Page 1

NEEΣ ΘΕΣΕΙΣ

1.394 ΕΡΓΑΣΙΑΣ

ΣΗΜΕΡΑ ΚΑΙ ΟΙ ∆ΙΑ∆ΡΟΜΕΣ Πού θα πάτε • Τι θα δείτε

ΕΝΘΕΤΟ ΜΟΝΟ ΣΤΗΝ ΠΟΛΗ ΤΗΣ ΘΕΣΣΑΛΟΝΙΚΗΣ

ΠΕΜΠΤΗ 15 ΑΠΡΙΛΙΟΥ 2010 | 1,30 ΕΥΡΩ

ΣΥΜΦΩΝΑ ΜΕ ΣΤΟΙΧΕΙΑ ΤΟΥ ΠΡΩΤΟΔΙΚΕΙΟΥ ΘΕΣΣΑΛΟΝΙΚΗΣ

«Στο σφυρί» 100 σπίτια το µήνα Α. Σαµαράς για την οικονοµία: Θα τα καταφέρουµε µόνοι µας... Δήλωσε ο πρόεδρος της ΝΔ αμέσως μετά τη συνάντησή του με τον πρωθυπουργό. • Το πρωί υπήρξε οξύτητα στη Βουλή κατά την ψήφιση του φορολογικού σελ. 3, 5, 8, ΑΠΟΨΗ σελ. 4

ΘΕΣΣΑΛΟΝΙΚΗ Εργα κάθε βράδυ στην περιφερειακή οδό

15 04

Αρχισαν έργα ανακατασκευής του οδοστρώματος που θα διαρκέσουν ένα μήνα και θα γίνονται μόνο νυχτερινές ώρες σελ. 19

Eκατοντάδες Σήµερα το νεκροί πρώτο ντιµπέιτ από σεισµό στην ιστορία στην Κίνα της Βρετανίας σελ. 33

σελ. 32

Στενάζει η κτηματαγορά στη Θεσσαλονίκη, ενώ παράλληλα οι πλειστηριασμοί ακινήτων αγγίζουν τα περυσινά υψηλά επίπεδα. Το 2009 στο Πρωτοδικείο κατατέθηκαν 1.236 αιτήσεις πλειστηριασμού, αριθμός - ρεκόρ για τη Θεσσαλονίκη, ενώ από τις αρχές του χρόνου μέχρι και σήμερα έχουν κατατεθεί 311. Τα συγκεκριμένα στοιχεία δείχνουν ότι το 2010 θα είναι «φωτογραφία» του 2009, χωρίς ωστόσο να αποκλείεται περαιτέρω επιδείνωση!

Οπως προκύπτει από τα στατιστικά στοιχεία του Πρωτοδικείου Θεσσαλονίκης, οι πλειστηριασµοί ακινήτων το 2009 σηµείωσαν αύξηση περίπου 40% συγκριτικά µε το 2006

σελ. 12

Τετραπλός... τρόµος µε γκαζάκια στη Θεσσαλονίκη Επίδειξη ισχύος από ομάδες αναρχικών χαρακτηρίζεται η χτεσινή τετραπλή επίθεση με αυτοσχέδιους εμπρηστικούς μηχανισμούς στην καρδιά της Θεσσαλονίκης και στόχους πρόσωπα κυρίως από τον πολιτικό χώρο. Οι επιθέσεις πραγματοποιήθηκαν σε διάστημα μόλις δεκαπέντε λεπτών, μέρα μεσημέρι, σε πολυσύχναστες περιοχές, με κίνδυνο να τραυματιστούν περαστικοί κι εργαζόμενοι σελ. 10

ΣΗΜΕΡΑ

Θέµατα και λύσεις για τους υποψηφίους στις πανελλήνιες σε συνεργασία µε τα φροντιστήρια ΠΟΡΕΙΑ ένθετο 8σέλιδο

ΑΣΕΠ: ∆ύο σελίδες µε ερωτήσεις κι απαντήσεις για το διαγωνισµό για την Εθνική Τράπεζα • Περίπου 16.000 υποψήφιοι θα διεκδικήσουν το Σάββατο 230 θέσεις, σε 107 εξεταστικά κέντρα σελ. 16 - 18


ΚΑΛΗΜΕΡΑ

2

Πέµπτη 15 Απριλίου 2010

το συναξάρι

ΕΠΙΜΕΛΕΙΑ ΧΑΪ∆Ω ΣΚΑΝ∆ΥΛΑ chskandyla@ekdotiki.gr

ΑΝΑΤΟΛΗ ΗΛΙΟΥ: 6.50 ΔΥΣΗ ΗΛΙΟΥ: 20.01 ΣΕΛΗΝΗ 1 ΗΜΕΡΑΣ

η ατζέντα της ημέρας

✝ Λεωνίδου επ. Αθηνών ιεροµ. Ο άγιος Λεωνίδης, επίσκοπος Αθηνών, μαρτύρησε το έτος 250 μ.Χ. Συνελήφθη στην Επίδαυρο για την πίστη του στο Χριστό και υπέστη πολλά βάσανα. Αρχικά τον κρέμασαν και ξέσχισαν τις σάρκες του και μετά τον έριξαν στη θάλασσα. Τα άγια λείψανά του βρέθηκαν κατά θαυμαστό τρόπο προ 100 ετών.

Μουσική Η Χαρούλα Αλεξίου εμφανίζεται στις 21.00 στο Μέγαρο Μουσικής Θεσσαλονίκης (25ης Μαρτίου και Παραλία, τηλ. 2310/895.938).

2310/423.925). Σκηνοθετεί ο Λευτέρης Γιοβανίδης και παίζουν οι Φώτης Σπύρος, Ιούλιος Τζιάτας, Μαίρη Ανδρέου και Δημήτρης Παλαιοχωρίτης.

Πρεμιέρα Η θεατρική παράσταση «Μόνοι μαζί» κάνει πρεμιέρα στις 21.15 στο θέατρο «Σοφούλη» (Τραπεζούντος 5 και Θεμ. Σοφούλη, τηλ.

Εικαστικά Η έκθεση «la mamart» εγκαινιάζεται σήμερα στις 20.00 στην γκαλερί «Ζήτα Μι» (Προξ. Κορομηλά 1, τηλ. 2310/270.636).

Οι «Editors» δίνουν συναυλία απόψε στο Principal Club Theatre (17ο χλμ. Θεσ/νίκης - Ν. Μουδανιών, τηλ. 2310/ 428.088)

Προσκλήσεις του Sunday offer για τη θεατρική παράσταση «Το θαύµα της Αννυ Σάλιβαν»

Πρωτόλειο διαχρονικά

Να το δούμε αυτό το πρωτόλειο που το θυμήθηκε η στήλη στο προηγούμενο σημείωμά της και το έκανε αφιέρωμα στις πολλών δεκαετιών συναπτές επετείους του Απριλίου 1941 και στις λιγότερες (αλλά όχι λίγες) επετείους της 14ης Απριλίου 1955. Αλλά πρώτα να δούμε τι είναι το πρωτόλειο, πέρα από την καθιερωμένη σημασία του στη γλώσσα της φιλολογικής κριτικής (το πρώτο έργο ενός δημιουργού). Τα λεξικά της αρχαίας το λένε, παραπέμποντας τα πρωτόλεια στα προτέλεια: θυσία προσφερομένη προ ιεράς τινός πράξεως, αλλά και οι πρώτοι καρποί. Τα δυο μαζί συνδυάστηκαν στις Απαρχές, που ήταν η αφιέρωση των πρώτων καρπών στους θεούς. Πρώτοι καρποί, εκεί περί τα τέλη Ιουνίου, κι αν ψάξει κανείς, μαζί με τους αρχαιογνώστες και τους λαογράφους μας, μπορεί να βρει τη συνέχεια ίσως των Απαρχών στην κατάνυξη με την οποία οι γυναίκες των χωριών μας πήγαιναν τη μέρα της Πεντηκοστής στα Μνήματα και μοίραζαν, η καθεμία στις άλλες, τα «προϊόντα» της παραγωγής και της ζαχαροπλαστικής τους. Ηταν - και τηρείται ακόμη - μια ιερή πράξη, μια «θυσία» για τους νεκρούς, αλλά η συγκέντρωση τόσου κόσμου στα νεκροταφεία τα γέμιζε ζωντάνια. Τελικά, μια τέτοια ζωντάνια από το θάνατο φαίνεται πως άντλησε και το πρωτόλειο της 14ης Απριλίου 1957, που μένει να το δούμε και να το κρίνουμε: «14 Απριλίου. Αισθάνεσαι την ηρεμία της απογευματινής ώρας όταν βγεις παραέξω. Στους ακραίους συνοικισμούς της πόλεως οριστικά κυριάρχησε η Ανοιξη και σιωπά, καθώς βυθίζεται στην ελαφριά νάρκη της μεταμεσημβρινής γαλήνης. Ακολουθείς έναν από τους παράλληλους δρόμους που ενώνουν με αθόρυβη συμμετρία την Ανω με την Κάτω Τούμπα κι ενώ...». Η συνέχεια δε χωράει εδώ. Θα δούμε την Τούμπα του 1957 στο επόμενο.

Κατά τη χτεσινή κλήρωση του διαγωνισμού του περιοδικού Sunday που αφορά τις προσκλήσεις για τη θεατρική παράσταση «Το θαύμα της Αννυ Σάλιβαν» με την Πέγκυ Τρικαλιώτη, για σήμερα στο κινηματοθέατρο «Αριστο-

τέλειον», αναδείχθηκαν οι παρακάτω κωδικοί: 3038111, 3037878, 3037689, 3035655, 3035083, 3034705, 3033165, 3032538, 3031452 και 3030250.

Οι κάτοχοι των παραπάνω κωδικών μπορούν να επικοινωνήσουν σήμερα με το τμήμα Μarketing & Επικοινωνίας της Εκδοτικής Βορείου Ελλάδος από τις 10:30 μέχρι τις 17:00 (Δαναΐδων 4, 4ος όροφος, 2310/779.348).

ο καιρός

Σ Η Μ Ε Ρ Α

Α Υ Ρ Ι Ο

Για αύριο, Παρασκευή, προβλέπονται νεφώσεις με πρόσκαιρες βροχές. Οι άνεμοι θα πνέουν νότιοι νοτιοανατολικοί 4 με 6 Μποφόρ. Η θερμοκρασία θα κυμανθεί από 7 έως 23 βαθμούς Κελσίου.

Για σήμερα, Πέμπτη, προβλέπονται νεφώσεις παροδικά αυξημένες, με τοπικές βροχές. Οι άνεμοι θα πνέουν νότιοι 3 με 5 Μποφόρ. Η θερμοκρασία θα κυμανθεί από 6 έως 19 βαθμούς Κελσίου.

ΦΛΩΡΙΝΑ 6 18

ΦΛΩΡΙΝΑ 7 20

ΘΕΣΣΑΛΟΝΙΚΗ 11 18

ΚΟΖΑΝΗ 7 17

ΛΑΡΙΣΑ 8 21

ΙΩΑΝΝΙΝΑ 12 21

ΑΛΕΞ/ΠΟΛΗ 10 19

ΚΑΒΑΛΑ 9 18

ΜΥΤΙΛΗΝΗ 14 21

ΘΕΣΣΑΛΟΝΙΚΗ Προβλέπονται νεφώσεις κατά περιόδους αυξημένες, με λίγες τοπικές βροχές. Οι άνεμοι θα πνέουν ανατολικοί νοτιοανατολικοί 3 με 4 Μποφόρ. Η θερμοκρασία θα κυμανθεί από 11 έως 18 βαθμούς Κελσίου.

ΑΘΗΝΑ 11 22

ΜΥΤΙΛΗΝΗ 12 23

ΤΡΙΠΟΛΗ 8 23

KΥΚΛΑ∆ΕΣ 12 21

„ 3

ΑΛΕΞ/ΠΟΛΗ 9 20

‚ 3

ΛΑΡΙΣΑ 8 22

ΙΩΑΝΝΙΝΑ 13 21

ΤΡΙΠΟΛΗ 6 22

 3

ΚΟΖΑΝΗ 8 20

‚ 3

ΚΑΒΑΛΑ 10 19

ΘΕΣΣΑΛΟΝΙΚΗ 11 21

ΑΘΗΝΑ 13 23

 4

ΚΥΚΛΑ∆ΕΣ 11 22

 4 ΗΡΑΚΛΕΙΟ 14 22

HΡΑΚΛΕΙΟ 13 22

ΟΙ ΘΕΡΜΟΚΡΑΣΙΕΣ ΣΤΗΝ ΕΥΡΩΠΗ ΣΗΜΕΡΑ

ΕΛΣΙΝΚΙ .............0- 7 ΛΟΝΔΙΝΟ.........2-13 ΡΩΜΗ................. 9-18 ΚΡΑΚΟΒΙΑ ................................ 3- 9 ΟΣΛΟ .............. 2- 17 ΠΑΡΙΣΙ ..............6- 17 ΒΕΡΟΛΙΝΟ ....... 1- 13 ΒΕΛΙΓΡΑΔΙ ...........................10- 16 ΚΙΕΒΟ ............... 7-16 ΜΑΔΡΙΤΗ .........5-16 ΜΟΝΑΧΟ ........ 0 - 12 ΚΩΝΣΤΑΝΤΙΝΟΥΠΟΛΗ ......8-18

σαν σήμερα 1896

1912

1980

1989

Γ. Βιζυηνός

«Τιτανικός»

Ζ. Π. Σαρτρ

Χίλσµπορο

Πεθαίνει ο Γεώργιος Βιζυηνός, ποιητής και πεζογράφος.

Βυθίζεται ο «Τιτανικός», ύστερα από ένα φοβερό χτύπημα σε παγόβουνο στο Βόρειο Ατλαντικό. Από τους 2.340 επιβαίνοντες, χάνονται στα παγωμένα νερά οι 1.595.

Πεθαίνει ο Γάλλος υπαρξιστής φιλόσοφος Ζαν Πολ Σαρτρ. Βραβεύτηκε με το Νομπέλ Λογοτεχνίας το 1964.

Η Τραγωδία του Χίλσμπορο. Λίγο πριν από την έναρξη του ημιτελικού για το Κύπελλο Αγγλίας μεταξύ Λίβερπουλ και Νότιγχαμ, καταρρέει η εξέδρα του γηπέδου του Σέφιλντ, λόγω υπεράριθμων θεατών, με αποτέλεσμα να βρουν το θάνατο 96 οπαδοί της Λίβερπουλ και να τραυματιστούν 250.


3

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

Λύση ανάγκης ο µηχανισµός Ο πρωθυπουργός είπε στον Α. Σαµαρά ότι επιθυµεί να αποφύγει τη βοήθεια ΤΟΥ ΣΠΥΡΟΥ ΣΟΥΡΜΕΛΙ∆Η Παπανδρέου και Σαμαράς συζήτησαν σε βάθος τις πτυχές της οικονομικής κρίσης

Η κυβέρνηση δεν επιθυμεί να προσφύγει στο μηχανισμό στήριξης, εξήγησε ο Γ. Παπανδρέου στον αρχηγό της αξιωματικής αντιπολίτευσης Αντώνη Σαμαρά, με τον οποίο συναντήθηκε χτες.

Ο

ι συνεργάτες του πρωθυπουργού υποστηρίζουν ότι στη συνάντηση των δύο ανδρών υπήρξε ουσιαστικά ταύτιση απόψεων σε ό,τι αφορά την ουσία. Με ευγενικό τρόπο υποστηρίζουν πως ο κ. Σαµαράς δεν κοµίζει κάτι εντελώς διαφορετικό από αυτό που βλέπει και η κυβέρνηση. «Ο κ. Σαµαράς έχει την άποψη που έχουµε και εµείς, όσο µπορούµε να µη χρησιµοποιήσουµε το µηχανισµό στήριξης, ο οποίος είναι λύση ανάγκης ως δίχτυ ασφαλείας και εµµένουµε σε αυτό», ανέφεραν συνεργάτες του πρωθυπουργού. Οι ίδιοι κύκλοι ανέφεραν ότι επιθυµία της Ελλάδας είναι ο µηχανισµός να είναι όσο το δυνατόν πιο έτοιµος, ώστε αν χρειαστεί να τον ενεργοποιήσουµε, προσθέτοντας ότι «έχει τεχνικές λεπτοµέρειες τις οποίες πρέπει να επεξεργαστούµε». Σε ό,τι αφορά τις απόψεις του κ. Σαµαρά για το ΔΝΤ, επισήµαναν ότι ο κ. Σαµαράς έχει πει και παλαιότερα «όχι» στο ΔΝΤ, αυτό όµως είναι µια αναγκαιότητα, έτσι όπως προέκυψε µέσω του µηχανισµού. Δεν αποφασίσαµε εµείς να υπάρχει το ΔΝΤ στο µηχανισµό, το αποφάσισαν οι γνωστές ευρωπαϊκές κυβερνήσεις, επανέλαβε στον Α. Σαµαρά ο Γ. Παπανδρέου κατά τη συνάντησή τους, κάτι που το οικονοµικό επιτελείο της κυβέρνησης δηλώνει και δηµοσίως.

Ενηµερωτικό χαρακτήρα Το Μέγαρο Μαξίµου αποφεύγει να προβλέψει την αντίδραση του κ. Σαµαρά σε περίπτωση που τελικώς κριθεί αναγκαία η προσφυγή στο µηχανισµό στήριξης. Εµείς λέµε ότι υπάρχει ο συγκεκριµένος µηχανισµός, µε ενστάσεις ή χωρίς, αυτός είναι, και πρόσθεσαν ότι η σηµερινή συνάντηση είχε ενηµερωτικό χαρακτήρα και δεν είχε σκοπό τη συµφωνία ή κάτι διαφορετικό, ενώ επισήµαναν ότι σύγκλιση δεν υπάρχει εκ των πραγµάτων γενικώς.

Συµφωνούν για λιγότερες οµιλίες Σε ό,τι αφορά την επισήµανση του κ. Σαµαρά για λιγότερες οµιλίες, οι ίδιοι συνεργάτες του πρωθυπουργού επισηµαίνουν πως είναι σωστό, καθώς είναι κρίσιµη όλη η περίοδος. Για την αναφορά του κ. Σαµαρά σε µίγµα

πολιτικής, είπαν ότι ο καθένας έχει τις απόψεις του και τη συγκεκριµένη δράση και λειτουργία, προσθέτοντας ότι «εµείς µέσα από τη δράση µας φτάσαµε σ’ αυτόν το µηχανισµό, δε λέµε ότι είναι το ιδανικό, αλλά λέµε ότι είµαστε ικανοποιηµένοι». «Σε θεωρητικό επίπεδο ίσως υπάρχουν άλλες προσεγγίσεις, η κυβέρνηση, επειδή αυτή αποφασίζει, βλέπει πιο πρακτικά τα ζητήµατα. Σεβόµαστε τις αντιρρήσεις και τις ενστάσεις της αντιπολίτευσης», επισήµαναν οι ίδιοι κύκλοι και πρόσθεσαν ότι «είπαµε πως θέλουµε να µη φτάσουµε στην ενεργοποίηση του µηχανισµού, αν χρειαστεί θα το ζητήσουµε. Λέµε ότι είµαστε στις αγορές». Τέλος ανέφεραν ότι µπορεί στο προσεχές Ecofin να υπάρξει πιο τυπική επικύρωση του µηχανισµού, ωστόσο η Ελλάδα θεωρεί ότι υπάρχει απόφαση σε πολιτικό επίπεδο.

Ο Αρειος Πάγος «σώζει» τον ανακριτή Ν. Ζαγοριανό Βαθαίνει το ρήγμα μεταξύ Αρείου Πάγου και υπουργείου Δικαιοσύνης μετά την απόφαση του ανώτατου δικαστηρίου να μη θέσει σε προσωρινή αργία τον πρώην ανακριτή της Siemens, Νίκο Ζαγοριανό. Με συντριπτική πλειοψηφία 48 ψήφων έναντι 19, η ολομέλεια του Αρείου Πάγου απάντησε στο ερώτημα του Χ. Καστανίδη για το εάν θα πρέπει να τεθεί σε προσωρινή αργία ο δικαστικός λειτουργός, απορρίπτοντάς το για δεύτερη φορά. Οι ανώτατοι δικαστές

μπαίνοντας στην ουσία της υπόθεσης -ενώ η Ολομέλεια δεν έχει τέτοιο δικαίωμα από το νόμο- έκρινε ότι δεν υπάρχουν επαρκή στοιχεία για να οδηγήσουν τον Ν. Ζαγοριανό σε προσωρινή έξοδο, αν και βαρύνεται με το κακούργημα της κατάχρησης εξουσίας. Σύμφωνα με πληροφορίες, κατά τη διάρκεια της συνεδρίασης υπήρξαν αντιπαλότητες, αλλά και προτάσεις που χαρακτηρίστηκαν ακραίες. Ο αντεισαγγελέας του Αρείου Πάγου, Αθ. Κονταξής, πρότεινε να κηρυχθεί απαράδεκτη η προ-

σφυγή του υπουργού! Ο εισηγητής Δ. Δαλιάνης πρότεινε να αναβληθεί η συζήτηση μέχρι να ολοκληρωθεί ο πειθαρχικός και ποινικός έλεγχος του πρώην ανακριτή των μαύρων ταμείων. Από την πλευρά του, ο «διώκτης» του Ν. Ζαγοριανού, Ι. Παπανικολάου, έβαλε σε βάρος των συναδέλφων του, υποστηρίζοντας ότι αναβάλλοντας τη συζήτηση της υπόθεσης καταλύεται το κράτος δικαίου. Και όταν τελικά η υπόθεση συζητήθηκε και οι δικαστές έλαβαν την απόφασή τους, ο κ. Παπανικολάου

έκανε λόγο για «ρήγμα και για πλήγμα στη Δικαιοσύνη».

Χ. Καστανίδης Σκληρό ήταν και το σχόλιο του υπουργού Δικαιοσύνης, ο οποίος έβαλε στο στόχαστρό του τόσο τον Αρειο Πάγο όσο και το δικαστή Ν. Ζαγοριανό. «Κανέναν δεν μπορώ να υποχρεώσω σε αυτοσεβασμό, όπως και κανέναν δεν μπορώ να υποχρεώσω να διεκδικεί το σεβασμό της κοινωνίας. Εκαστος εφ’ ώ ετάχθη», δήλωσε ο Χ. Καστανίδης. ΣΟΦΙΑ ΦΑΣΟΥΛΑΚΗ

Ελληνοτουρκική συνεργασία µόνον υπό προϋποθέσεις Στον απόηχο της επίσκεψης του Δ η μ ή τρ η Δρούτσα στην Αγκυρα και εν αναμονή της άφιξης του Ταγίπ Ερντογάν στην Αθήνα, ο αναπληρωτής υπουργός Εξωτερικών θέλησε χτες να αποσαφηνίσει το πλαίσιο εντός του οποίου προτίθεται να κινηθεί η κυβέρνηση στις ελληνοτουρκικές σχέσεις. Ο Δ. Δρούτσας ενημέρωσε αναλυτικά τον Πρόεδρο της Δημοκρατίας (φωτογραφία), υπενθυμίζοντας με την ευκαιρία ότι ο Κάρολος Παπούλιας «είναι βαθύς γνώστης των θεμάτων εξωτερικής πολιτικής με πολύ μεγάλη εμπειρία και εκφράζει με τον πιο κατάλληλο τρόπο τις θέσεις της Ελλάδας», ενώ ταυτόχρονα έσπευσε να ξεκαθαρίσει ότι η επιθυμία της κυβέρνησης «για πιο στενή συνεργασία με την Τουρκία είναι ειλικρινής, είναι σαφής, όσο σαφείς είναι και οι προϋποθέσεις για μία τέτοια συνεργασία, δηλαδή ο σεβασμός της εδαφικής ακεραιότητας της Ελλάδας, ο σεβασμός των κυριαρχικών δικαιωμάτων μας, ο σεβασμός του διεθνούς δικαίου». Ταυτόχρονα, ο Δ. Δρούτσας επιβεβαίωσε οτι η επίσκεψη Ερντογάν στην Αθήνα αναμένεται να πραγματοποιηθεί στα μέσα Μαΐου, αλλά οι σχετικές συνεννοήσεις για τον καθορισμό ημερομηνίας δεν έχουν ολοκληρωθεί.

Ο Πάπας στην Κύπρο Ιστορική επίσκεψη, με σημαντικές διπλωματικές προεκτάσεις, θα πραγματοποιήσει ο Πάπας Βενέδικτος στην Κύπρο, στις 4 - 6 Ιουνίου. Οπως ανακοίνωσε η κυπριακή κυβέρνηση, ο ηγέτης της Καθολικής Εκκλησίας αποδέχθηκε πρόσκληση του προέδρου Δημήτρη Χριστόφια, ο οποίος βρέθηκε στο Βατικανό το Μάρτιο του 2009. Είναι η πρώτη φορά που επισκέπτεται Πάπας την Κύπρο, ενώ η συγκεκριμένη εξέλιξη ενισχύει τους δεσμούς και το κύρος της Λευκωσίας στον καθολικό κόσμο. Ο Πάπας θα έχει συνάντηση με τον Δημήτρη Χριστόφια στο Προεδρικό Μέγαρο, ενώ θα πραγματοποιήσει δέηση στο ναό του Αγίου Παύλου, στην Πάφο.

Υποψήφιος πρύτανης και ο Αν. Φιλιππίδης Την υποψηφιότητά του για τη διεκδίκηση του πρυτανικού θώκου στο Αριστοτέλειο Πανεπιστήμιο Θεσσαλονίκης ανακοίνωσε χτες και ο καθηγητής Γεωλογίας και πρώην κοσμήτορας της Σχολής Θετικών Επιστημών, Ανέστης Φιλιππίδης. Σήμερα αναμένεται να καταθέσει και επίσημα την υποψηφιότητά του

στο πρυτανικό συμβούλιο. Το συνδυασμό του κ. Φιλιππίδη θα πλαισιώσουν η Βασιλική Δρόσου - Αγακίδου, καθηγήτρια Ιατρικής, ο Παρασκευάς Σαββαΐδης, καθηγητής του Τμήματος Πολιτικών Μηχανικών, και ο Θεόδωρος Χατζηπαντελής, καθηγητής στον τομέα Πολιτικών Επιστημών της Νομικής.


4

Η 4η ΣΕΛΙΔΑ

Πέµπτη 15 Απριλίου 2010

η άποψή μας

Να ξαναγίνουµε µια κανονική χώρα Η οικονοµική πολιτική της εκάστοτε κυβέρνησης ανέκαθεν προκαλεί εντάσεις και οξείς τόνους από την πλευρά των κοµµάτων της αντιπολίτευσης, τα οποία επιχειρούν να πραγµατώσουν το ρόλο τους ως φορέα ελέγχου της εξουσίας και υπερασπιστή των συµφερόντων, συνήθως, των φτωχότερων κοινωνικών στρωµάτων. Αυτά υπό κανονικές συνθήκες και όχι σε συνθήκες οικονοµικού πολέµου, όπως αυτού που βιώνει τους τελευταίους µήνες η Ελλάδα, για την επιτυχή έκβαση του οποίου απαιτείται η µέγιστη δυνατή συνεννόηση των πολιτικών δυνάµεων. Αλλωστε, αποτελεί το µοναδικό τρόπο να πειστούν οι πολίτες για την αναγκαιότητα και αποτελεσµατικότητα των µέτρων λιτότητας που εφαρµόζει η κυβέρνηση, προκειµένου να αποφευχθεί η οικονοµική χρεοκοπία και η συνακόλουθη κατάρρευση της κοινωνίας. Είναι παραπάνω από προφανές πως το πολιτικό σύστηµα οφείλει να δώσει το παράδειγµα, διότι έχει και τη µεγαλύτερη ευθύνη για τη δηµιουργία της σηµερινής αδιέξοδης κατάστασης. Κατά συνέπεια, προκαλεί ερωτήµατα η αµφιθυµία που παρατηρείται στη στάση της αξιωµατικής αντιπολίτευσης έναντι της πολιτικής που εφαρµόζει η κυβέρνηση για να ανορθώσει τα συντρίµµια που άφησε πίσω της η διακυβέρνηση της Νέας Δηµοκρατίας. Θα όφειλε η νέα ηγεσία της ΝΔ να εννοεί περισσότερο τα όσα περί συναίνεσης διακηρύττει, αντιλαµβανόµενη το µέγεθος της ευθύνης της και επιδεικνύοντας την ανάλογη υπευθυνότητα, καθώς το προέχον είναι αυτή η ίδια η ύπαρξη της χώρας. Αλλωστε σ’ αυτήν την περίσταση η εθνική συνεννόηση µάλλον δίνει «πολιτικούς πόντους», παρά αφαιρεί. Εάν αυτή η αντίληψη υιοθετηθεί και από τα κόµµατα της ήσσονος αντιπολίτευσης, αυξάνονται γεωµετρικά οι πιθανότητες επιτυχίας του Προγράµµατος Σταθερότητας, οπότε η χώρα θα εξέλθει συντοµότερα από τη στενωπό και τη διεθνή επιτήρηση, ανακτώντας τη χαµένη εθνική της κυριαρχία και τη δυνατότητα να ασκεί δικαιότερη κοινωνική πολιτική. Βεβαίως, δικαίωµα και υποχρέωση της αντιπολίτευσης είναι να ελέγχει, να κριτικάρει την κυβερνητική πλειοψηφία και ουδείς διανοείται να αµφισβητήσει αυτόν το ρόλο. Αντιθέτως, η κριτική και η διατύπωση εναλλακτικών προτάσεων είναι απολύτως επιβεβληµένες. Ζητούµενο δεν είναι να απεµπολήσουν τα κόµµατα το ρόλο τους. Ζητούµενο είναι να επιτευχθεί µία εθνική συµφωνία επί του στόχου, ο οποίος θα υπηρετηθεί µε αταλάντευτη συνέπεια από όλους, ώστε να ξαναγίνουµε µια κανονική χώρα.

ΣΚΙΤΣΟ: ΒΑΓΓΕΛΗΣ ΠΑΠΑΒΑΣΙΛΕΙΟΥ

από το(ν) Α... ώς το Ω

Το περίστροφο και το τεστ ΠΑΠ Το περίστροφο είναι γεμάτο πια πάνω στο τραπέζι. Ετσι λέει η κυβέρνηση. Το δοκιμάσαμε μόλις τη Δευτέρα, με την τελευταία έκδοση ομολόγων. Ρίξαμε στην αγορά -έχουμε μάθει απ’ έξω κι ανακατωτά τους όρουςομόλογα ελληνικού Δημοσίου εξάμηνης κι ετήσιας διάρκειας, έτρεξαν τα ΤΟΥ ΛΑΖΑΡΟΥ ΘΕΟ∆ΩΡΑΚΙ∆Η επενδυτικά funds να τα πάρουν, αλλά lazth@ekdotiki.gr τα επιτόκια που μας έδωσαν υπερδιπλασιάστηκαν σε σχέση με την προηγούμενη φορά, μόλις τον περασμένο Ιανουάριο. Πήραμε λεφτά, αλλά τα πληρώσαμε ακριβά. Και συνεχίζουμε. Η διάθεση των ομολόγων έγινε για να δούμε τις διαθέσεις των αγορών μετά την πρωτοφανή τηλεδιάσκεψη των «16» της ευρωζώνης για το σκόπελο της ελληνικής οικονομίας. Κατέληξαν οι εταίροι μας στη σύσταση μηχανισμού στήριξης, στο ποσό του δανεισμού, στο επιτόκιο, κι αν τον χρειαστούμε θα τον ενεργοποιήσουμε. Είναι το περίστροφο που λέγαμε. Μ’ αυτόν τον τρόπο θα αντιμετωπίσουμε τους αδίστακτους κερδοσκόπους, που εάν συνεχίσουν να μας πυροβολούν με τα spreads, θα σηκώσουμε το περίστροφο και... στο κεφάλι! Μέχρι τότε όμως θα έχουμε φάει τόσες αδέσποτες,

ΙΔΙΟΚΤΗΣΙΑ: ΕΚΔΟΤΙΚΗ ΒΟΡΕΙΟΥ ΕΛΛΑΔΟΣ ΑΕ ΕΚΔΟΤΗΣ: Αλέξανδρος Κ. Μπακατσέλος ΔΙΕΥΘΥΝΤΗΣ: Τραϊανός Χατζηδημητρίου ΕΤΟΣ: 14ο ΑΡ. ΦΥΛΛΟΥ: 4.070 www.agelioforos.gr email: aglfros@otenet.gr ΓΡΑΦΕΙΑ ΘΕΣΣΑΛΟΝΙΚΗΣ: Δαναΐδων 4, Τ.Κ. 54626, Τηλ.: 2310 779111, Fax: 2310 243852

ΓΡΑΦΕΙΑ ΑΘΗΝΩΝ: Π. Ιωακείμ 60, Τ.Κ. 10676, Τηλ.: 210 7255850 -51, Fax: 210 7255853

που δύσκολα θα επουλώνονται οι πληγές μας. Κόψαμε από παντού, χάσαμε κεκτημένα και με μια πιστολιά των κερδοσκόπων όλα πέφτουν στο κενό. Aλλο και τούτο: εμείς έχουμε το περίστροφο, άλλοι πυροβολούν! Ειδικός δεν είμαι, αλλά δεν μπορώ να καταλάβω ακόμη γιατί δεν ενεργοποιούμε το μηχανισμό στήριξης, μιας και δώσαμε τόσο μεγάλο αγώνα εντός της ΕΕ μέχρι να συσταθεί. Γιατί δε σταματάμε το δανεισμό από τις αγορές, να τα πάρουμε από τον περιβόητο μηχανισμό; Τι φοβόμαστε; Επιπλέον μέτρα; Τέτοια περιθώρια δεν έχει η ελληνική κοινωνία. Και οι εταίροι μας το ξέρουν. Γιατί δεν παίρνουμε αυτό το δάνειο να τελειώνουμε; Μα, από όσα γίνονται γνωστά, τα μέτρα που πήρε η κυβέρνηση Παπανδρέου κινούνται στη σωστή κατεύθυνση και ικανοποιούν τους Ευρωπαίους ηγέτες - δανειστές μας. Ικανοποιούν και το ΔΝΤ. Φοβόμαστε μήπως μπει το ΔΝΤ στη χώρα μας; Γιατί, μήπως δεν είναι ήδη εδώ; Ο κόσμος βλέπει παντού περίστροφα να τον σημαδεύουν και περιμένει το επόμενο μπαμ. Από τη μια ακούει το μύλο του περιστρόφου να γυρίζει και από την άλλη αδημονεί για τα αποτελέσματα του τεστ… ΠΑΠ(ανδρέου) στις αγορές. Κι αναρωτιέμαι: μια κοινωνία που ζει υπό το κράτος της αγωνίας και της απειλής πώς περιμένουμε να προκόψει και να παραγάγει προϊόν;

ΔΙΕΥΘΥΝΤEΣ ΣΥΝΤΑΞΗΣ: Εύρης Τσουμής, Xριστίνα Χρυσοστομίδου ΑΡΧΙΣΥΝΤΑΚΤΕΣ: Λάζαρος Θεοδωρακίδης, Πέτρος Τανανάκης

ΕΚΤΥΠΩΣΗ: «ΦΙΛΙΠΠΟΣ», Τηλ.: 2310 779277 ΕΜΠΟΡΙΚΟ ΤΜΗΜΑ: Τηλ.: 2310 779273, Fax: 2310 257328

ΜΙΚΡΕΣ ΑΓΓΕΛΙΕΣ: Τηλ.: 2310 294444, FAX: 2310 237316

ΣΥΝΔΡΟΜΕΣ: Τηλ.: 2310 779111


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

5

ΡΕΠΟΡΤΑ Ζ

Αντ. Σαµαράς: «Μπορούµε να τα βγάλουµε πέρα µόνοι µας» ΤΗΣ ΜΑΡΙΑΣ ΣΠΥΡΑΚΗ

Καλό κλίμα, αλλά και καταγεγραμμένες διαφωνίες έδωσε η συνάντηση -η τέταρτη κατά σειρά από τότε που ο Αντώνης Σαμαράς βρίσκεται στην ηγεσία της ΝΔ- του αρχηγού της αξιωματικής αντιπολίτευσης με τον πρωθυπουργό. Γιώργος Παπανδρέου και Αντώνης Σαμαράς συζήτησαν περισσότερο από μια ώρα αυτήν τη φορά, αποτιμώντας την πορεία των εξελίξεων από τη Σύνοδο Κορυφής της Ευρωπαϊκής Ενωσης της 25ης Μαρτίου μέχρι και σήμερα και διαπιστώνοντας το σοβαρό πρόβλημα που δημιουργεί η Γερμανία απέναντι στη στήριξη των χωρών του Νότου που πλήττονται από την κρίση αλλά και από το έλλειμμα ανταγωνιστικότητας.

Ευχαριστηµένος Σύμφωνα με πληροφορίες από τη Ρηγίλλης, ο κ. Σαμαράς έφυγε ευχαριστημένος από τη συνάντησή του με τον Γιώργο Παπανδρέου, χωρίς ωστόσο να λάβει απάντηση για το εάν και κατά πόσον τις επόμενες δύο εβδομάδες η Ελλάδα προτίθεται να προσφύγει στο μηχανισμό στήριξης. Σε αυτό το πεδίο, όπως αναμενόταν άλλωστε, ο πρωθυπουργός δεν άνοιξε τα χαρτιά του. Ωστόσο οι δύο άνδρες έκαναν αποτίμηση των εξελίξεων που αφορούν τη χώρα μας μετά την αποσαφήνιση του μηχανισμού στήριξης την περασμένη Κυριακή στο Eurogroup. Ο κ. Σαμαράς ενημερώθηκε ειδικά για τις εξελίξεις των επαφών και των συνομιλιών μεταξύ των υπηρεσιακών παραγόντων της ελληνικής πλευράς, των στελεχών της Ευρωπαϊκής Επιτροπής, της Ευρωπαϊκής Κεντρικής Τράπεζας και του Διεθνούς Νομισματικού Ταμείου. Ο πρόεδρος της ΝΔ επέμενε στη συνομιλία του με τον πρωθυπουργό ότι δε θα πρέπει να προχωρήσει σε προσφυγή στο μηχανισμό στήριξης. Κατά την άποψή του με ένα κατάλληλο μείγ-

μα πολιτικής η χώρα μπορεί να περάσει την κρίση μόνη της. Σε αυτό το σημείο ο κ. Σαμαράς επισήμανε ιδιαίτερα την ανάγκη να ληφθούν συγκεκριμένα μέτρα τόνωσης της οικονομικής δραστηριότητας, ώστε η χώρα να μη βυθιστεί στην ύφεση και να υποστηριχθούν οι θέσεις εργασίας και απασχόλησης.

Μόνοι µας Στο ίδιο μήκος κύματος κινήθηκε και η δήλωση που έκανε ο αρχηγός της αξιωματικής αντιπολίτευσης έξω από το Μέγαρο Μαξίμου. «Ενημερώθηκα, ενημέρωσα και συζητήσαμε σε βάθος τις κρίσιμες πτυχές αυτής της μεγάλης οικονομικής κρίσης. Εγώ εξακολουθώ να θεωρώ ότι με το κατάλληλο μείγμα οικονομικής πολιτικής μπορούμε να τα βγάλουμε πέρα μόνοι μας», είπε ο κ. Σαμαράς. Σε επίμονες ερωτήσεις των δημοσιογράφων αν θα γίνει χρήση του μηχανισμού, ο κ. Σαμαράς τόνισε με έμφαση ότι «όσο λιγότερο μιλάμε τόσο καλύτερα για την οικονομία».

Τρία αγκάθια Στη συνάντησή του με τον πρωθυπουργό ο πρόεδρος της ΝΔ ανέδειξε και τα τρία σημαντικά αγκάθια: ■ «Μια συνταγή ΔΝΤ δεν ενδείκνυται για την Ελλάδα κυρίως για τις βαρύτατες επιπτώσεις που θα έχει στα θέματα κοινωνικής συνοχής», είπε ο κ. Σαμαράς, ο οποίος από την αρχή που προέκυψε το θέμα δηλώνει την κατηγορηματική αντίθεσή του σε μια τέτοια εξέλιξη. ■ Η σύσταση Εξεταστικής Επιτροπής για την οικονομία που θα διερευνήσει την περίοδο 2004 - 2009 δε θα συμβάλει στη δημιουργία κλίματος συναίνεσης, προειδοποίησε τον πρωθυπουργό ο αρχηγός της αξιωματικής αντιπολίτευσης. Αλλωστε όπως υπενθυμίζουν πηγές της Ρηγίλλης, η ΝΔ μόλις προέκυψε το ζήτημα, αντιτάχθηκε σε ένα τέτοιο ενδεχόμενο, λέγοντας πως μια τέτοια επιτροπή μπορεί να κρεμάσει τη χώρα στα μανταλάκια του διεθνούς Τύπου.

■ «Οι οικονομικές δυσχέρειες της περιόδου που διανύουμε επιβάλλουν περισσότερο παρά ποτέ στα εθνικά θέματα να είμαστε απολύτως προσηλωμένοι στις κόκκινες γραμμές», είπε ο πρόεδρος της ΝΔ, απευθυνόμενος στον πρωθυπουργό μετά την ενημέρωση που του έκανε για την επικείμενη επίσκεψη Ερντογάν στην Αθήνα. Σύμφωνα με πληροφορίες από τη Ρηγίλλης, ο κ. Σαμαράς έφυγε ευχαριστημένος από τη συνάντησή του με τον Γιώργο Παπανδρέου


6

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΣΦΗΝΕΣ

επωνύμως

Η µάχη του αυτονόητου Δεν παράγουµε. Δεν είµαστε ανταγωνιστικοί. Δεν εξάγουµε προϊόντα. Αντίθετα, εισάγουµε ακόµη και σταφύλια Αργεντινής και καρύδια Τουρκίας. Η χώρα είναι καταχρεωµένη και αναξιόπιστη διεθνώς και αυτόν τον καιρό δοκιµάζεται δεινώς. Το πολιτικό µας σύστηµα σπατάλησε εδώ και αρκετά χρόνια πακτωλούς χρηµάτων, τα οποία δυστυχώς δεν αξιοποιήθηκαν, µε συνέπεια η χώρα να µείνει πίσω από άποψη υποδοµών. Ζούµε σ’ ένα ευρωπαϊκό περιβάλλον, που στο µέλλον θα έχουµε µόνο υποχρεώσεις, και η πορεία µας εξαρτάται από την καινοτοµία, τις νέες τεχνολογίες, την ποιότητα των προϊόντων και υπηρεσιών, το λιγότερο κράτος, από τις προσπάθειές µας ν’ αλλάξουµε νοοτροπία, να περιορίσουµε τις απαιτήσεις µας, να µαζέψουµε τα απλωµένα πόδια µας, να εκµεταλΤΟΥ ΓΙΩΡΓΟΥ Θ. ΙΓΝΑΤΙΑ∆Η* λευτούµε τα προσόντα της χώρας. Απλά παραδείγµατα: οι ανεµογεννήτριες και τα φωτοβολταϊκά, σε όλα τα νησιά µας τουλάχιστον, είναι ιδανικοί τόποι για ανάπτυξη αυτών των συστηµάτων και παραγωγή ηλεκτρικού ρεύµατος. Στην κεντρική Ευρώπη, µε ελάχιστο ήλιο, τα φωτοβολταϊκά δίνουν λύσεις στον ηλεκτρισµό. Οι δηµόσιοι υπάλληλοι, 771.000 κατά την ΑΔΕΔΥ, πλην των ΔΕΚΟ, επαρκούν να στελεχώσουν όλες τις υπηρεσίες του κράτους. Συµβαίνει όµως κάποιες υπηρεσίες να έχουν υπεράριθµους και κάποιες άλλες να υπολειτουργούν εξαιτίας των ελλείψεων. Δεν είναι δύσκολο να αποφασιστούν οι µετατάξεις αυτές, αρκεί να υπάρχει βούληση και κάποια οργανωµένη προσπάθεια. Ενας υπουργός, ο Στ. Μπένος, δηµιούργησε τα ΚΕΠ, µια απλή, σύντοµη, αλλά επαναστατική εξυπηρέτηση του πολίτη, ενταγµένη στη δηµόσια διοίκηση, που πρέπει να διευρυνθεί. Ολα αυτά είναι ενδεικτικά παραδείγµατα, που επιβάλλεται να προωθήσει το πολιτικό σύστηµα της χώρας, το οποίο δυστυχώς λειτουργεί µε όρους επαγγελµατισµού και λαϊκισµού. Δηλαδή, πώς να εκτιµήσει ο απλός πολίτης την υπεύθυνη Πολιτεία σήµερα, όταν ένα τεράστιο σκάνδαλο της Siemens, µε χρηµατισµούς κοµµάτων και πολιτικών προσώπων αποδεδειγµένα, ταλαιπωρεί τη χώρα αρκετά χρόνια και βρίσκεται ακόµη στο στάδιο της διερευνήσεως µε την Εξεταστική Επιτροπή και γελάει το πανελλήνιο, όταν οι Γερµανοί έχουν στείλει «αρµοδίως» τους δικούς τους υπαίτιους στις φυλακές; Γιατί να πιστέψει τους πολιτικούς η κοινωνία, όταν τα αδικήµατά τους παραγράφονται σύντοµα σε σχέση µε τα αντίστοιχα των πολιτών και οι λαθροχειρίες που σηµειώνονται στο δηµόσιο τοµέα, και όχι µόνο από τα διάφορα τρωκτικά, δεν έχουν προηγούµενο; Στη χώρα αυτή πρέπει να δοθεί η µάχη του αυτονόητου. Γιατί ό,τι είναι απλό είναι και επαναστατικό και τη µάχη αυτή υπάρχουν αξιόµαχες και αξιόπιστες δυνάµεις να τη δώσουν, αρκεί οι οσφυοκάµπτες και οι κυρτοµεσίτες να λιγοστέψουν από τα πολιτικά γραφεία των πολιτικών και αξιωµατούχων της κάθε κυβέρνησης. *Ο ΓΙΩΡΓΟΣ Θ. ΙΓΝΑΤΙΑΔΗΣ είναι δικηγόρος

η και αϊκή..ς. οτίΜγίμρης Ευρωπαυ Ανδρουλάκης στικό σχε-

Απολ ικού νομο ση του φορολογ βαθμολογεί κατά τη συζήτη ... να ή, όταν άρχισε Οικονομικών. δίου στη Βουλ ου εί υ υπουργ το μα ιτη θέ μο το νο 5 στη φορολογ υς στόχους, 8, το α νω γι άγ 9 α σε ητ ω Εδ σταθερότ η στ , νη σύ ιο ιο κή του δικα ι παίρνει μέτρ λότητα είπε ότ στο και στην απ στάση μας στο μηχανισμό τη ξεπεψέζεις βαθμό. Και για την τίγρη, αν ες ησ άλ αβ «Κ ; της ΕΕ Α.Σ. σ’ έφαγε»!

-Θόδωρε,είσαι να πάµε στο Dancing with the stars?

Βαρεσλταάκτώι θηκαν, αλλά όχι από την αρχήεία,

Ανα αν στα γραφ ολόγων που ήτ ικ Ο ν άκια. τω λη μέ τα κασαν τα γκαζ έσ υ πο ρα ώ ν πόρτα, τους χτες τη α έξω από την σμ όι θρ α έν ε άζουν δια«Ακούσαμ μασία. Θα μοιρ ση ς ω όμ με δαμε καδε δώσα είπαμε. Μετά εί α, δι λά υλ φ κά φημιστι που καιγόταν», με την πόρτα, ξα οί αν ι κα ς τά άρπαξε το πνού πλιώνης. Και με ... Μ ος ργ ώ Γι ο λέει ύκτη ρού από τον ψ Α.Σ. βαρελάκι του νε

µάνικεσατική αντλία έφτα«Αχρητεσυττηο.»Η πυ ροσβ Οικο-

Απίσ αφεία των α καιόμενα γρ σε γρήγορα στ λάτωνος, αλλά δεν μπόρεσε όΠ ν του μελόγων, στην οδ Λόγω των έργω ά. τι ω φ τη ει πλησιάσει να σβήσ ν μπορούσε να δε α τί να Εγ ην τρό στ ρίπου πενήντα ία. Πάρκαρε πε ικ το κα λυ πο στην τες αντί να πιάκαι οι πυροσβέσ ά με αντλίες ιά κρ μα α τρ μέ ωτι έσβησαν τη φ σουν τη μάνικα υ θα έχουμε και μετρό, ας πο χειρός. Ε, τώρα ! τε Α.Σ. καιγόμασ

υπάντωκονμματικοί εναντίον αιρετών καΣΟι βοΚ σε Κατά άσ Α Π υ ινοι» το

«Πρ νώσεων ματείς των οργα τους επιλευτών. Οι γραμ ίχνη και Ευκαρπία, με κοινή Πολ διαμαρτύΣταυρούπολη, ι Γ. Ραγκούση, κα δη νί Ξυ Σ. υς οτείνουν στολή προς το μάρχων που πρ δη ν τω η ασ ότ πρ στα ορισμέρονται για την ν. Καλούν μάλι μω δή ν ιώ τρ ν βουλευτές «να τη συνένωση τω νους» τοπικούς σι ν ρά «π , νε λέ τικοί κι όχι σα νους, όπως υπεύθυνοι πολι ν σα ς ου έλ ιτ φερθούν επ Α.Σ. ρίς ονόματα... πολιτευτές». Χω

έναν ΠΑΣΟΚ στη Σταυρούπολη έχει∆έκα γπια ική δε του Την υπογρά

Η το όφαση. ς, χωριστή, απ τη κή δι ι ονιστικής της κα βγάλει μέλη της συντ τα ι κα ας τέ ου είναι, πολύ φουν ο γραμμα λη πρόταση. Π άλ υν νο κά ι Νεάπολη, Ποεπιτροπής κα λονίκη (Συκιές, σα εσ Θ κή τι δυ Εύοσμος, Αμπεαπλά, όλη η , Σταυρούπολη, ) να γίνει ένας κα εύ Π , ία ρπ λίχνη, Ευκα - Κορδελιό ένη, Ελευθέριο λόκηποι, Μενεμ τιμή του ενός. Α.Σ. ην δήμος. Δέκα στ

είπαν...

ANNA ΔΙΑΜΑΝΤΟΠΟΥΛΟΥ Υπουργός Παιδείας «Εχουμε 180.000 μονίμους, παίρνουμε κάθε χρόνο άλλους 30.000 εκτάκτους και πάλι έχουμε παντού κενά». Κάποιοι κάθονται;

ΔΗΜΗΤΡΗΣ ΑΒΡΑΜΟΠΟΥΛΟΣ Βουλευτής της ΝΔ «Εχετε καμία αμφιβολία ότι η παλιά Νέα Δημοκρατία ανθίσταται;».

Ποιοι την αποτελούν;

ΓΕΡΑΣΙΜΟΣ ΓΙΑΚΟΥΜΑΤΟΣ Βουλευτής της ΝΔ «Οι λαθρεπιβάτες και αυτοί που πλήγωσαν και μάτωσαν τη ΝΔ έπρεπε να πάνε σπίτι τους». Γιατί δεν τους πετάτε στη θάλασσα;


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΣΦΗΝΕΣ

Ο Γιώργος, ο Αντώνης και ο Κώστας γενιά στελεχών, πολύ ωραία. Τότε να πετάξει την Ντόρα στο καλάθι των αχρήστων και να κρατήσει τον Μαρκόπουλο», σημείωσε. Μάλιστα υποστήριξε ότι αν ήταν στη θέση του το βράδυ των εκλογών θα πρότεινε στην κ. Μπακογιάννη τη θέση της αντιπροέδρου. Το καινούργιο το είπε για τον Κώστα Καραμανλή. «Δε νομίζω ότι έχει τελειώσει, ούτε νομίζω ότι έχει βάλει ταφόπλακα στα όνειρά του. Πιστεύει ότι του ανήκει μια δεύτερη ευκαιρία. Εξάλλου είναι πολύ νέο παιδί ακόμη», σημείωσε. Να χάρηκε άραγε ο πρώην πρωθυπουργός; Ν.Ο.

μποξέρ

Μπορεί χτες να μην πραγματοποιήθηκε η συνάντηση του Γιώργου Καρατζαφέρη με τον Μιλτιάδη Εβερτ, λόγω αδιαθεσίας του τελευταίου, αλλά δεν έλειψαν οι ειδήσεις. Ιδιαίτερα προς τη μεριά της ΝΔ, που είχε χτες την τιμητική της. Για τον Αντώνη Σαμαρά είπε ότι όσο ο πρόεδρος της ΝΔ θα επιμένει ότι δεν επιθυμεί συνεργασία ΝΔ - ΛΑΟΣ, αυτός θα επιμένει περισσότερο. «Είμαι πιο επίμονος από το Σαμαρά, οπότε θέλει δε θέλει θα τον τραβήξω στη λογική μου», σημείωσε, ενώ επανέλαβε τα περί φοβικών συνδρόμων του προέδρου της ΝΔ. «Αν θέλει μια νέα

7

επωνύμως Αστραπή Τετράωρη επίσκεψη - αστραπή στη Χαλκιδική θα πραγματοποιήσει αύριο ο Αντώνης Σαμαράς. Ο πρόεδρος της ΝΔ θα προσγειωθεί στη Θεσσαλονίκη στις 4 μ.μ. και θα αποχωρήσει την ίδια ημέρα λίγο πριν από τις 8 μ.μ. Στο ενδιάμεσο θα πεταχθεί μέχρι τον Πολύγυρο, για να μιλήσει σε εκδήλωση της Ενωσης Επιμελητηρίων Ελλάδας, όπου και αναμένεται να αναφερθεί αναλυτικά στα ζητήματα της οικονομίας. Ολα αυτά με φόντο τις εκλογές σε πολλά επιμελητήρια, που έρχονται το επόμενο διάστημα. Ν.Ο.

Κιλκίς Λίγο μεγαλύτερη σε διάρκεια αλλά εξίσου πιεσμένη χρονικά θα είναι η σημερινή περιοδεία του Αλέξη Τσίπρα στο Κιλκίς. Ο πρόεδρος του ΣΥΝ θα φτάσει στη Θεσσαλονίκη το πρωί και στη συνέχεια θα κατευθυνθεί οδικά προς το Κιλκίς, όπου θα επισκεφτεί το νοσοκομείο και το Εργατοϋπαλληλικό Κέντρο της πόλης, ενώ το απόγευμα θα μιλήσει σε εκδήλωση - συζήτηση για τη διοικητική μεταρρύθμιση, που θα γίνει στο προσυνεδριακό κέντρο του Κιλκίς. Το βράδυ επιστρέφει στην Αθήνα. Ν.Ο.

Πρόσωπο Ενα πρόσωπο των ημερών θα βρεθεί τις επόμενες ημέρες στη Θεσσαλονίκη. Ο λόγος για τον ελληνικής καταγωγής ευρωβουλευτή των Ελεύθερων Δημοκρατών της Γερμανίας Γιώργο Χατζημαρκάκη, που στο παρελθόν έχει δημιουργήσει ουκ ολίγες συζητήσεις με τις τοποθετήσεις του και ο οποίος θα είναι ένας εκ των βασικών ομιλητών σε εκδήλωση που συνδιοργανώνουν τη Δευτέρα 26 Απριλίου ο Σύνδεσμος Εξαγωγέων Βόρειας Ελλάδας και το Ελληνογερμανικό Εμπορικό και Βιομηχανικό Επιμελητήριο. Ν.Ο.

ΟΝΝΕ∆

Τη μέθοδο του καρότου και του μαστίγιου χρησιμοποίησε χτες ο Αλέκος Αλαβάνος (σκίτσο) για την κυβέρνηση. «Η κυβέρνηση δεν έχει τη δημοκρατική νομιμοποίηση να πάρει αυτά τα μέτρα, δεδομένου ότι τίποτα από αυτά δεν είχε πει πριν από τις εκλογές. Οι εκλογές δεν είναι καλλιστεία, δε βγάζουν τον ωραίο για να τον στείλουμε στο Μαξίμου ή στα υπουργεία Ανάπτυξης και Τουρισμού», σημείωσε, ενώ εκτίμησε ότι ο δρόμος που έχει επιλέξει ο Γιώργος Παπανδρέου θα τον οδηγήσει να φύγει από το Μέγαρο Μαξίμου με ελικόπτερο. Πάντως τάχθηκε υπέρ της προσέγγισης με το ΠΑΣΟΚ, λέγοντας πως δεν έχει βρει στο χώρο του ΠΑΣΟΚ κάποιον στο ρόλο του Λαφοντέν. «Βλέπω μόνο κόσμο του ΠΑΣΟΚ που θέλει να ακούσει το λόγο της Αριστεράς», δήλωσε χαρακτηριστικά.

MANTEIO

Το ελικόπτερο και ο Λαφοντέν

Κορυφώνεται η μάχη στην ΟΝΝΕΔ, με τη Θεσσαλονίκη να δίνει αυτές τις ημέρες τον τόνο. Η προχτεσινή συγκέντρωση του Κώστα Χατζή κύλησε χωρίς απρόοπτα, αλλά και χωρίς πολιτικές παρουσίες, ενώ η χτεσινή «εντός έδρας» εκδήλωση του Ανδρέα Παπαμιμίκου έδειξε και το μέγεθος του σαφούς προβαδίσματος που διαθέτει στην πόλη του. Η πανελλαδική μάχη πάντως είναι σκληρή και θα δοθεί μέχρι το τέλος... Ν.Ο.

Γιατί κατήργησαν τη βάση του «10»; -Για να μη μείνει μετεξεταστέος κανένας υπουργός!

Συλλογικότητα Αφού βουλώσαµε τις τρύπες στο δηµόσιο χρέος (τα χρωστούµενα, µε δανεικά), ας πάµε παρακάτω. Ανωθεν οι εντολές: «βάλτε πλάτη», «ο λαός θα κάνει αυτό που πρέπει…». Κάτω στη βάση «οι γνώµες διίστανται». Οι µεν µε αισθήµατα ενοχής «καιρός να συµµαζευτούµε, το είχαµε παρακάνει…». Οι δε, αγανακτισµένοι, «εγώ δεν έκλεβα, να πιάσουν τους κλέφτες, όχι να τιµωρούν εµένα…». Σωστά και λάθη, ανάκατα! Εχουµε τους χαµηλότερους µισθούς στις χώρες του ευρώ, τη χειρότερη εκπαίδευση, τις χειρότερες συγκοινωνίες και είµαστε κακοµαθηµένοι, προνοµιούχοι! Στην άλλη πλευρά, η αγανάκτηση δίκαιη, αλλά καθυστερηµένη (τα λεφτά δε γυρνάνε πίσω). Η κραυγή έπρεπε να ακουστεί από την αρχή, από τον πρώτο κλέφτη. Αν συνεχίσουµε την ίδια ανεκτιΤΟΥ ΓΙΩΡΓΟΥ ΜΕΤΑΞΑ* κότητα, στα ίδια χάλια θα ξαναπέσουµε. Οσον αφορά το σήµερα. Ο πολίτης, σε απλά ελληνικά, πρέπει να πειστεί να κάνει νέες θυσίες. Η συντριπτική όµως πλειοψηφία δεν έκλεψε, δεν µιζάρισε, δεν τα πιάνει µαύρα. Καλείται να κάνει θυσίες προς χάριν των λίγων που το γλέντησαν. Πώς θα πειστεί ο πολίτης; Ενα πολιτικό ερώτηµα. Μια απάντηση είναι: Αναγκαστικά! Σου κόβω τα λεφτά από µισθούς και συντάξεις και ας διαµαρτύρεσαι! Είναι φανερό πόσο πρόσκαιρες είναι αυτές οι λύσεις, και µόνο από καθεστώτα που δε στήνουν κάλπες. Χρειάζεται ο πολίτης να πειστεί, να ξεπεράσει το ζόρι του, να χάνει λεφτά, να ξεπεράσει την πίκρα του ότι πληρώνει για κάποιους που τον έκλεψαν. Να ξεπεράσει το «εγώ» του για κάποιο «εµείς». Εδώ είναι το κενό. Στο πολιτικό µας σύστηµα, εδώ και δεκαπέντε χρόνια, ισχύουσα κοινωνική φιλοσοφία είναι ο εκσυγχρονισµός. Στους στόχους του ήταν να διαλύσει τις λογής συλλογικότητες. Χλεύασε την πίστη στο έθνος, στη θρησκεία, στο κόµµα, στο συνδικάτο. Η επίσηµη προπαγάνδα πλασάρισε το παραµύθι του νεοφιλελευθερισµού. «Το άτοµο γίνεται δηµιουργικό, επιδιώκοντας το προσωπικό του συµφέρον. Η αγορά αυτορρυθµίζεται αρµονικά, φέρνοντας ευηµερία σε όλους». Τα αποτελέσµατα τα βλέπουµε. Για να τελειώνουµε. Κανένα πρόγραµµα καµιάς σταθερότητας δεν µπορεί να περπατήσει σε εκσυγχρονιστικό περιβάλλον. Η πολιτική δεν µπορεί να κρατά εκσυγχρονιστικά πιστεύω και να ζητά συλλογικές θυσίες. Στη νέα εποχή θα µπει µε νέα ρούχα, µε νέα ιδεολογία. Ζητούµενο η νέα συλλογικότητα. Ζήτηµα ύπαρξης. *Ο ΓΙΩΡΓΟΣ ΜΕΤΑΞΑΣ είναι πολιτικός µηχανικός


8

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Γ. Παπανδρέου: Ελάτε µαζί Πρόσκληση του πρωθυπουργού προς Ν∆ και ΣΥΡΙΖΑ για να βοηθήσουν τη χώρα ΤΟΥ ΓΙΩΡΓΟΥ ΧΑΤΖΗ∆ΗΜΗΤΡΙΟΥ

Με την πρόσκληση «ελάτε να αλλάξουμε όλοι μαζί εποχή. Αυτό που ζήσαμε για χρόνια δεν πάει άλλο» προς όλες τις κοινοβουλευτικές δυνάμεις, ο πρωθυπουργός Γ. Παπανδρέου υπέδειξε χτες από τη Βουλή, όπου ψηφίστηκε επί της αρχής του από την κυβερνητική πλειοψηφία το φορολογικό νομοσχέδιο, το κρίσιμο πρόταγμα που εν μέσω της οξύτατης κρίσης του χρέους οφείλει να θέσει το πολιτικό σύστημα προκειμένου να ανακτήσει την κλονισμένη εμπιστοσύνη των πολιτών.

«Ναι» Μπουτάρη στο διάλογο µε Αράπογλου

Μ

άλιστα, µε ισχυρές δόσεις αυτοκριτικής παρότρυνε: «Ελάτε να αποδείξουµε όλοι µαζί ότι το πολιτικό σύστηµα µπορεί να διορθώσει τα λάθη που έκανε στο παρελθόν και να γεµίσει τους Ελληνες και τις Ελληνίδες µε πίστη, υπερηφάνεια και σιγουριά ότι αν δουλέψουµε όλοι µαζί µπορούµε να ζήσουµε σε µια πολύ καλύτερη χώρα. Ελάτε να αφήσουµε πίσω µας την Ελλάδα της υπανάπτυξης, της διαφθοράς, των εξαιρέσεων και των αθέµιτων προνοµίων».

∆ιακριτοί ρόλοι Την ίδια στιγµή, έδωσε απάντηση σε όσους επίµονα διακινούν το σενάριο της κυβέρνησης εθνικής σωτηρίας δείχνοντας ευκρινώς ότι προτιµά τους διακριτούς πολιτικούς ρόλους, στο πλαίσιο όµως ενός νέου προτύπου διαχείρισης του κράτους, στη θέση του παλαιού που κατέρρευσε οδηγώντας τη χώρα σε πολύπλευρη χρεοκοπία. Εκπροσωπώντας, όπως σχολίαζαν έµπειροι κοινοβουλευτικοί, συνολικά το πολιτικό σύστηµα ο κ. Παπανδρέου επισήµανε εµφατικά ότι «δικαίως πολλοί συµπολίτες µας είχαν χάσει την εµπιστοσύνη τους σε όλο το πολιτικό σύστηµα, όταν έβλεπαν ότι στη χώρα επί δεκαετίες τα δικαιώµατά τους δεν ήταν αποτέλεσµα της βούλησης του νοµοθέτη που τους εκπροσωπεί σε αυτήν την αίθουσα αλλά αποτέλεσµα συναλλαγής. Και όσο πιο στενές σχέσεις και εξαρτήσεις είχε κάθε συντεχνία και συµφέρον µε τις κυβερνήσεις τόσο πιο πολλά ήταν και τα προνόµια, τόσο πιο πολλές και οι εξαιρέσεις».

Προσκλήσεις Δεν παρέλειψε, µάλιστα, ο κ. Παπανδρέου να εξατοµικεύσει τις προσκλήσεις. Απευθυνόµενος προς το ΣΥΡΙΖΑ παραδέχτηκε ότι η κυβέρνηση υποχρεωµένη από τα γεγονότα ακολουθεί σήµερα «θατσερικού τύπου πολιτική» καλώντας τον να βοηθήσει ώστε να βγει η χώρα απ΄ αυτήν την εξάρτηση. Και την ίδια στιγµή στρεφόµενος στα έδρανα της ΝΔ ζήτησε από τον κ. Σαµαρά «να βοηθήσει τη χώρα από τη θέση της αξιωµατικής αντιπολίτευσης».

Ισχυρή δόση αυτοκριτικής περιείχε η χτεσινή ομιλία του πρωθυπουργού

Υψηλοί τόνοι από την αντιπολίτευση Απαντώντας στην πρόσκληση ο Α. Σαμαράς κινήθηκε σε υψηλούς τόνους και ταυτόχρονα, ενισχύοντας το μέτωπο για την αυτοτέλεια του πολιτικού συστήματος, φρόντισε να υπογραμμίσει τις διαφορές που έχει το κόμμα του στο ζήτημα της φορολογίας από το ΠΑΣΟΚ και τη γραμμή που θα κινηθεί ως κυβέρνηση. Χωρίς πάντως να μπει σε λεπτομέρειες, επέκρινε τον πρωθυπουργό ότι έχει υποκαταστήσει την οικονομική λογική με τη στείρα λογιστική, επισείοντας για μία ακόμη φορά τον κίνδυνο να διολισθήσουμε στο φαύλο κύκλο της ύφεσης και των ελλειμμάτων.

Ο Γ. Καρατζαφέρης Ο Γ. Καρατζαφέρης, αν και ανέβασε τους τόνους της κριτικής του στην κυβέρνηση προβλέποντας ότι η Ελλάδα «από το κώμα θα μετατραπεί σε πτώμα», επιτέθηκε για μία ακόμη φορά στην Αριστερά λέγοντας: «Θα μπορούσαμε και εμείς να προτρέψουμε τον κόσμο να βγει στους δρόμους. Ομως αυτό είναι η εύκολη λύση. Εμείς δε θέλουμε πέτρες στις τζαμαρίες. Θα

συνεχίσουμε να δείχνουμε φιλική διάθεση προκειμένου να συμβάλουμε στην εθνική υπόθεση της οικονομικής ανάπτυξης».

Ο Αλ. Τσίπρας Είχε προηγηθεί αιχμηρή υπόμνηση του προέδρου του ΣΥΡΙΖΑ, Αλ. Τσίπρα, ότι ο πρωθυπουργός μολονότι είχε ζητήσει από τον πολιτικό του χώρο να συμβάλει με προτάσεις δεν άκουσε καμία απ’ αυτές, ενώ προτίμησε να ακούσει τις προτάσεις της Ακροδεξιάς που προέτρεπε την κυβέρνηση να λοξοκοιτάξει προς την άλλη πλευρά του Ατλαντικού και του ΔΝΤ παραμερίζοντας την ευρωπαϊκή λύση.

Το ΚΚΕ Επαναλαμβάνοντας τη θέση της γ.γ. του ΚΚΕ, Αλ. Παπαρήγα, που μίλησε την προηγούμενη μέρα, ο Νικ. Καραθανασόπουλος τόνισε: «Θα πρέπει κάποια στιγμή να σταματήσουν οι πανηγυρισμοί που έχει στήσει η πλουτοκρατία στην Ελλάδα και αποκαλύπτει τη βεβαιότητα των κεφαλαιοκρατών ότι θα τηρήσει τις δεσμεύσεις της».

«Ναι» στην πρόταση της Χρύσας Αράπογλου για συζήτηση και συνεννόηση σε ό,τι αφορά στη Θεσσαλονίκη, αλλά με το δικό της τρόπο, είπε η παράταξη του Γιάννη Μπουτάρη. Αφού προηγήθηκε συζήτηση στο συντονιστικό της όργανο παρουσία και εκπροσώπων των Οικολόγων Πράσινων, χτες εστάλη στην επικεφαλής της μείζονος αντιπολίτευσης στο δημοτικό συμβούλιο μία επιστολή, όπου η κίνησή της γίνεται μεν αποδεκτή, αλλά δεν της αναγνωρίζεται η «πατρότητα» της πρωτοβουλίας για την έναρξη ενός διαλόγου μεταξύ των αντιπολιτευόμενων παρατάξεων! «Είναι ουσιαστικά το πρώτο βήμα στην πρόσκληση που η παράταξή μας έχει επανειλημμένα απευθύνει στις δημοτικές κινήσεις της αντιπολίτευσης για μια συνάντηση, που μπορεί να μας οδηγήσει σ’ ένα κοινό μέτωπο για την ανατροπή της κατεστημένης κατάστασης στο δήμο Θεσσαλονίκης», σημειώνεται χαρακτηριστικά στην επιστολή, που υπογράφουν οι Γ. Μπουτάρης, Π. Αβραμόπουλος και Α. Κουράκης. Ανακοινώνεται, επίσης, στην κ. Αράπογλου ότι τις επόμενες μέρες θα της κατατεθούν τα πρώτα σχόλια επί του προγραμματικού πλαισίου θέσεων για την πόλη που έχει υποβάλει ως βάση συζήτησης. Της προτείνεται δε η πρώτη διά ζώσης συνάντηση να γίνει μεταξύ 20 και 30 Απριλίου.

Θετική διάθεση Πληροφορίες αναφέρουν ότι στο στρατόπεδο της κ. Αράπογλου έμφαση δόθηκε στην ουσία της απαντητικής επιστολής, που αποδεικνύει τη διάθεση των συντακτών της να καθίσουν σε κοινό τραπέζι διαλόγου και ως εκ τούτου κρίνεται σε γενικές γραμμές ως θετική. Εξελίξεις θα πρέπει να αναμένονται πάντως προς τα τέλη της επόμενης εβδομάδας, καθώς η κ. Αράπογλου βρίσκεται από σήμερα με αποστολή της Βουλής στις ΗΠΑ. Στο μεταξύ, οι Οικολόγοι Πράσινοι που δεν εξέφρασαν, όπως λένε εκπρόσωποί τους, συγκεκριμένη θέση στη συνεδρίαση της παράταξης Μπουτάρη, για την έναρξη διαλόγου με τη δημοτική ομάδα της κ. Αράπογλου, δεν αποκλείεται να εκδώσουν χωριστή ανακοίνωση που θα διαφοροποιείται από την επιστολή που ήδη εστάλη. Α. Σ.


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

9

ΡΕΠΟΡΤΑ Ζ

Τα διλήµµατα του Καρατζαφέρη

Απόσυρση «Καλλικράτη» ζητά ο Π. Ψωµιάδης

Προβληµατισµός για την εκλογική στρατηγική του ΛΑΟΣ στο δήµο Θεσσαλονίκης

Την αντίθεσή του στην πρόταση για το θεσμικό πλαίσιο του «Καλλικράτη» εξέφρασε χτες και με επίσημο τρόπο ο Παναγιώτης Ψωμιάδης. Με επιστολή του στον πρωθυπουργό, Γιώργο Παπανδρέου, ζητά την απόσυρση του νομοσχεδίου για τη διοικητική μεταρρύθμιση της χώρας και την ψήφιση ενός νόμου - πλαισίου που θα εφαρμοστεί σε τέσσερα χρόνια, ώστε στο μεταξύ να υλοποιηθεί με τις απαραίτητες διορθώσεις και προσαρμογές. Δηλώνει ότι σε διαφορετική περίπτωση «μπορεί να παραμείνει η νομαρχιακή αυτοδιοίκηση στη μορφή που έχει σήμερα, ενισχυμένη σε αρμοδιότητες, κονδύλια και προσωπικό», μια φράση που μπορεί να ερμηνευτεί και ως δική του επιθυμία να παραμείνει στη νομαρχιακή αυτοδιοίκηση, αν τελικά οι αλλαγές που ζητά για την περιφερειακή αυτοδιοίκηση δεν υλοποιηθούν. Με αφορμή την αποστολή του μη οριστικοποιημένου προσχεδίου για τον «Καλλικράτη» στην ΚΕΔΚΕ και την ΕΝΑΕ, ο κ. Ψωμιάδης κάνει λόγο για ένα νομοσχέδιο με προχειρότητα και ασάφειες στις αρμοδιότητες, το οποίο δεν κάνει καμία αναφορά στο χωροταξικό χάρτη ούτε προβλέπει τους αναγκαίους πόρους. «Δεν είναι δυνατόν οι αντιπεριφερειάρχες να εκλέγονται άμεσα, όπως ο αιρετός περιφερειάρχης. Φανταστείτε οι υπουργοί μιας κυβέρνησης να εκλέγονταν άμεσα στις βουλευτικές εκλογές και έναν αποτυχημένο υπουργό να μην μπορεί να τον μετακινήσει ο πρωθυπουργός!», σημειώνει στην επιστολή του ο κ. Ψωμιάδης. Ταυτόχρονα, σε δήλωση - απάντηση προς τον υφυπουργό Εσωτερικών, Γιώργο Ντόλιο, υποστηρίζει ότι το συγκεκριμένο νομοσχέδιο είναι φωτογραφικό και στοχεύει στον ίδιο προσωπικά. «Ορισμένοι δεν έχουν καταλάβει ότι η δική μου υποψηφιότητα είναι υπερκομματική», τονίζει ο νομάρχης Θεσσαλονίκης. Ν. Ο.

