Issuu on Google+

Clinical Research

Microbial Analysis of Canals of Root-filled Teeth with Periapical Lesions Using Polymerase Chain Reaction Brenda P.F.A. Gomes, PhD, MSc, BDS,* Ericka T. Pinheiro, PhD, MSc, BDS,† Rogério C. Jacinto, PhD, MSc, BDS,† Alexandre A. Zaia, PhD, MSc, BDS,† Caio C.R. Ferraz, PhD, MSc, BDS,† and Francisco J. Souza-Filho, PhD, MSc, BDS† Abstract The objective of the present study was to investigate the presence of nine bacterial species in root-filled teeth associated with periapical lesions using a polymerase chain reaction analysis and to correlate these species with clinical features of the cases. DNA was extracted from 45 canal samples of root-filled teeth with periapical lesions. A PCR assay using speciesspecific primers of 16S rDNA and the downstream intergenic spacer region was used for microbial detection. Enterococcus faecalis was the most prevalent species, detected in 77.8% of the study teeth, followed by Peptostreptococcus micros, detected in 51.1%. Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia, and Prevotella nigrescens were detected in 35.6%, 22.2%, 11.1%, and 11.1% of the sampled teeth, respectively. Moreover, PCR detected Filifactor alocis in 26.7%, Treponema denticola in 24.4%, and Tannerella forsythia in 4.4% of the samples. T. denticola and P. micros were statistically associated with tenderness to percussion (p 0.05). P. nigrescens was associated with the presence of spontaneous pain and abscess (p 0.05). P. endodontalis and P. nigrescens were associated with purulent exudates (p 0.05). Synergistic relationship was also observed between some species. The results of this study indicated that E. faecalis was the most frequently identified test species by PCR in teeth with failing endodontic treatment. (J Endod 2008;34:537–540)

Key Words Bacteria, endodontic failure, polymerase chain reaction

From the *Department of Restorative Dentistry, Endodontic Division, Piracicaba Dental School, State University of Campinas-UNICAMP, and the †Department of Restorative Dentistry, Endodontic Division, State University of CampinasUNICAMP, Piracicaba, SP, Brazil. Supported by the Brazilian agencies FAPESP (04/05743-2, 05/51653-8, 06/60500-3), CNPq (304282/2003-0), and CAPES (PRODOC). Address requests for reprints to Dr Brenda P.F.A. Gomes, Endodontia, Faculdade de Odontologia de Piracicaba, FOPUNICAMP, Avenida Limeira, 901, Piracicaba, Sao Paulo 13414900, Brazil. E-mail address: bpgomes@fop.unicamp.br. 0099-2399/$0 - see front matter Copyright © 2008 by the American Association of Endodontists. doi:10.1016/j.joen.2008.01.016

