάσωση βιώσιμων επιχειρήσεων». ΗΜΕΡΗΣΙΑ: «Μεταρρυθμιστή κόπωση. Οι εξελίξεις στην Αθήνα ανησυχούν Ε.Ε.-ΔΝΤ». ΚΕΡΔΟΣ: «Τελεσίγραφο στην Ευρώπη στέλνουν οι αγορές για το χρέος».

«ΤΑ ΝΕΑ»: Από τη στήλη με τίτλο «Γνώμες» ουρασμένα παλληκάρια; Είναι φανερό πώς η κυβέρνηση πάσχει από μεταρρυθμιστική κόπωση. Μπορεί η διατύπωση της τρόικας -«έχετε παραλύσει»- να ήταν υπερβολική, αποδίδει ωστόσο παραστατικά τον σχεδόν μοιρολατρικό τρόπο με τον οποίο πολλοί υπουργοί περιμένουν τα νέα από τις Βρυξέλλες ωσάν έτσι να μπορέσουμε να αποφύγουμε τα μέτρα που θα χρειαστεί να πάρουμε. Από την πλευρά των υπουργών η κόπωση είναι φυσιολογική. Τι καλύτερο γι αυτούς από το να κάθονται στα αυγά τους αποφεύγοντας τις συγκρούσεις και το πολιτικό κόστος... Η εξουσία χωρίς πολλές πολλές ευθύνες είναι γλυκιά. Μπορούν και το κάνουν όμως μόνο επειδή το Μαξίμου λειτουργεί αποσπασματικά χωρίς να γίνονται σαφείς οι προτεραιότητες, χωρίς συλλογικές επεξεργασίες και κυρίως χωρίς συνεχή και συστηματική παρακολούθηση κάθε υπουργείου. Οι παρεξηγήσεις και οι ενδοκυβερνητικοί εμφύλιοι είναι η φυσική συνέπεια.(…) Όσοι παρακολουθούν από κοντά τα πράγματα θεωρούν ότι δύσκολα θα αλλάξει η κατάσταση. Ο Γιώργος Παπανδρέου έχει την τάση να ενδιαφέρεται πιο πολύ για την διεθνή πλευρά των προβλημάτων μας που άλλωστε σήμερα είναι καθοριστική. Έτσι ο ίδιος δυσκολεύεται να παρακολουθήσει την καθημερινή ροή του κυβερνητικού έργου -λόγω ιδιοσυγκρασίας ωστόσο αλλά και των κακών εσωκομματικων εμπειρίων του παρελθόντος δεν θέλει να ορίσει συντονιστή ή συντονιστές. Κατανοητό. Αυτός πρώτος όμως οφείλει να κάνει τις δύσκολες επιλογές!

Κ

«ΚΑΘΗΜΕΡΙΝΗ»: Από τη στήλη με τίτλο «Σχόλιο» ο βέτο και... η τρομάρα μας Οι Ελληνες ανταποκριτές στις Βρυξέλλες πάντα λίγο πριν από τις κρίσιμες Συνόδους Κορυφής βάζουν μεταξύ τους το ίδιο στοίχημα. Οτι η Αθήνα θα απειλήσει όλες τις ευρωπαϊκές πρωτεύουσες με ένα βροντερό «ΟΧΙ», αν οι αποφάσεις τους δεν την ικανοποιήσουν. Πρόκειται, βέβαια, περί ενός διαχρονικού δημοσιογραφικού αστείου, καθώς η απειλή του «ελληνικού βέτο» όχι μόνον δεν τίθεται ποτέ στο τραπέζι των διαπραγματεύσεων, αλλά ούτε καν διαμηνύεται στους δήθεν αποδέκτες της. Ο λόγος είναι απλός. Σκεφτείτε, π. χ., τον εαυτό σας σε μια ψαροταβέρνα με 26 «φίλους» σας, κι εσάς να πετάγεστε ξαφνικά αξιώνοντας από όλους να φάνε παστίτσιο. Ποιος άραγε θα μείνει νηστικός; Επικαλούμαι το φαιδρό αυτό παράδειγμα για να καταδείξω πόσο αστεία ηχεί αντίστοιχα η διαρκής επίκληση της απειλής μιας «ελληνικής αρνησικυρίας», την οποία ως επικοινωνιακό τέχνασμα πρωτοσκαρφίστηκε ο Ανδρέας Παπανδρέου και δυστυχώς την υιοθέτησαν όλοι οι διάδοχοί του για να «πωλούν» λεονταρισμούς στην ελληνική κοινή γνώμη. Παραδείγματα, ουκ ολίγα. Χάρη στο ελληνικό «βέτο» δήθεν διατηρήθηκαν κάποτε οι αγροτικές επιδοτήσεις, το βέτο μας «φοβήθηκαν» οι εταίροι μας και έβαλαν την Κύπρο στην Ε. Ε., με βέτο «απειλούσαμε» τις διαπραγματεύσεις της Τουρκίας, με βέτο «μπλοκάραμε» και την ονομασία των Σκοπίων. Επειδή, ωστόσο, η Ελλάδα θα είχε ήδη κερδίσει το Νόμπελ... Διαπραγμάτευσης αν είχε όντως κατορθώσει να επιβάλει στους δήθεν «απρόθυμους» εταίρους της όλες τις κατά καιρούς αξιώσεις της, ας είμαστε επιτέλους σοβαροί. Η κοινή λογική λέει ότι μια μικρή χώρα -και δη χρεοκοπημένη- είναι ανέφικτο να μεταβάλει τις αποφάσεις μιας Συνόδου Κορυφής. Το μόνο όπλο που είχε και αυτή τη φορά η Ελλάδα ήταν να συνασπισθεί εγκαίρως με άλλα κράτη που αντιμετωπίζουν ανάλογα προβλήματα, προκειμένου να μετέχει σε ένα υπολογίσιμο «μέτωπο». Με το δεδομένο αυτό είναι ανησυχητικό το ότι οι πρωθυπουργοί της Ισπανίας και της Πορτογαλίας ήταν οι μόνοι που δεν ήρθαν στην πρόσφατη «σοσιαλιστική» σύναξη του κ. Παπανδρέου στην Αθήνα.

Τ ΙΑΤΡΙΚΑ ΕΙΔΗ - ΑΠΟΛΥΜΑΝΤΙΚΑ ΑΝΑΛΩΣΙΜΑ ΥΛΙΚΑ

l

ΙΑΤΡΙΚΑ ΑΝΑΛΩΣΙΜΑ l ΠΡΟΪΟΝΤΑ ΑΚΡΑΤΕΙΑΣ l ΑΠΟΛΥΜΑΝΤΙΚΑ "BODE" l ΑΝΑΠΗΡΙΚΑ ΑΜΑΞΙΔΙΑ l ΒΑΔΙΣΤΙΚΑ ΟΡΘΟΠΕΔΙΚΑ l ΕΙΔΗ ΑΙΣΘΗΤΙΚΗΣ

3 Με ένα τηλεφώνημα στο χώρο σας, χωρίς καμία επιβάρυνση

ΓΙΑΝΝΟΥΛΑΤΟΣ ΠΕΤΡΟΣ - ΓΥΡΑ ΕΛΕΝΗ Δ/ΝΣΗ: ΒΕΝΙΖΕΛΟΥ 82 ΒΕΡΟΙΑ ΤΗΛ. ΠΑΡ. 23310 61857 - 6974 000786 e-mail: petroselena@hotmail.gr

3 Ατομική συμβουλευτική 3 Ομαδική συμβουλευτική (ζευγαριών, γονέων, φροντιστών ασθενών με νόσο Alzheimer) 3 Διαχείριση άγχους 3 Νευροψυχολογική εκτίμηση ηλικιωμένων και γνωστική αποκατάσταση 3 Διαχείριση πένθους 3 Μαθησιακές δυσκολίες

Προφήτη Ηλία 15 (2ος όροφος) Βέροια τηλ. 23310 60883, Κιν. 6945 929810 e-mail: alexiastergiou@yahoo.gr

17

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

Α

«ΕΛΕΥΘΕΡΟΤΥΠΙΑ»: Από τη στήλη με τίτλο «Πολιτικά παρασκήνια»

διαφορία

Δεδομένες είναι οι ευθύνες της κοινοπραξίας των εταιρειών που διαχειρίζεται την εθνική οδό Αθηνών-Λαμίας για την πολύωρη ταλαιπωρία χιλιάδων οδηγών το βράδυ της Καθαράς Δευτέρας. Ευθύνες μπορεί να έχει και η Τροχαία, που δεν εμπόδισε την κυκλοφορία οχημάτων χωρίς αλυσίδες. Ομως, οδηγοί που βρέθηκαν εγκλωβισμένοι στο δρόμο εκείνες τις ώρες, μας είπαν ότι δεν είναι άμοιροι ευθυνών και οι ίδιοι οι πολίτες-οδηγοί. Συγκεκριμένα: * Υπήρχαν τροχονόμοι τουλάχιστον σε δύο σημεία του δρόμου που προειδοποιούσαν τους οδηγούς να μην προχωρήσουν αν δεν έχουν αλυσίδες, γιατί θα εγκλωβιστούν. Παρ’ όλα αυτά, πάρα πολλοί τούς παρέκαμψαν μαζικά και το αποτέλεσμα ήρθε λίγα χιλιόμετρα παρακάτω, όταν διαπίστωσαν ότι «κόλλησαν». * Αλλοι «βιαστικοί» οδηγοί προσπερνούσαν τα οχήματα που έριχναν αλάτι στο δρόμο, με αποτέλεσμα να «κολλήσουν» λίγα χιλιόμετρα παρακάτω. * Πολλοί, δηλαδή χιλιάδες, οδηγοί παραβίασαν τη λωρίδα έκτακτης ανάγκης, η οποία από ένα σημείο και μετά μπλοκαρίστηκε, με αποτέλεσμα να μην μπορούν να περάσουν τα μηχανήματα καθαρισμού του δρόμου. Και δεν υπήρχαν περιπολικά της Αστυνομίας να την ανοίξουν. Αυτά μάς είπαν παθόντες οδηγοί, που μας τηλεφώνησαν, για να παραθέσουν και την άλλη όψη του προβλήματος: την αδιαφορία, τον τσαμπουκά, τον εξυπνακισμό, την αντικοινωνική συμπεριφορά. Τη γνωστή, δηλαδή, νεοελληνική πραγματικότητα. Με τις υγείες μας... «ΕΘΝΟΣ»: Από τη στήλη με τίτλο «Απόψεις» πέκυψε η Σερβία στις Βρυξέλλες Διασυρμός κάθε έννοιας εθνικής αξιοπρέπειας: η άνευ όρων φιλοδυτική κυβέρνηση του Βελιγραδίου αποφάσισε να ξεπουλήσει το Κόσοβο, την ιστορική κοιτίδα του σερβικού έθνους, που σήμερα κατοικείται από Αλβανούς, με αντάλλαγμα να καταστεί η Σερβία χώρα υποψήφια προς ένταξη στην ΕΕ! Αυτή είναι η πολιτική ουσία της απόφασης της σερβικής κυβέρνησης να υποκύψει στις πιέσεις των Ευρωπαίων και των Αμερικανών και να προσέλθει με το πιστόλι στον κρόταφο σε απευθείας διαπραγματεύσεις με την κυβέρνηση του Κοσόβου, οι οποίες άρχισαν την Τρίτη στις Βρυξέλλες. Το εθνικά ταπεινωτικό για τη Σερβία έγκειται στο ότι δεν φτάνει που οι ΗΠΑ και το ΝΑΤΟ απέσπασαν το Κόσοβο από τη Σερβία με τη χρήση ωμής στρατιωτικής βίας το 1999, δεν φτάνει που μετά από μια δεκαετία οι Ευρωπαίοι και οι Αμερικανοί μετέτρεψαν την παράνομα αποσπασμένη σερβική επαρχία σε ανεξάρτητο κράτος το οποίο έσπευσαν να αναγνωρίσουν και επισήμως αυτοί και οι στενοί τους σύμμαχοι, τώρα εξανάγκασαν και τους ίδιους τους Σέρβους να αναγνωρίσουν «ντε φάκτο» το Κόσοβο ως ανεξάρτητο κράτος μέσω αυτών των συνομιλιών. Αυτή είναι η ουσία, όσες προφάσεις και αν προσπαθεί να βρει η ενδοτική κυβέρνηση του Μπορίς Τάντιτς με ανόητες δηλώσεις του εκπροσώπου της στις συνομιλίες, Μπόρκο Στεφάνοβιτς, του τύπου «προσήλθαμε σε αυτή τη διαδικασία όχι για να παίξουμε μια παρτίδα πόκερ, όπου η μία πλευρά θα νικήσει και η άλλη θα χάσει, αλλά για να λύσουμε τα προβλήματα του λαού». Ο ευρωπαϊκός Τύπος δεν έχει κανέναν δισταγμό να γράψει και να τονίσει χωρίς περιστροφές ότι το Βελιγράδι υπέκυψε στους εκβιασμούς που του άσκησαν η ΕΕ και οι ΗΠΑ, παρόλο που πέντε χώρες από τις «27» δεν έχουν αναγνωρίσει τη μονομερώς ανακηρυχθείσα ανεξαρτησία του Κοσόβου - η Ελλάδα, η Κύπρος, η Ισπανία, η Ρουμανία και η Σλοβακία. Αλλωστε μόνο 74 από τις σχεδόν διακόσιες χώρες - μέλη του ΟΗΕ έχουν αναγνωρίσει το Κόσοβο.