κού και Βιοµηχανικού Επιµελητηρίου Θεσσαλονίκης, Δηµήτρης Μπακατσέλος, ένα όνοµα, που, όπως είπε, θα ήταν µια καλή επιλογή.

ΤΟΥ ΝΙΚΟΥ ΟΙΚΟΝΟΜΟΥ

Οποιος παρακολούθησε την πρόσφατη συνέντευξη Τύπου που έδωσε στη Θεσσαλονίκη ο Γιώργος Καρατζαφέρης δεν ήταν δύσκολο να αντιληφθεί ότι ο πρόεδρος του ΛΑΟΣ βρίσκεται μπροστά σε διλήμματα για τη στάση που θα κρατήσει στις αυτοδιοικητικές εκλογές της Θεσσαλονίκης.

Γ

ιατί µπορεί µεν να έχει από νωρίς ξεκαθαρίσει ότι θα στηρίξει τον Παναγιώτη Ψωµιάδη για την Περιφέρεια της Κεντρικής Μακεδονίας, όµως η στάση του στις εκλογές του κεντρικού δήµου µόνο δεδοµένη δεν πρέπει να θεωρείται. Κι αυτό για δύο κυρίως λόγους. Ο πρώτος έχει να κάνει µε την καλή µαγιά που έχει δηµιουργήσει ο ΛΑΟΣ στην Α’ Θεσσαλονίκης και ειδικότερα στον κεντρικό δήµο. Εδώ, ο ΛΑΟΣ πέτυχε τόσο το 2007 όσο και το 2009 τα καλύτε-

Οι δύο βουλευτές

Aγ. Κολοκοτρώνης και Κυριάκος Βελόπουλος δεν αποκλείουν το ενδεχόμενο να είναι υποψήφιοι για το δήμο Θεσσαλονίκης

ρα ποσοστά του πανελλαδικά, συγκεντρώνοντας 6,22% και 8,26% αντίστοιχα, ενώ στις ευρωεκλογές του 2009 το ποσοστό πλησίασε το 10% (9,3%). Ολα αυτά, βέβαια, είχαν ως βάση εκκίνησης την υποψηφιότητα του Γιώργου Καρατζαφέρη στις δηµοτικές εκλογές του 2006, όταν ο συνδυασµός του είχε πετύχει ποσοστό 7,5%, βάζοντας τα θεµέλια για τα καλά εκλογικά αποτελέσµατα των εθνικών

εκλογών που ακολούθησαν. Ο πρόεδρος του ΛΑΟΣ δε θα είναι εκ νέου υποψήφιος δήµαρχος, αναζητεί όµως το διάδοχό του. Οπως έλεγε και στο περιθώριο της συνέντευξης Τύπου στη Θεσσαλονίκη, υπάρχουν πρόσωπα πέρα από τις πολιτικές υποψηφιότητες που µπορεί να κάνουν την έκπληξη. Ενα από αυτά -όπως αποκάλυψε χτες µιλώντας στο Κανάλι 1 του Πειραιά- είναι και ο πρόεδρος του Εµπορι-

Ταυτόχρονα «τρέχουν» και άλλα σενάρια, που αφορούν στους δύο βουλευτές του κόµµατος στην Α΄ και Β΄ Θεσσαλονίκης, Αγγελο Κολοκοτρώνη και Κυριάκο Βελόπουλο. Ο πρώτος υπό κάποιες προϋποθέσεις θα το σκεφτόταν, ο δεύτερος δηλώνει κατ’ ιδίαν ότι αν υποστηριζόταν και από τη ΝΔ θα κατέβαινε στη µάχη της αυτοδιοίκησης στον κεντρικό δήµο. Οπως εκτιµάται, το σενάριο της πολιτικής υποψηφιότητας δεν είναι αυτό που έχει αυτήν τη στιγµή το προβάδισµα στο µυαλό του κ. Καρατζαφέρη, αλλά κανείς δεν µπορεί να είναι βέβαιος για το πώς θα οριστικοποιηθεί το τοπίο των υποψηφιοτήτων. Λύση στο... γόρδιο δεσµό θα µπορούσε να αποτελέσει η µεταγραφή του Παναγιώτη Ψωµιάδη στον κεντρικό δήµο, ένα σενάριο πάντως που σήµερα δεν εµφανίζεται ως το πιο πιθανό.


10

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

φορίες προκύπτει ότι στην περίπτωση αυτήν τη σακούλα µε τον εµπρηστικό µηχανισµό εντόπισε πολίτης, ο οποίος και έσβησε το αναµµένο κεράκι, αποτρέποντας την έκρηξη. Αξιωµατικοί επισηµαίνουν ότι οι µηχανισµοί ήταν του ίδιου τύπου, αποτελούνταν δηλαδή από γκαζάκια, εύφλεκτο υγρό και κεράκια γενεθλίων και τοποθετήθηκαν σχεδόν ταυτόχρονα τουλάχιστον από δύο οµάδες νεαρών. Στελέχη της ΕΛΑΣ τονίζουν ότι πρόκειται για αυτοσχέδιους µηχανισµούς παρόµοιους µε αυτούς που τοποθετούνται κατά καιρούς στη Θεσσαλονίκη από οµάδες αναρχικών και οι οποίοι συνήθως είναι µικρής ισχύος και δεν προκαλούν σηµαντικές ζηµιές. Μάλιστα, λίγη ώρα αργότερα, στην αρχή της οδού Τσιµισκή πολίτες εντόπισαν µία µικρή βαλίτσα στη µέση του οδοστρώµατος, µε συνέπεια να σηµάνει και πάλι συναγερµός στην Αντιτροµοκρατική. Αστυνοµικοί απέκλεισαν το χώρο, ωστόσο τελικά αποδείχτηκε ότι η βαλίτσα περιείχε µία... συσκευή µασάζ και προφανώς είχε πέσει από κάποιον περαστικό.

ΡΕΠΟΡΤΑΖ ΚΑΤΕΡΙΝΑ ΑΓΟΡΑΣΤΟΥ

Επίδειξη ισχύος από ομάδες αναρχικών χαρακτηρίζεται από αστυνομικούς η χτεσινή τετραπλή επίθεση με αυτοσχέδιους εμπρηστικούς μηχανισμούς στην καρδιά της Θεσσαλονίκης με στόχους πρόσωπα κυρίως από τον πολιτικό χώρο. Οι επιθέσεις πραγματοποιήθηκαν σε διάστημα μόλις δεκαπέντε λεπτών, μέρα μεσημέρι και μάλιστα σε πολυσύχναστες περιοχές, ενώ αστυνομικοί τονίζουν ότι ίσως οι νεαροί δράστες ήθελαν να αποδείξουν πως ούτε τα νέα μέτρα της ΕΛΑΣ, όπως π.χ. οι ομάδες ΔΙΑΣ που περιπολούν σε όλη την πόλη, είναι ικανά να σταματήσουν τη δράση τους.

Σ

την Αντιτροµοκρατική Υπηρεσία, που ανέλαβε την υπόθεση, σήµανε συναγερµός, ενώ οι µηχανισµοί, καθώς και τα υπολείµµατά τους που περισυνελέγησαν στάλθηκαν αµέσως για ανάλυση. Συγκεκριµένα, αυτοσχέδιοι εµπρηστικοί µηχανισµοί εξερράγησαν στα γραφεία των εκδόσεων «Κάδµος», συµφερόντων του βουλευτή Κυριάκου Βελόπουλου και στα γραφεία των Οικολόγων Πράσινων, ενώ παρόµοιοι µηχανισµοί εντοπίστηκαν και περισυνελέγησαν πριν εκραγούν έξω από το γραφείο της βουλευτίνας Ελενας Ράπτη, καθώς και σε οικοδοµή όπου παλαιότερα στεγάζονταν οι επιχειρήσεις του µπασκετµπολίστα Νίκου Γκάλη. Μάλιστα, αξιωµατικοί δεν αποκλείουν το ενδεχόµενο οι επιθέσεις να πραγµατοποιήθηκαν ως ένδειξη συµπαράστασης στους συλληφθέντες για την υπόθεση τροµοκρατίας στην Αθήνα, κάτι που αναµένεται να ξεκαθαριστεί µόλις γίνει ανάληψη ευθύνης.

Σχεδόν ταυτόχρονα Οπως έγινε γνωστό, µηχανισµός αποτελούµενος από δύο γκαζάκια και εύφλεκτο υγρό εξερράγη χτες το µεσηµέρι έξω από τα γραφεία των Οικολόγων Πράσινων που στεγάζονται στον πρώτο όροφο οικοδοµής στην οδό Πλάτωνος. Σχεδόν ταυτόχρονα ένας ακόµη µηχανισµός µε ένα γκαζάκι εξερράγη έξω από τα γραφεία των εκδόσεων «Κάδµος» στην οδό Ερµού, µε συνέπεια να προκληθεί φωτιά. Και στις δύο περιπτώσεις στους χώρους βρίσκονταν υπάλληλοι, οι οποίοι, ωστόσο, αποµακρύνθηκαν χωρίς πρόβληµα, ενώ από τις εκρήξεις σηµειώθηκαν υλικές ζηµίες κυρίως στις πόρτες. Επίσης, µηχανισµός µε ένα γκαζάκι και εύφλεκτο υγρό τοποθετήθηκε και έξω από το γραφείο της βουλευτίνας Ελενας Ράπτη στην οδό Εγνατία, ωστόσο εντοπίστηκε από περιοίκους πριν εκραγεί και περισυνελέγη από αστυνοµικούς. Ενας ακόµη µηχανισµός, αυτός αποτελούµενος από τέσσερα γκαζάκια, εντοπίστηκε όµως και στην οικοδοµή όπου παλαιότερα στεγάζονταν οι επιχειρήσεις του Νίκου Γκάλη στην οδό Παπαναστασίου. Από πληρο-

Αυτοσχέδιος μηχανισμός εξερράγη έξω από τα γραφεία των Οικολόγων Πράσινων στη Θεσσαλονίκη

Τετραπλό «χτύπηµα» µε γκαζάκια στη Θεσσαλονίκη Η ΕΛΑΣ «βλέπει» πίσω από τα χτυπήµατα επίδειξη ισχύος από οµάδες αντιεξουσιαστών

Παρόµοιες επιθέσεις Την περασµένη χρονιά είχαν πραγµατοποιηθεί στη Θεσσαλονίκη άλλα δύο µπαράζ επιθέσεων σε γραφεία πολιτικών προσώπων. Συγκεκριµένα, το Μάρτιο του 2009 είχαν «χτυπηθεί» µέσα σε ελάχιστη ώρα µε γκαζάκια τα γραφεία των Στάθη Κουτµερίδη, του Στέλιου Παπαθεµελή, του Κωνσταντίνου Γκιουλέκα, του Δηµήτρη Γαλαµάτη, του Γιώργου Ορφανού και του Γιάννη Ιωαννίδη σε κεντρικά σηµεία της Θεσσαλονίκης. Τότε η ανάληψη ευθύνης είχε γίνει από την οµάδα «Συµβούλιο αποδόµησης της τάξης», τα µέλη της οποίας ανέφεραν ότι προέβησαν στη συγκεκριµένη πράξη ως ένδειξη συµπαράστασης στον Πολύκαρπο Γεωργιάδη, που έχει συλληφθεί για την απαγωγή Μυλωνά. Η ίδια οµάδα είχε αναλάβει και άλλο ένα µπαράζ επιθέσεων τον Οκτώβριο του 2009 µε την τοποθέτηση εµπρηστικών µηχανισµών στα γραφεία του υπουργού Δικαιοσύνης, Διαφάνειας και Ανθρωπίνων Δικαιωµάτων, Χάρη Καστανίδη, του υφυπουργού Προστασίας του Πολίτη Σπύρου Βούγια και της βουλευτίνας του ΠΑΣΟΚ Χρύσας Αράπογλου. Μάλιστα, η ίδια οµάδα είχε αναλάβει και τοποθέτηση δύο εµπρηστικών µηχανισµών στην οικία του µητροπολίτη Θεσσαλονίκης, Ανθιµου.

Οικολόγοι Πράσινοι

Γκαζάκια εξερράγησαν και στην είσοδο των γραφείων των εκδόσεων «Κάδμος», συμφερόντων του Κυριάκου Βελόπουλου

Με ανακοίνωσή τους οι Οικολόγοι Πράσινοι κάνουν λόγο για τυφλή βία, που απειλεί ανθρώπινες ζωές: «Οποιες κι αν ήταν οι προθέσεις και τα κίνητρα, η βία µιλάει πάντα τη γλώσσα της εξουσίας», ενώ ο υφυπουργός Προστασίας του Πολίτη Σπύρος Βούγιας τονίζει ότι «τέτοιες ενέργειες είναι αδιέξοδες, παράλογες και καταδικαστέες. Η κυβέρνηση µε συνέπεια και συγκεκριµένα αποτελέσµατα προασπίζεται την ασφάλεια όλων των Ελλήνων πολιτών».


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Ούτε καν απολογήθηκαν Τρεις προφυλακίστηκαν για τον «Επαναστατικό Αγώνα» • Τέσσερις νέες συλλήψεις ΡΕΠΟΡΤΑΖ ΣΟΦΙΑ ΦΑΣΟΥΛΑΚΗ, ∆ΗΜΗΤΡΑ ΧΑΤΖΗΠΑΝΑΓΙΩΤΟΥ

Αστυνομία και δικαστικές αρχές (η πρώτη με το διαβιβαστικό της και οι δεύτερες με το κατηγορητήριο) πιστεύουν ότι ο Νίκος Μαζιώτης και η σύζυγός του Παναγιώτα Ρούπα -μαζί με άγνωστα άτομα στην ανάκριση- έπαιζαν ηγετικό ρόλο στον «Επαναστατικό Αγώνα».

Ω

στόσο, τόσο ο 39χρονος κατηγορούµενος όσο και η σύζυγός του αρνήθηκαν να δώσουν οποιαδήποτε εξήγηση στην ανακρίτρια για όσα τους βαρύνουν. Ο Νίκος Μαζιώτης δεν έµεινε περισσότερο από 15 λεπτά στο γραφείο της. Αρκέστηκε στο να δηλώσει εχθρός του κράτους και του καπιταλισµού, λέγοντας: «Οι εγκληµατίες είστε εσείς, το κράτος και ο καπιταλισµός, που καταστρέφει τους ανθρώπους». Την ίδια στάση κράτησε και η σύζυγός του, η οποία δήλωσε στην ανακρίτρια ότι δεν αναγνωρίζει τις δικαστικές αρχές. «Δεν αναγνωρίζω τη διαδικασία σας, το κράτος σας και το πολιτικό σας σύστηµα», είπε. Ενώπιον του εισαγγελέα, µάλιστα, η Παναγιώτα Ρούπα δήλωσε ότι δεν επιθυµεί να της φερθούν µε επιείκεια λόγω της εγκυµοσύνης της αλλά να την κρίνουν µε βάση τα πραγµατικά στοιχεία: «Δε θέλω να κριθώ µε βάση το ότι είµαι έγκυος, αλλά µε βάση τα στοιχεία, εάν αυτά υπάρχουν». Αντίθετα µε τους συγκατηγορούµενούς του, ο Σαράντος Νικητόπουλος απολογήθηκε στον ανακριτή υποστηρίζοντας ότι δεν έχει καµία σχέση µε τον «Επαναστατικό Αγώνα». Δικαιολογώντας το πώς βρέθηκε το αποτύπωµά του στο σπίτι του Λάµπρου

11

Σήμερα οδηγούνται στον ανακριτή άλλα τρία άτομα, κάτω από αυστηρά μέτρα ασφαλείας

Φούντα, που είχε σκοτωθεί στη συµπλοκή της Δάφνης, δεν αρνήθηκε ότι τον γνώριζε. Οπως είπε, µε τον 35χρονο βιολόγο είχε µία κοινωνική σχέση και στοχοποιήθηκε µετά από µία οµιλία που έκανε γι’ αυτόν στο Πάντειο Πανεπιστήµιο. «Οι κοινωνικές σχέσεις που είχα µε πολλούς έγιναν κακουργήµατα. Το αποτύπωµά µου που βρέθηκε σε έντυπο υποστήριξης στον Πολύκαρπο Γεωργιάδη (αντιεξουσιαστής) κυκλοφορούσε στα Εξάρχεια, στη Θεσσαλονίκη και σε όλη την Ελλάδα. Ο καθένας θα µπορούσε να το έχει πιάσει», υποστήριξε ο κατηγορούµενος. Η Αντιτροµοκρατική Υπηρεσία έχει επικεντρώ-

σει τις έρευνές της στην ανακάλυψη της γιάφκας µε το οπλοστάσιο του «Επαναστατικού Αγώνα» και οι αστυνοµικοί ερευνούν πόρτα πόρτα, έχοντας στα χέρια τους φωτογραφίες των ατόµων που εµπλέκονται στην υπόθεση.

Ερευνες Από τις συνοµιλίες που έχουν καταγραφεί από τους κοριούς της ΕΥΠ και της Αντιτροµοκρατικής, προκύπτει ότι υπάρχουν δύο ύποπτα σπίτια, τα οποία πιθανότατα χρησιµοποιούσαν ως γιάφκες. Με τη σύµφωνη γνώµη ανακριτή και εισαγγελέα οι τρεις κατηγορούµενοι κρίθηκαν προφυλακιστέοι, ενώ σήµερα οδηγούνται

Κοντά στην εξιχνίαση της δολοφονίας στην Καλαµαριά Σε καλό δρόμο βρίσκονται οι έρευνες της Ασφάλειας Θεσσαλονίκης για την εξιχνίαση της υπόθεσης της δολοφονίας της 24χρονης στην Καλαμαριά, που διαπράχθηκε την περασμένη Δευτέρα. Σύμφωνα με πληροφορίες από αστυνομικές πηγές, μέχρι τις πρώτες πρωινές ώρες ανακρινόταν 30χρονος που ανήκει στο στενό φιλικό περιβάλλον της 24χρονης, ο οποίος φέρεται να εμπλέκεται στη δολοφονία της. Πάντως, σύμφωνα με τις ίδιες πληροφιρίες, οι αστυνομικοί περιμένουν να ταυτιστούν εργαστηριακά τα ευρήματα από τον τόπο του εγκλήματος, κάτι που αναμένεται να γίνει σήμερα, ώστε να «δέσουν» την υπόθεση. Δεν έχει αποκλειστεί το ενδεχόμενο στην υπόθεση να εμπλέκονται και άλλα άτομα που βρέθηκαν στο σπίτι της 24χρονης στην Καλαμαριά την περασμένη Δευτέρα, τα οποία πιθανόν να προέρχονται από το χώρο των τοξικομανών. Υπενθυμίζεται ότι η άτυχη κοπέλα ήταν χρήστρια ναρκωτικών και το τελευταίο διάστημα έκανε προσπάθειες απεξάρτησης.

στον ανακριτή οι άλλοι τρεις συγκατηγορούµενοί τους.

Νέες συλλήψεις Σε νέες συλλήψεις τεσσάρων ατόµων προχώρησε χτες η Αστυνοµία. Οι τέσσερις συλληφθέντες φέρονται να είναι µέλη της τροµοκρατικής οργάνωσης «Συνωµοσία Πυρήνων της Φωτιάς» και σήµερα το πρωί θα οδηγηθούν στον ειδικό εφέτη ανακριτή, για να απολογηθούν. Αστυνοµικές πηγές αναφέρουν ότι τέσσερα άτοµα - τρεις άνδρες και µία γυναίκα, εκ των οποίων οι δύο έχουν συγγενική σχέση µεταξύ τους- συνελήφθησαν το βράδυ της Τρίτης στην Καλλιθέα.

ΣΥΛΛΟΓΟΣ ΤΩΝ ΑΠΑΝΤΑΧΟΥ ΝΕΟΔΗΜΗΤΡΙΩΤΩΝ «ΟΙ ΜΕΤΡΕΣ» ΠΡΟΣΚΛΗΣΗ ΓΙΑ ΓΕΝΙΚΗ ΣΥΝΕΛΕΥΣΗ Ο νεοϊδρυθείς ΣΥΛΛΟΓΟΣ ΤΩΝ ΑΠΑΝΤΑΧΟΥ ΝΕΟΔΗΜΗΤΡΙΩΤΩΝ «ΟΙ ΜΕΤΡΕΣ», καλεί τα μέλη του σε Γενική Συνέλευση στις 22 Απριλίου 2010, ημέρα Πέμπτη και ώρα 15:00, στον υπόγειο χώρο κάτω από το κομμωτήριο «Ξανθή», οδός Μητροπολίτου Ιωσήφ 20. Αμέσως μετά τη συνέλευση θα ακολουθήσουν εκλογές για την ανάδειξη του 1ου Διοικητικού Συμβουλίου του Συλλόγου. Οι κάλπες θα κλείσουν στις 19:00. Η ΠΡΟΣΩΡΙΝΗ ΔΙΟΙΚΟΥΣΑ ΕΠΙΤΡΟΠΗ

Θα επανεξεταστεί το θέµα του ανδριάντα Μέσα στις επόμενες ημέρες ο υπουργός Πολιτισμού και Τουρισμού, Παύλος Γερουλάνος, θα αναπέμψει το θέμα ανέγερσης ανδριάντα του Κωνσταντίνου Καραμανλή στη Θεσσαλονίκη και το Κεντρικό Συμβούλιο Νεωτέρων Μνημείων θα επανεξετάσει το θέμα της τοποθέτησης του αγάλματος στην πλατεία Αριστοτέλους της Θεσσαλονίκης. «Ο Κωνσταντίνος Καραμανλής συνδέεται ιστορικά με τη Θεσσαλονίκη», αναφέρεται σε σχετική ανακοίνωση. «Η προσφορά του στην εξέλιξη και πρόοδο της πόλης αλλά και η συμβολή του στη σύγχρονη ιστορία της χώρας μας είναι αναμφισβήτητη. Η τοποθέτηση του ανδριάντα του ως εκ τούτου αποτελεί μια αυτονόητη κίνηση τιμής και μνήμης. Ο τρόπος και ο χώρος, όμως, που θα επιλεγεί για την τοποθέτηση του ανδριάντα του και την απότιση φόρου τιμής στο σημαντικό πολιτικό πρέπει να συνάδει με την προσωπικότητά του, καθώς και με την αισθητική και την ιστορία του χώρου που θα επιλεγεί». Το ΥΠΠΟΤ σημειώνει επίσης: «Η επιλογή του χώρου της πλατείας Αριστοτέλους -που συνιστά νεότερο μνημείο και επιπλέον δε συνδέεται ιστορικά με τον Κωνσταντίνο Καραμανλή- για την τοποθέτηση ενός αναντίστοιχου με τα ανωτέρω ανδριάντα του, συντελέστηκε με τρόπο που γεννά εύλογα ερωτηματικά. Ειδικότερα, η αρμόδια Υπηρεσία του ΥΠΠΟΤ από την πρώτη στιγμή που ανέκυψε το θέμα προέβαλε σημαντικές ενστάσεις για τη χωροθέτηση του ανδριάντα, οι οποίες αφορούσαν αφενός σε ζητήματα αισθητικής και σε έμμεση βλάβη του μνημείου και αφετέρου στη σκοπιμότητα τοποθέτησής του στο συγκεκριμένο χώρο, καθώς δε συνδέεται με το περιβάλλον και την ιστορία του. Οι αντιρρήσεις της Υπηρεσίας παρακάμφθηκαν στο Τοπικό Συμβούλιο Μνημείων Θεσσαλονίκης το οποίο με οριακή πλειοψηφία (5-4), η οποία σχηματίστηκε με την ψήφο του δημάρχου, αποφάσισε την τοποθέτηση. Την απόφαση αυτή επιβεβαίωσε το Κεντρικό Συμβούλιο Νεωτέρων Μνημείων χωρίς και πάλι να ληφθούν υπόψη οι ενστάσεις της Υπηρεσίας».


ΕΛΛΑΔΑ

12

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

«Στο σφυρί» 100 σπίτια το µήνα! Στη Θεσσαλονίκη κατατέθηκαν 311 αιτήσεις πλειστηριασµού το πρώτο τρίµηνο του 2010 ΡΕΠΟΡΤΑΖ ΒΑΣΙΛΗΣ ΚΥΡΙΑΚΟΥΛΗΣ

Το 2009 οι πλειστηριασμοί ακινήτων στη Θεσσαλονίκη αυξήθηκαν 40% σε σχέση με το 2006!

Σε βαθιά ύφεση παραμένει η κτηματαγορά στη Θεσσαλονίκη, όπως προκύπτει από τα στατιστικά στοιχεία του Πρωτοδικείου Θεσσαλονίκης, ενώ οι πλειστηριασμοί ακινήτων εξακολουθούν να διατηρούνται σε υψηλά επίπεδα...

Μ

ετά την «απογείωση» του 2007, η «φούσκα» έσκασε, µε αποτέλεσµα εκατοντάδες ακίνητα να βγαίνουν «στο σφυρί» κάθε χρόνο, ενώ πάγωσαν οι αγοραπωλησίες. Είναι χαρακτηριστικό ότι το 2009 στο Πρωτοδικείο κατατέθηκαν 1.236 αιτήσεις πλειστηριασµού, αριθµός-ρεκόρ για τη Θεσσαλονίκη, ενώ «βουτιά» σηµείωσε ο αριθµός των συναινετικών προσηµειώσεων αντικατοπτρίζοντας τη µεγάλη µείωση του αγοραστικού ενδιαφέροντος στο χώρο των ακινήτων.

Το 2010 Απογοητευτικά είναι και τα στοιχεία για το πρώτο τρίµηνο του 2010, καθώς η κτηµαταγορά συνεχίζει να βρίσκεται σε τέλµα. Από τις αρχές Ιανουαρίου µέχρι και σήµερα κατατέθηκαν 311 αιτήσεις για πλειστηριασµό ακινήτων, ενώ στα... ρηχά παραµένουν και οι συναινετικές προσηµειώσεις, οι οποίες έφτασαν τις 4.408 για το πρώτο τρίµηνο του έτους. Τα συγκεκριµένα στοιχεία δείχνουν ότι το 2010 θα είναι «φωτογραφία» του 2009, χωρίς ωστόσο να αποκλείεται περαιτέρω επιδείνωση!

Αύξηση 40% Οπως προκύπτει από τα στατιστικά στοιχεία του Πρωτοδικείου Θεσσαλονίκης, οι πλειστηριασµοί ακινήτων το 2009 σηµείωσαν αύξηση περίπου 40% συγκριτικά µε το 2006, ενώ µειώθηκαν κατά 45% οι συναινετικές προσηµειώσεις ακινήτων. Συγκεκριµένα, το 2006 είχαν κατατεθεί συνολικά 889 αιτήσεις πλειστηριασµού, πέρυσι έφτασαν τις 1.236 αιτήσεις, ενώ ο αριθµός ρεκόρ των 28.621 συναινετικών προσηµειώσεων που καταγράφηκε το 2007 πέρυσι έπεσε στις 15.640 προσηµειώσεις. Σύµφωνα µε δικηγόρους και συµβολαιογράφους, κατά µέσο όρο στη Θεσσαλονίκη κάθε µήνα βγαίνουν «στο σφυρί» περίπου 100 ακίνητα, ενώ εκφράζονται φόβοι ότι η κατάσταση θα επιδεινωθεί τα επόµενα χρόνια λόγω της οικονοµικής ύφεσης. Οπως εκτιµάται, ο αριθµός των οφειλετών οι οποίοι δεν ανταποκρίνονται στις οικονοµικές υποχρεώσεις που προκύπτουν από τις πιστωτικές συµβάσεις, τις οποίες υπογράφουν κατά τη σύναψη του δανείου, αναµένεται να αυξηθεί κατακόρυφα τα επόµενα χρόνια.

Τραπεζικά προσκόµµατα... Τις τακτικές και τις μεθόδους των τραπεζών, οι οποίες με διάφορες προφάσεις και κωλυσιεργίες εμπόδιζαν τους δανειολήπτες να συμπεριληφθούν στη ρύθμιση για τις ληξιπρόθεσμες οφειλές, θεωρεί υπεύθυνες για τη διατήρηση του αριθμού των πλειστηριασμών ακινήτων σε πολύ υψηλά επίπεδα και φέτος ο εκπρόσωπος στη Θεσσαλονίκη του Συλλόγου Δανειοληπτών Ελλάδος, Μπάμπης Περβανάς. Οπως ανέφερε στον «Α», αν και ο νόμος 3816/2010, ο οποίος ισχύει από τις 26 Ιανουαρίου, προέβλεπε να ενταχθούν στη ρύθμιση -σε συνεννόηση με τις τράπεζες που χρωστούσαν χρήματακαι να μη χάσουν ακίνητό τους για οφειλές μικρότερες από 200.000 ευρώ, όσοι δεν μπορούσαν να αποπληρώσουν επιχειρηματικό, καταναλωτικό ή αγροτικό δάνειο, οι τράπεζες με διάφορες προφάσεις τους καθυστερούσαν κι έτσι οι περισσότεροι πλειστηριασμοί διενεργήθηκαν κανονικά. «Αντί να δώσουν οι τράπεζες στους δανειολήπτες το έντυπο του υπουργείου

Σύμφωνα με εκτιμήσεις ο αριθμός των οφειλετών που αδυνατεί να ανταποκριθεί στις υποχρεώσεις του αναμένεται να αυξηθεί κατακόρυφα

Οικονομίας για τις ληξιπρόθεσμες οφειλές και να μπουν στη ρύθμιση, τους έδιναν να υπογράψουν ένα δικό τους έντυπο αναγνώρισης χρέους και στη συνέχεια τους ζητούσαν ένα σωρό δικαιολογητικά. Ετσι ο χρόνος κύλησε και οι περισσότεροι δανειολήπτες δεν υπάχθηκαν στη ρύθμιση. Από το τέλος Μαρτίου οι τράπεζες άρχισαν να δέχονται αιτήματα για τη ρύθμιση. Εχουμε καταγγελίες δανειοληπτών ότι βγήκαν

σπίτια «στο σφυρί» για οφειλές μικρότερες από 200.000 ευρώ και μετά τις 16 Απριλίου, που είναι η καταληκτική ημερομηνία για τη ρύθμιση, θα γίνει χαμός. Θα φτάσουν περισσότερα ακίνητα σε πλειστηριασμό. Δυστυχώς, για μία ακόμη φορά οι τράπεζες έκαναν ό,τι ήθελαν και για όλα αυτά η Πολιτεία έκανε τα «στραβά μάτια»», τόνισε στον «Α» ο κ. Περβανάς. ΡΩΜΑΝΟΣ ΚΟΝΤΟΓΙΑΝΝΙΔΗΣ

«Παράθυρο» για να προσµετρώνται στο συντελεστή οι ηµιυπαίθριοι Ανοικτό το ενδεχόμενο να προσμετρώνται στο συντελεστή δόμησης οι ημιυπαίθριοι χώροι άφησε χτες η υπουργός Περιβάλλοντος, Ενέργειας και Κλιματικής Αλλαγής, Τίνα Μπιρμπίλη, κατά τη συζήτηση του νομοσχεδίου στο πλαίσιο της διαβούλευσης στη Βουλή. Την πρόταση διατύπωσε ο πρόεδρος της επιτροπής, βουλευτής του ΠΑΣΟΚ Κ. Καρτάλης και η κ. Μπιρμπίλη δεν το απέκλεισε. Πάντως, συμπλήρωσε ότι θα ήταν ένα αποσπασματικό μέτρο, αν δεν υπάρξει συνολική λύση για το θέμα του Γενικού Οικοδομικού Κανονισμού που δεν έχει αλλάξει από το 1985. Η κ. Μπιρμπίλη απέρριψε τις αιχμές ότι η λύση που προωθεί για τους ημιυπαίθριους έχει εισπρακτικό χαρακτήρα, ωστόσο οι βουλευτές της ΝΔ και ο αρμόδιος τομεάρχης, Κυριάκος Μητσοτάκης, δήλωσαν ενοχλημένοι γιατί, όπως είπαν, ενημερώθηκαν για το νομοσχέδιο από τις εφημερίδες. Η κ. Μπιρμπίλη από την πλευρά της δήλωσε με κάθε ειλικρίνεια ότι δε γνωρίζει τις κοινοβουλευτικές διαδικασίες και τελικά το νομοσχέδιο θα εισαχθεί προς συζήτηση στην αρμόδια επιτροπή της Βουλής την Παρασκευή το πρωί, εφόσον κατατεθεί νωρίτερα στο Κοινοβούλιο. Νωρίτερα, στο θέμα των ημιυπαίθριων αναφέρθηκε και ο πρόεδρος του ΤΕΕ, Γιάννης Αλαβάνος, ο οποίος συμμετείχε στην παρουσίαση του προγράμματος συνεργασίας του επιστημονικού οργανισμού των διπλωματούχων μηχανικών με την Εθνική Τράπεζα της Ελλάδος. Ο κ. Αλαβάνος άσκησε σκληρή κριτική για τη ρύθμιση του νομοσχεδίου που αφορά στην επιβολή αυστηρών κυρώσεων στους πολιτικούς μηχανικούς όταν θα εντοπίζονται αυθαιρεσίες και υπερβάσεις στη δόμηση, τονίζοντας ότι με αυτόν τον τρόπο δε διασφαλίζει την αποτροπή των μελλοντικών παρανομιών, ενώ η ευθύνη θα έπρεπε να διανέμεται αναλογικά, διότι άλλος ευθύνεται για την αλλαγή χρήσεως και άλλος για την κατασκευαστική παρανομία.


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

13

ΡΕΠΟΡΤΑ Ζ

Κτηµατογράφηση για 7.500 στρέµµατα στο δήµο Θερµαϊκού Η δεύτερη φάση του ΓΠΣ ολοκληρώθηκε και οι ιδιοκτήτες ακινήτων καλούνται να εισφέρουν σε γη και χρήµα ξεπεράσαµε τους 50.000. Κι αυτοί οι πολίτες ζουν σε 5.000 πολεοδοµηµένα στρέµµατα που είναι η έκταση του δήµου. Με την προσθήκη 7.500 στρ. θα αποκτήσουµε άλλη... µιάµιση πόλη». Το Γενικό Πολεοδοµικό Σχέδιο στο Θερµαϊκό εγκρίθηκε το Μάρτιο του 2007 και µέσα σε τρία χρόνια ολοκληρώνεται η δεύτερη φάση, ενώ υπολογίζεται πως σε µια τριετία είναι δυνατό να ολοκληρωθεί συνολικά η επέκταση (και η πράξη εφαρµογής). Αυτός είναι ο στόχος του δήµου, όµως κανείς δεν µπορεί να είναι βέβαιος, καθώς οι ενστάσεις µπορούν να καθυστερήσουν ακόµη και χρόνια το εγχείρηµα.

ΡΕΠΟΡΤΑΖ ΤΑΣΟΣ ΤΑΣΙΟΥΛΑΣ

Οσους έχουν ιδιοκτησίες στις περιοχές της Ανω Περαίας και των Ανω Νέων Επιβατών καλεί ο δήμος Θερμαϊκού, προκειμένου να ενημερωθούν για την κτηματογράφηση (δεύτερη ανάρτηση), η οποία ολοκληρώθηκε στο πλαίσιο του εγκεκριμένου Γενικού Πολεοδομικού Σχεδίου για Περαία, Ν. Επιβάτες και Αγία Τριάδα.

Ο

ι πολίτες καλούνται να µεταβούν στο πρώην κοινοτικό κατάστηµα των Νέων Επιβατών από την ερχόµενη Δευτέρα και για 15 µέρες, ώστε να έχουν την ευκαιρία να υποβάλουν τυχόν ενστάσεις ή προσφυγές, καθώς και να παραλάβουν ειδοποιήσεις για την προείσπραξη 10% της εισφοράς σε χρήµα. Οσοι µάλιστα δεν έχουν υποβάλει δηλώσεις ιδιοκτησίας για την κτηµατογράφηση, µπορούν µέσα στις 15 µέρες να τις καταθέσουν συνοδευόµενες από τα απαιτούµενα δικαιολογητικά (φωτοτυπία ταυτότητας, ΑΦΜ γραµµένο πάνω στη φωτοτυπία της ταυτότητας, φωτοτυπία του τίτλου ιδιοκτησίας του σηµερινού ιδιοκτήτη µε το πιστοποιητικό µεταγραφής, φωτοτυπία του τίτλου ιδιοκτησίας του ιδιοκτήτη στις 10 Μαρτίου 1982, τοπογραφικό διάγραµµα, οικοδοµι-

Οι ιδιοκτήτες ακινήτων θα κληθούν να πληρώσουν εισφορά 10% σε χρήμα για να δημιουργηθούν οι απαιτούμενες υποδομές

κή άδεια, πιστοποιητικά κτηµατολογικών εγγραφών φυσικού ή νοµικού προσώπου και αντικειµένου εγγραπτέων δικαιωµάτων από το Υποθηκοφυλακείο Καλαµαριάς και αντίγραφα µερίδων του σηµερινού ιδιοκτήτη και του ιδιοκτήτη του 1982, επίσης από το Υποθηκοφυλακείο Καλαµαριάς).

Εντάσσονται 7.500 στρ. Το Γενικό Πολεοδοµικό Σχέδιο του δήµου Θερµαϊκού θα έχει ως αποτέλεσµα την ένταξη στο σχέδιο πόλης συνολικής

έκτασης 7.500 στρεµµάτων. Πρόκειται για µια από τις σηµαντικότερες επεκτάσεις στο νοµό Θεσσαλονίκης, καθώς επί δεκαετίες η περιοχή συγκεντρώνει το οικοδοµικό και κτηµατοµεσιτικό ενδιαφέρον. Οπως χαρακτηριστικά τόνισε στον «Α» ο δήµαρχος, Γιάννης Αλεξανδρής, «γεννιέται µια νέα πόλη και µάλιστα µε ταχύτατους ρυθµούς. Με την απογραφή του 2001 είχαµε λίγους περισσότερους από 20.000 κατοίκους στο δήµο. Σήµερα, βάσει των υδροµέτρων (περισσότερα από 20.000) υπολογίζουµε πως

Εργαζόµενοι ΤΥ∆ΚΥ: Η συνένωση έφερε µαρασµό βλέπονται, ενώ μείωση προσωπικού υπάρΣε τροχιά μαρασμού έχει μπει το Ταμείο χει και στα περιφερειακά γραφεία ΤΥΔΚΕ, Υγείας Δημοτικών και Κοινοτικών Υπαλλήμε το Κιλκίς να βρίσκεται στη χειρότερη λων (ΤΥΔΚΥ) μετά και τη συνένωσή του με κατάσταση, αφού έχει απομείνει ένας μόλις τον Οργανισμό Περίθαλψης και Ασφάλισης υπάλληλος. Οι ασφαλισμένοι, μάλιστα, εξυτων Δημοσίων Υπαλλήλων (ΟΠΑΔ) το 2008, πηρετούνται με μεγάλη καθυστέρηση, κακαταγγέλλουν οι εργαζόμενοι του ταμείου, θώς η υπηρεσία δε διαθέτει με ευθύνη της που από χτες Τρίτη προχώρησαν σε κατάΠολιτείας μηχανογράφηση, με αποτέλεσμα ληψη των γραφείων του οργανισμού στην πολλές εργασίες να καθυστερούν και ήδη οδό Σαπφούς και όπως αναφέρουν θα συνα εκκρεμεί η έκδοση συνταγολογίων από νεχιστεί μέχρι και την Παρασκευή. τον Ιούνιο του 2009. Οπως καταγγέλλουν οι εργαζόμενοι, μετά τη συνένωση των δυο ταμείων το Κλειστά μέχρι και την Παρασκευή τα γραφεία του Στάση εργασίας ΠΟΕ - ΟΤΑ ΤΥΔΚΥ ακολουθεί καθοδική πορεία με τα ΤΥΔΚΥ, καθώς οι εργαζόμενοι προχώρησαν σε αποθεματικά του να χρησιμοποιούνται κατάληψη διαμαρτυρόμενοι για κακοδιαχείριση Στη στάση εργασίας που κήρυξε χτες η για να καλυφθούν οι «μαύρες τρύπες»του ΠΟΕ - ΟΤΑ από τις 11 το πρωί εως τη λήξη ΟΠΑΔ. Και ενώ στόχος της συνένωσης ήταν η μείωση των λειτουργι- του ωραρίου συμμετείχαν και οι εργαζόμενοι των ΟΤΑ Θεσσαλονίκών εξόδων, μέσα σε ένα χρόνο τα λειτουργικά έξοδα του οργανισμού κης. Οι εργαζόμενοι συγκεντρώθηκαν αρχικά στις 12 το μεσημέρι στο αυξήθηκαν από δυο εκατομμύρια ευρώ σε 13 εκατομμύρια ευρώ. Οι άγαλμα Βενιζέλου, όπου μοίρασαν ενημερωτικό υλικό σε περαστικούς εργαζόμενοι κρούουν τον κώδωνα του κινδύνου και για τις παροχές, και στη συνέχεια κατευθύνθηκαν στα γραφεία της ΤΥΔΚΥ ως ένδειξη καθώς ήδη έχει αυξηθεί η συμμετοχή των ασφαλισμένων σε μερίδα συμπαράστασης στους εργαζομένους του ταμείου. «Ζητούμε να παριατρικών εξετάσεων και χειρουργικών επεμβάσεων, ενώ επιχειρείται θούν πίσω όλες οι μειώσεις στους μισθούς μας και τα νέα φορολογικά εξίσωση των παροχών των δυο ταμείων «προς τα κάτω», όπως τονί- μέτρα. Δε θα αφήσουμε σε καμία περίπτωση την κυβέρνηση να αγγίξει ζει και ο πρόεδρος των εργαζομένων στο δήμο Θεσσαλονίκης, Τάσος τα ασφαλιστικά μας δικαιώματα», τόνισε ο Φώτης Μουρατίδης, εκπρόΚυριακίδης. Με τη λήξη των συμβάσεων έργου και Stage, που δεν σωπος των εργαζομένων στο δ.σ. του ΠΟΕ - ΟΤΑ, ενώ όπως τόνισε οι ανανεώθηκαν, το ΤΥΔΚΥ υπολειτουργεί, αφού πλέον από τα 25 άτομα εργαζόμενοι των ΟΤΑ ζητούν την ανανέωση των συμβάσεων όλων των που αποτελούσαν το προσωπικό, έχουν μείνει 14. Προσλήψεις τόσο εργαζομένων που έχουν παγώσει από το Δεκέμβριο του 2009. για το διοικητικό προσωπικό όσο και για ελεγκτές ιατρούς δεν προΒΑΣΩ ΝΤΟΥΝΑ

Πληρώστε... Οι ιδιοκτήτες ακινήτων θα κληθούν να βάλουν το χέρι στην τσέπη, πληρώνοντας την απαιτούµενη εισφορά σε γη και χρήµα, γεγονός που αποτελεί επίσης ανασταλτικό παράγοντα στην έγκαιρη και γρήγορη ολοκλήρωση της επέκτασης. Ωστόσο, η εισφορά τους είναι προαπαιτούµενο προκειµένου οι περιοχές που θα ανοικοδοµηθούν να έχουν τουλάχιστον τις στοιχειώδεις υποδοµές. Επιπλέον, σε αυτήν τη φάση, όπως είπε ο κ. Αλεξανδρής, δηµιουργείται µια σηµαντική τράπεζα γης, που θα βοηθήσει στις απαιτούµενες ανταλλαγές για τη δηµιουργία σχολείων, κοινωφελών και κοινόχρηστων χώρων, υποδοµών κ.λπ.

Σκηνοθέτησαν ληστεία για 9.890 ευρώ Ληστεία σε τουριστικό γραφείο σκηνοθέτησαν τρεις φίλοι, οι οποίοι, σύμφωνα με τις αστυνομικές αρχές, στη συνέχεια μοιράστηκαν τη... λεία τους, που ανερχόταν σε 9.890 ευρώ. Οπως έγινε γνωστό, η ληστεία είχε σημειωθεί στις αρχές Ιουλίου του 2009 στην περιοχή του Ευόσμου Θεσσαλονίκης. Τότε η 27χρονη υπάλληλος είχε αναφέρει στις αρχές ότι την ακινητοποίησε άγνωστος νεαρός, ο οποίος άρπαξε τα χρήματα από το ταμείο και στη συνέχεια εξαφανίστηκε. Η νεαρή γυναίκα είχε καταγγείλει τη ληστεία στις διωκτικές αρχές δείχνοντας μάλιστα σοκαρισμένη από την επίθεση που δέχτηκε. Ωστόσο, όπως αποδείχτηκε στη συνέχεια, η 27χρονη υπάλληλος και ο «δράστης» είχαν σκηνοθετήσει τη ληστεία με τη βοήθεια και μίας ακόμη 21χρονης γυναίκας. Συγκεκριμένα, ο νεαρός πήγε στο τουριστικό γραφείο όπου εργαζόταν η 27χρονη, η οποία του παρέδωσε τα χρήματα από το ταμείο και αφού περίμενε να απομακρυνθεί τηλεφώνησε στην Αστυνομία καταγγέλοντας ότι είχε πέσει θύμα ληστείας. Σε βάρος των δύο γυναικών και του 27χρονου σχηματίστηκε δικογραφία από το Τμήμα Εγκλημάτων κατά Ιδιοκτησίας της Διεύθυνσης Ασφάλειας Θεσσαλονίκης.


14

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Εκθεση κινεζικής τέχνης στο Μορφωτικό Ιδρυµα της ΕΣΗΕΜ-Θ

Περισσότερα από 15.000 δέντρα κλαδεύτηκαν στους δρόμους της Θεσσαλονίκης

Απλό κλάδεµα ή καταστροφή των δέντρων της πόλης; ΤΗΣ ΕΥΤΥΧΙΑΣ ΒΑΤΑΛΗ

Σε... καταστροφή των δέντρων της πόλης προχωρά ο δήμος Θεσσαλονίκης, όπως καταγγέλλουν καθηγητές του ΑΠΘ, οι οποίοι ήδη συγκεντρώνουν υπογραφές με τις οποίες εκφράζουν την αντίθεσή τους στην κλάδευση των δέντρων που γίνεται από την αντιδημαρχία Πρασίνου.

«Α

υτό που γίνεται µε την υπερβολική κλάδευση των δένδρων, σε πρώτη φάση (κατά 80%-100%) σε ακατάλληλη εποχή, Μάρτιο-Απρίλιο, οδηγεί στη δεύτερη φάση σταδιακής ξήρανσης, ολικής νέκρωσης του κορµού και των κλάδων. Τα νεκρά-σάπια δένδρα από εγκληµατική άγνοια και αυθαίρετη λειτουργία των εργολαβικών συνεργείων, λόγω αφασίας των υπηρεσιών Πρασίνου του δήµου, µετατρέπουν γρήγορα τη Θεσσαλονίκη σε “κρανίου τόπο”», σηµειώνει χαρακτηριστικά σε σχετική επιστολή του ο καθηγητής Δασολογίας και Φυσικού Περιβάλλοντος Παύλος Ευθυµίου.

Λάθος χρόνος Την ίδια άποψη έχει και ο καθηγητής Δασοκοµίας - Οικολογίας, πρόεδρος του Εργαστηρίου Δασοκοµίας του ΑΠΘ, Παύλος Σµύρης, που σηµειώνει ότι, εάν οι εργασίες κλαδέµατος στα δέντρα έγιναν το τελευταίο διάστηµα ή συνεχίζονται ακόµη, είναι λάθος. «Κανονικά οι κλαδεύσεις πρέπει να γίνονται µέχρι τον Ιανουάριο, το πολύ µέχρι τα µέσα Φεβρουαρίου, αν

Η εικαστική πρόταση με τίτλο «Τρισδιάστατη Κίνα: έκθεση κινεζικής σύγχρονης τέχνης» θα παρουσιαστεί στο Μορφωτικό Ιδρυμα της ΕΣΗΕΜ-Θ, στο πλαίσιο των πολιτιστικών εκδηλώσεων της τιμώμενης χώρας της 7ης Διεθνούς Εκθεσης Βιβλίου Θεσσαλονίκης, που φέτος είναι η Κίνα. Η έκθεση θα εγκαινιαστεί την Πέμπτη 22 Απριλίου, πρώτη ημέρα της Διεθνούς Εκθεσης Βιβλίου, στις 4.30 το απόγευμα και θα διαρκέσει έως τις 30 Απριλίου. Παρουσιάζονται τρισδιάστατα έργα οκτώ καλλιτεχνών, ζωγραφισμένα με παραδοσιακές τεχνικές, βασισμένες στο μελάνι, τις νερομπογιές, αλλά και τα λάδια, γλυπτά, βίντεο και κατασκευές, που παρουσιάζουν σταθερά σύμβολα και θέματα του δυτικού πολιτισμού, με το μοναδικό τρόπο της visual art. Στα εγκαίνια της έκθεσης θα παραστούν οι Sun Shoushan, υφυπουργός Γενικής Αρχής Τύπου και Εκδόσεων (GAPP), Luo Linquan, πρέσβης της Λαϊκής Δημοκρατίας της Κίνας στην Ελλάδα, και Chan Qi, εικαστικός καλλιτέχνης. Η έκθεση θα λειτουργεί καθημερινά από τις 10 το πρωί έως τις 8 το βράδυ.

και κατά κύριο λόγο εξαρτάται από τον καιρό. Με τις καιρικές συνθήκες που επικρατούν φέτος, το κλάδεµα των δέντρων έπρεπε ήδη να έχει ολοκληρωθεί το πολύ µέχρι τα µέσα Φεβρουαρίου», τονίζει. Οπως εξηγεί ο ίδιος, το κλάδεµα πρέπει να γίνεται πριν από τη λεγόµενη «κίνηση των χυµών» στο δέντρο, δηλαδή πριν αρχίσουν να σκάνε οι «οφθαλµοί» στα κλαδιά. Μακροπρόθεσµα τα δέντρα αυτά δε θα αναπτυχθούν, ενώ υπάρχει και κίνδυνος να προσβληθούν από ασθένειες.

Πάνω από 15.000 δέντρα Για το µεγαλύτερο κλάδεµα που έγινε τα τελευταία χρόνια στη Θεσσαλονίκη κάνει λόγο ο αντιδήµαρχος Πρασίνου, Νίκος Παπαγιαννόπουλος, που επισηµαίνει ότι φέτος κλαδεύτηκαν περισσότερα από 15.000 δέντρα που είχαν χρόνια να κλαδευτούν, σε «δύσκολους» δρόµους, όπως η Κρήτης, η Δελφών, η Μπότσαρη, η Αλ. Σβώλου, η Ολύµπου, η Πλάτωνος. «Οι δασολόγοι και γεωπόνοι της υπηρεσίας µού εξηγούν ότι άλλο είναι το κλάδεµα του περιβολιού κι άλλο του πεζοδροµίου. Το δέντρο του πεζοδροµίου δεν πρέπει να κρύψει το φανάρι, να ακουµπήσει το στύλο της ΔΕΗ, το µπαλκόνι ή την τέντα ενός διαµερίσµατος. Επιστηµονικές διαφωνίες υπάρχουν σε όλους τους κλάδους. Εµείς ως αντιδηµαρχία ελέγχουµε, πάντως, ότι στο κλάδεµα που κάνει ο εργολάβος παρίσταται υποχρεωτικά δασολόγος ή γεωπόνος που ελέγχει και καθοδηγεί το κλάδεµα. Οσο για το χρόνο του κλαδέµατος, αφήνουµε τελευταία τα δέντρα που δε βλαστάνουν τώρα», τονίζει ο αντιδήµαρχος.

∆ιέρρηξαν τα Γραφεία Υδρευσης του δήµου Θερµαϊκού Στα γραφεία της Δημοτικής Επιχείρησης Υδρευσης και Αποχέτευσης του δήμου Θερμαϊκού εισέβαλαν χτες τα ξημερώματα άγνωστοι διαρρήκτες. Αφού παραβίασαν την είσοδο της ταμειακής υπηρεσίας, οι δράστες απέσπασαν χρηματικό ποσό ύψους περίπου 800 ευρώ. Στη συνέχεια, προχώρησαν στα γραφεία της διοίκησης και του προσωπικού, όπου προκάλεσαν υλικές ζημιές σε συρτάρια και ντουλάπες, προφανώς στην προσπάθειά τους να εντοπίσουν κάτι πολύτιμο. Το περιστατικό αντιλήφθηκε νωρίς χτες το πρωί η καθαρίστρια που επιμελείται το χώρο και αμέσως ειδοποίησε το Αστυνομικό Τμήμα Θερμαϊκού, που επιλήφθηκε του περιστατικού. Ανδρες της Ελληνικής Αστυνομίας διεξάγουν έρευνες για τον εντοπισμό των δραστών.

∆ιαλέξεις στο Ανοιχτό Πανεπιστήµιο Τρεις επιστημονικές διαλέξεις θα δοθούν σήμερα στη Θεσσαλονίκη, στο πλαίσιο του θεσμού του Ανοιχτού Πανεπιστημίου του δήμου, που λειτουργεί με στόχο την προσφορά γνώσεων σε ανθρώπους κάθε ηλικίας και μορφωτικού επιπέδου. Μεταξύ των διαλέξεων που θα αναπτυχθούν σήμερα περιλαμβάνεται και η ομιλία του καθηγητή του Τμήματος Φυσικής του ΑΠΘ Αλκιβιάδη Μπάη, που τιμήθηκε με το δίπλωμα συμμετοχής στο Νομπέλ Ειρήνης 2007 ως μέλος της Διακυβερνητικής Επιτροπής για την Κλιματική Αλλαγή (IPCC) των Ηνωμένων Εθνών και «μοιράστηκε» το βραβείο με τον Αλ Γκορ. Η πρώτη διάλεξη θα δοθεί στις 5.30 το απόγευμα, στην αίθουσα διαλέξεων του Κέντρου Ιστορίας του δήμου Θεσσαλονίκης (πλ. Ιπποδρομίου) και εντάσσεται στα μαθήματα του κύκλου της Νομικής. Ομιλητής θα είναι ο επίκουρος καθηγητής Διοικητικού Δικαίου του Τμήματος Νομικής του ΑΠΘ Κωνσταντίνος Γώγος, που θα αναπτύξει το θέμα «Οι προστατευόμενες περιοχές Natura». Στον ίδιο χώρο, στις 7.30 το απόγευμα και στο πλαίσιο του κύκλου Περιβάλλον και Οικολογία, ο καθηγητής του Τμήματος Φυσικής του ΑΠΘ, Αλκιβιάδης Μπάης, θα δώσει διάλεξη με θέμα την κλιματική αλλαγή και την ατμόσφαιρα τον 21ο αιώνα. Μια τρίτη διάλεξη θα δοθεί στις 18:45, στο πλαίσιο του κύκλου της Ιστορίας – Αρχαιολογίας - Τέχνης, στην αίθουσα διαλέξεων της Κεντρικής Βιβλιοθήκης του δήμου Θεσσαλονίκης (Εθν. Αμύνης 27), από το διδάκτορα Βυζαντινής Αρχαιολογίας (αρχιτέκτονα-αναστηλωτή), Πασχάλη Ανδρούδη, ο οποίος θα αναπτύξει το θέμα: «Χάνια και καραβάν-σαράγια στην Οθωμανική Αυτοκρατορία». Τα μαθήματα θα συνεχιστούν την επόμενη εβδομάδα με θέματα από την ιστορία - αρχαιολογία - τέχνη, την ιατρική - βιολογία - ψυχολογία - AIDS - ναρκωτικά, τη νομική, την οικονομία και διοίκηση, τη θεολογία και το περιβάλλον.


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

15

ΡΕΠΟΡΤΑ Ζ

Ευάλωτοι και στο σώµα οι ψυχικά ασθενείς Πολύ στενά συνδέονται η ψυχική και η σωματική υγεία, λένε οι ειδικοί. «Απόδειξη, ότι τα άτομα με σοβαρές ψυχικές ασθένειες διατρέχουν διπλάσιο έως τριπλάσιο κίνδυνο θανάτου σε σχέση με συνομήλικα άτομα που είναι ψυχικά υγιή. Πεθαίνουν κατά μέσο όρο 20 χρόνια νωρίτερα, με κύρια αιτία τα καρδιαγγειακά νοσήματα», επισήμανε η επίκουρη καθηγήτρια Ψυχιατρικής του Πανεπιστημίου Αθηνών, Μένη Μαλιώρη. Τα παραδείγματα και τα στατιστικά δεδομένα που αποδεικνύουν ότι η ψυχική και η σωματική υγεία βρίσκονται σε αλληλεπίδραση και οι ψυχικά ασθενείς χρειάζονται ολοκληρωμένη προσέγγιση είναι πολλά. Οπως πρόσθεσε η κ. Μαλιώρη στην επιστημονική εκδήλωση με θέμα «Ολιστική προσέγγιση και κοινωνικές προεκτάσεις των ψυχικών- σωματικών νόσων» που έγινε χτες στην Εταιρεία Μακεδονικών Σπουδών, τα άτομα με σοβαρές

ψυχικές παθήσεις παρουσιάζουν 2-3 φορές μεγαλύτερη πιθανότητα να αναπτύξουν διαβήτη ή άλλους καρδιαγγειακούς παράγοντες κινδύνου, ενώ μόνο το ένα τρίτο παρουσιάζει φυσιολογικό βάρος. Και, αντιστρόφως, όμως, διαπιστώθηκε

Η Ευρωπαϊκή Ενωση δαπανά για την ψυχική υγεία 436 εκατομμύρια ευρώ το χρόνο ότι οι διαβητικοί διατρέχουν διπλάσιο κίνδυνο να πάθουν κατάθλιψη.

Οι δαπάνες και το στίγµα Οι ψυχικά άρρωστοι βρίσκονται αντιμέτωποι -εκτός από την ασθένειά τους- και με έναν άλλο μεγάλο «εχθρό», το κοινωνικό στίγμα. Το αποτέλεσμα είναι τα δύο τρίτα να μην αναζητούν θεραπεία.

Πάντως, ο κρίκος που συνδέει την ψυχική και τη σωματική υγεία «μεταφράζεται» σε υπέρογκες δαπάνες που επιφορτίζουν τα εθνικά συστήματα υγείας. Οπως ανέφερε η κ. Μαλιώρη, η Ευρωπαϊκή Ενωση δαπανά για την ψυχική υγεία 436 εκατομμύρια ευρώ το χρόνο (πάνω από 2.000 ευρώ ανά νοικοκυριό), ενώ οι πρόσθετες δαπάνες για προβλήματα σωματικής υγείας σε ψυχικά ασθενείς αυξάνουν αυτόν τον αριθμό μέχρι και 70%. Γι’ αυτό, εξάλλου, θεωρείται αναγκαία η συνεχής εκπαίδευση των εμπλεκόμενων φορέων σωματικής και ψυχικής υγείας, καθώς και η εξασφάλιση επαρκών πόρων. Οι προσπάθειες που πρέπει να γίνουν για να γεφυρωθεί το χάσμα ανάμεσα στην ψυχική και τη σωματική υγεία είναι μεγάλες, σύμφωνα με τους επιστήμονες, παρόλο που το πρώτο θετικό βήμα σε ευρωπαϊκό επίπεδο έγινε με τη δημιουργία της Πλατφόρμας Ψυχικής και Σωματικής Υγείας. Η συνεργα-

Στιγμιότυπο από την εκδήλωση οργάνωσαν οι Γ’ Ψυχιατρική Κλινική και Α’ Παθολογική Κλινική της Ιατρικής Σχολής του ΑΠΘ

σία φορέων και ειδικών ξεκίνησε τον Απρίλιο του 2008, με στόχο οι ασθενείς να δέχονται ολοκληρωμένη φροντίδα. Την εκδήλωση οργά-

νωσαν οι Γ’ Ψυχιατρική Κλινική και Α’ Παθολογική Κλινική της Ιατρικής Σχολής του ΑΠΘ. ΜΑΡΙΑ ΛΙΤΟΥ


16

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΑΣΕΠ

Εν όψει του επικείμενου γραπτού διαγωνισμού της 17ης Απριλίου, για την πλήρωση 230 θέσεων κύριου προσωπικού στην ΕΘΝΙΚΗ ΤΡΑΠΕΖΑ, ο Εκπαιδευτικός Οργανισμός ΑLEXANDER, παραθέτει 100 θέματα κλειδιά καθώς και τις λύσεις τους για την πληρέστερη προετοιμασία των υποψηφίων (Δωδεκανήσου 21, Θεσσαλονίκη, Tηλ.: 2310-546669, Fax: 2310-546668 www.alexander.edu.gr, E– Mail: alexanderinst@the.forthnet.gr).

ΜΑΘΗΜΑΤΙΚΕΣ ∆ΕΞΙΟΤΗΤΕΣ – ΙΚΑΝΟΤΗΤΕΣ 1. Ένας τυπογράφος όταν εργάζεται 8 ώρες την ημέρα στοιχειοθετεί το κείμενο ενός βιβλίου σε 25 ημέρες. Αν αυξήσει τις ώρες εργασίας κατά 2 την ημέρα, πόσες ημέρες νωρίτερα θα τελειώσει τη στοιχειοθέτηση; Α. 3 Β. 6 Γ. 5 Δ. 4 2. Ένας λόχος στρατιωτών βαδίζει 8 ώρες την ημέρα και διανύει απόσταση 120 χιλιομέτρων σε 3 ημέρες. Πόσες μέρες θα χρειαστεί για να διανύσει απόσταση180 χιλιομέτρων αν βαδίζει 6 ώρες την ημέρα; Α. 6 Β. 4 Γ. 5 Δ. 3 3. Για να κτίσουμε 216 μέτρα τοίχο προσλάβαμε 10 εργάτες. Οι εργάτες αυτοί εργαζόμενοι 7 ώρες την ημέρα έκτισαν σε 15 μέρες 135 μέτρα τοίχου. Αν προσληφθούν ακόμη 4 εργάτες και αυξηθεί κατά 2 ώρες η ημερήσια απασχόληση, σε πόσες μέρες θα τελειώσει το έργο; Α. 5 Β. 10 Γ. 4 Δ. 8 4. Μια δεξαμενή γεμίζει από μια βρύση Α και αδειάζει από μια άλλη βρύση Β. Όταν η Α είναι ανοικτή και η Β κλειστή η δεξαμενή γεμίζει σε 10 ώρες ενώ όταν η Α είναι κλειστή και η Β ανοικτή η δεξαμενή αδειάζει σε 15 ώρες. Σε πόσες ώρες γεμίζει η δεξαμενή όταν οι Α και Β είναι ταυτόχρονα ανοικτές; Α. 20 Β. 30 Γ. 40 Δ. 18 5. Ποια η τιμή κόστους ενός Scooter που πουλήθηκε 3600€ με κέρδος 8%; Α. 3500€ Β.3000€ Γ.3333€ Δ.3200€ 6. Ο πληθυσμός μιας χώρας αυξάνεται κατά 2% τον χρόνο. Στο τέλος του 2001 ο πληθυσμός ήταν 20.000.000. Πόσος ήταν ο πληθυσμός το τέλος του 2003; Α.240.000 Β.30.200.000 Γ.28.800.000 Δ.27.800.000 7. Η τιμή μιας μετοχής αυξήθηκε κατά 5% την Δευτέρα και μειώθηκε κατά 6% την Τρίτη. Πόσο μειώθηκε συνολικά τις δύο ημέρες; Α.0,8% Β.0,9% Γ.1% Δ.1,3% 8. Σε ένα κατάστημα ένα εμπόρευμα πωλείται με κέρδος 30%. Στην εποχή των εκπτώσεων γίνεται σε αυτό έκπτωση 20% (στην τιμή πώλησής του). Ποιο είναι το κέρδος του καταστήματος από την πώλησή του στις εκπτώσεις; Α.12% Β.10% Γ.6% Δ.4% 9. Ποιο ποσό πρέπει να επενδυθεί με επιτόκιο 4,5% ώστε να δώσει τόκο 9.000€ σε 5 χρόνια; Α. 40.000€ Β. 35.000€ Γ. 55.000€ Δ. 60.000€ 10. Για πόσο χρόνο πρέπει να δανείσουμε κεφάλαιο 25.000€ με επιτόκιο 7,5% ώστε να πάρουμε τόκο 7.500€; Α. 5 χρόνια Β. 6 χρόνια Γ. 3 χρόνια Δ. 4 χρόνια 11. Κάποιος δανείζεται 41.200€ με ετήσιο επιτόκιο 3 1/4%. Τι ποσό πρέπει να επιστρέψει μετά από 46 ημέρες;

Α. 41.500€ Β. 41.400€ Γ. 41.368,75€ Δ. 41.650,3€ 12. Τι κεφάλαιο πρέπει να καταθέσουμε σε μία τράπεζα στην οποία γίνεται ετήσιος ανατοκισμός με επιτόκιο 4% ώστε μετά από 3 χρόνια να έχει γίνει 56.243,2€; Α. 45.000€ Β. 48.000€ Γ. 60.000€ Δ. 50.000€ 13. Κάποιος καταθέτει τα 3/5 του κεφαλαίου του σε μία τράπεζα Α με επιτόκιο 5% και σε 6 μήνες το τοκοκεφάλαιο γίνεται 7.687,5€. Το υπόλοιπο κεφάλαιο το καταθέτει σε μία άλλη τράπεζα Β με επιτόκιο 3%. Σε πόσο χρόνο το δεύτερο ποσό (τράπεζα Β) αποδίδει τόκο 100€; Α. 7 μήνες Β. 10 μήνες Γ. 4 μήνες Δ. 8 μήνες 14. Δύο αυτοκίνητα ξεκινούν ταυτόχρονα από τις πόλεις Α & Β κινούμενα προς την ίδια κατεύθυνση. Οι ταχύτητές τους είναι 45 km/h και 38 km/h αντίστοιχα. Σε ποια απόσταση από την πόλη Α θα συναντηθούν, αν η απόσταση ΑΒ μεταξύ των δύο πόλεων είναι 21 km; Α. 130 km Β. 135km Γ. 140km Δ. 145km 15. Εννέα εργάτες ανέλαβαν να τελειώσουν μια εργασία σε 20 ώρες. Τέσσερις ώρες μετά την έναρξη του έργου προσέλαβε άλλους 3 εργάτες. Σε πόσες ώρες τελείωσε όλο το έργο; Α. 12 Β. 10 Γ. 8 Δ. 16 16. Ενα βαρέλι είναι γεμάτο κρασί. Την πρώτη μέρα πουλήθηκαν τα 3/8 του περιεχομένου και τη δεύτερη άλλα 39 κιλά. Αν το κρασί που πουλήθηκε αντιπροσωπεύει τα 3/4 του περιεχομένου, τότε στο βαρέλι απέμειναν: Α. 31 κιλά Β. 26 κιλά Γ. 22 κιλά. Δ. 18 κιλά. 17. Οπωροπώλης αγόρασε 200 κιλά αχλάδια. Πούλησε τα 120 κιλά με κέρδος 40% και τα υπόλοιπα με κέρδος 20%. Εισέπραξε 6,3 ευρώ περισσότερα από όσα θα εισέπραττε αν πουλούσε ολόκληρη την ποσότητα με κέρδος 25%. Πόσα ευρώ αγόρασε το κιλό τα αχλάδια; Α. 0,45 Β. 0,5 Γ. 0,55 Δ. 0,6 18. Ποιου κεφαλαίου τα 3/8 και το 1/5 του υπολοίπου, τοκιζόμενα με 9% επί 4 έτη φέρουν συνολικό τόκο 9000 ευρώ; Α. 5000 ευρώ Β. 50000 ευρώ. Γ. 25000 ευρώ Δ. 30000 ευρώ. 19. Δύο καταστηματάρχες αγοράζουν ένα συγκεκριμένο τύπο τηλεόρασης στην ίδια τιμή. Ο πρώτος την πουλάει με κέρδος 10% επί της τιμής αγοράς και ο δεύτερος με κέρδος 20% επί της τιμής πώλησης. Ενας ενδιαφερόμενος μετά από σύγκριση των τιμών διαπίστωσε ότι ο δεύτερος την πουλάει 60 ευρώ παραπάνω. Πόσο είχαν αγοράσει την τηλεόραση οι καταστηματάρχες; Α. 400 ευρώ Β. 300 ευρώ Γ. 600 ευρώ Δ. 500 ευρώ 20. Κεφάλαιο 2000 ευρώ τοκίστηκε επί 1 έτος και έγινε μαζί με τους τόκους του 2100 ευρώ. Ένα δεύτερο κεφάλαιο 720 ευρώ τοκίστηκε επί 10 μήνες και έγινε 744 ευρώ. Τότε κάποιο από τα δύο επιτόκια είναι: Α. 3% Β. 3,5% Γ. 4% Δ. 4,5% 21.Εμπορος πουλά εμπόρευμα με κέρδος 12% και εισπράττει 5376€. Πόσο θα εισέπραττε αν πουλούσε με ζημία 3%: Α. 4656€ Β. 4500€ Γ. 5200€ Δ. 5000€.