JOE — Volume 34, Number 5, May 2008

P

ersistent intraradicular or secondary infections seem to be the major causes of root canal treatment failure, which is usually characterized by radiographic evidence of periapical lesions (1). Culture and molecular methods have been used to detect bacterial species from canals of root-filled teeth with persistent periapical lesions. Enterococcus faecalis has been the most frequently identified species in canals of root-filled teeth with periapical lesions either by culture or molecular methods (2–11). Although E. faecalis possesses several virulence factors, its ability to cause periradicular disease stems from its ability to survive the effects of root canal treatment and persist as a pathogen in the root canals and dentinal tubules of teeth and survive starvation (12, 13). However, its prevalence has diverged among the studies, 12% to 77% of the cases (2–11, 14, 15). Moreover, some authors have failed to detect E. faecalis in retreatment cases using culture or molecular methods (16, 17). These discrepancies may be caused by differences in patient selection, sampling and microbial methodology, sample size, or geographic location (18). Anaerobic species, especially some difficult-to-grow bacteria, have been more regularly detected in canals of teeth with failed endodontic treatment by molecular methods than by culture. Pseudoramibacter alactolyticus, Propionibacterium propionicus, Filifactor alocis, and Dialister pneumosintes have been frequently detected by polymerase chain reaction (PCR) in a Brazilian study (8). However, a similar study has failed to detect the latter species in retreatment cases in a South Korean population (19). Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia, and Prevotella nigrescens, have been found in relatively low prevalence values from teeth with failing endodontic treatment despite the use of more sensitive PCR techniques (8, 20). Similarly, Treponema denticola has not been frequently reported in such cases (8). Culture-based studies have shown that the microbial flora of cases with failed endodontic treatment is limited to a small number of predominantly facultative grampositive species (2–7). On the other hand, molecular-based studies have revealed a more complex microbiota in cases of endodontic failure (8 –10). Therefore, not only species frequently detected by culture in retreatment cases such as E. faecalis and P. micros but also species not detected so often by culture such as P. intermedia, P. nigrescens, P. gingivalis, P. endodontalis, and species that are difficult to grow on agar plates but can be easily detected by PCR such as T. denticola, F. alocis, and T. forsythia, might be involved in the pathogenesis of endodontic failures, especially if they develop a synergistic relationship. Data concerning the molecular detection of microorganisms from canals of teeth with failed endodontic treatment are limited and, particularly for some species, vary widely. Therefore, the aim of this research was to investigate the presence of nine bacterial species in root-filled teeth associated with periapical lesions using a PCR analysis and to correlate these species with clinical features of the cases.

Materials and Methods Subjects Forty-five root canal samples were taken from patients who needed nonsurgical endodontic retreatment and attended the Piracicaba Dental School, Sao Paulo, Brazil. A detailed medical and dental history was obtained from each patient. Patients who had

Microbial Analysis of Root-filled Teeth

537


Clinical Research TABLE 1. Primers Used in This Study Primers

Specificity/Location/Orientation

Sequence

Sm785 422 L189 ENFE Pmic PRIN PRNI Pg13 Pe1 Tdent Falo BF4R

Universal primer/16S/785 bp from 5’end/forward Universal primer/23S/422 bp from 5’end/forward Universal primer/23S/forward E. faecalis/16S/forward Peptostreptoccus micros/16S/forward P. intermedia/16S/forward P. nigrescens/16S/forward P. gingivalis/16S/forward P. endodontalis/16S/forward T. denticola/16S/forward F. alocis/16S/forward Tannerella forsythia/16S/forward

GGATTAGATACCCTGGTAGTC GGAGTATTTAGCTT GGTACTTAGATGTTTCAGTTC GTCGCTAGACCGCGAGGTCATGA AACGAGAAGCGAGATAGAGATGTTA TGTTAGCGCCTTGCGCTA CGTTGGCCCTGCCTGCGG CATCGGTAGTTGCTAACAGTTTTC TTTAGATGATGGCAGATGAGAG CAACAGCAATGAGATATGG ACATAACCAATGACAGCCTTTTTAA TGCGATATAGTGTAAGCTCTACAG

received antibiotic treatment during the last 3 months or had a general disease were excluded from the study. The human Volunteers Research and Ethics Committee of the Dental School of Piracicaba approved the study, and all patients signed an informed consent. All teeth had endodontic therapy performed more than 4 years but showed radiographic evidence of apical periodontitis. The following features were recorded for each patient: tooth type, clinical symptoms, presence or absence of a sound coronal restoration (ie, a permanent restoration that clinically and radiographically appeared sealed), caries, sinus, swelling of periodontal tissues, tenderness to percussion, mobility, periodontal status of the tooth, status of the root canal in terms of whether dry or wet (the term “wet canal” in this study means presence of exudate), and the radiographic quality of the root canal filling (21). Teeth presenting mobility, periodontal pockets, or root fractures were excluded from the study.