Υ


Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

SUDOKU

Σαν σήμερα... 1904 ιδρύεται ο ΟΦΗ, που δημιουργεί στην πορεία του το άτυπο ρεκόρ της παρουσίας του ίδιου προπονητή, του Ολλανδού, Έλληνα πια, Ευγένιου Γκέραρντ που κάθεται στον πάγκο από το καλοκαίρι του 1985 έως το καλοκαίρι του 2000. το 1905... ο Ελευθέριος Βενιζέλος κηρύττει από τη Θέρισο την Κρητική Επανάσταση. 1910 καταργείται η δουλοπαροικία στην Κίνα. 1920 το βρετανικό Κοινοβούλιο ψηφίζει νόμο περί αυτοδιακυβέρνησης, που χωρίζει την Ιρλανδία σε δύο ημιανεξάρτητες περιοχές. 1933 από ισχυρό σεισμό στο Λονγκ Μπιτς της Καλιφόρνιας πεθαίνουν 120 άτομα. 1941 ο Μουσολίνι φεύγει απογοητευμένος από την Αλβανία, όπου έφτασε για να εμψυχώσει τους Ιταλούς στρατιώτες. 1943 ο βρετανικός στρατός απωθεί τις αντεπιθέσεις των Γερμανών στην Τυνησία, κατά τη διάρκεια του Β Παγκοσμίου Πολέμου. 1945 300 αμερικανικά βομβαρδιστικά

τα

ισοπεδώνουν το Τόκιο ρίχνοντας 2000 τόνους βομβών και σκοτώνοντας 100.000 πολίτες. 1949 κλείνει επ αόριστον το Πανεπιστήμιο Θεσσαλονίκης, διότι καθυστερεί επί εννέα μήνες η έγκριση του προϋπολογισμού του. 1951 στην Πράγα, συλλαμβάνεται ο αρχιεπίσκοπος της Τσεχοσλοβακίας, Γιόζεφ Μπεράν. 1959 η Συρία δέχεται εναέρια επίθεση από το Ιράκ. 1964 σοβιετικό καταδιωκτικό καταρρίπτει πάνω από το δάσος της Θουριγγίας, στην Ανατολική Γερμανία, ένα αμερικανικό αεροσκάφος, χωρίς να υπάρξουν θύματα. 1969 δικαστήριο του Μέμφις στις ΗΠΑ βρίσκει ένοχο για την δολοφονία του μαύρου ακτιβιστή Μάρτιν Λούθερ Κινκ τον Τζέιμς Ερλ Ρέι και τον καταδικάζει σε θάνατο. 1971 η Ιντίρα Γκάντι κερδίζει τις εκλογές στην Ινδία. 1974 επανεκλέγεται η Γκόλντα Μέιρ στην πρωθυπουργία του Ισραήλ. 1980 στο Ιράν, ο Χομεϊνί υποστηρίζει τους μαχητές, που κρατούν τους

Αμερικανούς ομήρους. 1985 στην Ουρουγουάη, πέφτει μετά από δώδεκα χρόνια η στρατιωτική δικτατορία. 1987 το Βατικανό καταδικάζει την απόκτηση παιδιού μέσω δανεικής μητέρας όπως είχε κάνει το ίδιο με τα παιδιά του σωλήνα και την τεχνητή γονιμοποίηση 1988 50 νεκροί και πολλοί τραυματίες στην Τρίπολη της Λιβύης κατά τη διάρκεια σύρραξης μεταξύ των φιλάθλων στον φιλικό αγώνα ΛιβύηΜάλτα 1990 δεκαοχτώ μήνες μετά την κατάληψη της εξουσίας με πραξικόπημα, εκδιώκεται από την Αϊτή ο δικτάτορας Πρόσπερ Αβρίλ 1993 ΗΠΑ και Γαλλία επιβεβαιώνουν μετά τη συνάντηση των Προέδρων τους στην Ουάσινγκτον, την πρόθεσή τους να μην αποστείλουν στρατεύματα στη Βοσνία. 1994 με τιμές Πρωθυπουργού κηδεύεται η υπουργός Πολιτισμού Μελίνα Μερκούρη. 1995 στο Πακιστάν, 10 άνθρωποι σκοτώνονται από έκρηξη βόμβας που

σημειώνεται κοντά σε τέμενος σε ανατολικό προάστιο του Καράτσι. 1997 το Βατικανό συνάπτει διπλωματικές σχέσεις με τη Λιβύη. 1998 Αμερικανοί στρατιώτες που εδρεύουν στο Περσικό Κόλπο εμβολιάζονται κατά του άνθρακα 2002 ο Άκης Τσαταλιός, 33χρονος προπονητής της ομάδας πόλο γυναικών της Βουλιαγμένης, πεθαίνει από ανακοπή κατά τη διάρκεια του αγώνα της ομάδας του με τον Εθνικό στο κολυμβητήριο του Πειραιά 2003 σε αδιέξοδο καταλήγουν οι διαβουλεύσεις στη Χάγη για την επίλυση του Κυπριακού, ανάμεσα στον Πρόεδρο της Κυπριακής Δημοκρατίας, Τάσσο Παπαδόπουλο, και στον Τουρκοκύπριο ηγέτη, Ραούφ Ντενκτάς, υπό την αιγίδα του Κόφι Ανάν. Ευθύνες στην τουρκοκυπριακή πλευρά για το αδιέξοδο στο Κυπριακό επιρρίπτουν ΟΗΕ, Στέιτ Ντιπάρτμεντ και Φόρεϊν Όφις, ενώ η Ε.Ε. δηλώνει ότι θα σκληρύνει τη στάση της απέναντι στην Τουρκία, όσον αφορά την ένταξή της στους κόλπους της.

μιλούν Κριος

Καλά θα κάνετε να πλησιάσετε περισσότερο το σύντροφό σας και θα μπορέσετε διορθώσετε προβληματικές καταστάσεις *Δείξτε περισσότερο ενδιαφέρον *Εσείς που είστε μόνοι θα μπορέσετε να κάνετε μια γνωριμία η οποία θα σας συναρπάσει *Αποφύγετε τις επιπολαιότητες, φίλοι μου. Στην εργασία σας θα χρειαστεί οργάνωση

Λεων

Καλά θα κάνετε ζητήματα εργασίας να τα ρυθμίσετε με προσοχή *Η περίοδος αυτή δεν είναι κατάλληλη για να πάρετε κάποιο ρίσκο *Σκεφτείτε καλά *Αποφύγετε στα οικονομικά σας να κάνετε κινήσεις που μπορούν να σας βγάλουν από τον προϋπολογισμό σας *Κινηθείτε με προσοχή. Σχέδια για το μέλλον θα ευνοηθούν

Τοξοτης

Στα αισθηματικά σας είναι πιθανό να έχετε κάποια προβλήματα με το ταίρι σας *Καλά θα κάνετε να προσέξετε τη συμπεριφορά *Να είστε υπομονετικοί *Εσείς που είστε μόνοι θα έχετε την ευκαιρία να κάνετε μια γνωριμία η οποία θα σας χαροποιήσει πολύ *Δείξτε τον καλύτερο σας εαυτό. Προσέξτε περισσότερο την εικόνα σας

Ταυροσ

Προσπαθήστε στην εργασία σας να ακολουθήσετε ένα πρόγραμμα για να μπορέσετε να πετύχετε τους στόχους σας *Μην πάρετε αποφάσεις για το μέλλον σας *Κάποια σκαμπανεβάσματα στα οικονομικά σας θα σας αγχώσουν λίγο *Ρυθμίστε τις εκκρεμότητες με σοβαρότητα και προσοχή

Παρθενος

Ρυθμίστε με προσοχή ζητήματα που έχουν να κάνουν με την εργασία σας *Μην βιαστείτε να ξεκινήσετε νέες συνεργασίες για να μην έχετε προβλήματα *Αποφύγετε στα οικονομικά σας να κάνετε κινήσεις που μπορούν να σας βγάλουν από το πρόγραμμα σας *Κινηθείτε με προσοχή. Δείξτε περισσότερο ενδιαφέρον

Αιγοκερως

Με τον ερωτισμό σας στα ύψη θα μπορέσετε να βρείτε λύσεις σε υποθέσεις που καιρό σας δυσκόλευαν και κρατούσαν σε στασιμότητα τη σχέση σας *Αγαπητοί αδέσμευτοι καλά θα κάνετε να προσέξετε νέες γνωριμίες που θα σας χαροποιήσουν *Κινηθείτε με προσοχή για να μην έχετε προβλήματα

18

ΔΙΔΥΜΟΙ

Μερικές συζητήσεις με το ταίρι σας θα σας βοηθήσουν να κάνετε καλύτερη τη σχέση σας *Λύστε όποιες διαφορές έχετε αποφεύγοντας τις εντάσεις *Φροντίστε οι εργένηδες του ζωδίου να αλλάξετε μερικές συνήθειες που έχετε *Αποφύγετε τις περιττές μετακινήσεις για να μην ταλαιπωρηθείτε. Κάντε νέα ξεκινήματα. Οι δικοί σας θα στηρίξουν τις επιλογές σας

Ζυγος

Καλά θα κάνετε να περάσετε όσο πιο ευχάριστα μπορείτε τη σημερινή ημέρα *Μην κάνετε πράγματα που μπορούν να σας πιέσουν *Κάντε μια νέα αρχή *Αγαπητοί αδέσμευτοι θα έχετε την ευκαιρία να κάνετε πράγματα τα οποία θα σας χαροποιήσουν *Περάστε καλά παρέα με αγαπημένους φίλους σας

Υδροχοος

Σε μερικά πράγματα καλά θα κάνετε να έχετε τα μάτια σας ανοιχτά στα αισθηματικά σας *Κάποιες εντάσεις με το ταίρι σας θα σας ρίξουν ψυχολογικά *Αγαπητοί αδέσμευτοι η τύχη είναι με το μέρος σας και σύντομα θα μπορέσετε να περάσετε πολύ καλά με μια γνωριμία που θα κάνετε. Καλά θα κάνετε να προσέξετε περισσότερο την εικόνα σας

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

ΚΑΡΚΙΝΟΣ

Με τον ερωτισμό σας στα ύψη θα μπορέσετε να απολαύσετε μοναδικές στιγμές με το ταίρι σας *Αποφύγετε να κάνετε κινήσεις που θα φέρουν εντάσεις *Αγαπητοί αδέσμευτοι θα έχετε την ευκαιρία να βρείτε λύσεις σε πράγματα που έχουν να κάνουν με κοντινά σας πρόσωπα. Αλλάξτε μερικές συνήθειες σας

Σκορπιος

Προσέξετε λίγο καλύτερα ζητήματα που έχουν να κάνουν με την υγεία σας *Είναι πιθανό κάποιο κρυολόγημα να σας ταλαιπωρήσει για λίγες μέρες *Προσπαθήστε να έχετε τα μάτια σας ανοιχτά στις μετακινήσεις σας *Μην κάνετε πράγματα που θα επηρεάσουν αρνητικά τη ψυχολογία σας

ΙΧΘΕΙΣ

Η κινητικότητα στην εργασία σας θα είναι έντονη *Καλά θα κάνετε να προσέξετε λίγο καλύτερα την εικόνα σας *Μην παρασυρθείτε και κάνετε υπερβολές *Προτιμήστε μερικά ζητήματα που έχουν να κάνουν με τα οικονομικά σας να τα προσέξετε *Μην κάνετε πράγματα που θα σας αγχώσουν. Δείξτε τον καλύτερό σας εαυτό


ΨΗΓΜΑΤΑ 

epikera@otenet.gr

Επιμέλεια Νικολέττα Φλιάταρη

Έτσι, έμεινε να λέμε:

Αχίλλεια φτέρνα

gaρ

Η μητέρα του Αχιλλέα, η Θέτιδα, θέλοντας να προφυλάξει το γιο της από πλήγωμα, τον είχε βυθίσει, όταν γεννήθηκε, στο νερό της Στύγας . Αλλά η φτέρνα του ενός ποδαριού, απ’ όπου τον βαστούσε, είχε μείνει άγγιχτη και για αυτό πέθανε ο Αχιλλέας στο τέλος του Τρωικού πολέμου από μια πληγή . – Λέγεται για σημείο αδύνατο που παρουσιάζεται μέσα σε σύνολο δυνατό .