ΝΕΟΣ ΓΡΑΠΤΟΣ ∆ΙΑΓΩΝΙΣΜΟΣ

Θέµατα και 22. Δύο αυτοκίνητα αναχωρούν συγχρόνως το ένα από την Αθήνα και κινείται με 65 χλμ/ ώρα και το άλλο από την Καβάλα με ταχύτητα 78 χλμ/ώρα και συναντιούνται ύστερα από 5 ώρες. Να υπολογίσετε πόσο απέχουν οι δύο πόλεις. Α. 700 χλμ. Β. 715 χλμ. Γ. 730 χλμ. Δ. 800 χλμ. 23. Μία κυρία έδωσε για το λάδι που αγόρασε τα 3/5 των χρημάτων της και για το κρέας τα 5/8 του υπολοίπου και 50€ ακόμη και της έμειναν 70€. Πόσα χρήματα είχε πριν ψωνίσει; Α. 750€ Β. 800€ Γ. 700 Δ. 650€ 24. Τα 7/8 ενός κεφαλαίου είναι μεγαλύτερα των 3/5 κατά 165€. Αν καταθέσουμε τα 2/3 του κεφαλαίου αυτού στην τράπεζα με επιτόκιο 9% πόσο τόκο θα πάρουμε σε 70 ημέρες; Α. 8€ Β. 9€ Γ. 7€ Δ. 10€ 25. Ενα γραμμάτιο προεξοφλείται 9 μήνες πριν από τη λήξη του με επιτόκιο 16% αντί 264€. Ποια είναι η ονομαστική αξία του; Α. 350€ Β. 360€ Γ. 320€ Δ. 300€ 26. Μια ομάδα καλαθοσφαίρισης έχει κερδίσει 50 αγώνες από τους 75 που έχει παίξει σε μια χρονιά και υπολείπονται ακόμα 45 παιχνίδια. Σε πόσα απ’ αυτά θα πρέπει να νικήσει για να έχει κερδίσει συνολικά το 60% των παιχνιδιών; Α. 20 Β. 22 Γ. 34 Δ. 25 27. Το νερό της Μεσογείου περιέχει 3,645 ‰ αλάτι. Αν κάθε μέρα εξατμίζεται 10% νερό, πόσο ‰ αλάτι θα περιέχει μετά από 3 ημέρες; Α. 4 Β. 5 Γ. 6 Δ. 7 28. Ράφτης φτιάχνει σε 5 μέρες το 1/3 ενός κουστουμιού, ενώ ένας δεύτερος το 1/5 του ίδιου κουστουμιού σε 2 μέρες. Σε πόσες μέρες θα ράψουν το κουστούμι αν συνεργαστούν; Α. 6 Β. 3 Γ. 5 Δ. 15 29. Σ’ έναν αγώνα δρόμου ο Γιώργος τερματίζει κατά το 1/8 του χιλιομέτρου μπροστά από το Νίκο. Ο Νίκος τερματίζει κατά το 1/40 της ολικής διαδρομής μπροστά από τον Ηλία. Αν ο Γιώργος τερματίζει 250 μέτρα μπροστά από τον Ηλία, η απόσταση που έτρεξαν οι τρεις δρομείς σε μέτρα είναι: Α. 5000 Β. 4000 Γ. 2500 Δ. 3000 30. Πατέρας άφησε κληρονομιά στα δύο παιδιά του 14625€. Ο α΄ ήταν 10 ετών και ο β΄ 7 ετών. Η κληρονομιά μοιράστηκε έτσι, που τα μερίδια τοκισμένα με 5% να γίνουν ίσα, όταν κάθε παιδί συμπλήρωνε το 21ο έτος της ηλικίας του. Η διαφορά των μεριδίων ήταν: Α. 765 Β. 675 Γ. 685 Δ. 775 31. Μια ηλεκτρική αντλία αδειάζει τα 5/12 μιας δεξαμενής πετρελαίου σε 5/6 της ώρας. Σε πόσες ώρες θα αδειάσει η αντλία ολόκληρη τη δεξαμενή; Α. 2 Β. 2,5 Γ. 3 Δ. 3,5 32. Δύο κεφάλαια που διαφέρουν κατά 32700€ τοκίζονται με το ίδιο επιτόκιο. Το μεγαλύτερο τοκίζεται για 8 μήνες και φέρνει

τόκο 5280€. Το άλλο για 10 μήνες δίνει τόκο 5237,50€. Να βρεθεί το κοινό επιτόκιο. Α. 4% Β. 5% Γ. 6% Δ. 6,5% 33. Ανεβαίνουμε βαδίζοντας μια ανηφόρα με 30 m το λεπτό, κάνουμε μία δεκάλεπτη στάση και επιστρέφουμε βαδίζοντας πάλι με 50 m το λεπτό. Αν ο συνολικός χρόνος ήταν 90 λεπτά, η απόσταση σε μέτρα ήταν: Α. 800 Β. 1200 Γ. 1500 Δ. 1800 34. Ενα παιδί που ρωτήθηκε για την ηλικία του αποκρίθηκε: «Το διπλάσιο της ηλικίας μου είναι κατά 20 έτη, 2 μήνες και 24 ημέρες μικρότερο από την ηλικία του πατέρα μου, ενώ το πενταπλάσιο αυτής ξεπερνάει την ηλικία του πατέρα μου κατά 16 έτη και 11 μήνες». Ποια ήταν η ηλικία του πατέρα; Α. 45 Β. 46 Γ. 44 Δ. 43 35. Αλυσίδα καταστημάτων ηλεκτρικών ειδών αγόρασε 200 τηλεοράσεις προς 392,5 ευρώ τη μία. Πλήρωσε 5 ευρώ για τη μεταφορά κάθε τηλεόρασης και 500 ευρώ συνολικά για την αποθήκευσή τους. Αν τελικά βρέθηκε κέρδος 25% επί του κόστους, πόσα ευρώ πουλήθηκε κάθε τηλεόραση; Α. 200 Β. 300 Γ. 400 Δ. 500 36. Μια συναλλαγματική προεξοφλήθηκε με εσωτερική υφαίρεση με επιτόκιο 12% αντί 1400€ και 8 μήνες πριν τη λήξη του. Πόση είναι η εσωτερική υφαίρεση και ποια η ονομαστική του αξία; Α. 112 & 1512€ Β. 120 & 1520€ Γ. 150 & 1550€ Δ. 200 & 1600€ 37. Πόσα κιλά νερού πρέπει να εξατμιστούν από διάλυμα 140 κιλών νερού με αλάτι, περιεκτικότητας 20% σε αλάτι ώστε να προκύψει διάλυμα περιεκτικότητας 56% σε αλάτι; Α. 10 Β. 70 Γ. 50 Δ. 90 38. Ενα αγρόκτημα σχήματος ορθογωνίου παραλληλογράμμου έχει εμβαδόν 10 στρέμματα. Αν μειώσουμε τις διαστάσεις του στο μισό το εμβαδόν του θα είναι σε τετραγωνικά μέτρα: Α. 5000 Β. 7500 Γ. 250 Δ. 2500 39. Ενα κρουαζιερόπλοιο έχει τρόφιμα για 15 μέρες. Μια ομάδα 40 ατόμων λόγω κάποιας δυσκολίας δεν ήρθαν. Τα υπόλοιπα άτομα ελάττωσαν τη μερίδα τους κατά 0,25 για να περάσουν 25 μέρες. Πόσα άτομα δήλωσαν αρχικά συμμετοχή; Α. 180 Β. 200 Γ. 220 Δ. 240 40. Σε τρεις ακτήμονες μοιράστηκε έκταση 116 στρεμμάτων ανάλογα με τους αριθμούς 1/3, 1/4, 2/9. Πόσα στρέμματα πήρε ο πρώτος; Α. 50 Β. 48 Γ. 52 Δ. 46

ΛΕΚΤΙΚΕΣ ∆ΕΞΙΟΤΗΤΕΣ - ΙΚΑΝΟΤΗΤΕΣ 1) Αντίθετο του απεχθής είναι : Α. Συμπαθής Β. Σιχαμερός Γ. Αποκρουστικός Δ. Αντιπαθής 2) Πώς λέγεται η επιβεβαίωση της εγκυρότητας ενός εγγράφου; Α. Ακύρωση Β. Επισημοποίηση Γ. Χαρτοσήμανση Δ. Επικύρωση 3) Μεταξύ των συνωνύμων έχει παρεισφρήσει ένα αντίθετο : Α. Αναμφισβήτητος Β. Αδιαφιλονίκητος


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΑΣΕΠ

ΕΘΝΙΚΗΣ ΤΡΑΠΕΖΑΣ

απαντήσεις Γ. Αβέβαιος Δ. Αναντίρρητος 4) Συνώνυμο της λέξης ζωηρός είναι : Α. Αλέγρος Β. Νωχελικός Γ. Κουρασμένος Δ. Αργός 5) Τι σημαίνει η έκφραση «εμπεριστατωμένη γνώμη»; Α. Ανάλογα με τις περιστάσεις Β. Επίσημη γνώμη Γ. Έγκυρη, αυθεντική γνώμη Δ. Κατευθυνόμενη κοινή γνώμη 6) Πώς λέγεται η συμπληρωματική αμοιβή πέραν του βασικού μισθού; Α. Σύνταξη Β. Επιμίσθιο Γ. Επίδομα Δ. Επιδότηση 7) Ενας όρος δεν αποδίδει προσωπική αρετή του ηγέτη : Α. Ψυχραιμία Β. Τόλμη Γ. Προκατάληψη Δ. Διορατικότητα 8) Δεν έχει την ίδια σημασία με τα υπόλοιπα: Α. Απόφθεγμα Β. Γνωμικό Γ. Νομολογία Δ. Ρητό 9) Ποιο δεν είναι συνώνυμο της λέξης κοπετός; Α. Σπαραγμός Β. Κόπος Γ. Κλαυθμός Δ. Οδυρμός 10) Ποιο δεν είναι συνώνυμο της λέξης αυτοδιάθεση; Α. Ετερονομία Β. Ανεξαρτησία Γ. Αυτοδυναμία Δ. Αυτονομία 11) Η έριδα δεν λέγεται : Α. Αντιδικία Β. Διαμάχη Γ. Εχθρότητα Δ. Ερεισμα 12) Σε ένα ζευγάρι δεν βρίσκουμε συνώνυμα: Α. Απόρροια – έκβαση Β. Επακόλουθο – απόληξη Γ. Συνέπεια – πόρισμα Δ. Προϊόν – προμήθεια 13) Μια απόφαση είναι : Α. Ευδιάκριτη Β. Αμετάκλητη Γ. Κοινότοπη Δ. Ατελής 14) Σε ένα ζευγάρι απουσιάζουν τα συνώνυμα: Α. Προσωρινός – πρόσκαιρος Β. Φευγαλέος – στιγμιαίος Γ. Εφήμερος – ετήσιος Δ. Μεταβατικός – διαβατικός 15) Ενα ρήμα δεν είναι αντίθετο με το αρχικό: Α. Σβήνω – ανάβω Β. Μειώνω – αυξάνω Γ. Ερμηνεύω – μεταφράζω Δ. Διαφοροποιούμαι – ταυτίζομαι 16) Από ένα ζευγάρι απουσιάζουν τα αντώνυμα: Α. Κατηγορία – υπεράσπιση Β. Προτροπή – νουθεσία

17

Γ. Δαπάνη – αποταμίευση Δ. Προσλαμβάνομαι – απολύομαι 17) Να βρεις δυο άλλα ουσιαστικά που έχουν την ίδια σημασία με το πρώτο: Α. Συμφωνία : συνθήκη, προδοσία Β. Διάρρηξη : θραύση, κάταγμα Γ. Πλαίσιο : περίμετρος, παρέκκλιση Δ. Αντήχηση : συνήχηση, αντίλαλος 18) Χρησιμοποιήθηκε λάθος στερητικό μόριο: Α. Αρμόδιος – αναρμόδιος Β. Υλικός – άυλος Γ. Ευχάριστος – δυσάρεστος Δ. Εύχρηστος – άχρηστος 19) Με τη λέξη λογαριασμός δεν ταιριάζει το επίθετο: Α. Τραπεζικός Β. Ανοιχτός Γ. Συνειδητός Δ. Τρεχούμενος 20) Είναι συνώνυμα του ανεπίληπτος, εκτός από ένα: Α. Διαβλητός Β. Αμεμπτος Γ. Αψογος 21) Μια σειρά ανομοιωδών λέξεων, ανάμεσα στις τέσσερις, έχει παρεισφρήσει: Α. Συγκρότηση – σύσταση – οργάνωση – κατάρτιση Β. Ομάδα – όμιλος – αγέλη – σύνολο Γ. Ενσάρκωση – υλοποίηση – πραγμάτωση – επίτευξη Δ. Βοηθός – υφιστάμενος – κύριος – υποτακτικός 22) Να σχηματίσεις μια πρόταση με το ρήμα διαστρεβλώνω: Α. Με τα ρούχα μου Β. Την αλήθεια Γ. Το αίτημα Δ. Το νόημα 23) Να συνδυάσεις σωστά τις λέξεις : Α. Αποσύνθεση της διαδήλωσης Β. Παράταση της φοίτησης Γ. Οι επιπτώσεις της αγάπης Δ. Διάρκεια της φοίτησης 24) Τι σημαίνει συνημμένος; Α. Προσαρτημένος Β. Αυτός που μαζεύεται Γ. Αυτός που είναι συνεσταλμένος Δ. Συνεχής 25) Μία σύναψη λέξεων είναι λάθος : Α. Αποδίδω τιμές Β. Δικλείδα ανάγκης Γ. Συγκροτώ επιτροπή Δ. Αποδιοπομπαίος τράγος 26) Να αποκλείσεις την άστοχη σύναψη λέξεων: Α. Τοξικά απόβλητα Β. Φρούδες ελπίδες Γ. Διεξάγω ποδόσφαιρο Δ. Συντριπτική πλειοψηφία 27) Πετυχημένη σύναψη λέξεων : Α. Καθιστώ αντιληπτό

Β. Ανυπέρβλητο συμφέρον Γ. Αρχουσα τάξη Δ. Γέφυρα χωρισμού 28) Η λέξη «υπεξαιρώ» σημαίνει Α. Κλέβω Β. Εξαιρώ Γ. Συναιρώ Δ. Καθαιρώ 29) Η λέξη «μηχανορραφώ» σημαίνει Α. Μολύνω Β. Χαλκεύω Γ. Τρομάζω Δ. Μεγαλορρημονώ 30) Στην πρόταση «Απαγορεύεται να καπνίζετε», ο τύπος να καπνίζετε συντακτικά είναι: Α. Αντικείμενο Β. Υποκείμενο Γ. Κατηγορούμενο Δ. Επιρρηματικός προσδιορισμός

ΑΓΓΛΙΚΑ The warming of the Pacific Ocean creates weather patterns that affect the world. When the waters warm, the amount of rainfall in Indonesia and the surrounding region decreases. Australia could even experience a drought. On the other hand, Chile, which borders the Pacific Ocean, is preparing for severe rainstorms. In Pakistan and northwestern India, the weather pattern makes the monsoon season weaker and makes the area much drier. This phenomenon is called El Nino and is used by weather forecasters to make long – range weather predictions. Forecasters know that El Nino will bring unusually heavy rains to the south western part of the United States and make the central part of the country drier. El Nino itself used to be predictable. It would occur every two to seven years. But now, the

weather pattern is becoming more constant. Scientists are unsure of the reason for this change.

QUESTIONS: 1. What would characterize the effects of El Nino? A. They΄re widespread. B. They΄re benign. C. They΄re short - lived. D. They΄re decreasing. 2. What phenomenon defines El Nino? A. The rainstorms in Australia. B. The drought in Chile. C. The warming of the Pacific Ocean. D. The dryness of southwestern U.S. 3. Which region will be abnormally wet? A. Pakistan B. Australia C. Southwestern U.S. D. Central U.S. 4. Which is not an effect of El Nino? A. Droughts B. Heavy rainfalls C. Weak monsoons

ΟΙ ΑΠΑΝΤΗΣΕΙΣ: ΓΛΩΣΣΙΚΕΣ ΔΕΞΙΟΤΗΤΕΣ – ΙΚΑΝΟΤΗΤΕΣ: 1Α,2Δ, 3Γ, 4Α, 5Γ, 6Β, 7Γ, 8Γ, 9Β, 10Γ, 11Δ, 12Δ, 13Β, 14Γ, 15Γ, 16Β, 17Δ, 18Δ, 19Δ, 20Α, 21Δ, 22Β, 23Δ, 24Α, 25Β, 26Γ, 27Γ, 28Α, 29Β, 30Β ΜΑΘΗΜΑΤΙΚΕΣ ΔΕΞΙΟΤΗΤΕΣ – ΙΚΑΝΟΤΗΤΕΣ: 1Γ, 2Α, 3Α, 4Β, 5Γ, 6Γ, 7Δ, 8Δ, 9Α, 10Δ, 11Γ, 12Δ, 13Δ, 14Β, 15Δ, 16Β, 17Α, 18Β, 19Α, 20Γ, 21Α, 22Β, 23Β, 24Γ, 25Δ, 26Β, 27Β, 28Α, 29Α, 30Β, 31Α, 32Β, 33Γ, 34Α, 35Δ, 36Α, 37Δ, 38Δ, 39Β, 40Β ΑΓΓΛΙΚΑ 1Α,2C, 3C, 4D,5D,6D,7B, 8C, 9A, 10B, 11C, 12D, 13C, 14B, 15A

VOCABULARY: 5.

6. 7. 8. 9. 10. 11. 12. 13. 14. 15.

John is very persistent. He won’t ____no matter how difficult it is. He’ll keep trying. A let on B keep up C break up D give up What is your opinion of the class?’‘Actually, I _____ like the subject nor the teacher.” A also B either C both D neither I am always _______ of my mistakes. A remembered B reminded C represented D suggested What’s your _____ status? Are you married? A single B martial C marital D engagement He put his life at ____ trying to save the little girl from drowning in the lake. A risk B danger C threat D fear The doctor _______ me about the bad effects of smoking. A showed B warned C discussed D explained __________ speaking, most students have to study for weeks to pass the exam. A Completely B Extensively C Generally D Scarcely I have _____ behind in my work. I will need a couple of days to catch up. A taken B removed C kept D fallen The soldier _____ his orders without questioning them. A made out B did up C carried out D fell through His ______ over the last years is incredible. I have never seen anyone so tall. A increase B growth C expression D benefit John is always late. It is highly ______that he will be on time for his business appointment this evening A unlikely B unfortunately C impossibly D improbably


18

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Η «µάχη» της... Εθνικής Τράπεζας

«Ο βυθός µέσα από τη µάσκα µου» Με στόχο την περιβαλλοντική ευαισθητοποίηση των μαθητών μέσω της εικαστικής έκφρασης, το Δίκτυο ΜΕΣΟΓΕΙΟΣ SOS και το εκπαιδευτικό πρόγραμμα ΟΙΚΑΔΕ της Τράπεζας Κύπρου διοργανώνουν για άλλη μία χρονιά έκθεση μαθητικής καλλιτεχνικής δημιουργίας. Η έκθεση, η οποία θα πραγματοποιηθεί το ερχόμενο Σαββατοκύριακο στο σταθμό του μετρό Συντάγματος στην Αθήνα, γίνεται στο πλαίσιο μαθητικού διαγωνισμού στον οποίο συμμετείχαν 3.080 μαθητές από σχολεία και καλλιτεχνικά εργαστήρια όλης της χώρας με ζωγραφιές, φωτογραφίες, κολάζ και θεατρικά κείμενα. Παράλληλα με την έκθεση θα λειτουργούν καλλιτεχνικά εργαστήρια για παιδιά από τις 10.00 έως τις 17.00. Κατά τη διάρκειά τους, τα παιδιά θα έχουν τη δυνατότητα να παίξουν παιχνίδια και να μάθουν για τα θαλάσσια είδη, να φτιάξουν κατασκευές σε πέτρες θαλάσσης, να ζωγραφίσουν σε μπαλόνια, να φανταστούν και να φτιάξουν το δικό τους βυθό.

Εθελοντική αιµοδοσία στο ΑΠΘ Εθελοντική αιμοδοσία πραγματοποιείται σήμερα και την ερχόμενη Τετάρτη 21 Απριλίου, από τις 9.00 έως τις 12.30, στην αίθουσα τελετών του ΑΠΘ, με στόχο την ενίσχυση της τράπεζας αίματος του ΑΠΘ. Από το Νοέμβριο του 2001 έως σήμερα, η τράπεζα αίματος της Επιτροπής Κοινωνικής Πολιτικής, ανταποκρινόμενη στις ανάγκες τόσο των μελών της πανεπιστημιακής κοινότητας όσο και των συγγενικών τους προσώπων, έχει εκδώσει 900 εντολές χορήγησης αίματος, ενώ έχει διαθέσει 1.800 φιάλες αίματος σε ασθενείς που απευθύνθηκαν σε αυτήν. Παράλληλα, διαθέτει περίπου 500 τακτικά μέλη και ο αριθμός των εθελοντών αιμοδοτών αυξάνεται ενθαρρυντικά σε κάθε νέα αιμοληψία.

Στην «εκκίνηση» 16.000 υποψήφιοι για 230 θέσεις

Το πρωί του Σαββάτου 17 Απριλίου περίπου 16.000 υποψήφιοι καλούνται να δώσουν τη «μάχη» με την ελπίδα να κατακτήσουν κάποια από τις 230 θέσεις υπαλλήλων του κλάδου κύριου προσωπικού που προκήρυξε η Εθνική Τράπεζα μέσω του ΑΣΕΠ. Ο διαγωνισμός θα διεξαχθεί στα 109 εξεταστικά κέντρα, όπως έχει ανακοινωθεί, σε διάστημα τεσσάρων ωρών (από τις 10.00 έως και τις 14.00). Οι ενδιαφερόμενοι θα πρέπει να προσέλθουν στο εξεταστικό κέντρο που τους έχει οριστεί το αργότερο μία ώρα πριν από την έναρξη της εξέτασης, δηλαδή από τις 9.00, προκειμένου να γίνει ο απαραίτητος έλεγχος, ενώ στην αίθουσα θα πρέπει να βρίσκονται το αργότερο μισή ώρα πριν από την εξέταση. Στις 9.30 θα κλείσουν οι πόρτες των εξεταστικών κέντρων και δε θα επιτρέπεται η είσοδος σε κανέναν. Οι εξεταζόμενοι θα πρέπει να έχουν μαζί τους την αστυνομική τους ταυτότητα ή το διαβατήριο ή άλλο έγγραφο με επικυρωμένη φωτογραφία (όπως το δίπλωμα οδήγησης). Κατά την εξέταση θα πρέπει να έχουν μαζί τους δύο στυλό και, αν το επιθυμούν, ένα θερμός με νερό ή αναψυκτικό. Οι υποψήφιοι θα πρέπει να γνωρίζουν ότι μέσα στην αίθουσα απαγορεύεται το κάπνισμα, ενώ τα κινητά θα πρέπει να είναι κλειστά και τοποθετημένα στο πάτωμα δίπλα στους εξεταζομένους. Σύμφωνα με τη σχετική ανακοίνωση του ΑΣΕΠ, οι υποψήφιοι απαγορεύεται να έχουν μαζί τους βιβλία, γραπτές σημειώσεις ή οποιαδήποτε άλλα βο-

ηθήματα, καθώς και υπολογιστικές μηχανές. Οταν δοθούν από τους επιτηρητές τα ειδικά απαντητικά φύλλα, οι υποψήφιοι θα πρέπει να ελέγξουν την ορθότητα των στοιχείων που αναγράφονται στην αυτοκόλλητη ετικέτα και στη συνέχεια να υπογράψουν στον προβλεπόμενο χώρο, φροντίζοντας η υπογραφή να μη βγαίνει έξω από το προκαθορισμένο πλαίσιο και αλλοιώσει το barcode. Οι διαγωνιζόμενοι θα μπορούν να βγουν από την αίθουσα το νωρίτερο σε μια ώρα από την έναρξη της εξέτασης, αφού παραδώσουν στους επιτηρητές το απαντητικό τους φύλλο μαζί με όλο το υπόλοιπο έντυπο υλικό που θα τους έχει διανεμηθεί

Ηµερίδα για το ζήτηµα της µονής Εσφιγµένου «Το ζήτημα της Ιεράς Μονής Εσφιγμένου Αγίου Ορους», ένα πρόβλημα που ταλανίζει εδώ και δεκαετίες το Αγιον Ορος, το Οικουμενικό Πατριαρχείο, την ελληνική Δικαιοσύνη και την Πολιτεία, θα βρεθεί στο επίκεντρο ημερίδας που διοργανώνουν το Τμήμα Θεολογίας της Θεολογικής Σχολής του ΑΠΘ, η Αγιορειτική Εστία και ο Σύλλογος Φίλων της Ιεράς Μονής Εσφιγμένου. Ο αρχιτέκτονας του Κέντρου Διαφύλαξης Αγιορειτικής Κληρονομιάς, Φαίδων Χατζηαντωνίου, θα μιλήσει με θέμα «Η Ιερά Μονή Εσφιγμένου Αγίου Ορους», ενώ ο δικηγόρος Διογένης Καραγιαννακίδης θα αναπτύξει μια διαφορετική πλευρά του ζητήματος με θέμα «Το φαινόμενο ‘’Εσφιγμένου’’ ως πρόβλημα της Αγιορειτικής Αυτοδιοίκησης». Τη θέση του Φαναρίου, από «Εκκλησιαστική-Εκκλησιολογική προσέγγιση», θα παρουσιάσει ο αρχιγραμματέας της Ιεράς Συνόδου του Οικουμενικού Πατριαρχείου, Ελπιδοφόρος Λαμπρυνιάδης. Της συζήτησης θα προηγηθεί η προβολή του ντοκιμαντέρ του Νίκου Αναγνωστόπουλου «Ει έχεις καρδίαν, δύνασαι σωθήναι…». Η εκδήλωση θα φιλοξενηθεί στην Αποθήκη Δ’ (λιμάνι, Α’ προβλήτας), αύριο στις 19.00, ενώ θα μεταδίδεται απευθείας στην ηλεκτρονική σελίδα www. livemedia.gr.

Βράβευση νικητών σε διαγωνισµό υδραυλικών

Οι υποψήφιοι θα διαγωνιστούν σε 109 εξεταστικά κέντρα για 230 θέσεις και αφού υπογράψουν στην κατάσταση παρόντων. Οι επιτηρητές, αφού ελέγξουν τα στοιχεία που αναγράφονται στο απαντητικό φύλλο, παρουσία του υποψηφίου, θα πρέπει να τα καλύψουν με μαύρο αυτοκόλλητο και να υπογράψουν στα προκαθορισμένα σημεία. Επίσης, θα πρέπει να καταστρέψουν τα βοηθητικά έντυπα. Ολες οι λεπτομέρειες για τη διαδικασία, καθώς και τα εξεταστικά κέντρα δημοσιεύονται στις ιστοσελίδες του ΑΣΕΠ (www.asep.gr) και της Εθνικής Τράπεζας (www.nbg.gr). ΔΗΜΗΤΡΗΣ ΤΣΕΚΙΤΣΙΔΗΣ

Οι μαθητές που διακρίθηκαν στο διαγωνισμό υδραυλικών εγκαταστάσεων που διοργάνωσε το Ελληνικό Ινστιτούτο Ανάπτυξης Χαλκού βραβεύτηκαν την Τρίτη 23 Μαρτίου στην αίθουσα εκδηλώσεων της ΕΠΑΣ Νεαπόλεως στη Θεσσαλονίκη. Στους τρεις βραβευθέντες μαθητές, Γιώργο Καραγιάννη, Φίλιππο Παπαλεξίου και Ιωάννη Σακκίδη, απονεμήθηκε τιμητική πλακέτα για την άριστη απόδοσή τους κατά τη διάρκεια του διαγωνισμού, ενώ ο γενικός διευθυντής του ΕΙΑΧ, Νίκος Βεργόπουλος, επισήμανε τη σπουδαιότητα του διαγωνισμού, που προάγει τον επαγγελματισμό και την αξιοπιστία στο επάγγελμα των θερμοϋδραυλικών και ανακοίνωσε την πρώτη επίσημη καθιέρωση του σήματος Cu+ στα προϊόντα του χαλκού, που σηματοδοτεί την αντιμικροβιακή του ιδιότητα.


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

Ξηλώνονται οι παράνοµες διαφηµιστικές πινακίδες Σε ένα ευρύ πρόγραμμα για την οδική ασφάλεια, στο πλαίσιο του οποίου θα εξεταστεί η αναμόρφωση του Κώδικα Οδικής Κυκλοφορίας και θα αρχίσει η αποξήλωση όλων των παράνομων διαφημιστικών πινακίδων στις μεγάλες πόλεις της χώρας, προχωρά η κυβέρνηση. Στο τέλος Απριλίου θα συνεδριάσει για πρώτη φορά η αρμόδια διυπουργική επιτροπή που συστήθηκε για την οδική ασφάλεια, προκειμένου να εξετάσει τα σχεδιαζόμενα μέτρα, ώστε να κάνει τις σχετικές προτάσεις της. Στο πλαίσιο αυτό από τις 26 Απριλίου θα αρχίσει η αποκαθήλωση όλων των παράνομων πινακίδων της Αθήνας και άλλων μεγάλων πόλεων, σε συνεργασία με τις νομαρχίες της χώρας. Ο υπουργός Υποδομών, Μεταφορών και Δικτύων, Δημήτρης Ρέππας, χαρακτήρισε «αντιαισθητικό και επικίνδυνο τσουνάμι» τις υπαίθριες διαφημίσεις στην Ελλάδα, επισημαίνοντας ότι «δεν πάει άλλο». Από την πλευρά του, ο υφυπουργός, Νίκος Σηφουνάκης, τόνισε ότι από τις χιλιάδες υπαίθριες διαφημίσεις που υπάρχουν στη χώρα το 80% είναι παράνομες και ευθύνονται για μεγάλο ποσοστό τροχαίων ατυχημάτων, πολλά από τα οποία είναι θανατηφόρα. Για τις διαφημιστικές πινακίδες είπε ότι οι δήμοι θα ειδοποιούν όλους τους ενδιαφερόμενους φορείς, διαφημιστές, διαφημιζόμενους, ακόμη και πολίτες που έχουν επιτρέψει την ανάρτηση τέτοιων πινακίδων στις στέγες των σπιτιών τους. Θα δίνεται ένα περιθώριο 5 ημερών μέσα στο οποίο οι ενδιαφερόμενοι θα πρέπει να κατεβάσουν τις διαφημιστικές πινακίδες. Ηδη λειτουργεί διαδικτυακός τόπος στην ηλεκτρονική διεύθυνση www. illegalsignw. gov.gr, όπου κάθε πολίτης θα μπορεί να καταγγέλλει τις περιπτώσεις των παράνομων διαφημιστικών πινακίδων που υποπίπτουν στην αντίληψή του, προσδιορίζοντας οδό, αριθμό και περιοχή και επισυνάπτοντας και φωτογραφία, αν επιθυμεί. ΧΑΡΑ ΛΕΜΟΝΗ

ΡΕΠΟΡΤΑ Ζ

Εργα το βράδυ για ένα µήνα στην περιφερειακή οδό Αρχισε η ασφαλτόστρωση στο δρόµο, που εξυπηρετεί 100.000 οχήµατα ηµερησίως

Σε πολλά σημεία της περιφερειακής το οδόστρωμα είναι σε άθλια κατάσταση

Μετ’ εμποδίων γίνεται από χτες και για τις επόμενες 30 μέρες η κίνηση στην περιφερειακή οδό της Θεσσαλονίκης τα βράδια.

Α

ιτία είναι η έναρξη των εργασιών αποκατάστασης και συντήρησης του οδοστρώµατος από τα συνεργεία της Περιφέρειας Κεντρικής Μακεδονίας. Οι οδηγοί καλούνται να δείξουν ιδιαίτερη προσοχή στα σηµεία όπου είναι στηµένα εργοτάξια τις νυχτερινές ώρες, καθώς µετά τις 5.30 το πρωί ο δρόµος θα είναι ελεύθερος µέχρι τις 20.30. Ο προϋπολογισµός των εργασιών είναι 500.000 ευρώ και επικεντρώνονται στην αποκατάσταση των φθορών του ασφαλτοτάπητα, που ανακατασκευάζεται στο σύνολό του, στους κύριους κλάδους της περιφερειακής µεταξύ του κόµβου προς οδό Μοναστηρίου – εθνική οδό Θεσσαλονίκης – Εδεσσας και του κόµβου συµβολής της εθνικής οδού Θεσσαλονίκης – Νέων Μουδανιών. Οι εργασίες κρίθηκαν απαραίτητες για την οδική ασφάλεια, αφού όπως είπε η γενική γραµµατέας της Περιφέρειας, Μαρία Λιονή, «σκοπός µας είναι να διατηρήσουµε σε καλή κατάσταση το οδόστρωµα µιας από τις σηµαντικότερες αρτηρίες για τις µετακινήσεις στο ευρύτερο πολεοδοµικό συγκρότηµα και το νοµό. Στόχος µας είναι να αποκαταστήσουµε βλάβες και φθορές, που είναι λογικό να υπάρχουν ανά τακτά διαστήµατα, δεδοµένου ότι ο συγκεκριµένος δρόµος σχεδιάστηκε για µικρότερους κυκλοφοριακούς φόρτους από τα περισσότερα των 100.000 οχηµάτων που εξυ-

Ειδικές επεμβάσεις θα γίνουν στην περιοχή της Τούμπας (οδός Διαγόρα)

πηρετεί σήµερα ηµερησίως».

Επεµβάσεις Χτες, από τις 20.30 άρχισαν τα έργα µε κατάληψη της δεξιάς λωρίδας κυκλοφορίας και µια ώρα αργότερα επεκτάθηκαν και στη µεσαία. Ανοιχτή παραµένει πάντα µια λωρίδα, προκειµένου να µην κλείνει ο δρόµος. Σύµφωνα µε τον προγραµµατισµό των υπηρεσιών, τα τµήµατα στα οποία θα επικεντρωθούν οι αποκαταστάσεις του οδοστρώµατος είναι: Προς δυτικά: Κ12 (εθνική οδός Θεσσαλονίκης - Μουδανιών) – Κ11 (κόµβος Πανοράµατος) 1.500 µέτρα, Κ11 – Τούνελ 350 µ., Τούνελ – Κ10 (Πυλαία) 200 µ., Κ9 (Τριανδρία) – Κ8 (Τούµπα) 300 µ., Ωραιοκάστρου – Μακρυγιάννη 750 µ., Μακρυγιάννη – Μαιάνδρου 1.800 µ. Προς ανατολικά: Μακρυγιάννη – Μαιάνδρου 1.100 µ., Κόµβος Μακρυγιάννη 50 µ., Μακρυγιάννη – Ωραιοκάστρου 500 µ., Κ7 (Επταπύργιο) – Κ8 500 µ., Κ8 – Κ9 1.000 µ., Κ10 – Τούνελ 500 µ., Κ11 – Κ12 2.000 µ., έξοδος για Χαλκιδική 60 µ.

Μακρυγιάννη Στον κόµβο της Μακρυγιάννη θα εκτελεστούν πρόσθετες εργασίες επέκτασης της διαχωριστικής νησίδας του κλάδου µε κατεύθυνση προς τα δυτικά (µε στόχο την επιµήκυνση της λωρίδας αναµονής για στροφή προς την περιοχή της Ηλιούπολης), καθώς και ορισµένες συµπληρωµατικές παρεµβάσεις.

Μοναστηρίου Επίσης, ένα Σάββατο (κατόπιν συ-

νεννόησης µε το αρµόδιο Τµήµα Τροχαίας) θα ανακατασκευαστεί το οδόστρωµα του κόµβου προς Μοναστηρίου – εθνική οδό Θεσσαλονίκης – Εδεσσας. Για την ασφαλή ανάπτυξη του εργοταξίου θα αποκλειστεί τοπικά η πρόσβαση της περιφερειακής οδού από και προς την οδό Μοναστηρίου. Τα οχήµατα που κινούνται προς δυτικά επί της περιφερειακής οδού θα συνεχίζουν την πορεία τους µέχρι τον επόµενο κόµβο της Συµµαχικής οδού, µέσω της οποίας θα µπορούν να στραφούν προς τη Μοναστηρίου. Τα οχήµατα που κινούνται και στους δυο κλάδους της οδού Μοναστηρίου θα εισέρχονται στην περιφερειακή οδό µέσω της οδού Μιαούλη. Η έναρξη των εργασιών θα γίνει τις πρώτες πρωινές ώρες µέχρι το απόγευµα της ίδιας µέρας, οπότε ο κόµβος θα παραδοθεί εκ νέου στην κυκλοφορία.

∆ιαγόρα Για ένα βράδυ (κατόπιν συνεννόησης µε το αρµόδιο Τµήµα Τροχαίας) στην απόληξη της οδού Διαγόρα (Κ9) στον κλάδο µε κατεύθυνση προς ανατολικά θα εκτελεστούν εργασίες ασφαλτόστρωσης µε αποκλεισµό της ανόδου της οδού Διαγόρα προς τον αντίστοιχο κλάδο της περιφερειακής οδού. Τα οχήµατα που θα κατευθύνονται από την άνοδο της οδού Διαγόρα και επιθυµούν να κινηθούν προς τα ανατολικά θα εισέρχονται στον κλάδο µε κατεύθυνση προς τα δυτικά και µέσω του κόµβου Αγίου Παύλου θα µπορούν να αναστρέφουν προς τον κλάδο µε κατεύθυνση προς τα ανατολικά.

19


20

ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Στα ύψη οι τιµές, κάτω οι δουλειές Πάνω από το 1,5 ευρώ εκτοξεύτηκε η αµόλυβδη, ενώ η κίνηση στα πρατήρια υγρών καυσίµων µειώθηκε κατά 35%-50% προς τα πάνω την ώρα που η κίνηση στα πρατήρια υγρών καυσίµων συνεχίζει να είναι καθοδική. «Η πτώση ξεκίνησε τον Ιανουάριο και σταδιακά γίνεται όλο και µεγαλύτερη. Τον τελευταίο µήνα, µετά τις διαδοχικές αυξήσεις του φόρου, διαπιστώνουµε ότι ελάχιστοι έρχονται πλέον και η πτώση µπορεί να ξεπερνά ακόµη και το 50%», σηµείωσε ο Ανδρέας Χαλδέζος, γενικός γραµµατέας της Ενωσης Πρατηριούχων Θεσσαλονίκης. Ακόµη µεγαλύτερη ήταν η αύξηση στην τιµή του πετρελαίου θέρµανσης, που έχει πλησιάσει τα 70 λεπτά το λίτρο. Η αύξηση της τιµής µέσα στον τελευταίο µήνα ξεπέρασε το 15%, καθώς από τα 60 - 62 λεπτά έφτασε τα 68 - 69 λεπτά το λίτρο. Το αποτέλεσµα είναι ακόµη και όσοι ήθελαν να προµηθευτούν πετρέλαιο για τις επόµενες ηµέρες (η διάθεση του πετρελαίου λήγει στις 30 Απριλίου), αλλά και για τις αρχές του επόµενου χειµώνα, να είναι επιφυλακτικοί και να το αναβάλλουν. «Οι τιµές ανέβηκαν µέχρι και 10 λεπτά τις τελευταίες 15 ηµέρες και έτσι όσοι περίµεναν να µειωθούν για να γεµίσουν τις δεξαµενές των σπιτιών τους τώρα βρίσκουν ακριβότερα το πετρέλαιο. Η σεζόν ολοκληρώνεται για εµάς µε σηµαντική πτώση του τζίρου κατά 35% σε σύγκριση µε πέρσι, που ήταν η χειρότερη, µέχρι τότε, χρονιά. Από το ποσοστό αυτό το 30% οφείλεται στις καλές καιρικές συνθήκες και τον ήπιο χειµώνα και το 5% στην αδυναµία πληρωµών και τη µειωµένη αγοραστική δύναµη των καταναλωτών», τόνισε ο Γιάννης Αγάντας, πρόεδρος του Σωµατείου Μεταπωλητών Υγρών Καυσίµων Νοµού Θεσσαλονίκης.

ΡΕΠΟΡΤΑΖ ΒΑΣΙΛΗΣ ΠΕΚΛΑΡΗΣ

Στα ύψη, ακόμη και πάνω από το 1,5 ευρώ το λίτρο, έχει εκτοξευτεί τις τελευταίες ημέρες η τιμή της απλής αμόλυβδης βενζίνης. Την ίδια ώρα, και το πετρέλαιο θέρμανσης «εκτινάχτηκε» έως και 15% μέσα στον τελευταίο μήνα, αγγίζοντας ακόμη και τα 70 λεπτά το λίτρο.

Λίγο πάνω από 1,40 ευρώ/λίτρο πωλείται η αμόλυβδη στα περισσότερα πρατήρια της Θεσσαλονίκης

Ο

ι πρατηριούχοι βλέπουν όλο και λιγότερα αυτοκίνητα να εφοδιάζονται µε βενζίνη και κάνουν λόγο για σταδιακή µείωση της κίνησης τουλάχιστον κατά 50%. Οι ανοδικές τάσεις στις διεθνείς τιµές του πετρελαίου (85 δολάρια το µπρεντ), κυρίως όµως η σηµαντική αύξηση των τιµών διυλισµένων προϊόντων (Platts Μεσογείου) και πάνω από όλα η σηµαντική ενίσχυση του δολαρίου έναντι του ευρώ έχουν οδηγήσει στην «κούρσα» των τιµών των καυσίµων. Με τις τιµές των υγρών καυσίµων να έχουν ανέβει σε πολύ υψηλά επίπεδα τον τελευταίο µήνα, λόγω των αλλεπάλληλων αυξήσεων στους φόρους, δεν έχουν εκλείψει οι σηµαντικές αποκλίσεις, αφού ακόµη και σε γειτονικά πρατήρια που βρίσκονται στον ίδιο δρόµο καταγράφονται διαφορές πάνω από 10 λεπτά το λίτρο. Ταυτόχρονα, οι αποκλίσεις διατηρούνται και µεταξύ των νοµών, µε τη διαφορά να ξεπερνά τα 15 λεπτά (π.χ. οι νοµοί Κιλκίς και Θεσσαλονίκης που διαθέτουν τη φτηνότερη αµόλυβδη µε τους νοµούς της Κρήτης και τη Χίο που έχουν την ακριβότερη). Σύµφωνα µε τα στοιχεία του υπουργείου Περιβάλλοντος από τις τιµοληψίες, την τελευταία εβδοµάδα, η µέση τιµή της αµόλυβδης σε όλη τη χώρα ανέβηκε στα 1,442 ευρώ/λίτρο, καταγράφοντας αύξηση τον τελευταίο µήνα κατά 3,5% (1,394 στις 10 Μαρτίου). Το ίδιο διάστηµα η τιµή διυλιστηρίου της απλής αµόλυβδης βενζίνης αυξήθηκε κατά 3,1% από τα 1.061 στα 1.094 ευρώ τα 1.000 λίτρα. Το θετικό, σύµφωνα µε παράγοντες της αγοράς καυσίµων, είναι ότι τις τελευταίες ηµέρες οι τιµές έχουν σταθεροποιηθεί, ενώ ήδη φάνηκαν και τα πρώτα σηµάδια αποκλιµάκωσης. Για πρώτη φορά η µέση τιµή της αµόλυβδης ανέβηκε πάνω από το 1,4 ευρώ και στη Θεσσαλονίκη, φτάνοντας στα 1,401 ευρώ/λίτρο. Σύµφωνα µε το Παρατηρητήριο Τιµών Υγρών Καυσίµων, τα πρατήρια της Θεσσαλονίκης διαθέτουν την αµόλυβδη από 1,369 ευρώ έως και 1,599 ευρώ/λίτρο. Στα περισσότερα πρατήρια οι τιµές βρίσκονται περίπου στο 1,39 έως 1,47 ευρώ/λίτρο.

Πτώση τζίρου 50% Οι τιµές της βενζίνης «τρέχουν»

Τουλάχιστον κατά 50% μειώθηκε η κίνηση στα πρατήρια υγρών καυσίμων

«Απεταξάµην» τη δηµοτική Την προσήλωση της Εκκλησίας στην παράδοση του γλωσσικού ιδιώματος στο οποίο τελούνται οι λειτουργίες και τα ιερά μυστήρια επαναλαμβάνει η Ιερά Σύνοδος (ΔΙΣ), με αφορμή την απόφαση του μητροπολίτη Πρεβέζης Μελέτιου να επιτρέψει την τέλεσή τους στη δημοτική. «Οιαδήποτε μετάφραση λειτουργικών κειμένων μπορεί να δημιουργήσει προβλήματα στην ενότητα της Εκκλησίας», αναφέρεται στη σχετική ανακοίνωση, ωστόσο οι ιεράρχες αφήνουν ανοιχτό ένα παράθυρο, αφού επισημαίνουν ότι θα διευρυνθεί ο διάλογος για το θέμα με τη συμμετοχή και των θεολογικών σχολών. Η ΔΙΣ κάλεσε τον κ. Μελέτιο να δώσει εξηγήσεις, αλλά και να παραθέσει τη μετάφραση των λειτουργικών κειμένων που ακολούθησαν οι ιερείς της μητρόπολης στις λειτουργίες.

«Κοινό σημείο των συζητήσεων ήταν ότι η ορθόδοξη λατρεία και δη η Θεία Λειτουργία είναι ένας μεγάλος λειτουργικός πλούτος, τον οποίο μας παρέδωσαν οι Αγιοι Πατέρες και όλη η διαχρονική παράδοση, όπως θαυμάζεται από τους ετεροδόξους, σε συνδυασμό με την ποιμαντική προσπάθεια μυήσεως των πιστών στα γινόμενα και τελούμενα της θείας λατρείας», αναφέρει η ΔΙΣ και σημειώνει ότι «εμμένει στην παράδοση του γλωσσικού ιδιώματος του παραδεδομένου τρόπου τελέσεως της Θείας Λειτουργίας και των ιερών μυστηρίων». Παράλληλα, τονίζεται ότι ο μητροπολίτης που έχει ειδικό ρόλο ανάγνωσης των κειμένων σε μετάφραση θα πρέπει να λαμβάνει άδεια από τη ΔΙΣ.

«Ανοίγµατα» στους νέους «Μαζί με τους καθηγητές Ιωάννη Κογκού-

λη και Παναγιώτη Σκαλτσή έχουμε εκδώσει ήδη τη μετάφραση της Θείας Λειτουργίας. Η μελέτη αυτή περιλαμβάνει κείμενο, μετάφραση και σχόλια στη Θεία Λειτουργία. Αυτό το έργο μπορεί να χρησιμοποιείται στους ναούς ως βοήθημα των πιστών, ιδιαίτερα της νέας γενιάς, οι οποίοι δεν κατανοούν είτε τη γλώσσα, είτε τη θεολογία της θείας λατρείας. Ως εκ τούτου, το κείμενο της Θείας Λειτουργίας είναι σε απλή και κατανοητή γλώσσα. Εκείνο που προέχει είναι η εξοικείωση των ανθρώπων με τη βιωματική εμπειρία πρωτίστως της θείας λατρείας, χωρίς να παραγνωρίζεται και η γλωσσολογική διάσταση του κειμένου της Θείας Λειτουργίας», αναφέρει στον «Α» ο καθηγητής και πρόεδρος του Τμήματος Ποιμαντικής και Κοινωνικής Θεολογίας στη Θεολογική Σχολή του ΑΠΘ, Χρήστος Οικονόμου. ΣΟΦΙΑ ΠΑΚΑΛΙΔΟΥ


ΠΕΜΠΤΗ 15 AΠΡΙΛΙΟΥ 2010

Αντίστροφη µέτρηση για τις πανελλήνιες

Μαθήµατα Νανοτεχνολογίας στο 4ο ΓΕΛ Σταυρούπολης

Αρχίζουν στις 14 Μαΐου και χωρίς το βραχνά της βάσης του 10

Πρωτοποριακό πρόγραμμα που υλοποιείται σε ακόμα 25 σχολεία σε όλη την Ευρώπη

Ε Ι ∆ Ι Κ Η

Ε Κ ∆ Ο Σ Η

Τ Ο Υ

Θέµατα και λύσεις για Φυσική Θετικής και Τεχνολογικής Κατεύθυνσης, Βιολογία Θετικής Κατεύθυνσης σε συνεργασία µε τα φροντιστήρια «Πορεία»

Α Γ Γ Ε Λ Ι Ο Φ Ο Ρ Ο Υ


2

Πέμπτη 15 Α

άρθρο

Προσφορά και ζήτηση επαγγελμάτων Διαβλέποντας τις σύγχρονες τάσεις στην αγορά εργασίας αλλά και ΤΟΥ ΧΡΗΣΤΟΥ ΤΑΟΥΣΑΝΗ* το θολό τοπίο με τα διαρκώς αυξανόμενα ποσοστά ανεργίας, κρίνεται πιο καίριο από ΤΟΥ ΚΩΝΣΤΑΝΤΙΝΟΥ ΚΟΤΙΟΥ* ποτέ το ερώτημα για τα επαγγέλματα τα οποία θα έχουν αυξανόμενη ζήτηση στην αυριανή αγορά εργασίας. Πέρα από έρευνες και στατιστικά δεδομένα, θα πρέπει ο κάθε ενδιαφερόμενος να σταθμίσει πως υπάρχουν καθοριστικοί παράγοντες που συντελούν στην αύξηση της ζήτησης αλλά συνάμα και αστάθμητοι οι οποίοι συχνά διαταράσσουν το ισοζύγιο της προσφοράς και της ζήτησης επαγγελμάτων. Σχετικά πρόσφατα, το Δίκτυο Πληροφόρησης για την Απασχόληση (Ο*Νet), με το οποίο συνεργάζεται το αμερικανικό υπουργείο Εργασίας και Κατάρτισης, δημοσίευσε έρευνα με τα επαγγέλματα που θα έχουν τη μεγαλύτερη ζήτηση και τις ελκυστικότερες αποδοχές. Σαφώς τα εξαγόμενα δεδομένα δεν μπορούμε να τα επαληθεύσουμε αυτούσια και για την εγχώρια αγορά εργασίας, ωστόσο μπορούμε συνυπολογίζοντας σχετικές παραμέτρους να εξαγάγουμε και ανάλογα συμπεράσματα για την Ελλάδα. Στον κλάδο της υγείας, θεωρείται δεδομένη η έλλειψη του νοσηλευτικού προσωπικού, αλλά εξίσου δεδομένη είναι και η ύπαρξη χιλιάδων πτυχιούχων διαφόρων βαθμίδων. Τη διαφοροποίηση εδώ θα την επιτύχει ο αυριανός επαγγελματίας είτε συγκαταλέγεται στο ιατρικό είτε στο παραϊατρικό προσωπικό, ο οποίος θα συνδυάσει την ειδικότητά του με την αναπόδραστη εξειδίκευση - σύνθεσή της με την πληροφορική ή με τηλεφαρμογές (e-health) αλλά και με την προσθετική Ιατρική, τον καρκίνο, τα τροχαία ατυχήματα κ.λπ. Παράλληλα, έστω και αν στην Ελλάδα ο κλάδος της φαρμακοβιομηχανίας στηρίζεται σε μεγάλο ποσοστό στην εισαγωγή και όχι στην παραγωγή, η γιγάντωση του συγκεκριμένου κλάδου παγκοσμίως και η εμφάνιση νέων παθήσεων αναμένεται να επηρεάσει και την εγχώρια αγορά εργασίας στις ειδικότητες των βιοχημικών-βιοτεχνολόγων. Στον κλάδο του τουρισμού, αν και η παγκόσμια οικονομική κρίση έχει πλήξει ορατά όλες τις μορφές του, δεν πρέπει να παραβλέπουμε το γεγονός πως η ελληνική αγορά έστω και με αργά βήματα, αρχίζει να μεταμορφώνεται σε ένα all season προορισμό προσπαθώντας να αποτινάξει το ξεπερασμένο μοντέλο του κλασικού θερινού τουρισμού με αργές αλλά θετικές επιδράσεις στις ειδικότητες που μπορούν να δραστηριοποιηθούν στη βαριά βιομηχανία της χώρας μας. Στον κλάδο αυτό τα εξειδικευμένα στελέχη που θα συνδυάζουν γνώσεις και δεξιότητες από τους κλάδους του τουρισμού, της διοίκησης και του marketing θα μπορούν να διεκδικούν με αξιώσεις σοβαρό ρόλο στη «βαριά» βιομηχανία της χώρας μας ειδικά στα νέα μοντέλα τουρισμού, όπως ο αγροτουρισμός, ο συνεδριακός ή θρησκευτικός

τουρισμός, ο οικοτουρισμός κ.ά. Στον κλάδο της εκπαίδευσης και της ειδικής αγωγής, η αυξανόμενη -αν και καθυστερημένηεκδήλωση ενδιαφέροντος από τους σχετικούς φορείς, δίνει μια ώθηση στις ειδικότητες που σχετίζονται με την κοινωνική μέριμνα και τη φροντίδα των ΑΜΕΑ. Εδώ θα πρέπει να επισημανθεί πως, επειδή το δεδομένο αυτό δίνει μια έντονη προοπτική απασχόλησης στην ελληνική αγορά εργασίας, θα συντελέσει καθοριστικά η διαφοροποίηση του κάθε ενδιαφερόμενου -είτε είναι παιδαγωγός είτε είναι ψυχολόγος, είτε εκπαιδευτικός κ.λπ.- με συστηματική εμβάθυνση και εξειδίκευση σε συγκεκριμένο άξονα της ειδικής αγωγής η οποία θα προκύψει κατά κύριο λόγο με την πρόσκτηση ενός καινοτόμου μεταπτυχιακού τίτλου ή μιας εξειδικευμένης κατάρτισης - επιμόρφωσης π.χ. στη μέριμνα παιδιών με σύνδρομο ASPERGER. Επιπρόσθετα, δεν πρέπει σε καμία περίπτωση να παραβλέψουμε δυο σημαντικές παραμέτρους που θα επιδρούν μελλοντικά ακόμη περισσότερο στον κλάδο των εκπαιδευτικών και η είναι η γλωσσομάθεια και οι διαπολιτισμικές γνώσεις αλλά και η εξοικείωση και συστηματική αξιοποίηση των νέων τεχνολογιών. Η «πράσινη» αλλά και γενικότερα οι ανανεώσιμες πηγές ενέργειας είναι μια τάση η οποία θα επηρεάσει τόσο τον κλάδο των μηχανικών αλλά και των τεχνικών που θα ειδικευθούν σε αυτήν και, όσο καθυστερημένα και αν οι εξελίξεις επηρεάζουν και τη χώρα μας, αναμφίβολα θα συντελέσει στη δημιουργία νέων θέσεων εργασίας. Ειδικά στον κλάδο των τεχνικών - τεχνιτών που θα ειδικευθούν στο συγκεκριμένο επαγγελματικό πεδίο και στον εργασιακό τους ρόλο εμπεριέχεται σε ένα ποσοστό και χειρωνακτική απασχόληση, οι προοπτικές φαντάζουν ακόμη θετικότερες. Και επειδή γίνεται ιδιαίτερος λόγος για τα λεγόμενα «πράσινα» επαγγέλματα, τα οποία αναφέρονται διαρκώς, αλλά στην αντίληψη του κάθε ενδιαφερομένου είτε αυτός είναι μαθητής είτε φοιτητής ή και γονιός ελάχιστες φορές αποκωδικοποιούνται, αν θέλαμε να παραθέσουμε ορισμένα επιγραμματικά, κάποια από τα αυτά, τα οποία εμπίπτουν στην επονομαζόμενη αυτή κατηγορία, είναι το επάγγελμα του γεωπόνου φυτικής παραγωγής, γεωργού βιολογικής γεωργίας, γεωτεχνολόγου – περιβαλλοντολόγου, δασολόγου - περιβαλλοντολόγου, ειδικού γεωγραφικών συστημάτων - GIS , περιβαλλοντολόγου, τεχνικού βιολογικής-οικολογικής γεωργίας, τεχνολόγου αντιρρύπανσης, τεχνολόγου τοπογράφου Γεωπληροφορικής κ.ά. Αναμφίβολα, πέρα από όλα τα προαναφερθέντα, θα πρέπει να συνυπολογιστεί πως καθένας από εμάς, ανεξαρτήτως ειδικότητας και επαγγελματικής ταυτότητας, θα πρέπει βέβαια να συνεκτιμά δεδομένα που σχετίζονται με το επαγγελματικό του μέλλον, αρκεί να έχει ως πρώτιστο κριτήριο τις κλίσεις και τα ενδιαφέροντά του, καθώς μόνο έτσι, επιλέγοντας να ασκήσει ένα επάγγελμα του μέλλοντος, αυτό θα ταιριάζει και με το δικό του -επιτυχημένο- επαγγελματικό μέλλον. *Οι Χ. Ταουσάνης - Κ. Κότιος είναι σύμβουλοι σταδιοδρομίας της εταιρίας συμβούλων εκπαίδευσης και σταδιοδρομίας EMPLOY και υποψήφιοι διδάκτορες του Αριστοτέλειου Πανεπιστημίου Θεσσαλονίκης.

Αντίστροφη μέτρηση

Αλλαγές στον αριθμό των εισακτέων • Απαλλαγμένοι οι υ ΡΕΠΟΡΤΑΖ ΒΑΣΩ ΝΤΟΥΝΑ

Δυο μέρες μόλις μετά τη λήξη των μαθημάτων, στις 14 Μαΐου και χωρίς το βραχνά της βάσης του 10, θα ξεκινήσουν φέτος οι πανελλήνιες εξετάσεις για τους υποψηφίους των γενικών λυκείων.

Σ

υνολικά οι θέσεις για όλες τις κατηγορίες υποψηφίων ανέρχονται στις 88.165, ενώ 902 θέσεις δίνονται στην ομάδα Β των εσπερινών και ημερήσιων ΕΠΑΛ για πανεπιστήμια, ΤΕΙ και αστυνομικές και στρατιωτικές σχολές. Υπενθυμίζεται ότι όσοι δήλωσαν πως θα εξεταστούν στο μάθημα της Οικονομικής Θεωρίας πανελλαδικά ή ενδοσχολικά το Φεβρουάριο δεν μπορούν να αλλάξουν την επιλογή τους. Το πρόγραμμα των εξετάσεων έχει ήδη ανακοινωθεί και για κάθε εξεταζόμενο μάθημα η εξέταση διαρκεί τρεις ώρες. Οι υποψήφιοι μπορούν να προμηθεύονται από τώρα τα δελτία εξεταζομένου από τις διευθύνσεις του σχολείου τους. Χωρίς αυτό η εξέταση δεν επιτρέπεται, ενώ οι αλλοδαποί υποψήφιοι θα πρέπει να φροντίσουν να έχουν μαζί τους κατά την εξέταση το διαβατήριό τους είτε την ταυτότητα της χώρας καταγωγής τους. Στο μεταξύ, με τον ίδιο τρόπο θα γίνει και φέτος η βαθμολόγηση των γραπτών. Οι διορθωτές δεν θα σημειώνουν πάνω στο γραπτό τις παρατηρήσεις τους, όπως και πέρσι, ενώ σε περίπτωση διαφοράς 12 μονάδων (σ.σ. η βαθμολόγηση γίνεται στην κλίμακα 0-100) ανάμεσα στον πρώτο και το δεύτερο βαθμολογητή θα καλείται ο τρίτος. Και ενώ οι εισακτέοι στα ΤΕΙ αυξάνονται κατά 460, άλυτο παραμένει το ζήτημα της αναγνώρισης των επαγγελματικών δικαιωμάτων σε

25 ειδικότητες των ΤΕΙ και ΑΕΙ, το αναμένεται να λυθεί τον Ιούνιο. Π παρόν πάντως και έως τις 30 Απρι αντίστοιχα σχέδια των Προεδρικώ ταγμάτων για το ζήτημα δόθηκαν μόσια διαβούλευση. Αλλαγές στους εισακτέους Ανακατατάξεις στον αριθμό εισ στις σχολές του ΑΠΘ και του ΠΑΜΑ και στο ΑΤΕΙ- Θ έφεραν οι ανακο του υπουργείου για τον αριθμό τω νών εισακτέων στην τριτοβάθμια δευση. Συγκεκριμένα οι εισακτέο νονται συνολικά κατά 65. Βέβαια οι εισακτέοι θα είναι φέτος περισσ κατά 90. Συγκεκριμένα 20 επιπλέον δίνονται στα τμήματα Ζωικής Παρ και Μαιευτικής, δέκα επιπλέον άτ εισαχθούν στο τμήμα Νοσηλευτική 40 επιπλέον θέσεις δίνονται στο τμή γιστικής. Στο ΑΠΘ αυξάνονται κατά πέντ σεις των εισακτέων στο τμήμα Μηχ Χωροταξίας και Περιβάλλοντος που ει στη Βέροια, ωστόσο μειώνοντα πέντε οι εισακτέοι στα τμήματα Βιο Πληροφορικής και Οδοντιατρικής κ δέκα στο Ιστορικό Αρχαιολογικό. τατάξεις υπάρχουν και στο ΠΑΜΑΚ λιγότεροι κατά πέντε θα είναι φέτο σακτέοι στο τμήμα Εφαρμοσμένης φορικής και δέκα περισσότεροι στο Εκπαιδευτικής και Κοινωνικής Πολι Τις απογευματινές ώρες θα γίνο τος για πρώτη φορά οι εξετάσεις τ κών μαθημάτων. Πρόκειται για τη δ αλλαγή στον τρόπο εξέτασης των μαθημάτων μετά και την κατάργη μετάφρασης από τα διαγωνίσματα νων γλωσσών. Ετσι όλες οι ξένες γ θα εξεταστούν στις τέσσερις το από όπως επίσης και η Αρμονία για το ψηφίους των μουσικών σχολών, ε 11 το πρωί θα εξεταστούν το Ελεύθ το Γραμμικό Σχέδιο, των οποίων η ε διαρκεί έξι ώρες, όπως και ο έλεγχ σικών ικανοτήτων, η εξέταση του διαρκεί 20 λεπτά. Οι υποψήφιοι κα να προσέλθουν στις σες μισή ώ ρίτερα την ώ ταση οι ημ νίες καν σ Ιουνίο Τις τα Α αποστις 25 γευματιΕλεύθε νές ώρες θα γίνουν φέτος διο, στις για πρώτη φορά το Γρ οι εξετάσεις των στις 28 ειδικών μαθημάτων Γερμανικ 29 για τα


7

Απριλίου 2010

η για τις πανελλήνιες εξετάσεις

υποψήφιοι από το άγχος της βάσης του 10 • Οι αλλαγές των εισακτέων σε ΑΠΘ, ΠΑΜΑΚ, ΑΤΕΙ-Θ

ο οποίο Προς το ιλίου τα ών Διαν σε δη-

Στις 14 Μαΐου ξεκινούν οι πανελλήνιες εξετάσεις για την εισαγωγή σε ΑΕΙ-ΤΕΙ

Εξεταστικά Κέντρα Μπορεί από το υπουργείο Παιδείας να ανακοινώθηκε το πρόγραμμα των εξετάσεων, ωστόσο μέχρι στιγμής δεν έχουν δηλωθεί τα κατά τόπους εξεταστικά κέντρα. Το υπουργείο Παιδείας ενέκρινε 132 εξεταστικά κέντρα μόνο για τους υποψηφίους των ημερήσιων και εσπερινών ΕΠΑΛ της ομάδας Α και Β, από τα οποία δέκα προβλέπονται για τη Θεσσαλονίκη, πέντε στην ανατολική και πέντε στη δυτική πλευρά της. Από ένα εξεταστικό κέντρο θα λειτουργήσει στην ανατολική και δυτική Θεσσαλονίκη για τους αποφοίτους των παλιών ΤΕΕ και Ναυτικών Λυκείων. Την ίδια στιγμή μειωμένα αναμένεται να είναι τα εξεταστικά κέντρα των γενικών λυκείων, καθώς έγγραφο του υπουργείου που έφτασε στις διευθύνσεις Δευτεροβάθμιας Εκπαίδευσης της Θεσσαλονίκης ενημέρωνε πως φέτος τα εξεταστικά κέντρα θα συντμηθούν, δηλαδή δεν θα αποτελεί κάθε λύκειο και διαφορετικό εξεταστικό κέντρο. Αυτόματα έτσι μειώνονται τα μέλη των εξεταστικών επιτροπών κάθε κέντρου αλλά και οι επιτηρητές.

σακτέων ΑΚ αλλά οινώσεις ων φετια εκπαίοι αυξάστο ΤΕΙ σότεροι ν θέσεις ραγωγής τομα θα ής, ενώ ήμα Λο-

τε οι θέχανικών υ εδρεύαι κατά ολογίας, και κατά ΑνακαΚ, όπου ος οι ειΠληροο τμήμα ιτικής. ουν φέτων ειδιδεύτερη ειδικών ηση της των ξέγλώσσες όγευμα, ους υποενώ στις θερο και εξέταση χος μουοποίου

αλούνται ς αίθουώρα νωα από ώρα εξέης, ενώ μερομηορίστηστις 24 ου για Αγγλικά, 5 για το ερο Σχές 26 για ραμμικό, 8 για τα κά, στις α Γαλλι-

κά, στις 30 για την Αρμονία, την 1η Ιουλίου για τον έλεγχο μουσικών Ικανοτήτων και τα Ιταλικά και στις 2 Ιουλίου για τα Ισπανικά.

Για τις μετεγγραφές Σε ό,τι αφορά το δικαίωμα μετεγγραφής, ισχύει μέχρι στιγμής ο προηγούμενος νόμος, όπως εφαρμόστηκε μέχρι και πέρσι και με το όριο του εισοδήματος για όσους θέλουν να πάρουν μετεγγραφή στο τρίτο εξάμηνο σπουδών αυξημένο κατά 10.000 ευρώ, δηλαδή στα 45.000 ευρώ. Ωστόσο οι υποψήφιοι πρέπει να γνωρίζουν ότι δικαίωμα μετεγγραφής σε σχολή άλλης πόλης δεν θα έχουν όσοι δηλώσουν και επιτύχουν σε σχολές για τις οποίες δεν υπάρχουν αντίστοιχα τμήματα σε άλλο πανεπιστήμιο. Τα αναντίστοιχα πανεπιστημιακά τμήματα είναι συνολικά 47 και μοιράζονται σε όλα τα πανεπιστημιακά ιδρύματα της χώρας. Μοναδικά και αναντίστοιχα είναι τα τμήματα Κινηματογράφου, Μουσικών Σπουδών και Θεάτρου του Αριστοτελείου, ενώ στην ίδια κατηγορία ανήκουν τα τμήματα Μάρκετινγκ και Διοίκησης Λειτουργιών, Μουσικής Επιστήμης και Τέχνης, Διοίκησης Τεχνολογιών του Πανεπιστημίου Μακεδονίας όπως επίσης και το Βαλκανικών Σπουδών του Πανεπιστημίου Δυτικής Μακεδονίας.

Πρόκειται για τα τμήματα Μάρκετινγκ και Επικοινωνίας και το τμήμα Διοικητικής Επιστήμης και Τεχνολογίας Στατιστικής του Οικονομικού Πανεπιστημίου Αθηνών, Γεωπονικής Βιοτεχνολογίας του Γεωπονικού Πανεπιστημίου Αθηνών, το τμήμα Δημόσιας Διοίκησης του Παντείου και Διδακτικής της Τεχνολογίας και Ψηφιακών Συστημάτων του Πανεπιστημίου Πειραιώς. Επίσης το ίδιο ισχύει για τα τμήματα Τουρκικών Σπουδών και Σύγχρονων Ασιατικών Σπουδών, Μεθοδολογίας Ιστορίας και Θε-

88.165 θέσεις σε ΑΕΙ - ΤΕΙ θα διεκδικήσουν φέτος οι υποψήφιοι ωρίας της Επιστήμης, Μουσικών Σπουδών του Καποδιστριακού Πανεπιστημίου όπως επίσης και τη σχολή Θεωρητικών Σπουδών της Τέχνης της Ανώτατης Σχολής Καλών Τεχνών. Στο Εθνικό Μετσόβιο Πολυτεχνείο μοναδικά είναι το τμήμα Ναυπηγών Μηχανολόγων Μηχανικών, Μηχανικών Μεταλλείων Μεταλλουργών και Εφαρμοσμένων Μαθηματικών και Φυσικών Επιστημών. Στην ίδια κατηγορία ανήκουν και τα δυο τμήματα του Χαροκόπειου Πανεπιστημίου Επιστήμης Διαιτολογίας και Διατροφής και Οικιακής Οικονομίας και Οικολογίας.

Αθήνα

Ιωαννίνων

Στην Αθήνα και στο Χαροκόπειο Πανεπιστήμιο, το Καποδιστριακό και το Πάντειο, το Εθνικό Μετσόβιο Πολυτεχνείο όπως και στο Πανεπιστήμιο Αθηνών και Πειραιά αναντίστοιχα είναι δεκαπέντε τμήματα.

Στο Πανεπιστήμιο Ιωαννίνων τα τμήματα Βιολογικών Εφαρμογών και Τεχνολογιών, Μηχανικών Επιστήμης Υλικών (σ.σ. το πρώην τμήμα Επιστήμης Τεχνολογίας Υλικών), Πλαστικών Τεχνών και Επιστη-

μών της Τέχνης, Διοίκησης Επιχειρήσεων Αγροτικών Προϊόντων και Τροφίμων, Διαχείρισης Πολιτισμικού Περιβάλλοντος και Νέων Τεχνολογιών δεν αντιστοιχούν σε κάποιο τμήμα άλλου πανεπιστημίου.

ΔΠΘ Στο Δημοκρίτειο Πανεπιστήμιο Θράκης σε αυτήν την κατηγορία ανήκουν τα τμήματα Μοριακής Βιολογίας και Γενετικής, Γλώσσας, Φιλολογίας και Πολιτισμού Παρευξείνιων Χωρών. Μη αντίστοιχα είναι τα εξής τμήματα στο Πανεπιστήμιο Αιγαίου: Μεσογειακών Σπουδών, Επιστήμης Τροφίμων και Διατροφής, Μηχανικών Οικονομίας και Διοίκησης, Μηχανικών Σχεδίασης Προϊόντων και Συστημάτων, Επιστημών της Θάλασσας, Περιβάλλοντος, Πολιτισμικής Τεχνολογίας και Επικοινωνίας.

Ιόνιο Στο Ιόνιο Πανεπιστήμιο αναντίστοιχα είναι τα τμήματα Ξένων Γλωσσών Μετάφρασης και Διερμηνείας, Αρχειονομίας και Βιβλιοθηκονομίας του Ιονίου Πανεπιστημίου, Τεχνών Ηχου και Εικόνας του Ιονίου Πανεπιστημίου, Μουσικών Σπουδών του Ιονίου Πανεπιστημίου, όλα με έδρα την Κέρκυρα.

Κρήτη Η δυνατότητα μετεγγραφής αποκλείεται και σε δυο τμήματα του Πανεπιστημίου Κρήτης στο Εφαρμοσμένων Μαθηματικών, Μηχανικών Ορυκτών Πόρων, όπως και σε δυο τμήματα του Πανεπιστημίου Θεσσαλίας Ειδικής Αγωγής και Βιοχημείας και Βιοτεχνολογίας, που εδρεύουν στο Βόλο.

Οι ημερομηνίες κατάθεσης δικαιολογητικών για τις στρατιωτικές σχολές Τους 1.790 θα φτάσουν φέτος οι σπουδαστές στο 1ο έτος των Ανώτατων Στρατιωτικών Εκπαιδευτικών Ιδρυμάτων (ΑΣΕΙ), Ευελπίδων (ΣΣΕ), Ναυτικών Δοκίμων (ΣΝΔ), Ικάρων (ΣΙ), Σωμάτων (ΣΣΑΣ), Νοσηλευτικής (ΣΑΝ) καθώς και των Ανώτερων Στρατιωτικών Σχολών Υπαξιωματικών (ΑΣΣΥ), Στρατού Ξηράς (ΣΜΥ), Πολεμικού Ναυτικού (ΣΜΥΝ), Πολεμικής Αεροπορίας Τεχνικών Υπαξιωματικών Αεροπορίας (ΣΤΥΑ), Υπαξιωματικών Διοικητικών Αεροπορίας (ΣΥΔ) και Σχολή Ιπτάμενων Ραδιοναυτίλων (ΣΙΡ) ακαδημαϊκού έτους 2010-2011, σύμφωνα με την εγκύκλιο του υπουργείου Εθνικής Αμυνας. Μέχρι τις 28 Απριλίου καλούνται, σύμφωνα με την εγκύκλιο, όσοι επιθυμούν να διεκδικήσουν μια θέση στις στρατιωτικές σχολές της χώρας να καταθέσουν τα απαραίτητα δικαιολογητικά κατ’ ιδίαν ή με συστημένη επιστολή στο τμήμα εισιτηρίων εξετάσεων της Στρατιωτικής Σχολής Ευελπίδων, στη Σχολή Ναυτικών Δοκίμων στο Χατζηκυριάκειο Πειραιά, στη Διοίκηση Αεροπορικής Εκπαιδεύσεως στο Τατόι, στη Στρατιωτική Σχολή Αξιωματικών Σωμάτων στην οδό Πλήθωνος Γεμιστού 2 στη Θεσσαλονίκη, στη Σχολή Αξιωματικών Νοσηλευτικής στο Στρατόπεδο ΣΑΚΕΤΑ στο Βύρωνα Αττικής, στη Σχολή Μόνιμων Υπαξιωματικών στα Τρίκαλα, και στη Σχολή Μόνιμων Υπαξιωματικών Ναυτικού ΚΕ στο Σκαραμαγκά, ανάλογα με τη σχολή που επιθυμούν την είσοδό τους. Στις 14 Μαΐου θα ανακοινωθούν σε κάθε σχολή οι λίστες με τα ονόματα των υποψηφίων που έχουν καταθέσει ελλιπή δικαιολογητικά, οι οποίοι καλούνται να τα καταθέσουν έως τις 21 Μαΐου. Οι τελικές λίστες με τα ονόματα των υποψηφίων θα ανακοινωθούν στις 4 Ιουνίου, ενώ σημειώνεται πως οι λίστες με τα ονόματα θα αναρτώνται στις εισόδους των αντίστοιχων σχολών είτε στις ιστοσελίδες τους. Οσοι τελικά πάρουν μέρος στις ειδικές εξετάσεις για την είσοδό τους στις στρατιωτικές σχολές θα πρέπει να βρίσκονται στο χώρο εξέτασης στις επτά το πρωί, ενώ θα γίνονται δεκτοί μόνο με την αστυνομική τους ταυτότητα και το δελτίο εξεταζόμενου.


3 Πέµπτη 15 Απριλίου 2010

Φυσική Θετικής και Τεχνολογικής Κατεύθυνσης Σώμα μάζας m=4kg δένεται στο κάτω άκρο κατακόρυφου ιδανικού ελατηρίου σταθεράς k = 100N/m του οποίου το άλλο άκρο είναι στερεωμένο σε οροφή. Κάτω από το σώμα τοποθετούμε μικρή λεκάνη γεμάτη με υγρό και σε τέτοιο ύψος ώστε το σώμα m να πλέει μέσα στο υγρό. Στο υγρό έχουμε δύο πηγές κυμάτων ίδιου πλάτους Α=1m και ίδιας συχνότητας που η μία απέχει από το σώμα την διπλάσια απόσταση από ότι η άλλη. Οι πηγές τίθενται ταυτόχρονα σε λειτουργία και στο υγρό το πλάτος του κύματος διαδίδεται αμετάβλητο και το σώμα m βρίσκεται συνέχεια στην επιφάνεια του υγρού χωρίς να αυξομειώνεται η βύθιση του. To κύμα από την κοντινότερη στο σώμα πηγή, φθάνει σε αυτό σε χρόνο 1/5sec. α) Αν τα κύματα που δημιουργούνται έχουν μήκος κύματος λ=2m να υπολογίσετε την απομάκρυνση του σώματος σε συνάρτηση με το χρόνο θεωρώντας ως αρχή μέτρησης των χρόνων την έναρξη της ταλάντωσης των πηγών στο υγρό. Να γίνει και γραφική παράσταση του πλάτους σε συνάρτηση με το χρόνο μέχρι t=1/2sec. β) Αν την στιγμή t=9/40 απομακρύνουμε ακαριαία την λεκάνη χωρίς να αλλάξει η Θ.Ι το σύστημα ελατήριο σώμα θα συνεχίσει να εκτελεί ταλάντωση; Αν ναι βρείτε τις συναρτήσεις της απομάκρυνσης κα της ταχύτητας με το χρόνο και να κάνετε γραφική παράσταση της ταχύτητα με το χρόνο θεωρώντας ως αρχή μέτρησης των χρόνων την απομάκρυνση της λεκάνης από το σύστημα. γ) Την στιγμή t=T/2 όπου Τ η περίοδος της ταλάντωσης του σώματος m, το σώμα διασπάται λόγω έκρηξης σε δύο ίσες μάζες από τις οποίες η μία μένει δεμένη με το ελατήριο και ενώ αυτή που αποσπάται κινείται με ταχύτητα μέτρου

Όμως η απόσταση που απέχει η μία πηγή από το σώμα είναι διπλάσια από την απόσταση που απέχει η άλλη πηγή από το σώμα άρα r2=2˜r1 = 8m Το κύμα από την πρώτη πηγή θα φθάσει στο σώμα σε χρόνο t1=

τότε το σώμα ταλαντώνεται υπό την επίδραση του κύματος διότι αφού συνέχεια είναι μέσα στο υγρό χωρίς να αυξομειώνεται η βύθιση του είναι μια εξαναγκασμένη ταλάντωση όπου ο διεγέρτης είναι το κύμα, άρα το σώμα θα ταλαντώνεται στη συχνότητα του κύματος. Δηλαδή από την στιγμή t1 μέχρι να φθάσει το κύμα από την δεύτερη πηγή σε χρόνο t2=

y ολ

X

=

8 20

2 sec. 5

( δηλ για t2> t ≥ t1) το σώμα ταλαντώνεται

§r r · § t r r · 2$συν2π¨ 1 2 ¸ ˜ ημ2π ¨  1 2 ¸ 2λ ¹ © 2λ ¹ ©T

Άρα η απομάκρυνση του σώματος από τη Θ.Ι είναι:

y = 0 για t<t1

y

y

4 1 ˜ ημ2π(10t - ) 2

ημ2π 10t - 2

για t1 < t ≤ t2

4 8· § 4-8· § 2συν2π¨ ¸ ˜ ημ2π ¨10t ¸ 2˜2 ¹ © 2˜2 ¹ ©

2ημ2π 10t - 3

για t ≥ t2

Δίνονται: Η ταχύτητα διάδοσης του κύματος στο υγρό 2 υ=20m/sec, g=10m/sec .