Sampling Procedure All coronal restorations, posts, and carious defects were removed. After access cavity preparation, the teeth were individually isolated from the oral cavity with a rubber dam, and disinfection was performed using 5.25% sodium hypochlorite. The sterility of the operation field was checked after inactivation of the solution with 5% sodium thiosulfate. The sterility was checked by taking a swab sample of the cavity surface and streaking on to blood agar plates with subsequent incubation at 37°C in both aerobic and anaerobic conditions, which presented negative results in all cases. Aseptic techniques were used throughout root canal treatment and sample acquisition. The root filling was removed by using Gates Glidden drills (Dentsply Maillefer, Ballaigues, Switzerland) and endodontic files without the use of chemical solvents. Irrigation with sterile saline solution was performed in order to remove any remaining materials and to moisten the canal before sample collection. For microbial sampling, a sterile paper point was introduced into the full length of the canal (as determined with a preoperative radiograph) and kept in place for 60 seconds. In the cases that have been previously irrigated with saline, as many paper points as possible were used to absorb all liquid or fluid inside the canal. The paper points were immediately transferred to a test tube containing 1 mL of the VMGA III transport medium (Anaerobic Systems, Morgan Hill, CA) (22), which was frozen at !70°C. Microbial Identification For PCR detection of the target species, DNA was extracted (23) and was first amplified with prokaryotic universal ribosomal 16S and 23S primers (785 and 422, respectively) (24, 25). Amplification was then performed of the 16S rDNA and the downstream intergenic spacer region (ISR). Inclusion of the ISR provided an additional check of the specificity of primers because the length of the ISR region varies among 538

Gomes et al.

bacterial species. E. faecalis, P. micros, P. gingivalis, P. endodontalis, P. intermedia, P. nigrescens, T. denticola, F. alocis, and T. forsythia species were then identified by a second, nested amplification with species-specific 16S primers paired with a universal primer located in the 23S gene (L189). Table 1 shows the primer sequences. All primers were synthesized by Biosynthesis, Lewisville, TX. PCR reactions were performed in a total volume of 50 ␮L containing 1.25 U Taq DNA polymerase (Perkin-Elmer, Foster City, CA), 5 ␮L of 10 PCR buffer plus 3 mmol/L MgCl2, 0.25 mmol/L of each primer, and 0.2 mmol/L (each) deoxynucleoside triphosphates. For each sample, 0.5 ␮L of extracted DNA was added to the reaction mixture. PCR was also performed by using a positive control (0.5 ␮L of DNA extracted from American Type Culture Collection [ATCC] species) and several negative controls. For the first amplification, samples were subjected to 22 cycles of denaturation at 94°C for 1 minute, annealing at 42°C for 2 minutes, primer extension at 72°C for 3 minutes, and a final extension of 72°C for 10 minutes. For the second amplification, the PCR reaction conditions were 30 cycles of 94°C for 1 minute, 52°C for 2 minutes, and 72°C for 3 minutes. PCR amplification was performed in an automated Perkin-Elmer Cetus DNA Thermal Cycler PCR (Scientific Support, Hayward, CA). PCR products were analyzed by 1% agarose gel electrophoresis, stained with ethidium bromide, and viewed under ultraviolet transillumination. A positive or negative identification was based on the presence of clear bands of the expected molecular size using a 21-kb lambda DNA ladder (Invitrogen Corporation, Carlsbad, CA).

PCR Primer Specificity The species-specific primer in the 16S rDNA coding region was selected based on previous investigation of endodontic bacteria by cloning and sequencing of the bacterial 16S gene (26) and on sequences available in GenBank. The species specificity was further confirmed by sequencing at least one PCR product from a clinical sample for the specific primer in an ABI Prism 310 automated sequencer (AME Bioscience Ltd, London, UK) (27). Statistical Analysis The data collected for each case (clinical features) were typed onto a spreadsheet and statistically analyzed using SPSS for Windows (SPSS Inc, Chicago, IL). The Pearson chi-square test or the one-sided Fisher exact test, as appropriate, was chosen to examine the null hypothesis that there is no relationship between endodontic symptoms and signs, and the presence of specific bacterial species. Fisher’s Exact test was applied to test the null hypothesis that there was no relationship between any pair of bacterial species recovered from the root canal (P"0.05). When there was a significant difference, indicating that JOE — Volume 34, Number 5, May 2008


Clinical Research TABLE 2. Clinical and Radiographic Features and Bacterial Findings in 45 Root-filled Teeth with Periapical Lesions Patients

T

TAT

R

P

HP

TTP

Sw

W/D

Si

RCF

PCR

1. 2. 3. 4. 5. 6. 7. 8.