… ς α τ ον

Μήλο της Έριδας

Υποψίες γεννά η επίθεση Παπανδρέου σε Σαμαρά Μόλις 24 ώρες μετά τη συνάντησή τους, στα πλαίσια της πρόσκλησης που είχε απευθύνει ο κ. Παπανδρέου στους πολιτικούς αρχηγούς, παρακολουθήσαμε όλοι μια «ανεξήγητη» επίθεση του κ. Παπανδρέου προς τον Αντώνη Σαμαρά, τον οποίο εξέθεσε ενώπιον του ελληνικού λαού κατηγορώντας τον για διγλωσσία. Δηλαδή του είπε ότι, ενώ στο εσωτερικό της χώρας είναι κατά του μνημονίου, όταν βρίσκεται στο εξωτερικό τάσσεται υπέρ του μνημονίου. Το έπραξε αυτό ενσυνείδητα και ενώ γνώριζε ότι θα επακολουθούσε οργισμένη αντίδραση της Νέας Δημοκρατίας. Αφού λοιπόν είχαν συναντηθεί Παπανδρέου και Σαμαράς μόλις μια μέρα πριν και αφού είχε διαφανεί μια κάποια συναίνεση και βοήθεια από πλευράς του κ. Σαμαρά προς τον κ. Παπανδρέου, στη λύση πακέτο που ετοιμάζεται αυτός να θέσει στην Σύνοδο Κορυφής, τότε προς τι αυτή η ξαφνική και απρόκλητη επίθεση εναντίον του κ. Σαμαρά; Επειδή πλέον είμαστε μεγάλα παιδιά και δεν πρέπει να «τρώμε» τα προπαγανδιστικά τεχνάσματα, κάνουμε τις εξής σκέψεις: Σκέψη πρώτη: Υπάρχει πλήρης συνταύτιση ΠΑΣΟΚ και Νέας Δημοκρατίας στα θέματα του μνημονίου και απλώς έπρεπε να υπάρξει αυτό το θέατρο διαφωνίας και σύγκρουσης για να διασωθεί το πολιτικό σύστημα, μέσα από έναν

&...

http://hassapis-peter.blogspot.com

περίεργα

Π

αράξενα

αποπροσανατολισμό και περιμάντρωση των κομματικών οπαδών, διεγείροντας το θυμικό τους. Σκέψη δεύτερη: Είναι γνωστό σε όλους ότι οι δημοσκοπήσεις εμφανίζουν τη διαφορά μεταξύ ΠΑΣΟΚ και ΝΔ στα όρια του στατιστικού λάθους. Μάλιστα, σύμφωνα με πληροφορίες, η ΝΔ έχει δημοσκόπηση που την εμφανίζει 1% μπροστά. Επομένως στα πλαίσια αυτά και με δεδομένο ότι το ΠΑΣΟΚ δεν θα μπορέσει να συνεχίσει, ο κ. Παπανδρέου πρότεινε στον κ. Σαμαρά συγκυβέρνηση και ο τελευταίος αρνήθηκε. Σκέψη Τρίτη: Σύμφωνα και πάλι με τα αποτελέσματα των δημοσκοπήσεων, αλλά και σύμφωνα με τις προοπτικές της ελληνικής οικονομίας και του δημοσίου χρέους, δεν πιστεύουμε ότι υπάρχει κάποιος εχέφρων σ’ αυτόν τον τόπο που να πιστεύει ότι το ΠΑΣΟΚ θα προσπαθήσει να πάει μέχρι το 2013 και τότε να κάνει εκλογές. Απλά αυτό είναι μαθηματικά αδύνατο. Επομένως ο κ. Παπανδρέου αποφάσισε εκλογές, τώρα που ενδεχομένως είναι ακόμα μπροστά και η επίθεση εναντίον του κ. Σαμαρά έχει στόχο να βάλει πάλι στο κομματικό «μαντρί» όλους τους αμνούς που διαμαρτύρονται. Δηλαδή προετοιμάζει το έδαφος για τη συσπείρωση του κόμματός του, ενόψει εκλογών. Εσείς ποια από τις τρεις σκέψεις επιλέγετε;;

Εξι τραυματίες σε συμπλοκή για... γάλα μωρού! Η ανασφάλεια για την ποιότητα των κινεζικών προϊόντων οδηγεί τους πολίτες σε εκδρομές στο Χονγκ Κονγκ, όπου τα καταστήματα έχουν βάλει... πλαφόν στον αριθμό συσκευασιών που πωλούν, με εκρηκτικά αποτελέσματα. Την Πέμπτη σε σούπερ μάρκετ της πόλης η αστυνομία αντιμετώπισε συμπλοκή πελατών, με μήλο της έριδος εισαγόμενες κονσέρβες βρεφικού γάλακτος σε σκόνη. Δύο άτομα ξεκίνησαν την αψιμαχία που άφησε έναν με τραύμα στο κεφάλι, ενώ σε άλλους πέντε παρασχέθηκαν πρώτες βοήθειες. Το κατάστημα είχε πλαφόν τις τρεις συσκευασίες ανά πελάτη, γεγονός που προκάλεσε και την σύγκρουση μεταξύ επίδοξων αγοραστών. Οι εισαγωγείς βρεφικών τροφών στην ηπειρωτική Κίνα θησαυρίζουν, καθώς οι τιμές στην αγορά είναι διπλάσιες από τις αντίστοιχες του Χονγκ Κονγκ. Ετσι πολλοί πραγματοποιούν ταξίδια στην πρώην βρετανική αποικία για να συγκεντρώσουν προμήθειες. Υπενθυμίζεται ότι στο παρελθόν μόνο σε μία από τις υποθέσεις νοθείας βρεφικών τροφών, έξι βρέφη είχαν χάσει τη ζωή τους και πάνω από 300.000 είχαν υποστεί βλάβες από γάλα σε σκόνη μολυσμένο με μελαμίνη, το 2008. Η ουσία αυτή συγκαλύπτει την μειωμένη περιεκτικότητα του γάλακτος, λόγω των πρωτεϊνών που περιέχει.

19

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

Η Έριδα, αδερφή του Άρη, και κατά τον Ησίοδο κόρη της Νύχτας και μητέρα όλων των κακών, χαιρόταν για κάθε φιλονικία . Όταν έγιναν οι γάμοι του Πηλέα με τη Θέτιδα, από ζήλια που δεν την είχαν καλέσει πήγε και έριξε ανάμεσα στις καλεσμένες θεές, την Ήρα, την Αθηνά και την Αφροδίτη, ένα μήλο με την επιγραφή «Η καλή λαβέτω», να το πάρει η όμορφη . Ο Πάρης, που ορίστηκε κριτής, έδωσε το μήλο στην Αφροδίτη . Η κρίση αυτή είχε για επακόλουθο τον Τρωικό πόλεμο . – Το μήλο της Έριδας έγινε παροιμιακό για κάτι που γίνεται αφορμή φιλονικίας και κακών ή για κάτι που το διεκδικούν πολλοί .

Θάλαττα, Θάλαττα «Θάλασσα! Θάλασσα!» (Ξενοφ . Κύρου Ανάβασις 4 . 724) . Ήταν η κραυγή της ασυγκράτητης χαράς που βγήκε από τα στήθη των Ελλήνων στρατιωτών που έκαμαν την «Κάθοδο των Μυρίων» . Οδηγημένοι από τον Ξενοφώντα, έπειτα από ταλαιπωρίες σχεδόν, χρονιάς ολόκληρης στα βουνά της Μικρασίας και σε τόπους μακρινούς, στις ζέστες του καλοκαιριού και στο κρύο του χειμώνα, φώναξαν τη λέξη αυτή όταν από ένα βουνό αντίκρισαν επιτέλους με δάκρυα και με αγκαλιάσματα, τον Εύξεινο Πόντο, τη θάλασσα που τους μηνούσε πως δεν ήταν πια μακριά η μέρα που θα ξανάβλεπαν τ’ ακρογιάλια της πατρίδας . – Το λέμε όταν ύστερ’ από κοπιαστικές βλέπομε επιτέλους κάποιο σημάδι για το τέρμα .

Eν τούτο νίκα Οδηγώντας ο Μ . Κωνσταντίνος το στρατό του στη Ρώμη για να πολεμήσει με τον Μαξέντιο (312 μ . Χ . ), είδε στον ουρανό, όπως αναφέρει ο Ευσέβιος, ένα φωτεινό σταυρό με την επιγραφή αυτή . Τότε ύψωσε τη σημαία με το σταυρό και τα δύο αρχικά γράμματα του ονόματος του Χριστού μέσα σε χρυσό στέμμα και δείχνοντας έτσι επίσημα τη συμπάθειά του στη νέα θρησκεία μπήκε στην Ιταλία, νίκησε το Μαξέντιο και κατατρόπωσε το στρατό του .

Δ Ι Α Π Ι Σ Τ Ω Σ Ε Ι Σ

Γνωρίζετε ότι...

 Το 1960, στους Ολυμπιακούς Αγώνες της Ρώμης, ο Αιθίοπας δρομέας Αμπέμπε Μπεκίλα τερμάτισε πρώτος στον μαραθώνιο (40 χλμ.) τρέχοντας ξυπόλητος!  Το 1967, το εσωτερικό σημείωμα της CIA που αναφερόταν στα σχέδια για τη δολοφονία του Φιντέλ Κάστρο περιλάμβανε 133 σελίδες.  Tο 1977 υπήρχαν μόνο 37 άνθρωποι που ντυνόταν σαν τον Elvis. To 1993, έφτασαν τους 48.000.  Το 1991, ένα αεροπλάνο MD 80 με 100 επιβάτες αναγκάστηκε να κάνει αρκετούς κύκλους πάνω από ένα ισπανικό αεροδρόμιο, περιμένοντας να ξυπνήσει ο μοναδικός ελεγκτής εναέριας κυκλοφορίας, που είχε αποκοιμηθεί εν ώρα εργασίας!  Το 1993, οι επιστήμονες εντόπισαν την μεγαλύτερη συγκέντρωση ηφαιστείων στον βυθό του Νοτίου Ειρηνικού ωκεανού. Πρόκειται για μια περιοχή ίση σε έκταση με την Νέα Υόρκη, όπου βρίσκονται 1.133 ηφαιστειακοί κώνοι.  Το 1998, 2.541 ταχυδρόμοι δαγκώθηκαν από σκυλιά στις Η.Π.Α. Οι περισσότερες επιθέσεις (49) έγιναν στο Χιούστον.