από τα παραπάνω φαίνεται ότι το πλάτος με το χρόνο έχει την εξής διαμόρφωση:

Λύση:

Ÿ f

X O

10 Hz.

Άρα για το κύμα από την

πηγή που είναι πιο κοντά στο σώμα θα φθάσει σε χρόνο t1=1/5 δηλ.

r2

μόνο υπό την επίδραση του κύματος από την πρώτη πηγή και αφού το πλάτος διαδίδεται αμετάβλητο θα ταλαντωθεί με αυτό το πλάτος, ενώ για χρόνους t ≥ t2 έχουμε συμβολή των δύο κυμάτων άρα ισχύει η σχέση :

υ2=6 2 m/s κατακόρυφα προς τα κάτω. Να υπολογίσετε την συνάρτηση της απομάκρυνσης για την νέα ταλάντωση της μάζας που μένει προσδεμένη στο ελατήριο θεωρώντας ως αρχή μέτρησης των χρόνων την έκρηξη.

α) υ = λ f

1 sec και 5

X

r1 Ÿ r1 t1

20 ˜

1 5

4m

Α(m) 2 1 0

t (sec) 0,2

0,4

0,5

Γυρίστε σελίδα


4 Πέµπτη 15 Απριλίου 2010

β)

Η

y

t

=

9 sec είναι ανάμεσα στους χρόνους 40

8 sec , t = 2 2 5 40

1 t1= 5 άρα

στιγμή

η

εξίσωση

απομάκρυνσης

ημ2π 10t - 2

παραπάνω εξίσωση

16 sec 40

είναι

της

μορφής

αντικαθιστώντας τον χρόνο t = 9 sec στην 40

y

π 9 § · ημ2π ¨10 - 2 ¸ = ημ( 2 © 40 ¹

) = +1.

Άρα όταν απομακρυνθεί η λεκάνη με το υγρό το σώμα βρίσκεται στην άνω ακραία θέση της ταλάντωσης του επομένως η ταχύτητα του είναι μηδέν και θα ξεκινήσει νέα ταλάντωση από ακραία θέση με συχνότητα και περίοδο διαφορετική αφού απομακρύνθηκε ο διεγέρτης. Η περίοδο που έχει όταν εκτελεί ελεύθερη α.α.τ. είναι:

T και

2π ω

m k 2π Τ

=

2π 2π 5

4 100

π 2

το πλάτος του είναι το ίδιο διότι

για k=0 έχουμε ή φο=

άρα η νέα ταλάντωση έχει εξίσωση απομάκρυνσης:

π· § y = ημ ¨ 5t  ¸ στο S.I. και 2¹ © π· § υ = ωΑ συν ¨ 5t  ¸ που γίνεται υ= -5ημ(5t) 2¹ ©

1

1

2

2

Άρα 2·υ1= - 12 2 o υ1= -6 2 m/sec (το μείον δηλώνει ότι κινείται αντίθετα με το m2 αλλά επειδή στην ταλάντωση ως θετική ακραία θέση θεωρήσαμε την άνω άρα η ταχύτητα υ1 είναι θετική.

o

Πριν την διάσπαση στην Θ.Ι. ΣF = 0 άρα mg = kΔl1 Μετά την διάσπαση η Θ.Ι. άλλαξε για την Ν.Θ.Ι. ΣF = 0 άρα m1g = kΔl2

o

Δl2 =

20 100

2 10

Δl1=

40 100

4 m. 10

m.

Άρα μετά την έκρηξη στην νέα ταλάντωση το m1 έχει ταχύτητα υ1= 6 απομάκρυνση από τη Ν.Θ.Ι. x1= A+( Δl1- Δl2) = 1 +

Ε=Κ+U

δεν αλλάζει η Θ.Ι. και έχει αρχική φάση αφού για t=0, y=+A. Δηλ. y=Aημ(ωt+φο) ή Α=Αημ(φο) ημ(φο)=1=ημ(π/2) ή φο=2kπ+

p& ολ πριν p& ολ μετα ή 0 = m · υ + m υ

2 = 12 m. 10 10

2 m/sec και

Εφαρμόζουμε την Αρχή Διατήρησης της Ενέργειας για την ταλάντωση :

2 π sec 5

5 rad/sec

Για την διάσπαση εφαρμόζουμε Α.Δ.Ο

π rad 2

o

1 kA 2 2

100Α2= 144 + 144

1 1 m1 υ12  kx 12 o 2 2

o A

12 2 10

δηλ.

A

2 )2 + 144

12 2 m. 10

12 2 10 10

Στην σχέση x=Aημ(ωt+φο) θέτουμε για t=0 το x=x1= - 12 m άρα - 12 =

10

Δηλαδή ημ(φο)= -

2 2

ή ημ(φο) = ημ(π+

2κπ + π + φο=

στο

2 ˜ 144 100

100Α2 = 2 · (6

π 4

ημ(φο)

π ) άρα 4

2κπ+π -π - π

S.I

4

για κ=0

x x

φο= 5π απορρίπτεται γιατί τότε υ<0

4 π απορρίπτεται γιατί πρέπει φ >0 φο= ο 4

για κ=1

x γ) Την στιγμή t =

T το σώμα βρίσκεται 2

στην κάτω ακραία θέση δηλ y=-A αφού την στιγμή t=0 ήταν στην άνω ακραία θέση y=+A. Εκεί υ=0 και διασπάται ακαριαία σε δύο κομμάτια ίσων μαζών δηλ. m1=m2 =2kg

x

π = 13π απορρίπτεται γιατί πρέπει φ <2π ο 4 4 π = 7π δεκτή γιατί τότε υ>0 φο= 2π 4 4 φο=3π+

επίσης αφού έχει αλλάξει η μάζα που είναι στον ταλαντωτή έχει αλλάξει το ω διότι

D

m1 ˜ ω12 o 100 = 2 ω12

Είναι λοιπόν x =

12 2 10

άρα ω1=5

ημ(5 2 ˜t + 7π )

4

2 rad/sec στο S.I.

Ζησάκος Βασίλειος Φυσικός


5 Πέµπτη 15 Απριλίου 2010

Βιολογία Θετικής Κατεύθυνσης Ζήτημα 1

Ζήτημα 2

Επιλέξτε την σωστή απάντηση στις παρακάτω ερωτήσεις. 1) Πόσα μόρια mRNA παράγονται από την μέταγραφη του υπερονίου της λακτόζης? Α

1 Μόριο mRΝΑ

Β

2 Μόρια mRΝΑ

Γ

3 Μόρια mRΝΑ

Δ

Τίποτα από τα παραπάνω

2) Η φαινοτυπική αναλογία 9:3:3:1 επηρεάζεται όταν: A

To ένα ζεύγος συνεπικρατων.

αλληλόμορφων

έχει

σχέση

Β

Υπάρχει ένα θνησιγόνο γονίδιο

Γ

Το ένα ζεύγος αλληλόμορφων γονιδίων έχει σχέση ατελώς επικρατών και στο άλλο ζεύγος υπάρχει θνησιγόνο γονίδιο

Δ

Ισχύει οποιαδήποτε από της παραπάνω περιπτώσεις.

3) Για το πλασμίδιο τi ισχύει ότι : Α

Βρίσκεται στο βακτήριο bacillus thurigiensis.

Β

Έχει την ικανότητα να μολύνει φυτικά κύτταρα.

Γ

Διαθέτει γονίδια που προσδίδουν στα ανθεκτικότητα στα επιβλαβή έντομα και ζιζάνια.

Δ

Βρίσκεται στο βακτήριο agrotobacterium trimefaciens.

Ε

Τα Β & Δ Σχηματίζονται κατά την διάρκεια της μεσόφασης

Β

Σχηματίζονται κατά την διάρκεια της μετάφασης

Γ

Αποτελούνται από 148 ζεύγη βάσεων

Δ

Δεν ισχύει τίποτα από τα παραπάνω

φυτά

5) Τα κυριότερα φυτά τα οποία έχουν τροποποιηθεί γενετικά είναι Α

Η σόγια και το βαμβάκι

Β

Ο καπνός και η ελαιοκράμβη

Γ

Κανένα από τα παραπάνω

Δ

Τα α και β

Ποιο είναι το μήκος του DΝΑ (σε ζεύγη βάσεων) στον πυρήνα ενός ανθρώπινου σωματικού κυττάρου;

Β.

Περιγράψτε την διαδικασία πολυπεπτιδικής αλυσίδας.

Γ.

Τι είναι τα μονοκλωνικά αντισώματα; Ποιο πρόβλημα παρουσιάζεται κατά την εργαστηριακή παραγωγή τους και πως αντιμετωπίζεται αυτό;

Δ.

Περιγράψτε την μέθοδο παρασκευής της ανθρώπινης Α1 αντιθρυψίνης από διαγονιδιακό ζώο;

επιμήκυνσης

της

Ζήτημα 3 Σε μια οικογενεια που ο πατερας πασχει από αχρωματοψια στο πρασινο και στο κοκκινο γεννιουνται 2 παιδιά ο Δημήτρης και η Ελένη. Ο Δημήτρης πάσχει από αχρωματοψία. Η Ελενη παντρευεται έναν ανδρα τον Γιωργο και γεννα ένα κοριτσι την Νεφελη που πασχει από αχρωματοψια και ένα γιο τον Ορεστη που δεν πασχει . Α.

Να βρεθούν οι γονότυποι όλων των ατόμων.

Β.

Ποια είναι η πιθανότητα το δεύτερο παιδί της Ελένης και του Γιώργου να πάσχει από την ασθένεια αυτή;

Ζήτημα 4

4) Τα νουκλεοσώματα Α

Α.

Δινεται το πεπτιδιο : H2N - Μεθειονίνη - Προλίνη - Σερίνη - Αλανίνη - Τυροσίνη - COOH που κωδικοποιείται από το παρακάτω τμήμα μορίου DNA ευκαριωτικού κυττάρου.O υποκινητής του γονιδίου βρίσκεται δεξιά του τμήματος αυτού …CAAATGCCCAGCTTTACCCGGGCCTATTGAGGA… …GTTTACGGGTCGAAATGGGCCCGGATAACTCCT… Α.

Να γράψετε την αλληλουχία του πρόδρομου mRNA και την αλληλουχία του ώριμου mRNA που προκύπτει μετά την μεταγραφή του παραπάνω τμήματος DNA και να αιτιολογήσετε την απάντηση σας.

Β.

Να γράψετε την αλληλουχία εσωνίου που βρίσκεται στο παραπάνω τμήμα μορίου DNA. Σε ποια περιοχή του κυττάρου πραγματοποιείται η ωρίμανση; Περιγράψτε την διαδικασία.

Γ.

Η περιοριστική ενδονουκλεάση EcoRi θα μπορούσε να χρησιμοποιηθεί για το κόψιμο του παραπάνω τμήματος DNA; Αιτιολογήστε. Γυρίστε σελίδα


6 Πέµπτη 15 Απριλίου 2010

ΑΠΑΝΤΗΣΕΙΣ :

P:

XAXa * XαΨ

ΖΗΤΗΜΑ 1:

Γαμέτες:

ΧΑ, Χα Χα, Ψ

F:

XAXα , XAΨ, ΧαΧα, ΧαΨ

1) 2) 3) 4) 5)

Β Δ Ε Δ Δ

Η πιθανότητα το δεύτερο παιδί της Ελένης και του Γιώργου να πάσχει από αχρωματοψία είναι 50% (αν είναι αγόρι) και 50% (αν είναι κορίτσι) εφόσον κάθε κύηση είναι ξεχωριστό γεγονός και ανεξάρτητη από το αποτέλεσμα των προηγούμενων κυήσεων.

ΖΗΤΗΜΑ 4:

ΖΗΤΗΜΑ 2: Α. Το μήκος του DNA στον πυρήνα ενός ανθρωπινού σωματικού κυττάρου είναι διαφορετικό και εξαρτάται από την φάση του κυτταρικού κύκλου στην οποία αυτό βρίσκεται. Έτσι λοιπόν διακρίνουμε της παρακάτω περιπτώσεις: α) Το σωματικό κύτταρο πριν την αντιγραφή το DNA αποτελείται από περίπου 6*104 ζεύγη αζωτούχων βάσεων . β)Το σωματικό κύτταρο μετά την αντιγραφή το DNA αποτελείται από περίπου 12*109 ζεύγη αζωτούχων βάσεων . γ)Στο κύτταρο που προκύπτει μετά την 1η μειωτική διαίρεση το DNA 9 αποτελείται από περίπου 6*10 ζεύγη αζωτούχων βάσεων . Β. Σχολ. βιβλίο: σελ. 37 από: επιμηκυση…. προσδένονται μεταξύ τους

μέχρι:… τα οποία

Γ. Σχολ. βιβλίο: σελ. 119 από: κάθε είδος αντισώματος … … μεγάλες ποσότητες ενός μονοκλωνικού αντισώματος.

μέχρι:

Δ. Σχολ. βιβλίο: σελ. 135 από: υποσχόμενη ιδέα … μέχρι: ... να έχουν το ξένο γονίδιο και να παράγουν την ΑΑΤ.

ΖΗΤΗΜΑ 3 : Α. Η μερική αχρωματοψία υπολειπόμενος χαρακτήρας .

κληρονομείται

σαν

φυλοσύνδετος

Α

Χ κανονική όραση α Χ αχρωματοψία

Συμβολίζουμε με:

Πιθανοί γονότυποι Α

Α

Α

α

Χ Χ

Χ Χ α α Χ Χ

φαινότυποι Θηλυκό άτομο με φυσιολογική όραση Θηλυκό άτομο με φυσιολογική όραση (φορέας) Θηλυκό άτομο με αχρωματοψία

Α

Αρσενικό άτομο με φυσιολογική όραση

α

Αρσενικό άτομο με αχρωματοψία

Χ Ψ Χ Ψ

Ο Ορέστης δεν πάσχει από αχρωματοψία άρα έχει γονότυπο ΧΑΨ. Άρα η Ελένη (μητέρα του Ορέστη ) έχει γονότυπο ΧΑΧα αφού ο γιός της έχει κληρονομήσει το ΧΑ από αυτή, ενώ η κόρη της η Νεφέλη που πάσχει, έχει γονότυπο ΧαΧα και έχει κληρονομήσει το Χα από την μητέρα της και το Χα από τον πατέρα της. Άρα ο πατέρας έχει γονότυπο ΧαΨ. Η Ελένη κληρονόμησε το αλληλόμορφο Χα από τον πατέρα της που έπασχε (ΧαΨ) και το ΧΑ από την μητέρα της η οποία έχει γονότυπο ΧΑΧα αφού γέννησε τον Δημήτρη ο οποίος πάσχει από αχρωματοψία και έχει γονότυπο ΧαΨ Οι γονότυποι των ατόμων της οικογένειας είναι : Πατέρας Χ αΨ Μητέρα ΧΑΧα Ελένη ΧΑΧα Δημήτρης Χ αΨ Γιώργος Χ αΨ Νεφέλη ΧαΧα Ορέστης ΧΑΨ Β. Το δεύτερο παιδί της Ελένης και του Γιώργου θα την παρακάτω διασταύρωση :

προκύψει από

Α. Το πεπτίδιο που δίνεται προκύπτει από την μετάφραση του ώριμου mRΝΑ με την παρακάτω αλληλουχία βάσεων .Η μετάφραση γίνεται με προσανατολισμό 5 - 3 αφού το ριβόσωμα προσδένεται στην 5 αμετάφραστη περιοχή του ώριμου mRNA και το μεταφράζει κατευθυνόμενο προς το 3 αμετάφραστο άκρο του . Ώριμο mRNA: 5-AUG –CCC-AGC-GGC-UAU-3 Το παραπάνω mRNA προέκυψε από την μεταγραφή της μη κωδικής αλυσίδας του DNA . Η μεταγραφή έγινε με προσανατολισμό 5 - 3 αφού η RNA πολυμεράση προσδέθηκε στον υποκινητή του γονιδίου και με καλούπι την μη κωδική αλυσίδα σχηματίστηκε το συμληρωματικό και αντιπαράλληλο πρόδρομο mRNA Μη κωδική (DNA )3-TAC-GGG-TCG-CGG-ATA-5 Από τις δύο αλυσίδες DNA που δίνονται η δεύτερη έχει την παραπάνω αλληλουχία βάσεων άρα η δεύτερη είναι η μη κωδική και αφού ο υποκινητής του γονιδίου βρίσκεται αριστερά η διεύθυνση της μεταγραφής θα είναι από αριστερά προς τα δεξιά. Άρα η δεύτερη αλυσίδα που είναι η μη κωδική θα έχει το 3 άκρο της αριστερά προκειμένου η RNA πολυμεράση να μεταγράψει με προσανατολισμό 5’ - 3’από αριστερά προς τα δεξιά. Η κωδική αλυσίδα είναι η πάνω και είναι συμπληρωματική και αντιπαράλληλη με την μη κωδική. Έχει δηλαδή το 5 άκρο της αριστερά και το 3 δεξιά.Το πρόδρομο mRNA που θα προκύψει από την μεταγραφή θα είναι το παρακάτω: 5’ CAAAUGCCCAGCUUUACCCGGGCCUAUUGAGGA 3’. Το γονίδιο αυτό είναι ασυνεχές δηλαδή ανάμεσα στα κωδικόνια που θα μεταφραστούν παρεμβάλλονται αμετάφραστες περιοχές. Κατα την ωρίμανση τα ριβονουκλεοπρωτεϊνικά σωματίδια, κόβουν και απομακρύνουν τα εσώνια ενω συρράπτουν τα εξώνια. Έτσι προκύπτει το ώριμο MRNA το οποίο διατηρεί της 5', 3’ αμετάφραστες περιοχές: 5’ CAAAUGCCCAGCGCCUAUUGAGGA 3’. Συνοψίζοντας όλα τα παραπάνω:

Υποκινητής γονιδίου Κωδική: 5΄ CAAATGCCCAGCTTTACCCGGGCCTATTGAGGA 3’ Μη κωδική: 3’ GTTTSCGGGTCGAAATGGGCCCGGATAACTCCT 5’ Προδρομο mRNA: 5’ CAAAUGCCCAGCUUUACCCGGGCCUAUUGAGGA 3’ Ωριμο mRNA: 5’ CAAAUGCCCAGCGCCUAUUGAGGA 3’ Β.

ΕΣΩΝΙΟ: 5’ UUUACCCGG 3’

Σχολ. βιβλίο: σελ. 33-34 απο: Στους ευκαρυωτικούς οργανισμούς το mRNA που … μεχρι: …όπου είναι η θέση της πρωτεϊνοσύνθεσης . Γ. Όχι ,η Ε.coRI δεν μπορεί να κόψει το συγκεκριμένο τμήμα DNA. Σχολ. βιβλίο: σελ. 57 από: Μία από της περιοριστικές ενδονουκλεάσες … μέχρι:… αζευγάρωτες βάσεις στα κομμένα άκρα.

Επιμέλεια : Τσιομλεκτσή Ελένη


8 Πέµπτη 15 Απριλίου 2010

Τα πλεονεκτήµατα της νανοτεχνολογίας Μαθητές από το 4ο ΓΕΛ Σταυρούπολης συµµετέχουν στο ευρωπαϊκό πιλοτικό πρόγραµµα «Nanoyou» ΡΕΠΟΡΤΑΖ ΒΑΣΩ ΝΤΟΥΝΑ

«Ενα μικροσκοπικό δημιούργημα της νανοτεχνολογίας στο μπουφάν ενός ορειβάτη σίγουρα θα ήταν πολύ χρήσιμο. Τι συνέπειες, όμως, θα είχε αυτό, εάν ενσωματωνόταν στα ρούχα κάθε πολίτη;». Το ερώτημα θέτουν οι 20 μαθητές της α’ και β τάξης του 4ου ΓΕΛ Σταυρούπολης, όπου εφαρμόζεται το πιλοτικό πρόγραμμα «Nanoyou», που συντονίζει το Ευρωπαϊκό Σχολικό Δίκτυο. Το πρόγραμμα «τρέχει» σε ακόμη 25 σχολεία σε όλη την Ευρώπη και έχει ως στόχο να ενημερώσει τη νέα γενιά για τη χρήση της νανοτεχνολογίας.

Τ

α εργαλεία του µαθήµατος δεν είναι άλλα από µερικούς ηλεκτρονικούς υπολογιστές µε σύνδεση στο Ιντερνετ και... διάθεση για προβληµατισµό. Μέσα από µια ιστοσελίδα, την www.nanoyou.eu, οι νεαροί µαθητές έρχονται σε επαφή µε τη θεωρία για τη νανοτεχνολογία, τα επιτεύγµατά της σε διάφορους επιστηµονικούς τοµείς, όπως η ιατρική, η πληροφορική, η χηµεία. Συζητούν µε µαθητές από άλλα σχολεία της Ευρώπης, οι οποίοι συµµετέχουν στο πρόγραµµα, ενώ µπορούν να παρακολουθήσουν και να κάνουν εικονικά πειράµατα στα ηλεκτρονικά εργαστήρια της ιστοσελίδας και στη συνέχεια να προβληµατιστούν...

«Ενας µαγικός κόσµος γύρω µας» «Ο κόσµος της νανοτεχνολογίας φαντάζει πραγµατικά µαγικός στα µάτια των µαθητών», εξηγεί ο Σταύρος Νικολάου, καθηγητής Πληροφορικής και υπεύθυνος του προγράµµατος στο 4ο ΓΕΛ Σταυρούπολης. Το πρόγραµµα γίνεται σε συνδυασµό µε το µάθηµα Πληροφορικής. Οι µαθητές µαθαίνουν πώς η νανοτεχνολογία εφαρµόζεται στην πράξη. Το ενδιαφέρον αυξάνεται όταν τελικά ανακαλύπτουν πως ένα σωρό από τα λεγόµενα γκάτζετ που χρησιµοποιούν στην καθηµερινότητά τους έχουν δηµιουργηθεί µε βάση αυτό το εργαλείο. Η δουλειά όµως του µαθήµατος δε σταµατά εκεί, καθώς παράλληλα τους δίνεται η δυνατότητα να δουν τις τυχόν αρνητικές συνέπειες και να σκεφθούν κριτικά. «H νανοτεχνολογία θα επιφέρει επανάσταση σε διάφορους κλάδους της επιστήµης, όπως η ιατρική, η πληροφορική, η επιστήµη υλικών, η παραγωγή ενέργειας. Κατά συνέπεια θα επηρεάσει τη ζωή κάθε πολίτη στο άµεσο µέλλον», εξηγεί ο Σταύρος Νίκου.

Οι αρνητικές συνέπειες «Η χρήση της νανοτεχνολογίας µπορεί να έχει και αρνητικές περιβαλλοντικές, κοινωνικές και ηθικές συνέπειες. Αυτές προσπαθούµε να δούµε µέσα από το µάθηµα

Μαθητές στη Σταυρούπολη μαθαίνουν για τη χρήση της νανοτεχνολογίας

και να ανακαλύψουµε πώς θα αποφευχθούν», λέει ο κ. Νίκου, φέρνοντας ως παράδειγµα το «µακροάργυρο», ο οποίος έχει αποδειχθεί ασφαλής και χρησιµοποιείται ήδη σε κάλτσες, εσώρουχα και άλλα προϊόντα, επειδή έχει ισχυρές µικροβιοκτόνες ιδιότητες και εµποδίζει την κακοσµία. Παρ’

όλα αυτά κανείς δε γνωρίζει τι επιδράσεις θα είχαν στις διάφορες µορφές ζωής τα πολύ µικρότερα σωµατίδια νανοαργύρου που καταλήγουν στην αποχέτευση. Ανησυχία εκφράζεται επίσης για τα νέα υφάσµατα που περιέχουν νανοσωλήνες και δε χρειάζονται βαφή - το χρώµα τους καθορίζεται

από τη διάµετρο των νανοσωλήνων. Το πρόγραµµα συντονίζεται από το Ευρωπαϊκό Σχολικό Δίκτυο σε συνεργασία µε διεθνή επιστηµονικά ιδρύµατα, όπως το Κέντρο Νανοτεχνολογίας του Πανεπιστηµίου του Κέµπριτζ, το Επιστηµονικό Πάρκο Βαρκελώνης, το Κέντρο Νανοεπιστηµών του Πανεπιστηµίου του Ααρχους στη Γερµανία, το Κέντρο Κοινωνικής Καινοτοµίας στη Βιέννη, το ORT του Ισραήλ και άλλα. Η συµµετοχή στα µαθήµατα είναι εθελοντική και όπως τονίζει ο υπεύθυνος καθηγητής στο πρόγραµµα Σταύρος Νίκου, το ενδιαφέρον των µαθητών για αυτό το τεχνολογικό εργαλείο είναι µεγάλο. Στο πρόγραµµα µέχρι στιγµής συµµετέχουν 25 συνολικά σχολεία από όλη την Ευρώπη και ένα από την Ελλάδα. Στο τέλος κάθε σχολείο θα αµειφθεί µε 1.000 ευρώ για τη συµµετοχή του στο πρόγραµµα, που θα επαναληφθεί και στο νέο ακαδηµαϊκό έτος. Δικαίωµα συµµετοχής έχει κάθε σχολείο καταθέτοντας απλά µια αίτηση.

Πες µου το φύλο σου, να σου πω την... κλίση σου Το... φύλο των επαγγελματικών κατηγοριών αλλά και τις τάσεις των Ελλήνων μαθητών αποκαλύπτει έρευνα που πραγματοποίησε ο καθηγητής του Οικονομικού Πανεπιστημίου Αθηνών Εμμανουήλ Γιαννακουδάκης, μελετώντας επί πέντε χρόνια την προσωπικότητα των Ελλήνων ηλικίας από 14 έως και 24 ετών. Σύμφωνα με τα συμπεράσματα, τα οποία παρουσίασε κατά τη διάρκεια εκδήλωσης που πραγματοποιήθηκε από το Επαγγελματικό Επιμελητήριο Θεσσαλονίκης, κάθε φύλο παρουσιάζει τάση προς συγκεκριμένες επαγγελματικές κατηγορίες. Ειδικότερα, οι άνδρες έχουν κλίση, κατά σειρά προτίμησης, στους κλάδους των υπολογιστών, των φυσικών επιστημών, της μηχανολογίας, του περιβάλλοντος, της εκπαίδευσης και των αθλητικών. Μικρότερη κλίση παρουσιάζουν για τους κλάδους των κοινωνικών επιστημών, της γεωργίας, της υγείας, της επικοινωνίας, των τεχνών και των ανθρωπιστικών επιστημών. Με προσωπικότητα που χαρακτηρίζεται από έντονη κοινωνικότητα και καλλιτεχνικό ενδιαφέρον, οι γυναίκες διαπιστώθηκε πως υστερούν σε πρακτικούς επαγγελματικούς κλάδους, όπως αυτοί των μαθηματικών, των φυσικών επιστημών, της γεωργίας, της οικονομίας, της ασφάλειας, των υπολογιστών και της μηχανολογίας. Αντίθετα, εμφανίζουν τάση στου τομείς της εκπαίδευσης, των υπηρεσιών, των κοινωνικών επιστημών, των τεχνών, της επικοινωνίας και των νομικών. Αξιοποιώντας τα αποτελέσματα της έρευνας, ο κ. Γιαννακουδάκης σχεδίασε ένα έμπειρο σύστημα επαγγελματικού προσανατολισμού (γνωστό ως ΑΡΙΣΤΟΝ) το οποίο καθιστά απο-

τελεσματικότερο το έργο της συμβουλευτικής επί θεμάτων καριέρας, εφόσον μέσω αυτού είναι δυνατόν να διαπιστωθούν κλίσεις, ταλέντα, ικανότητες και δεξιότητες που κατέχει ένα άτομο, καθώς και το επίπεδο στο οποίο αυτό τα κατέχει. «Οπλισμένοι με αυτά τα στοιχεία μπορούμε πλέον να μελετήσουμε τους νέους μας και με γνώμονα την προσωπικότητά τους να χαράξουμε μία εθνική στρατηγική που θα αφορά την παιδεία και τα εργασιακά περιβάλλοντα στα οποία πρέπει να επενδύσουμε ώστε να έχει μέλλον ο νέος εργαζόμενος», δήλωσε στον «Α» ο κ. Γιαννακουδάκης.

«Κλειδί» η σωστή επιλογή επαγγέλµατος Σύμφωνα με τον ίδιο, η σωστή επιλογή επαγγέλματος έχει ως αποτέλεσμα την επαγγελματική καταξίωση, διότι το άτομο μοχθεί για το καλύτερο, γίνεται δημιουργικό και διακρίνεται στον επαγγελματικό χώρο στον οποίο έχει ενταχθεί και ανήκει. «Το εργασιακό περιβάλλον πρέπει να ταιριάζει με την προσωπικότητα και τις κλίσεις του εργαζομένου. Η προσωπική ικανοποίηση είναι δεδομένη όταν το άτομο ασχολείται επαγγελματικά με κάτι που του αρέσει και του ταιριάζει. Εξάλλου, είναι γνωστό πως η σωστή επιλογή επαγγέλματος αυξάνει την απόδοση και την παραγωγικότητα του εργαζομένου με προφανή οφέλη για το ευρύτερο κοινωνικό σύνολο», επισημαίνει χαρακτηριστικά. Ακόμη, στο πλαίσιο έρευνάς του αναφορικά με τις πανεπιστημιακές ειδικότητες του μέλλοντος, ο κ. Γιαννακουδάκης κατέγραψε μία συνεχώς αυξανόμενη ανάγκη για διεπι-

Ο καθηγητής του Οικονομικού Πανεπιστημίου Αθηνών Εμμανουήλ Γιαννακουδάκης

στημονική έρευνα και ανάπτυξη (π.χ. Βιοπληροφορική, Βιοηθική, Ψυχοκυβερνητική, Υπολογιστική Γλωσσολογία), ιδιαίτερα σε σχέση με τη μελέτη του ανθρώπινου εγκεφάλου και την πρόβλεψη της συμπεριφοράς του ατόμου. Σύμφωνα με τον ίδιο, μεταξύ των επαγγελμάτων που αναμένεται να γνωρίσουν άνθηση στο μέλλον, περιλαμβάνονται ειδικότητες όπως εμφυτευτής νανοσυσκευών, χαρτογράφος ασθενειών, ειδικός πνευματικών δικαιωμάτων, βιοκλιματολόγος (ειδικός στο βιοκλιματικό σπίτι, οικολογικό σπίτι, μείωση κατανάλωσης ενέργειας) κ.ά.


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

ΕΘΝΙΚΟ ΛΑΧΕΙΟ (Εκδοση: 213, Κλήρωση: 6η) Στη χτεσινή κλήρωση του Εθνικού Λαχείου, ημέρα 10η, τυχερές χιλιάδες ήταν οι: 81 και 93. Ολοι οι αριθμοί που κληρώθηκαν και τα ποσά που κερδίζουν είναι: Αριθμός

Κέρδος

81962 93743

36.100 9.100

Από 4.600 ευρώ κερδίζουν: 81984

93765

Από 1.900 ευρώ κερδίζουν: 81695

81949

93476

93730

Από 1.000 ευρώ κερδίζουν: 81047

81557

81581

81878

81923

81927

93338

93362

93659

93704

93708

93828

Από 500 ευρώ κερδίζουν: 81002

81043

81079

81084

81087

81105

81106

81111

81115

81116

81123

81129

81133

81152

81165

81181

81182

81189

81212

81217

81226 81278

81232 81281

81236 81294

81267 81314

81364

81366

81393

81402

81450

81453

81463

81483

81501

81516

81523

81525

81550

81553

81562

81596

81604

81640

81655

81657

81708

81718

81732

81741

81747

81749

81788

81796

81797

81829

81857

81861

81865

81873

81896

81899

81924

81929

81954

81970

81990 93017 93075

81992 93048 93095

93007 93059 93145

93013 93062 93147

93174

93183

93231

93234

93244

93264

93282

93297

93304 93343 93436

93306 93377 93438

93331 93385 93489

93334 93421 93499

93513

93522

93528

93530

93569 93638 93677

93577 93642 93680

93578 93646 93705

93610 93654 93710

93735 93783 93868 93896 93914

93751 93824 93886 93897 93933

93771 93860 93887 93904 93946

93773 93865 93892 93910 93962

93963

93970

93993

93998

Τέλος, από 240 ευρώ κερδίζουν όλοι οι άλλοι αριθμοί από 81000 έως 81999 και από 93000 έως 93999 που δεν αναγράφονται στον παραπάνω πίνακα. Η κλήρωση συνεχίζεται.

SUPER 3/EX TRA 5 SUPER 3 (1η κλήρωση):

119

SUPER 3 (2η κλήρωση):

629

SUPER 3 (3η κλήρωση):

925

EXTRA 5:

29

1, 3, 21, 23, 30

Πολυτεχνική πύλη στην... κοινωνία ερευνητικά έργα τα οποία μπορούν να βρουν εφαρμογή στους τομείς της ανάπτυξης, των κτιρίων και κατασκευών, του περιβάλλοντος, της πληροφορικής και της διοίκησης.

ΡΕΠΟΡΤΑΖ ΛΑΜΠΡΙΝΗ ΠΑΠΑ∆ΟΠΟΥΛΟΥ

Την απόσταση που χωρίζει την ακαδημαϊκή έρευνα από τον παραγωγικό ιστό φιλοδοξεί να μειώσει η Πύλη Ερευνητικών Δραστηριοτήτων της Πολυτεχνικής Σχολής (http://rp.web.auth. gr/rp/index.html) του Αριστοτέλειου Πανεπιστημίου Θεσσαλονίκης. Υπηρεσίες, καινοτόμα προϊόντα και άλλες χρήσιμες εφαρμογές, οι οποίες συχνά έμεναν «εγκλωβισμένες» στα υπόγεια των εργαστηρίων της Σχολής, μπορούν πλέον να βρουν το δρόμο τους προς την κοινωνία και την πρακτική εφαρμογή τους. «Η Πύλη αποτελεί ένα χρήσιμο εργαλείο για επιχειρήσεις και ιδιώτες και έχει ως στόχο να συντελέσει στην ευρύτερη διάδοση και εμπορική αξιοποίηση προϊόντων και υπηρεσιών που βασίζονται στην ακαδημαϊκή έρευνα», δήλωσε στον «Α» ο κοσμήτορας της Πολυτεχνικής Σχολής, Νίκος Μουσιόπουλος, ο οποίος χτες το απόγευμα παρουσίασε επίσημα την ιστοσελίδα στο αμφιθέατρο «Αλέξανδρος Τσιούμης» της Σχολής. Υπηρεσίες υπολογισμού

Από τη θεωρία στην πράξη

Οι εφαρμογές στις οποίες δουλεύει η ομάδα του Λεωνίδα Ντζιαχρήστου θα μπορούσαν να βοηθήσουν τις επιχειρήσεις που δραστηριοποιούνται στον τομέα των μεταφορών να εξοικονομούν καύσιμα υπολογίζοντας την πιο συμφέρουσα περιβαλλοντικά διαδρομή

ρύπων από τις οδικές μεταφορές, προτάσεις για ολοκληρωμένη διαχείριση

ιατρικών αποβλήτων και υπηρεσίες νανοδιείσδυσης είναι μερικά μόνο από τα

Στο εργαστήριο Θερμοδυναμικής του τμήματος Μηχανολόγων Μηχανικών η ομάδα του επίκουρου καθηγητή Λεωνίδα Ντζιαχρήστου δουλεύει εντατικά επάνω στο «COPERT 4», ένα πρόγραμμα υπολογιστή το οποίο υπολογίζει τις εκπομπές ρύπων από την οδική κυκλοφορία. Οπως αναφέρει ο κ. Ντζιαχρήστος, η συγκεκριμένη εφαρμογή, αν «ανοιγόταν» στην κοινωνία, θα μπορούσε να βοηθήσει τις επιχειρήσεις που δραστηριοποιούνται στον τομέα των μεταφορών να εξοικονομούν καύσιμα, υπολογίζοντας την πιο συμφέρουσα περιβαλλοντικά διαδρομή. «Η πύλη αυτή ελπίζουμε να αποτελέσει ένα διαμεσολαβητή ανάμεσα στη δουλειά μας και την κοινωνία, τη θεωρία και την πράξη, ώστε οι έρευνές μας να βρουν πρακτική εφαρμογή στην καθημερινότητα», σημείωσε.

Συνελήφθη 53χρονος για απαγωγή και βιασµό

Συνέλευση Συλλόγου Οικογένειας και Φίλων ΚΕΘΕΑ - Ιθάκη (Π. Θεσσαλονίκης)

Ενας 53χρονος Ρουμάνος συνελήφθη στην Κατερίνη με την κατηγορία ότι απήγαγε ανήλικη ομοεθνή του από το σπίτι της και τη βίασε επανειλημμένα. Σύμφωνα με πληροφορίες, την εξαφάνιση της ανήλικης δήλωσε η μητέρα της στις 11 Μαρτίου, σε αστυνομικό τμήμα της Λάρισας. Η 16χρονη κοπέλα ανέφερε στους αστυνομικούς ότι ο 53χρονος άντρας την κράτησε για περίπου είκοσι μέρες στο σπίτι του στην Ελασσόνα Λάρισας, όπου τη βίασε τουλάχιστον τρεις φορές, ενώ στη συνέχεια τη μετέφερε σε ξενοδοχείο στην Κατερίνη, όπου και πάλι τη βίασε. Από πληροφορίες προκύπτει ότι ο 53χρονος και η ανήλικη κοπέλα εντοπίστηκαν στην Κατερίνη από αστυνομικούς που πραγματοποιούσαν ελέγχους για επαιτεία, με αποτέλεσμα να προσαχθούν στο αστυνομικό τμήμα. Εκεί η κοπέλα κατήγγειλε ότι έπεσε θύμα αρπαγής και βιασμού, με αποτέλεσμα να συλληφθεί ο ομοεθνής της. Ο 53χρονος, με τη δικογραφία που σχηματίστηκε σε βάρος του, οδηγήθηκε στον εισαγγελέα Πλημμελειοδικών Κατερίνης.

Ο Σύλλογος Οικογένειας και Φίλων ΚΕΘΕΑ - Ιθάκη (Π. Θεσσαλονίκης) καλεί τα μέλη του σε τακτική Γενική Συνέλευση στις 28 Απριλίου, ημέρα Τετάρτη και ώρα 6.30 μ.μ. στα γραφεία του Συλλόγου (Συγγρού 4, 2ος όρ.), με θέματα ημερήσιας διάταξης: 1. Διοικητικός απολογισμός 2009. 2. Οικονομικός απολογισμός 2009. 3. Εκθεση εξελεγκτικής επιτροπής. 4. Εγκριση πεπραγμένων - απαλ-

λαγή ΔΣ. 5. Εγκριση προϋπολογισμού 2010. 6. Διάφορα θέματα - προτάσεις συζήτηση. Σε περίπτωση μη ύπαρξης απαρτίας, η ΓΣ θα πραγματοποιηθεί οπωσδήποτε την επόμενη Τετάρτη 5 Μαΐου την ίδια ώρα και στον ίδιο χώρο (χωρίς νέα ειδοποίηση). Η παρουσία όλων κρίνεται απαραίτητη.

∆ιόρθωση στην καταχώριση ΑΓΝΟ «ΓΑΛΑ ΜΟΥ» Από την αρμόδια διαφημιστική εταιρία διευκρινίζεται ότι σε καταχώριση που δημοσιεύτηκε σε εφημερίδες την Κυριακή 11 Απριλίου εκ παραδρομής αναφέρθηκε για το γάλα υψηλής παστερίωσης ΑΓΝΟ «ΓΑΛΑ ΜΟΥ» ότι το προϊόν είναι «πιο πλούσιο σε ασβέστιο», ενώ κανονικά θα έπρεπε να αναγράφεται ότι το προϊόν είναι «πλούσιο σε ασβέστιο».

Τιµή στον καθηγητή Γ. Σφακιανάκη Επίτιμος καθηγητής της Ιατρικής Σχολής του ΑΠΘ αναγορεύτηκε χτες ο καθηγητής Ακτινολογίας και Παιδιατρικής, διευθυντής στο Τμήμα Πυρηνικής Ιατρικής της Ιατρικής Σχολής Miller του Πανεπιστημίου του Μαϊάμι Γιώργος Σφακιανάκης (φωτογραφία). Η τελετή αναγόρευσης πραγματοποιήθηκε χτες στην αίθουσα Τελετών της Παλαιάς Φιλοσοφικής Σχολής του ΑΠΘ.Γεννημένος στην Αθήνα, το 1938, ο Γιώργος Σφακιανάκης εισήχθη στην Στρατιωτική Ιατρική Σχολή δεύτερος, το 1956. Φοίτησε στην Ιατρική Σχολή του ΑΠΘ και μετά την αποφοίτηση συνδύασε την στρατιωτική υπηρεσία και την επιστημονική εκπαίδευση. Υπηρέτησε σε μονάδες της Ελλάδας και της Κύπρου, ενώ απέκτησε ειδικότητα Εσωτερικής Παθολογίας στο ΑΧΕΠΑ και έγινε διδάκτωρ του ΑΠΘ, με διατριβή για την επίδραση της ινσουλίνης στο πλάσμα και τα ερυθρά αιμοσφαίρια. Ακολούθησε μετεκπαίδευση στις ΗΠΑ, με υποτροφία, στην Πυρηνική Ιατρική και την Ενδοκρινολογία. Εργάστηκε σε παιδιατρικά νοσοκομεία ως ειδικός στην Πυρηνική Ιατρική και επικέντρωσε την έρευνά του στις παθήσεις των νεφρών. Εξάλλου, την επιστημονική του υπόσταση υπογραμμίζουν η κλινική του εμπειρία, η ερευνητική του εργασία και οι δημοσιεύσεις του.Ο κ. Σφακιανάκης είναι ιδρυτικό μέλος και τέως πρόεδρος του Ελληνικού Πολιτιστικού και Μορφωτικού Συλλόγου του Μαϊάμι και του Ελληνικού Σχολείου «Σωκράτης».

ΛΟΤΤΟ ΤΖΑΚ ΠΟΤ σημειώθηκε στην πρώτη κατηγορία του ΛΟΤΤΟ εξάρια. Στη δεύτερη κατηγορία 5+1 δε βρέθηκαν νικητές και το ποσό των 50.000,00 ευρώ μεταφέρεται στην επόμενη κλήρωση του διαγωνισμού. Βρέθηκαν 11 πεντάρια, που το καθένα κερδίζει από 1.500,00 ευρώ, 671 τεσσάρια (30,00) και 15.907 τριάρια (1,50). Οι αριθμοί που κληρώθηκαν είναι οι 2, 4, 27, 37, 38, 48 και bonus το 5.


ΕΛΛΑΔΑ

Πέµπτη 15 Απριλίου 2010

Συνελήφθη ιδιοκτήτης ιστοσελίδας «Λουκέτο» έβαλαν οι αστυνομικές αρχές σε ιστοσελίδα μέσω της οποίας χρήστες του διαδικτύου μπορούσαν να παρακολουθούν κινηματογραφικές ταινίες και σειρές που δεν είχαν ακόμη προβληθεί στην Ελλάδα. Οπως έγινε γνωστό, οι άντρες του τμήματος δίωξης ηλεκτρονικού εγκλήματος της Ασφάλειας Θεσσαλονίκης συνέλαβαν έναν 25χρονο, ως ιδιοκτήτη και διαχειριστή της συγκεκριμένης ιστοσελίδας, η οποία μάλιστα βρισκόταν σε πλήρη λειτουργία τη στιγμή του ελέγχου. Σύμφωνα με πληροφορίες, ο νεαρός είχε 15 σέρβερ στην Αγγλία και είχε «φορτώσει» συνολικά 21.000 κινηματογραφικές ταινίες, τις οποίες οι χρήστες είχαν τη δυνατότητα να παρακολουθούν μέσω του υπολογιστή τους, ενώ παράλληλα μέσω της ίδιας ιστοσελίδας μπορούσαν να παρακολουθούν τηλεοπτικά προγράμματα και επεισόδια από ξένες σειρές. Οπως τονίζουν αξιωματικοί, οι χρήστες του Iντερνετ παρακολουθούσαν δωρεάν τις ταινίες ή οποιοδήποτε άλλο πρόγραμμα τους ενδιέφερε. Οι αστυνομικοί έφτασαν στα ίχνη του νεαρού ιδιοκτήτη της ιστοσελίδας έπειτα από έγκληση που υποβλήθηκε από εκπρόσωπο της Εταιρίας Προστασίας Οπτικοακουστικών Εργων (ΕΠΟΕ). Κατά τη διάρκεια της έρευνας που πραγματοποιήθηκε στο σπίτι του 25χρονου βρέθηκαν και κατασχέθηκαν ένας φορητός υπολογιστής, δύο σκληροί δίσκοι, μια φορητή συσκευή αποθήκευσης και τέσσερα βιβλιάρια καταθέσεων.

Νοίκιαζαν πλαστά dvd Πλαστά dvd πουλούσαν ή νοίκιαζαν οι ιδιοκτήτες δύο βιντεοκλάμπ όπου πραγματοποιήθηκε έλεγχος των αστυνομικών αρχών σε συνεργασία με κλιμάκιο υπαλλήλων της Εταιρίας Προστασίας Οπτικοακουστικών Εργων (ΕΠΟΕ). Οπως έγινε γνωστό, πρόκειται για δύο καταστήματα σε Πολίχνη και Καλαμαριά στα οποία βρέθηκαν και κατασχέθηκαν συνολικά 328 πλαστά dvd. Οι ιδιοκτήτες των καταστημάτων συνελήφθησαν.

31

ΡΕΠΟΡΤΑ Ζ

·ˆ˙`ˆ»–ˆ”‚ …˙…ˆ»¶ ·´‚‚ `ˆ»–ˆ”˙… …¿´ˆ‰¶` „‚ ´·¯…”†‚` .»..·. 27948/06/–/92/11 ·¸ ¨: ˛ ´ —  ˛ 21 - ¿ ¨— ¨ - •

¨— ˛ `´‚¯·‚ „‚ ¿”¶˜‚·` ¯¶`¶` ¨ 1 ‚…ˆ‚ˆ 2009  31 ‡·„·»–‚ˆ 2009 (¸˛ — ¨ ¨ —  .. 2190/20, ¨ ˇ  135 ˚—¨ —— ˛ —  ¨

  ˛ — — —  ¨¨ ¨ —, —˛ ¨— ˛, ¨¨ ¨ ‡”¿)

´¨ ¨ ¨ ¨  —— ¨ ¨— ˛   — ,       ¨ — — —   ¨¨ ¨ —,      — ¨ ˚— ˛ ˛  ˛ ˚—¨ ˛ — — ˛ ¨¨ ¨ ˛ ¨— ¨ ¨ ¨¨ ˛ « E ˆ˙`ˆ»–ˆ”‚ .·. `ˆ»–ˆ”˙… …¿´ˆ‰¶` „‚ ´·¯…”†‚`". ` —       ¨¨˚ ˛,  —  —  —¨¸˛  — ¸  ¸ — ˛ —˚˛ ˛ ¨ ˛ ¨¨˚˛  ˛ ¨— — ¨, ¨ ¨¨  — ˛ ¸—  ˇ  ˛ ¸—¨¸— —  ˛ ¨— — ¨,   ¨¨  ¨— — — —   ¨¨ ¨ — ¨ˇ  ¨— ˛  ˇ ˛  ˚     ˚ ˛ ˚— ˛ . 1.2. `´‚¯·‚ „´`´`¶` `ˆ…”‚„˙… ·`‡˙… (—˛ ¨ ¨— ˛ —˛ ¨)   ¸—¨ ˆ˛  — ¨ - …¨ — ¨ ˆ ˚—  ¨  ˛ - †— ˛ † ¨¨— ¨ · —  ¿ ¨  ¨  ¨    ‡—  ˇ  ˛ ‡—¨¸—    : www.euroconsultants.gr »‚”` ·´‚‚ ¿¨ — „    —  ¿  ¸  ‡.`. ¨— ‡— ˇ   `   ,·  —  »  `  ˇ ˛ ‡—— ˛—   `  —  01.01-31.12.2009 01.01-31.12.2008 01.01-31.12.2009 01.01-31.12.2008 · ¨ ˇ— ´¨ — ¸˛ A’ —  ¸  ‡.` ¨— ‡/ `   , ·  —  »  „   · ˚¨ —  13.151.914,37 16.222.726,00 11.802.328,11 14.892.699,73 „—  ˚ „¨ , –’ —  ¸  ‡.`., ·  —  »  , »— ¨  ¸˛ 4.350.098,15 5.700.949,74 3.971.753,89 4.836.278,21 •—  ˛  „    —  »  ‡.`. , ·  —  »  „ ¸˛    ,  ˛¨¸—   ¨— `¨   ¨ „¨˚    »  ‡.`., »˛ ·  —  »  ¸ —   ¨ ¨  2.221.917,04 2.206.757,56 2.217.580,59 2.114.425,00 † ˚— „  ˝ ˛ »  ‡.`., ¨ ˛ - »˛ ·  —  »  „ ¸˛ / (˝˛— )     1.464.184,54 1.620.848,80 1.585.977,82 1.323.424,76 ‡˛˛  — »¨ ¨˚   »  ‡.`., ¨ ˛ - »˛ ·  —  »  „ ¸˛ / (˝˛— ) ¨ ¨    () 920.896,74 1.165.128,43 1.069.972,66 897.027,34 ¶ ˛— ¨  ˚ — ˛ ¨  ‡—— ˛—  - ‚¸— ˛  ˛ — ˛  960.826,46 1.182.187,73 1.069.972,66 897.027,34 `   —  ˛ — — —   ¨¨ ¨  24 »¨ —  2010 - ‡— ¨— ¨¨ —˛ — ¨ -39.929,72 -17.059,30 0,00 0,00 (¨ — —  ¨˛ ˇ˛ ¨ ¨ —— ¨ & ˛   — ): ”—¨ — ¨  ¸¨ ¨ ¨    (–) -19.567,11 26.757,14 0,00 53.195,38    ·˚ ˛  ”˚— ˛ : · ¨ ˚˚ †. »—˝ ˚—¨ ˛ .».`..·.” 26441 ` ˚  — ¨ — ¨  ¸¨ ¨ ¨    () + (–) 901.329,63 1.191.885,57 1.069.972,66 950.222,72 ·˚ — ˛ ·¨— — ¨ `” ¨.... - Crowe Horwath - ‚¸— ˛  ˛ — ˛  941.535,38 1.208.944,87 1.069.972,66 950.222,72 ´    ˇ ˛  ˚ ˚   : »   ˛ ˚ ˛ - ‡— ¨— ¨¨ —˛ — ¨ -40.205,75 -17.059,30 0,00 0,00 1.1. `´‚¯·‚ „´`´`¶` ‚„…»‚„¶` •·`¶` (—˛ ¨ ¨— ˛ —˛ ¨) „ ¸˛/(˝˛— ) ¨ ¨  o  ¨¨ ˛ ¿ ¨  ¨  ¨    ¨ — ¨ (    ) 0,1335 0,1643 0,1487 0,1247 »‚”` ·´‚‚ 0,00 0,00 0,054 0,0904 31.12.2009 31.12.2008 31.12.2009 31.12.2008 ¿ —   — ¨ ¨¨ ˛ - (    ) „ ¸˛/(˝˛— )    ,  ˛¨¸—  , ·…·†¶´‚„ ‚¸— ˛ ——  ¨   ¨¨ ¨ ˚—¨ —— ¨ 5.478.954,41 5.645.950,65 5.432.138,34 5.586.948,39 ¸ —   ¨ ¨  2.551.428,79 2.522.811,35 2.455.017,31 2.348.253,24 ·¸  —  ¨ — ˛¨ 0,00 0,00 0,00 0,00 ¨— —   ¨   A ¨  — —¨ ¨ —— ¨ 836.246,39 706.379,01 254.906,33 218.569,57 `˛: ‡ ¨   ¸—¨    ¨  — ”—¨ ˛     ¨  — —¨ ¨ —— ¨ 2.516.498,19 2.559.756,40 3.241.285,12 3.005.188,96 1.4. `´‚¯·‚ „´`´`¶` ´»·‚„˙… ˙… (—˛ ¨ ¨— ˛ —˛ ¨) ˇ ¨¨ 29.853,03 50.513,86 0,00 0,00 ¿ ¨  ¨  ¨    »‚”` ·´‚‚ ¨—˛ — ¨ ¨  7.878.044,77 9.547.720,55 7.048.540,98 9.155.340,62 01.01.200901.01.200801.01.200901.01.2008”—¨     ¨  — —¨ ¨ —— ¨ 3.001.747,80 2.746.251,29 2.433.268,64 2.109.330,86 31.12.2009 31.12.2008 31.12.2009 31.12.2008 `ˆ…” ·…·†¶´‚„ˆ 19.741.344,59 21.256.571,76 18.410.139,41 20.075.378,40 ”— ˚—   ¸ ¨ ˛ — ˛ „ ¸˛     ( —˝  ¸ ¨ ˛ — ˛) 1.464.184,54 1.620.848,80 1.585.977,82 1.323.424,76 „•¶ •·`¶ „‚ ˆ¿¯·˙`·‚` 0,00 0,00 0,00 0,00 »—  „ ¨ ¨— 3.391.200,00 3.391.200,00 3.391.200,00 3.391.200,00 „ ¸˛     (¸—¨ —  ¸ ¨ ˛ — ˛) ”—¨ —— ¨ —¸—   ¨¨—  5.078.438,41 4.194.499,12 5.263.505,76 4.200.008,35 ¿  / —    ¨ ˚  ˚—¨: 329.551,75 314.110,85 237.436,72 233.828,24 `   —¸—   ¨¨—  —¸— ˛  ˛ — ˛  (¨) 8.469.638,41 7.585.699,12 8.654.705,76 7.591.208,35   — ‡— ¨— ¨¨ »—˛ — ¨ () 420.767,96 356.587,80 0,00 0,00 — —   ¨ ¨— ¨  ¨ ˚— 0,00 0,00 0,00 0,00 `   —¸—   ¨¨—  (˚) = (¨) + () 8.890.406,37 7.942.286,92 8.654.705,76 7.591.208,35  — —¨   ——  ¿  — 79.438,61 182.276,54 65.591,15 181.373,93 »¨   ˇ  ¸¨—¨     — 2.086.980,89 2.260.779,61 2.081.734,89 2.255.864,61 ` ¨¨˚¨—   ¸—¨    889,32 -3.226,11 889,32 -3.226,11 ¿  — / ”—  ¨   ˇ    — 1.932.590,54 1.754.806,69 1.879.665,69 1.711.405,50  ¨¨ ( ¸¨,  ¸¨,  ¸˛ ¨— ˝˛— ) – ¨   ˇ  ¸¨—¨   ˆ  — 1.421.770,35 1.808.217,83 1.056.154,71 1.548.347,45 ¸ — ˛  ¸ ¨ ˛ — ˛¨ 201.238,45 -178.750,89 117.033,83 69.010,73 ”—   ¨   ˇ    — 5.409.596,44 7.490.480,71 4.737.878,36 6.968.552,49 ¯  — —  — ¨— ¨ ˛  ¸¨ 401.242,31 646.049,84 373.521,73 606.576,92 ˆ  —  — ˝¨—  ˛     ¨  — —¨ ¨ ¿ / —    ¨ ˚  ˚—¨ ¨  ˚¨ —¨    ¨¨— 

—— ¨   —˝ ¨ ˚—¨  ˛ ˛ 0,00 0,00 0,00 0,00 — ˛ ˛ ˛  — ˝¨—  — — ˚—   ¸ ¨ ˛ — ˛: `      (¸) 10.850.938,22 13.314.284,84 9.755.433,65 12.484.170,05 »—  ˛ / (¨  ˛ ˛) ¨ˇ¨  20.660,83 -4.172,63 0,00 0,00 `ˆ…” „•¶` •·`¶` „‚ ˆ¿¯·˙`·˙… (˚) + (¸) 19.741.344,59 21.256.571,76 18.410.139,41 20.075.378,40 »—  ˛ / (¨  ˛ ˛) ¨¨—˛  2.254.632,51 1.974.818,71 1.998.965,25 1.590.788,89 (»—  ˛) / ¨  ˛ ˛    (˛ ¸¨—¨  ) -2.319.755,29 -1.454.293,81 -2.466.945,39 -1.256.292,55 1.3. `´‚¯·‚ „´`´`¶` »·´–”˙… ‚‡‚˙… „·˜”‚˙… (—˛ ¨ ¨— ˛ —˛ ¨) »— : ¿ ¨  ¨  ¨    ¯  — —  — ¨— ¨ ˛  ¸¨ ¨¨˛ ¨ -392.307,77 -640.625,00 -364.587,19 -601.152,08 »‚”` ·´‚‚ -57.746,26 -50.126,61 -28.934,26 -50.126,61 31.12.2009 31.12.2008 31.12.2009 31.12.2008 „¨¨˛ —  — `   —

  / (  ) ¨ `   —¸—   ¨¨—   ¨ ˛  — ¸ 1.982.029,00 2.406.909,69 1.518.948,98 2.094.206,12 (01.01.2009 ¨— 01.01.2008 ¨— —¨) 7.942.286,92 7.630.263,47 7.591.208,35 7.689.070,48 — ˚—   ¸ ¨ ˛ — ˛ (¨) ·¸ —   ¸ ¨ ˛ — ˛ ` ˚  — ¨ — ¨  ¸¨ ¨ ¨    ( —˝  ¨— ¸—¨ —  ¸ ¨ ˛ — ˛) 901.329,63 1.191.885,57 1.069.972,66 950.222,72  ˛ ˛ ˇ ˚¨ —  , ˚˚ , -356.810,00 -440.051,00 -55.000,00 -603.002,00   ˛ ˛ / (—  ˛) —    ¨¨—  53.265,07 168.222,73 0,00 0,00 — ¨—  ¨— —  ¸   -294.317,63 -385.348,14 -133.354,12 -211.977,45 ‡—¨˛ˇ ¨  — ¨¨ -232.836,48 -893.138,56 -232.836,48 -893.138,56 ˚ ¨   ¨ ¨— ¨ ¢  ¨˚—  ——  0,00 4.300,00 0,00 4.300,00 ˚  /(˛ —) —¸—    226.361,23 -154.946,29 226.361,23 -154.946,29 ·—  ¨ — ¨ ˛ —   ¨ & ¨ ¢  ¨˚. ——  ´ — —  ¨ˇ  5.209,44 28.030,83 4.910,25 26.576,83 `   —¸—   ¨¨—  ˛ ˛  — ¸ 41.562,39 53.643,00 41.562,39 53.643,00 (31.12.2009 ¨— 31.12.2008 ¨— —¨) 8.890.406,37 7.942.286,92 8.654.705,76 7.591.208,35 » — ¨¨ —  ¨ˇ ¨ ·¸ —     ¨ ¸—¨ —  ¸ ¨ ˛ — ˛ 0,00 161.260,92 0,00 161.260,92 ¿`•·´ `´‚¯·‚ „‚ ¿”¶˜‚·` 1) ¶ ˛ — ˛ ¨— — ¨ — ¨— ˚ ˛  ˚— ¨   — ¨— ˛  ˛ ˛ 2004,  ˚—¨ — —   & ˚˚—  ¨— —  — ¨ ˚   ˛ — `   —

  / (  ) ¨ -604.355,80 -578.164,39 -141.881,48 -569.198,70 ¨ ¨— ˇ¨— ¨¨ — ¨ ˛ `˛—  ˛ 29 ˛ ·˛ —¨ — — ˛   E ˇ ˛ . 2) ‡ ¨ — ¨˛ — ˚— —   ˇ ¸  ˛ — ¸ —   ¸ ¨ ˛ — ˛ () ˚— —    —˛ —. 3) ‡ ¨   ¨— — ¨ ˚˚ ¨ ¨ — ¨   ¨ ¨  ¨   25%     ˚¨ — , ¨ ¨ ¨¨ ¯ ˛¨¸—   ¸ ¨ ˛ — ˛ 29.693,01 123.754,12 0,00 0,00 ¨ ¨    ¨— ˛ ¨ˇ¨ ˛ ˇ ˛  ¨— — ˛ ¨— —˛ ˛ ¨ ˛. 4) ‡ ˛  ¨¨˚˛ ˛  — ˛   — ¸ ˛    ¨ ·—  ¨ — ¨ ¨  ˛ ˛ —    ¨¨—  184.619,62 -188.556,79 184.619,62 -188.556,79 — — ˛   ˛ ˛   ˛  ˛  ˛˚  ˛. 5) — — —   ¨¨ ¨ — ˛ ¨— — ¨ ¸  —¨¨ ¨— — —˛  ¿˛   ˚—¨ —  ˛  ¨¨—  106.076,26 191.613,30 0,00 299.011,40 ¨¨ ¨ —  ¨¨ — ˝  ¨  ¨— — . 6) ¶ ¨— — ¨ ¨— — ¨— —   —  ¸    — ¸—  ˛  ¸—¨—˛ — ¨ ¸—¨    ¨¨    ·—  ¨ — ¨  ¸ˇ ¨ / ¨¨˛ ˇ ¨ ¸¨ —¨ -492.192,74 -117.937,12 -492.192,74 0,00  —  ¸— ¨ —   ¨ ¨ — ˛ ¨ ¨ — ¸—¨—˛—    ˚¨ . 7) ´¨  ¨         ˛¨— ˇ— — ¨—: ¨) ˚—¨ ¨ ˚  · ˛ — ¸¨—   ˛ — ˚—¨ ˛ ¨— — ¨ ¨—   — 160.000,00   , ) ˚—¨ —    — ˚—¨ ˛ ¨— — ¨     578.414,48   ¨— 592.261,94 · ˛ —    ¨  ˛¨¸—     ˚—¨   O —. 8) `  O —, ˛    ¨  — ¸, ¨¨ ˛ ˇ˛ ¨ "—¨ — ¨  ¸¨ ¨ ¨   "      -19.567,11 — ˇ — (   —¨) -154.751,86 -118.352,93 -154.751,86 -118.352,93   ¨ — ¨   ¨— ¨ "˝˛—  ¨ ˛  — —   ¨¨ ¨   —   " ( ¨¨˚¨—   ¸—¨   ). 9) ¶ ¨— — ¨, ˛ 31˛ » — ¨¨ ˛ ˇ ¨ -215.477,69 -828.552,16 -215.477,69 -828.552,16 ‡  —  2009,  ˛    ¿  ˚ ¨¨ ‡—¨ ˇ ˛ »     —  ˛,   ¨  — ¨ 28/06/2007 ¨— 02/06/2008 `   —

  / (  ) ¨ ¨ ¨ —  ´¨ —   †—   `       ˛, ¨— ¸ ¨ —   — ¸—  . ¿ —

   ˛   —  ¨    ˛¨¸—   ¸ ¨ ˛ — ˛ (˚) -542.033,40 -938.031,58 -677.802,67 -836.450,48

˛ ˛—  ˛ 17 ˛ ·˛ —¨ — — ˛   E ˇ ˛. 10)  ¨ —ˇ    —   —   ˛ ¨— — ¨ ˛ 31/12/2009 ¨ ¨  72 „¨ˇ¨ ˛ ¨  ˛ ˛ / (—  ˛) ¨ ¨—¨ ¨ ¸—¨ˇ —¨ ¨ ¨ ¨—  —   85. O ¨ —ˇ    —   —   ˛ ¨— — ¨ 31/12/2008 ¨ ¨  57 ¨ ¨ ¨—  —   68. 11) ´¨ ¨— — ¸  ¨¨  — ¸ (¨) + () + (˚) 835.639,80 890.713,72 699.264,83 688.556,94  ¨  ˛  ¨— ¨˚     — ¨ ¨ ˛  ¨ ˛ ˛ — — ˛   ˛  ¨— ¨  —¨  ¨¨—˛  ¨—    ˛ ´¨—¨ ¨ ¸—¨ˇ —¨ ¨— — ¸  ¨¨  ¨ ˛  — ¸ 1.336.532,00 445.818,28 1.039.490,63 350.933,69 ¨— — ¨ ¨—  —  ˛ ˛ ˛ ˛    ¨  — ¸ ,        — ¨ ¨¨˚  ˛  ¨ ¸¸ ¨, ¨¨ ˛  —¨  ´¨—¨ ¨ ¸—¨ˇ —¨ ¨— — ¸  ¨¨ ˛ ˛  — ¸ 2.172.171,80 1.336.532,00 1.738.755,46 1.039.490,63 ‡.”.¿. 24,   ¨ ˛   ˛  ¨— ˝¨—  ¨ ¨ ¨  — ¨ ¨: ¨)  E ¸¨ )  E ¸¨ ˚) ¨—˛ — ¸) ˆ  — ) ` ¨¨˚  ¨— ¨—  ¸— ˇ —     ¨—   ˛ ¸—— ˛ ˛

) ¨—˛ — ¨ ¸— ˇ — ¨  ˛ ¨—  ˛ ˛ ¸—— ˛ ˛ ˝) ˆ  —   ¨ ¸— ˇ — ¨  ˛ ¨—  ˛ ˛ ¸—— ˛ ˛

 O — 393.424,80 794.833,39 473.972,19 498.547,57 722.227,03 20.095,44 37.661,64

·¨— — ¨ 220.219,43 934.995,12 249.722,68 477.771,10 513.747,83 20.095,44 24.541,84

12) — ¨— —   —  , ¨   ¨  ¨ — ¨ ˛ ·¨— — ¨  —  —     ¨ ¨— ¨ˇ  ¨— ˛  ˇ¸  ¨  ˛   

— —˛  — —   ¨¨ ¨ — ¨ ¨— ˇ¨— ¨¨ — ¨ — ˛— — 8 ¨— 9 ˛ ·˛ —¨ — — ˛   E ˇ ˛. 13) `˛ — ˛ ˛  ¸¸ ¨˛   2009,   ˛  ˛ ¨— —˛ 

—˛  — ¸   : ¨) ˛ — ¸ ˛ ˛ ˇ ˚¨ — ˛  CHOICEXS Plc ˛ »˚¨ ˛ – ¨— ¨     ˛  73,64%, ˛ — ¨  —   ˛ˇ—  100%    ˛ ˇ ˚¨ — ˛  ¨— — ¨ "ICTV HELLAS A.E.- · ˝— ¨ ‡—  ¨ ·— —— ¨ ¨— ¿˛   ˛ ˛ .·.", ¨— ) ˛ — ¸ ˛ ¨ ˛ ˚˚˛ "†…˙»˙… ¿”¶˜‚„¶` .·.", ˛ — ¨ ˛ « E ˆ˙`ˆ»–ˆ”‚ .·."  —    44,46%, ˛ "GNOMON PLIROFORIKIS (CYPRUS) Ltd"  ¨— ¨ ˛  79.700,00   ¨—    ˛  85%. ¿ —

   ˛   —  ¨   — ˛— — 8 ¨— 9 ˛ ·˛ —¨ — — ˛   E ˇ ˛. 14) `˛ — ˛ ˛  ¸¸ ¨˛   2009,   ˛  ˛ ¨   ˛˚  ˛ ¨— ˛ ¨— —˛ 

—˛  — ¸   : ¨) ¨ ˛ ˇ ˚¨ — ˛ ¨— — ¨ "ICTV HELLAS A.E.- · ˝— ¨ ‡—  ¨ ·— —— ¨ ¨— ¿˛   ˛ ˛ .·." ˛ ¨˚ ¨     40% ˛ ˛ — ˛˚ ˛ ¨— — ¨ "–·””ˆ» `ˆ»–ˆ”‚ ·¿‚¯·‚¶`·˙… ·.¿.·. ¨— ¨ 300.000   ¨— ) ¨ ˛ ˇ ˚¨ — ˛ ¨— — ¨ "FIRST ELEMENTS EUROCONSULTANTS LIMITED" ˛ — ¸ ˛ ˛ ¨— — ¨ "HUMAN ASSET LTD" ˛ „ ¢    ¨— ¨ ˛  600   ¨—    ˛  60%. ¿ —

   ˛   —  ¨   — ˛— — 8 ¨— 9 ˛ ·˛ —¨ — — ˛   E ˇ ˛.

24 »¨ —  2010

 ¿·‡` ´ˆ ‡.`. & ‡‚·ˆ•ˆ…˙… `ˆ»–ˆ”`

 …´‚¿·‡` ´ˆ ‡.`. & ‡‚·ˆ•ˆ…˙… `ˆ»–ˆ”`

 ‚„…»‚„` ‡‚·ˆ•ˆ…´¶`

¿‚` `. „„´`‚„` .‡.´. ‰ 499816/87

·ˆ`´•‚` †. ´ˆ‚‡¶` .‡.´. H 177920/08

†·˙†‚` –. ´`‚˙´` .‡.´. · 670996/07 ’ ´¨ ˛ .»..·.: 13372


32

ΔΙΕΘΝΗ

Πέµπτη 15 Απριλίου 2010

Σήµανε η ώρα του ντιµπέιτ Για πρώτη φορά στη Βρετανία διοργανώνεται τηλεοπτική αναµέτρηση αρχηγών Ο Kλεγκ παρουσίασε το εκλογικό μανιφέστο των Φιλελεύθερων Δημοκρατών

ΤΟΥ ΚΩΣΤΑ ΓΟΥΛΗ goulis@ekdotiki.gr

Αυλαία στις προεκλογικές τηλεοπτικές αναμετρήσεις των πολιτικών αρχηγών ανοίγει για πρώτη φορά σήμερα στη Βρετανία, όπου θα στηθούν κάλπες στις 6 Μαΐου. Η τηλεοπτική αναμέτρηση εκτιμάται ότι θα περιπλέξει περαιτέρω το σκηνικό, ενισχύοντας την άποψη ότι οι φετινές εκλογές θα είναι οι πλέον απρόβλεπτες στις τελευταίες δεκαετίες.

Η

ιστορική εµφάνιση του πρωθυπουργού και ηγέτη των Εργατικών, Γκόρντον Μπράουν, δίπλα στο µεγάλο αντίπαλό του, επικεφαλής του Συντηρητικού Κόµµατος, Ντέιβιντ Κάµερον, και τον ηγέτη των Φιλελεύθερων Δηµοκρατών, Νικ Κλεγκ, στο τηλεοπτικό στούντιο, θα είναι η πρώτη από τις τρεις αναµετρήσεις που θα διεξαχθούν ανά εβδοµάδα µέχρι τις 29 Απριλίου. Στη µιάµιση ώρα της αναµέτρησης οι τρεις πολιτικοί αρχηγοί θα δεχθούν ερωτήσεις από παριστάµενους στο στούντιο πολίτες σχετικά µε ζητήµατα όπως η εγκληµατικότητα και η περίθαλψη, ενώ στις άλλες δυο τηλεοπτικές εµφανίσεις θα κυριαρχήσουν τα ζητήµατα της εξωτερικής πολιτικής και της οικονοµίας. Η επίδοση των τριών ανδρών στο «γυαλί» αναµένεται µε µεγάλο ενδιαφέρον, καθώς ο

απερχόµενος πρωθυπουργός βρίσκεται σε µειονεκτική θέση λόγω της κυβερνητικής θητείας και τυχόν µέτρια εµφάνιση δε θα επιβαρύνει την κατάσταση. Αλλωστε ο 59χρονος Μπράουν θεωρείται ο πλέον «αντι-τηλεοπτικός» από τους τρεις και οι τηλεοπτικές εµφανίσεις του χαρακτηρίζονται από τους ειδικούς απογοητευτικές. Παράδοξα, οι νεότεροί του αντίπαλοι κινδυνεύουν να απογοητεύσουν περισσότερο το κοινό λόγω των προσδοκιών που δηµιουργήθηκαν.