22 41 12 22 11 22 45 11

"4 "4 20 "2 "4 "4 5 "4

NR TR PR TR NR TR PR GR

N N N N Y N N N

N N N N Y N N N

N N N N Y N N N

N N N N N N N N

D D D W D D D D

N N N Y N N N N

PE PE PE PE GE PE PE PE

9.

45

"4

NR

Y

Y

Y

N

W

N

GE

10. 11.

22 46

"2 "2

GR NR

N N

N Y

Y Y

N N

D W

N N

PE PE

12. 13.

12 12

5 20

PR PR

N N

N Y

N N

N N

D D

N Y

PE PE

14. 15.

12 37

"2 20

TR PR

N N

N N

Y Y

N N

D D

N N

PE GE

16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37.

32 22 12 15 11 22 21 46 45 37 11 35 22 11 33 21 23 45 32 37 21 34

5 5 10 "4 10 10 5 7 7 5 8 "4 6 8 30 12 5 5 30 4 5 12

GR PR PR PR PR PR NR NR TR PR PR GR NR NR PR TR PR NR PR PR TR PR

N N N N N N N N N N N N N N N N N N N N N N

N Y Y N N N Y N Y Y N N N Y N N N Y N Y Y N

N Y Y N N N Y Y N Y N Y N N N N N N N Y N N

N N N N N N N N N N N N N N N N N N N N N N

D D D D D D D D D D D D D D D D D D D D D D

N N Y N N N Y N N N N N N N N N N N N N N N

PE GE PE PE PE GE GE PE GE GE GE PE PE PE GE PE PE GE GE GE GE PE

38. 39.

22 12

5 15

GR GR

N N

N Y

N Y

N N

D D

N N

PE PE

40. 41. 42. 43. 44. 45.

21 14 46 47 41 46

11 11 "4 "4 8 "2

GR NR GR GR PR GR

N N N N N N

N N N N N Y

N N N N N Y

N N N N N N

D D D D D D

N N N N N N

PE PE PE PE PE PE

— — — E. faecalis, P. gingivalis, P. endodontalis, P. nigrescens E. faecalis, P. micros — E. faecalis, P. gingivalis E. faecalis, P. micros, P. gingivalis, P. endodontalis, P. intermedia, T. denticola, F. alocis E. faecalis, P. gingivalis, P. endodontalis, P. intermedia, P. nigrescens, T. forsythia, T. denticola, F. alocis E. faecalis, P. gingivalis, P. micros, T. denticola P. gingivalis, P. endodontalis, P. nigrescens, P. micros, T. denticola, F. alocis E. faecalis, P. gingivalis, P. micros E. faecalis, P. gingivalis, P. endodontalis, P. nigrescens, T. forsythia, F. alocis E. faecalis, P. gingivalis, P. endodontalis, P. micros E. faecalis, P. gingivalis, P. endodontalis, T. denticola, F. alocis, P. micros E. faecalis E. faecalis E. faecalis, P. micros P. micros E. faecalis, T. denticola E. faecalis E. faecalis, T. denticola, F. alocis, P. micros P. micros E. faecalis, P. micros E. faecalis, P. micros — E. faecalis E. faecalis, P. gingivalis, P. micros E. faecalis — E. faecalis E. faecalis E. faecalis E. faecalis, P. gingivalis, P. endodontalis, F. alocis E. faecalis, P. gingivalis, P. intermedia, P. micros, T. denticola E. faecalis, F. alocis E. faecalis, P. gingivalis, P. endodontalis, P. intermedia, P. nigrescens, P. micros, T. denticola E. faecalis E. faecalis, P. gingivalis, P. intermedia, P. micros, T. denticola, F. alocis E. faecalis, P. gingivalis, P. micros E. faecalis, P. micros, F. alocis E. faecalis, P. micros, F. alocis E. faecalis, P. gingivalis, P. endodontalis, P. micros, F. alocis P. micros E. faecalis, P. micros