αγγελιεσ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

ΜΙΚΡΕΣ Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα

Επικαιρα

Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΑΓΟΡΑΖΩ ΠΑΛΙΑ ΧΡΥΣΑΦΙΚΑ Λίρες, Βραχιόλια, Σκουλαρίκια, Δαχτυλίδια, Δόντια. Σπασμένα, χαλασμένα. Στις καλύτερες τιμές της αγοράς, με 1 βήμα μπορείτε χωρίς φόβο να έρθετε στο γραφείο μας, κρατάμε πλήρη εχεμύθεια. Έναντι Κλινικής Αντωνιάδη Βενιζέλου 16 Βέροια (1ος όροφος) Τηλ.: 23310 66581, κιν.: 6984223075 Από 8.30 π.μ. έως 8.30 μ.μ.

ΠΙΤΣΑΡΙΑ "Ο ΝΙΚΟΣ"

και πάλι κοντά σας...

Πίτσα σπέσιαλ γίγας Πίτσα σπέσιαλ οικογενειακή Καλτσόνε Μακαρανόδα του Σεφ

7 ευρώ 5 ευρώ 7 ευρώ 4 ευρώ

Καρμπονάρα

4 ευρώ

με κόκκινη σάλτσα

Οι πίτσες μας είναι χειροποίητες και τις δημιουργούμε με τα πιο αγνά υλικά και πολύ μεράκι...

Προσφορές

l l

Στις 2 πίτσες γίγας + 1 Δώρο ή 1 κόλα Στις 2 οικογ/κές + 1 Δώρο ή 1 κόλα

Ωρες λειτουργίας από τις 12.30 το μεσημέρι έως τις 1.00 το βράδυ

σπεσιαλιτέ μας ΠΙΤΣΑ ΜΕ ΚΙΜΑ

Τηλ. παραγγελιών

2331 400721

κιν. 6972 475934 (what's up)

Πατρίδα Ημαθίας

υπεύθυνοι: Νίκος Φουτσιτζίδης - Ηρακλής Ελευθεριάδης

Κοπελα με μεγάλη εμπειρία και χωρισ υποχρεωσεισ ΑΝΑΛΑΒΑΝΕΙ καθαρισμό σπιτιών και επαγγελματικών χώρων. Τηλ.: 6972688217 Ζήτηση Εργασίας Ζητάω δουλεία ως καθαρίστρια. Μπορώ να καθαρίζω σπίτια, σκάλες, γραφεία και επαγγελματικούς χώρους. Τηλ. επικοινωνίας: 6979260569 Ζήτηση εργασίας Ζητώ δουλειά ως οδηγός ή πωλητής. Κατέχω Επαγγελματικό Δίπλωμα Γ΄ Κατηγορίας, εμπειρία και άριστες γνώσεις του οδικού δικτύου. κ.Χρήστος: 6974325285 Κυρία, Ελληνίδα, έμπειρη ΖΗΤΑ ΕΡΓΑΣΙΑ για καθορισμό σπιτιών, γραφείων κ.λ.π. Αναλαμβάνει επίσης τη φροντίδα ηλικιωμένων. Επικοινωνία στο τηλ. 6945 975452 κ. Βάσω. ΚΥΡΙΑ με μεγάλη εμπειρία ζητά εργασία για καθαρισμό σπιτιών - γραφείων κ.λ.π. Επίσης φροντίζει και ηλικιωμένους. Ωράριο ελεύθερο. Κιν. 6973917652, κα Γιάννα. Νοσοκόμα αναλαμβάνει τη φύλαξη ηλικιωμένων πρωινές ώρες.Τηλ:6987347068 ΟΔΗΓΟΣ Με Γ’ κατηγορία δίπλωμα με γνώση Γερμανικών και Αγγλικών, ψάχνει εργασία. Κιν. 6934798786. ΑΝΑΛΑΜΒΑΝΩ κάθε είδους οικοδομικά μερεμέτια και διαρρυθμίσεις οικιών και καταστημάτων, έλληνας τεχνίτης. Κιν. 6945974197. Κοπελα με μεγάλη εμπειρία και χωρισ υποχρεωσεισ ΑΝΑΛΑΒΑΝΕΙ την φροντίδα παιδιών. Τηλ.: 6972688217 ΒΙΒΛΙΟΔΕΤΡΙΑ επαγγελματίας ζητάει εργασία (τυπογραφεία) σε βιβλιοδετεία, εργαστήρια, εκδοτικούς οίκους. Κιν.6993033111.V ΑΓΟΡΑΖΩ Παλιά κοσμήματα και τιμαλφή τοις μετρητοίς. Μόνο σοβαρές προτάσεις. Τηλ. Επικοινωνίας: 6974901322 ολοήμερα - 2331024203 ώρες καταστ.

ΖΗΤΗΣΗ ΕΡΓΑΣΙΑΣ ΖΗΤΕΙΤΑΙ:Άτομο για εργασία στο χώρο της πώλησης για το νομό Ημαθίας Τηλ. 2331500124 ώρες καταστημάτων Zητείται κοπέλα για εργασία στο Καφέ-Μπαρ «ΤΕΤΑ-ΤΕΤ» στη Βέροια. Τηλ. επικοινωνίας: 6982618526 ΖΗΤΕΙΤΑΙ Κοπέλα για εργασία σε καφετέρια στα Ριζώματα Ημαθίας Τηλέφωνο επικοινωνίας 9649449615 ΖΗΤΟΥΝΤΑΙ κοπέλες για βραδυνή εργασία σε καφέ - μπαρ στη Βέροια. Πληροφορίες στο τηλέφωνο 6976399315. ΖΗΤΕΙΤΑΙ κοπέλα για εργασία στο ταβερνάκι της Κούλας, Εμ. Παππά 11, κοντά στο ΙΚΑ. Πληροφορίες στο τηλ. 23310 65502 κ. Κούλα

20

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

ΚΑΤΟΙΚΙΑ ΠΩΛΕΙΤΑΙ Μεζονέτα 120μ2 στο Λιτόχωρο Πιερίας ΠΩΛΕΙΤΑΙ Μεζονέτα 120 μ2 στο Κέντρο ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 μ2 κάτω από τα στρατόπεδα. ΠΩΛΕΙΤΑΙ Μεζονέτα Νεόδμητη 115 μ2 περιοχή Βίλλα Βικέλα. ΠΩΛΕΙΤΑΙ Μεζονέτα 110 μ2 στο Πανόραμα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 60 μ2 στο κέντρο. ΠΩΛΕΙΤΑΙ Μεζονέτα 80 μ2 στη Νικήτη Χαλκιδικής. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 μ2 περιοχή Βίλλα Βικέλα. ΠΩΛΟΥΝΤΑΙ Διαμερίσματα 100 και 100 μ2 στην Αλεξάνδρεια. ΠΩΛΕΙΤΑΙ Διαμέρισμα 100 τ.μ. κοντά στην Πλ. Ωρολογίου. ΠΩΛΕΙΤΑΙ Μεζονέτα Νεόδμητη 100 τ.μ. στο Καλαμίτσι Χαλκιδικής. ΠΩΛΕΙΤΑΙ Διαμέρισμα 100 τ.μ. περιοχή Κύπρου. ΠΩΛΕΙΤΑΙ Διαμέρισμα 65 τ.μ. στη Νικήτη Χαλκιδικής. ΠΩΛΕΙΤΑΙ Μεζονέτα 95 τ.μ. στην Καλλιθέα. ΠΩΛΕΙΤΑΙ Γκαρσονιέρα 25 τ.μ. στο κέντρο. ΠΩΛΕΙΤΑΙ Διαμέρισμα 116 τ.μ. περιοχή Προμηθέα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 85 τ.μ. περιοχή Κέντρο. ΠΩΛΕΙΤΑΙ Διαμέρισμα 95 τ.μ. περιοχή Καλλιθέα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 85 τ.μ. επί της οδού Θεσ/νικης. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 τ.μ. στο Τσερμένι. ΠΩΛΕΙΤΑΙ Διαμέρισμα 165 τ.μ. περιοχή Προμηθέα. ΠΩΛΕΙΤΑΙ Διαμέρισμα 95 τ.μ. περιοχή Κέντρου. ΠΩΛΕΙΤΑΙ Διαμέρισμα 105 τ.μ. περιοχή Παπάγου. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 τ.μ. πάνω από τα Παπάκια. ΠΩΛΕΙΤΑΙ Ημιτελής Μονοκατοικία 130 τ.μ. στο κέντρο. ΠΩΛΕΙΤΑΙ Διαμέρισμα 110 τ.μ. πίσω από το Βυζαντινό Μουσείο. ΠΩΛΟΥΝΤΑΙ Μονοκατοικίες 65 τ.μ. στην Λεπτοκαρυά. ΠΩΛΕΙΤΑΙ Μονοκατοικία 130 τ.μ. στο Μακροχώρι. ΕΝΟΙΚΙΑΣΕΙΣ ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα μερικώς επιπλωμένο, σε άψογη κατάσταση, με Ατ. Θέρμανση στη Τούμπα Θεσ/νίκης

ΕΝΟΙΚΙΑΖΟΝΤΑΙ Διαμερίσματα, Καταστήματα, Γραφεία, Αποθηκευτικοί - Βιομηχανικοί χώροι σε όλες τις περιοχές και τα εμβαδά ΕΠΑΓΓΕΛΜΑΤΙΚΗ ΣΤΕΓΗ ΠΩΛΕΙΤΑΙ κατάστημα 107 τ.μ. σε υπόγειο 128,41 τ.μ. πλησίον της οδού Θεσ/νικης. ΠΩΛΕΙΤΑΙ κατάστημα 100 τ.μ. περιοχή φανάρια Κύπρου. ΠΩΛΕΙΤΑΙ κατάστημα 100 τ.μ. με 100 τ.μ. υπόγειο και 60 τ.μ. πατάρι στο κέντρο. ΠΩΛΕΙΤΑΙ ημιυπόγειος χώρος 170 τ.μ. κοντά στην Ανοίξεως. ΠΩΛΕΙΤΑΙ κατάστημα 104 τ.μ. επί της Κεντρικής. ΠΩΛΕΙΤΑΙ κατάστ. 107 τ.μ. με υπόγειο 90 τ.μ. στο κέντρο της Βέροιας. ΠΩΛΕΙΤΑΙ κατάστημα 160 τ.μ. περιοχή οδού Θεσ/νικης. ΠΩΛΕΙΤΑΙ γραφείο 100 τ.μ. στη Μ. Αλεξάνδρου. ΠΩΛΕΙΤΑΙ γραφείο 50 τ.μ. στη Μ. Αλεξάνδρου. ΠΩΛΕΙΤΑΙ κατάστημα 100 τ.μ. πλησίον του Αγ. Αντωνίου. ΠΩΛΕΙΤΑΙ κατάστημα – γραφείο 55 τ.μ. επί της οδού Μ. Αλεξάνδρου. ΟΙΚΟΠΕΔΑ – ΑΓΡΟΙ ΠΩΛΕΙΤΑΙ Αγροοικόπεδο 6.800 μ2 στα Καβάκια ΠΩΛΕΙΤΑΙ Οικόπεδο 390 μ2 στη Ραχιά ΠΩΛΕΙΤΑΙ Αγροοικόπεδο 4.000 μ2 στο Λοζίτσι ΠΩΛΕΙΤΑΙ Οικόπεδο 260 μ2 στο Κέντρο της Βέροιας ΠΩΛΕΙΤΑΙ Οικόπεδο 500 μ2 στη Σκοτίνα Πιερίας ΠΩΛΕΙΤΑΙ Οικόπεδο 500 μ2 στο Εργοχώρι ΠΩΛΕΙΤΑΙ Αγροοικόπεδο 4.00 μ2 στο Εργοχώρι ΠΩΛΕΙΤΑΙ Οικόπεδο 1.000 τ.μ. στη Βεργίνα. ΠΩΛΕΙΤΑΙ Οικόπεδο 1.000 τ.μ. στα Ασώματα. ΠΩΛΕΙΤΑΙ Οικόπεδο 1.000 τ.μ. στους Γεωργιανούς. ΠΩΛΕΙΤΑΙ Οικόπεδο 500 τ.μ. στη Βεργίνα. Κωττουνίου 18, Βέροια 59100 Τηλ. – Fax.: 23310 65564 Κιν. 6972 808878