Οι 43χρονοι αντίπαλοι Ο 43χρονος Κάµερον παροµοιάζεται από πολλούς µε το χαρισµατικό Τόνι Μπλερ και ορισµένοι έσπευσαν να παραλληλίσουν το σηµερινό ντιµπέιτ µε εκείνο του 1960

Μειώνεται η διαφορά των Συντηρητικών από τους Εργατικούς στις ΗΠΑ, το οποίο επιβράβευσε το διεκδικητή της προεδρίας Τζορτζ Κένεντι έναντι του Ρίτσαρντ Νίξον. Αρκετοί υποστηρικτές του Κάµερον άλλωστε παροµοιάζουν τον ηγέτη των Συντηρητικών µε τον Κένεντι, ισχυριζόµενοι ότι η εικόνα... συµπληρώνεται από την παρουσία στο πλευρό του της αριστοκρατικής συζύγου του, η οποία είναι έγκυος και προκαλεί συµπάθεια στο βρετα-

νικό κοινό, όπως συνέβαινε µε την Τζάκι πριν από µισό αιώνα. Ο συνοµήλικος του Κάµερον, Νικ Κλεγκ, είναι ο πλέον άπειρος από τους τρεις και στα βρετανικά γραφεία στοιχηµάτων υποστηρίζουν ότι έχει τις περισσότερες πιθανότητες να χάσει σήµερα λόγω του εκρηκτικού χαρακτήρα του. Για τον ηγέτη των Φιλελεύθερων Δηµοκρατών ωστόσο αποτελεί ήδη επιτυχία το γεγονός ότι µοιράζεται το... πάλκο µαζί µε τους µεγάλους της πολιτικής σκηνής, ενώ θα έχει τα φώτα συγκεντρωµένα επάνω του µε αφορµή το προεκλογικό µανιφέστο του κόµµατός του, το οποίο παρουσίασε χτες, και του διαφαινόµενου ρόλου του ρυθµιστή των πολιτικών εξελίξεων µετεκλογικά. Ο Κλεγκ, που υποστήριξε ότι µόνο το κόµµα του έχει σαφές σχέδιο για την αντιµετώπιση της κρίσης, αποφεύγει να τοποθετηθεί για το ενδεχόµενο συνεργασίας µε τον έναν ή τον άλλον µετά τις 6 Μαΐου και στοχεύει σε αύξηση των 63 εδρών που κατέχουν σήµερα οι Φιλελεύθεροι στη Βουλή των 646 µελών. Την αβεβαιότητα στο πολιτικό σκηνικό ενίσχυσαν χτες δυο έρευνες που δηµοσιεύτηκαν στις εφηµερίδες «Τάιµς» και «Ιντιπέντεντ», από τις οποίες προκύπτει µείωση της διαφοράς στην πρόθεση ψήφου µεταξύ Συντηρητικών και Εργατικών. Η αξιωµατική αντιπολίτευση συγκεντρώνει τη στήριξη του 36% των ερωτηθέντων και προηγείται από 3% έως 6% των κυβερνώντων, ενώ το κόµµα του Κλεγκ ακολουθεί µε 19%-21%.

Ο Ροµποναύτης πάει στο ∆ιάστηµα Θέση στο διαστημικό λεωφορείο έκλεισε το ρομπότ που κατασκεύασαν η Αμερικανική Αεροδιαστημική Υπηρεσία (NASA) και η Τζένεραλ Μότορς. Ο Ρομποναύτης 2, όπως βαφτίστηκε από τους δημιουργούς του, θα μετέχει στην αποστολή που έχει προγραμματιστεί για το Σεπτέμβριο με προορισμό το Διεθνή Διαστημικό Σταθμό (ISS). Το πρώτο ανθρωποειδές ρομπότ που θα εγκαταλείψει τη Γη, όπως επισήμανε ο επικεφαλής του Γραφείου Ολοκλήρωσης Συστημάτων Εξερεύνησης της NASA, Τζον Ολσον, θα χρησιμοποιηθεί ως βοηθός των αστροναυτών σε διαστημικούς περιπάτους και των επιστημόνων σε πειράματα στον ISS. Σύμφωνα με τον ίδιο, η συνεργασία ανθρώπων και ρομπότ είναι καθοριστική για το άνοιγμα των «συνόρων» στο ηλιακό σύστημα και θα επιτρέψει στη NASA να κάνει ένα μεγάλο βήμα στο Διάστημα. Οι υπεύθυνοι στη NASA ελπίζουν ότι τα σύννεφα που είχαν σωρευτεί πάνω από το διαστημικό πρόγραμμα της υπηρεσίας μετά τη δραστική συρρίκνωσή του από τον πρόεδρο των ΗΠΑ, Μπαράκ Ομπάμα, θα διαλυθούν σήμερα διά στόματος του ίδιου Αμερικανού ηγέτη. Ο Ομπάμα θα εξαγγείλει τη νέα πολιτική κατά την επίσκεψή του στο Διαστημικό Κέντρο «Κένεντι», στο ακρωτήρι Κανάβεραλ, στη Φλόριντα, και σύμφωνα με αξιωματούχους του Λευκού Οίκου θα ανακοινώσει την αναβίωση του προγράμματος για το διαστημικό θάλαμο Orion και θα δώσει εντολή για την ανάπτυξη νέου πυραύλου, που θα έχει δυνατότητα μεταφοράς αστροναυτών και φορτίων στο Διάστημα. Η στροφή του Ομπάμα σε σχέση με τις ανακοινώσεις του μόλις πριν από λίγους μήνες σημειώνεται δυο εικοσιτετράωρα μετά την κριτική που άσκησαν στην πολιτική του ο πρώτος αστροναύτης ο οποίος πάτησε στη Σελήνη, Νιλ Αρμστρονγκ, συνάδελφοί του και πρώην υψηλόβαθμα στελέχη της NASA, υποστηρίζοντας ότι η διαγραφή του προγράμματος Constellation, που στόχευε στην επιστροφή στο φεγγάρι και μελλοντικά στην κατάκτηση του Αρη, μετατρέπει τη NASA σε κομπάρσο στο Διάστημα. Ο Ομπάμα στοχεύει τώρα στην επιτάχυνση ανάπτυξης ενός πιο ευέλικτου προγράμματος, κατευθύνοντας τη NASA σε εξερευνητικές αποστολές στο Διάστημα με τη χρήση ρομπότ, ώστε να διαπιστωθούν οι δυνατότητες για μελλοντικές επανδρωμένες αποστολές σε καθεστώς ενισχυμένης ασφάλειας. Παράλληλα ο Αμερικανός ηγέτης αναμένεται να επισημάνει ότι με το νέο πρόγραμμα θα μεταμορφωθεί η περιοχή, αφού θα δημιουργηθούν χιλιάδες νέες θέσεις εργασίας τόσο στη Φλ ό ρ ι ν τα όσο και σε άλλες περιοχές της χώρας, ενώ η NASA θα πάρει μια... βαθιά ανάσα και θα αποκτήσει εφικτούς στόχους για τις επόμενες δεκαετίες.


ΔΙΕΘΝΗ

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Χτύπησε πάλι ο Εγκέλαδος Εκατοντάδες νεκροί στην Κίνα από τον ισχυρό σεισµό των 7,1 Ρίχτερ ΤΟΥ ∆ΗΜΗΤΡΗ ΟΥΖΟΥΝΙ∆Η dimitouz@yahoo.gr

Εικόνα ολικής καταστροφής παρουσιάζει το οροπέδιο του Γιουσού στην επαρχία Κινγκχάι στην Κίνα, που συγκλονίστηκε από ισχυρό σεισμό. Οι Κινέζοι σεισμολόγοι ανακοίνωσαν ότι το μέγεθος της σεισμικής δόνησης ήταν 7,1 βαθμοί της κλίμακας Ρίχτερ, ενώ το Αμερικανικό Γεωλογικό Ινστιτούτο έκανε λόγο για σεισμό της τάξης των 6,9 Ρίχτερ.

Ο

σεισµός σηµειώθηκε σε µια ορεινή αραιοκατοικηµένη περιοχή, δίπλα στο Θιβέτ, η οποία βρίσκεται σε υψόµετρο 4.000 µέτρων. Το 70% των σχολείων συνολικά στο Γιουσού και ένα µεγάλο τµήµα των κατοικιών, που ήταν κατασκευασµένες από ξύλο και λάσπη, κατέρρευσαν στην περιοχή µε αποτέλεσµα τουλάχιστον 589 άνθρωποι να χάσουν τη ζωή τους. Μόνο σε µια πόλη κατέρρευσε το 85% των κατοικιών. Ο αριθµός των θυµάτων ενδέχεται να είναι πολύ µεγαλύτερος, καθώς οι έρευνες γύρω από τον εντοπισµό αγνοουµένων βρίσκεται σε εξέλιξη. Ανάµεσα στους αγνοουµένους περιλαµβάνονται µαθητές που θάφτηκαν ζωντανοί κάτω από τα συντρίµµια σχολείων, ενώ οι τραυµατίες ξεπερνούν τους 10.000. Ο πρόεδρος, Χου Ζιντάο, απέστειλε στην περιοχή τον αντιπρόεδρο της κυβέρνησης, Χουί Λιάνγκιου, για να επιβλέψει την επιχείρηση διάσωσης, στην οποία συµµετέχουν τουλάχιστον 5.700 στρατιώτες. Οι διασώστες, οι οποίοι πρέπει να συντονίσουν τις ενέργειές τους σε µια τεράστιας έκτασης περιοχή µε υποτυπώδες οδικό δίκτυο, δεν έχουν τη δυνατότητα να επικοινωνήσουν τηλεφωνικά µεταξύ τους λόγω της

Ρωσία - ΗΠΑ ανταγωνίζονται για τη βοήθεια στην Κιργισία Στην Μπισκέκ έσπευσε χτες ο Αμερικανός αναπληρωτής υπουργός Εξωτερικών, Ρόμπερτ Μπλέικ (φωτογραφία), και υποσχέθηκε να προσφέρει βοήθεια στη νέα κυβέρνηση που σχηματίστηκε στην Κιργισία μετά την ανατροπή του προέδρου, Κουρμανμπέκ Μπακίγεφ, στη διάρκεια λαϊκής εξέγερσης με 84 νεκρούς. Την ίδια στιγμή η Ρωσία, η οποία επίσης διαθέτει βάση στην Κιργισία και ήταν η πρώτη

που αναγνώρισε τη νέα κυβέρνηση, ανακοίνωσε ότι της χορηγεί βοήθεια ύψους 50 εκατομμυρίων δολαρίων, ενώ ο Μπακίγεφ φαίνεται ότι ετοιμάζει βαλίτσες, καθώς εμφανίστηκε πρόθυμος να αναγνωρίσει υπό όρους τη νέα ηγεσία.

Φονικές µάχες διαδηλωτών και αστυνοµικών στην Ινδονησία Οι τραυματίες από το σεισμό ξεπερνούν τους 10.000

κατάρρευσης του δικτύου.

Μετ’ εµποδίων Επιπλέον, οι προσπάθειες συναντούν µεγάλα εµπόδια, καθώς οι διασώστες δεν έχουν τα απαραίτητα σκαπτικά και άλλα µηχανήµατα που θα τους βοηθήσουν στο γρήγορο απεγκλωβισµό των παγιδευµένων µε αποτέλεσµα να εκφράζονται φόβοι ότι θα χαθεί πολύτιµος χρόνος και θα αυξηθεί ο αριθµός των θυµάτων. Ακόµη, κάτοικοι διαµαρτύρονται ότι στις περιοχές τους δεν έχει σταλεί ακόµη το απαραίτητο φαρµακευτικό υλικό για την παροχή πρώτων βοηθειών σε τραυµατίες, οι οποίοι κινδυνεύουν να πεθάνουν. Η διαφαινόµενη απουσία συντονισµού στη διάσωση και την παροχή βοήθειας στους σεισµόπληκτους εκτιµάται ότι θα διογκώσει τις διαµαρτυρίες και οι αρχές είναι πιθανό να επικριθούν άλλη

µια φορά για αναλγησία, όπως συνέβη πριν από δύο χρόνια, όταν ισχυρός σεισµός συγκλόνισε το Σετσουάν µε αποτέλεσµα τουλάχιστον 90.000 άνθρωποι να χάσουν τη ζωή τους. Οι αρµόδιες υπηρεσίες προσπαθούν, πάντως, να συνδράµουν τους δεκάδες χιλιάδες πληγέντες που έµειναν άστεγοι και αναγκάζονται να υποµείνουν το τσουχτερό κρύο, καθώς η θερµοκρασία πέφτει κάτω από το µηδέν στη διάρκεια της νύχτας. Η κατάσταση επιδεινώνεται από τους ισχυρούς ανέµους που πνέουν στην περιοχή. Προς το παρόν, έχουν σταλεί 5.000 σκηνές και 100.000 παλτά και κουβέρτες στην περιοχή, ενώ ο εξόριστος ηγέτης των Θιβετιανών, Δαλάι Λάµα, απέστειλε συλλυπητήριο µήνυµα στους συµπατριώτες του που αποτελούν την πλειοψηφία του τοπικού πληθυσµού.

∆ιχόνοια στην Πολωνία για τον τόπο ταφής του Κατσίνσκι Αυξάνονται οι διαμαρτυρίες στην Πολωνία γύρω από το σχέδιο της Καθολικής Εκκλησίας της χώρας να ταφεί ο πρώην πρόεδρος, Λεχ Κατσίνσκι -ο οποίος έχασε τη ζωή του το Σάββατο μαζί με τη σύζυγό του και άλλα 95 άτομα σε αεροπορικό δυστύχημα στη Ρωσίαστον καθεδρικό ναό της Βαβέλ στην Κρακοβία, όπου αναπαύονται οι ήρωες του

33

έθνους, ποιητές και βασιλιάδες. Η εφημερίδα «Γκαζέτα Βιμπόρζα» χαρακτήρισε την απόφαση «βιαστική», ενώ ο Πολωνός σκηνοθέτης Αντρέι Βάιντα ζήτησε να ταφεί αλλού ο Κατσίνσκι. Την ίδια ώρα, δεκάδες χιλιάδες Πολωνοί εκφράζουν την αντίθεσή τους στην επιλογή του ναού της Βαβέλ με σχετικά μηνύματά τους στο διαδίκτυο. Οι αντιδρώντες

υποστηρίζουν ότι δεν αξίζει ο Κατσίνσκι να ταφεί στον ίδιο χώρο με εθνικούς ήρωες της χώρας, ενώ λένε ότι σύντομα θα αποκαλυφθεί αν είχε εμπλακεί σε σκάνδαλα. Η κηδεία του Κατσίνσκι θα πραγματοποιηθεί την Κυριακή, παρουσία των προέδρων των ΗΠΑ, της Ρωσίας, της Γερμανίας, της Γαλλίας και άλλων χωρών. Την ίδια

ώρα, η κυβέρνηση αποφάσισε να λάβει, την επόμενη εβδομάδα, την απόφαση για την ημερομηνία διεξαγωγής των πρόωρων προεδρικών εκλογών, οι οποίες επρόκειτο αρχικά να πραγματοποιηθούν το φθινόπωρο. Αξιωματούχοι του κυβερνώντος κόμματος, «Πολιτική Πλατφόρμα», δήλωσαν ότι οι εκλογές ίσως οριστούν για τις 20 Ιουνίου.

Εκατοντάδες μουσουλμάνοι κρατώντας μαχαίρια, πέτρες και βόμβες μολότοφ συγκρούστηκαν χτες με αστυνομικούς (φωτογραφία) στο λιμάνι της Τζακάρτα με αποτέλεσμα να σκοτωθούν δύο άνθρωποι και να τραυματιστούν άλλοι 130. Οι διαδηλωτές πυρπόλησαν αστυνομικά οχήματα στην προσπάθειά τους να προστατέψουν τον τάφο ενός μουσουλμάνου ιερέα, φοβούμενοι ότι οι δημοτικές

αρχές σχεδίαζαν να τον μετακινήσουν σε άλλο σημείο. Οι δημοτικές αρχές, οι οποίες σχεδιάζουν ανάπλαση της περιοχής, όπου υπάρχουν πολλά παραπήγματα, διευκρίνισαν ότι στόχος τους είναι μόνο η ανακαίνιση του τάφου.

Οι διαδηλωτές ετοιµάζονται για αναµέτρηση στην Ταϊλάνδη Για την τελική αναμέτρηση με την κυβέρνηση υπό τον Αμπχισίτ Βετζατζίγια δήλωσαν ότι ετοιμάζονται οι επικεφαλής του κινήματος δεκάδων χιλιάδων διαδηλωτών στη Μπανγκόκ, οι οποίοι επιδιώκουν τη διεξαγωγή νέων εκλογών με την ελπίδα ότι θα επιστρέψει στην εξουσία ο πρώην πρωθυπουργός, Θακσίν Σιναβάτρα, που ανατράπηκε με πραξικόπημα το 2006. Οι διαδηλωτές έστησαν χτες... γλέντι σε συνοικία της Μπανγκόκ

με εμπορικά κέντρα, πολυτελή καταστήματα και ξενοδοχεία. Απέναντί τους, ωστόσο, βρέθηκαν εκατοντάδες υποστηρικτές της κυβέρνησης, οι οποίοι συσπειρώθηκαν μέσω της δημοφιλούς ιστοσελίδας στο Ιντερνετ, Facebook, με αποτέλεσμα να υπάρχει κίνδυνος να επαναληφθούν βιαιότητες, όπως συνέβη την περασμένη εβδομάδα, όταν σκοτώθηκαν 23 άνθρωποι σε συγκρούσεις υποστηρικτών του Σιναβάτρα με αστυνομικούς και στρατιώτες.


34

OIKONOMIA

Πέµπτη 15 Απριλίου 2010

Νέα άνοδος στα spreads Οι αγορές θεωρούν δύσκολη την άµεση ενεργοποίηση του µηχανισµού βοήθειας της Ελλάδας ΤΟΥ ΠΑΝΑΓΙΩΤΗ ΦΩΤΙΟΥ

Mε την εφαρμογή δέσμης εννέα μέτρων θα επιδιώξει το υπουργείο Εργασίας να βάλει φρένο στην ασυδοσία που επικρατεί στην αγορά εργασίας. Με το νομοσχέδιο που κατατέθηκε στη Βουλή, επαναπροσδιορίζεται το θεσμικό πλαίσιο που διέπει τις ευέλικτες μορφές απασχόλησης, τροποποιούνται και συμπληρώνονται διατάξεις που αφορούν στις εργασιακές σχέσεις, ενώ παράλληλα θεσπίζεται και η επέκταση της προσυνταξιοδοτικής βεβαίωσης για τις περιπτώσεις διαδοχικής ασφάλισης.

Τις 400 μονάδες βάσης άγγιξαν χτες τα spreads των ελληνικών δεκαετών ομολόγων, αφού οι αγορές θεωρούν δύσκολη την άμεση ενεργοποίηση του μηχανισμού δανειοδότησης της Ελλάδας από την ευρωζώνη και το Διεθνές Νομισματικό Ταμείο.

Μ

ε το επιτόκιο των δεκαετών οµολόγων να ξεπερνά στη δευτερογενή αγορά το 7%, δείχνει απαγορευτική η έκδοση οµολόγων στην αγορά, µε συνέπεια οι πληροφορίες να συγκλίνουν στο ότι η Ελλάδα θα ζητήσει ενεργοποίηση του πακέτου. «Θα προσπαθήσουµε να δανειστούµε µε καλύτερους όρους από την αγορά, αλλά εάν χρειαστεί θα ενεργοποιήσουµε φυσικά το µηχανισµό στήριξης», δήλωσε χτες ο κυβερνητικός εκπρόσωπος, Γιώργος Πεταλωτής. Επίσης θεωρεί ότι δεν υπάρχει πολυπλοκότητα στην ενεργοποίηση του µηχανισµού στήριξης, καθώς, όπως είπε χαρακτηριστικά, υπάρχει κατηγορηµατική απόφαση από τις χώρες της ευρωζώνης πως ο µηχανισµός στήριξης είναι έτοιµος. «Δεν προκύπτει από πουθενά όλη αυτή η περίεργη και σύνθετη διαδικασία που προβάλλεται τις τελευταίες µέρες για ψήφιση από Κοινοβούλια κ.λπ.», είπε ο κ. Πεταλωτής.

Η Γερµανία Ωστόσο, το γερµανικό υπουργείο Οικονοµικών διά του εκπροσώπου του ανέφερε πως οποιοδήποτε πακέτο στήριξης πρέπει να εγκριθεί από το γερµανικό Κοινοβούλιο, επισηµαίνοντας πως το Βερολίνο δε σχεδιάζει να λάβει αυτήν την έγκριση του σχεδίου προτού η Ελλάδα ζητήσει βοήθεια. Επίσης ανέφερε ότι ο υπουργός Οικονοµικών, Βόλφγκανγκ Σόιµπλε, επιµένει να µη χορηγηθεί η πίστωση χωρίς αυτήν την κοινοβουλευτική έγκριση. Το κλίµα για τα ελληνικά οµόλογα βάρυνε και από τις νέες προειδοποιήσεις της

Στη Βουλή το νοµοσχέδιο για τα εργασιακά

Τα «µπλοκάκια»

Το spread των ελληνικών δεκαετών ομολόγων εκτοξεύθηκε χτες στις 398 μονάδες βάσης, ενώ το όλο κλίμα βάρυνε από τις νέες προειδοποιήσεις της Moody’s για υποβάθμιση της Ελλάδας

Moody’s για την υποβάθµιση της Ελλάδας. «Η πιθανότητα υποβάθµισης της πιστοληπτικής ικανότητας της Ελλάδας από τη Moody’s εντός των επόµενων 12 - 18 µηνών είναι µεγαλύτερη του 50%», επισηµαίνει η Sarah Carlson, αναλύτρια του οίκου για τη χώρα, σε συνέντευξή της στο «Ρόιτερς». Η αναλύτρια υπογράµµισε ότι το αρνητικό outlook στην πιστοληπτική αξιολόγηση ση-

µαίνει ότι υπάρχει πιθανότητα υποβάθµισης µεγαλύτερη του 50% σε κάποια χρονική στιγµή εντός των επόµενων 12 - 18 µηνών.

Ενδιαφέρον ιδιωτών Στο κλίµα αυτό, το spread των ελληνικών δεκαετών οµολόγων εκτοξεύθηκε χτες στις 398 µονάδες βάσης από 369 µονάδες, που ήταν την Τρίτη και από 353, που είχε υποχω-

ρήσει την περασµένη Δευτέρα. Εξάλλου, από τα στοιχεία των τραπεζών προκύπτει ότι χτες εκδηλώθηκε έντονο ενδιαφέρον για την απόκτηση των έντοκων γραµµατίων εξάµηνης και ετήσιας διάρκειας. Αιτία ήταν τα υψηλά επιτόκια, που προσέφεραν, δηλαδή, 4,55% για τα εξάµηνης διάρκειας και 4,85% για τα ετήσια. Τα ποσά που τελικά θα διατεθούν σε ιδιώτες θα γίνουν γνωστά σήµερα.

Στο 20% ο φόρος υπεραξίας για µετοχές Φόρος υπεραξίας 20% επί των κερδών από μετοχές, τα οποία προκύπτουν από πώλησή τους σε χρονικό διάστημα εντός τριών μηνών από την αγορά τους, καθιερώνεται, μεταξύ άλλων, με τροποποίηση επί του φορολογικού νομοσχεδίου που κατατέθηκε χτες στη Βουλή από το υπουργείο Οικονομικών. Για κέρδη που προκύπτουν από την πώληση των μετοχών σε διάστημα από τρεις έως δώδεκα μήνες από την αγορά τους, ο φόρος υπεραξίας θα είναι 10%. Για πάνω από δώδεκα μήνες, δε θα επιβάλλεται φόρος υπεραξίας, αλλά φόρος πωλήσεων 0,015%, ο οποίος ισχύει και σήμερα. Η προηγούμενη διάταξη του νομοσχεδίου προέβλεπε φόρο υπεραξίας 15% για κέρδη από μετοχές που πωλούνταν δώδεκα και πλέον μήνες μετά την αγορά τους. Με άλλες τροποποιήσεις

που επέρχονται στο φορολογικό νομοσχέδιο προβλέπεται ότι ο φόρος 15% επί της αντικειμενικής αξίας των ακινήτων που ανήκουν σε off shore εταιρίες θα επιβαρύνει το φυσικό πρόσωπο - ιδιοκτήτη τους. Ακόμη καθιερώνεται επιστροφή ΦΠΑ 5% για τους αγρότες, παραγωγούς και πωλητές λαϊκών αγορών (θα υπόκεινται πλέον σε καθεστώς ΦΠΑ 10%), ενώ θεσπίζεται φοροαπαλλαγή 40% από το φόρο των δαπανών παραγωγής κινηματογραφικών έργων. Οσον αφορά τις εφέσεις στα δικαστήρια, προβλέπεται προθεσμία ενός μήνα, αντί για έξι σήμερα, από τη βεβαίωση της παράβασης, ενώ καθιερώνονται χωριστή βεβαίωση και είσπραξη φόρου για τα ζευγάρια, που σημαίνει ότι η ευθύνη καταβολής του φόρου βαρύνει αποκλειστικά τον κάθε σύζυγο χωριστά.

Το νομοσχέδιο περιέχει σειρά τροποποιήσεων σε όλο το ρυθμιστικό πλαίσιο που αφορά τις ευέλικτες σχέσεις εργασίας. Ειδικά για την απασχόληση με «μπλοκάκια», σύμφωνα με το νομοσχέδιο η συμφωνία για παροχή υπηρεσιών ή έργου, για ορισμένο ή αόριστο χρόνο, τεκμαίρεται ότι υποκρύπτει σύμβαση εξαρτημένης εργασίας, εφόσον η εργασία παρέχεται αυτοπροσώπως αποκλειστικώς ή κατά κύριο λόγο στον ίδιο εργοδότη για 6 συνεχείς μήνες. Οσον αφορά στην εκ περιτροπής εργασία, προβλέπεται ότι σε περίπτωση περιορισμού της δραστηριότητας, ο εργοδότης μπορεί, αντί να καταγγείλει τη σύμβαση εργασίας, να επιβάλει εκ περιτροπής απασχόληση έως 6 μήνες κατά τη διάρκεια του έτους. Ακόμη, για να εφαρμοστούν ελαστικά ωράρια εργασίας ανάλογα με τις ανάγκες των επιχειρήσεων, πρέπει να υπάρχει συμφωνία των συνδικάτων (το λόγο θα έχουν τα κλαδικά σωματεία ή οι ομοσπονδίες σε επιχειρήσεις με λιγότερα από 5 άτομα). Επίσης, η διαθεσιμότητα δε θα μπορεί να υπερβεί τους τρεις μήνες ετησίως και θα αποφασίζεται υποχρεωτικά ύστερα από διαβούλευση και ύστερα από έγκριση του υπουργού Εργασίας, αν πρόκειται για ΔΕΚΟ. Στο ίδιο νομοσχέδιο ρυθμίζεται η ταχύτητα στην απονομή της σύνταξης, με στόχο η σύνταξη να καταβάλλεται το αργότερο τρεις μήνες μετά την υποβολή του σχετικού αιτήματος. Αυτό προϋποθέτει συγκεκριμένες διοικητικές διευθετήσεις.


OIKONOMIA

Πέµπτη 15 Απριλίου 2010

35

ΡΕΠΟΡΤΑ Ζ

Αρση των παραλογισµών ζητά ο ΣΒΒΕ Επιστολή διαμαρτυρίας για τις δυσλειτουργίες που παρατηρούνται στην υλοποίηση επιχειρηματικών σχεδίων μέσω αναπτυξιακού νόμου απέστειλε προς την, Λούκα Κατσέλη, ο Σύνδεσμος Βιομηχανιών Βορείου Ελλάδος. Στην επιστολή του ο ΣΒΒΕ επισημαίνει προς την υπουργό Οικονομίας, Ανάπτυξης και Ναυτιλίας ότι σύμφωνα με την υπ’ αριθμ.

14929 / ΦΕΚ 1301 / Τεύχος Β’ / 26.07.2007 απόφαση του πρώην υπουργείου Ανάπτυξης, η οποία ενεργοποιήθηκε πρόσφατα, για να καταβληθεί η πρώτη δόση (50%) της επιχορήγησης με την πιστοποίηση του 50% της επένδυσης, απαιτείται από τα ελεγκτικά όργανα, στην περίπτωση σύναψης τραπεζικού δανείου, να έχει εκταμιευθεί το συνολικό ποσό του δανείου.

«Η παραπάνω διάταξη είναι κυριολεκτικά ανεφάρμοστη καθώς, οι τράπεζες, όπως είναι απολύτως λογικό, εκταμιεύουν τα δάνεια που έχουν συνάψει με την πρόοδο των εργασιών και όχι εφάπαξ», σημειώνει ο ΣΒΒΕ, ο οποίος ταυτόχρονα εκτιμά ότι «η παραπάνω υπουργική απόφαση αποτελεί ένα κατεξοχήν παράδειγμα στρέβλωσης, γραφειοκρατίας και παραλογισμού, που αντιστρατεύεται την

Η καινοτοµία, «όπλο» για την ανάπτυξη της Θεσσαλονίκης

Το πρόγραμμα του 1ου Φεστιβάλ Καινοτομίας Θεσσαλονίκης, παρουσιάστηκε χτες από τον πρόεδρο του ΕΒΕΘ, Δ. Μπακατσέλο

ΤΟΥ ΓΙΩΡΓΟΥ ΜΗΤΡΑΚΗ

Μήνυμα με πολλούς αποδέκτες στη Θεσσαλονίκη επιχειρεί να αποστείλει ο κ. Δημήτρης Μπακατσέλος, ο οποίος αυτήν την περίοδο είναι ταυτόχρονα πρόεδρος του Εμπορικού και Βιομηχανικού Επιμελητηρίου και της Διεθνούς Εκθέσεως Θεσσαλονίκης.

Ο

ι δύο φορείς, όπως ανακοίνωσε χτες ο κ. Μπακατσέλος, οργανώνουν από τις 10 έως τις 16 Μαΐου το 1ο Φεστιβάλ Καινοτοµίας Θεσσαλονίκης, µια σειρά εκδηλώσεων µε την καινοτοµία στο επίκεντρο. Το Φεστιβάλ αποσκοπεί να ευαισθητοποιήσει τόσο την ελληνική Πολιτεία και τους τοπικούς παράγοντες, όσο και τις επιχειρήσεις στα ζητήµατα και την αξία της καινοτοµίας. «Η σφοδρή οικονοµική κρίση µάς έχει φέρει µπροστά σε πρωτόγνωρες προκλήσεις, στις οποίες οφείλουµε να ανταποκριθούµε, δηλαδή οφείλουµε να ανακαλύψουµε νέους τρόπους, νέες µεθόδους, νέες φόρµουλες για να βγούµε πιο δυνατοί, πιο ανταγωνιστικοί και καινοτόµοι από την κρίση», επισήµανε ο κ. Μπακατσέλος.

Η πρωτοβουλία Ο ίδιος αποκάλυψε ότι «η αφορµή για να προχωρήσουµε στη δηµιουργία ενός τέτοιου θεσµού στην Ελλάδα ήταν τα αντίστοιχα φεστιβάλ που βλέπαµε να γίνονται στο εξωτερικό, ενώ, την ίδια στιγµή, παρακολουθούσαµε τη Ζώνη Καινοτοµίας να βαλτώνει στη Θεσσαλονίκη και µάλιστα ως θεατές, γιατί το ΕΒΕΘ δε συµµετέχει στη διοίκηση του φορέα αυτού». Ταυτόχρονα, ο κ. Μπακατσέλος υπογράµµισε ότι «τη στιγµή που η Ισπανία, η Ολλανδία, η Γερµανία και άλλες χώρες πρωτοστατούν στην υπόθεση της καινοτοµίας, ως παράγοντα ποιότητας και αειφόρου βιώσιµης ανάπτυξης, τη στιγµή που διενεργείται δηµόσια διαβούλευση µεταξύ των κρατών-µελών της ΕΕ για τους τρόπους που θα διαπεράσει η ιδέα της καινοτοµίας την εκπαίδευση, τη δηµόσια διοίκηση και θα γίνει εγγενές στοιχείο των ακολουθούµενων πολιτικών, η Ελλάδα βρίσκεται εκτός αυτού του διαλόγου».

∆ύο άξονες Το Φεστιβάλ θα αναπτυχθεί σε δύο βασικούς άξονες: την ψηφιακή ανάπτυξη και την πράσινη ανάπτυξη - ενεργειακή οικονοµία. Θα φιλοξενήσει τρεις εκδηλώσεις, µία έκθεση και διάφορες πρωτοποριακές

ενέργειες. Η κεντρική εκδήλωση θα πραγµατοποιηθεί στις 13 Μαΐου στο Βασιλικό Θέατρο, µε θέµα τον καινούργιο ψηφιακό κόσµο που δηµιουργείται. Θα βραβεύσει πρωτοπόρους Ελληνες και ξένους καλεσµένους, οι οποίοι έχουν διακριθεί επιχειρηµατικά και καινοτοµικά τόσο στην Ελλάδα όσο και διεθνώς, όπως την Ελενα Αµβροσιάδου, που κατάγεται και από τη Θεσσαλονίκη, τον Γιώργο Σακελλάρη της Ameresco, τον Νικόλαο Χρηστάκη και τον Νίκο Τοµπάζη. Προσκεκληµένοι οµιλητές θα µιλήσουν για τις προσπάθειές τους, όπως ο Κάρλο Ράτι του ΜΙΤ Senseable City Lab από τις ΗΠΑ, ο Αντόνιο Καµάρα, πρωτοπόρος σε καινοτοµίες νέων τεχνολογιών από την Πορτογαλία, ο Κάρλο Μπιόντο της Google, ο Ροµπ Γουόρεν της Science Gallery και ο Χόρχε Πέρεζ του Ευρωπαϊκού Ινστιτούτου Design της Βαρκελώνης.

Πρωτότυπες ενέργειες Στην Αποθήκη Δ’ στο Λιµάνι θα πραγµατοποιηθεί έκθεση µε νέα προϊόντα που αποτελούν επιτυχηµένα παραδείγµατα καινοτοµίας, ενώ θα περιλαµβάνει το διαδραστικό χώρο Idea Factory, όπου θα µπορούν οι επισκέπτες να πειραµατιστούν. Παράλληλα, σε όλη την πόλη θα πραγµατοποιηθούν πρωτότυπες ενέργειες, όπως το Πράσινο Σπίτι και τα Innovation Café.

ανάπτυξη, μπλοκάρει τις επενδύσεις και δεν οδηγεί πουθενά». Ο ΣΒΒΕ καλεί την κ. Κατσέλη να επανεξετάσει άμεσα και να άρει την παράλογη αυτή υπουργική απόφαση και προτείνει την επαναφορά στο καθεστώς καταβολής των επιχορηγήσεων που ίσχυε πριν από το 2007, όταν η εκταμίευση των δανείων έπρεπε να αποδεικνύεται με την ολοκλήρωση της επένδυσης.

∆ιπλή διάκριση για την Τράπεζα Πειραιώς Για δεύτερη συνεχή χρονιά η Τράπεζα Πειραιώς βραβεύτηκε από το διεθνή Δείκτη Εταιρικής Ευθύνης (CRI), που την κατέταξε στη χρυσή κατηγορία. Πρόκειται για την ανώτατη διάκριση που δόθηκε φέτος σε επιχείρηση της Ελλάδας. Επίσης, κατά την τελετή απονομής των βραβείων, η τράπεζα έλαβε και ειδικό έπαινο για το κοινωνικό της έργο, που επιτελείται κυρίως μέσα από τις πολυσχιδείς δραστηριότητες του Πολιτιστικού Ιδρύματος Ομίλου Πειραιώς (ΠΙΟΠ). O CR Index αποτελεί διεθνώς κορυφαίο εργαλείο αξιολόγησης των επιδόσεων της Εταιρικής Κοινωνικής Ευθύνης (ΕΚΕ) στους τομείς Κοινωνία, Περιβάλλον, Χώρος Εργασίας, Αγορά, με βάση διεθνώς αναγνωρισμένα κριτήρια και πρότυπα. Στην Ελλάδα ο Δείκτης εκπροσωπείται από το Ινστιτούτο Εταιρικής Κοινωνικής Ευθύνης που συνεργάζεται με το Business in the Community (BITC), βρετανικό οργανισμό που δημιούργησε αυτόν το Δείκτη. Η αξιολόγηση των εταιριών έγινε από ανεξάρτητους εμπειρογνώμονες-αξιολογητές, οι οποίοι έχουν εκπαιδευτεί ειδικά από το BITC. Το βραβείο και τον έπαινο παρέλαβε η πρόεδρος του ΠΙΟΠ και υπεύθυνη της Επιτροπής ΕΚΕ του Ομίλου Πειραιώς, Σοφία Στάικου, η οποία τόνισε τη σημασία που έχει η διεθνής αυτή διάκριση για την Τράπεζα Πειραιώς, ειδικά σε μια περίοδο οικονομικής κρίσης. «Η συμμετοχή μας στη διαδικασία αξιολόγησης του CRI μάς επιτρέπει να παρακολουθούμε την πρόοδό μας και να βελτιωνόμαστε συνεχώς αναφορικά με το έργο που επιτελούμε στον τομέα της Εταιρικής Υπευθυνότητας», δήλωσε χαρακτηριστικά.


36

OIKONOMIA

Πέµπτη 15 Απριλίου 2010

ΡΕΠΟΡΤΑ Ζ

Χρηµατοδοτήσεις για «πράσινα» σπίτια Νέο πρόγραµµα ανακοίνωσαν η Εθνική Τράπεζα και το ΤΕΕ για την ενεργειακή αποκατάσταση των κτιρίων µισης, µε ή χωρίς εµπράγµατες εξασφαλίσεις. Χωρίς εµπράγµατες εξασφαλίσεις το επιτόκιο θα είναι µικρότερο από το τρέχον επιτόκιο καταναλωτικών δανείων της Εθνικής Τράπεζας κατά 300 µονάδες βάσης. Με την παροχή εµπράγµατων εξασφαλίσεων το επιτόκιο θα είναι βασισµένο στο euribor και µικρότερο από το τρέχον επιτόκιο των επισκευαστικών δανείων της Εθνικής Τράπεζας κατά 100 µονάδες βάσης. Η αξιολόγηση των αιτηµάτων θα γίνεται δωρεάν, χωρίς επιβάρυνση των ενδιαφεροµένων. Η διάρκεια της χρηµατοδότησης θα είναι έως 5 έτη για δάνεια χωρίς εµπράγµατες εξασφαλίσεις και έως 15 έτη για δάνεια µε εµπράγµατες εξασφαλίσεις.

ΤΗΣ ΧΑΡΑΣ ΛΕΜΟΝΗ

Διευρύνεται ο αριθμός των δικαιούχων για την ενεργειακή αναβάθμιση των κτιρίων, με το πρόγραμμα χρηματοδότησης ενεργειακής αποκατάστασης κατοικιών που ανακοινώθηκε χτες από το διευθύνοντα σύμβουλο της Εθνικής Τράπεζας, Απόστολο Ταμβακάκη, και τον πρόεδρο του Τεχνικού Επιμελητηρίου Ελλάδος, Γιάννη Αλαβάνο, παρουσία της υπουργού Περιβάλλοντος, Ενέργειας και Κλιματικής Αλλαγής, Τίνας Μπιρμπίλη.

Ο

υσιαστικά, πρόκειται για το νέο πρόγραµµα «Ενεργειακή Εθνοστέγη», της Εθνικής Τράπεζας και του ΤΕΕ, που διευρύνει το πρόγραµµα του υπουργείου Περιβάλλοντος «Εξοικονοµώ κατ’ οίκον», δίνοντας τη δυνατότητα σε ιδιοκτήτες να αναβαθµίσουν ενεργειακά την κατοικία τους µέσω χορήγησης δανείου από την Εθνική Τράπεζα, µε την εγγύηση των αποθεµατικών του ασφαλιστικού Ταµείου ΤΣΜΕΔΕ. Το πρόγραµµα προβλέπει ευνοϊκούς όρους χρηµατοδότησης, ενώ παράλληλα διασφαλίζει την ενδιάµεση χρηµατοδότηση για τους µηχανικούς, οι οποίοι θα χρειαστούν βραχυπρόθεσµα κεφάλαια κίνησης για να υλοποιήσουν τις εργασίες ενεργειακής αναβάθµισης των κτιρίων. Επιδοτήσεις προς τους µηχανικούς πρόκειται να χορηγήσει και το ΤΕΕ, χρησιµοποιώντας κεφάλαια από το αποθεµατικό του, µε στόχο να τους δώσει κίνητρα για να εµπλακούν στην όλη διαδικασία.

Το επιτόκιο Δικαιούχοι του νέου προγράµµατος είναι όλοι οι κάτοχοι κατοικιών που θέλουν να προχωρήσουν σε ενεργειακή αναβάθµιση της περιουσίας τους. Οπως είπε ο κ. Ταµβακάκης, για µικρές επεµβάσεις σε κτίρια, το επιτόκιο θα είναι κατά 3% φθηνότερο από το καταναλωτικό δάνειο (διαµερίσµατα µέχρι 50 τ.µ. µε κόστος εργασιών µικρότερο των 10.000 ευρώ). Σε περίπτω-

Παράλληλη χρηµατοδότηση

Η υπουργός Περιβάλλοντος, Τ. Μπιρμπίλη, εν μέσω του του διευθύνοντος συμβούλου της ΕΤΕ, Α. Ταμβακάκη (αριστερά), και του προέδρου του ΤΕΕ, Γ. Αλαβάνου, κατά τη χτεσινή συνέντευξη Τύπου

ση που οι εργασίες είναι µεγαλύτερες, θα χορηγείται επισκευαστικό δάνειο, µε επιτόκιο κατά 1% χαµηλότερο σε σχέση µε το

αντίστοιχο της αγοράς. Για όλα τα δάνεια οι ιδιοκτήτες θα έχουν από την Εθνική περίοδο χάριτος µέχρι και ένα έτος.

Αναλυτικότερα, θα χρηµατοδοτείται έως και το 100% του εγκεκριµένου προϋπολογισµού για έργα ενεργειακής αναβάθ-

Wind: Στόχος η επιστροφή στα κέρδη το 2012 Τριετές επιχειρησιακό σχέδιο, που προβλέπει επενδύσεις ύψους 500 εκατ. ευρώ, ανακοίνωσε χτες ο διευθύνων σύμβουλος της Wind Ελλάς, Νάσος Ζαρκαλής. Πρόκειται για επενδύσεις που μόνο για φέτος θα φτάσουν τα 150 εκατ. ευρώ και θα αφορούν τον εκσυγχρονισμό των υποδομών σταθερής τηλεφωνίας, αλλά και την επέκταση του δικτύου της κινητής, προκειμένου αυτό να μπορεί να υποστηρίζει υπηρεσίες Mobile Internet. Ουσιαστικά, πρόκειται για ένα διευρυμένο τριετές πλάνο ανάκαμψης της Wind, με στόχο στο τέλος του 2012 η εταιρία να έχει γυρίσει στην κερδοφορία, καθώς, όπως είπε ο κ. Ζαρκαλής, ο βασικός μέτοχος, ο Αιγύπτιος μεγιστάνας, Ναγκίμπ Σαουίρις, είναι απόλυτα δεσμευμένος στην επένδυσή του στη χώρα μας και μάλιστα βλέπει τις προοπτικές ανάπτυξης για την επόμενη δεκαετία. Ο κ. Ζαρκαλής σημείωσε ότι το 2009 ήταν ένας χρόνος εξαιρετικά δύσκολος για τη Wind, ο οποίος ωστόσο έληξε καλά λόγω της επιτυχούς αναδιάρθρωσης του χρέους της εταιρίας, ενώ ταυτόχρονα μπήκαν και τα θεμέλια της ανάπτυξής της.

Αναλυτικότερα, τον περασμένο χρόνο το EBITDA της εταιρίας έφτασε τα 320 εκατ. ευρώ, ενώ οι τόκοι που θα πληρώσει για το δανεισμό της, μετά την αναδιάρθρωση που επιτεύχθηκε, θα είναι 130 εκατ. ευρώ για το 2010, μειωμένοι πάνω από 50% χάρη στην αναδιάρθρωση αυτή. Σύμφωνα με τον κ. Ζαρκαλή, οι ζημιές που εμφανίζονται είναι κατά βάση λογιστικές, ενώ για το 2010 δεν προβλέπονται κέρδη στα καθαρά αποτελέσματα. Ωστόσο, πρόσθεσε ότι η γενικότερη αναδιάρθρωση της εταιρίας έχει αρχίσει να αποδίδει καρπούς, καθώς έχει ήδη ανακοπεί ο αυξανόμενος ρυθμός πτώσης σε επίπεδο εσόδων και κερδών. Τέλος, ο κ. Ζαρκαλής ξεκαθάρισε ότι δεν ενδιαφέρει την εταιρία η «διαδικτυακή» τηλεόραση. Χαρακτήρισε δε εξαιρετική την πρωτοβουλία του υπουργείου Υποδομών, Μεταφορών και Δικτύων για την ανάπτυξη του δικτύου οπτικών ινών σε επίπεδο τελικού χρήστη (FTTH), δηλώνοντας ότι η Wind θα συμμετέχει τουλάχιστον σε επίπεδο παροχής υπηρεσιών. Χ. Λ.

Για έργα η χρηµατοδότηση των οποίων έχει εγκριθεί από την ΕΤΕ, θα προβλέπεται πρόγραµµα παράλληλης χρηµατοδότησης του µηχανικού - εργολάβου µε βραχυπρόθεσµο κεφάλαιο κινήσεως για την ολοκλήρωση του έργου. Αυτό θα αποπληρώνεται από το επισκευαστικό δάνειο του ιδιώτη ιδιοκτήτη όταν το έργο ολοκληρωθεί και πιστοποιηθεί. Το πρόγραµµα αναµένεται να ξεκινήσει µέσα στον Ιούλιο, ενώ ένα µήνα νωρίτερα θα αρχίσει η υλοποίηση του προγράµµατος «Εξοικονοµώ κατ’ οίκον», στο οποίο αναµένεται να συµµετάσχουν περίπου 100.000 νοικοκυριά από ασθενέστερες εισοδηµατικά τάξεις, όπου εντοπίζεται και το πρόβληµα των µεγάλων καταναλώσεων.

Τα οφέλη Με το νέο πρόγραµµα της Εθνικής φέρεται να διασφαλίζεται και η ποιότητα των έργων που θα πραγµατοποιηθούν, καθώς, προϋπόθεση για την τελική εκταµίευση των δανείων αυτών θα είναι η ολοκλήρωση, αλλά και πιστοποίησή τους από τους ενεργειακούς επιθεωρητές. Οπως εκτίµησε ο κ. Ταµβακάκης, για ένα «µέσο» έργο επεµβάσεων ενεργειακής αναβάθµισης σε στέγη και παράθυρα κατοικίας αξίας 15.000 ευρώ, η οικονοµική ωφέλεια από τον περιορισµό της ενεργειακής κατανάλωσης θα αντιστοιχεί σχεδόν στο κόστος της δόσης ενός αντίστοιχου δανείου.


OIKONOMIA

Πέµπτη 15 Απριλίου 2010

37

ΡΕΠΟΡΤΑ Ζ

η πορεία του γενικού δείκτη του ΧΑ 2.200 2.100 2.000

Μεταβολή τιµής στη συνεδρίαση (%) 6,91 4,76 3,57 2,94 2,94 2,90 2,78 2,43 1,98 1,50

Οι µετοχές µε τη µεγαλύτερη άνοδο

2.300 2.061,04 (+3,51%) 1.925,82 (-3,11%)

ΔΗΜΟΣΙΑ ΕΠΙΧ/ΣΗ ΗΛΕΚΤ/ΣΜΟΥ Α.Ε F.G. EUROPE Α.Ε. (ΚΟ) Χ. Κ. ΤΕΓΟΠΟΥΛΟΣ ΕΚΔΟΣΕΙΣ Α.Ε. ΙΝΤΡΑΛΟΤ Α.Ε. (ΚΟ) ΘΕΣΣ/ΝΙΚΗ ΕΤΑΙΡΙΑ ΥΔ/ΣΕΩΣ Α.Ε. ΕΛΓΕΚΑ Α.Ε. (ΚΟ) FRIGOGLASS Α.Β.Ε.Ε. RILKEN Βιομηχανία Καλλυντικών ΧΑΛΚΟΡ Α.Ε (ΠΡΩΗΝ ΒΕΚΤΩΡ) (ΚΑ) S & B ΒΙΟΜΗΧΑΝΙΚΑ ΟΡΥΚΤΑ Α.Ε.

2.015,96 (-2,21%)

1.991,22 (+3,40%)

1.987,36 (-1,40)

1.900 8 ΑΠΡΙΛΙΟΥ 2010

9 ΑΠΡΙΛΙΟΥ 2010

12 ΑΠΡΙΛΙΟΥ 2010

13 ΑΠΡΙΛΙΟΥ 2010

14 ΑΠΡΙΛΙΟΥ 2010

Οι µετοχές µε τη µεγαλύτερη πτώση ΙΛΥΔΑ Α.Ε (ΚΟ) Π. ΠΕΤΡΟΠΟΥΛΟΣ Α.Ε.Β.Ε. (ΚΟ) ΤΕΧΝΙΚΗ ΟΛΥΜΠΙΑΚΗ Α.Ε. (ΚΟ) LAMDA DEVELOPMENT Α.Ε. ΤΡΑΠΕΖΑ EUROBANK ERGASIAS A.E EUROBANK PROPERTIES Α.Ε.Ε.Α.Π. VELL GROUP Α.Ε (ΚΟ) MARFIN INVEST.GROUP SA (ΚΟ) ALPHA ΤΡΑΠΕΖΑ Α.Ε. (ΚΟ) REDS A.E.

η εικόνα του ΧΑ Συνολική Κεφαλαιοποίηση (σε δισ ευρώ)78,1

Μετοχές με πτώση

Xθεσινή Κεφαλαιοποίηση

Μετοχές που δεν άλλαξαν

79,2

Απόλυτη/Σχετική

140 99

Αξία Συναλλαγών (σε εκατ. ευρώ)

Μεταβολή Κεφαλαιοποίησης -1,17 -0,1%

Μετοχές με άνοδο

Αριθμός τεμαχίων

Μεταβολή τιµής στη συνεδρίαση (%) -19,85 -6,25 -6,00 -5,48 -5,15 -5,11 -5,08 -4,94 -4,87 -4,35

188,6

Πτωτικές τάσεις επικράτησαν χτες για δεύτερη συνεχόμενη συνεδρίαση στην ελληνική χρηματιστηριακή αγορά, η οποία υποχώρησε κάτω από το ψυχολογικό επίπεδο των 2.000 μονάδων, ενώ δείχνει να αυτονομείται πλήρως έναντι των υπόλοιπων διεθνών χρηματαγορών. O γενικός δείκτης τιμών του ΧΑ έκλεισε στις 1.987,36 μονάδες έναντι 2.015,96 μονάδων της προηγούμενης συνεδρίασης, σημειώνοντας πτώση 28,60 μονάδων ή σε ποσοστό 1,40%. Το αρνητικό κλίμα διαμόρφωσαν χτες τόσο η έκθεση της Goldman Sachs, η οποία μειώνει τιμές-στόχους για έξι ελληνικές τράπεζες, όσο και οι δηλώσεις της Sarah Carlson του οίκου Moody’s, σύμφωνα με τις οποίες οι πιθανότητες υποβάθμισης της ελληνικής οικονομίας εντός των επόμενων 12 - 18 μηνών είναι πάνω από 50%. Ο δείκτης FTSE/ASE 20 έκλεισε στις 974,96 μονάδες, με πτώση σε ποσοστό 2,05%, ενώ ο δείκτης FTSE/ ASE 40 έκλεισε στις 2.280,16 μονάδες με πτώση σε ποσοστό 0,42%. Ο δεί-

13.770.074,51 33.285,32 179.292,00 2.538.755,21 342.378,27 19.776,32 750.467,87 29.808,16 10.363,34 490.920,96

Αξία συναλλαγών σε χιλιάδες ευρώ 84.574,70 18.749,00 54.399,30 14.960,00 7.389.620,15 479.622,65 53.111,12 5.118.799,66 18.088.057,06 11.746,63

34.727.712

52

χρηματιστήριο αθηνών

Και πάλι κάτω από τις 2.000 µονάδες

Αξία συναλλαγών σε χιλιάδες ευρώ

νομίσματα Για συναλλαγές µέχρι ισοτίµου ευρώ 10.000 (Ποσότητα νοµίσµατος ανά 1 ευρώ)

Οι επιµέρους κλαδικοί δείκτες έκλεισαν ως εξής: Ασφάλειες Βιομηχανικά προϊόντα και υπηρεσίες Εμπόριο Κατασκευές και υλικά Μέσα ενημέρωσης Πετρέλαιο και αέριο Προσωπικά και οικιακά προϊόντα Πρώτες ύλες Ταξίδια και αναψυχή Τεχνολογία Τηλεπικοινωνίες Τράπεζες Τρόφιμα και ποτά Υγεία Υπηρεσίες κοινής ωφέλειας Χημικά Χρηματοοικονομικές υπηρεσίες

κτης FTSE/ASE SMALLCAP 80 έκλεισε στις 356,21 μονάδες, με πτώση σε ποσοστό 1,58%, ενώ ο δείκτης FTSE 140 έκλεισε στις 2.206,73 μονάδες, με πτώση σε ποσοστό 1,85%. Ο δείκτης Ftse/Athex International έκλεισε στις 2.584,81 μονάδες, με πτώση 1,86%. Από τις μετοχές του δείκτη της υψηλής κεφαλαιοποίησης τα υψηλότερα κέρδη κατέγραψαν οι μετοχές της ΔΕΗ (+6,91%) και του ΟΠΑΠ (+1,40%). Αντιθέτως τις μεγαλύτερες απώλειες σημείωσαν οι μετοχές της

1.671,57 3.433,28 2.637,09 2.963,86 2.605,38 3.135,92 3.584,71 2.651,28 3.058,00 1.034,90 2.394,74 2.079,00 7.087,28 3.509,62 4.077,42 7.005,24 3.060,22

Τρέχουσα +1,54% -1,68% -1,74% -2,98% -3,18% -0,76% -0,02% -1,83% +1,46% -2,51% -1,14% -3,35% -1,17% -0,57% +5,32% -1,29% -3,44%

Eurobank (-5,15%), της MIG (-4,94%) και της Alpha Bank (-4,87%), ενώ η μετοχή της Εθνικής υποχώρησε σε ποσοστό 3,99%. Από τις μετοχές που διακινήθηκαν, 52 είχαν άνοδο και 140 πτώση, ενώ οι τιμές 99 τίτλων παρέμειναν σταθερές. Η αξία των συναλλαγών ανήλθε στα 188,6 εκατ. ευρώ. Η συνολική κεφαλαιοποίηση της αγοράς διαμορφώθηκε στα 78,1 δισ. ευρώ.

ΔΟΛΑΡΙΟ ΗΠΑ ΛΙΡΑ ΑΓΓΛΙΑΣ ΚΟΡΟΝΑ ΔΑΝΙΑΣ ΚΟΡΟΝΑ ΣΟΥΗΔΙΑΣ ΓΕΝ ΙΑΠΩΝΙΑΣ ΦΡΑΓΚΟ ΕΛΒΕΤΙΑΣ ΚΟΡΟΝΑ ΝΟΡΒΗΓΙΑΣ ΔΟΛΑΡΙΟ ΚΑΝΑΔΑ ΔΟΛΑΡΙΟ ΑΥΣΤΡΑΛΙΑΣ

Υψηλότερη Χαµηλότερη

1,3615

1,3724

1,3411

0,8814

0,88845

0,86818

7,4431

7,5026

7,3315

9,7327

9,8106

9,5867

127,42

128,44

125,51

1,4368

1,4483

1,4152

7,9955

8,0595

7,8756

1,3571

1,368

1,3367

1,4583

1,47

1,4364

τα μέταλλα (Τιµές συµβολαίων σε δολάρια ανά ουγκιά)

Χρυσός Ασήµι

1.160,80 18,45


ΟΙΚΟΝΟΜΙΑ

38

Πέµπτη 15 Απριλίου 2010

ΜΕΤΟΧΕΣ

Μετοχές

Τιμή ∆ιακύµανση ΔιαφοκλεισίΜετα- 52 εβδοµάδων ρά από ματος βολή χτες σε Ανώ- Κατώσε % ευρώ τατη τατη ευρώ

Μετοχές

Τιμή ∆ιακύµανση ΔιαφοκλεισίΜετα- 52 εβδοµάδων ρά από ματος βολή χτες σε Ανώ- Κατώσε % ευρώ τατη τατη ευρώ

Μετοχές

Τιμή ∆ιακύµανση ΔιαφοκλεισίΜετα- 52 εβδοµάδων ρά από ματος βολή χτες σε Ανώ- Κατώσε % ευρώ τατη τατη ευρώ

Μετοχές

Τιμή ∆ιακύµανση ΔιαφοκλεισίΜετα- 52 εβδοµάδων ρά από ματος βολή χτες σε Ανώ- Κατώσε % ευρώ τατη τατη ευρώ

MEVACO (KO)

0.97

0.00

0.00

1.58

0.74

ΛΙΒΑΝΗ (ΚΟ)

0.47

0.02

4.44

1.08

0.36

ΣΑΝΥΟ ΕΛΛΑΣ (Κ)

0.22

0.01

4.76

0.57

AEGEAN AIRLINES (ΚΟ)

3.32

-0.01

-0.30

4.94

2.71

MIG REAL ESTATE Α.Ε.Ε.Α.Π. (KO)

4.00

0.00

0.00

4.80

4.00

ΜΑΘΙΟΣ ΠΥΡΙΜΑΧΑ (ΚΟ)

0.49

-0.03

-5.77

0.94

0.47

ΤΕΓΟΠΟΥΛΟΣ (ΚΟ)

0.87

0.03

3.57

0.91

0.36

ALAPIS (ΚO)

0.40

0.00

0.00

0.93

0.39

MLS ΠΛΗΡΟΦΟΡΙΚΗ (ΚΟ)

2.20

0.02

0.92

2.41

1.11

ΜΙΝΕΡΒΑ (ΚΑ)

1.32

0.05

3.94

2.10

1.10

ΤΡΙΑ ΑΛΦΑ(ΚO)

14.99

1.35

9.90

18.00

8.00

MODA BAGNO - ΒΑΡΒΕΡΗΣ (ΚΟ)

0.47

0.00

0.00

0.95

0.44

ΜΟΤΟΔΥΝΑΜΙΚΗ (ΚΟ)

1.48

0.01

0.68

2.29

1.43

ΤΡΙΑ ΑΛΦΑ(ΠΟ)

14.99

1.35

9.90

18.00

8.00

NEWSPHONE (ΚΟ)

0.57

-0.02

-3.39

1.02

0.53

ΜΟΥΖΑΚΗΣ (ΚΑ)

0.38

-0.04

-9.52

0.86

0.34

ΦΙΕΡΑΤΕΞ (ΚΟ)

0.19

0.00

0.00

0.75

0.16

0.22

0.00

0.00

0.69

0.19

Μεγάλης Κεφαλαιοποίησης

ALPHA BANK (KO)

6.25

-0.32

-4.87

13.01

5.78

COCA COLA HBC (ΚΟ)

19.85

-0.24

-1.19

21.00

10.44

EUROBANK EFG (ΚΟ)

6.26

-0.34

-5.15

12.94

4.92

NEXANS HELLAS (ΚΟ)

2.50

-0.01

-0.40

4.25

2.20

ΜΠΗΤΡΟΣ HOLD. (ΚΟ)

0.73

0.00

0.00

1.43

0.58

ΧΑΤΖΗΙΩΑΝΝΟΥ (ΚΟ)

EUROBANK PROPERTIES

6.50

-0.35

-5.11

8.64

6.37

PASAL DEVELOPMENT

0.66

-0.03

-4.35

2.73

0.66

ΜΥΛΟΙ ΚΕΠΕΝΟΥ (ΚΟ)

0.83

0.00

0.00

1.50

0.68

Σε Επιτήρηση

0.19

17.30

0.10

0.58

17.70

6.47

PROFILE (ΚΟ)

0.83

0.00

0.00

1.11

0.71

ΝΑΥΤΕΜΠΟΡΙΚΗ (ΚΟ)

0.56

0.00

0.00

1.29

0.52

ALMA - ΑΤΕΡΜΩΝ (ΚΟ)

0.12

0.00

0.00

0.35

0.10

FORTHNET (ΚΟ)

0.96

-0.03

-3.03

2.24

0.84

PROTON BANK (KO)

1.33

-0.02

-1.48

2.34

0.65

ΝΕΩΡΙΟΝ (ΚΟ)

0.79

0.03

3.95

1.52

0.52

ALTEC (KO)

0.17

-0.02

-10.53

0.31

0.13

FOURLIS ΣΥΜΜΕΤΟΧΩΝ (ΚΟ)

8.19

-0.05

-0.61

12.28

7.30

REDS (Κ)

1.10

-0.05

-4.35

2.19

1.04

ΝΗΡΕΥΣ (ΚO)

0.55

0.00

0.00

1.16

0.50

ΒΕΤΑΝΕΤ ΑΒΕΕ

0.06

0.00

0.00

0.06

0.00

FRIGOGLASS (ΚΟ)

9.97

0.27

2.78

10.10

3.28

REVOIL (ΚΟ)

0.97

-0.02

-2.02

1.20

0.60

ΝΤΙΟΝΙΚ (ΚΟ)

0.33

0.00

0.00

0.91

0.32

COMPUCON (KO)

0.08

-0.01

-11.11

0.26

0.07

J. & P. ΑΒΑΞ (ΚΟ)

2.07

0.02

0.98

4.08

1.68

RILKEN (ΚΟ)

3.80

0.09

2.43

4.87

2.76

ΝΤΡΟΥΚΦΑΡΜΠΕΝ (ΚΟ)

0.53

-0.01

-1.85

1.00

0.47

HELLAS ON LINE (KO)

1.03

0.00

0.00

2.64

0.90

JUMBO (ΚΟ)

6.51

0.01

0.15

9.55

5.75

SCIENS ΔΙΕΘΝΗΣ ΣΥΜΜΕΤΟΧΩΝ (ΚO)

0.54

0.00

0.00

0.82

0.38

ΞΥΛΕΜΠΟΡΙΑ (K)

0.51

0.00

0.00

0.76

0.46

RIDENCO (ΚΟ)

0.21

-0.01

-4.55

0.69

0.21

LAMDA DEVELOPMENT(ΚΟ)

5.00

-0.29

-5.48

8.60

4.42

SPACE HELLAS (ΚΟ)

0.42

-0.01

-2.33

0.86

0.37

ΞΥΛΕΜΠΟΡΙΑ (Π)

0.55

0.00

0.00

0.92

0.49

ΑΕΓΕΚ (ΚΟ)

0.81

-0.01

-1.22

4.29

0.73

MARFIN INVESTMENT GROUP (KO)

1.54

-0.08

-4.94

3.65

1.54

TRASTOR ΑΕΕΑΠ

1.12

0.01

0.90

1.81

1.04

ΠΑΙΡΗΣ (ΚΟ)

0.71

-0.08

-10.13

1.12

0.48

ΑΤΤΙ-ΚΑΤ (ΚΟ)

0.33

-0.01

-2.94

0.72

0.23

MARFIN POPULAR BANK PUBLIC

1.93

-0.07

-3.50

3.49

1.64

VELL GROUP (ΚO)

0.56

-0.03

-5.08

0.65

0.21

ΠΑΡΝΑΣΣΟΣ

1.02

-0.01

-0.97

2.78

0.86

ΒΑΡΑΓΚΗΣ (ΚΟ)

0.69

-0.02

-2.82

0.89

0.59

S & B ΟΡΥΚΤΑ (ΚΟ)

4.73

0.07

1.50

5.96

3.90

YALCO (ΚΑ)

0.43

-0.01

-2.27

0.91

0.34

ΠΕΤΡΟΠΟΥΛΟΣ (ΚΟ)

3.00

-0.20

-6.25

4.82

2.73

ΒΑΡΒΑΡΕΣΟΣ (ΚΑ)

0.18

-0.01

-5.26

0.36

0.12

SPRIDER (KO)

0.73

-0.02

-2.67

2.08

0.68

ΑΙΟΛΙΚΗ ΕΠΕΝΔ. (ΚO)

2.10

-0.04

-1.87

2.17

1.41

ΠΗΓΑΣΟΣ (ΚΟ)

2.70

-0.15

-5.26

2.95

2.20

ΕΔΡΑΣΗ Χ.ΨΑΛΙΔΑΣ (ΚΟ)

0.12

-0.02

-14.29

0.66

0.12

ΑΓΡΟΤΙΚΗ ΤΡΑΠΕΖΑ (ΚΟ)

1.50

-0.02

-1.32

2.47

1.15

ΑΚΡΙΤΑΣ (ΚΟ)

0.80

0.03

3.90

1.00

0.50

ΠΛΑΣΤ. ΚΡΗΤΗΣ (KΟ)

3.69

0.06

1.65

4.22

2.74

ΕΙΚΟΝΑ & ΗΧΟΣ (ΚΟ)

0.15

-0.01

-6.25

0.28

0.10

ΑΝΕK (ΚΟ)

0.49

-0.01

-2.00

1.22

0.47

ΑΛΚΟ ΕΛΛΑΣ (KO)

0.39

0.02

5.41

0.74

0.35

ΠΛΑΣΤΙΚΑ ΘΡΑΚΗΣ (ΚΟ)

0.66

-0.02

-2.94

1.02

0.57

ΕΛΒΙΕΜΕΚ (ΚΟ)

3.70

0.00

0.00

4.00

2.00

ΑΝΕΚ (ΠΟ, ‘96)

1.40

0.00

0.00

1.80

1.32

ΑΛΟΥΜΥΛ-ΜΥΛΩΝΑΣ (ΚΟ)

0.82

-0.01

-1.20

1.55

0.76

ΣΑΤΟ (ΚΟ)

0.30

0.00

0.00

0.84

0.28

ΕΛΛ. ΙΧΘΥΟΚΑΛΛΙΕΡΓΙΑΙ (ΚΟ)

0.11

0.00

0.00

0.33

0.09

ΒΙΟΧΑΛΚΟ (ΚΑ)

3.74

-0.17

-4.35

5.83

2.89

ΑΛΦΑ ΓΚΡΙΣΙΝ (KO)

1.01

-0.04

-3.81

1.85

0.96

ΣΕΛΜΑΝ (Κ)

0.62

0.01

1.64

0.92

0.15

ΕΛΦΙΚΟ (ΚO)

0.88

0.00

0.00

1.99

0.36

ΒΩΒΟΣ ΜΠΑΜΠΗΣ (ΚΟ)

3.74

-0.12

-3.11

7.19

3.08

ΑΝΔΡΟΜΕΔΑ ΑΕΕΧ (ΚΟ)

1.47

-0.06

-3.92

1.61

1.12

ΣΕΛΟΝΤΑ (ΚΟ)

0.50

-0.01

-1.96

1.02

0.41

ΕΜΠΟΡΙΚΟΣ ΔΕΣΜΟΣ (ΚΟ)

0.10

0.00

0.00

0.17

0.08

ΓΕΚ ΤΕΡΝΑ (ΚΟ)

5.55

0.05

0.91

7.46

4.12

ΑΤΕ ΑΣΦΑΛΙΣΤΙΚΗ

1.53

0.00

0.00

1.96

1.10

ΣΠΥΡΟΥ (KΟ)

0.53

0.00

0.00

0.93

0.46

ΕΥΡΩΣΥΜΜΕΤΟΧΕΣ

0.18

0.00

0.00

0.36

0.12

ΓΕΝΙΚΗ ΤΡΑΠΕΖΑ (ΚΟ)

0.60

-0.01

-1.64

1.54

0.57

ΑΤΛΑΝΤΙΚ (ΚΟ)

0.68

-0.02

-2.86

1.59

0.51

ΣΦΑΚΙΑΝΑΚΗΣ (ΚΟ)

0.97

-0.01

-1.02

2.08

0.92

ΙΠΠΟΤΟΥΡ (Κ)

0.23

-0.02

-8.00

0.44

0.19

ΔΕΗ (ΚΟ)

14.08

0.91

6.91

17.40

10.83

ΑΤΤΙΚΕΣ ΕΚΔΟΣΕΙΣ (ΚΟ)

1.43

0.00

0.00

2.42

1.24

ΤΕΧΝ. ΕΚΔΟΣΕΙΣ (ΚΟ)

0.47

-0.03

-6.00

0.80

0.30

ΚΕΡΑΜΕΙΑ ΑΛΛΑΤΙΝΗ (ΚO)

0.80

0.00

0.00

0.88

0.33

ΔΟΛ (ΚΟ)

1.49

-0.03

-1.97

3.82

1.48

ΑΤΤΙΚΗΣ ΤΡΑΠΕΖΑ (ΚΟ)

1.29

-0.04

-3.01

2.59

1.17

ΤΕΧΝΙΚΗ ΟΛΥΜΠΙΑΚΗ (ΚΟ)

0.47

-0.03

-6.00

0.66

0.17

ΚΛΩΝΑΤΕΞ HOLD. (ΚO)

0.06

0.00

0.00

0.22

0.05

13.25

-0.55

-3.99

28.25

12.49

ΑΦΟΙ Χ.ΚΟΡΔΕΛΛΟΥ (ΚΟ)

0.31

0.00

0.00

0.89

0.29

ΤΖΙΡΑΚΙΑΝ ΠΡΟΦΙΛ (ΚΑ)

0.49

0.01

2.08

0.73

0.33

ΚΛΩΝΑΤΕΞ HOLD. (ΠO)

0.09

0.00

0.00

0.22

0.06

ΕΛΒΑΛ (ΚΑ)

1.28

-0.04

-3.03

2.25

1.05

ΒΑΡΔΑΣ (ΚΟ)

0.42

-0.03

-6.67

0.96

0.42

ΤΗΛΕΤΥΠΟΣ (ΚΟ)

4.25

0.00

0.00

5.87

3.51

ΚΟΥΜΠΑΣ (ΚΟ)

0.27

-0.01

-3.57

0.73

0.22

ΕΛΛΑΚΤΩΡ (ΚΟ)

4.00

-0.15

-3.61

6.74

3.87

ΒΙΟΚΑΡΠΕΤ Α.Ε. (ΚΟ)

0.81

-0.03

-3.57

1.30

0.68

ΦΙΛΙΠΠΟΣ ΝΑΚΑΣ (ΚΟ)

1.17

-0.07

-5.65

2.28

1.17

ΜΑΪΛΛΗΣ (ΚΟ)

0.25

0.00

0.00

0.48

0.21

ΕΛΛΗΝΙΚΑ ΠΕΤΡΕΛΑΙΑ (ΚΟ)

8.20

-0.11

-1.32

8.98

6.55

ΒΙΣ (ΚΟ)

1.20

0.00

0.00

1.96

0.97

ΦΙΝΤΕΞΠΟΡΤ (ΚΟ)

0.39

-0.02

-4.88

0.76

0.27

ΜΑΡΑΚ (ΚΟ)

0.37

-0.01

-2.63

0.61

0.31

ΕΛΛΗΝΙΚΑ ΧΡΗΜΑΤΙΣΤΗΡΙΑ (ΚΟ)

6.25

0.05

0.81

10.78

5.89

ΒΟΓΙΑΤΖΟΓΛΟΥ (ΚΟ)

1.21

0.01

0.83

2.65

1.05

ΠΕΡΣΕΥΣ (ΚΟ)

0.39

0.00

0.00

1.08

0.28

ΕΥΑΘ (ΚΟ)

4.91

0.14

2.94

7.72

3.80

ΓΑΛΑΞΙΔΙ (ΚΟ)

0.34

-0.03

-8.11

0.71

0.32

ΠΕΤΖΕΤΑΚΙΣ (ΚΟ)

0.43

0.02

4.88

0.56

0.18

ΕΥΔΑΠ (ΚΟ)

6.49

0.09

1.41

7.49

5.21

ΓΕΒ (ΚΑ)

0.34

0.00

0.00

0.62

0.32

Χαμηλής Διασποράς & Ειδικών Χαρακτηριστικών

ΠΡΑΞΙΤΕΛΕΙΟ Α.Ε. (ΚΟ)

0.39

0.00

0.00

1.11

0.31

ΙΑΣΩ (ΚΟ)

3.15

-0.02

-0.63

5.26

3.08

ΔΑΙΟΣ ΠΛΑΣΤΙΚΑ (ΚΟ)

7.30

0.00

0.00

7.90

4.47

ALPHA ΑΣΤ. ΑΚΙΝΗΤΑ (ΚΟ)

7.70

ΠΡΑΞΙΤΕΛΕΙΟ Α.Ε. (ΠΟ)

0.54

0.00

0.00

1.44

0.54

ΙΑΤΡΙΚΟ ΑΘΗΝΩΝ (ΚΟ)

1.13

-0.04

-3.42

1.94

1.10

ΔΙΑΣ ΑΕΕΧ (ΚΟ)

0.74

0.01

1.37

0.82

0.46

ATTICA ΣΥΜΜΕΤΟΧΩΝ (ΚΟ)

ΠΡΟΟΔΕΥΤΙΚΗ (ΚΟ)