T  tooth; TAT  time after treatment (y); R  restoration; GR  good restoration; PR  poor restoration; TR  temporary restoration; NR  no restoration; P  pain; HP  history of pain; TTP  tenderness to percussion; Sw  swelling; W/D  wet (W) or dry (D) canal; Si  sinus tract; RCF  root canal filling; GE  good endodontic filling; PE  poor endodontic filling; Y  yes; N  no.

the relationship between the pair of species was present, the odds ratio was calculated. Positive associations were those with an average odds ratio "2.0 and negative associations were those with an average odds ratio 0.5.

Results In general, the target species were detected in 39 of 45 cases (86.6%). Of the species studied, E. faecalis was the most prevalent species in canals of root-filled teeth associated with periapical lesions detected in 35 of 45 cases (77.8%). The prevalence values of the other microbial species were as follows: P. micros (23/45, 51.1%), P. gingivalis (16/45, 35.6%), F. alocis (12/45, 26.7%), T. denticola (11/45, 24.4%), P. endodontalis (10/45, 22.2%), P. intermedia and P. nigre-

JOE — Volume 34, Number 5, May 2008

scens (5/45, 11.1% both), and T. forsythia (2/45, 4.4%). The microbial findings and clinical features of each case are presented in Table 2. An average of 2.67 species per canal was found. T. denticola and P. micros were statistically associated with tenderness to percussion (p 0.05). P. nigrescens was associated with the presence of spontaneous pain and abscess (p 0.05). P. endodontalis and P. nigrescens were associated with purulent exudates (p 0.05). Positive associations were found between P. endodontalis and F. alocis (odds ratio, 14.000), P. gingivalis and P. endodontalis (odds ratio, 36.140), P. endodontalis and T. denticola (odds ratio, 9.000), F. nucleatum and G. morbilorum (odds ratio, 6.670), P. gingivalis and T. denticola (odds ratio, 8.600), and P. gingivalis and G. morbilorum (odds ratio, 6.600).