αγγελιεσ 

epikera@otenet.gr

ΜΙΚΡΕΣ

Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα Επικαιρα Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΕΝΟΙΚΙΑΣΕΙΣ ΕΝΟΙΚΙΑΖΕΤΑΙ γκαρσονιέρα 35τ.μ κοντά στο Δημαρχείο. Έχει σαλοδωμάτιο, κουζίνα, χωλ, w.c .Λίγα κοινόχρηστα, τιμή προσιτή. Τηλ. 2331070853 & 6974297043 ΕΝΟΙΚΙΑΖΕΤΑΙ γκαρσονιέρα στο 2ο όροφο, επι της 10ης Μεραρχίας 2, στο κέντρο δίπλα στο Επιμελητήριο στη Βέροια. Οικονομικό ενοίκιο. Τηλ. 2331061594. ΕΝΟΙΚΙΑΖΕΤΑΙ το πρώην κατάστημα «Γλυκοζαλάδες» που βρίσκεται στην Οδό Κεντρικής 90 καθώς και το «Ψυγείο Μαυρίδη» στην οδό Πιερίων 62.Τηλ. Επικοινωνίας: 23310-29547. ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα απέναντι από το γήπεδο Βέροιας Σταδίου 35, 80 τ.μ, δωμάτιο, σαλόνι, κουζίνα, ασανσέρ. Τηλ. Επικοινωνίας: 23310-21204

106 τ.μ. και 80 τ.μ. (Καλιθέα), επιπλωμένα ή όχι. τηλ: 2331070926 και 2331062347, κιν: 6946098247 και 6943697645

ΠΩΛΕΙΤΑΙ Άδεια ΠΡΟΠΟ με μεγάλο τζίρο, χωρίς χρέος προς τον ΟΠΑΠ, ολόκληρη ή μισή. Τηλ.: 6979903631 Ψητοπωλείο - Σαντουϊτσάδικο με άδεια λειτουργίας. 100 καθιστικά στην πιάτσα στην πλατεία της Σίβηρης, μόνο για γνώστες της δουλειάς. Τιμή ευκαιρίας! Τηλ. 6980622488

Ενοικιάζεται διαμέρισμα στη Θεσσαλονίκη 45 τ.μ, πλήρως ανακαινισμένο, 2ος όροφος.Τηλ: 6942595995

ΕΝΟΙΚΙΑΖΕΤΑΙ: γκαρσονιέρα 1Δ.Κ.ΜΠ. ανακαινισμένη Τιμή: 280,00 € Τηλ.:693.246.6.633

Ενοικιάζεται κατάστημα 50 τ.μ με υπόγειο πατάρι, WC, δίπλα στο Επιμελητήριο Βέροιας. ΤΗΛ: 2331061594

ΕΝΟΙΚΙΑΖΕΤΑΙ: 2ος όροφος, γκαρσονιέρα 1Δ.Κ.ΜΠ. Τιμή: 250,00 € Τηλ.: 693.246.6.6333

ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα 90 τ.μ. κοντά στο ΙΚΑ Βέροιας. Μεσιτικό γραφείο: 6974747117

ΕΝΟΙΚΙΑΖΕΤΑΙΔιαμέρισμα στην Καλλιθέα 100τμ, Σ, Κ, 2Δ, WC, 2Ος όροφος (ευκαιριακό ενοίκιο) Τηλ. Επικοινωνίας: 6946491573

ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα 123 τ.μ. στην περιοχή Περικλέους (κέντρο), Βέροια. Μεσιτικό γραφείο: 6974747117 ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα 50 τ.μ. Πλουτάρχου 20. τηλ: 2331065187 ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα στη Θεσ/ νίκη 75 τ.μ. για φοιτητές κοντά στα πανεπιστήμια. τηλ: 2331023804, κιν: 6972834596 ΕΝΟΙΚΙΑΖΕΤΑΙ Η ΠΩΛΕΙΤΑΙ Κατάστημα Θεσ/νίκης 43, 100τ.μ. και υπόγειο 100 τ.μ. τηλ: 2331029321

ΑΛΕΞΑΝΔΡΕΙΑ

οδός Σχολείων κοντά στο δημαρχείο πωλούνται διαμπερή διαμερίσματα, μικρά και μεγάλα, εξαιρετικής κατασκευής σε 3όροφη οικοδομή με άνετους εξώστες, ημιυπαίθριους, ιδιωτικό πάρκινγκ και κήπο - χωρίς ΦΠΑ - από ιδιοκτήτες. Τηλ. 6944-312455, 6946-584834, 2310-920185

ΕΝΟΙΚΙΑΖΕΤΑΙ Γραφείο ανακαινισμένο Βενιζέλου 27, 35 τ.μ, 2 Δ, WC,κλιματιστικό Τηλ. Επικοινωνίας: 6978244410 ΕΝΟΙΚΙΑΖΕΤΑΙ γκαρσονιέρα 50 τ.μ. στον Προμηθέα. Μεσιτικό γραφείο: 6974747117

ΕΝΟΙΚΙΑΖΕΤΑΙ γκαρσονιέρα καινούργια, επιπλωμένη, ένα δωμάτιο, WC, κουζίνα 28 τ.μ. με θέα σε πάρκο, περιοχή Μπότσαρη Θεσ/νίκης. Κατάλληλο για φοιτητές ή ειδικευμένο γιατρό. Πληροφορίες στο τηλ. 6944 529650.

ΕΝΟΙΚΙΑΖΕΤΑΙ Στη Θεσ/νίκη γκαρσονιέρα ρετιρέ, κοντά στα ΚΤΕΛ Μακεδονία (2Δ,Σ,Κ,WC) θέρμανση με ωρομετρητή, πάρκιγνκ. Τιμή 300 €. Τηλ. 2332023001 και 6979521178. ΕΝΟΙΚΙΑΖΕΤΑΙ Στη Θεσ/νίκη Πανεπιστήμια στούντιο επιπλωμένο 4 ετών 280 ευρώ. Τηλέφωνο επικοινωνίας 6977233555 και 2331023222.

ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα επαγγελματικός χώρος Μ. Μπότσαρη (πρώην Φροντιστήρια Καράμπελα – Σαμαρά). Κιν. 6972848470. Eνοικιάζονται και πωλούνται στο Μακροχώρι Αριστοτέλους 123 (κεντρικό – γωνία) γραφεία Τηλ. 6988141980 κ. Αντώνης ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα 90 τ.μ. κοντά στο ΙΚΑ Βέροιας. Μεσιτικό γραφείο: 6974747117 ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα 123 τ.μ. στην περιοχή Περικλέους (κέντρο), Βέροια. Μεσιτικό γραφείο: 6974747117 ΕΝΟΙΚΙΑΖΕΤΑΙ Γραφείο 38 τ.μ. απέναντι από το Σ/Μ Βερόπουλος στη Βέροια, Ζωγιοπούλου 1, 1ος όροφος. τηλ: 2331025393 ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα 50 τ.μ. Πλουτάρχου 20. τηλ: 2331065187

ΕΝΟΙΚΙΑΖΕΤΑΙ Οικόπεδο στη Νέα Περιφερειακή Οδό, δύο στρέμματα, περιφραγμένο με κεντρική είσοδο μπροστά στην άσφαλτο δίπλα από την ΕΚΟ. Τηλ:23310-27683 κ. Σταύρος

ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα 50 τ.μ. (2Δ,Κ,WC) στον 2ο όροφο, Καρακωστή 3. Τηλ. 23310 24403 – 25840.

ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα 34 τ.μ. πλήρως εξοπλισμένη και ανακαινισμένη με κεντρική θέρμανση, στο κέντρο. τηλ: 2331024302 και 6945669786

ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα στη Θεσ/ νίκη 75 τ.μ. για φοιτητές κοντά στα πανεπιστήμια. τηλ: 2331023804, κιν: 6972834596 ΕΝΟΙΚΙΑΖΕΤΑΙ: γκαρσονιέρα 1Δ.Κ.ΜΠ. ανακαινισμένη Τιμή: 280,00 € Τηλ.:693.246.6.633 ΕΝΟΙΚΙΑΖΕΤΑΙ Διαμέρισμα απέναντι από το γήπεδο Βέροιας Σταδίου 35, 80 τ.μ, δωμάτιο, σαλόνι, κουζίνα, ασανσέρ. Τηλ. Επικοινωνίας: 23310-21204 Ενοικιάζεται κατάστημα 100τ.μ. στη διεύθυνση Καλής Παναγιάς 12.Τηλ επικοινωνίας: 23310 23765

ΠΩΛΗΣΕΙΣ ΠΩΛΕΙΤΑΙ Επιχείρηση Κέντρο Αισθητικής Spa στο κέντρο της Βέροιας, προσφάτως πλήρως ανακαινισμένη. Τηλ. επικοινωνίας 2331070117 από 20.00μ.μ. έως 22.00μ.μ ΠΩΛΟΥΝΤΑΙ Ελαφρώς μεταχειρισμένα: 1 σαλόνι γωνία, 1 τραπεζαρία με τζάμι και 6 καρέκλες, 1 τραπεζάκι σαλονιού κεντρικό, 1 μπουφές με καθρέφτη και κρυσταλιέρα, 1 ψυγείο PITSOS σχεδόν καινούργιο πωλούνται λόγω μετακόμισης σε άλλη πόλη. Όλα σε τιμή ευκαιρίας. Τηλ.: 6948880903 κ. Γεωργία ολοήμερα ΠΩΛΕΙΤΑΙ Άδεια ΤΑΧΙ (μόνο άδεια ή με το όχημα μαζί) Τηλ. Επικοινωνίας: 6977947813 κ.Τάσος ΠΩΛΟΥΝΤΑΙ 2 κοτοπουλιέρες σαραντάρες, ανοξείδωτες Γερμανίας Τιμή 1500 η μία 2.500 και οι δύο Τηλ. Επικοινωνίας: 6972842984 ΠΩΛΕΙΤΑΙ Χωραφοοικόπεδο στην περιοχή (Δαίου Πλαστικά) όπισθεν Βενζινάδικου100 μέτρα από τον κεντρικό δρόμο.Τιμή ευκαιρίας-συζητήσιμη Τηλ: 23320-43226 και 6977598329

ΑΥΤΟ ΤΟ ΣΚΥΛΑΚΙ ΒΡΕΘΗΚΕ ΣΤΗΝ ΠΕΡΙΟΧΗ ΤΟΥ ΠΑΝΟΡΑΜΑΤΟΣ ΕΔΩ ΚΑΙ ΔΥΟ ΕΒΔΟΜΑΔΕΣ. ΦΑΙΝΕΤΑΙ ΝΑ ΕΙΝΑΙ ΑΠΟ ΣΠΙΤΙ. ΟΠΟΙΟΣ ΕΙΝΑΙ Ο ΙΔΙΟΚΤΗΤΗΣ ΤΟΥ ΝΑ ΕΠΙΚΟΙΝΩΝΗΣΕΙ ΣΤΟ

6934200953

ΕΝΟΙΚΙΑΖΟΝΤΑΙ 2 διαμερίσματα

21

Ενοικιάζεται διαμέρισμα 85 τ.μ με ατομική θέρμανση, στον 3ο όροφο στην Οδό Σοφίας 50, στο δρόμο προς το Νοσοκομείο. Τηλ: 23310-29457, 27406

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011


αγγελιεσ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

ΜΙΚΡΕΣ

Δημοσιεύστε ΔΩΡΕΑΝ όλες τις μικρές αγγελίες στα Επικαιρα Τηλεφωνείστε στο 23310 78080 ή στείλτε στο fax 23310 78087 και στην ηλεκτρονική διεύθυνση epikera@otenet.gr

ΠΩΛΗΣΕΙΣ Πωλείται επιχείρηση franchise με φυσικά καλλυντικά & οικολογικά προϊόντα στο κέντρο της Βέροιας σε τιμή ευκαιρίας λόγω αλλαγής επαγγέλματος. Πληροφορίες 6974507008 / 2331028090 ΠΩΛΕΙΤΑΙ διαμέρισμα στη Βασ. Όλγας (πλησίον Μπότσαρη) με αέριο, ανατολικό όλο στο φως, 6ος όροφος (2Δ, ΣΛ, Κ, WC), κατάλληλο για κατοικία ή ιατρείο. Πληροφορίες στο τηλ. 6930 561762. ΠΩΛΕΙΤΑΙ καντίνα πλήρης εξοπλισμένη, περασμένη ΚΤΕΟ και υγειονομικό, σε τιμή ευκαιρίας. Πληροφορίες στο τηλ. 6995845825 κ. Γιώργο. ΠΩΛΟΥΝΤΑΙ σε 4,5 στρ. μπροστά στην θάλασσα στην αμμώδη Παραλία Κορινού Πιερίας συγκρότημα 6 ανεξάρτητων διόρωφων κατοικιών. Κάθε κατοικία είναι 85 τμ σε κήπο 500 μέτρων. Παραδίδονται στα τούβλα ή τελειωμένες. Πληρ. τηλ. 23510 47497, 6976 760579, 6944 865855 ΠΩΛΕΙΤΑΙ στο Πλατύ οικοδομή με κατάστημα στο ισόγειο και διαμέρισμα στον 1ο όροφο με αποθήκη, σε οικόπεδο 180τ.μ. στο κέντρο του Πλατέος. Τιμή συζητήσιμη. Πληροφορίες στο τηλ. 6956029638 6972381385 ΠΩΛΕΙΤΑΙ οικόπεδο 202,97 τ.μ. στην περιοχή πάνω από την Πιερίων (όπισθεν Παγούρα). Τιμή 70.000 ευρώ (ευκαιριακό).

Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ ΕπιχείρησηΑρτοζαχαροπλαστείο πλήρως ανακαινισμένο στο κέντρο της Βέροιας Τιμή ευκαιρίας Μεσιτικό Γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ: Πίνακας του DORIS.Διαστάσεις 92Χ72 χωρίς την κορνίζα. Είναι έργο του 1940 Τηλ:6977275357 ΠΩΛΕΙΤΑΙ μονοκατοικία στα Παλατίτσια Βέροιας. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ Οικία στο πανόραμα 240 τ.μ. 3ος όροφος, με γκαράζ και πανοραμική θέα με προσιτή τιμή. τηλ: 6974322308 ΠΩΛΕΙΤΑΙΟικόπεδο 308 τ.μ. στην πλατεία του Σταυρού. τηλ: 6947328265 ΠΩΛΕΙΤΑΙ Μονοκατοικία στα Ριζώματα 90 τ.μ Ημιτελής, καινούρια Σε τιμή ευκαιρίας Τηλ: 6944546553, κ. Γιώργος ΠΩΛΕΙΤΑΙ Στο Λιτόχωρο Πιερίας βίλα 234 τ.μ. με υπόγειο πάρκινγκ, αποθήκη, με 2,5 στρ. οικόπεδο, πανοραμική θέα βουνό-θάλασσα. τηλ: 6976391864 ΠΩΛΕΙΤΑΙ Τσιμισκή με Γούναρη στη Θεσ/νίκη διαμέρισμα 145 τ.μ. 2Δ, Σ, ΣΚ, αποθήκη, μπάνιο, WC, 3ος όροφος, κατάλληλο και για επαγγελματική στέγη. τηλ: 2310222777 και 2392052883 ΠΩΛΕΙΤΑΙ Διαμέρισμα 75 τ.μ. Μανδυλάρα 43 στη Βέροια, 2ος όροφος. τηλ: 6940006656 ΠΩΛΕΙΤΑΙ Οικία 100 τ.μ. στον τρίλοφο,

ΓΡΑΦΕΙΟ ΤΕΛΕΤΩΝ ΒΕΡΟΙΑΣ ΣΤΕΦΑΝΙΑ - ΣΤΟΛΙΣΜΟΙ ΜΝΗΜΟΣΥΝΩΝ

ΕΥΑΓΓΕΛΟΣ ΚΟΥΡΕΑΣ Αναλαμβάνουμε την τελετή του αγαπημένου σας προσώπου με σεβασμό - εξυπηρέτηση ποιότητα και ΟΙΚΟΝΟΜΙΑ. Μεταφορές των προσφιλών σας σε όλη την Ελλάδα και από εξωτερικό. Λειτουργούμε όλο το 24ωρο και με ανοιχτή γραμμή ΒΟΗΘΕΙΑΣ.

ΚΕΝΤΡΙΚΗΣ 153 - ΒΕΡΟΙΑ ΤΗΛ. 23310 74222, ΚΙΝ. 6947934834, 6932 464356

μονοκατοικία, 3 ετών καινούρια με 2 οικόπεδα 600 τ.μ. ατομική θέρμανση. τηλ:2331093480, κιν: 6979939697 ΠΩΛΕΙΤΑΙ Στον Τρίλοφο διόροφη κατοικία 84 τ.μ. οικόπεδο 550 τ.μ. τηλ: 2331093377 ΠΩΛΕΙΤΑΙ μονοκατοικία στην Αγ. Τριάδα – Μελίκης. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ διαμέρισμα 115 τ.μ. καινούργιο στο Μακροχώρι Βέροια. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ διαμέρισμα 92 τ.μ. στο Μακροχώρι Βέροια. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ διαμέρισμα 85 τ.μ. στο Μακροχώρι Βέροια. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ μονοκατοικία μεζονέτα σε οικόπεδο 470 τ.μ. στη Μελίκη. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ οικόπεδο 280 τ.μ. στη Σωζόπολη Χαλκιδικής. Μεσιτικό γραφείο: 6974747117 ΠΩΛΟΥΝΤΑΙ Έπιπλα δρύινα, κρεβ/ρα, ντουλάπα, τραπεζαρία 2 ετών σε άριστη κατάσταση. ΤΙΜΗ ΕΥΚΑΙΡΙΑΣ Τηλ. 6986692916. ΠΩΛΕΙΤΑΙ διαμέρισμα ημιυπόγειο 80 τ.μ. στο κέντρο της Βέροιας. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ Οικόπεδο 220 τ.μ. με 2όροφο κτίσμα, πίσω από το γήπεδο της Βέροιας Τηλ. επικοινωνίας 6977691662 κ. Νίκος ΠΩΛΕΙΤΑΙ SUZUKI SAMURAI, μοντέλο 91, cabrio, κιν:6942480058 ΠΩΛΕΙΤΑΙ οικόπεδο 330 τ.μ. στό Δ. Βέροιας, τοποθεσία Βικέλα. τηλ. 6977933532 ΠΩΛΕΙΤΑΙ Αντίκα σαλόνι, σκαλιστό Λουδοβίκου ελαφρώς μεταχειρισμένο. Μόνο σοβαρές προτάσεις Τηλ: 2331027683 (ώρες καταστήματος) κ.Σταύρος ΠΩΛΕΙΤΑΙ διαμέρισμα 93 τ.μ. στο (κέντρο) πολύ καλό. Τιμή 90.000 ευρώ. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ διαμέρισμα 100 τ.μ. περίπου την περιοχή Αντ. Καμάρα (κέντρο) Βέροια. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ γραφείο 67

22

τ.μ. στο κέντρο της Θεσ/ νίκης. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ Οικόπεδο 280τ.μ στη Σωζόπολη Χαλκιδικής Τηλ: 6974747117 ΠΩΛΕΙΤΑΙ γραφείο 67 τ.μ. με ανεξάρτητη είσοδο και κλιματισμό στο κέντρο της Θεσ/νίκης. Μεσιτικό γραφείο: 6974747117 ΠΩΛΕΙΤΑΙ κατάστημα ισόγειο 53 τ.μ. στο Πευκοχώρι Χαλκιδικής. Μεσιτικό γραφείο: 6974747117 Πωλείται οικόπεδο 240τ.μ. το οποίο περιλαμβάνει οίκημα εντός, στην διεύθυνση Ετεοκλή 6 – Βέροια. Τηλ επικοινωνίας: 23310 23765 ΠΩΛΕΙΤΑΙ Οικόπεδο άρτιο και οικοδομήσιμο 375τμ στην Αλεξάνδρεια Ημαθίας, στους Αμπελότοπους με 15μ πρόσοψη επί της οδού Δυτικής Μακεδονίας. Τηλέφωνο: 693 29 811 29 ΠΩΛΕΙΤΑΙ Εξοπλισμός καφετέριας σε πολύ καλή τιμή Τηλ. επικοινωνίας 6949449615 ΠΩΛΕΙΤΑΙ τουριστική επιχείρηση από 10 καινούργιες γκαρσονιέρες στην Παραλία Λεπτοκαρυάς. Πληρ. Τηλ. 6906 584427 ΠΩΛΕΙΤΑΙ Οικόπεδο στα Ριζώματα και δομήσιμο. Τηλ:6944546553 Πωλείται αγροικία 1 στρέμμα οικόπεδο στον Κοπανό Ναούσης. Τιμή 90.000 ευρώ. Τηλ. επικοινωνίας: 6946780770 ΠΩΛΕΙΤΑΙ διαμέρισμα ανακαινισμένο στη Θεσσαλονίκη κοντά στα Πανεπιστήμια απέναντι από τη Ροτόντα. Διαθέτει δύο δωμάτια, σαλόνι, κουζίνα, WC. Τιμή 95.000 Ε. Πληρ. τηλ. 6979 985665, 6972 823840 ΠΩΛΕΙΤΑΙ SCONTA FABIA Χρώμα μαύρο, μοντέλο 2004 1400 κυβικά. Σχεδόν καινούριο, κάθε έλεγχος δεκτός Τηλ:6977262582 κυρ. Γιάννης ΠΩΛΕΙΤΑΙ BMW ελαφρώς μεταχειρισμένη, χρώμα κόκκινο, 1600 cc μοντέλο 11-1996, φουλ έξτρα, σε πάρκινγκ, 2πορτο κουπέ. Τηλ. 23310 27683 (εκτός Κυριακής). ΠΩΛΕΙΤΑΙ Διαμέρισμα 74 τ.μ. (Σ,Κ,2Δ,WC) στον 3ο όροφο, Βουλγαροκτόνου 2 στον Προμηθέα. Τιμή 72.000 €. Κιν. 6970959780.

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011




epikera@otenet.gr

Π Ω Λ ΟΥ Ν ΤΑ Ι

ΔΙΑΜΕΡΙΣΜΑΤΑ ΚΤΕΛ 24 τ.μ. επιπλωμένο 3ος, 18.000 € ΑΝΟΙΞΕΩΣ 24 τ.μ. ανακαινισμένο, επιπλωμένο, λουξ, (ενοικιάζεται 200 €) 23.000 € ΡΟΛΟΪ 25 τ.μ. 1ος, 19.000 € ΣΤΕΓΗ 40 τ.μ. ισόγειο, ανακαινισμένο, 25.000 € ΑΓ. ΑΝΤΩΝΙΟΣ 30 τ.μ. ρετιρέ, θέα, ανακαινισμένο, πλήρως, λουξ, με μπαλκόνι 100 τ.μ. 35.000 € ΑΓ. ΑΝΤΩΝΙΟΣ 65 τ.μ. 4ος όροφος, ατομ. θερμ. 53.000 € ΜΗΤΡΟΠΟΛΗ 25 τ.μ. ανακαινισμένο πλήρως, 23.000 € ΡΟΛΟΪ 65 τ.μ. στην πλατεία, 3ος όροφος, πολύ καλό 54.000 € ΠΑΣΑΚΙΟΣΚΙ 45 τ.μ. καινούργιο, τζάκι, θέα 50.000 € ΕΛΗΑ και υπόγειο 57 τ.μ. 22.000 € ΠΑΖΑΡΙ 80 τ.μ. ανακαινισμένο, 1ος ορ. και για επαγγελματική στέγη 55.000 € ΕΔΕΣΣΗΣ 75 τ.μ. ρετιρέ οροφοδιαμέρισμα, θέα, ανακαινισμένο πλήρως, 85.000 € ΛΑΔΟΜΥΛΟΙ 75 τ.μ., 5 ετών, ατομ. θερμ., γκαράζ 95.000 € ΠΑΣΑΚΙΟΣΚΙ 70 τ.μ. καινούργιο δυο δωμάτια, αποθήκη, 2ος, 85.000 € ΑΝΟΙΞΕΩΣ 87 τ.μ. 3ος όροφος, θέα, 110.000 € ΤΣΕΡΜΕΝΗ 100 τ.μ. 5 ετών, λουξ, γκαράζ, 110.000 € ΠΡΟΜΗΘΕΑΣ 90 τ.μ., 9 ετών, 2 δωμάτια, 2 αποθήκες, διαμπερές, ατομ. θερμ. 83.000 € ΠΑΣΑΚΙΟΣΚΙ 87 τ.μ. 3 ετών, ατομ. θερμ., τζάκι, θέα, γκαράζ 108.000 € ΚΕΝΤΡΟ 100 τ.μ. καινούργιο, 3 δωμάτια γκαράζ 140.000 € ΠΑΠΑΚΙΑ 85 τ.μ., 4ος όροφος, ατομ. θερμ. 15 ετών 75.000 € ΠΙΕΡΙΩΝ 90 καινούργιο, ατομ. θερμ. 100.000 € ΠΑΝΟΡΑΜΑ 90 τ.μ. ανακαινισμένο 130.000 € ΠΡΟΜΗΘΕΑΣ 95 τ.μ. 10 ετών, πολύ καλό, θέα, γκαράζ 125.000 € ΜΗΤΡΟΠΟΛΕΩΣ 110 τ.μ. ρετιρέ 105.000 € ΠΑΣΑΚΙΟΣΚΙ 110 τ.μ. καινούργιο, 3 δωμάτια, θέα, 140.000 € ΠΑΣΑΚΙΟΣΚΙ 90, καινούργιο, θέα 108.000 € ΠΡΟΜΗΘΕΑΣ 120 τ.μ., 4 δωμάτια, ατομ. θερμ. 145.000 € ΠΡΟΜΗΘΕΑΣ 120 τ.μ. τζάκι, γκαράζ, ηλιακό 140.000 €