0.22

-0.01

-4.35

0.46

0.15

ΙΝΤΡΑΚΟΜ (ΚΟ)

0.92

-0.01

-1.08

2.08

0.68

ΔΙΑΣ ΙΧΘΥΟΚ. (ΚO)

1.68

-0.02

-1.18

2.00

0.67

ΣΑΟΣ (ΚΟ)

0.78

0.00

0.00

0.78

0.00

ΙΝΤΡΑΛΟΤ (ΚΟ)

3.50

0.10

2.94

5.55

3.09

ΔΟΜΙΚΗ ΚΡΗΤΗΣ (ΚΟ)

1.26

-0.01

-0.79

1.89

0.45

ΣΙΔΜΑ (ΚΟ)

0.99

-0.03

-2.94

2.46

0.97

ΚΑΕ (ΚΟ)

5.95

-0.10

-1.65

7.50

4.80

ΔΟΥΡΟΣ (ΚΟ)

0.96

-0.06

-5.88

1.50

0.76

ΤΕΞΑΠΡΕΤ (ΚO)

0.14

0.00

0.00

0.30

0.10

ΚΥΠΡΟΥ ΤΡΑΠΕΖΑ (ΚΟ)

4.75

0.00

0.00

6.24

2.61

ΔΡΟΜΕΑΣ (ΚΟ)

0.40

0.00

0.00

0.99

0.38

FOLLI - FOLLIE (ΚΟ)

ΕΘΝΙΚΗ ΤΡΑΠΕΖΑ (ΚΟ)

10.21

-0.15

-1.45

11.77

6.56

ΕΒΖ (ΚΑ)

0.81

-0.03

-3.57

1.86

0.78

ΜΗΧΑΝΙΚΗ (ΚΟ)

0.86

0.01

1.18

2.34

0.77

ΕΒΡΟΦΑΡΜΑ (ΚΟ)

0.64

0.00

0.00

1.35

0.54

ΜΗΧΑΝΙΚΗ (ΠΟ)

0.71

0.00

0.00

1.76

0.64

ΕΚΤΕΡ (ΚΟ)

0.76

-0.02

-2.56

1.12

0.54

ΜΟΤΟΡ ΟΪΛ (ΚΟ)

10.20

0.05

0.49

12.80

6.78

ΕΛΑΣΤΡΟΝ (Κ)

0.43

0.00

0.00

1.00

0.40

5.00

-0.11

-2.15

6.93

3.53

ΕΛΒΕ (ΚΟ)

1.16

0.00

0.00

1.75

0.71

ΟΛΘ (ΚΟ)

13.25

-0.25

-1.85

17.30

10.02

ΕΛΓΕΚΑ (ΚO)

0.71

0.02

2.90

1.38

0.65

ΟΛΠ (ΚΟ)

13.30

-0.17

-1.26

18.60

11.02

ΕΛΙΝΟΪΛ (ΚO)

2.13

0.00

0.00

3.20

1.98

ΟΠΑΠ (ΚΟ)

17.39

0.24

1.40

24.89

14.14

ΕΛΛ. ΚΑΛΩΔΙΑ (ΚΟ)

1.29

-0.01

-0.77

2.45

1.07

0.38

0.00

0.00

0.67

0.30

45.90

-0.78

-1.67

60.70

38.80

ΜΕΤΚΑ (ΚΟ)

ΜΥΤΙΛΗΝΑΙΟΣ (ΚΟ)

ΟΤΕ (ΚΟ)

8.70

-0.10

-1.14

12.79

8.46

ΕΛΛ. ΥΦΑΝΤΟΥΡΓΙΑ (ΚΟ)

ΠΕΙΡΑΙΩΣ ΤΡΑΠΕΖΑ (KO)

6.05

-0.08

-1.31

13.45

5.05

ΕΛΛΑΔΟΣ ΤΡΑΠΕΖΑ (ΚΟ)

ΠΛΑΙΣΙΟ COMPUTERS (ΚΟ)

5.01

0.00

0.00

5.65

4.14

ΕΛΤΟΝ (ΚΟ)

0.51

-0.01

-1.92

0.77

0.49

2.70

-0.08

-2.88

3.24

2.30

ΧΑΪΔΕΜΕΝΟΣ (ΚΟ)

1.18

0.04

3.51

1.96

0.68

ΧΑΤΖΗΚΡΑΝΙΩΤΗ (ΚΟ)

0.48

0.04

9.09

0.63

0.37

0.00

0.00

8.10

6.42

1.48

-0.03

-1.99

2.47

1.43

CPI (ΚΟ)

0.32

0.01

3.23

0.49

0.24

CROWN HELLAS CAN (Κ)

7.90

0.00

0.00

9.00

7.20

ELBISCO ΣΥΜΜΕΤΟΧΕΣ (ΚA)

0.38

-0.01

-2.56

0.94

0.38

ELMEC SPORT (Κ)

0.84

0.00

0.00

2.44

0.82

INFORMER (KO)

0.39

0.00

0.00

0.90

0.36

INTERFISH ΙΧΘ/ΓΕΙΕΣ (ΚO)

0.32

-0.01

-3.03

0.70

0.25

MARFIN ΕΓΝΑΤΙΑ ΤΡΑΠΕΖΑ (ΚΟ)

1.46

0.00

0.00

5.25

1.36

OLYMPIC CATERING (ΚΟ)

1.47

0.00

0.00

2.20

1.32

PAPERPACK ΤΣΟΥΚΑΡΙΔΗΣ (ΚΟ)

0.18

-0.02

-10.00

0.45

0.16

PC SYSTEMS AE (ΚΟ)

0.30

0.00

0.00

0.52

0.15

QUALITY & RELIABILITY (ΚΟ)

0.20

-0.01

-4.76

0.39

SPIDER (ΚΟ)

0.26

-0.01

-3.70

UNIBIOS (ΚΟ)

0.18

-0.01

21.30

VIVERE

Διαπραγματεύσιμα Αμοιβαία Κεφάλαια 9.68

-0.36

-3.59

15.77

8.02

NBGAM ETF ATHEX GENERAL INDEX 20.00

-0.44

-2.15

29.35

18.28

1.01

0.00

0.00

1.09

0.93

TECHNOLOGY (KO)

2.47

0.00

0.00

3.20

1.80

DOPPLER (KO)

2.62

0.00

0.00

2.72

2.23

0.16

ENTERSOFT (KO)

1.40

0.00

0.00

1.81

1.29

0.49

0.19

ENVITEC (KO)

2.10

-0.04

-1.87

4.60

1.90

-5.26

0.38

0.13

EPSILON NET (KO)

2.07

0.00

0.00

2.46

1.80

-0.56

-2.56

25.40

18.73

EUROXX (KO)

4.03

0.00

0.00

4.03

3.03

0.46

-0.04

-8.00

1.27

0.39

FOODLINK

2.15

0.00

0.00

2.43

2.01

ΑΘΗΝΑ (ΚΟ)

0.72

-0.01

-1.37

1.23

0.37

MEDITERRA (KO)

2.15

0.00

0.00

2.93

2.03

ΑΣΤΗΡ ΠΑΛΑΣ (ΚΟ)

2.66

-0.02

-0.75

4.53

2.58

OPTRONICS (KO)

2.10

0.00

0.00

3.19

2.10

0.85

0.00

0.00

1.84

0.61

PERFORMANCE TECHNOLOGIES (KO)

2.52

0.00

0.00

2.80

0.66

35.73

0.00

0.00

38.40

22.70

VIDAVO HEALTH TELEMATICS (KO)

3.55

0.00

0.00

3.55

3.22

1.05

0.00

0.00

1.49

1.05

VIVARTIA ABEE (KΟ)

ΣΑΡΑΝΤΗΣ ΓΡ. (ΚO)

4.81

-0.03

-0.62

5.49

2.75

ΕΛΤΡΑΚ (ΚO)

ΣΙΔΕΝΟΡ (ΚΑ)

3.63

-0.07

-1.89

6.70

3.03

ΕΠΙΛΕΚΤΟΣ (ΚΟ)

0.34

0.00

0.00

0.59

0.30

ΣΩΛ/ΓΕΙΑ ΚΟΡΙΝΘΟΥ (ΚΟ)

1.17

-0.02

-1.68

2.48

0.92

ΕΤΕΜ (Κ)

0.58

-0.02

-3.33

1.14

0.52

0.56

0.02

3.70

1.12

0.48

ΒΑΛΚΑΝ ΑΚΙΝΗΤΑ (Κ)

2.85

0.01

0.35

2.94

1.12

ΒΑΣΙΛΟΠΟΥΛΟΣ AB (KO)

ALPHA ETF FTSE ATHEX 20 Εναλλακτική Αγορά ALPHA TRUST ΑΕΠΕΥ (KO) BIOMEDICAL & ROBOTICS

ΤΑΧΥΔΡΟΜΙΚΟ ΤΑΜΙΕΥΤΗΡΙΟ (ΚΟ)

3.67

-0.05

-1.34

5.96

3.29

ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ (ΚΟ)

ΤΕΡΝΑ ΕΝΕΡΓΕΙΑΚΗ ΑΒΕΤΕ

5.42

-0.08

-1.45

7.00

4.16

ΕΥΡΩΣΥΜΒΟΥΛΟΙ (KO)

18.80

-0.80

-4.08

26.63

16.48

ΖΑΜΠΑ (Κ)

11.00

0.18

1.66

15.40

7.72

ΒΙΟΤΕΡ (ΚΟ)

0.22

0.00

0.00

0.50

0.19

ΚΡΗΤΩΝ ΑΡΤΟΣ (ΚΟ)

ΖΗΝΩΝ (ΚΟ)

1.38

-0.03

-2.13

1.63

0.65

ΓΕΚΕ - PRESIDENT (ΚΑ)

8.20

0.00

0.00

8.99

6.64

Ανεσταλμένες

ΤΙΤΑΝ (ΚΟ) ΤΙΤΑΝ (ΠΟ)

18.80

-0.80

-4.08

26.63

16.48

ΥΓΕΙΑ (ΚO)

1.22

-0.02

-1.61

2.58

1.22

ΗΛΕΚ. ΑΘΗΝΩΝ (ΚΟ)

1.80

0.00

0.00

3.40

1.67

ΕΚΔ. ΛΥΜΠΕΡΗ (ΚΟ)

0.60

0.00

0.00

1.02

0.34

HITECH SNT (ΚΟ)

0.00

0.00

0.00

0.00

0.00

ΧΑΛΚΟΡ (ΚΑ)

1.03

0.02

1.98

2.09

0.93

ΙΚΤΙΝΟΣ ΕΛΛΑΣ (ΚO)

0.56

0.00

0.00

0.96

0.42

ΕΜΠΟΡΙΚΗ ΤΡΑΠΕΖΑ (ΚΟ)

3.86

-0.08

-2.03

7.91

3.48

ΑΛΥΣΙΔΑ (ΚΟ)

0.00

0.00

0.00

0.00

0.00

Μεσαίας - Μικρής Κεφαλαιοποίησης

ΙΛΥΔΑ (ΚΟ)

1.05

-0.26

-19.85

1.42

0.64

ΗΡΑΚΛΗΣ ΑΓΕΤ (ΚΟ)

5.50

0.01

0.18

6.98

4.78

ΑΛΥΣΙΔΑ (ΠΟ)

0.00

0.00

0.00

0.00

0.00

A.S. COMPANY (ΚΟ)

0.70

-0.02

-2.78

1.18

0.67

ΙΜΠΕΡΙΟ Α.Ε. (ΚΟ)

0.42

-0.01

-2.33

1.20

0.36

ΙΟΝΙΚΗ ΞΕΝΟΔΕΙΑΧΗ (ΚΟ)

14.00

0.00

0.00

17.38

12.90

ΑΣΠΙΣ ΠΡΟΝΟΙΑ (KΟ)

0.00

0.00

0.00

0.00

0.00

ALSINCO (KO)

0.85

0.00

0.00

1.47

0.72

ΙΝΤΕΑΛ ΟΜΙΛΟΣ (ΚΟ)

0.97

0.03

3.19

1.61

0.68

ΚΑΡΕΛΙΑΣ (Κ)

79.00

0.00

0.00

86.00

57.05

ΛΑΝ-ΝΕΤ (ΚΟ)

0.00

0.00

0.00

0.00

0.00

ALTER CHANNEL (ΚΟ)

1.36

0.00

0.00

3.25

1.35

ΙΝΤΕΑΛ ΟΜΙΛΟΣ (ΠΟ)

8.26

0.00

0.00

8.26

8.26

ΚΕΚΡΟΨ (ΚΟ)

2.99

-0.25

-7.72

7.32

2.86

ΝΕΛ (ΚΟ)

0.00

0.00

0.00

0.00

0.00

ASPIS BANK (ΚΟ)

0.58

-0.02

-3.33

1.54

0.56

ΙΝΤΕΡΤΕΚ (ΚΟ)

0.85

-0.02

-2.30

1.40

0.71

ΚΛΩΣΤ. ΝΑΥΠΑΚΤΟΥ (ΚΑ)

0.29

-0.01

-3.33

0.46

0.27

ΔΙΕΚΑΤ (ΚΟ)

0.00

0.00

0.00

0.00

0.00

AUDIOVISUAL (ΚΟ)

0.71

0.00

0.00

2.37

0.57

ΙΝΤΡΑΚΟΜ ΚΑΤΑΣΚΕΥΕΣ (ΚΟ)

0.50

-0.01

-1.96

1.17

0.44

19.34

0.42

2.22

22.88

18.20

ΜΕΣΟΧΩΡΙΤΗ (ΚΟ)

0.00

0.00

0.00

0.00

0.00

AUTOHELLAS (ΚΟ)

1.93

-0.07

-3.50

2.20

1.29

ΚΑΘΗΜΕΡΙΝΗ (ΚΟ)

4.91

-0.01

-0.20

5.81

3.98

ΜΙΝΩΙΚΕΣ ΓΡΑΜΜΕΣ (ΚΟ)

2.72

-0.11

-3.89

4.30

2.69

ΧΑΛΥΒΔΟΦΥΛΛΩΝ (ΚΟ)

0.00

0.00

0.00

0.00

0.00

ΑΧΟΝ ΣΥΜΜΕΤΟΧΩΝ (ΚΟ)

0.53

0.00

0.00

1.46

0.50

ΚΑΝΑΚΗΣ (KO)

1.70

-0.02

-1.16

1.92

1.21

ΜΟΧΛΟΣ (ΚΟ)

0.18

-0.01

-5.26

0.38

0.13

ALTIUS AEEX (ΚΟ)

0.00

0.00

0.00

0.00

0.00

BYTE COMPUTER (ΚΟ)

0.79

0.00

0.00

1.41

0.70

ΚΑΡΑΜΟΛΕΓΚΟΣ (KΟ)

0.75

-0.08

-9.64

1.39

0.71

ΜΠΕΝΡΟΥΜΠΗ (Κ)

3.48

0.00

0.00

3.52

2.83

ΩΜΕΓΑ ΑΕΕΧ (ΚO)

0.00

0.00

0.00

0.00

0.00

CENTRIC ΠΟΛΥΜΕΣΑ (ΚΟ)

0.65

-0.01

-1.52

1.66

0.55

ΚΑΡΑΤΖΗΣ (ΚΟ)

1.26

0.00

0.00

1.82

1.08

ΜΠΟΥΤΑΡΗΣ (ΚΑ)

0.21

-0.01

-4.55

0.40

0.16

MICROLAND COMPUTERS (ΚΟ)

0.00

0.00

0.00

0.00

0.00

CYCLON ΕΛΛΑΣ (ΚΟ)

0.63

-0.01

-1.56

1.25

0.51

ΚΑΡΔΑΣΙΛΑΡΗΣ (ΚO)

0.28

-0.01

-3.45

0.89

0.24

ΜΠΟΥΤΑΡΗΣ (ΠΑ)

0.40

0.00

0.00

0.40

0.30

ΜΑΞΙΜ-ΠΕΡΤΣΙΝΙΔΗΣ (ΚΑ)

0.00

0.00

0.00

0.00

0.00

EUROBROKERS (KO)

0.81

-0.03

-3.57

1.87

0.34

NUTRIART (πρώην ΚΑΤΣΕΛΗΣ) (Κ)

0.35

-0.01

-2.78

0.82

0.32

ΝΙΚΑΣ (ΚO)

1.32

-0.01

-0.75

2.23

1.22

ΕΝ. ΚΛΩΣΤΟΫΦΑΝΤΟΥΡΓΙΑ Α.Ε. (ΚO)

0.00

0.00

0.00

0.00

0.00

EURODRIP (ΚO)

0.81

0.01

1.25

1.00

0.62

ΚΛΟΥΚΙΝΑΣ - ΛΑΠΠΑΣ (ΚΟ)

1.65

-0.06

-3.51

3.36

1.50

EUROLINE ΑΕΕΧ (KO)

1.07

0.00

0.00

1.54

0.90

ΚΟΡΡΕΣ (KO)

5.80

0.00

0.00

7.79

5.20

EUROMEDICA (KO)

4.06

-0.09

-2.17

6.50

3.80

ΚΡΕ.ΚΑ A.E. (KA)

0.75

0.00

0.00

1.31

0.59

FASHION BOX (ΚΟ)

1.27

0.00

0.00

2.07

1.15

ΚΡΕΤΑ ΦΑΡΜ (KO)

5.88

0.03

0.51

9.35

3.78

F.G. EUROPE (ΚΟ)

1.10

0.05

4.76

1.89

0.93

ΚΡΙ ΚΡΙ (ΚO)

1.33

0.00

0.00

2.14

1.23

FLEXOPACK (ΚO)

7.64

0.00

0.00

8.24

7.10

ΚΤΗΜΑ ΛΑΖΑΡΙΔΗ (ΚO)

0.63

-0.04

-5.97

0.91

0.52

INFO-QUEST (ΚΟ)

1.32

-0.01

-0.75

1.95

1.12

ΚΥΛ. ΛΟΥΛΗ (ΚΟ)

1.78

0.00

0.00

2.22

1.45

INFORM ΛΥΚΟΣ Π. (ΚΟ)

1.18

-0.04

-3.28

2.26

1.05

ΚΥΛ. ΣΑΡΑΝΤΟΠΟΥΛΟΥ (Κ)

2.80

0.00

0.00

5.00

2.17

INTERINVEST AEEX (KO)

0.81

0.01

1.25

1.39

0.74

ΚΥΡΙΑΚΙΔΗΣ FHL (ΚΟ)

0.87

0.02

2.35

1.08

0.35

KLEEMAN HELLAS (KO)

1.92

0.00

0.00

2.97

1.68

ΚΥΡΙΑΚΟΥΛΗΣ (ΚΟ)

0.46

-0.04

-8.00

1.26

0.38

LAVIPHARM (ΚΟ)

0.77

-0.03

-3.75

1.73

0.74

ΛΑΝΑΚΑΜ (ΚO)

0.65

-0.02

-2.99

2.08

0.54

LOGISMOS (ΚΟ)

0.40

0.00

0.00

0.84

0.34

ΛΕΒΕΝΤΕΡΗΣ (Κ)

0.59

0.02

3.51

0.74

0.54

MEDICON ΕΛΛΑΣ (KO)

3.00

0.20

7.14

4.16

2.25

ΛΕΒΕΝΤΕΡΗΣ (Π)

0.59

0.02

3.51

0.74

0.54

ΛΑΜΨΑ (ΚΟ)

ΣΕ ΑΝΑΣΤΟΛΗ: HITECH SNT (ΚΟ), ΑΦΟΙ ΜΕΣΟΧΩΡΙΤΗ (ΚΟ), ΑΛΥΣΙΔΑ (ΚΟ), ΑΛΥΣΙΔΑ (ΠΟ), ΑΣΠΙΣ ΠΡΟΝΟΙΑ (ΚΟ), ΔΙΕΚΑΤ (ΚΟ), ΛΑΝ-ΝΕΤ, ΝΕΛ (ΚΟ), ΧΑΛΥΒΔΟΦΥΛΛΩΝ (ΚΟ), BETANET (KO), ΣΑΟΣ (ΚΟ), ALTIUS ΕΠΕΝΔΥΤΙΚΗ (ΚΟ), ΩΜΕΓΑ ΑΕΕΧ (ΚΟ), MICROLAND COMPUTERS (KO), ΜΑΞΙΜ ΠΕΡΤΣΙΝΙΔΗΣ (ΚΑ), ΕΝΩΜΕΝΗ ΚΛΩΣΤΟΫΦΑΝΤΟΥΡΓΙΑ, ΑΤΕΡΜΩΝ, ΠΡΑΞΙΤΕΛΕΙΟ ΘΕΡΑΠΕΥΤΗΡΙΟ .


ΟΙΚΟΝΟΜΙΑ

Πέµπτη 15 Απριλίου 2010

39

ΑΜΟΙΒΑΙΑ ΚΕΦΑΛΑΙΑ

ΑΠΟΤΙΜΗΣΗ 13/4/2010 ΤΙΤΛΟΙ

Τιµή Τιµή Καθαρή Ενεργητικό ∆ιάθεσης Εξαγοράς Τιµή σε εκατ. ευρώ σε ευρώ σε ευρώ σε ευρώ

Ηµερήσια Μεταβ. (%)

Μεταβ. (%) από 1/1/2010

ΟΜΟΛΟΓΙΑΚΑ Α/Κ ΕΣΩΤΕΡΙΚΟΥ AAAB ΕΙΣΟΔΗΜΑΤΟΣ ΚΑΙ ΟΜΟΛΟΓΙΩΝ ΕΣΩΤ. ALLIANZ ΟΜΟΛΟΓΙΩΝ ΕΣΩΤΕΡΙΚΟΥ ALPHA ΟΜΟΛΟΓΙΑΚΟ ΕΣΩΤΕΡΙΚΟΥ GENIKI ΟΜΟΛΟΓΙΩΝ ΕΣΩΤΕΡΙΚΟΥ ΑΣΦΑΛ/ΚΩΝ ΟΡΓΑΝΙΣΜΩΝ ΕΙΣΟΔΗΜΑΤΟΣ-ΟΜΟΛΟΓΙΑΚΟ ΕΣΩΤ. ATE ΕΙΣΟΔΗΜΑΤΟΣ ΟΜΟΛΟΓΙΩΝ ΕΣΩΤ. ΑΤΕ ΚΕΦΑΛΑΙΟΥ & ΥΠΕΡΑΞΙΑΣ ΟΜΟΛ.ΕΣΩΤ. ΑΤΤΙΚΗΣ ΕΙΣΟΔΗΜΑΤΟΣ ΟΜΟΛ.ΕΣΩΤ. CITI FUND ΟΜΟΛΟΓΙΩΝ ΕΣΩΤΕΡΙΚΟΥ ΔΗΛΟΣ ΕΙΣΟΔΗΜΑΤΟΣ ΔΗΛΟΣ BASE 95 - ΟΜΟΛΟΓΙΑΚΟ ΕΣΩΤΕΡΙΚΟΥ ΕΡΜΗΣ EIΣΟΔΗΜΑΤΟΣ ΕΥΡΩΠ.ΠΙΣΤΗ EUROBOND ΟΜ.ΕΣ. EUROBANK EFG (LF) GREEK GOVERNMENT BOND FUND EUR EUROBANK EFG I (LF) GREEK GOVERNMENT BOND FUND EUR INTERAMERICAN ΣΤΑΘΕΡΟ ΟΜΟΛΟΓΙΑΚΟ ΕΣ. INTERNATIONAL ΟΜΟΛΟΓΩΝ ΕΣΩΤ. ΙΟΝΙΚΗ ΖΩΗΣ ΣΥΝΤ.ΠΡΟΓΡ.ΟΜΟΛ.ΕΣΩΤ. ΚΥΠΡΟΥ ΕΛΛΗΝΙΚΟ ΟΜΟΛΟΓΙΑΚΟ ΕΣΩΤ. MILLENNIUM VALUE PLUS ΟΜΟΛΟΓΙΑΚΟ ΕΣ. PROBANK ΟΜΟΛΟΓΙΑΚΟ ΕΣΩΤΕΡΙΚΟΥ HSBC ΕΙΣΟΔΗΜΑΤΟΣ ΟΜΟΛΟΓΙΑΚΟ ΕΣ. ΠΕΙΡΑΙΩΣ Α/Κ ΟΜΟΛΟΓΩΝ ΕΣΩΤ. Τ.Τ. ΕΛΤΑ ΟΜΟΛΟΓΙΩΝ ΕΣΩΤ. PROTON ΟΜΟΛΟΓΙΩΝ ΕΣΩΤΕΡΙΚΟΥ ΕΞΩΤΕΡΙΚΟΥ ALICO ΚΡΑΤΙΚΩΝ ΟΜΟΛΟΓΩΝ ΕΞΩΤΕΡΙΚΟΥ ALICO EΤΑΙΡΙΚΩΝ ΟΜΟΛΟΓΙΩΝ ΕΞΩΤΕΡΙΚΟΥ ΑLICO ΔΟΛΑΡΙΑΚΟ ΟΜΟΛΟΓΙΩΝ ΕΞΩΤΕΡΙΚΟΥ ΑLPHA ΕΥΡΩΠ.ΕΤΑΙΡ.ΟΜΟΛΟΓΩΝ ΟΜ.ΕΞ. ALPHA ΕΥΡΩΠ.ΚΡΑΤΙΚΩΝ ΟΜΟΛΟΓΩΝ ΟΜ.ΕΞ. ALPHA GLOBAL ΑΝΑΔΥΟΜΕΝΩΝ ΑΓΟΡΩΝ ΟΜΟΛΟΓΙAKO ΕΞ. ALPHA ΑΝΩ ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ ALPHA BANCASSURANCE EE100 ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ ALPHA BANCASSURANCE EE101 ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ ALPHA TRUST STRATEGIC BOND FUND ΟΜ.ΕΞ. ALPHA BEST OF STRATEGIES ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ ΑΤΕ ΟΜΟΛΟΓΙΩΝ ΕΞΩΤΕΡΙΚΟΥ ΑΤΤΙΚΗΣ ΟΜΟΛΟΓΙΩΝ ΕΞΩΤΕΡΙΚΟΥ ΔΗΛΟΣ USD BOND ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΔΗΛΟΣ EUROBOND ΟΜΟΛΟΓΙΑΚΟ ΕΞ. ΔΗΛΟΣ ΔΙΕΘΝΩΝ ΟΜΟΛΟΓΙΩΝ - ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ ΔΗΛΟΣ DELTA SKY ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΔΗΛΟΣ DELTA SMART ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΔΗΛΟΣ DELTA BONUS ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΔΗΛΟΣ DELTA FASMA ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΔΗΛΟΣ ΔΟΛΛΑΡΙΑΚΟ (USD) - ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ NBG EMERGING EUROBOND - CLASS A (EUR) NBG EMERGING EUROBOND - CLASS B (EUR) NBG INCOME PLUS - CLASS Α (EUR) NBG INCOME PLUS - CLASS B (EUR) NBG STRATEGIC BOND - CLASS A (EUR) NBG STRATEGIC BOND - CLASS B (EUR) NBG SYN GROWTH STRATEGY II /A (EUR) NBG SYN GROWTH STRATEGY II / B (EUR) ΕΛΛΗΝΙΚΗ TRUST ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ BOND ΟΜΟΛΟΓΙΑΚΟ ΕΞ. ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ YIELDPLUS (ΟΜΟΛΟΓΙΑΚΟ ΕΞ.) ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ ΕΙΣΟΔ.(ΟΜΟΛ.ΕΞΩΤ.) EUROBANK CLICK ΟΜΟΛΟΓΙΑΚΟ EΞΩΤΕΡΙΚΟΥ EUROBANK DOUBLE CLICK ΟΜΟΛΟΓΙΑΚΟ EΞΩΤΕΡΙΚΟΥ INTERAMERICAN DOUBLE CLICK ΟΜΟΛΟΓΙΑΚΟ EΞΩΤΕΡΙΚΟΥ EUROBANK ALL WEATHER ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ EUROBANK GLOBAL BOND ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ EUROBANK WIN-WIN ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ INTERAMERICAN ΔΟΛΑΡΙΟΥ ΟΜΟΛΟΓΙΑΚΟ ΕΞ. EUROBANK EFG (LF) SPECIAL PURPOSE COMMODITY MAX 30 EUROBANK EFG (LF) ABSOLUTE RETURN EUR EUROBANK EFG (LF) ABSOLUTE RETURN II EUR ΚΥΠΡΟΥ DUAL STRATEGY ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΚΥΠΡΟΥ EURIBOR RETURN (EUR) ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. ΚΥΠΡΟΥ LIBOR RETURN (USD) ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ. MARFIN INCOME ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ MARFIN ΘΕΣΜΙΚΩΝ ΧΑΡΤΟΦ. ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤΕΡΙΚΟΥ HSBC ΟΜΟΛΟΓΙΩΝ ΕΞΩΤΕΡΙΚΟΥ ΔΟΛΑΡΙΟΥ PIRAEUSINVEST EUROPEAN BOND FUND (EUR) Τ.Τ. ΕΛΤΑ EUROPLUS ΟΜΟΛΟΓΙΑΚΟ ΕΞΩΤ.

25,072,821.01 22,569,984.47 135,114,051.24 14,958,343.11 363,797,095.00 29,210,945.67 18,234,792.71 7,372,143.19 12,187,400.62 124,311,019.53 1,308,615.54 51,655,680.06 6,041,749.41 27,030,935.95 9,804,600.55 201,435,516.06 15,867,992.97 3,776,112.97 10,403,557.10 8,433,368.04 8,882,449.33 14,559,984.28 35,760,466.08 10,203,302.68 4,025,862.05

4.971 8.043 8.759 6.802 3.370 8.663 6.908 5.082 7.439 8.809 11.450 7.674 4.073 10.010 10.061 14.559 17.209 5.840 5.092 3.766 3.631 7.509 9.441 1.875 14.302

4.776 7.865 8.693 6.618 3.370 8.598 6.856 5.012 7.329 8.809 10.796 7.560 3.771 9.935 10.061 14.378 16.703 5.668 5.041 3.618 3.604 7.434 9.254 1.871 13.950

4.873 7.924 8.759 6.685 3.370 8.663 6.908 5.052 7.329 8.809 10.905 7.598 3.771 10.010 10.061 14.487 16.872 5.725 5.092 3.692 3.631 7.434 9.348 1.875 14.091

-0.49% -0.56% -0.88% -0.62% -1.01% -0.19% -0.93% -0.50% -0.58% -0.15% -0.30% -0.75% -0.95% -0.77% -0.77% -0.79% -0.38% -0.45% -0.37% -0.80% -0.40% -0.62% -0.44% -0.17% -0.62%

-3.22% -4.69% -3.01% -4.11% -5.14% -4.01% -3.58% -5.85% -3.89% -0.72% -0.27% -4.29% -5.07% -3.79% -3.64% -4.58% 0.61% -2.90% -2.93% -3.76% -1.85% -2.82% -5.71% -2.81% -3.66%

78,096,036.63 26,026,110.71 3,437,773.73 162,747,931.58 37,458,364.87 7,022,954.69 29,039,596.44 32,990,471.83 17,517,096.87 10,162,208.69 32,589,654.01 11,631,078.54 20,741,422.16 35,042,028.29 325,923,284.06 5,681,808.86 28,467,552.65 57,319,873.93 129,354,027.34 54,306,832.86 17,648,412.30 117,047.48 6,630,100.23 666,840.01 14,439,378.67 1,104,264.37 1,401,547.92 33,032,563.12 2,143,559.69 5,033,787.10 13,472,939.20 3,545,225.84 3,107,341.99 125,175,951.27 59,674,167.29 14,792,784.17 55,860,429.62 105,154,847.46 57,234,908.99 10,910,276.08 56,374,490.85 81,004,886.78 42,238,208.76 4,132,769.65 484,307.91 10,059,934.23 73,743,045.02 21,006,471.50 2,807,272.75 4,271,557.89 5,557,812.82

16.835 12.738 10.017 4.566 7.006 7.048 8.811 9.511 10.155 4.098 8.277 6.954 3.148 5.227 6.085 5.935 9.960 11.258 9.089 10.566 11.318 1,245.280 1,239.880 1,154.300 1,184.120 978.490 1,037.330 1,017.400 1,020.740 4.579 3.626 3.180 8.310 3.362 10.838 10.676 9.517 3.154 9.770 28.403 9.593 1.113 10.622 3.389 3.015 4.919 2.892 3.473 3.955 210.276 3.411

16.339 12.363 9.722 4.532 6.953 6.995 8.223 9.049 9.662 3.987 7.875 6.902 3.105 5.227 6.085 5.935 9.485 10.722 8.613 10.013 11.318 1,245.280 1,239.880 1,154.300 1,184.120 978.490 1,037.330 1,017.400 1,020.740 4.522 3.573 3.133 8.187 3.215 10.413 10.258 9.327 3.130 9.387 28.050 9.401 1.104 10.542 3.290 2.985 4.869 2.835 3.271 3.916 209.230 3.245

16.505 12.488 9.820 4.566 7.006 7.048 8.391 9.233 9.859 4.028 8.036 6.954 3.130 5.227 6.085 5.935 9.485 10.722 8.656 10.063 11.318 1,245.280 1,239.880 1,154.300 1,184.120 978.490 1,037.330 1,017.400 1,020.740 4.557 3.573 3.133 8.187 3.280 10.626 10.467 9.517 3.154 9.578 28.262 9.593 1.113 10.622 3.323 3.015 4.919 2.864 3.372 3.916 209.230 3.311

0.04% 0.11% 0.14% 0.08% 0.10% 0.13% -0.13% -0.52% -0.06% -0.02% -0.20% 0.00% -0.18% 0.09% -0.02% 0.13% -0.01% -0.08% -0.01% -0.01% 0.12% 0.36% 0.36% 0.05% 0.05% 0.56% 0.56% -0.08% -0.08% 0.03% 0.17% 0.17% -0.02% -0.00% 0.02% -0.05% -0.05% 0.02% -0.01% 0.05% -0.07% 0.09% 0.17% 0.01% -0.03% 0.09% -0.26% -0.16% -0.04% 0.52% 0.07%

1.43% 2.26% 6.74% 1.37% 1.41% 5.63% -1.47% -2.49% 1.25% 2.37% -1.72% 2.09% -0.84% 12.73% 6.57% 3.52% 0.51% 1.45% -0.01% -0.01% 5.07% 2.45% 2.46% -0.39% -0.38% -0.14% -0.13% -0.47% -0.46% 2.15% 1.98% 0.17% 1.34% 0.57% -0.29% -0.02% -1.39% 1.34% -0.74% 6.65% -1.89% -0.86% -1.06% 0.78% 1.67% 2.06% -0.46% 1.45% 6.58% 0.08% 0.80%

2.787 8.702 5.298 18.512 3.257 7.731 11.908 11.870 7.549 12.925 10.062 37.501 13.989 5.642 6.088 2.063 5.328 1.091 1.232 6.289 1.783 8.688 1.540 20.396 1,035.660 1,037.070 3.796 17.357 2.398 6.397 9.694 3.021 23.804 5.429 0.444 0.479 8.302 8.077 8.894 1.439 10.523 10.524 3.867 2.164 2.730 1.975 12.820 2.117 43.693 8.765 3.861 0.797 9.447 0.755

2.601 8.204 4.995 17.454 3.115 7.395 11.672 11.634 7.400 12.669 9.932 36.398 13.578 5.476 5.909 1.993 5.275 1.080 1.202 6.134 1.765 8.601 1.524 20.396 1,035.660 1,037.070 3.683 16.683 2.305 6.149 9.597 2.990 23.333 5.321 0.439 0.474 8.219 8.077 8.894 1.425 10.312 10.314 3.646 2.040 2.703 1.955 12.440 2.054 42.628 8.551 3.767 0.781 9.262 0.727

2.654 8.287 5.045 17.630 3.147 7.470 11.790 11.752 7.474 12.797 10.012 36.765 13.715 5.532 5.969 1.993 5.328 1.091 1.214 6.196 1.783 8.688 1.540 20.396 1,035.660 1,037.070 3.758 16.851 2.329 6.211 9.694 3.021 23.568 5.375 0.444 0.479 8.302 8.077 8.894 1.439 10.523 10.524 3.682 2.061 2.730 1.975 12.693 2.096 42.628 8.551 3.767 0.781 9.262 0.742

-1.42% -1.44% -2.80% -1.86% -1.20% -1.80% -1.45% -1.56% -2.15% -1.63% -2.83% -1.59% -0.45% -1.45% -1.33% -1.67% -1.78% -1.07% -1.33% -0.96% -1.58% -2.05% -2.37% -2.18% 3.34% 3.35% -1.94% -1.89% -1.21% -1.74% -1.06% -1.27% -1.13% -0.68% -1.11% -1.42% -0.72% -0.98% -0.14% -1.34% -1.38% -1.38% -1.56% -1.01% -1.43% -1.38% -1.60% -1.13% -2.07% -1.32% -1.34% -1.24% -1.77% -1.58%

-9.85% -10.86% -11.62% -8.31% -7.97% -9.75% -7.69% -8.33% -8.30% -8.17% -11.50% -8.86% -3.94% -7.36% -6.62% -8.79% -5.33% -6.38% -7.64% -8.50% -9.59% -9.87% -9.64% -8.15% -7.10% -7.09% -9.84% -7.07% -8.83% -6.96% -6.49% -9.81% -6.55% -7.20% -6.69% -10.73% -1.69% -3.18% -1.53% -2.22% -4.09% -4.08% -8.17% -10.67% -6.84% -8.58% -8.30% -7.42% -9.04% -12.67% -11.57% -10.01% -9.20% -10.40%

ΜΕΤΟΧΙΚΑ Α/Κ 8,473,766.38 4,717,946.48 23,700,762.35 38,188,589.26 14,954,663.36 15,774,983.95 185,919,081.28 175,927,931.57 20,628,378.06 21,311,662.30 59,629,697.51 44,232,831.11 46,131,429.45 32,270,882.91 1,283,660.91 16,427,404.56 78,458,151.89 2,127,168.58 11,483,962.43 893,503.86 72,963,818.84 163,856,981.50 25,949,793.32 5,701,222.94 200,310.19 14,187,077.68 1,456,683.67 117,585,309.08 10,269,840.26 9,074,204.76 57,361,864.55 7,026,374.92 188,520,807.63 64,661,592.86 29,325,269.52 2,011,382.90 85,075,770.02 51,491,786.11 46,135,348.93 5,253,801.96 601,991.68 2,743,086.71 12,490,321.67 2,273,662.33 19,606,951.60 10,568,398.50 59,630,400.03 13,685,929.34 71,455,606.38 4,288,443.89 6,605,182.03 13,615,111.20 47,510,079.15 6,857,447.01

ΠΕΙΡΑΙΩΣ Α/Κ ΜΕΤΟΧΙΚΟ ΕΣΩΤ. PROBANK ΕΛΛΑΣ ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ MILLENNIUM BLUE CHIPS ΜΕΤΟΧΙΚΟ ΕΣ. MILLENNIUM MID- CAP ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ Τ.Τ. ΕΛΤΑ ΜΕΤΟΧΙΚΟ ΕΣΩΤ. ΕΠΕΝΔΥΤΙΚΗ ΚΡΗΤΗΣ ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ PROTON ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ

Τιµή Τιµή Καθαρή Ενεργητικό ∆ιάθεσης Εξαγοράς Τιµή σε εκατ. ευρώ σε ευρώ σε ευρώ σε ευρώ

Ηµερήσια Μεταβ. (%)

Μεταβ. (%) από 1/1/2010

36,860,730.58 7,919,455.18 26,370,421.17 17,635,294.28 924,976.75 577,865.68 5,648,918.62

9.004 3.028 1.992 2.238 1.076 2.779 9.118

8.673 2.997 1.878 2.089 1.044 2.645 8.679

8.850 3.028 1.897 2.132 1.055 2.672 8.767

-2.18% -1.69% -2.14% -1.38% -0.99% -1.71% -1.75%

-9.35% -6.95% -8.97% -11.07% -4.88% -6.25% -6.38%

17,340,085.36 3,235,445.50 5,783,874.69 10,751,345.12 18,895,730.19 3,720,833.44 8,024,608.49 4,235,113.95 980,546.70 21,651,706.87 31,848,816.04 1,199,576.75 778,653.93 37,390,349.28 778,416.22 45,548,126.29 44,537.79 4,845,676.01 4,275,002.78 2,134,149.62 4,393,876.65 1,819,754.23 3,899,866.15 1,504,730.20 56,217,984.37 9,022,193.73 17,669,910.32 48,700,031.99 11,068,672.63 14,810,251.04 3,094,019.16 3,457,095.60 1,329,057.67 151,934,424.91 45,789,825.19 1,943,744.64 29,734,209.76 6,430,751.14 4,165,328.85 694,322.22 1,460,104.43 9,497,872.16 19,323,883.26 22,476,093.52 13,839,923.05 32,994,957.57 674,427.17 3,766,374.27 2,060,475.11

13.600 8.109 5.399 11.174 13.507 6.162 5.240 2.335 7.996 3.510 3.768 9.996 1,193.380 1,213.310 1,109.960 1,111.470 1,012.380 1,013.870 3.734 5.091 1.604 2.680 2.714 2.807 1.349 15.519 14.023 11.568 0.712 0.962 9.018 8.993 8.860 8.716 7.479 3.240 10.678 2.327 2.138 3.998 3.213 1.511 3.090 5.369 2.932 2.255 17.610 292.750 5.621

12.823 7.757 5.293 10.953 13.240 5.980 5.187 2.311 7.799 3.475 3.731 9.897 1,193.380 1,213.310 1,109.960 1,111.470 1,012.380 1,013.870 3.623 4.940 1.542 2.575 2.622 2.698 1.336 15.364 13.746 11.339 0.705 0.952 8.838 8.813 8.683 8.542 7.405 3.207 10.464 2.172 1.995 3.732 3.026 1.467 3.014 5.238 2.860 2.210 17.087 287.010 5.348

12.953 7.835 5.346 11.063 13.374 6.041 5.240 2.335 7.878 3.510 3.768 9.996 1,193.380 1,213.310 1,109.960 1,111.470 1,012.380 1,013.870 3.697 5.041 1.557 2.602 2.648 2.725 1.349 15.519 13.884 11.454 0.712 0.962 9.018 8.993 8.860 8.716 7.479 3.240 10.678 2.216 2.036 3.808 3.120 1.497 3.014 5.238 2.860 2.210 17.436 287.010 5.457

-0.24% -0.42% -0.79% -0.54% -1.30% -0.14% 0.11% -0.40% 0.79% -0.26% -0.53% -0.00% -0.35% -0.35% 0.25% 0.25% 0.21% 0.21% -0.82% -0.41% -0.25% -0.41% 0.05% 0.01% -0.13% -0.51% -0.12% -0.53% -0.13% -0.63% -0.86% -0.83% -0.44% -0.70% -0.01% -0.35% 0.05% -0.53% 0.06% -1.02% -0.26% -0.31% 0.14% -0.70% -0.34% -0.05% -1.26% -0.20% 0.12%

7.40% 19.88% 19.28% 8.27% 8.01% 9.27% 8.92% -0.28% 7.30% 2.01% -0.72% -0.04% 7.05% 7.06% 1.17% 1.18% 2.43% 2.44% -8.12% 4.28% 5.68% 10.54% 11.24% 13.82% 7.14% 15.78% 6.26% 15.25% 7.24% 16.86% -0.57% -1.15% -0.76% -1.37% -2.44% 5.13% 1.00% -0.46% 9.18% 1.57% 3.99% 5.00% 18.89% 7.45% 3.07% 7.02% 12.11% 3.00% 0.08%

ΕΞΩΤΕΡΙΚΟΥ ALICO ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ALLIANZ MILLENNIUM E.M.E.A. ΜΕΤ. ΕΞΩΤΕΡΙΚΟΥ ALPHA ΝΑΥΤΙΛΙΑ ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ALPHA ENERGY ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ALPHA SELECT ΝΟΤΙΟ-ΑΝΑΤΟΛΙΚΗΣ ΕΥΡΩΠΗΣ ΜΕΤ. ΕΞ. ALPHA TRUST EMERGING EUROPE ΜΕΤ.ΕΞ. ΑΤΕ US ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ΑΤΕ EUROZONE ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ATTICA REAL ESTATE ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ΔΗΛΟΣ ΔΙΕΘΝΕΣ ΔΗΛΟΣ ΕΥΡΩΠΑΙΚΟ ΔΗΛΟΣ ΠΡΑΣΙΝΗ ΕΝΕΡΓΕΙΑ ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ NBG GLOBAL EQUITY - CLASS Α (EUR) NBG GLOBAL EQUITY - CLASS B (EUR) NBG EUROPEAN ALLSTARS - CLASS A (EUR) NBG EUROPEAN ALLSTARS - CLASS B (EUR) NBG SOCIALLY RESPONSIBLE - CLASS A (EUR) NBG SOCIALLY RESPONSIBLE - CLASS B (EUR) ΕΛΛΗΝΙΚΗ TRUST ΚΥΠΡΙΑΚΟ ΜΕΤΟΧΙΚΟ ΕΞΩΤ. ΕΛΛΗΝΙΚΗ TRUST ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ EUROPEAN OPPORTUNITIES ΜΕΤ. ΕΞ. ΕΥΡΩΠΑΪΚΗ ΠΙΣΤΗ EMERGING MARKETS OPPORTUN. ΜΕΤ.ΕΞ. ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ GLOBAL OPPORTUNITIES (ΜΕΤ. ΕΞ.) ΕΥΡΩΠΑΪΚΗ ΠΙΣΤΗ AMERICAN OPPORTUNITIES ΜΕΤ. ΕΞ. EUROBANK GLOBAL EQUITIES ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ EUROBANK EMERGING EUROPE ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ INTERAMERICAN ΑΝΑΠΤΥΓΜΕΝΩΝ ΑΓΟΡΩΝ ΜΕΤ. ΕΞ. INTERAMERICAN ΝΕΑ ΕΥΡΩΠΗ ΜΕΤ. ΕΞ. EUROBANK EFG (LF) EQUITY- GLOBAL EQUITIES FUND EUR EUROBANK EFG (LF) EQUITY- EMERGING EUROPE FUND EUR EUROBANK EFG (LF) SPECIAL PURPOSE CLICK EUR EUROBANK EFG (LF) SPECIAL PURP DBLE CLICK EUR EUROBANK EFG (LF) SPECIAL PURP ALL WEATHER EUR EUROBANK EFG (LF) SPECIAL PURP ALL WEATHER PLUS EUR EUROBANK EFG I (LF) SPECIAL PURPOSE DUAL FORMULA EUR ΚΥΠΡΟY FUND OF FUNDS METOXIKO EUROBANK EFG (LF) SP 6% EQUITY FORMULA $ USD MILLENNIUM EUROZONE ΜΕΤΟΧΙΚΟ ΕΞ. MILLENNIUM AMERICA US ΜΕΤΟΧΙΚΟ ΕΞ. MILLENNIUM CHINA GROWTH ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ MARFIN EUROPEAN EQUITY ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ MARFIN GLOBAL ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ HSBC AMERICAN EQUITY ΜΕΤ. ΕΞΩΤ. HSBC ΑΝΑΔΥΟΜΕΝΩΝ ΑΓΟΡΩΝ ΜΕΤ.ΕΞΩΤ. HSBC ΠΑΝΕΥΡΩΠΑΙΚΟ ΜΕΤ.ΕΞΩΤ. ING Α/Κ GLOBAL ΜΕΤ.ΕΞ. ΠΕΙΡΑΙΩΣ BALKAN FUND ΜΕΤΟΧΙΚΟ ΕΞΩΤΕΡΙΚΟΥ PIRAEUSINVEST EUROPEAN EQUITY FUND (EUR) Τ.Τ. ΕΛΤΑ ΟΙΚΟΛΟΓΙΚΟ ΜΕΤΟΧΙΚΟ ΕΞΩΤ.

ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΑΘΕΣΙΜΩΝ Α/Κ ΕΣΩΤΕΡΙΚΟΥ AAAB ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤ. ALICO ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤΕΡΙΚΟΥ ALLIANZ ΒΡΑΧ/ΣΜΩΝ ΕΠΕΝΔ.ΔΙΑΧ. ΔΙΑΘ.ΕΣΩΤ. ΑLPHA ΔΙΑΧΕΙΡ.ΔΙΑΘΕΣΙΜΩΝ ΕΣ. ΑΤΕ ΔΙΑΧΕΙΡ. ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤ. ΑΤΤΙΚΗΣ ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΑΘΕΣΙΜΩΝ CITI FUND ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤΕΡΙΚΟΥ GENIKI ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤΕΡΙΚΟΥ INTERAMERICAN ΔΙΑΧ. ΔΙΑΘ. ΕΣ. INTERNATIONAL ΔΙΑΧ.ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤ. ΕΡΜΗΣ ΒΡΑΧ/ΣΜΩΝ ΤΟΠΟΘΕΤΗΣΕΩΝ ΔΙΑΧ.ΔΙΑΘ.ΕΣ. MARFIN SMART CASH ΔΙΑΧ.ΔΙΑΘ. HSBC ΔΙΑΘΕΣΙΜΩΝ ΕΣΩΤΕΡΙΚΟΥ ΚΥΠΡΟΥ ΕΛΛΗΝΙΚΟ ΔΙΑΧ.ΔΙΑΘ.ΕΣΩΤ. ING Α/Κ Δ.Δ. ΕΣΩΤ. ΠΕΙΡΑΙΩΣ Α/Κ Δ.Δ. ΕΣΩΤ. PROBANK ΔΙΑΧΕΙΡΙΣΗΣ ΔΙΑΘΕΣΙΜΩΝ ΕΣ. MILLENNIUM ΒΡΑΧ/ΣΜΩΝ ΤΟΠΟΘΕΤ.ΔΙΑΧ.ΔΙΑΘ.ΕΣ. Τ.Τ. ΕΛΤΑ ΔΙΑΧ/ΣΗΣ ΔΙΑΘ/ΜΩΝ ΕΣΩΤ.

12,824,663.68 26,010,354.88 7,361,846.37 273,668,136.15 11,034,530.76 2,967,923.06 3,773,702.88 7,934,424.82 58,844,352.83 4,515,615.08 81,226,569.63 221,671,034.32 201,736,040.52 7,766,242.63 12,749,374.59 33,600,128.93 4,847,876.41 13,359,274.99 128,151,150.89

6.558 12.488 5.823 11.084 6.913 3.612 6.746 5.519 7.424 5.949 3.272 3.913 1.909 4.669 5.360 5.335 3.553 8.332 2.325

6.414 12.240 5.764 11.084 6.913 3.594 6.746 5.464 7.380 5.904 3.272 3.874 1.909 4.622 5.360 5.335 3.535 8.006 2.325

6.545 12.364 5.823 11.084 6.913 3.608 6.746 5.519 7.417 5.934 3.272 3.894 1.909 4.669 5.360 5.335 3.553 8.169 2.325

0.01% -0.02% -0.12% 0.02% -0.13% -0.07% -0.01% -0.07% -0.01% 0.04% -0.01% -0.11% 0.01% 0.01% 0.01% -0.04% 0.01% -0.02% 0.01%

0.55% 0.33% -0.42% 0.42% 0.13% -0.21% 0.37% -0.07% 0.42% 2.42% 0.11% 0.02% 0.67% 0.61% 0.39% -0.01% 0.14% 0.17% 0.79%

76,267,105.63 36,303,468.30 41,713,528.42 1,500,960.05 52,254,415.71

11.642 11.602 1.102 1.102 1.050

11.642 11.602 1.102 1.102 1.050

11.642 11.602 1.102 1.102 1.050

0.00% 0.00% 0.01% 0.00% -0.26%

0.06% 0.22% 0.30% 0.31% -0.14%

2,155,008.25 2,010,734.39 1,216,850.72 14,278,144.09 46,458,745.51 92,647,012.40 28,888,450.09 12,714,173.40 3,905,875.75 5,447,542.80 663,918,491.20 31,991,687.10 5,678,783.15 73,844,452.95 28,074,428.49 12,894,147.66 12,616,208.05 9,312,985.57 25,006,521.61 4,143,256.72 44,584,676.87 8,699,202.47 42,491,592.05 15,930,585.93 15,120,773.33 964,340.44 1,235,778.32 13,836,169.61 4,175,811.53 3,499,688.09 981,468.23 15,823,348.20 2,273,580.65

5.878 11.946 10.090 10.993 8.262 8.731 11.069 10.251 9.709 9.588 4.534 3.505 6.482 14.495 5.288 10.212 9.804 3.209 7.316 1.995 15.523 5.818 8.971 3.209 3.089 8.117 8.294 3.411 3.062 7.038 2.187 2.294 9.015

5.542 11.264 9.793 10.515 7.790 8.559 10.850 9.974 9.446 9.375 4.534 3.470 6.322 14.350 5.236 10.110 9.804 3.177 7.032 1.847 15.215 5.486 8.816 3.162 3.028 7.956 8.129 3.377 2.883 6.696 2.167 2.288 9.015

5.598 11.377 9.892 10.621 7.869 8.645 10.959 10.075 9.542 9.469 4.534 3.505 6.386 14.495 5.288 10.212 9.804 3.209 7.103 1.847 15.369 5.541 8.816 3.162 3.058 8.036 8.212 3.411 2.973 6.833 2.176 2.294 9.015

-0.58% -1.40% -0.58% -1.05% -1.39% -0.97% -0.73% -1.36% -1.14% -1.45% -1.13% -0.40% -1.23% -1.35% -0.60% -0.47% -0.75% -0.54% -1.48% -1.65% -1.00% -1.11% -0.22% -1.43% -1.33% -1.37% -1.43% -0.93% -0.53% -1.41% -1.40% -0.75% -1.16%

-11.04% -8.35% 1.22% -7.84% -8.87% -5.44% -4.44% -5.70% -4.59% -6.04% -5.07% -3.76% -5.95% -4.88% -2.37% -2.79% -4.40% -3.19% -6.40% -6.96% -7.19% 1.30% -1.55% -7.60% -7.57% -6.01% -6.07% -5.43% -0.92% -6.62% -6.96% -3.15% -5.85%

21,184,377.19 6,649,945.23 4,209,308.77 2,777,413.70 2,021,767.83 17,590,283.35 66,756,200.05 37,695,956.71 24,082,531.19 38,798,661.85 2,177,807.17 16,679,757.03

19.183 12.094 12.297 11.705 5.818 7.751 10.709 6.316 2.904 10.478 3.891 2.799

18.087 11.288 11.477 10.925 5.647 7.598 10.497 6.253 2.833 10.426 3.704 2.744

18.269 11.518 11.711 11.147 5.704 7.674 10.603 6.316 2.862 10.478 3.741 2.771

-0.38% -0.26% -0.26% -0.42% -0.20% -0.66% -0.06% -0.07% -0.41% -0.09% 0.17% -0.05%

2.69% 1.24% 1.21% 2.35% 4.88% 19.23% 1.91% 2.91% 1.56% 4.22% 15.49% 0.77%

ΕΞΩΤΕΡΙΚΟΥ

ΕΣΩΤΕΡΙΚΟΥ AAAB ΕΠΙΛΕΓΜΕΝΩΝ ΜΕΤΟΧΩΝ ΕΣΩΤ. ALICO ΜΕΤ.ΕΣΩΤ. ΜΕΣΑΙΑΣ & ΜΙΚΡΗΣ ΚΕΦΑΛΑΙΟΠΟΙΗΣΗΣ ALICO INDEX FUND FTSE20 ΜΕΤΟΧΙΚΟ ΕΣ. ALICO ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ALLIANZ ΕΠΙΘΕΤΙΚΗΣ ΣΤΡΑΤ.ΜΕΤ.ΕΣ. ALLIANZ ΜΕΤΟΧΩΝ ΕΣΩΤΕΡΙΚΟΥ ΑLPHA BLUE CHIPS ΜΕΤΟΧΙΚΟ ΕΣ. ALPHA ΜΕΤΟΧΙΚO ΕΣΩΤΕΡΙΚΟΥ ALPHA ATHENS INDEX FUND ΜΕΤ.ΕΣ. ALPHA ΕΠΙΘΕΤΙΚΗΣ ΣΤΡΑΤΗΓΙΚΗΣ ΜΕΤΟΧΙΚΟ ΕΣ. ALPHA ETF FTSE ATHEX 20 ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ALPHA TRUST ΑΝΑΠΤΥΞΙΑΚΟ ΜΕΤ.ΕΣ. ALPHA TRUST ΝΕΩΝ ΕΠΙΧ.ΜΕΤΟΧ.ΕΣ. GENIKI ΕΠΙΛΕΓΜΕΝΩΝ ΑΞΙΩΝ ΜΕΤ. ΕΣΩΤ. ALPHA TRUST OPPORTUNITIES ΜΕΤ. ΕΣΩΤ. CITI FUND ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ATE ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ATE ΜΕΤΟΧΙΚΟ ΜΕΣΑΙΑΣ-ΜΙΚΡΗΣ Κ/ΣΗΣ ΕΣΩΤ. ΑΤΤΙΚΗΣ ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ATTICA MARATHON ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ΔΗΛΟΣ SMALL CAP ΜΕΤΟΧΙΚΟ ΕΣ. ΔΗΛΟΣ BLUE CHIPS ΔΗΛΟΣ TOP-30 NBGAM ETF ΓΕΝΙΚΟΣ ΔΕΙΚΤΗΣ Χ.Α.- ΜΕΤΟΧΙΚΟ ΕΣΩΤ. NBG HELLENIC ALLSTARS - CLASS A (EUR) NBG HELLENIC ALLSTARS - CLASS B (EUR) ΕΛΛΗΝΙΚΗ TRUST ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ ΕΡΜΗΣ ΔΥΝΑΜΙΚΟ ΕΡΜΗΣ ΠΡΩΤΟΠΟΡΟΣ ΕΥΡΩΠΑΙΚΗ ΠΙΣΤΗ ΑΝΑΠΤΥΞ.(ΜΕΤ.ΕΣΩΤ.) EUROBANK GREEK EQUITIES ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ EUROBANK ΘΕΣΜΙΚΩΝ ΧΑΡΤΟΦΥΛΑΚΙΩΝ ΜΕΤ. ΕΣ. INTERAMERICAN ΔΥΝΑΜΙΚΟ ΜΕΤΟΧΙΚΟ ΕΣ. INTERAMERICAN ANAΠΤΥΣΣΟΜΕΝΩΝ ΕΤΑΙΡΙΩΝ ΜΕΤ.ΕΣ. EUROBANK EFG (LF) EQUITY-GREEK EQUITIES FUND EUR EUROBANK EFG (LF) EQUITY-INSTITUTIONAL PORT EUR EUROBANK EFG I (LF) SPECIAL PURP BLUE CHIPS P EUR EUROBANK EFG I (LF) SP PURP BLUE CHIPS P II EUR EUROBANK EFG I (LF) SP PURP BLUE CHIPS III PROTECT EUR EUROBANK EFG (LF) EQUITY - FLEXI STYLE GREECE EUR EUROBANK EFG (LF) SPECIAL PURPOSE GREEK MAX 50 EUR INTERAMERICAN (LF) SPECIAL PURPOSE GREEK MAX 50 EUR INTERNATIONAL ΜΕΤΟΧΙΚΟ ΕΣΩΤΕΡΙΚΟΥ INTERNATIONAL EΠΙΛΟΓΗΣ ΜΕΤΟΧΙΚΩΝ ΑΞΙΩΝ ΜΕΤ.ΕΣ. ΚΥΠΡΟΥ ΕΛΛΗΝΙΚΟ ΜΕΤΟΧΙΚΟ ΕΣΩΤ. ΚΥΠΡΟΥ ΕΛΛΗΝΙΚΟ ΔΥΝΑΜΙΚΟ ΜΕΤ.ΕΣ. MARFIN ΟΛΥΜΠΙΑ METOXIKO ΕΣΩΤΕΡΙΚΟΥ MARFIN ΑΘΗΝΑ ΔΥΝΑΜΙΚΟ ΜΕΤΟΧΩΝ ΕΣΩΤΕΡΙΚΟΥ HSBC ΑΝΑΠΤΥΞΙΑΚΟ ΜΕΤΟΧΩΝ ΕΣΩΤ. HSBC TOP 20 ΜΕΤΟΧΩΝ ΕΣΩΤ. HSBC ΜΕΣΑΙΑΣ ΚΕΦΑΛ.ΜΕΤ.ΕΣΩΤ. ING Α/Κ ΔΥΝΑΜ.ΕΠΙΧ. ΜΕΤ. ΕΣΩΤ. ING Α/Κ ΜΕΤΟΧΙΚΟ ΕΣΩΤ. ΠΕΙΡΑΙΩΣ Α/Κ ΔΥΝΑΜ.ΕΠΙΧ. ΜΕΤ. ΕΣΩΤ.

ΤΙΤΛΟΙ

ΔΗΛΟΣ MONEY PLUS ΔΙΑΧ.ΔΙΑΘ. ΕΞ. EUROBANK DOLLAR PLUS ΔΙΑΧ. ΔΙΑΘ. ΕΞΩΤ. (USD) EUROBANK EFG (LF) MONEY MARKET-INCOME PLUS$ USD EUROBANK EFG I(LF) MONEY MARKET INCOME PLUS $ USD EUROBANK EFG (LF) MONEY MARKET- CASH FUND EUR

ΜΙΚΤΑ Α/Κ ΕΣΩΤΕΡΙΚΟΥ AAAB ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ ALICO ΕΛΛΗΝΙΚΟ ΜΙΚΤΟ SOLIDUS MID RISK GREEK MUTUAL FUND-ΕΛΛΗΝΙΚΟ ΜΙΚΤΟ ALLIANZ MIKTO ΕΣΩΤΕΡΙΚΟΥ ALLIANZ MIKTO ΕΣΩΤ.(UNIT LINKED) ΑLPHA ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ ΑLPHA ΣΥΝΤΗΡΗΤΙΚΟ ΜΙΚΤΟ ΕΣ. ALPHA TRUST EUROSTAR ΜΙΚΤΟ ΕΣΩΤ. ΕΠΑΓΓΕΛΜΑΤΙΚΟ ΤΑΜΕΙΟ ΟΙΚΟΝΟΜΟΛΟΓΩΝ INTERLIFE ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ ΑΣΦΑΛΙΣΤΙΚΩΝ ΟΡΓΑΝΙΣΜΩΝ ΜΙΚΤΟ ΕΣΩΤ. ΑΤΕ ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ ΑΜΥΝΤΙΚΗΣ ΣΤΡΑΤΗΓΙΚΗΣ ΑΤΤΙΚΗΣ ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ ΔΗΛΟΣ ΜΙΚΤΟ ΔΗΛΟΣ ΣΥΛΛΟΓΙΚΟ ΔΗΛΟΣ ΕΠΙΚ/ΚΗΣ ΣΥΝΤΑΞΗΣ ΜΙΚΤΟ ΕΣΩΤ. ΔΗΛΟΣ ΤΑΚΤΙΚΗΣ ΚΑΤΑΝΟΜΗΣ ΚΕΦΑΛΑΙΩΝ ΔΗΛΟΣ ΠΕΤ ΟΤΕ ΜΙΚΤΟ ΕΣ. ΕΡΜΗΣ ΜΙΚΤΟ ΕΥΡΩΠ.ΠΙΣΤΗ EUROINVEST ΜΙΚΤΟ ΕΣ. INTERAMERICAN ΕΛΛΗΝΙΚΟ ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ INTERNATIONAL ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ HSBC ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ ING Α/Κ ΜΙΚΤΟ ΕΣΩΤ. ΠΕΙΡΑΙΩΣ Α/Κ ΜΙΚΤΟ ΕΣΩΤ. ΠΕΙΡΑΙΩΣ Α/Κ ΘΕΣΜΙΚΩΝ ΕΠΕΝΔΥΤΩΝ ΜΙΚΤΟ ΕΣΩΤ. ΠΕΙΡΑΙΩΣ Α/Κ ΑΣΦΑΛΙΣΤΙΚΩΝ ΦΟΡΕΩΝ ΜΙΚΤΟ ΕΣΩΤ. ΚΥΠΡΟΥ ΕΛΛΗΝΙΚΟ ΜΙΚΤΟ ΕΣΩΤ. MARFIN GREEK VALUE ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ PROTON ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ N.P. INSURANCE ΝΕΟΣ ΠΟΣΕΙΔΩΝ ΜΙΚΤΟ ΕΣΩΤΕΡΙΚΟΥ Τ.Τ. ΕΛΤΑ ΜΙΚΤΟ ΕΣΩΤ. Τ.Τ. ΕΛΤΑ ΘΕΣΜΙΚΩΝ ΕΠΕΝΔΥΤΩΝ ΜΙΚΤΟ ΕΣΩΤΕΡ.

ΕΞΩΤΕΡΙΚΟΥ ALICO MIKTO ΕΞΩΤΕΡΙΚΟΥ ALICO ΕΠΙΚΟΥΡΙΚΟ ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ ΕΠΙΚΟΥΡΙΚΗΣ ΑΣΦΑΛΙΣΗΣ MIKTO ΕΞΩΤΕΡΙΚΟΥ ΑΛΛΗΛΟΒΟΗΘΕΙΑΣ MIKTO ΕΞΩΤΕΡΙΚΟΥ BETA GLOBAL MIKTO ΕΞΩΤΕΡΙΚΟΥ ALPHA ΡΟΥΜΑΝΙΑΣ ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ ALPHA GLOBAL ΣΥΝΤΗΡΗΤΙΚΟ ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ ATE ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ ΑΤΤΙΚΗΣ ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ ΔΗΛΟΣ ΣΤΡΑΤΗΓΙΚΩΝ ΤΟΠΟΘΕΤΗΣΕΩΝ ΜΙΚΤΟ ΕΞΩΤ. INTERNATIONAL ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ MARFIN ABSOLUTE RETURN ΜΙΚΤΟ ΕΞΩΤΕΡΙΚΟΥ

Επιδότηση συσκευών από Κωτσόβολο Περισσότερες από 180.000 συσκευές έχουν ανακυκλωθεί από το πρόγραμμα απόσυρσης και ανακύκλωσης των παλαιών ηλεκτρικών συσκευών της αλυσίδας ηλεκτρικών και ηλεκτρονικών συσκευών Κωτσόβολος. Το πρόγραμμα έχει συμπληρώσει δύο χρόνια ζωής και η Κωτσόβολος ενισχύει την προσπάθεια ανακύκλωσης παρέχοντας νέα κίνητρα στους καταναλωτές. Μέχρι τις 17 Απριλίου η Κωτσόβολος αναλαμβάνει να παραλάβει δωρεάν οποιαδήποτε παλιά ηλεκτρική συσκευή επιδοτώντας με ποσό έως και 600 ευρώ την αγορά καινούργιας κουζίνας, πλυντηρίου, ψυγείου και κλιματιστικού. «Είμαστε εξαιρετικά ικανοποιημένοι με την ανταπόκριση των καταναλωτών και των πολιτών στο πρόγραμμά μας», δήλωσε ο managing director της DSGi Ελλάδος, Κρις Μάθιους.

∆ιάκριση για τον MLS Destinator Talk&Drive Τον τίτλο του Product of the Year 2009 κέρδισε το σύστημα πλοήγησης MLS Destinator Talk&Drive της MLS Πληροφορική, στο διαγωνισμό για τα καλύτερα προϊόντα και τεχνολογίες της ελληνικής αγοράς, Tech Excellence Awards, που διοργανώνουν τα περιοδικά “PC Magazine” και “Τ3”. Η ανάδειξη έγινε με on line ψηφοφορία με τη συμμετοχή χιλιάδων καταναλωτών τον Ιανουάριο και το Φεβρουάριο του 2010. Η MLS βραβεύεται για δεύτερη συνεχή χρονιά, καθώς στον εν λόγω διαγωνισμό Product of the Year 2008 είχε αναδειχθεί το σύστημα MLS Destinator 4800A. Επίσης, το 1998 η MLS τιμήθηκε πρώτη και μόνη ελληνική εταιρία έως σήμερα- με το Χρυσό Πανευρωπαϊκό Βραβείο Τεχνολογίας, το οποίο συνοδεύτηκε με χρηματικό έπαθλο 200.000 ευρώ.


40

Πέµπτη 15 Απριλίου 2010

µας άρεσε

ΜΟΥΣΙΚΗ

|

ΘΕΑΤΡΟ

| ΧΟΡΟΣ

|

ΚΙΝΗΜΑΤΟΓΡΑΦΟΣ

|

ΕΙΚΑΣΤΙΚΑ

Αναζητήσεις στο «Κενό» Την παράσταση «Κενό. Κοινό. Καινό» παρουσιάζουν ο «Πολυχώρος Πείραμα» και το «Θέατρο Αναζήτησης». Ηρωες του έργου μία όμορφη και πλούσια γυναίκα που χάνεται στις αναμνήσεις της, μία Εβραία παντρεμένη με Γερμανό που επιχειρεί να αποδράσει στο εξωτερικό παραμονές του Β’ Παγκόσμιου Πολέμου, ένας μοναχικός ηλικιωμένος στη Νέα Υόρκη που περιμένει την έξωση από το διαμέρισμά του. Τι

είναι αυτό που συνδέει όλα αυτά τα πρόσωπα μεταξύ τους; Το έργο αποτελεί μια πρωτότυπη σύνθεση κειμένων, εικόνων, ήχων, μουσικής, θεάτρου, βίντεο και τεχνικών τσίρκου που επιμελήθηκε ο σκηνοθέτης και ηθοποιός, Αχιλλέας Ψαλτόπουλος. Παραστάσεις έως 2 Μαΐου κάθε Πέμπτη, Παρασκευή, Σάββατο, στις 21.15 και Κυριακή στις 20.00, στον «Πολυχώρο Πείραμα» (Βαλαωρίτου 18, 7ος όροφος).

Το αντίο ενός «Σκορπιού» Συνέντευξη Τύπου του Κλάους Μάινε στη Θεσσαλονίκη ΤΟΥ ΑΛΕΞΑΝ∆ΡΟΥ ΣΑΛΑΜΕ asalames@ekdotiki.gr

Πρεμιέρα κάνει απόψε, στις 21.15 η παράσταση «Μόνοι μαζί» στο θέατρο «Σοφούλη»

Ενας ύµνος στη φιλία Δύο πρώην τρόφιμοι της Πρόνοιας προσπαθούν να αποδείξουν ότι μπορούν να ζήσουν ανεξάρτητοι, προκειμένου να κερδίσουν την ελευθερία τους. Βάζουν λοιπόν τα δυνατά τους. Ελα, όμως, που μία βόλτα για τα ψώνια της μέρας δεν είναι απλή υπόθεση για έναν αγοραφοβικό, ενώ δεν προτιμούν όλοι το κρεβάτι από την... ντουλάπα για να πάρουν έναν υπνάκο. Ο Λευτέρης Γοβανίδης και ο Φώτης Σπύρος μετέφρασαν και διασκεύασαν το νορβηγικό έργο «Μόνοι μαζί» (πρωτότυπος τίτλος: «Βrodre i blodet» που σημαίνει «Αίμα στο χιόνι») του Ingvar Ambjonsen και το ανεβάζουν από σήμερα στο θεάτρο «Σοφούλη», σε μία παράσταση «που φτιάξαμε ειδικά για εδώ, για το κοινό της Θεσσαλονίκης. Δεν ξέρουμε καν αν θα τη μεταφέρουμε αργότερα στην Αθήνα ή κάπου αλλού», τόνισε στη χτεσινή συνέντευξη τύπου ο Φώτης Σπύρος. «Η αρχική μορφή του έργου ήταν μυθιστόρημα. Πρώτα

μεταφέρθηκε στη μεγάλη οθόνη -μάλιστα είχε κερδίσει το Οσκαρ ξενόγλωσσης ταινίας- και αργότερα διασκευάστηκε για το θέατρο. Συγκινεί επειδή μιλά για τη δύναμη τη φιλίας, για την αλήθεια του ότι μόνο μέσα από το συνάνθρωπό μας μπορούμε να βρούμε λύση στα δικά μας προβλήματα», πρόσθεσε ο σκηνοθέτης της παράστασης. Πρόκειται για μια τρυφερή κωμωδία, με γλυκόπικρο χιούμορ, την οποία σκηνοθετεί ο Λευτέρης Γιοβανίδης, και στην οποία παίζουν οι Φώτης Σπύρος, Ιούλιος Τζιάτας, Μαίρη Ανδρέου και Δημήτρης Παλαιοχωρίτης. Το έργο παρουσιάζεται σε πανελλήνια πρώτη και αποτελεί μία παραγωγή του θεάτρου «Σοφούλη». Παραστάσεις: 15-20 και 26-27 Απριλίου, καθώς και κάθε Κυριακή, Δευτέρα και Τρίτη μέχρι το τέλος του Μαΐου. Ωρες παραστάσεων: καθημερινές 21.15, Κυριακή στις 20.00. Χ. Σ.

Δεκάδες δημοσιογράφοι έδωσαν το «παρών» χτες στη μία το μεσημέρι σε κεντρικό ξενοδοχείο της Θεσσαλονίκης, προκειμένου να παραστούν στη συνέντευξη Τύπου που παραχώρησε ο «ηγέτης» ενός εκ των θρυλικότερων ροκ συγκροτημάτων όλων των εποχών. Η μία ώρα που διατέθηκε αποδείχτηκε πολύ λίγη μπροστά στη σωρεία των ερωτήσεων που προέκυψαν.