Microbial Analysis of Root-filled Teeth

539


Clinical Research Discussion PCR-based analyses have reported differences in the prevalence of E. faecalis in cases of endodontic failure. This species was detected in 77% (8) and 67% (9) of root-filled teeth with apical periodontitis in a Brazilian population and in 64% in a South Korean population (19). E. faecalis was also the most prevalent species detected in the present study (77.8%). However, this prevalence is higher than that reported in a North American population, 22% (14) and 12.1% (15). The low incidence of E. faecalis in the study of Kaufman et al. (15) could be explained by factors such as patient selection and time after root filling. The high prevalence of E. faecalis may also be influenced by the geographic location of the study population. Besides, such a difference could be related to the presence of coronal leakage. In the present study, microleakage (by defective coronal restorations, old temporary restorative materials, or nonrestored teeth) was detected in the majority of the teeth (35/45) and may have influenced the microbial findings. Nevertheless, primer sensitivity might influence the results of E. faecalis prevalence studies because certain primers might have higher sensitivity than others. Ke et al. (28), for example, developed a PCR-based assay that improved the diagnosis of enterococcal infections by targeting the tuf gene, which encodes elongation factor EF-Tu. PCR-based identification, not being dependent on bacterial viability, may not be as technique-sensitive as anaerobic culture. Despite the use of VMGA III as a transport medium, which contains agar and other ingredients that could affect the DNA extraction, the amplification with universal primers detected the presence of DNA in all samples. The PCR method used in this study only detects targeted microbial species. The results showed that the target species were not detected in six cases. However, it is possible that species other than those studied could have been present in the examined teeth. P. micros was the most frequently anaerobic species detected by PCR; it was present in half of the samples. All cases with positive PCR reactions harbored at least 1 gram-positive species, E. faecalis or P. micros. On the other hand, the prevalence of gram-negative anaerobic bacteria, particularly the black-pigmented species, was low when compared with primary root canal infections (16, 18, 20). These findings confirmed those reported in a previous molecular study (8), despite the fact that P. micros, P. gingivalis, P. endodontalis, P. intermedia, and P. nigrescens, were detected in a higher prevalence in the present study and association with clinical features could be observed. This study confirmed that molecular techniques allow a more reliable identification of diverse bacterial species, especially some difficult-to-grow bacteria. Fastidious bacterial species were detected in the root-filled canals studied by PCR. F. alocis, T. forsythia, and T. denticola were detected in, respectively, 26.7%, 24.4%, and 4.4% of the cases. However, a higher percentage of F. alocis (48%) and T. denticola (14%) have been previously reported in retreatment cases (8). In conclusion, the results of this study showed that E. faecalis is a common member of the microbiota of teeth with failing endodontic treatment detected by molecular technique. Similarly, gram-negative anaerobic bacteria species commonly found in cases of primary endodontic infections, such as P. gingivalis, P. endodontalis, P. intermedia, P. nigrescens, F. alocis, T. forsythia, and T. denticola, are not frequently detected in cases of endodontic failure but can be associated with clinical features and exert a synergistic relationship that might be involved in the pathogenesis of failed endodontic treatments.

Acknowledgment We would like to thank Drs Eugene J. Leys and Ann L. Griffen, from the Ohio State University College of Dentistry, for providing the facilities. We are also thankful to Dr Purnima S. Kumar and Ms

540

Gomes et al.

Zheng Wang for all their help and Francisco J. Martinez and Adailton dos Santos Lima for technical support.