ΠΙΕΡΙΩΝ 105 τ.μ. 3 δωμάτια, καινούργιο 135.000 € ΠΙΕΡΙΩΝ 120 τ.μ. 3 δωμάτια καινούργιο, 3ος όροφος 155.000 € ΑΝΟΙΞΕΩΣ κάτω 75 τ.μ. 42.000 €

επαγγελματικοι χωροι - γραφεια ΓΡΑΦΕΙΟ Βενιζέλου 28 τ.μ. super lux

μονοκατοικιεσ

37.000 € ΑΓ. ΑΝΤΩΝΙΟΣ 70 τ.μ. γραφείο super lux 82.000 € ΒΕΝΙΖΕΛΟΥ 75 τ.μ. 65.000 €

ΠΑΣΑΚΙΟΣΚΙ 125 τ.μ. μεζονέτα ανακαινισμένη πλήρως, θέα, 2 WC, 140.000 €

ΒΕΝΙΖΕΛΟΥ 60 τ.μ. ανακαινισμένο

ΤΣΕΡΜΕΝΙ 180 τ.μ. μεζονέτα καινούργια, 5 δωμάτια, γκαράζ 255.000 €

ΡΟΛΟΙ ΓΡΑΦΕΙΟ 35 τ.μ. 35.000 €

ΜΑΚΡΟΧΩΡΙ 140 τ.μ. σε 500 οικόπεδο 7 ετών, 180.000 €

ΑΓ. ΑΝΤΩΝΙΟΣ 65 τ.μ. 55.000 €

ΔΙΑΤΗΡΗΤΕΟ κέντρο 120 τ.μ. 130.000 € ΤΣΕΡΜΕΝΙ κέντρο 20 ετών σε 3 επίπεδα, 170.000 € ΕΠΙΣΚΟΠΗ Βέροιας 70 τ.μ. σε 1.250 οικόπεδο, 115.000 €

οικοπεδα

65.000 € ΜΗΤΡΟΠΟΛΕΩΣ 55 τ.μ. 2 χώροι 60.000 € ΜΗΤΡΟΠΟΛΗ 30 τ.μ. γραφείο 30.000 € ΡΟΛΟΙ 80 τ.μ. 3 χώροι 100.000 € ΡΟΛΟΙ 45 τ.μ. (ενοικιασμένο 210 €) 200.000 € ΜΑΓΑΖΙ Κεντρικής 90 τ.μ. (δίνει ενοίκιο 500 €) 260.000 € ΜΑΓΑΖΙ ΚΤΕΛ 40 τ.μ. με πατάρι 45.000 € ΜΑΓΑΖΙ κέντρο 35 τ.μ. 78.000 (δίνει ενοίκιο 340 €)

ΕΡΓΟΧΩΡΙ 550 τ.μ. γωνιακό 160.000 € ΠΑΠΑΚΙΑ κέντρο 80 τ.μ. κτίζει 100 τ.μ., 35.000 € ΦΑΝΑΡΙΑ ΚΥΠΡΟΥ 205 τ.μ. 78.000 € ΜΕΤΟΧΙ 1.100 μ. στο χωριό 50.000 € ΓΕΩΡΓΙΑΝΟΙ 1.000 τ.μ. 42.000 € ΤΡΙΛΟΦΟΣ 1.400 τ.μ. 43.000 € ΠΡΟΜΗΘΕΑΣ 1.100 τ.μ. 70.000 € ΠΕΡΙΦΕΡΕΙΑΚΟΣ ΒΕΡΟΙΑΣ 12.000 μ. 18.000 € ΡΑΧΙΑ 700 μ. κέντρο 42.000 € ΝΙΚΟΜΗΔΕΙΑ δίπλα στο χωριό 13.000 μ. 65.000 € ΠΡΟΜΗΘΕΑΣ 5.750 τ.. θέα κτίζει 280 τ.μ., 185.000 € ΓΕΩΡΓΙΑΝΟΙ 1.900 τ.μ. 50.000 € ΛΕΥΚΑΔΙΑ 1.000 μ. 20.000 € ΠΑΣΑΚΙΟΣΚΙ 400 τ.μ. 110.000 € ΚΟΜΒΟΣ ΒΕΡΟΙΑΣ 1.630 μ. γωνιακό 55.000 € ΡΑΧΙΑ 400 μ. 28.000 € ΝΟΣΟΚΟΜΕΙΟ ΕΠΑΝΩ 5.000 μ. 150.000 € ΔΟΒΡΑ 5.800 μ. 130.000 € ΠΑΝΟΡΑΜΑ 326 τ.μ. 125.000 € ΠΑΠΑΓΟΥ 226 τ.μ. με άδεια 165.000 € ΓΗΠΕΔΟ 150 τ.μ. πάνω στο δρόμο 80.000 € ΜΑΚΡΟΧΩΡΙ μέσα πάνω στο δρόμο 5.000 μ. 115.000 € ΠΑΤΡΙΔΑ 6.000 μ. στον κεντρικό δρόμο μόνο 65.000 €

Διαφημιστείτε τώρα στην εφημερίδα

Επικαιρα με ακόμη χαμηλότερες τιμές Πληροφορίες στο τηλ. 23310 78080

23

ΜΑΓΑΖΙ φανάρια Κύπρου 78 τ.μ. καινούργιο 220.000 € ΑΠΟΘΗΚΗ 220 τ.μ. Εληά 90.000 € ΑΠΟΘΗΚΗ Ρολόι 350 τ.μ. 60.000 €

ΑΓ. ΑΝΤΩΝΙΟΣ 40 τ.μ. ρετιρέ πλήρως ανακαινισμένο, θέα, επιπλωμένο 270 € ΕΛΗΑ 75 τ.μ. 3 χώροι, ρετιρέ λουξ 300 € ΣΤΕΓΗ 70 τ.μ. 4 χώροι, πάρκινγκ, επιπλωμένο 250 € ΠΑΣΑΚΙΟΣΚΙ 40 τ.μ. καινούργιο 220 € ΑΓ. ΚΥΡΙΑΚΗ 65 τ.μ. 2 δωμάτια 200 € ΚΤΕΛ 70 τ.μ. 2 χώροι 150 € ΑΓ. ΑΝΤΩΝΙΟΣ 70 τ.μ. πλήρως ανακαινισμένο λουξ, ατομ. θερμ. 300 € ΡΟΛΟΙ 80 τ.μ. ανακαινισμένο, ηλιακό 270 € ΜΗΤΡΟΠΟΛΗ 85 τ.μ. θωρακισμένη 250 € ΠΑΣΑΚΙΟΣΚΙ 85 τ.μ. 3 ετών, ατομ. θέρμ., θέα 350 € ΠΑΣΑΚΙΟΣΚΙ 90 τ.μ. 8 ετών, ατομ. θερμ., γκαράζ 220 € ΠΡΟΜΗΘΕΑ 100 τ.μ. 2 δωμάτια καλό 250 € ΠΡΟΜΗΘΕΑ 100 τ.μ. 3 δωμάτια ατομ. θερμ. 280 € ΜΟΥΣΕΙΟ 100 τ.μ. θέα καλό 300 € ΠΑΣΑΚΙΟΣΚΙ 90 τ.μ. 2 δωμάτια, ατομ. θερμ. 250 € ΠΛ. ΚΟΡΑΚΑ 110 τ.μ. 3 δωμάτια ατομ. θερμ. 280 € ΚΑΛΛΙΘΕΑ 110 τ.μ. 3 δωμάτια, 5 ετών, τζάκι, πάρκινγκ, ηλιακό 350 € ΠΑΣΑΚΙΟΣΚΙ 110 τ.μ. 2 ετών, θέα, ατομ. θερμ., 2 WC, πάρκινγκ 350 € ΚΕΝΤΡΟ 100 τ.μ. πλήρως ανακαινισμένο, ατομ. θερμ. 320 €

επαγγελματικοι χωροι - γραφεια

Ε Ν Ο Ι Κ Ι Α Ζ Ο Ν ΤΑ Ι

διαμερισματΑ

ΓΡΑΦΕΙΟ Μητροπόλεως 2 χώροι επιπλωμένο 210 € ΓΡΑΦΕΙΟ Ρολόι 2 χώροι ανακαινισμένο 230 €

ΑΝΟΙΞΕΩΣ 40 τ.μ. 10 ετών ατομ. θερμ. θέα 220 € ΠΑΠΑΚΙΑ 28 τ.μ. επιπλωμένο 150 € ΜΗΤΡΟΠΟΛΗ 30 τ.μ. ανακαινισμένο ατομ. θερμ. 200 € ΕΛΗΑ 35 τ.μ. καλό 180 € ΜΗΤΡΟΠΟΛΗ 30 τ.μ. 180 € ΑΝΟΙΞΕΩΣ 50 τ.μ. 2 χώροι, ανακαινισμένο, ατομ. θερμ. 230 € ΔΗΜΑΡΧΕΙΟ 40 τ.μ. ανακαινισμένο πλήρως 220 € ΕΛΗΑ 50 τ.μ. κεντρικό 3 χώροι 240 € ΤΣΕΡΜΕΝΙ 45 τ.μ. 2 χώροι, βεράντα 180 € ΑΝΟΙΞΕΩΣ 50 τ.μ. 200 € ΡΟΛΟΙ 40 τ.μ. 150 €

ΕΝΟΙΚΙΑΣΕΙΣ

ΓΡΑΦΕΙΟ 30 τ.μ. Μ. Αλεξάνδρου 200 € ΓΡΑΦΕΙΟ 30 τ.μ. Βενιζέλου, πλήρως ανακαινισμένο 180 € ΓΡΑΦΕΙΟ Εληά πλατεία 100 τ.μ. 1ος όροφος ΕΠΑΓ. ΧΩΡΟΣ Αγ. Αντώνιος 70 τ.μ. πλήρως ανακαινισμένο ατομ. θερμ. 300 € ΜΑΓΑΖΙ στο κέντρο Βενιζέλου 80 τ.μ. 1.400 € ΑΠΟΘΗΚΗ Πιερίων 100 τ.μ. 250 € ΜΑΓΑΖΙΑ σε όλη τη Βέροια ΓΚΑΡΑΖ ενοικιάζονται στο κέντρο

καινούργιο διαπλατυσμένο δρόμο Πολύ καλή ευκαιρία. τηλ.6947120444 τηλ. οικίας.2331024091 ΕΝΟΙΚΙΑΖΕΤΑΙ Γκαρσονιέρα επιπλωμένη στο κέντρο της Βέροιας. Τηλ. 23310 70926 – 6946098247. Ενοικιάζεται διαμέρισμα 45 τ.μ στη Θεσσαλονίκη, στην οδό Αγγελάκη2ος όροφος, πλήρως ανακαινισμένο με δύο air condition.Τηλ: 6942595995 ΕΝΟΙΚΙΑΖΕΤΑΙ Κατάστημα καινούργιο 100τ.μ. στην οδό Καλής Παναγιάς 12. Τιμή 250€. Τηλ. 23310-23765

ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα στη Θεσσαλονίκη στον 6ο όροφο με 2 δωμάτια, κουζίνα, μπάνιο, ατομική θέρμανση φυσικού αερίου, ντουλάπες, τέντες, μπόιλερ, κλιματισμό, ψυγείο, ηλεκτρική κουζίνα και θωρακισμένη πόρτα. Το διαμέρισμα βρίσκεται στην Πλατεία Ιπποδρομείου 17(πλησίον Ναυαρίνου). Τηλ.επικοινωνίας: 23310-61739 και 6948004677 ΕΝΟΙΚΙΑΖΕΤΑΙ περίπτερο απέναντι από το ΙΚΑ Βέροιας Πληρ. τηλ. 6976403151 ΕΝΟΙΚΙΑΖΕΤΑΙ για επαγγελματική χρήση χωραφοοικόπεδο δύο στρεμμάτων στην περιοχή της λαχαναγοράς Βεροίας (πιο κάτω από τα Λύκεια). Πληροφορίες στα τηλ: 23310 29416 και 69773919 06. ΕΝΟΙΚΙΑΖΕΤΑΙ διαμέρισμα στην 16ης Οκτωβρίου 3, απέναντι από το Σούπερ Μάρκετ Αρβανιτίδη (στο Ζάππειο) 1ος όροφος, διαμπερές, σαλόνι, σαλοκουζίνα, 1 υπνοδωμάτιο, WC, μπάνιο, μπαλκόνια από το σχολείο. Τηλ.: 6976555452 κος Σάρρας ΕΝΟΙΚΙΑΖΟΝΤΑΙ ΤΡΙΑ ΚΑΤΑΣΤΗΜΑΤΑ 70 τ.μ. ΠΙΕΡΙΩΝ 24 ΤΗΛ. 23310 67400, το καθένα με 5,30 μ. ύψος με δυνατότητα ένωσις των δύο KIN. 6936 631658 ΒΕΡΟΙΑ επί της οδού Καλής Παναγίας ΒΕΡΓΙΝΑ ΤΗΛ. 23310 66300 13. Βρίσκονται πάνω στον

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011


ΕΛΛΑΔΑ

Καθημερινη ΕφημερΙδα της κεντρικησ μακεδονιασ | τευχοσ 511

Στη συνάντησή του με τον διοικητή της Τράπεζας της Ελλάδος, Γ. Προβόπουλο

Κ. Παπούλιας: «Αν δεν βρει λύσεις η Ευρώπη... χαθήκαμε»

Τ

ην πεποίθησή του ότι το 2011 θα είναι χρονιά συγχωνεύσεων στον τραπεζικό κλάδο, εξέφρασε χθες ο διοικητής της Τράπεζας της Ελλάδος, Γ.Προβόπουλος, κατά τη διάρκεια της συνάντησης που είχε με τον Πρόεδρο της Δημοκρατίας Κάρολο Παπούλια. «Οι τράπεζες είναι σε δύσκολη καμπή λόγω της δημοσιονομικής κρίσης, θα είναι μία χρονιά ανακατατάξεων συγχωνεύσεων και συνεργασιών», είπε ο κ. Προβόπουλος. «Πιστεύω ότι δεν θα καθυστερήσουν πολύ. Οι εξελίξεις είναι τέτοιες που θα τις οδηγήσουν προς συνεργασίες», συμπλήρωσε. Ερωτηθείς από τον κ. Παπούλια για τις εκτιμήσεις του

σχετικά με τις αποφάσεις της ΕΕ για την κρίση χρέους, ο κ. Προβόπουλος εμφανίστηκε συγκρατημένος. «Δεν είμαι ούτε αισιόδοξος, ούτε απαισιόδοξος. Επομένως, δεν θα πρέπει να κρατάμε ούτε μεγάλο, ίσως ούτε και μικρό καλάθι. Αλλά, θα ήθελα να επαναλάβω ότι τα προβλήματα τα δικά μας θα τα λύσουμε εδώ, στην Αθήνα, όχι στις Βρυξέλλες. Οι Βρυξέλλες μπορεί σε κάποιο βαθμό με τις λύσεις που θα πάρουν να μας δώσουν επικουρικά ένα χέρι βοηθείας. Αλλά εδώ είναι τα προβλήματα και επιμένω ότι εδώ πρέπει να στραφούμε στη λύση τους». Από την πλευρά του ο κ. Παπούλιας, αναφερόμενος στις αποφάσεις που επίκεινται στις Βρυξέλλες, δήλωσε χαρακτηριστικά ότι «αν δεν βρει λύσεις η Ευρώπη... χαθήκαμε».

Η μελέτη για το νέο μισθολόγιο προτείνει:

Ανακατανομή προσωπικού στο δημόσιο τομέα Παραδίδεται σήμερα στο Υπ. Οικονομικών

Σ

ήμερα Παρασκευή θα παραδοθεί στα υπουργεία Οικονομικών και Εσωτερικών η μελέτη των εταιρειών Hay Group και Icap Group για το νέο μισθολόγιο και την δυναμική απασχόλησης στο δημόσιο τομέα. Η μελέτη απαρτίζεται από τρία βασικά μέρη. Το πρώτο αφορά στη παρουσίαση της δομής του ισχύοντος μισθολογίου, τόσο των προβλεπόμενων αμοιβών αλλά και των πραγματικών αμοιβών, το δεύτερο μέρος αφορά στη δυναμική της απασχόλησης και η τρίτη ενότητα δημιουργεί τα θεμέλια για το νέο μισθολόγιο. Στην μελέτη γίνεται αναλυτική αποτύπωση του αριθμού εργαζομένων ανά τομέα του δημοσίου, αναλύονται οι μισθολογικές διαφορές και προτείνεται η ανακατανομή του προσωπικού στο σύνολο της δημόσιας διοίκησης, προκειμένου να γί-

νουν οι μετατάξεις και οι μετακινήσεις που θα ενισχύσουν τις υποστελεχομένες υπηρεσίες. Σύμφωνα με το προσχέδιο της εν λόγω μελέτης: Το μέγεθος της απασχόλησης στο δημόσιο τομέα στην Ελλάδα συμβαδίζει με το αντίστοιχο μέγεθος των ανεπτυγμένων οικονομικά χωρών, ειδικά της ΕΕ. Τονίζεται ωστόσο ότι «το μέγεθος της απασχόλησης δεν αποτελεί από μόνο του ένδειξη «μικρού» ή «μεγάλου» δημόσιου τομέα, στο βαθμό που δεν συνυπολογίζει παράγοντες όπως την αποτελεσματικότητα ή παραγωγικότητα της εργασίας ή την επιλεχθείσα πολιτική εμπλοκής του κράτους στην οικονομική ζωή». • Η μισθολογική δαπάνη ως ποσοστό του ΑΕΠ συμβαδίζει με την αντίστοιχη των ανεπτυγμένων οικονομικά χωρών (ειδι-

κά της ΕΕ) αν και είναι υψηλότερη από το μέσο όρο των χωρών του ΟΟΣΑ. • Η μέση αμοιβή των απασχολούμενων στον Ελληνικό Δημόσιο τομέα είναι χαμηλότερη σε σχέση με τα μέσα ευρωπαϊκά μεγέθη, ωστόσο η αξία της συγκεκριμένης διαπίστωσης περιορίζεται από την αδυναμία σύγκρισης της αποτελεσματικότητας των δημόσιων τομέων μεταξύ των χωρών. Όπως επισημαίνεται στην έκθεση, οι μεγαλύτερες αμοιβές -από πλευράς τακτικών προβλεπόμενων αμοιβών, δηλαδή βασικός μισθός, κίνητρο απόδοσης και επιδόματα- δίδονται στο υπουργείο Οικονομικών και ακολουθούν το υπουργείο Εσωτερικών και Δικαιοσύνης. Η αμοιβή ενός νεοδιόριστου στο υπουργείο Οικονομικών βρίσκεται γύρω στο 40% πάνω από τα μέσο όρο των υπουρ-

γείων και για έναν με 33 χρόνια υπηρεσίας στο 55-64% πάνω από το μέσο όρο. Στα άλλα δύο υπουργεία, δηλαδή το Εσωτερικών και Δικαιοσύνης οι αμοιβές υπερβαίνουν το 8-12% και 7-14% αντίστοιχα από την κατηγορία ΠΕ (Πανεπιστημιακής Εκπαίδευσης) μέχρι την κατηγορία ΥΕ (Υποχρεωτικής Εκπαίδευσης) για τους νεοδιορισμένους. Οι χαμηλότερες αμοιβές, σε σχέση με τα υπόλοιπα υπουργεία, δίδονται στο υπουργείο Εθνικής Άμυνας, για το πολιτικό προσωπικό, κατά 20%, στο υπουργείο Θαλάσσιων Υποθέσεων, Νήσων και Αλιείας κατά 15% και στο υπουργείο Παιδείας κατά 19%, από το μέσο όρο. Επίσης, όπως σημειώνεται το 50% των υπαλλήλων λαμβάνει το ποσό των 1.639 ευρώ, ενώ μόλις το 0,4% πληρώνεται με ποσό 5.856 ευρώ.

Αγωνία για τη συνέχισή του προγράμματος «Βοήθεια στο Σπίτι» «Καμπανάκι» και από βουλευτές του ΠΑΣΟΚ

Σ

το πρόγραμμα απασχόλησης του υπουργείου Εργασίας αναμένεται να εντάξει η κυβέρνηση το πρόγραμμα «Βοήθεια στο Σπίτι», προκειμένου να διασφαλίσει τα περίπου 70 εκατ. ευρώ, εκ των οποίων το 75% προέρχονται από το ΕΣΠΑ, που απαιτούνται για την συνέχισή του. Τον κώδωνα του κινδύνου για το μέλλον του προγράμματος κρούουν 21 βουλευτές του ΠΑΣΟΚ.Με ερώτησή τους

προς τους αρμόδιους υπουργούς Λούκα Κατσέλη και Ι.Ραγκούση ζητούν να πληροφορηθούν για τα μέτρα τα οποία προτίθεται να λάβει η κυβέρνηση για τη χρηματοδότηση του προγράμματος από το ΕΣΠΑ σε συνδυασμό με εθνικούς πόρους. Ειδικότερα οι 21 βουλευτές ζητούν να πληροφορηθούν, με δεδομένη την υποχρηματοδότηση των ΟΤΑ, «πώς θα καλυφθεί η χρηματοδότηση του προ-

24

γράμματος για το μεταβατικό διάστημα από την 1η Ιανουαρίου 2011 ως την οριστική ένταξή του στο ΕΣΠΑ».Για το 2011 έχει διασφαλιστεί η ένταξη του προγράμματος στο πρόγραμμα απασχόλησης του υπουργείου Εργασίας, με το αιτιολογικό ότι το πρόγραμμα εξυπηρετεί συγγενικά πρόσωπα ανέργων, οι οποίοι αδυνατούν να τους προσφέρουν τις εν λόγω υπηρεσίες. Για τη συνέχισή του

ΠΑΡΑΣΚΕΥΗ 11 ΜΑΡΤΙΟΥ 2011

προγράμματος θα απαιτηθούν περίπου 70 εκατ. ευρώ, εκ των οποίων το 25%, δηλαδή, η εθνική συμμετοχή, θα καλυφθεί από τους ΟΤΑ. Αμφιβολίες εξακολουθούν να υπάρχουν για το πώς θα καλυφθεί μετά το 2012. Ήδη, η ΚΕΔΚΕ έχει υποβάλει πρόταση να υπάρξει τριμερής χρηματοδότηση του προγράμματος (Δήμοι, Ταμεία και Κρατικός Προϋπολογισμός).

ΕΠΙΚΑΙΡΑ - 11 ΜΑΡΤΙΟΥ 2011  

ΕΠΙΚΑΙΡΑ - 11 ΜΑΡΤΙΟΥ 2011