Κ

εντρικό θέµα, η απόφαση του συγκροτήµατος να αποσυρθεί από την ενεργό δράση τη συγκεκριµένη χρονική περίοδο. «Η ιδέα να αποσυρθούµε ήταν του µάνατζέρ µας, καθώς, όπως µας εξήγησε, ύστερα από έναν τόσο σπουδαίο δίσκο όπως ο τελευταίος µας “Sting in the Tail” και µια τόσο µεγάλη περιοδεία θα ήταν πολύ δύσκολο να φτάσουµε στα ίδια στάνταρ. Και συµφωνήσαµε. Οταν θα τελειώσει αυτή η περιοδεία, οι περισσότεροι θα είµαστε πάνω από εξήντα. Καλό είναι να στραφούµε προς νέους ορίζοντες», είπε ο Κλάους Μάινε. Ο τραγουδιστής των «Σκόρπιονς», όµως, δεν απέκλεισε την ηχογράφηση ενός προσωπικού δίσκου αλλά ούτε και την κυκλοφορία ακυκλοφόρητου υλικού του συγκροτήµατος και ενός DVD από τις καλύτερες «ζωντανές» στιγµές του συγκροτήµατος. «Εχει µαζευτεί πολύ υλικό από συναυ-

Ο Κλάους Μάινε απάντησε με χαρά στις ερωτήσεις των δημοσιογράφων

λίες όπως η περσινή µας στο στάδιο Καραϊσκάκη µπροστά σε 40.000 κόσµο. Είναι πολύ σηµαντικό να γίνει ένα DVD για τους φαν µας». Προτροπή προς τους νεαρούς θαυµαστές του να αφήσουν τους υπολογιστές και τις παιχνιδοµηχανές και να πάρουν µια κιθάρα απηύθυνε ο Κλάους Μάινε σε παρότρυνση δηµοσιογράφων να δώσει µία συµβουλή… πλεύσης στους εκκολαπτόµενους τραγουδιστές. Συγκινητική ήταν και η δήλωση του εκπροσώπου του ελληνικού φαν κλαµπ του συγκροτήµατος, ο οποίος ευχαρίστησε τους «Σκόρπιονς» εκ µέρους

όλων των φίλων τους στην Ελλάδα για τις έντονες στιγµές που τους χάρισαν και µίλησε για τη δύσκολη θέση στην οποία βρίσκονται γνωρίζοντας ότι αυτή είναι η τελευταία περιοδεία του συγκροτήµατος. Ο Κλάους Μάινε µε τη σειρά του ευχαρίστησε το φαν κλαµπ για την ενεργή του στήριξη τονίζοντας ότι παρακολουθεί ανελλιπώς τις δράσεις τους. Η συνέντευξη Τύπου ολοκληρώθηκε µε την υπόσχεση του καλλιτέχνη για νέο ραντεβού το καλοκαίρι σε µια συναυλία για την οποία άφησε να εννοηθεί ότι θα είναι γεµάτη εκπλήξεις.


41 Πέµπτη 15 Απριλίου 2010

Σαξόφωνα εν δράσει

Με προβλήµατα αλλά και σχεδιασµό Δηλώσεις και προτεραιότητες του υπουργού Πολιτισμού και Τουρισμού Το 2012, που θα γιορταστούν τα εκατό χρόνια από την απελευθέρωση της Θεσσαλονίκης, «είναι μια μεγάλη ευκαιρία για συντονισμό των εποπτευόμενων φορέων της πόλης, που μάλιστα έχουν δυνατή φωνή».

Α

υτό δήλωσε χτες στους δηµοσιογράφους ο υπουργός Πολιτισµού και Τουρισµού, Παύλος Γερουλάνος. Οπως είπε, η φωνή των φορέων της Θεσσαλονίκης «δε χάνεται όπως στην Αθήνα, όπου επικρατεί χάος. Ετσι, θα κάνουµε ένα συντονισµό ώστε να µην πέφτουν ο ένας επάνω στον άλλον, αφήνοντας, όµως, µεγάλο δικό τους χώρο και ελευθερία για να κινηθούν». Το υπουργείο Πολιτισµού και Τουρισµού «σφίγγει τα ζωνάρια», αλλά ο υπουργός του συνεχίζει να ελπίζει ότι στον τριετή κυβερνητικό προγραµµατισµό ο προϋπολογισµός θα είναι «σταθερός ή ανερχόµενος». Για να το πετύχει κάνει επαφές µε τον υπουργό Οικονοµικών, αλλά και εξορθολογισµούς. Ζητά από τους εποπτευόµενους φορείς συγκεκριµένα πράγµατα. Από το διευθυντή του Εθνικού Θεάτρου, κ. Χουβαρδά, επί παραδείγµατι, ζήτησε συγκεκριµένο προϋπολογισµό. Πάντως, διέψευσε ότι δέχτηκε παραίτηση του διευθυντή του Εθνικού Θεάτρου. Αντίθετα, ανέφερε ότι κάνει διάλογο και ότι η ανανέωση της θητείας είναι µάλλον τυπική

Συντονισμό των φορέων της Θεσσαλονίκης ζητάει ο Παύλος Γερουλάνος για τον εορτασμό των εκατό χρόνων από την απελευθέρωση της πόλης

διαδικασία. Εξορθολογισµό έχει ζητήσει και από τον Οργανισµό Προβολής Ελληνικού Πολιτισµού,

Το «πορτρέτο» της πόλης στο «∆ίπολο» Οι παλιοί κινηματογράφοι «Πάνθεον» και «Ιλιον». Εικόνες από τρένα στο ύψος της γέφυρας Ξηροκρήνης. Η εκκλησία των 12 Αποστόλων. Πρόκειται για μερικές μόνο ψηφίδες από το «πορτρέτο» της πόλης που έρχεται να συμπληρώσει η πέμπτη κατά σειρά έκθεση με θέμα την αστική τοπιογραφία της Θεσσαλονίκης και τίτλο «Παραβαρδάρια περιοχή, Σιδηροδρομικός Σταθμός Θεσσαλονίκης», που εγκαινιάζεται σήμερα, από τις 19.00 μέχρι και τις 23.00, στον εκθεσιακό χώρο «Δίπολο» (Δ. Γούναρη 53, τηλ. 2310 200880). Οι επισκέπτες

θα έχουν την ευκαιρία να δουν 29 έργα -ποικίλων τεχνοτροπιών- των ζωγράφων Γ. Αδαμαντίδη, Σ. Ζαχαριάδη, Φ. Ζογλοπίτη, Ν. Θωμαΐδη, Β. Ιωαννίδη, Κ. Κουτρουμπή, Γ. Μαβίδη, Φ. Μάνου, Ντ. Παπασπύρου και Γ. Τσατσάγια. Το εγχείρημα για την προσπάθεια της αποτύπωσης της ταυτότητας της πόλης εικαστικά θα ολοκληρωθεί με τρεις ακόμα εκθέσεις. Η θεματολογία των επόμενων αυτών εκθέσεων θα αφορά θέματα όπως γενικές απόψεις της πόλης, παραδοσιακά και βιομηχανικά κτίσματα, μνημεία, σκηνές με ανθρώπους στην Παραλία, διάφορες περιοχές του περιαστικού χώρου. Το κοινό θα μπορεί να επισκέπτεται την έκθεση μέχρι και τις 30 Απριλίου, Τρίτη, Πέμπτη, Παρασκευή και Σάββατο 11.30-14.00 και Πέμπτη, Παρασκευή 18.30-20.30 (φωτογραφία από έργο του Β. Ιωαννίδη, που παρουσιάζεται στην έκθεση).

όπως και από το Ταµείο Αρχαιολογικών Πόρων και Απαλλοτριώσεων, µέχρι να δει αν θα συνενώσει τους δύο φορείς ή αν θα δηµιουργήσει νέο. Το Εθνικό Κέντρο Θεάτρου και Χορού ίσως οδεύει προς κατάργηση, αλλά οι επιχορηγήσεις θα εξακολουθήσουν να δίνονται. Μεγάλη σηµασία δίνει στο βυζαντινό πολιτισµό. Ο κ. Γερουλάνος εκφράζει το φόβο ότι οι Ελληνες «δεν τον αισθανόµαστε µέρος της κληρονοµιάς µας». Σκοπεύει να καταθέσει προτάσεις στην υπουργό Παιδείας για αλλαγή του τρόπου διδασκαλίας του, καθώς θεωρεί ότι είναι πολύ σηµαντικό να τον βάλουµε στο επίκεντρο της ζωής µας. Για το µεγάλο θέµα διεκδίκησης των Μαρµάρων του Παρθενώνα, ο κ Γερουλάνος είναι κατηγορηµατικός: πρέπει να συνεχίσουµε µε σύνεση και σοβαρότητα. Στη συνάντηση που θα γίνει την ερχόµενη εβδοµάδα στην UNESCO θα ακολουθήσουµε τη µέχρι σήµερα τακτική µας. Αλλά χρειάζεται ηρεµία. «Τώρα έρχονται οι Ολυµπιακοί του Λονδίνου», λέει. «Πολλά µπορούµε να κάνουµε. Σε καµιά περίπτωση δεν µπορούµε να µη δώσουµε την Ολυµπιακή Φλόγα. Αλλωστε, τη δίνουµε στη Διεθνή Ολυµπιακή Επιτροπή. Αλλά δεν είναι ώρα τώρα, που όλα τα βρετανικά µέσα ενηµέρωσης αναφέρονται στην Ελλάδα µε απαξιωτικό τρόπο, να ξεκινήσουµε µια βλακώδη συζήτηση. Θα έρθει η ώρα να ανεβάσουµε τη θερµοκρασία στο δωµάτιο». ΑΓΓΕΛΙΚΗ ΚΩΤΤΗ

«Εφυγε» στο σανίδι… Την Τρίτη το βράδυ η τύχη επιφύλαξε ένα άσχημο παιχνίδι σε μία από τις χαρακτηριστικότερες χροιές του σύγχρονου ελληνικού τραγουδιού. Ο Μάνος Ξυδούς έφυγε από τη ζωή αιφνίδια από ανακοπή καρδιάς, κατά τη διάρκεια πρόβας που πραγματοποιούσε με συνεργάτες του στο Νέο Φάληρο. Ο αγαπημένος τραγουδοποιός ένιωσε δυσφορία κατά τη διάρκεια της πρόβας, με αποτέλεσμα να κληθεί αμέσως ασθενοφόρο, το οποίο τον μετέφερε στο Τζάνειο, όμως ήταν αργά, καθώς εκεί απλώς διαπιστώθηκε ο θάνατός του. Ο Μάνος Ξυδούς, ο οποίος ήταν παντρεμένος με την αδερφή της γυναίκας του Φίλιππου Πλιάτσικα, άφησε σημαντικό καλλιτεχνικό έργο. Τελευταία του εμφάνιση στη Θεσσαλονίκη ήταν στην επανένωση των αδερφών Κατσιμίχα. Ο Χάρης Κατσιμίχας μάλιστα σε πρόσφατη συνέντευξή του τον χαρακτήρισε «πέρα από καλό συνεργάτη πάνω από όλα παλιό και καλό φίλο». Ο Μάνος Ξυδούς πέρα από το καλλιτεχνικό έργο που κατέθεσε και περιελάμβανε συνεργασίες με τους Βασίλη Παπακωνσταντίνου, αδερφούς Κατσιμίχα αλλά και δεκάδες νέα παιδιά, τους οποίους «τροφοδότησε» με τραγούδια βοηθώντας τους στο ξεκίνημά τους, είχε τη φήμη ενός από τους πιο ειλικρινείς καλλιτέχνες του χώρου. Χαρακτηριστική ήταν η δήλωσή του σε ερώτηση δημοσιογράφου που αφορούσε τη διάλυση των «Πυξ Λαξ», των οποίων ήταν ιδρυτικό μέλος: «Οταν συνειδητοποίησα ότι ό,τι κάνουμε το κάνουμε για τα χρήματα, πρότεινα στους άλλους να κάνουμε μια χάρη στον κόσμο και να τους αδειάσουμε τη γωνιά. Μπας και μείνει κάτι».

Η Ορχήστρα «Σαξοφωνία» από την Κύπρο και η Ορχήστρα Σαξοφώνων «Ku Klux Sax» συναντιούνται για μια διαφορετική, υπαίθρια συναυλία το Σάββατο 24 Απριλίου, στις 21:00, στην κεντρική πλατεία Θέρμης (Παραμάνα). Τριάντα μουσικοί θα ταξιδέψουν το κοινό με όχημα αγαπημένα τραγούδια. Η Ορχήστρα Σαξοφώνων «Σαξοφωνία» δημιουργήθηκε το 2007 στο πλαίσιο της ίδρυσης του Συνδέσμου Σαξοφώνων της Κύπρου ως πρωτοβουλία του Γιάννη Μυράλη. Τα μέλη της είναι επαγγελματίες σαξοφωνίστες με πλούσια και ποικιλόμορφη καριέρα στην Κύπρο και στο εξωτερικό, καθώς και ερασιτέχνες σαξοφωνίστες. Οι «Ku Klux Sax» συσπειρώθηκαν στις αρχές του 2008 με δημιουργό και συντονιστή της ορχήστρας το Θεόφιλο Σωτηριάδη. Ο όρος «Ku Klux» προέρχεται από την ελληνική λέξη «κύκλος». Το σύνολο απαρτίζει μια ανοιχτή κοινότητα περίπου 20-30 εθελοντών, με κοινό τους ενδιαφέρον την αγάπη τους για το σαξόφωνο. Η ορχήστρα, προσκεκλημένη ως άξια πρεσβευτής του δήμου Θέρμης, έχει λάβει μέρος σε φεστιβάλ και εκδηλώσεις που έλαβαν χώρα σε διάφορες πόλεις της επικράτειας, αλλά και στο εξωτερικό. Μεταξύ άλλων συμμετείχε στο 21ο διεθνές φεστιβάλ τζαζ του δήμου Θεσσαλονίκης και στις συναυλίες των Τσαρλς Λόιντ και «Club Des Belugas», αλλά και στον εορτασμό των 50 χρόνων του Φεστιβάλ Κινηματογράφου Θεσσαλονίκης.


ΣΙΝΕΜΑ

42

Πέµπτη 15 Απριλίου 2010

Γλιστρώντας στους ωκεανούς Το «Oceans» και οι άλλες νέες ταινίες που προβάλλονται στις αίθουσες ΚΡΙΤΙΚΗ: ΤΑΣΟΣ ΡΕΤΖΙΟΣ

Οταν τα πράγματα ζορίζουν, οι λύσεις συνήθως αναζητούνται στην απλότητα και τη φυσικότητα. Το «Oceans», ωστόσο, θα σας ψιθυρίσει ότι τίποτα δεν είναι όπως φαίνεται, ο Βιμ Βέντερς θα σας αποκαλύψει από τι υλικά είναι κατασκευασμένοι οι... «καταραμένοι» και μια Περουβιανή σκηνοθέτρια θα σας περιγράψει τι συμβαίνει όταν σου κλέβουν την ψυχή... Αν έχετε χρόνο, βέβαια, και δεν αναζητείτε πρώην...

Σκηνοθεσία: Ζακ Περίν, Ζακ Κλουζό

Γυρισµένο σχεδόν σε όλο τον κόσµο για χρόνια, µε πλάνα καµωµένα µε τα πιο σύγχρονα κι ευφάνταστα µέσα και µε άξονα το υγρό στοιχείο των απέραντων ωκεανών, οι δηµιουργοί του «Ταξιδιάρικα πουλιά» δίνουν στον κόσµο άλλη µια µεγάλη αίσθηση αυτού που πρώτος είχε επιχειρήσει πριν από πενήντα χρόνια ο Ζακ Ιβ Κουστό. Φάλαινες, δελφί-

«Αστραπή πάνω στο νερό» («Nick’s Film – Lightning Over Water») Σκηνοθεσία: Βιµ Βέντερς, Νίκολας Ρέι

Το πορτρέτο ενός σκηνοθέτη που πεθαίνει, από ένα μεγάλο θαυμαστή συνάδελφό του...

Η ΤΑΙΝΙΑ ΤΗΣ ΕΒ∆ΟΜΑ∆ΑΣ

«Oceans»

Μια φαντασμαγορική περιήγηση στον κόσμο των μεγάλων ωκεανών και των θαλάσσιων πλασμάτων που ζουν σ’ αυτούς...

Οταν ο Βιμ συνάντησε τον Νικ

νια, γιγάντια καλαµάρια και άλλα απόκοσµα πλάσµατα των βυθών, η θάλασσα σε όλες τις άγριες και όµορφες στιγµές της κι ένα διάχυτο ανησυχητικό µήνυµα ότι όλα αυτά βρίσκονται εν κινδύνω: η ταινία των Περίν, Κλουζό εντυπωσιάζει µε τον πλούτο των εικόνων της, αλλά δε διαθέτει µονάχα αυτό. Ο ρυθµός, τα πλάνα της και η µουσική που τα συνοδεύουν σε κάνουν να νοµίζεις σε κάποιες στιγµές ότι παρακολουθείς ταινία µυθοπλασίας ή και θρίλερ σε ορισµένες περιπτώσεις. Εξάλλου οι ωκεανοί δεν κρύβουν µονάχα εικόνες ανείπωτης οµορ-

Εικόνες σπάνιας ομορφιάς στο «Oceans»

φιάς, αλλά και ταραγµένες στιγµές, γεµάτες ένταση και αγριότητα. Αυτό, επίσης, που έχει σηµασία στο «Oceans» είναι ότι όλο αυτό γυρίζεται από ανθρώπους που λειτουργούν ως µέρος του κόσµου που κινηµατογραφούν. Σαν να έχουµε το βλέµµα ενός ακόµη

θαλάσσιου πλάσµατος, σαν να συνοµιλούµε µε το σιωπηρό ή τον υπερβολικά φλύαρο αυτόν κόσµο του βυθού. Μια ταινία που αφήνει ανοικτό το βλέµµα και σκαλίζει ανησυχητικά νου και ψυχή... Προβολή: «Village», «Πλατεία», «Ster Μακεδονία», «Ster City Gate»

Συγκινητική, ρέουσα και γεμάτη χυμούς αυτή η παρακαταθήκη που άφησε ο Βέντερς για ένα μεγάλο Αμερικανό σκηνοθέτη, μετά μάλιστα από επιθυμία του ίδιου. Δραματοποιημένα στην αρχή και ντοκιμαντερίστικα στη συνέχεια, ο Βέντερς παρακολουθεί το δημιουργό του «Επαναστάτη χωρίς αιτία» και του «Τζόνι Γκιτάρ» σε όλες του τις τελευταίες στιγμές: να σχεδιάζει πλάνα, να συζητάει και να καταβάλλεται από τον καρκίνο. Μια σπάνια στιγμή κινηματογραφικής ευλάβειας – μάθημα αγάπης και σινεμά... Προβολή: Μακεδονικόν «Το γάλα της θλίψης» («La Teta Asustada») Σκηνοθεσία: Κλαούντια Γιόσα Παίζουν: Μαγκαλί Σολιέ, Σουζί Σαντσέζ, Εφρέν Σολίς

ΠΑΙΖΟΝΤΑΙ ΑΚΟΜΗ «Παράνοια» («Crazies»)

«Επικηρύσσοντας την πρώην» («The Bounty Hunter»)

Σκηνοθεσία: Μπρεκ Αϊσνερ Παίζουν: Τίµοθι Ολιφαντ, Ράντα Μίτσελ, Τζο Αντερσον

Σκηνοθεσία: Αντι Τέναντ Παίζουν: Τζένιφερ Ανιστον, Τζέραρντ Μπάτλερ

Σκληρές περουβιανές ιστορίες Η Φάουστα δε θέλει να έχει την τύχη της μητέρας της, μιας ακόμη βιασμένης γυναίκας στις ανήσυχες στιγμές του Περού, αλλά ο φόβος τής τρώει τα σωθικά... Πώς να πέσετε στην «Παράνοια» Μια τοξίνη μετατρέπει τους κατοίκους μιας μικρής πόλης σε παρανοϊκούς δολοφόνους. Αμέσως μπαίνει σε καραντίνα, αλλά υπάρχουν ακόμη υγιείς κάτοικοι... Ο Τζορτζ Ρομέρο, που είχε γυρίσει το αρχικό φιλμ, έδινε πάντα μια σημειολογική διάσταση στις αιματοβαμμένες του ιστορίες, που τις έκαναν να ξεχωρίζουν από το σωρό. Εδώ, πέρα από τη μάλλον χοντροκομμένη υπενθύμιση ότι το κακό κρύβεται κάτω από τις ειδυλλιακές καταστάσεις, δύσκολα μπορεί να φύγει η σκέψη σου από το ότι βλέπεις ένα ακόμη κλασικά γραμμικό φιλμ τρόμου... Προβολή: «Village», «Ster Μακεδονία», «Ster City Gate»

Ενας κυνηγός επικηρυγμένων βρίσκεται στη θέση να καταδιώκει την πρώην του, ενώ ξαφνικά μπλέκει και με σοβαρότερα θέματα... Τι περιμένεις από τέτοιες ταινίες; Να μη βαρεθείς βασικά, να έχει κάποιο ρυθμό η μπαλαφάρα και οι ατάκες να έχουν πρωτοτυ-

Μπάτλερ - Ανιστον σε κυνηγητό πία, χιούμορ, ευφυΐα. Αντε και να χαρείς του ακκισμούς του σταρ ζευγαριού. Σχεδόν τίποτα απ’ αυτά δε συμβαίνει εδώ, αλλά παραδόξως κάθεσαι μέχρι το τέλος. Μην είναι ο έρωτας που φτιάχνει και κινηματογραφική χημεία; Λέμε τώρα... Προβολή: «Village», «Πλατεία», «Ster Μακεδονία», «Ster City Gate»

Η Γιόσα κέρδισε τη Χρυσή Αρκτο στο Βερολίνο μ’ αυτήν την ταινία και συγκίνησε αρκετούς. Κινούμενη ανάμεσα στο μαγικό ρεαλισμό και τη σκληρή αποτύπωση μιας κοινωνίας που κυριαρχείται από φόβο καταφέρνει και στήνει μια πειστική κινηματογραφική διαμαρτυρία. Από την άλλη διηγείται μια ιστορία γεμάτη συγκίνηση, αλλά και απόγνωση, με κάτι που θα μπορούσες να το δεις και ως ένα πικρό χαμόγελο απέναντι σε μια σκληρή ζωή... Προβολή: «Ολύμπιον»


43 Πέµπτη 15 Απριλίου 2010

η Νέα Υόρκη με Εφτασε το 2008 στ ένα αφικές μηχανές και παρέα δύο φωτογρ υ το ξη ρι τή οσ ε την υπ σημειωματάριο. «Μ ιόχιλ 4 .99 16 α ησ ήγ , οδ Ιδρύματος Fulbright λιΠο , διασχίζοντας 27 μετρα σε 61 ημέρες 4 λεις, 9 εθνικά πάρκα, τείες, 35 μεγάλες πό τό, αυ ι ξίδ σσες. Με το τα ερήμους και 3 θάλα ήντ να συ καιρία να με είχα τη μοναδική ευ ο λύ καιρό», θυμάται πο ό απ σω ξανά μετά ρα τε γό αρ ια όν . Δύο χρ Γιώργης Γερόλυμπος ει ιάσ υσ ρο πα να για του, ανοίγει το άλμπουμ θεση φωτογραφίας ένα μέρος του σε έκ ρυσ. Σμύρνης 13). Η στην γκαλερί TinT (Χ 1.2. d Trip USA. 16994.6 έκθεση με τίτλο «Roa ιο αίσ πλ ο στ 24 Απριλίου » εγκαινιάζεται στις κα ει εύ ξιδ τα ί 2010. «Γιατ της Photobiennale τις ι ίσε σχ δια θρωπο να νείς; Τι ωθεί έναν άν ως από τον ένα ωκεανό ς είε λιτ Πο Ηνωμένες νη καλλιτέχνης. «Η μό τον άλλο;», γράφει ο ηείναι η παρακολούθ ειλικρινής απάντηση ιντ μα των σπουδών, ση , ση, κατά τα χρόνια να μέ ό απ υ, πολύ πριν κών φωτογράφων πο με ι κα ρα χώ απέραντη ταξίδεψαν αυτή την ικό ρφωσαν, σε σημαντ μό δια τις εικόνες τους Θα ο. σμ κό ν το ω υ βλέπ βαθμό, τον τρόπο πο , υς λο ιτέ επ α, σκ ρι θα έβ παρέμενα θεατής ή άξω;». το θάρρος να το πρ

τρα ε µ ιό ιλ χ 0 0 .0 7 1 . .. ν α Ούτε κ

«Stand up Comedy» για τολµηρούς θεατές Μέχρι τα τέλη Μαΐου συνεχίζονται οι παραστάσεις «Stand Up Comedy» στο «Θέατρο Φλέμιγκ» (Μισραχή 15). Παίρνουν μέρος οι ηθοποιοί Μαρία Τουμπέλη, Χριστίνα Χριστοφή και Στέλιος Χαρίτος. Στη Stand Up Comedy όλα γεννιούνται εκείνη τη συγκεκριμένη στιγμή επί σκηνής γι’ αυτό πολλές φορές συμβαίνει να υπάρχουν μεγάλες ανατροπές του βασικού καμβά-σεναρίου από παράσταση σε παράσταση. Τη διαφορά σε κάθε παράσταση κάνουν οι…θεατές. Οι τρεις ηθοποιοί, με τη σκηνοθετική καθοδήγηση του Γρηγόρη Μήττα, συνομιλούν με το κοινό, αναμετριούνται με τον εαυτό τους, εξομολογούνται και σοκάρουν. Παραστάσεις δίνονται κάθε Σάββατο (22.00). Επίσης, η Παιδική Σκηνή του Θεάτρου Φλέμιγκ θα συνεχίσει κάθε Κυριακή (11.30) τις παραστάσεις του έργου της Καρίνας Ιωαννίδου «Ο ζωηρούλης πίθηκος» σε σκηνοθεσία, σκηνικά και κοστούμια Γρηγόρη Μήττα. Η μουσική είναι της Εύης Σωτηροπούλου, οι χορογραφίες των Γρηγόρη Μήττα και Φωτεινής Ευαγγελοπούλου. Παίρνουν μέρος οι: Αμαλία Κωνσταντινίδου, Ρόζα Παναγιωτάκη, Στέργιος Σουγιουλτζής, Αλέξανδρος Πόπης, Χρύσα Παπαδοπούλου. Πληροφορίες - κρατήσεις για τις παραστάσεις στο τηλ.: 2310/812000.

Ο Τζον Μάλκοβιτς... κατά συρροήν δολοφόνος Εναν κατά συρροή δολοφόνο πρόκειται να υποδυθεί ο ηθοποιός Τζον Μάλκοβιτς στη σκηνή του Κέντρου Πολιτισμού «Ελληνικός Κόσμος», στην Αθήνα, στις 25 και 26 Μαΐου. Ο Τζον Μάλκοβιτς πρωταγωνιστεί στην «Κολασμένη κωμωδία», μια μουσική παράσταση του Μάικλ Στούρμινγκερ, με θέμα την αυτοβιογραφία ενός συγγραφέα - δημοσιογράφου, αγαπημένου της βιεννέζικης ελίτ που κατηγορήθηκε για μία σειρά δολοφονιών. Το διάσημο ηθοποιό θα συνοδεύσει η Ορχήστρα της Ακαδημίας της Βιέννης, σε έργα Μπετόβεν, Βιβάλντι, Γκλουκ, Μότσαρτ, Βέμπερ. Στην Αθήνα θα βρεθούν το Μάιο και οι Ρόμπερτ Γου-

ίλσον και Στίβεν Μπέρκοφ. Ο Ρόμπερτ Γουίλσον σκηνοθετεί και ερμηνεύει το έργο του Σάμιουελ Μπέκετ «Τελευταία μαγνητοταινία του Κραπ», στις 8 και 9 Μαΐου, στον «Ελληνικό Κόσμο». Ο Στίβεν Μπέρκοφ μεταφέρει την προσωπική του λονδρέζικη επιτυχία «Οι κακοί του Σαίξπηρ», ερμηνεύοντας και σχολιάζοντας επί σκηνής τους μοχθηρούς χαρακτήρες στα κείμενα του μεγάλου Ελισαβετιανού δραματουργού, στις 18, 19 και 20 Μαΐου στο θέατρο του Ιδρύματος «Μιχάλης Κακογιάννης». Και οι τρεις καλλιτέχνες είναι προσκεκλημένοι της Αττικής Πολιτιστικής Εταιρίας και του φεστιβάλ «Θέατρο Πέρα από τα Ορια».

Η Βάλια Κάλντα και τα µυστικά της Την Τρίτη 27 Απριλίου (20.00), στον «Ιανό» (Αριστοτέλους 7), ο πρόεδρος της περιβαλλοντικής οργάνωσης για την Προστασία της άγριας ζωής «Εταιρεία Προστασίας Βάλια Κάλντα», Απόστολος Διανέλλος, παρουσιάζει το βιβλίο του «Βάλια Κάλντα. Διαδρομή ερμηνείας της φύσης». Στο βιβλίο παρουσιάζονται με κείμενα και φωτογραφίες πολλά από τα είδη της χλωρίδας και της πανίδας της πεζοπορικής διαδρομής Κοιλάδα - Αρκουδόρεμα με στόχο την ενημέρωση των επισκεπτών για τη βιοποικιλότητα του Εθνικού Δρυμού. Το βιβλίο απευθύνεται σε επιστήμονες, σε επισκέπτες και σε όποιον επιθυμεί να μυηθεί στα μυστικά της άγριας ζωής.

ΠΕΡΙ ΟΝΟΥ ΣΚΙΑΣ

∆ιττή ανθρώπινη φύση Οι βρικόλακες είναι μυθικά όντα, δημιουργήματα της λαϊκής φαντασίας, που στην ελληνική παράδοση έχουν ποικίλα χαρακτηριστικά, αλλά και ονομασίες: βουρβούλακες, βρικολάκιους, καταχανάδες ή τυμπανιαίοι, γιατί είναι φουσκωμένοι από το αίμα των ανθρώπων που έχουν πιει. Σ’ αντίθεση με τις ελληνικές δοξασίες, που τους θέλει να κυκλοφορούν την ημέρα, αλλά να φοβούνται το νερό και ιδιαίτερα το θαλασσινό, στον ΤΟΥ ΑΧΙΛΛΕΑ ΨΑΛΤΟΠΟΥΛΟΥ υπόλοιπο κόσμο πιachillespsalt@hotmail.com στεύεται ότι μένουν στους τάφους τους κατά τη διάρκεια της ημέρας και βγαίνουν απ’ αυτούς μόλις νυχτώσει, εξαιτίας της καταστροφικής αδυναμίας που έχουν απέναντι στο ηλιακό φως. Στη λογοτεχνία έγιναν πολύ δημοφιλείς από τα μυθιστορήματα «Δράκουλας» του Μπραμ Στόκερ (1897), «Βαμπίρ» του Τζον Πολιντόρι και «Καμίλα» του Λε Φανού. Ο μαθηματικός Γκρέγκορι Αλστον απέδειξε βεβαίως μ’ έναν ενδιαφέροντα όσο και απλό μαθηματικό συλλογισμό ότι δεν μπορεί να υπάρχουν βρικόλακες, ξεκινώντας με βάση την αποδοχή ότι ένας βρικόλακας για να επιβιώσει χρειάζεται να πιει το αίμα ενός ανθρώπου την εβδομάδα, μετατρέποντάς τον κι αυτόν σε βρικόλακα. Ετσι, κι αν στο μεταξύ δεν έχουν εξουδετερωθεί, στο τέλος της τριακοστής τρίτης εβδομάδας θα πρέπει να έχουν δημιουργηθεί περί τα 5 δισ. βρικόλακες, όσος δηλαδή περίπου και ο πληθυσμός της γης. Πράγμα αδύνατον. Ή μήπως είμαστε όλοι βρικόλακες και δεν το ξέρουμε; Σκεφτείτε το. Ο κινηματογράφος που από τα γεννοφάσκια του, με τον Ζορζ Μελιές, έδειχνε την προτίμησή του για το «φανταστικό» και το «υπερφυσικό», ίσως γιατί ήταν το μόνο μέσο που είχε τη δυνατότητα να αναπαραστήσει πειστικά, δεν έμεινε απαθής απέναντι στη μυθολογία των βρικολάκων. Από τον έξοχο «Νοσφεράτου» (1922) του Μούρναου, φτάσαμε στις τρεις περσινές εκδοχές: «Ασε το κακό να μπει» και τις δύο ταινίες της σαγκά του «Λυκόφωτος», που έριχναν με το δικό τους τρόπο μια νέα ματιά στο μύθο. Ο Νοτιοκορεάτης σκηνοθέτης και σεναριογράφος Παρκ Τσαν-γουκ, μας αιφνιδίασε το 2003 με την εκπληκτική του ταινία εκδίκησης «Old boy», δεύτερο μέρος μιας εξαιρετικά ενδιαφέρουσας τριλογίας που ολοκλήρωσε το 2005 με την «Εκδίκηση μιας κυρίας». Πέρσι στις Κάννες θριάμβευσε πάλι, κερδίζοντας το βραβείο της κριτικής επιτροπής, με το νέο του πόνημα «Δίψα», βασισμένο χαλαρά πάνω στο μυθιστόρημα «Τερέζα Ρακέν» του Εμίλ Ζολά. Μόνο που εδώ, ο καθολικός ιερέας, που φτάνει μέχρι την αυτοθυσία για το καλό του κόσμου, μετατρέπεται τυχαία σε βρικόλακα κι όλες οι απωθημένες ανθρώπινες επιθυμίες του, τον κατακλύζουν απρόσμενα. Εξοχα στιλιζαρισμένη και φωτογραφημένη η «Δίψα» θα μπορούσε να είναι μια αριστουργηματική αλληγορία πάνω στο διττό της ανθρώπινης φύσης, αν δεν μακρυγορούσε, αν δεν θύμιζε το «Ossessione» του Βισκόντι, κι αν δεν είχε παρόμοιο τέλος με την πραγματικά τρομακτική ταινία του Ντέιβιντ Σλέιντ «30 μέρες νύχτα» (2007).


ΤΗΛΕΟΡΑΣΗ

44

Πέµπτη 15 Απριλίου 2010

τηλεβολές

Σε ευρωπαϊκό διαγωνισµό η ΕΤ3

ΕΤ1

Στο διαγωνισμό της Πανευρωπαϊκής Ενωσης Δημόσιων Περιφερειακών Σταθμών (CIRCOM) για τα καλύτερα τηλεοπτικά προγράμματα συμμετέχει η ΕΤ3. Το τρίτο κανάλι της δημόσιας τηλεόρασης συμμετέχει στην κατηγορία καλύτερου ντοκιμαντέρ με τη σειρά «Ελλήνων Δρώμενα» (επεισόδιο «Για μια αγάπη Ανωγειανή»). Επίσης, στην κατηγορία τηλεοπτικής μυθιστοριογραφίας η ΕΤ3 διαγωνίζεται με τη σειρά «Χώματα με Ιστορία - Θεόδωρος Κολοκοτρώνης» και

στην κατηγορία βίντεο-δημοσιογραφίας με την εκπομπή «Ανιχνεύσεις» (ρεπορτάζ «Στα ίχνη της Ιστορίας») του Παντελή Σαββίδη (φωτογραφία). Τα αποτελέσματα θα ανακοινωθούν τον επόμενο μήνα. Το συναρπαστικό ταξίδι στο «Θαυμαστό κόσμο των παραμυθιών» συνεχίζει σήμερα στις δώδεκα τα μεσάνυχτα η «Cinemania» της ΕΤ3. Η εκπομπή, με παρουσιαστή τον Νίκο Γουλιά, θα προβάλει το δεύτερο μέρος του αφιερώματος και επιβιβάζεται στο «Πολικό

(210 7701911 -5)

NET

(210 6066000)

08.15 Παιδικό πρόγραµµα 10.00 Ελληνική ταινία: «Ανθρωπος για όλες τις δουλειές» (1966) 12.00 Εχουµε και λέµε 14.00 Ειδήσεις 14.30 Ουράνιο τόξο 15.00 Φινέας και Φερµπ 15.30 Η απίθανη Κιµ 16.00 Χάνα Μοντάνα 16.30 Οι µάγοι του Γουέιβερλι 17.00 Ατίθασα νιάτα 18.00 Η Μανιάτισσα (Ε) 19.00 Μαρτυρίες (Ε) 20.00 Αρκτική: Ραγδαία τήξη των πάγων 21.00 Παρασκήνιο (Ε) 22.00 Οι αγνοούµενοι 23.00 Ειδήσεις 24.00 ∆ιαβολικά µυαλά 01.00 Εγκληµα και έρευνα (Ε)

06.00 10.00 12.00 13.00 15.00 16.00 18.00 19.00

Πρωινή ενηµέρωση Συµβαίνει τώρα Ειδήσεις Μένουµε Ελλάδα Ειδήσεις Εχει γούστο Ειδήσεις Ελληνική ταινία: «Κόσµος και κοσµάκης» Κωµωδία (1964) Σαν σήµερα τον 20ό αιώνα Ειδήσεις Ουδείς αναµάρτητος Με την Αννα Παναγιωταρέα Ξένη ταινία: «Η τελευταία σφαίρα» Αµερικανική κωµωδία (2004) Ιστορία: Η ζωή µετά τον άνθρωπο (Ε)

ALPHA 06.00 07.30 10.00 13.00 13.15 16.00 17.00 17.05 18.00 19.00 20.00 21.00 22.15 23.15 01.00

(212 2124000)

Κους κους το µεσηµέρι (Ε) Πάνω στην ώρα Καφές µε την Ελένη Ειδήσεις Κους κους το µεσηµέρι ∆έστε τους Ειδήσεις ∆έστε τους (Συν.) Fatus olous (Ε) Ειδήσεις Κάτι ψήνεται Πάµε πακέτο Εφιάλτης στην κουζίνα Sex and the city Οι ιστορίες του αστυνόµου Μπέκα (Ε) 02.15 10η εντολή (Ε) 03.15 Η κουζίνα της µαµάς (Ε) 04.15 Εικόνες (Ε)

20.45 21.00 22.00 23.15 01.00

ΣΚΑΪ

(210 4800000)

05.30 Ειδήσεις 06.00 Πρώτη γραµµή 10.00 Σκάι τώρα 13.00 Νταντά πρώτων βοηθειών 14.00 Ή εγώ ή ο σκύλος 15.00 The «F» word 16.00 America’s next top model 16.50 Ειδήσεις 17.00 Το κάστρο του Τακέσι 17.30 Υπαστυνόµος Ρεξ 18.30 Μύθος ή πραγµατικότητα 19.40 Doc it 20.45 Ελληνοφρένεια 21.00 Eιδήσεις 22.00 I love GR 23.00 CSI, Λας Βέγκας: Στον τόπο του εγκλήµατος 24.00 The first 48 01.00 Moto GP show 02.00 24

ET3

(2310 299400)

07.00 Ταξίδια στην άκρη του κόσµου µε τον Αρτ Γουλφ 07.30 Ο κόσµος των ζώων µε τον Ζέεκ 08.00 Οι κόρες του Μακ Λέοντ (Ε) 09.00 Μαγικός κόσµος 09.30 Καθηµερινά 11.00 Αληθινά σενάρια (Ε) 12.00 Λησµονηµένες φωνές 13.00 Ειδήσεις 14.30 Οι κόρες του Μακ Λέοντ 15.30 Τόλµη και γοητεία 16.00 Η χαρά της ζωγραφικής 16.30 Μαγικός κόσµος 17.00 Ειδήσεις 17.55 Αθλητικά 18.15 Εκτη αίσθηση 18.30 Αρπακτικά 19.30 Εργαζόµενα ζώα 20.00 Ο αρκτικός κύκλος: Το µέλλον της Γης 21.00 Κλήρωση Τζόκερ - ΠΡΟΤΟ 21.05 Ο γύρος των θαλασσών 21.40 Καιρός 22.00 Ειδήσεις 23.00 Αληθινά σενάρια 01.00 Η Θεσσαλονίκη της νοσταλγίας µας (Ε)

STAR 06.00 06.45 07.45 10.15 11.15 12.30 13.30 16.30 16.45 18.45 19.45 21.00

(210 3481000)

California teens Παιδικό πρόγραµµα Πρωινή µελέτη Νηστικοί πράκτορες Μαρίνα Ειδήσεις Super Star Ειδήσεις Φώτης - Μαρία live Ιατρικές υποθέσεις Ειδήσεις Ξένη ταινία: «Ταξίδι στο κέντρο της γης» Αµερικανική περιπέτεια (2008)

22.45 Ξένη ταινία: «Η έκρηξη» Αµερικανική περιπέτεια (1994) 01.15 Supernatural 02.15 The dead zone 03.15 Ξένη ταινία: «Ατίθαση γενιά» Αµερικανικό δράµα (2003)

MEGA 06.00 07.00 10.00 13.10 14.00 15.00 16.00 17.10 17.20 18.00 18.10 19.00 20.00 21.00 22.15

(210 6903000)

Αέρινες σιωπές (Ε) Κοινωνία ώρα Mega Οµορφος κόσµος το πρωί Η ζωή της άλλης (Ε) Ειδήσεις Μπουκιά και συχώριο (Ε) Απαράδεκτοι (Ε) Ειδήσεις Εραστής δυτικών προαστίων (Ε) Ειδήσεις Η ζωή της άλλης Τα µυστικά της Εδέµ Ειδήσεις Λάκης ο γλυκούλης Μίλα µου βρώµικα

ANT1 06.00 07.00 10.00 12.50 13.00 13.25 14.15 15.15 16.15 17.40 17.50 19.00 20.00 21.00 23.00 24.00 01.00 01.10 02.10 03.10

εξπρές», πετάει στη «Χώρα του Ποτέ - Ποτέ» μαζί με τον Πίτερ Παν, οδηγεί την Ντόροθι στο «Μάγο του Οζ» και επισκέπτεται το «Εργοστάσιο Σοκολάτας» του Γουίλι Γουάνκα. Κρήτη... εναντίον Μακεδονίας! Το ταξίδι του «Ι love GR» με οικοδέσποινα τη Δήμητρα Παπαδοπούλου συνεχίζεται στην τηλεόραση του Σκάι και σήμερα στις 22.00 τη... μάχη θα δώσουν τέσσερις αγαπημένες περιοχές, οι Σέρρες, η Νάουσα, τα Χανιά και το Ρέθυμνο. ΔΗΜΗΤΡΑ ΧΑΤΖΗΠΑΝΑΓΙΩΤΟΥ

(210 6886100)

Love bites (Ε) Καληµέρα Ελλάδα 10 µε 1 µαζί Με αγάπη Ειδήσεις Ακρως οικογενειακόν (Ε) Κωνσταντίνου και Ελένης (Ε) Το καφέ της Χαράς (Ε) Αξίζει να το δεις Ειδήσεις Love bites Κάρµα Ειδήσεις Ξένη ταινία: «Η αδελφότητα του τρόµου» Αµερικανική περιπέτεια (2001) Ράδιο αρβύλα Criminal minds Ειδήσεις Κος & κα Πελς (Ε) European poker tour Μωβ ροζ (Ε)

BOYΛΗ

(210 3707874)

(210 5707000)

01.15 Hit parade GR (E) 01.45 Auto Alter 02.00 Ξένη ταινία: «Ο εκδικητής» Αµερικανικό γουέστερν (2007) 04.00 Ξένη ταινία: «Η κλέφτρα» Αµερικανική περιπέτεια (1967) 05.30 Υδρόγειος (Ε)

23.10 Στο παρά πέντε (Ε) 24.00 Anthony Bourdain: No reservations 01.15 Ειδήσεις 01.30 Είµαστε στον αέρα (Ε)

09.30 Ολοµέλεια της Βουλής 15.00 Κλασική µουσική 16.00 Εκπαιδευτική τηλεόραση 17.00 Ειδήσεις 17.30 Μαγικός φανός 18.00 Αναζητώντας τις Μπροντέ Ντοκιµαντέρ παραγωγής BBC 20.00 Στην άκρη της ζωής Σειρά ντοκιµαντέρ παραγωγής BBC 21.00 Τι λέει ο νόµος 22.00 Ειδήσεις 22.10 Ξένη ταινία: «Κουκλίτσα» Σκηνοθεσία: Ελίας Καζάν

ALTER

06.00 Καληµέρα, µε τον Γιώργο Αυτιά 10.30 Εδώ και τώρα 12.00 Πολύ µπλα µπλα 15.30 Ειδήσεις 15.45 Μεσηµεριανό express 18.30 Σήµερα 20.00 Ειδήσεις 21.00 Υδρόγειος 21.30 Auto Alter 21.45 Ζούγκλα Με τον Μάκη Τριανταφυλλόπουλο

TV ΜΑΚΕΔΟΝΙΑ

(2310 504300)

09.30 Η αγορά σήµερα 10.30 Metro 11.30 Bajo las riendas del amor 12.30 Χίλιες και µια νύχτες (Ε) 14.00 Κορίτσια για σπίτι 15.30 Η αγορά σήµερα 18.30 Birth days 19.00 Ειδήσεις 19.50 Married with children 20.30 Χίλιες και µια νύχτες (E) 22.15 Kώδικας υγείας και οµορφιάς 22.30 Las Vegas 23.30 Mayday 00.30 Η αγορά σήµερα

TV 100

(2310 265828)

07.00 Παιδικό πρόγραµµα 10.00 Στην αγορά κι ό,τι προκύψει 12.00 Εκ βαθέων 12.30 ∆ιαµάντια του βυθού 13.00 Τα SOS 14.30 Αγρια ίχνη στην Αφρική 15.00 Ειδήσεις 15.05 Εδώ Μακεδονία 17.00 Ευ ζην 17.30 Με 100... στα σπορ 18.30 Ειδήσεις 19.30 Στη Γη της Μακεδονίας 20.30 Ελληνική ταινία 23.00 Ειδήσεις 24.00 Cinepolis 00.30 Ξένη ταινία

00.10 Ειδήσεις

ραδιόφωνο

ΤΑ ΚΑΝΑΛΙΑ ΦΕΡΟΥΝ ΤΗΝ ΕΥΘΥΝΗ ΓΙΑ ΤΥΧΟΝ ΑΛΛΑΓΕΣ ΣΤΟ ΠΡΟΓΡΑΜΜΑ ΤΟΥΣ 87,6 ΛΑΪΚOΣ FM 2310 240876, 88 ΝΕΤ 210 6066818-9, 88,5 ΡΑΔΙO 88 ΜΙΣO 2310 554291-2, 89 RAINBOW 2310 779352, 89,4 ΛΑΜΨΗ 2310 519404, 89,7 IMAGINE 2310 436800, 90 ΕΡΑ-2 210 6066260, 90,2 ΑΡΙΣΤΕΡΑ ΣΤΑ FM 2310 237841, 90,8 ZOO RADIO 2310 232908, 91,1 ΡΑΔΙO OΔΥΣΣΕΙΑ 2310 863809, 91,4 OΛΑ FM 2310 677070, 91,7 RSO 2310 678528, 92 ΕΡΑ-3 210 6066807-8, 92,4 ΡΑΔΙO ΕΚΦΡΑΣΗ 2310 539101, 92,8 ΑΡΗΣ FM 2310 351345, 93,1 HEART FM 2310 232931, 93,4 ΜΥΘOΣ ΣΤΑ FM 2310 869737, 93,7 ΓΝΩΜΗ ΤOΥ ΠOΛΙΤΗ 2310 288474, 94 ΛΥΔΙΑ ΦΙΛΙΠΠΗΣΙΑ 2310 730936, 94,5 ΡΑΔΙO ΘΕΣΣΑΛOΝΙΚΗ 2310 263707, 94,8

ΕΡΩΤΙΚOΣ FM 2310 262641, 95,1 ΚOΣΜOΡΑΔΙO (RDS) 2310 253400, 95,5 ΡΑΔΙO ΜΕΤΡOΠOΛΙΣ 2310 909090, 95,8 Β’ ΠΡ. ΡΣ ΜΑΚΕΔOΝΙΑΣ 2310 299600-1, 96,1 Σ’ ΑΓΑΠΩ 2130 250961, 96,5 ΠΑΛΜOΣ 2310 564100, 96,8 ΜΕΛΩΔΙΚOΣ FM 2310 231968, 97,1 STAR FM 2310 220300, 97,5 ΑΝΤΕΝΝΑ FM (RDS) 2310 502300, 98 OΑΣΙΣ 2310 519005, 98,4 ΠΑΝOΡΑΜΑ 2310 250984, 98,7 ΑΘΛΗΤΙΚΑ ΝΕΑ 2310 273000, 99 ΡΑΔΙO 1 2310 320162, 99,4 FLASH FM 2310 540201, 99,7 ΡΑΔΙO ΕΚΡΗΞΗ 2310 770014, 100 FM 100 2310 286202, 100,3 REPUBLIC 2310 266233, 100,5 Δ. Ρ. ΛOΓOΥ & ΤΕΧΝΗΣ 2310 286202, 101 SPORTS 2310 286202, 101,7 ΣΙΝΔOΣ FM

2310 501810, 102 Ρ.Σ. ΜΑΚΕΔOΝΙΑΣ 2310 299400, 102,3 ΡΑΔΙO ΑΚΡΙΤΕΣ 2310 608600, 102,6 PLUS RADIO 2310 256368, 103 EXTRA 2310 539103, 103,6 STUDIO 3 2310 236383, 104 ΡΥΘΜOΣ 2310 508155-7, 104,4 ΡΑΔΙOΚΥΜΑΤΑ 2310 772398, 104,7 ROCK RADIO 2310 251047, 104,9 ΡΑΔΙO ΔΕΘ 2310 285105, 105,2 ΡΑΔΙO ΧΡΙΣΤΙΑΝΙΣΜOΣ 2310 566362, 105,5 ROCK 2310 243560, 105,8 ΜOΥΣΙΚOΣ ΓΑΛΑΞΙΑΣ 2310 457125, 106,1 CITY INTERNATIONAL 2310 444000, 106,5 ΕΓΝΑΤΙΑ FM 2310 500950, 107,1 REAL FM 2310 555953, 107,4 LIBERO FM 2310 287888, 107,7 ΠΕΙΡΑΤΙΚOΣ 2310 250131-4, 108 SUPER FM 2310 512993.

ακούτε

Τηλέφωνο: 2310 779352

ΤΟ ΠΡΟΓΡΑΜΜΑ 08.00 - 12.00 Νίκος Τερζόγλου 12.00 - 15.00 ∆ηµήτρης Ιατρού 15.00 - 17.00 ∆ύο ώρες ασταµάτητης αληθινής µουσικής 17.00 - 21.00 Θωµάς Αρβανίτης


45 Πέµπτη 15 Απριλίου 2010

σινεµά και θέατρο κινηµατογράφοι ΒΑΚΟΥΡΑ

Σκηνοθεσία: Λουί Λετεριέ Παίζουν: Σαµ Γουόρθινγκτον, Λίαµ Νίσον, Ρέιφ Φάινς, Τζέµα Αρτερτον, Μαντς Μίκελσεν, Αλέξα Ντάβαλος, Τζέισον Φλέµινγκ

Η σύγκρουση κορυφής µεταξύ αρχαίων Ελλήνων θεών απειλεί να καταστρέψει τον κόσµο: ο αδίστακτος Αδης έχει βάλει στόχο να ανατρέψει τον ∆ία και να σπείρει παντού το χάος. Χτυπηµένος ήδη από τη µανία του Αδη, που διέλυσε την οικογένειά του, ο γεννηµένος από θεούς αλλά µεγαλωµένος από ανθρώπους Περσέας προσφέρεται να ηγηθεί µιας επικίνδυνης αποστολής, µε σκοπό να κατατροπώσει το θεό του Κάτω Κόσµου.

Η Τιτανοµαχία

VILLAGE CINEMAS, ODEON ΠΛΑΤΕΙΑ, STER CINEMAS ΜΑΚΕ∆ΟΝΙΑ, STER CINEMAS CITY GATE

ΠΕΡΙΠΕΤΕΙΑ ΦΑΝΤΑΣΙΑΣ

θέατρα Βασιλικό Θέατρο (πλ. Λευκού Πύργου, τηλ. 2310/288.000) «Η Ισαβέλλα, τρεις καραβέλες, και ένας παραμυθάς» του Ντάριο Φο, σε σκηνοθεσία Γιάννη Ρήγα, Σάββατο, 18.00 και 21.00, Πέμπτη-Παρασκευή, 21.00, Τετάρτη και Κυριακή, 19.00. Θέατρο Αθήναιον (Βασ. Ολγας 35, τηλ. 2310/832.060) Nέα Σκηνή: «Ερωτογενείς ζώνες» του Frank Vickery. Παρασκευή: 23.55, Σάββατο: 21.15 και 23.55, Κυριακή και Δευτέρα: 21.15. Θέατρο «Ακτίς Αελίου» (Χριστοπούλου 12, τηλ. 2310/229.249) «Αχταρμίξ 3», Πέμπτη – Κυριακή, 21.15, πρεμιέρα: αύριο. Θέατρο «Αριστοτέλειον» (Εθν. Αμύνης 2, τηλ. 2310/262.051) «Απόδραση» από την ομάδα «Αλογοι», κάθε Δευτέρα και τρίτη, στις 21.15. «Το θαύμα της Αννυ Σάλιβαν» του Ουίλιαμ Γκίμπσον, με την Πέγκυ Τρικαλιώτη. Τετάρτη, 19.15, Πέμπτη, 21.15, Παρασκευή, 21.15, Σάββατο – Κυριακή: 18.15 και 21.15. Θέατρο «Εγνατία» (Πατρ. Ιωακείμ 1, πλ. Αγίας Σοφίας, τηλ. 2310/225.172) «Απόψε τρώμε στης Ιοκάστης» του Ακη Δήμου, με τη Σοφία Φιλιππίδου, σε σκηνοθεσία Σταμάτη Φασουλή. Τετάρτη – Παρασκευή: 21.15, Σάββατο – Κυριακή: 18.15 και 21.15. Θέατρο «Εξω από τα τείχη» (Πανεπιστημίου 2, Ευαγγελίστρια, τηλ. 2310/210.308) «O δράκος» του Ερμή Μουρατίδη, Παρασκευή – Κυριακή, 21.30. Θέατρο «Κολοσσαίον» (Β. Ολγας 150, τηλ. 2310/834.996) «Σλουθ» του Αντονι Σάφερ με τους Γιώργο Κιμούλη – Κωνσταντίνο Μαρκουλάκη. Τετάρτη – Παρασκευή: 21.30, Σάββατο – Κυριακή: 18.30 και 21.30. Θέατρο «Ράδιο Σίτυ» (Παρασκευοπούλου 9, τηλ. 2310/819.153) «Ο μπακαλόγατος ή Της Κακομοίρας» με τον Πέτρο Φιλιππίδη. Τετάρτη - Πα-

ρασκευή 21.15, Σάββατο - Κυριακή: 18.15 και 21.15. Εως τέλη Μαΐου. Θέατρο «Σοφούλη» (Τραπεζούντος 5, τηλ. 2310/423.925) «Μόνοι μαζί» 15 – 20 Απριλίου, 26-27 Απριλίου και κάθε Κυριακή, Δευτέρα και Τρίτη έως τέλη Μαΐου. Ωρα έναρξης: 21.15, Κυριακή, 20.00. Θέατρο «Ταξίδι ονείρου» (Στεφάνου Τάττη 3, περ. Αγ. Σοφίας, τηλ. 6972/702870) «Μια νύχτα με τον Ρετζ» του Κέβιν Ελιοτ, Δευτέρα – Τετάρτη, 21.15, έως 2 Ιουνίου. Κέντρο Θεατρικής Ερευνας – Αίθουσα «Μάντης Τειρεσίας» (Γεωργίου Κωνσταντινίδη 15, τηλ. 2310/865.904) «Ο Ντάννυ και βαθιά γαλάζια θάλασσα» Παρασκευή – Σάββατο, 21.15, Κυριακή, 20.00 Kέντρο Πολιτισμού Χρήστος Τσακίρης – Δημοτικό Θέατρο (Λαγκαδά 221, Σταυρούπολη, τηλ. 2313/302.833) «Τα μεγάλα ροκ συγκροτήματα δε διαλύονται ποτέ» του Γιώργου Ηλιόπουλου, καθημερινά, στις 21.00, έως τις 26 Απριλίου. Από την ομάδα «6+», σε σκηνοθεσία Πέμυς Ζούνη. Μικρό Θέατρο (Αντ. Καμάρα 3, τηλ. 2310/232.799) «Σελεστίνα» του Χοσέ Ριβέιρα, σε σκηνοθεσία Εύης Δημητροπούλου, Παρασκευή και Σάββατο, 21.15, Κυριακή, 20.00. Μέχρι τέλη Απριλίου. Σκηνή «Σωκράτης Καραντινός»ΚΘΒΕ (Μονή Λαζαριστών, Κολοκοτρώνη 21, Σταυρούπολη, τηλ. 2310/288.000) «Τα παιδιά της πιάτσας» διασκευή του Γιώργου Σκαμπαρδώνη, σε σκηνοθεσία Κωνσταντίνου Αρβανιτάκη, Σάββατο, 18.00 και 21.00, Πέμπτη-Παρασκευή, 21.00, Τετάρτη και Κυριακή, 19.00. Μικρό Θέατρο: «Αποστολή στον πλανήτη Γη» του Σάκη Σερέφα, σε σκηνοθεσία Ανέστη Αζά, Σάββατο, 18.00 και 21.00, Πέμπτη-Παρασκευή, 21.00, Τετάρτη και Κυριακή, 19.00. Πολυχώρος Πείραμα (Βαλαωρί-

του 18, 7ος όροφος, τηλ. 2310/533.859) «Κενό. Κοινό. Καινό». Σύνθεση κειμένων - σκηνοθεσία: Αχιλλέας Ψαλτόπουλος. Πέμπτη – Σάββατο: 21.15, Κυριακή: 20.00. Φλέμινγκ (Μισραχή 15, τηλ. 2310/812.000) «Stand up comedy / Meet us», σε σκηνοθετική επιμέλεια Γρηγόρη Μήττα. Κάθε Σάββατο, 22.00. ContACT (Δάφνης 12, City Gate, τηλ. 2314/010.237) «Τhe thing 9» από την ομάδα «Αλεφέλα». Παρασκευή – Σάββατο, 21.15. Εως 2 Μαΐου. Studio Ars moriendi (Δ. Κουφίτσα 18, τηλ. 2310/248.588) «Molloy-FaustMephisto ή το μήλο και ο διάβολος» από την ομάδα «Alma Kalma», 16-19, 23-26 Απριλίου, 21.00.

ΠΑΙ∆ΙΚΕΣ ΠΑΡΑΣΤΑΣΕΙΣ Βασιλικό Θέατρο (πλ. Λευκού Πύργου, τηλ. 2310/288.000) «Ο Σιμιγδαλένιος» του Αλέξανδρου Αδαμόπουλου, σε σκηνοθεσία-χορογραφία Στέλλας Μιχαηλίδου, κάθε Κυριακή, 11.00. Θέατρο «Αλίκη Βουγιουκλάκη» (Αγ. Δημητρίου 115, τηλ. 2310/205.452) «Η αφίλητη βασιλοπούλα και το φεγγάρι» του Γιάννη Φίλια. Κάθε Κυριακή, 11.30. Θέατρο «Εγνατία» (Πατρ. Ιωακείμ 1, πλ. Αγίας Σοφίας, τηλ. 2310/225.172) «Ομήρου Ιλιάδα – Τρωικός πόλεμος» της Κάρμεν Ρουγγέρη, Κυριακή, 11.30 και 15.00. Θέατρο «Ράδιο Σίτυ» (Παρασκευοπούλου 9, τηλ. 2310/819.153) «Ζυμαροανθρωπάκι χαμογέλα!». Κάθε Κυριακή, 11.30. Θέατρο «Σοφούλη» (Τραπεζούντος 5, τηλ. 2310/423.925) «Η Καλλιπάτειρα» της Καλλιόπης Παπαδάκη, κάθε Κυριακή, 11.30. Φλέμινγκ (Μισραχή 15, τηλ. 2310/812.000) «Ο ζωηρούλης πίθηκος» Κουκλοθέατρο. Κυριακή, 11.30.

(τηλ. 2310/233.665): Α1: Harry Brown (19.00 – 21.00) Το νησί των καταραµένων (22.45) Α2: 4 µαύρα κουστούµια (19.00 - 20.45 – 22.30)

VILLAGE CΙΝΕΜΑS (Εµπορικό κέντρο «Mediterranean Cosmos», τηλ. 2310/499.999): Α1. Η πριγκίπισσα και ο βάτραχος – µε υπότιτλους (Σάββατο και Κυριακή: 12.40 – 14.40) Ζητείται γαµπρός (16.40 – 18.50) Η τιτανοµαχία (21.00 – 23.20) Α2. Ωκεανοί – µεταγλωττισµένη (15.30 – 18.00, Σάββατο και Κυριακή: 11.30 – 13.30 – 15.30 – 18.00) Ωκεανοί – µε υπότιτλους (20.00 – 22.10) Ο αόρατος συγγραφέας (00.20) Α3. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (16.20 – 18.30, Σάββατο και Κυριακή: 12.20 – 14.20 – 16.20 – 18.30) Παράνοια (20.30 – 22.40 – 00.50, Τρίτη: 22.40 – 00.50) Α4. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (15.10 – 17.20, Σάββατο και Κυριακή: 11.20 – 13.20 – 15.10 – 17.20) Επικηρύσσοντας την πρώην (19.30 – 21.50 – 00.10) Α5. Η τιτανοµαχία 3D (16.00 – 18.10 – 20.20 – 22.30 – 00.40, Σάββατο και Κυριακή: 11.40 – 13.50 – 16.00 – 18.10 – 20.20 – 22.30 – 00.40) Α6. Βρέχει κεφτέδες – µεταγλωττισµένη 3D (Σάββατο και Κυριακή: 11.10 – 13.00) Η τιτανοµαχία 3D (17.00 – 19.10 – 21.30 – 23.50, Σάββατο και Κυριακή: 14.50 – 17.00 – 19.10 – 21.30 – 23.50) Α7. Επικηρύσσοντας την πρώην (15.50 – 18.20 – 20.40 – 23.00, Σάββατο και Κυριακή: 13.10 – 15.50 – 18.20 – 20.40 – 23.00) Α8. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (15.40 – 17.50, Σάββατο και Κυριακή: 11.50 – 13.40 – 15.40 – 17.50) Υποψία (20.10 – 22.20 – 00.30) Α9. Επικηρύσσοντας την πρώην (19.30 – 21.50, Παρασκευή: 19.30 – 21.50 – 00.10, Σάββατο 17.10 – 19.30 – 21.50 – 00.10, Κυριακή: 17.10 – 19.30 – 21.50) Α10. Η τιτανοµαχία (20.00, Σάββατο και Κυριακή: 17.50 – 20.00) Υποψία (22.20, Παρασκευή και Σάββατο: 22.20 – 00.30)

ΜΑΚΕ∆ΟΝΙΚΟΝ (τηλ. 2310/261.727, Φιλ. Εταιρείας - ∆ηµ. Μαργαρίτη): Αστραπή πάνω στο νερό (19.00 – 21.00 – 23.00)

ODEON ΠΛΑΤΕΙΑ (Tσιµισκή 43, πληροφορίες: τηλ. 2310/290.290, Κρατήσεις: τηλ. 801 11 60000 και 210/ 6786000, on line: www. i-ticket.gr.): Α1. Cinema park: Ανθρώπινη εµπειρία (Κυριακή: 13.00) Η τιτανοµαχία (17.00 - 19.30 – 22.00 – 00.30) Α2. Ωκεανοί – µεταγλωττισµένη (16.45 – 19.00, Κυριακή: 12.15 – 14.30 – 16.45 – 19.00) Ωκεανοί – µε υπότιτλους (21.15 – 23.30) Α3. Ο µικρός Νικόλας – µεταγλωττισµένη (Κυριακή 13.00 – 16.00) Παράνοια (18.10 – 20.20 – 22.10 – 00.20) Α4. Πώς να εκπαιδεύσετε το δράκο σας– µεταγλωττισµένη (18.30, Σάββατο 16.20 – 18.30, Κυριακή: 12.00 – 14.10 – 16.20 – 18.30) Ζητείται γαµπρός (20.40 – 22.50) Α5. Επικηρύσσοντας την πρώην (18.10 – 20.30 – 23.00, Σάββατο και Κυριακή: 15.40 – 18.10 – 20.30 – 23.00) Α6. Η τιτανοµαχία (18.20, Σάββατο και Κυριακή: 15.50 – 18.20) Harry Brown (20.40 – 23.10) A7. Υποψία (16.50 – 19.00 – 21.10 – 23.20) Α8. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (18.00) Ο αόρατος συγγραφέας (20.10 – 22.50)

ΟΛΥΜΠΙΟΝ (τηλ. 2310/378.404): Α. Ολύµπιον: Τα παιδία δεν παίζει (19.00)

Το γάλα της θλίψης (21.00 – 23.00) Β. «Παύλος Ζάννας»: Οψεις του κινέζικου κινηµατογράφου (18.30 – 20.45 – 23.00)

STER CINEMAS ΜΑΚΕ∆ΟΝΙΑ (Εµπορικό κέντρο «Μακεδονία», Πυλαία, δίπλα στο νοσοκοµείο «Αγιος Παύλος», τηλ. από σταθερό 801 801 7837 και από κινητό 210/23.71.000): Α1. Επικηρύσσοντας την πρώην (19.00 – 21.10 – 23.20, Σάββατο και Κυριακή: 12.30 – 14.40 – 16.50 – 19.00 – 21.10 – 23.20) Α2. Η πριγκίπισσα και ο βάτραχος – µεταγλωττισµένη (Σάββατο και Κυριακή: 11.00 – 13.10 – 15.10 – 17.10) Παράνοια (19.20 – 21.50, Παρασκευή και Σάββατο: 19.20 – 21.50 – 00.15) Α3. Ωκεανοί – µεταγλωττισµένη (18.40, Σάββατο και Κυριακή: 12.20 – 14.30 – 16.30 – 18.40) Ωκεανοί – µε υπότιτλους (20.50 – 23.00) Α4. Ζητείται γαµπρός (18.00 – 20.00, Σάββατο και Κυριακή: 11.50 – 13.50 – 15.50 – 18.00 – 20.00) Η τιτανοµαχία (22.00, Παρασκευή και Σάββατο: 22.00 – 00.10) Α5. Η Αλίκη στη χώρα των θαυµάτων (18.10, Σάββατο και Κυριακή: 11.30 – 13.40 – 16.00 – 18.10) Η τιτανοµαχία (20.20 – 22.30) A6. Το λουλούδι της ερήµου (19.00 – 21.20, Σάββατο και Κυριακή: 12.00 – 14.20 – 16.40 – 19.00 – 21.20) Η τιτανοµαχία (23.40) Α7. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (19.15, Σάββατο και Κυριακή: 11.15 – 13.15 – 15.15 – 17.15 – 19.15) Ο αόρατος συγγραφέας (21.30, Παρασκευή έως Κυριακή: 21.30 – 24.00) Α8. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη 3D (Σάββατο και Κυριακή: 12.45 – 14.45 – 16.45) Η τιτανοµαχία 3D (18.50 – 21.00 – 23.10) Α9. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (18.15, Σάββατο και Κυριακή: 12.15 – 14.15 – 16.15 – 18.15) Υποψία (Παρασκευή και Σάββατο: 20.15 – 22.20 – 00.30) Α10. Ο µικρός Νικόλας – µεταγλωττισµένη (Σάββατο και Κυριακή: 11.20 – 13.20 – 15.20) Επικηρύσσοντας την πρώην (19.30 – 21.40 – 23.50, Σάββατο και Κυριακή: 17.20 – 19.30 – 21.40 – 23.50) Α11. Επικηρύσσοντας την πρώην (20.00 – 22.10, Παρασκευή: 20.00 – 22.10 – 00.20, Σάββατο 13.30 – 15.40 – 17.50 – 20.00 – 22.10 – 00.20, Κυριακή: 13.30 – 15.40 – 17.50 – 20.00 – 22.10)

STER CINEMAS CITY GATE (Εµπορικό κέντρο «City Gate», Γιαννιτσών και Κωλέττη, τηλ. από σταθερό 801 801 7837 και από κινητό 210/2371000): Α1. Η πριγκίπισσα και ο βάτραχος– µεταγλωττισµένη (Σάββατο και Κυριακή: 11.20 – 13.20 – 15.20 – 17.20) Παράνοια (19.20 – 21.30 – 23.40) Α2. Επικηρύσσοντας την πρώην (19.00 – 21.15 – 23.30, Σάββατο και Κυριακή: 11.45 – 14.30 – 16.45 – 19.00 – 21.15 – 23.30) Α3. Επικηρύσσοντας την πρώην (20.00 – 22.15, Σάββατο και Κυριακή: 12.45 – 15.30 – 17.45 – 20.00 – 22.15) Α4. Η τιτανοµαχία (19.50 – 22.00, Σάββατο και Κυριακή: 13.15 – 15.30 – 17.40 – 19.50 – 22.00) Α5. Ωκεανοί – µεταγλωττισµένη (18.45, Σάββατο και Κυριακή: 12.50 – 14.50 – 16.50 – 18.45) Ωκεανοί – µε υπότιτλους (20.50 – 23.00) Α6. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (19.00, Σάββατο και Κυριακή: 11.00 – 13.00 – 15.00 – 17.00 – 19.00) Η τιτανοµαχία (21.00 – 23.15) Α7. Πώς να εκπαιδεύσετε το δράκο σας – µεταγλωττισµένη (18.10, Σάββατο και Κυριακή: 12.10 – 14.10 – 16.10 – 18.10) Η τιτανοµαχία (20.20 – 22.30)

ΦΑΡΓΚΑΝΗ (τηλ. 2310/960.063): Το λουλούδι της ερήµου (18.45 – 21.00) Η Αλίκη στη χώρα των θαυµάτων (23.10)


ΧΡΗΣΙΜΑ

46

(

χρήσιμα τηλέφωνα 0 ΡΑΣΗ 10 ΑΜΕΣΗ Δ ΙΑ 2310 894646 Μ Ο Ν ΤΟ ΣΤΡΑ 9 1504-7 ΤΙΚΗ 19 2, 2310 53 ΠΥΡΟΣΒΕΣ ΙΚΟ 2310-53150 71 ΛΙΜΕΝ 48 55 10 ΟΜΙΑ 23 ΚΗ ΑΣΤΥΝ 6 ΤΟΥΡΙΣΤΙ ΗΣ ΒΟΗΘΕΙΑΣ 16 5 ΕΣ Μ 1155 ΚΕΝΤΡΟ Α ΕΙΑ (από κινητό) 400 ΗΘ ΕΛΠΑ 10 ΟΔΙΚΗ ΒΟ 48 ΙΡΟΥ 14 379000 Α Κ Ο ΤΙ ΔΕΛ ΚΗΣ 2310 2310 409609 ΡΑ Θ ΣΙΑ ΟΝ Α 156 & ΥΠ. ΜΑΚΕΔ ΝΟΜΑΡΧΙ 2310 375200 ΝΙΚΗΣ ΛΟ ΣΑ 996000 ΕΣ Θ ΔΗΜΟΣ ΑΠΘ 2310 25 ΚΤΕΟ 15 243373 33 10 AIDS 23 859459, 2310 8478 ΑΤΑ 2310 2310 515150 Μ ΣΗ Ο Ν ΚΑ 45 & ΣΕΞΟΥΑΛΙ ΙΘΑΚΗ 11 566134-5 2310 ήβους) 53 εφ ια (γ 2310 5550 ΟΚΑΝΑ Α ΘΕΜΑΤΑ 3333 ΓΥΝΑΙΚΕΙ ΛΩΤΩΝ 2310 23 76 Α ΚΑΤΑΝΑ ΟΙΖΩ 2310 2577 ΠΡΟΣΤΑΣΙ ΕΚΠ 10535263 ΙΝΚΑ 23 56 10 S ΩΝ SO 501 ΙΞΗ ΠΑΙΔ -3 ΥΠΟΣΤΗΡ ΔΥΤ. ΘΕΣ/ΝΙΚΗ 10 2 & 2310 511972 50 ΔΕΗ: 928243 /ΝΙΚΗ 10 ΚΕΝ. ΘΕΣ ΙΚΗ 10503 & 2310 /Ν ΑΝΑΤ. ΘΕΣ ΟΤΕ: 121 207345 ΟΥ 2310 ΕΥΑΘ: ΝΕΡ Σ 2310 300846 ό από σταθερ ΥΣΗ ΑΠΟΧΕΤΕ ΙΟ 800 11 87878 ό κινητό ΕΡ απ Α Ο 09 Κ 03 ΣΙ Υ 52 Φ » 2310

ΖΥΓΟΣ

(21 Μαρτίου – 20 Απριλίου)

(23 Σεπτεμβρίου – 22 Οκτωβρίου)

H σημερινή μέρα θα είναι δυνατόν να αποδειχθεί ήρεμη, αν επιλέξετε οι ίδιοι να ακολουθήσετε έναν πιο ήρεμο τρόπο ζωής.

Σήμερα, δεν πρέπει να πιέσετε τις καταστάσεις αλλά καλό είναι να παραμείνετε πιο ήπιοι και διακριτικοί.