References 1. Siqueira JF Jr. Aetiology of root canal treatment failure: why well-treated teeth can fail. Int Endod J 2001;34:1–10. 2. Sundqvist G, Figdor D, Persson S, Sjogren U. Microbiology analysis of teeth with endodontic treatment and the outcome of conservative retreatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 1998;85:86 –93. 3. Molander A, Reit C, Dahlen G, Kvist T. Microbiological status of root-filled teeth with apical periodontitis. Int Endod J 1998;31:1–7. 4. Peciuliene V, Balciuniene I, Eriksen HM, Haapasalo M. Isolation of Enterococcus faecalis in previously root-filled canals in a Lithuanian population. J Endod 2000;26:593–5. 5. Peciuliene V, Reynaud AH, Balciuniene I, Haapasalo M. Isolation of yeasts and enteric bacteria in root-filled teeth with chronic apical periodontitis. Int Endod J 2001;34:429 –34. 6. Pinheiro ET, Gomes BP, Ferraz CC, Sousa EL, Teixeira FB, Souza-Filho FJ. Microorganisms from canals of root filled teeth with periapical lesions. Int Endod J 2003;36:1–11. 7. Pinheiro ET, Gomes BP, Ferraz CC, Teixeira FB, Zaia AA, Souza Filho FJ. Evaluation of root canal microorganisms isolated from teeth with endodontic failure and their antimicrobial susceptibility. Oral Microbiol Immunol 2003;18:100 –3. 8. Siqueira JF Jr, Roças IN. Polymerase chain reaction-based analysis of microorganisms associated with failed endodontic treatment. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2004;97:85–94. 9. Roças IN, Siqueira JF Jr, Santos KRN. Association of Enterococcus faecalis with different forms of periradicular diseases. J Endod 2004;30:315–20. 10. Schirrmeister JF, Liebenow AL, Braun G, Wittmer A, Hellwig E, Al-Ahmad A. Detection and eradication of microorganisms in root-filled teeth associated with periradicular lesions: an in vivo study. J Endod 2007;33:536 – 40. 11. Hancock HH 3rd, Sigurdsson A, Trope M, Moiseiwitsch J. Bacteria isolated after unsuccessful endodontic treatment in a North American population. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001;91:579 – 86. 12. Stuart CH, Schwartz SA, Beeson TJ, Owatz CB. Enterococcus faecalis: Its role in root canal treatment failure and current concepts in retreatment. J Endod 2006;32:93– 8. 13. Davis JM, Maki J, Bahcall JK. An in vitro comparison of the antimicrobial effects of various endodontic medicaments on Enterococcus faecalis. J Endod 2007;33:567–9. 14. Fouad AF, Zerella J, Barry J, Spångberg LS. Molecular detection of Enterococcus species in root canals of therapy-resistant endodontic infections. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005;99:112– 8. 15. Kaufman B, Spångberg L, Barry J, Fouad AF. Enterococcus spp. In endodontically treated teeth with and without periradicular lesions. J Endod 2005;31:851– 6. 16. Rolph HJ, Lennon A, Riggio MP, et al. Molecular identification of microorganisms from endodontic infections. J Clin Microbiol 2001;39:3282–9. 17. Cheung GS, Ho MW. Microbial flora of root canal-treated teeth associated with asymptomatic periapical radiolucent lesions. Oral Microbiol Immunol 2001;16:332–7. 18. Baumgartner JC, Siqueira JF Jr, Xia T, Roças IN. Geographical differences in bacteria detected in endodontic infections using polymerase chain reaction. J Endod 2004; 30:141– 4. 19. Roças IN, Jung IY, Lee CY, Siqueira JF Jr. Polymerase chain reaction identification of microorganisms in previously root-filled teeth in a South Korean population. J Endod 2004;30:504 – 8. 20. Gomes BP, Jacinto RC, Pinheiro ET, et al. Porphyromonas gingivalis, Porphyromonas endodontalis, Prevotella intermedia and Prevotella nigrescens in endodontic lesions detected by culture and by PCR. Oral Microbiol Immunol 2005;20:211–5. 21. Ray HA, Trope M. Periapical status of endodontically treated teeth in relation to the technical quality of the root filling and the coronal restoration. Int Endod J 1995;28:12– 8. 22. Dahlen G, Pipattanagovit P, Rosling B, Möller AJR. A comparison of two transport media for saliva and subgingival samples. Oral Microbiol Immunol 1993;8:375– 82. 23. Leys EJ, Griffen AL, Strong SJ, Fuerst PA. Detection and strain identification of Actinobaciluys actinomycetemcomitans by nested PCR. J Clin Microbiol 1994;32:1288 –94. 24. McClellan DL, Griffen AL, Leys EJ. Age and prevalence of Porphyromonas gingivalis in children. J Clin Microbiol 1996;34:2017–9. 25. Kumar PS, Griffen AL, Barton JA, Paster BJ, Moeschberger ML, Leys EJ. New bacterial species associated with chronic periodontitis. J Dent Res 2003;82:338 – 44. 26. Gomes BPFA, Griffen AL, Kumar PS, et al. Molecular and culture analysis of bacteria in infected root canals. J Dent Res 2004;83:1040SL. 27. Rumpf RW, Griffen AL, Wen BG, Leys EJ. Sequencing of the ribosomal intergenic spacer region for strain identification of Porphyromonas gingivalis. J Clin Microbiol 1999;37:2723–5. 28. Ke D, Picard FJ, Martineau F, et al. Development of a PCR assay for rapid detection of enterococci. J Clin Microbiol 1999;37:3497–503.

JOE — Volume 34, Number 5, May 2008


Microbial Analysis of Canals of Root filled Teeth with