ΤΑΥΡΟΣ (21 Απριλίου – 20 Μαΐου)

Διαφορετικά από εσάς στη φύση αλλά και στη συμπεριφορά τους άτομα θα σας ενθουσιάσουν, αλλά και θα σας δώσουν ελπίδες, σε θέματα που μπορεί να είχατε χάσει το νόημά τους.

ΔΙΔΥΜΟΙ (21 Μαΐου – 21 Ιουνίου)

Ατομα από το εργασιακό σας περιβάλλον ίσως να σας φερθούν με τρόπο που δεν θα περιμένατε.

ΚΑΡΚΙΝΟΣ (22 Ιουνίου – 22 Ιουλίου)

Η συμπεριφορά των συναδέλφων σας θα βοηθήσει στην περαιτέρω ενεργοποίησή σας.

ΛΕΩΝ (23 Ιουλίου -23 Αυγούστου)

Μην απορρίψετε καμία πιθανότητα μέσα από την οποία θα μπορούσατε να διευρύνετε το φιλικό αλλά και τον κοινωνικό σας κύκλο.

ΠΑΡΘΕΝΟΣ (24 Αυγούστου – 22 Σεπτεμβρίου)

Σήμερα, θα έχετε μια ιδιαίτερα ερωτική συμπεριφορά, που θα εντυπωσιάζει τους πάντες.

ΣΚΟΡΠΙΟΣ (23 Οκτωβρίου – 22 Νοεμβρίου)

Ισως, σήμερα να χρειαστεί να περάσετε περισσότερη ώρα μακριά από το σπίτι ή τον οποιονδήποτε άλλο προσωπικό σας χώρο.

ΤΟΞΟΤΗΣ (23 Νοεμβρίου – 21 Δεκεμβρίου)

Σήμερα θα έχετε έναν μοναδικό τρόπο έκφρασης των συναισθημάτων και του κάθε ενδιαφέροντός σας.

Σήμερα, φροντίστε να είστε άμεσοι αλλά και γεμάτοι προσοχή προς τα πρόσωπα που αγαπάτε.

ΥΔΡΟΧΟΟΣ (20 Ιανουαρίου – 19 Φεβρουαρίου)

Το χιούμορ και η πρωτοτυπία σας θα είναι ακαταμάχητα στοιχεία, με τα οποία θα μπορέσετε να προωθήσετε επιτυχώς τα συμφέροντά σας.

ΙΧΘΥΕΣ (20 Φεβρουαρίου – 20 Μαρτίου)

Αρκετά ανατρεπτικοί στους τρόπους και τις απόψεις σας, θα γοητεύσετε, ιδιαίτερα τους πιο παθητικούς και μετρημένους ανθρώπους, που θα έχουν πολλές κρυμμένες αλλά ισχυρές επιθυμίες.

2

3

4

5

6

7

8

9

10

11

12

ε στα π

13

OPIZONTIA 1. •ÂÚ›˙ˆÌ· ¿¯ÚËÛÙˆÓ ¯fiÚÙˆÓ. 2. IÔ˘‰·›Ô˜ ·Ú¯ÈÂÚ¤·˜ – ™·Ê‹˜. 3. E›‰Ô˜ ˘Ê¿ÛÌ·ÙÔ˜ – YÔÙË ·ÌÔÈ‚‹ – ... AÚÛÏ¿Ó: ™ÂÏÙ˙Ô‡ÎÔ˜ ÛÔ˘ÏÙ¿ÓÔ˜. 4. M ٷ ¤Ú·Ù·... ÍfiÚÎÈ· – ZÔ˘Ó ÛÙË N¤· K·ÏˉÔÓ›·. 5. ¢‡Ô

14944

διανυκτερεύοντα φαρμακεία

Από τις 8.30 μ.μ. έως τις 12 τα μεσάνυχτα: Χρ. Σμύρνης 7 - όπισθεν θεάτρου Σταυρούπολης, Λ. Ιασονίδου 34 - Αγ. Σοφίας - Αγ. Δημητρίου, 25ης Μαρτίου 100 - Χαριλάου, Αλ. Παπαναστασίου 7 - Μ. Μπότσαρη - ΔΕΗ, 28ης Οκτωβρίου 53 με Μακεδονίας 20 - Φλέμινγκ, Β. Ολγας 166 - Μαρτίου, Εθν. Αντίστασης 69 Διοικητήριο, Ν. Πλαστήρα 15 - Χαριλάου, Αλ. Μπινιώρη 61 - Σχολείο ρολόι - Νεάπολη, Εθν. Αντίστασης 61 - έναντι δημαρχείου - Ελευθέριο - Κορδελιό, Αγ. Σοφίας 12 - Τσιμισκή, Ιμέρας 5 - πεζόδρομος - Καλαμαριά, Στρ. Σαράφη 52 - Αγ. Ιωάννης, Θ. Βασιλειάδη 35 με Λαμπράκη 190 - Α. Τούμπα, Π. Γρηγορίου Ε’ 14 - δημαρχείο Αμπελοκήπων, Εθν. Αντίστασης 142 - έναντι Νταλίπη, Εγνατία 142 - Καμάρα, Κωνσταντινουπόλεως 5 - Δελφών. Συνεχίζουν έως το πρωί τα εξής φαρμακεία: Αλ. Παπαναστασίου 78 - Μ. Μπότσαρη - ΔΕΗ, Β. Ολγας 166 - Μαρτίου, Ι. Δραγούμη 69 - Διοικητήριο, Αλ. Μπινιώρη 61 - Σχολείο ρολόι - Νεάπολη, Εθν. Αντίστασης 61 - έναντι δημαρχείου - Ελευθέριο - Κορδελιό, Στρ. Σαράφη 52 - Αγ. Ιωάννης.

14944

εφημερεύοντα νοσοκομεία

Από τις 8.00 π.μ. έως τις 8.00 π.μ. της επομένης: «Γ. ΠΑΠΑΝΙΚΟΛΑΟΥ» (τηλ. 2310-357602): για περιστατικά θωρακοχειρουργικά, καρδιοχειρουργικά. ΙΠΠΟΚΡΑΤΕΙΟ (τηλ. 2310892000): για περιστατικά παθολογικά, καρδιολογικά, νευρολογικά, παιδιατρικά, νεογνολογικά, χειρουργικά, ορθοπεδικά, ουρολογικά, ωτορινολαρυγγολογικά, νευροχειρουργικά, οφθαλμολογικά, μαιευτικά, γυναικολογικά, παιδοχειρουργικά, παιδοορθοπεδικά, αγγειοχειρουργικά. Β’ ΙΚΑ (τηλ. 2310-479600): για περιστατικά παθολογικά, καρδιολογικά, νευρολογικά, χειρουργικά, ορθοπεδικά, ουρολογικά. ΑΝΤΙΚΑΡΚΙΝΙΚΟ ΝΟΣΟΚΟΜΕΙΟ ΘΕΑΓΕΝΕΙΟ (τηλ. 2310-898848). ΨΥΧΙΑΤΡΙΚΟ ΝΟΣΟΚΟΜΕΙΟ (τηλ. 2310647100). ΝΟΣΟΚΟΜΕΙΟ ΕΙΔΙΚΩΝ ΠΑΘΗΣΕΩΝ (τηλ. 2310-202310) για λοιμώδη νοσήματα ενηλίκων - παίδων. Κ.Υ. ΘΕΡΜΗΣ (τηλ. 2310-472372). Κ.Υ. ΙΩΝΙΑΣ (τηλ. 2310-781840). Κ.Υ. ΛΑΓΚΑΔΑ (τηλ. 23940-23549). ΠΟΛΥΪΑΤΡΕΙΑ ΙΚΑ Για ραντεβού σε οποιοδήποτε πολυϊατρείο: τηλ. 184 (Ολες οι ειδικότητες): ΚΕΝΤΡΙΚΟ: Αγγελάκη 37, τηλ. 2310-

ÛÙËÓ... ›È˙· – M·˜ ÂÎÚÔÛÒËÛ·Ó ÙÔ 2001 ÛÙËÓ Eurovision – ¢fiÏÈÔ. 6. B¿Ú·ıÚÔ – °¿ÏÏÔ˜ ı·ÙÚ¿ÓıÚˆÔ˜. 7. ™ÙÈÁÌÈ·›Ô˜ ηʤ˜ – £˘Ì›˙ÂÈ... §Ô˘¤Ó – XˆÚÈfi Ù˘ £‹Ú·˜. 8. ¢ÈÂıÓ‹˜ ÂÌÔÚÈÎfi˜ fiÚÔ˜ – EÏÏËÓ·˜ ÎÔÈÓˆÓÈÔÏfiÁÔ˜ ηÈ

283907, 2310-283295 (για ραντεβού). ΠΥΛΗ ΑΞΙΟΥ: Πολυτεχνείου 1, τηλ. 2310543560, 2310-544082, 2310-544130. ΑΝΑΛΗΨΕΩΣ: Αγλαΐας Σχινά 4, τηλ. 2310810490, 2310-810492. ΑΓ. ΔΗΜΗΤΡΙΟΥ: Ι. Δραγούμη 61, τηλ. 2310-540713, 2310-540791, 2310-540735, 2310-540779. ΤΟΥΜΠΑΣ: Γρ. Λαμπράκη και Α. Τζουμαγιάς, τηλ. 2310-913166, 2310-912507.

KA£ETA 1. E¯ÂÈ ·ÓÙÚ¢Ù› ¿ÏÈ ÚÈÓ ÙÔÓ ÙÂÏÂ˘Ù·›Ô Á¿ÌÔ Ù˘. 2. K·È Ì ·ÏÔÈʤ˜ Á›ÓÔÓÙ·È – B˘˙·ÓÙÈÓfi˜ Ô ‰ÈΤʷÏÔ˜. 3. ¢ÈÏ‹... Ë ÌÔÈÚ·Ṳ̂ÓË – AÚ¯·›· ‚ÔȈÙÈ΋ fiÏË – ¶ÚÔ˚fiÓ... ËÊ·ÈÛÙ›Ԣ. 4. AÚ¯·›Ô˜ AÈÁÈÓ‹Ù˘ ¯·ÏÎÔÏ¿ÛÙ˘ – EÏ¿ÙÙˆÛË fiÁÎÔ˘ ‹ ‚¿ÚÔ˘˜ – ¢›„ËÊÔ ÊˆÓ‹ÂÓ. 5. O ·ÚÈıÌfi˜ 110 – IÙ·ÏÈο... Ù· Ó¤· ÙÔ˘ – ™¯ÔÈÓÈ¿ Ì ıËÏÈ¿. 6. ¢ÈÏfi... ˯› Û ˙Ô‡ÁÎÏ· – M˯·ÓÔ˘ÚÁÈÎfi ÂÚ-

13:02, 14:17, 19:38. Αλεξανδρούπολη: 02:01, 12:21, 18:25 IC, 06:04, 07:18, 13:02, 14:17, 19:38. Δίκαια: 02: 01 IC, 14:17. Τυχερό: 02: 01 IC, 14:17. Βέροια-Νάουσα-Σκύδρα-Εδεσσα: 04:48, 06:18, 07:01, 08:38, 09:58, 11:12, 12:31, 14:00, 15:11, 16:46, 17:51, 19:11, 20:17, 22:16. Φλώρινα: 06:18, 08:38, 11:02, 15:11, 19:11. Κωνσταντινούπολη :19:38. Σόφια: 06:40, 17:36, 23:46. Βουκουρέστι-Βουδαπέστη: 23:46. Πληροφορίες τηλ. 2310/517.517.

λαϊκές αγορές ΚΑΛΑΜΑΡΙΑ: Αμισού (μπροστά στο δημαρχείο). ΚΑΝΑΡΗ: Από Αλ. Παπαναστασίου μέχρι Παπάφη. ΚΑΛΛΙΘΕΑ: Αρχαιοτήτων και Δεξαμενής (όπισθεν υδραγωγείου). ΑΓΙΟΥ ΔΗΜΗΤΡΙΟΥ: Κων/νου Γκράτσιου. ΠΟΛΙΧΝΗ: Στην οδό Φιλίππου, από Δερβενακίων μέχρι Παπάφη. ΠΥΛΑΙΑ: Παύλου Μελά, δίπλα στο σχολείο. ΑΓ. ΠΑΥΛΟΣ: Ηπείρου, δίπλα στην παλιά εκκλησία. ΦΟΙΝΙΚΑΣ: Στο πάρκο, δίπλα στις εργατικές κατοικίες. ΔΕΝΔΡΟΠΟΤΑΜΟΣ: Οδός Νεκταρίου. ΚΥΜΙΝΑ / Ν. ΜΗΧΑΝΙΩΝΑ

πλοία 14944 ΛΗΜΝΟΣ - ΜΥΤΙΛΗΝΗ - ΧΙΟΣ - ΒΑΘΥ: Κάθε Δευτέρα στις 19.00 με το επιβατηγό οχηματαγωγό «Θεόφιλος». ΛΗΜΝΟΣ - ΜΥΤΙΛΗΝΗ - ΧΙΟΣ - ΠΕΙΡΑΙΑΣ: Κάθε Σάββατο στη 01.00 με το επιβατηγό οχηματαγωγό «Λισσός». Τηλέφωνο λιμεναρχείου Θεσσαλονίκης: 2310/593.147, 531.504 -5. Πληροφορίες: Καραχαρίσης Travel: 2310/522.716, 2310/522.736, 2310/524.544.

τρένα 1110 Από Θεσσαλονίκη για Αθήνα: 01:41IC, 07:13 ICE, 10:13, 11:40, 12:42, 14:54 IC, 16:33, 18:50 ICE, 22:59, 23:33. Λάρισα: 01:41, 10:13, 11:40, 14.54IC, 07:13, 18:50 ICE, 05:08, 06:08,08:08, 09:45, 12:15, 12:42,13:20, 14:10, 16:00, 16:33, 17:34, 17:59, 19:45, 21:05,22:09, 23:33. Σέρρες: 02: 01, 12:21, 18.25 IC, 06:04, 07:18, 13:02, 14:17. Δράμα: 02:01, 12:21, 18:25 IC, 06:04, 07:18, 13:02, 14:17, 19:38. Ξάνθη: 02:01, 12:21, 18:25 IC, 06:04, 07:18,

ερα ρ ί π τ ΟΤΑΝ Η ΖΩΗ ΓΙΝΕΤΑΙ ΤΑΞΙΔΙ!

ÔÏÈÙÈÎfi˜ – ¢‡Ô... ·fi ¤ÓÙÂ. 9. AÛÒÌ·ÙÔ – Y‡ı˘ÓÔ˜. 10. AÛ‡ÌʈÓÔ... ı¤Ì· – AÌÂÚÈηÓfi˜ ·ÛÙÚÔÓfiÌÔ˜ – ¢ÂÓ ·ÏÏ¿˙ÂÈ... Ë Ìfi‰· ÙÔ˘˜. 11. Z·Ê›Ú˘...: ÙÚ·ÁÔ˘‰ÈÛÙ‹˜ – °È· ÓÂfiÓ˘ÌÊÔ˘˜... ÙÔ˘ ̤ÏÈÙÔ˜. 12. B¿ÛÎÔÈ Ù· ̤ÏË Ù˘ – °¿ÏψÓ... Ê›ÏÔ˜ – ºÙËÓfi Ì·Ì·ÎÂÚfi ‡Ê·ÛÌ·. 13. NÂÔÏ·Ì‹˜ ·ÛÙ¤Ú·˜ – EÓ· ʈӋÂÓ – BÚÂÙ·ÓÈÎfi ÓËÛ›. 14. ¶ÚÔÊ‹Ù˘... ¯ÔÚÂ˘Ù·Ú¿˜ – K·ıÂÙ› ¿‚Ô˘ÏÔ (ÌÙÊ.).

1 2 3 4 5 6 7 8 9 10 11 12 13 14

ΑΙΓΟΚΕΡΩΣ (22 Δεκεμβρίου – 19 Ιανουαρίου)

τουριστικό, πολιτιστικό Ù Â Ú ·περιοδικό ·  Â Ú ›  αποδράσεις! Û Ùπολλαπλές για

το σταυρόλεξο 1

ζώδια ΚΡΙΟΣ

Πέµπτη 15 Απριλίου 2010

ΚΤΕΛ 14505 ΤΕΡΜΑΤΙΚΟΣ ΣΤΑΘΜΟΣ «ΜΑΚΕΔΟΝΙΑ» Γιαννιτσών 194, τηλ. 231.0.595408, ΘΕΣΣΑΛΟΝΙΚΗΣ (Για Αθήνα) 231.0.595411 – 421 και Μοναστηρίου 67 τηλ. 231.0.510834, 516104. ΑΤΤΙΚΗΣ τηλ. 231.0.595413, ΚΟΙΝΟΠΡΑΞΙΑ «ΜΑΚΕΔΟΝΙΑ» (Για Αθήνα) τηλ. 231.0.595444-495. ΞΑΝΘΗΣ τηλ. 231.0.595.423. ΓΡΕΒΕΝΩΝ – ΦΛΩΡΙΝΑΣ τηλ. 231.0.595485-418. ΔΡΑΜΑΣ τηλ. 231.0.595420. ΠΙΕΡΙΑΣ τηλ. 231.0.595428. ΛΑΡΙΣΑΣ τηλ. 231.0.595.430-487. ΙΩΑΝΝΙΝΩΝ τηλ. 231.0.595.442. ΜΑΓΝΗΣΙΑΣ – ΦΩΚΙΔΑΣ – ΧΑΝΙΩΝ – ΡΕΘΥΜΝΟΥ – ΗΛΕΙΑΣ – ΑΙΤΩΛΟΑΚΑΡΝΑΝΙΑΣ τηλ. 231.0.595424-491. ΑΧΑΪΑΣ – ΚΑΡΔΙΑΣ – ΑΡΓΟΛΙΔΑΣ τηλ. 231.0.595.425. ΕΒΡΟΥ – ΛΕΥΚΑΔΑΣ τηλ. 231.0.595439. ΘΕΣΠΡΩΤΙΑΣ – ΦΘΙΩΤΙΔΑΣ τηλ. 231.0.595416. ΚΑΒΑΛΑΣ τηλ. 231.0.595422. ΗΜΑΘΙΑΣ τηλ. 231.0.595432. ΚΙΛΚΙΣ τηλ. 231.0.595433. ΠΕΛΛΑΣ τηλ. 231.0.595434435. ΕΥΒΟΙΑΣ τηλ. 231.0.595448. ΣΕΡΡΩΝ

Á·ÏÂ›Ô – OÏÏ·Ó‰fi˜ ˙ˆÁÚ¿ÊÔ˜. 7. øÚ·›· ÎÔ¤Ï· – O ZÔÏ¿. 8. I¿Îˆ‚Ô˜... ͤÓÔ˜ – AıËÓ·˚Îfi ÚÔ¿ÛÙÈÔ – MÈÛ‹... ʤٷ. 9. §ÂÁfiÙ·Ó ¶ÂÚÛ›· – H ÚˆÙÂ‡Ô˘Û· ÙÔ˘ BÈÂÙÓ¿Ì – ... ˜ ™·Ï¿Ì: fiÏË Ù˘ T·Ó˙·Ó›·˜. 10. MË ÔÌfi˯· ʈӋÂÓÙ· – •ÂÓÈÎfi ̤ÙÚÔ ÂÈÊ·ÓÂÈÒÓ – E˘ÙÂϤ˜ Î·È Ê·ÓÙ·¯ÙÂÚfi ÎfiÛÌËÌ·. 11. MÔ˘ÛÈÎfi˜ fiÚÔ˜ – £ÂÚ·‡ÛÈÌ·. 12. TÔ ÁÚ·ÌÌÔÌfiÚÈÔ – ™˘ÓËıÈṲ̂ÓÔ˜ – ... ÌÚ¤ÈÎ: fiÚÔ˜ ÙÔ˘ ‚fiÏÂ˚. 13. MÂÚÈÎÔ› ÙÔ Î¿ÓÔ˘Ó... Ì·‡ÚÔ – Afi ¯¿Ï˘‚· Â›Ó·È ÊÙÈ·Á̤ÓÔ. H χÛË ÙÔ˘ ÚÔËÁÔ‡ÌÂÓÔ˘ ÛÙ·˘ÚÔϤÍÔ˘. 1 2 3 4 5 6 7 8 9 10 11 12 13 14

1

2

3

4

5

6

7

8

9

10

11

12

13

¶ A P A T P E X A M E N O ™

O N ø P I O ™

N A ™ A

T M

I M A T Z

K A M

O

¶ A P T A § I

A º

° A T I A

I T A

¢ E K A T O

A ™ T P A ¶ I A I A

™ ¶ E I P A

M A § T A N O K

N T A P I § A O A

¶ A M I P T K

A ° A N A § A ™ I

A N K A A ™ K E P I

K E N T P A

E P A ™ M O ™ A I P

K A T A P ° A

N T A N T O K O ™

T ™ I T A T A

N O P

τηλ. 231.0.595446-464. ΚΟΖΑΝΗΣ τηλ. 231.0.595.484-445. ΚΑΣΤΟΡΙΑΣ – ΚΑΡΔΙΤΣΑΣ τηλ. 231.0.595440-441. ΤΡΙΚΑΛΩΝ – ΚΟΡΙΝΘΟΥ τηλ. 231.0.595405. ΗΡΑΚΛΕΙΟΥ – ΛΑΣΙΘΙΟΥ τηλ. 231.0.595409. ΚΕΡΚΥΡΑΣ – ΜΕΣΣΗΝΙΑΣ – ΠΡΕΒΕΖΑΣ – ΑΡΤΑΣ τηλ. 231.0.595406. ΖΑΚΥΝΘΟΥ τηλ. 231.0.595.411.421. ΧΑΛΚΙΔΙΚΗΣ τηλ. 231.0.316555.

ραδιοταξί «ΑΛΦΑ ΛΕΥΚΟΣ ΠΥΡΓΟΣ» 2310/214.900 και 2310/218.600. «ΜΑΚΕΔΟΝΙΑ» 2310/550.500. «EUROTAXI» 2310/866.866, 511.855,551.525. «MERCEDES CLUB» 2310/525.000.

πτήσεις OLYMPIC AIR, τηλ. 801 801 01 01 (από σταθερό) 210/3550500 (από κινητό) AEGEAN AIRLINES, τηλ. 8011120000 BRITISH AIRWAYS, τηλ. 8011156000 AUSTRIA, τηλ. 2310/474.190 EASY JET, τηλ. 210/3530300, 210/3530276 ALITALIA, τηλ. 2310/383.414, 8011150055 MALEV, τηλ. 2310/475.740 VIMAVIA, τηλ. 2310/519289, 2310/473.354 JAT AIRWAYS, τηλ. 2310/383130, 2310/ 2310/233.188


Πέµπτη 15 Απριλίου 2010

Οι προαναγγελίες των Γάμων δημοσιεύονται στις σελίδες των Μικρών Αγγελιών.

ΚΗΔΕΙΑ Τον αγαπημένο μας γιο, εγγονό και φίλο ΠΡΟΚΟΠΗ ΤΣΙΚΟΥΝΤΟΥΡΑ ετών 26 κηδεύουμε σήμερα, 10 π.μ., από τον ιερό ναό Κοιμήσεως της Θεοτόκου Ν. Μεσήμβριας. Παρακαλούνται οι συγγενείς και φίλοι να συνοδεύσουν την εκφορά. Οι γονείς: Ηλίας – Ζαφειρούλα. Η γιαγιά: Δέσποινα. Οι συγγενείς. Οι φίλοι. Η δεξίωση θα γίνει σε αίθουσα του ναού.

ΠΕΝΘΗ Την αγαπημένη μας μητέρα, γιαγιά και θεία ΕΛΙΣΑΒΕΤ ΦΑΡΣΑΚΗ ετών 85 κηδεύσαμε την Τετάρτη 14 Απριλίου, 12 μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Τα παιδιά: Δημήτρης – Μαρία, Λάζαρος – Ελένη. Τα εγγόνια: Ελισάβετ, Κωνσταντίνος, Ελισάβετ, Αλέξιος-Αβραάμ. Τα ανίψια. Οι συγγενείς. Οι φίλοι. Την τελετή επιμελήθηκε ο οίκος τελετών «Παχούμη – από το 1955». Τον αγαπημένο μας πατέρα, αδελφό και παππού ΑΝΘΙΛΑΟ ΤΣΙΓΑΡΑ ετών 86 κηδεύσαμε την Τετάρτη 14 Απριλίου, 11 π.μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Τα παιδιά: Γεώργιος – Ευδοξία. Τα αδέλφια. Τα εγγόνια: Ανθίλαος, Αρχοντία. Οι συγγενείς. Οι φίλοι. Την τελετή επιμελήθηκε ο οίκος τελετών «Παχούμη – από το 1955». Την αγαπημένη μας σύζυγο, μητέρα, αδελφή, γιαγιά και θεία ΑΝΤΩΝΙΑ ΧΑΤΖΗΒΓΕΡΗ ετών 74 κηδεύσαμε την Τετάρτη 14 Απριλίου, 4 μ.μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Ο σύζυγος: Μιλτιάδης. Τα παιδιά: Ελένη – Γιώργος. Τα αδέλφια. Τα εγγόνια: Στέφανος, Μιλτιάδης. Τα ανίψια. Οι συγγενείς. Την τελετή επιμελήθηκε ο οίκος τελετών «Δημήτριος Χρ. Τσίγκρος».

Την αγαπημένη μας θεία ΑΙΚΑΤΕΡΙΝΗ ΚΟΝΙΔΑΡΗ ετών 91 κηδεύσαμε την Τετάρτη 14 Απριλίου, 12 μ., από τον ιερό ναό Αγίου Παύλου κοιμητηρίων Μαλακοπής. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Τα ανίψια: Σπύρος, Κωνσταντίνος. Οι συγγενείς. Την τελετή επιμελήθηκε ο οίκος τελετών «Στέλιος Μπαμπούλας», Κασσάνδρου 132. Την αγαπημένη μας μητέρα, αδελφή, γιαγιά και θεία ΒΙΚΤΩΡΙΑ ΣΥΡΙΩΔΗ ετών 59 κηδεύσαμε την Τετάρτη 14 Απριλίου, 12 μ., από τον ιερό ναό Οσίας Ξένης Χαριλάου Μαρασλή. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Τα παιδιά: Πέτρος – Ναταλία. Τα αδέλφια: Φώτης, Γιάννης, Κώστας, Μαίρη, Ελένη. Ο εγγονός: Σωτήρης. Τα ανίψια. Οι συγγενείς. Τον αγαπημένο μας σύζυγο, πατέρα, αδελφό και θείο ΜΙΧΑΗΛ ΚΑΪΣΕΡΛΙΔΗ ετών 67 κηδεύσαμε την Τετάρτη 14 Απριλίου, 6 μ.μ., από τον ιερό ναόΑγίων Κωνσταντίνου και Ελένης Ξηροχωρίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Η σύζυγος: Αποστολία. Τα παιδιά: Λεωνίδας – Ασαλία, Ελισσάβετ. Τα αδέλφια: Σεβαστή, Μακρίνα, Βασιλική. Τα ανίψια. Οι συγγενείς. Τον αγαπημένο μας σύζυγο, πατέρα, αδελφό, παππού και θείο ΕΥΣΤΡΑΤΙΟ ΓΚΑΓΚΑΝΗ ετών 74 κηδεύσαμε την Τετάρτη 14 Απριλίου, 10.30 π.μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Η σύζυγος: Ανδρομάχη. Τα παιδιά: Σταύρος – Μαρία, Ελενα – Γιώργος, Αλεξάνδρα. Τα αδέλφια: Κωνσταντίνος – Χριστίνα, Φιλιώ – Κωνσταντίνος. Τα εγγόνια: Ανδρομάχη, Στράτος, Ελισσάβετ, Γιάννης. Τα ανίψια. Οι συγγενείς. Την αγαπημένη μας μητέρα και γιαγιά ΜΑΡΙΑ ΜΑΝΕΤΑ ετών 96 κηδεύσαμε την Τετάρτη 14 Απριλίου, 10 π.μ., από τον ιερό ναό Αγίου Αθανασίου Ευόσμου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Ο γιος: Βασίλειος. Τα εγγόνια: Αντώνης – Φωτεινή. Οι συγγενείς.

ΕΙ∆ΙΚΟΙ ΣΤΙΣ ΑΠΟΤΕΦΡΩΣΕΙΣ

«ΤΣΕΠΑ» Τηλ.: 2310-555.106. fax 2310-555.107 κιν. 6946-81.71.71 1)Αγίου ∆ηµητρίου 41 (δίπλα στην ∆ΕΗ) 2) Μελισσοχώρι 3) ∆ρυµός

Α. ΜΑΜΑΛΗΣ ΓΡΑΦΕΙΑ ΤΕΛΕΤΩΝ α) Αγ. ∆ηµητρίου 172, τηλ. 2310-205.429 β) Αλ. Παπαναστασίου 137, τηλ. 2310-304.314 γ) Ν. Ρύσιο, τηλ. 23920-71023

ΤΕΚΤΟΝΙ∆ΗΣ Με τη µεγαλύτερη επιµέλεια 1) Π. Παπαγεωργίου 6, 2) Εγνατία 83

2310-276 010, 2310- 239 870, 6932 764 041

ΠΕΝΘΟΣ Την πολυαγαπημένη μας μητέρα, αδελφή, γιαγιά, προγιαγιά και θεία ΑΛΕΞΑΝΔΡΑ ΜΠΑΝΤΗ ετών 80 κηδεύσαμε την Τετάρτη 14 Απριλίου, 12 μ., από τον ιερό ναό Αγίου Φωτίου Ποσειδωνίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Τα παιδιά. Τα αδέλφια. Τα εγγόνια. Ο δισεγγονός. Τα ανίψια. Οι συγγενείς. Οι φίλοι. Την τελετή επιμελήθηκε ο οίκος τελετών «Παχούμη – από το 1955».

ΠΕΝΘΟΣ Την πολυαγαπημένη μας μητέρα και γιαγιά ΜΑΡΘΑ ΠΟΝΤΙΚΟΥ (ΑΠΟΣΤΟΛΙΔΟΥ) κηδεύσαμε την Τετάρτη 14 Απριλίου, 4.30 μ.μ., από τον ιερό ναό Αγίου Γεωργίου Πανοράματος. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Τα παιδιά: Ευγενία - Θεοφάνης. Η εγγονή: Ευλαμπία. Οι συγγενείς. Οι φίλοι. Την τελετή επιμελήθηκε ο οίκος τελετών «Παχούμη – από το 1955».

ΜΝΗΜΟΣΥΝΑ Τελούμε την Κυριακή 18 Απριλίου, 9.30 π.μ., στον ιερό ναό Κοιμήσεως της Θεοτόκου Κορησού Καστοριάς, τεσσαρακονθήμερο μνημόσυνο υπέρ αναπαύσεως της ψυχής του αγαπημένου μας συζύγου, πατέρα, παππού, προπαππού και θείου ΒΑΣΙΛΕΙΟΥ ΡΟΥΚΑ Η σύζυγος: Αντιγόνη. Τα παιδιά: Αθανασία – Χρήστος, Αργυρώ – Κωνσταντίνος, Γιώργος – Ελένη. Τα εγγόνια. Τα δισέγγονα. Τα ανίψια. Οι συγγενείς. Η δεξίωση θα γίνει σε αίθουσα του ναού. Την τελετή επιμελείται ο οίκος τελετών «Στέλιος Μπαμπούλας», Κασσάνδρου 132. Τελούμε το Σάββατο 17 Απριλίου, 11 π.μ., στον ιερό ναό Αναστάσεως του Κυρίου, τεσσαρακονθήμερο μνημόσυνο υπέρ αναπαύσεως της ψυχής του αγαπημένου μας συζύγου, πατέρα, αδελφού, παππού και θείου

ΓΙΑΝΝΟΥΚΑΚΟΣ ΚΗ∆ΕΙΕΣ ΜΝΗΜΟΣΥΝΑ Εγνατία 101 - Εξαδακτύλου 6 τηλ. 2310 275.843, 264.661 6944-712654

ΓΡΑΦΕΙΟ ΤΕΛΕΤΩΝ

ΑΝΑΣΤΑΣΙΑ∆Η Αγν. Στρατιώτη 32

Τηλ.: 2310 - 610.666, 6937-437.288 6936-699.218 Fax: 2310-610.800 ΓΡΑΦΕΙΟ ΤΕΛΕΤΩΝ & ΜΝΗΜΟΣΥΝΩΝ ΠΑΡΑΣΚΕΥΟΠΟΥΛΟΣ ΓΙΑΝΝΗΣ (δίπλα στο παλιό γραφείο) Ν. Παρασκευά 2 (Παραπλεύρως Τράπεζας Πειραιώς), Συκιές Τηλ.: 2310-622.642, Κιν.: 6944.420.058

ΚΩΝΣΤΑΝΤΙΝΟΥ ΣΤΟΛΤΙΔΗ Εργολάβου οικοδομών Η σύζυγος: Ελένη. Τα παιδιά: Χριστίνα, Δήμητρα – Νικόλαος, Ευφροσύνη – Ιωάννης. Τα αδέλφια: Ζηνοβία, Πελαγία – Αθανάσιος. Τα εγγόνια: Κωνσταντίνος, Ιωάννης, Ελένη. Τα ανίψια. Οι συγγενείς. Η δεξίωση θα γίνει στην αίθουσα «Η Ανάστασις» του οίκου τελετών «Στέλιος Μπαμπούλας», παραπλεύρως κοιμητηρίων. Την τελετή επιμελείται ο οίκος τελετών «Στέλιος Μπαμπούλας», Κασσάνδρου 132. Τελούμε την Κυριακή 18 Απριλίου, 10.15 π.μ., στον ιερό ναό Αγίας Σοφίας, τεσσαρακονθήμερο μνημόσυνο υπέρ αναπαύσεως της ψυχής του αγαπημένου μας συζύγου, γιου, αδελφού και θείου ΔΗΜΗΤΡΙΟΥ ΔΑΡΔΑΒΕΣΗ Ιατρού ορθοπεδικού Η σύζυγος: Μαρία. Οι γονείς: Αννα, Σπύρος – Ευαγγελία Κυρίτση. Τα αδέλφια: Θεόδω-

ΧΑΤΖΗΒΑΡΙΤΗΣ

ΚΗΔΕΙΑ Την αγαπημένη μας μητέρα και γιαγιά ΘΑΛΕΙΑ ΚΟΜΝΗΝΟΥ κηδεύουμε σήμερα, 6 μ.μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Παρακαλούνται οι συγγενείς και φίλοι να συνοδεύσουν την εκφορά. Τα παιδιά: Ξενοφών – Ρεγγίνα. Τα εγγόνια: Αγγελος – Παναγιώτης, Χριστίνα. Οι συγγενείς. Η σορός θα εκτίθεται από τις 4 μ.μ. στα νεκροστάσια «Η Ανάστασις» του οίκου τελετών «Φάνης Μπαμπούλας». Αναχώρηση με λεωφορείο στις 5 μ.μ. από την οικία μας, Τσόπελα 4. Η δεξίωση θα γίνει στην αίθουσα «Η Ανάστασις» του οίκου τελετών «Φάνης Μπαμπούλας», παραπλεύρως κοιμητηρίων. Την τελετή επιμελείται ο οίκος τελετών «Φάνης Μπαμπούλας», Βασ. Ολγας 72 (δίπλα στο εστιατόριο «Καμμένη γωνιά»), από το 1975.

ΠΕΝΘΟΣ Την πολυαγαπημένη μας σύζυγο, μητέρα, αδελφή, γιαγιά και θεία ΦΙΛΑΡΕΤΗ ΣΟΥΛΙΩΤΗ ετών 67 κηδεύσαμε την Τετάρτη 14 Απριλίου, 5 μ.μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Ευχαριστούμε θερμά όλους όσοι μας συμπαραστάθηκαν στο βαρύ μας πένθος. Ο σύζυγος: Κωνσταντίνος. Τα παιδιά: Σοφία – Ιωάννης. Τα αδέλφια. Τα εγγόνια: Φιλαρέτη, Πάρις, Αναστασία. Τα ανίψια. Οι συγγενείς. Οι φίλοι. Την τελετή επιμελήθηκε ο οίκος τελετών «Παχούμη – από το 1955». ρος – Μαρία, Χρήστος Κυρίτσης. Τα ανίψια: Γιάννης, Κωνσταντίνος. Οι συγγενείς. Η δεξίωση θα γίνει σε αίθουσα του ξενοδοχείου «Ηλέκτρα Παλλάς». Την τελετή επιμελείται ο οίκος τελετών «Στέλιος Μπαμπούλας», Κασσάνδρου 132. Τελούμε την Κυριακή 18 Απριλίου, 10.30 π.μ., στον ιερό ναό Αναλήψεως, τεσσαρακονθήμερο μνημόσυνο υπέρ αναπαύσεως της ψυχής της αγαπημένης μας συζύγου, μητέρας, αδελφής, γιαγιάς και θείας ΕΛΙΣΑΒΕΤ ΡΕΤΣΙΝΑ Ο σύζυγος: Νικόλαος. Τα παιδιά: Δήμητρα – Ιωάννης. Τα αδέλφια: Ιωάννης – Ελένη. Τα εγγόνια: Ελισσάβετ, Βασίλης. Τα ανίψια. Οι συγγενείς. Η δεξίωση θα γίνει σε αίθουσα του ναού.

Την τελετή επιμελείται ο οίκος τελετών «Στέλιος Μπαμπούλας», Κασσάνδρου 132. Τελούμε την Κυριακή 18 Απριλίου, 10 π.μ., στον ιερό ναό Λαοδηγήτριας, τεσσαρακονθήμερο μνημόσυνο υπέρ αναπαύσεως της ψυχής του αγαπημένου μας συζύγου, πατέρα, αδελφού, παππού και θείου ΑΝΑΣΤΑΣΙΟΥ ΚΥΡΙΑΚΙΔΗ Η σύζυγος: Αικατερίνη. Τα παιδιά: Διογένης – Γεωργία, Κωνσταντίνα – Γιώργος. Τα αδέλφια: Αριστοτέλης – Καίτη, Παναγιώτα. Τα εγγόνια: Δέσποινα – Αλέξανδρος, Κατερίνα, Κατερίνα. Τα ανίψια. Οι συγγενείς. Η δεξίωση θα γίνει σε αίθουσα του ναού. Την τελετή επιμελείται ο οίκος τελετών «Στέλιος Μπαμπούλας», Κασσάνδρου 132.

ΟΙΚΟΣ ΤΕΛΕΤΩΝ 28ης Οκτωβρίου 46 µε ∆ελφών Τηλ.: 2310-860.501, 6945-430.254

1. Μιχαήλ Καραολή 2, Συκιές Τηλ.: 2310-639509 2. Νικοτσαρά 1 µε Αγγελάκη, γωνία 2310-280148 Κιν. (Σάκης): 6944-389902

1)Κ. Καραµανλή 107 - 2310-925.949 2) Μεταµορφώσεως 2, Περαία - 23920.21289

ΓΡΑΦΕΙΑ ΤΕΛΕΤΩΝ

ΚΗΔΕΙΑ Τον πολυαγαπημένο μας πατέρα, αδελφό, παππού και θείο ΙΩΑΝΝΗ ΜΑΝΩΛΟΓΛΟΥ ετών 82 κηδεύουμε σήμερα, 4 μ.μ., από τον ιερό ναό Αναστάσεως του Κυρίου. Παρακαλούνται οι συγγενείς και φίλοι να συνοδεύσουν την εκφορά. Τα παιδιά: Χαράλαμπος – Ευθυμία, Ελισάβετ – Θεόδωρος. Τα αδέλφια. Τα εγγόνια: Ελλη, Ιωάννης, Σπυρίδων, Ελένη. Τα ανίψια. Οι συγγενείς. Οι φίλοι. Η σορός θα εκτίθεται από τη 1 μ.μ. στα νεκροστάσια του οίκου τελετών «Παχούμη», παραπλεύρως κοιμητηρίων. Η δεξίωση θα γίνει στις αίθουσες του οίκου «Παχούμη», παραπλεύρως κοιμητηρίων. Την τελετή επιμελείται ο οίκος τελετών «Παχούμη – από το 1955».

ΠΑΡΑΣΚΕΥΟΠΟΥΛΟΣ ∆ΗΜΗΤΡΙΟΣ

ΑΡΗ ΚΑΡΒΟΥΝΙ∆Η

ΣΕΒΑΣΜΟΣ - ΕΞΥΠΗΡΕΤΗΣΗ Β. Όλγας 41 (απέναντι από τη Σχολή Τυφλών) τηλ. 2310-830.924 www.daraviga.gr

ΜΝΗΜΟΣΥΝΟ Τελούμε το Σάββατο 17 Απριλίου, 10 π.μ., στον ιερό ναό Αγίων Κυρίλλου και Μεθοδίου, ετήσιο μνημόσυνο υπέρ αναπαύσεως της ψυχής της αγαπημένης μας αδελφής και θείας ΑΝΤΑΣ ΚΥΡΙΑΖΗ-ΠΑΠΑΚΩΝΣΤΑΝΤΙΝΟΥ Τα αδέλφια: Κώστας – Βάσω Παπακωνσταντίνου. Τα ανίψια: Βασίλης – Σοφία, Γιάννης – Αντυ. Οι συγγενείς. Η δεξίωση θα γίνει σε αίθουσα του ναού. Την τελετή επιμελείται ο οίκος τελετών «Φάνης Μπαμπούλας», Βασ. Ολγας 72 (δίπλα στο εστιατόριο «Καμμένη γωνιά»), από το 1975.

ΟΙΚΟΣ ΤΕΛΕΤΩΝ

ΟΙΚΟΣ ΤΕΛΕΤΩΝ

ΟΙΚΟΣ ∆ΑΡΑΒΙΓΚΑ

47

ΚΟΙΝΩΝΙΚΑ

ΕΥΘΥΜΙΟΣ ΜΠΑΤΖΗΣ ΓΡΑΦΕΙΟ ΤΕΛΕΤΩΝ Αγγελάκη 5 τηλ.: 2310-22.62.52 Κιν. 6932-728.760

ΑΠΟΤΕΦΡΩΣΕΙΣ

ΤΣΙΓΚΡΟΣ ΧΡ. ∆ΗΜΗΤΡΗΣ ΟΙΚΟΣ ΤΕΛΕΤΩΝ

Κωνσταντινουπόλεως 34, Τηλ.: 2310-843.648,845.230 fax 2310-826.373

ΟΙΚΟΣ «∆Ε∆ΟΣ» ∆ελφών 34, Θεσσαλονίκη Τηλ.: 2310-869.235, 2310-869.236

ΣΤΕΛΙΟΣ ΜΠΑΜΠΟΥΛΑΣ ΟΙΚΟΣ ΤΕΛΕΤΩΝ ΠΑΡΑΠΛΕΥΡΩΣ ΚΟΙΜΗΤΗΡΙΩΝ ΑΝΑΣΤΑΣΕΩΣ ΤΟΥ ΚΥΡΙΟΥ ΚΕΝΤΡΙΚΟ: ΚΑΣΣΑΝΔΡΟΥ 132 - ΘΕΣ/ΝΙΚΗ ΤΗΛ.: 2310 21.21.70, 2000.15 - ΚΙΝ.: 6977 597464 - FAX: 2310 203 691 www.baboulas.com

«Α. ΠΑΥΛΙ∆ΗΣ»

TEΛETAI

ΟΙΚΟΣ ΤΕΛΕΤΩΝ, από το 1968 1) Αγγελάκη 27, τηλ. 2310-273.414, 2310-273.352 2) Βασιλίσσης Ολγας 94, τηλ. 2310-831.064, 2310-831.065 Κινητά:6972-495.431, 6944-860.760

αφοι

χρυσιδη

OΛYMΠOY 118, τηλ. 2310 20.00.20 - 213.914 FAX: 2310 218.737 • M E TA Φ O P E Σ E Σ Ω T E P I K OY - E Ξ Ω T E P I K OY •

AΠOTEΦPΩΣEIΣ

• MNHMOΣYNA

«ΚΩΝΣΤΑΝΤΙΝΙ∆ΗΣ»

ΦΑΝΗΣ ΜΠΑΜΠΟΥΛΑΣ

Αγ. ∆ηµητρίου 157 Τηλ.: 2310-204615, 2310-205404

• Βασ. Ολγας 72 (Δίπλα στο εστιατόριο «Καμμένη γωνιά»)τηλ. 2310-869.250-1 • Ιδιόκτητος Οίκος Τελετών «Η ΑΝΑΣΤΑΣΙΣ», παραπλεύρως κοιμητηρίων Αναστάσεως Του Κυρίου ΚΙΝΗΤΟ: 6944 315827 SITE: www.baboulas.gr email: Info@baboulas.gr

ΟΙΚΟΣ ΤΕΛΕΤΩΝ


Σφυρηλατήσεις... ακινήτων

Εµµονές Η αξιολόγηση των καθηγητών, ο περιορισµός των αποσπάσεων, η επιλογή µέσω του ΑΣΕΠ είναι απαραίτητα µέτρα εκσυγχρονισµού ενός χώρου που κατεξοχήν επιβάλλεται να διακρίνεται από αξιοκρατία. Αλλά γιατί αυτή η εµµονή του ΠΑΣΟΚ να καταργηθεί η βάση του «δέκα»; Ενδεχοµένως, το µέτρο δε βοήθησε ώστε «να έχουµε καλύτερους φοιτητές σε ΑΕΙ και ΤΕΙ από εκείνους που είχαµε το 2006», όπως επιµένει το βασικό επιχείρηµα της υπουργού Παιδείας. Σίγουρα, όµως, βοήθησε ώστε να µη χάσουν πολύτιµο χρόνο από τη ζωή τους παιδιά που δεν έχουν καηµό να σπουδάσουν. Βοήθησε, επίσης, να µην ξοδέψουν οι γονείς τους χρήµα που δεν περισσεύει. Γιατί, κακά τα ψέµατα! Αυτό συνέβαινε µε τα περισσότερα παιδιά που εισάγονταν στην τριτοβάθµια εκπαίδευση µε τεσσάρια και πεντάρια. Πήγαιναν, γράφονταν και ύστερα από λίγο διαπίστωναν είτε ότι δεν µπορούσαν να παρακολουθήσουν το πρόγραµα σπουδών είτε ότι το αντικείµενο δεν τους ενδιέφερε -συνήθως το δεύτερο. Στο µεταξύ, TOY MAKH BOΪTΣI∆H ποιος γονιός mvoitsidis@the.forthnet.gr µπορεί να πει στο παιδί του ότι στο τέλος όλο αυτό θα αποδειχθεί άδικος κόπος; Κανένας. Ολοι αισθάνονται υποχρεωµένοι να χρηµατοδοτήσουν σπουδές, που στις περισσότερες περιπτώσεις δεν οδηγούν πουθενά. Το λέει µια απλή αντιπαράθεση των αριθµών -πόσοι εισάγονται µε µονοψήφιο µέσο όρο βαθµολογίας, ιδιαίτερα σε «εξωτικά» ΤΕΙ της περιφέρειας και πόσοι αποφοιτούν; Απ’ όλο αυτό το πανηγύρι, οι µόνες που βγαίνουν ωφεληµένες είναι οι «τοπικές κοινωνίες» που περιµένουν πώς και πώς τους φοιτητές για να νοικιάσουν διαµερίσµατα και να δουλέψουν καφετερίες και φαστφουντάδικα. Και τέλος πάντων, ας πούµε ότι είναι κι αυτή µια αντίληψη για τη made in Greece ανάπτυξη. Να κυκλοφορεί το χρήµα. Ακριβώς η αντίληψη που σκόρπισε στην Ελλάδα σχολές ως υποκατάστατα των στρατοπέδων -κάθε πόλη και ΑΕΙ, κάθε χωριό και ΤΕΙ. Αλλά τέσσερα χαµένα χρόνια σ’ αυτήν την ηλικία είναι πολύτιµα και δεν υπάρχει λόγος να ξοδεύονται. Είναι πολύ προτιµότερο να ενθαρρυνθούν οι αδύναµοι µαθητές να αναζητήσουν εγκαίρως αλλού τον επαγγελµατικό προσανατολισµό τους. Ούτε είναι επιχείρηµα ότι µε τη βάση του «δέκα» έχουµε καθηγητές και διοικητικό προσωπικό χωρίς αντικείµενο εργασίας και υποδοµές που υπολειτουργούν. Αυτό είναι το ζητούµενο; Επειδή κάπου, κάποτε, ιδρύθηκε ένα ΤΕΙ για λόγους τοπικής σκοπιµότητας και χωρίς εκπαιδευτικό σχεδιασµό, πρέπει να διατηρηθεί µε το ζόρι ώστε να απορροφά και άλλα χρήµατα από το δηµόσιο προϋπολογισµό; Ειδικά αυτόν τον καιρό, άλλωστε, δεν υπάρχουν περιθώρια για τέτοιες πολυτέλειες...

Εκρηξη ηφαιστείου προκαλεί... πληµµύρα στην Ισλανδία

Φωτογραφία Associated Press

Εκατοντάδες άνθρωποι αναγκάστηκαν να εγκαταλείψουν τις κατοικίες τους γύρω από την περιοχή του ηφαιστείου Αγιαφιγιαπλαγιουρκούλ, στην Ισλανδία, αφού εκείνο εξερράγη µε αποτέλεσµα ο τοπικός παγετώνας ν’ αρχίζει να λιώνει και να προκαλείται πληµµύρα. Λευκός ατµός και µαύρη τέφρα εκτινάσσονται από τον κρατήρα του ηφαιστείου, που βρίσκεται κάτω από 200 µέτρα πάγου.

Η Εγνατία και τα διόδια στο καναβάτσο

Πέµπτη 15 Απριλίου 2010

το οπισθόφυλλο

παραβολές

Ο δρόμος αυτός, που άλλαξε τα δεδομένα του Βορρά, επιτρέποντας αυθημερόν επικοινωνίες με αστικά κέντρα, ΤΟΥ ΠANOY ΘEO∆ΩPI∆H που χωρίζονταν από δρόpetefris@otenet.gr μους - παγίδες, κατοικημένα από συμπατριώτες που θεωρούσαν κατόρθωμα να επισκεφθούν τα Γιάννενα από τη Βέροια, έχει μπροστά του ένα μείζον πρόβλημα, που μπορεί και να καταστρέψει το σκοπό της κατασκευής του: σταθμούς διοδίων σε πάρα πολλά σημεία. Ορθότατα ο Γιάννης Μαγκριώτης υποσχέθηκε ηλεκτρονικά διόδια. Τον πιστεύω, αλλά πιστεύω επίσης ότι θα καταλήξουν οι εκτελεστικοί του συμπαραστάτες στα επικίνδυνα, τραγικώς παρωχημένα διόδια πάνω στο κατάστρωμα του αυτοκινητοδρόμου. Σε Ιταλία και Γαλλία, που το έζησα, όλοι οι αυτοκινητόδρομοι έχουν ελάχιστα τέτοιου τύπου διόδια, κυρίως στις περιφέρειες μεγάλων

πόλεων, όπου οι αυτοκινητόδρομοι λειτουργούν και ως περιφερειακές λεωφόροι. Παντού αλλού τα διόδια χτίζονται παροδίως, στους κόμβους. Οπως πρέπει να γίνει και στην Εγνατία. Να μπαίνεις από οπουδήποτε, παραλαμβάνοντας μια κάρτα και βγαίνοντας από οπουδήποτε να πληρώνεις ανάλογα με το χιλιόμετρο

και το κόστος κατασκευής του δρόμου. Αυτή η κλασική, μη ηλεκτρονική μορφή (έχει και πολύ πιο τέλειες...) έχει απέναντί της το μπετόν των μικροτοπικών συμφερόντων. Δεν είναι μακριά η εποχή που οι εξ Ηπείρου καταγόμενοι υπουργοί και υφυπουργοί υπόσχονταν μια Ηπειρο ελεύθερη διοδίων. Είναι γεγονός ότι γύρω από τη Θεσσαλονίκη δεν μπορεί να λειτουργήσουν διόδια, επειδή κόβεται η ανάπτυξη τελείως. Μια ζώνη 25 ή 30 χιλιομέτρων ολόγυρα πρέπει να μην έχει διόδια, οπότε και οι κόμβοι θα είναι ελεύθεροι. Αλλά στα υπόλοιπα κι εφόσον η Εγνατία ολοκληρώθηκε με δάνειο που πρέπει να εξοφληθεί, δεν της χρωστάει κάτι ο Κρητικός που παλεύει με το δικό του οδικό άξονα. Ο δρόμος εξοφλείται και συντηρείται από τους χρήστες του. Για τη μη χρήση των κόμβων σε διόδια άκουσα πλήθος από κουφαμάρες, όπως τι θα γίνει με τα αιγοπρόβατα που μπαινοβγαίνουν από εκεί. Μόνον με εγκατάσταση διοδίων δεν υπάρχει περίπτωση να σκοτωνόμαστε στην Εγνατία, επειδή οι τσοπάνηδες συνομιλούν με τους γενναίους αρματολούς. Η Εγνατία είναι κάτι παραπάνω από στοίχημα. Δεν είναι ζήτημα υπερβολικής ταχύτητας και άλλων σαλτανατιών. Από τη Θεσσαλονίκη, υπό οριακές συνθήκες, μπορώ να πηγαίνω Κέρκυρα και Εβρο και να επιστρέφω αυθημερόν. Μια φαρδιά ζώνη εκατέρωθεν του δρόμου, εκατό χιλιομέτρων, επιτρέπει απρόσκοπτη βελτίωση των όρων ζωής. Και είναι από τους δρόμους που αν δε συντηρούνται τους χάνεις. Μέσα σε ένα χρόνο λειτουργίας, έχω έναν κατάλογο από προβληματάκια που εύκολα μπορεί να γίνουν σοβαρές εμπλοκές. Ξεκινώντας, βέβαια, από τις καντίνες σε Μάλγαρα και Πολύμυλο, που μάλλον θα μετεξελιχθούν σε οικισμό…


φωνή Πέµπτη 15 Απριλίου 2010

ΓΙΑ Ζ. ΚΟΣΤΑ

ΤΩΝ ΣΠΟΡ

ΗΡΑΚΛΗΣ

Ενα βήµα πριν από τη συµφωνία µε Μπουµπένκο σελ. 22

Προέδρου παρόντος Προσωπικές πρωτοβουλίες αναλαµβάνει ο Ζαγοράκης για τα οικονοµικά θέµατα της ΠΑΕ ΠΑΟΚ. Οι τιµές των εισιτηρίων των πλέι οφ. ∆ιπλές προπονήσεις

∆ιάψευση Κονσεϊσάο ΕΠΙΜΕΝΕΙ η πορτογαλική «A’ Bola» στο «σενάριο» ότι ο Ζόρζε Κόστα ενδέχεται ν’ αντικαταστήσει τον Φερνάντο Σάντος στην τεχνική ηγεσία του ΠΑΟΚ, επισηµαίνοντας πως έχει δεχτεί πρόταση από τον Σέρτζιο Κονσεϊσάο (φωτό). Αναφέρει πως είναι απίθανο να παραµείνει ο 39χρονος προπονητής στην Ολιανένσε και ότι έχει δεχτεί κρούση από την Πόρτο, τον ΠΑΟΚ και άλλες οµάδες. «Ο Κόστα δεν έχει πει κάτι για το µέλλον του. Θα κάνουµε τα πάντα για να παραµείνει προπονητής µας», δήλωσε ο πρόεδρος της Ολιανένσε, Ισιντόρο Σόουζα. Η συνεχόµενη φηµολογία στην πατρίδα του και η εµπλοκή του ονόµατός του ανάγκασαν τον Κονσεϊσάο (είναι στενός φίλος του Κόστα) να τοποθετηθεί µε γραπτή δήλωση. «Θα ήθελα να διαψεύσω κατηγορηµατικά τις φήµες και τα δηµοσιεύµατα που µε θέλουν να έχω συζητήσεις µε προπονητές εν όψει της νέας σεζόν. Η προσοχή µας είναι αυτήν τη στιγµή στραµµένη στη µάχη των πλέι οφ. Η εµπιστοσύνη µας στον προπονητή και τους ποδοσφαιριστές είναι απεριόριστη και τους στηρίζουµε ολόψυχα προκειµένου να επιτευχθούν οι στόχοι µας. Ολα τα ανοιχτά θέµατα θα τεθούν επί τάπητος µετά το τέλος των αγωνιστικών υποχρεώσεων της οµάδας», σηµείωσε ο τεχνικός διευθυντής της ΠΑΕ ΠΑΟΚ. Εξάλλου, ένα ακόµη πορτογαλικό σενάριο που διαψεύδεται από τον ΠΑΟΚ µιλά για επαφές µε τον 30χρονο µέσο του Ανόβερου Σέρζιο Πίντο.

Οι φίλαθλοι του ΠΑΟΚ αναµένεται να γεµίσουν την Τούµπα και στα πλέι οφ... Του ΓΙΑΝΝΗ ΒΟΪΤΣΙΔΗ

Ζ

ητούνται έσοδα στον ΠΑΟΚ και µ’ αυτό το θέµα ασχολήθηκε το διοικητικό συµβούλιο της ΠΑΕ στη χτεσινή συνεδρίασή του. Ο πρόωρος αποκλεισµός από το Γιουρόπα Λιγκ και η αύξηση του µπάτζετ του αγωνιστικού τµήµατος οδηγούν τους διοικούντες σε µία αγωνιώδη αναζήτηση χρηµάτων. Στόχος είναι να µη βγει αρνητικός ο προσεχής ισολογισµός. Στις δύο προηγούµενες σεζόν ο ισολογισµός ήταν θετικός, κάτι για το οποίο ένιωθαν περήφανοι ο Ζαγοράκης και οι συνεργάτες του. Ο «Τέο» θ’ αναλάβει προσωπικές πρωτοβουλίες σε δύο σηµαντικά ζητήµατα οικονοµικού περιεχοµένου. Πρώτον, στις επαφές µε την πολιτική ηγεσία για µία βιώσιµη λύση σχετικά µε τα χρέη της ΠΑΕ στο Δηµόσιο (το θέµα είναι άµεσης προτεραιότητας για τον πρόεδρο του «Δικεφάλου» που θα πιέσει, αφού θεωρεί ότι έχει καθυστερήσει η επίλυσή του). Δεύτερον, στις επαφές µε επιχειρηµατίες που θα συµµετάσχουν στη νέα αύξηση µετοχικού κεφαλαίου. Ο Ζαγοράκης θα προσεγγίσει

τους προσεχείς µήνες ισχυρά οικονοµικά µέλη της «ασπρόµαυρης οικογένειας», από τα οποία θα ζητήσει να διαθέσουν ποσά άνω των 50.000 ευρώ. Βαθιά οικονοµική «ανάσα» θα δώσει στην ΠΑΕ η διάθεση των εισιτηρίων των πλέι οφ. Οι τιµές ανακοινώθηκαν (είναι αρκετά αυξηµένες σε σύγκριση µε τις αντίστοιχες περσινές) και η πώληση αρχίζει την Τρίτη. Η κρισιµότητα των αγώνων εγγυάται ότι η Τούµπα θα ζήσει µεγάλες στιγµές. Το «πακέτο τριών εισιτηρίων» στις Θύρες 4, 7, 8 κοστίζει 40 ευρώ, στις Θύρες 5, 6 η τιµή είναι 60 ευρώ, στις 2, 3 είναι 80 ευρώ, στην 1 είναι 100 ευρώ. Τα µεµονωµένα εισιτήρια τιµώνται 20, 25, 40, 60, 80 ευρώ. Οι κάτοχοι διαρκείας δικαιούνται (20-25 Απριλίου) ν’ ανανεώσουν τη θέση τους. Από τις 26 Απριλίου όσες θέσεις κατόχων διαρκείας δεν ανανεωθούν, απελευθερώνονται. Τα εκδοτήρια θα λειτουργούν και για την πώληση θέσεων που δεν αντιστοιχούν σε κατόχους διαρκείας. Εκτός από τα εκδοτήρια, η ανανέωση των κατόχων διαρκείας και η πώληση εισιτηρίων θα είναι εφικτές και µέσω διαδικτύου.

MEGAPRESS Οι κάτοχοι θέσεων VIP δε χρειάζεται ν’ ανανεώσουν το διαρκείας τους, εφόσον σ’ αυτό συµπεριλαµβάνονται οι αγώνες πλέι οφ. Στο µεταξύ, σε πρόγραµµα διπλών προπονήσεων µπήκαν οι παίκτες του ΠΑΟΚ στο πλαίσιο της προετοιµασίας για τα πλέι οφ. Το πρωί είχαν ραντεβού στη Σουρωτή, το απόγευµα στην Τούµπα. Το ίδιο προβλέπεται και για σήµερα. Χτες ο Σάντος δούλεψε πολύ σε θέµατα τακτικής. Στις προπονήσεις επέστρεψε ο Εντίνιο που ξεπέρασε το πρόβληµα στη µέση. Αντίθετα, σε ατοµικό πρόγραµµα παραµένουν οι Σνάουτσνερ, Βιεϊρίνια. Ο δεύτερος θα είναι σύντοµα έτοιµος. Για τον Πολωνό θα καταβληθεί προσπάθεια να προλάβει την έναρξη των πλέι οφ στις 28 Απριλίου. Ο Σάντος δεν... έδειξε κάποιο σχήµα για την Κυριακή, όµως θα δοκιµάσει παίκτες µε µικρό χρόνο συµµετοχής (Σαβίνι, Κουτσιανικούλης, Μουν, Παπάζογλου). Αλλωστε θ’ απουσιάσουν οι τιµωρηµένοι Κοντρέρας, Μαλεζάς, Ιβιτς (επιστρέφει ο Γκαρσία). Τα εισιτήρια του αγώνα µε τον Εργοτέλη τέθηκαν σε κυκλοφορία (15, 25, 30, 50 ευρώ).


22

2

φωνή

ΠΟ∆ΟΣΦΑΙΡΟ

Πέµπτη 15 Απριλίου 2010

ΤΩΝ ΣΠΟΡ

Ενα βήµα ακόµη

ΤΟΥΡΝΟΥΑ

Ηρακλής και Μπουµπένκο συµφώνησαν ότι... δε διαφωνούν και η ανανέωση της συνεργασίας είναι θέµα χρόνου. Νοµικό «τρικ» για Παντελή. Νότιγχαµ καλεί Μπαντή Του ΓΙΩΡΓΟΥ ΠΑΣΠΑΛΙΑΡΗ

Ε

να βήµα πριν από την τελική συµφωνία βρίσκονται Γ. Μπουµπένκο και Ηρακλής. Ο κ. Παντελή συναντήθηκε µε το Σλοβάκο προπονητή και συζήτησαν την προοπτική επέκτασης της συνεργασίας στη βάση µονοετούς ή και διετούς (όπως επιθυµεί ο κ. Μπουµπένκο) συµβολαίου. Οπως προκύπτει, η χρονική διάρκεια είναι το µοναδικό σηµείο «τριβής», αλλά σε κάθε περίπτωση όχι σοβαρό ώστε να µαταιώσει την ταύτιση απόψεων που παρατηρείται σε όλα τα επιµέρους ζητήµατα της οµάδας. Οι δύο πλευρές θα συναντηθούν εκ νέου τα επόµενα 24ωρα για να επικυρώσουν τη συµφωνία. Αυτή µπορεί να γίνει µέχρι την Παρασκευή, άλλως µετά τον καταληκτήριο αγώνα πρωταθλήµατος µε την Ξάνθη. Ανεξάρτητα µε τη χρονική διάρκεια της συνεργασίας ο κ. Μπουµπένκο θα συνεχίσει στον πάγκο των «κυανολεύκων». Το στίγµα που άφησε στο δεύτερο µισό της σεζόν έδειξε ότι έχει τις δυνατότητες για τη δηµιουργία µιας οµάδας, που δε θα µάχεται απλώς για την παραµονή της στην κατηγορία. Στο µεταξύ, µέσω µιας «παρατυπίας» ο Α. Παντελή θα αποκτήσει το θεσµικό ρόλο που ακόµη δεν έχει στον Ηρακλή. Η διαδικασία µέσω γενικής συνέλευσης δεν µπορεί να γίνει νωρίτερα από ένα µήνα και τελικά αποφασίστηκε να υπάρξει διέξοδος µε άλλον τρόπο. Συγκεκριµένα θα επικυρωθεί η διοίκηση, η οποία προέκυψε από τη γενική συνέλευση στις αρχές του χρόνου. Τα µέλη της (Σαµοβάρι, Ζιάκας) θα υποβάλουν τις παραιτήσεις τους, αφού νωρίτερα θα έχουν αναθέσει χρέη διευθύνοντος συµβούλου στον κ. Παντελή. Ο τελευταίος θα είναι και τυπικά διοικητικό στέλεχος και θα µπορεί να «τρέξει» υποθέσεις, που µέχρι χτες δεν µπορούσε.

∆εν ξεχνάµε τον Σταύρο...

Σε καλό δρόµο βρίσκεται η υπόθεση της παραµονής Μπουµπένκο στον Ηρακλή Ο Ντάνι Φερνάντες είναι ακόµη παίκτης του Ηρακλή, αλλά καθηµερινά αυξάνονται οι φήµες που τον θέλουν να καταλήγει - µέσω της Μπόχουµ - σε άλλη ελληνική οµάδα. Μετά τα σενάρια για τον Παναθηναϊκό, δηµοσίευµα πορτογαλικής εφηµερίδας φέρει τον Ολυµπιακό και τη Φούλαµ να ενδιαφέρονται για την απόκτησή του, µε τη γερµανική οµάδα να αξιώνει ένα εκατοµµύριο ευρώ για να συναινέσει. Οι «ερυθρόλευκοι» δήλωσαν άγνοια για τα σενάρια, ωστόσο το ενδιαφέρον τους (όπως και αυτό των «πρασίνων») πρέπει να θεωρείται δεδοµένο. Το δηµοσίευµα αναφέρεται σε αρκετά ακόµη θέµατα που αφορούν τον Φερνάντες, όπως η πρό-

MEGAPRESS

ταση που έγινε στην Μπενφίκα το Γενάρη για να τον αποκτήσει δανεικό, το ενδιαφέρον της Ακαντέµικα, αλλά και το γεγονός ότι την Κυριακή δεν αγωνίστηκε στο ΟΑΚΑ, όπου βρέθηκε ο Κάρλος Κεϊρός. Η ΠΑΕ Ηρακλής, στο µεταξύ, συναίνεσε χτες σε αίτηµα που κατέθεσε ο εκπρόσωπος του Γ. Μπαντή για παροχή άδειας, προκειµένου ο 25χρονος τερµατοφύλακας, µετά από σχετικό ενδιαφέρον, να δοκιµαστεί από τη Νότιγχαµ. Ο Μπαντής δε φαίνεται να προορίζεται για βασικός ούτε τη νέα περίοδο, οπότε η προοπτική µιας άλλης οµάδας - και ιδιαίτερα της Νότιγχαµ - θα είναι το καλύτερο για τον ίδιο.

ΤΗ µνήµη του Σταύρου Ρεπανά τιµούν σήµερα, για τρίτη συνεχόµενη χρονιά, ο Πανελλήνιος Σύνδεσµος Αθλητικού Τύπου (ΠΣΑΤ), η ΕΠΣΜ, η ΕΣΗΕΜ-Θ, η νοµαρχία Θεσσαλονίκης και ο δήµος Καλαµαριάς, που διοργανώνουν στις εγκαταστάσεις της ΕΠΣΜ, στη Μίκρα (16:00), το οµώνυµο παιδικό ποδοσφαιρικό τουρνουά. Ο Σταύρος Ρεπανάς, δάσκαλος για αρκετές γενιές δηµοσιογράφων που συνεργάστηκαν µαζί του, υπήρξε ένας από τους σηµαντικότερους λειτουργούς της αθλητικής ενηµέρωσης και συνδικαλιστής, που άφησε ανεξίτηλη τη σφραγίδα του στην αθλητική δηµοσιογραφία. Τα δύο προηγούµενα χρόνια, το τουρνουά ξεπέρασε κάθε προσδοκία των διοργανωτών και παρουσίασε µεγάλο ενδιαφέρον. Στην ξεχωριστή αυτή εκδήλωση θα πάρουν µέρος αντιπροσωπευτικές οµάδες των Ακαδηµιών του ΠΑΟΚ, του Αρη, του Ηρακλή, του Απόλλωνα Καλαµαριάς και η Μικτή της ΕΠΣΜ, ενώ έχουν προσκληθεί να παραστούν µέλη της κυβέρνησης, εκπρόσωποι των ΠΑΕ και αθλητικών φορέων της Θεσσαλονίκης. Θα διεξαχθεί επίσης φιλικός αγώνας µεταξύ της ποδοσφαιρικής οµάδας της ΕΤ3 και των βετεράνων ποδοσφαιριστών της ΕΠΣΜ. Τέλος, στον περιβάλλοντα χώρο των εγκαταστάσεων, θα λειτουργήσει έκθεση φωτογραφίας και θα απονεµηθούν διακρίσεις και αναµνηστικά έπαθλα στις νικήτριες οµάδες και σε όλα τα παιδιά που θα πάρουν µέρος στο τουρνουά. Α. Α.

∆ΟΞΑ ∆ΡΑΜΑΣ

ΠΑΝΣΕΡΡΑΪΚΟΣ

Ράµµατα στο κεφάλι ο Γκονζάλες

Αγώνας δρόµου για Τάντιτς

ΜΙΑ δυσάρεστη έκπληξη έκρυβε για τον Σ. Βουτσακέλη η επιστροφή των παικτών της ∆όξας στις προπονήσεις. Συγκεκριµένα ο Τ. Γκονζάλες (φωτό) τραυµατίστηκε στο κεφάλι έπειτα από εναέρια διεκδίκηση της µπάλας και χρειάστηκε να µεταβεί στο νοσοκοµείο ώστε να κάνει δύο ράµµατα. Το θετικό για το τεχνικό επιτελείο είναι ότι ο τραυµατισµός του Ισπανού επιθετικού δεν εµπνέει ανησυχία και ο κ. Βουτσακέλης θα τον έχει στη διάθεσή του για τον αγώνα µε το Αιγάλεω. Από εκεί και πέρα αµφίβολη είναι η συµµετοχή των Παπαθανασίου, Γκίκα, Ριοµπίνιο, οι οποίοι ακολουθούν ατοµικό πρόγραµµα, ενώ αντίθετα ο Τσιµπλίδης ξεπέρασε το πρόβληµα στον προσαγωγό και επανήλθε σε κανονικούς ρυθµούς προετοιµασίας. ΜΕ στόχο να επαναλάβει εµφάνιση ανάλογη µ’ αυτήν του πρώτου γύρου κόντρα στον Ολυµπιακό Βόλου, συνέχισε χτες την προετοιµασία του ο Αγρ. Αστέρας. Το 3-0 είναι «οδηγός» για την οµάδα του Ευόσµου, η οποία καλείται την Κυριακή να «µπλοκάρει» τα ατού των πρωτοπόρων της βαθµολογίας και να πάρει ένα θετικό αποτέλεσµα, το οποίο θα αποτελέσει σπουδαίο βήµα στην προσπάθεια που κάνει για είσοδο στη διαδικασία των πλέι οφ. Στα θετικά είναι η επιστροφή του (σκόρερ των δύο από τα τρία γκολ στην αναµέτρηση του πρώτου γύρου) Κούτση, ενώ αντίθετα απών θα είναι ο τιµωρηµένος Μπλαζέφσκι.

ΕΤΟΙΜΟΠΟΛΕΜΟΣ εν όψει Ηλιούπολης είναι στον Πανσερραϊκό ο Μαρκ Σεγκιρί. Ο Γάλλος αµυντικός εντάχθηκε χτες σε κανονικούς ρυθµούς προετοιµασίας και τίθεται στα πλάνα του Ν. Κοκότοβιτς. Εκτός από τον Σεγκιρί και οι Ανάκογλου, Ρούτσης ακολούθησαν πρόγραµµα βελτίωσης φυσικής κατάστασης και αναµένεται να είναι στην αποστολή για το κυριακάτικο παιχνίδι. Αντίθετα αγώνα δρόµου θα κάνει ο Τάντιτς (φωτό), που υποβλήθηκε σε µαγνητική τοµογραφία, η οποία έδειξε ελαφριά υµενίτιδα και ο Σέρβος ποδοσφαιριστής θα ακολουθήσει θεραπευτική αγωγή. Σήµερα θα µπει σε κανονικούς ρυθµούς ο Μπανγκουρά. ΕΝΑ δυσάρεστο απρόπτο περιελάµβανε η χτεσινή προπόνηση του Πιερικού για τον Σ. Παπαδόπουλο, ο οποίος είδε τον Παστό να αποχωρεί από αυτήν, ενώ οι πρώτες εκτιµήσεις κάνουν λόγο για θλάση στο δικέφαλο. Ο 31χρονος αµυντικός υποβλήθηκε το απόγευµα σε εξετάσεις και τα αποτελέσµατα θα γίνουν γνωστά σήµερα. Ο κ. Παπαδόπουλος δεν υπολογίζει για τη σαββατιάτικη αναµέτρηση µε την Καλαµάτα τους τιµωρηµένους Θάνο, Χατζηζήση και Φρέντερικς, ενώ ο Ολγκίν, που επίσης συµπλήρωσε αριθµό καρτών, θα απουσιάσει από τους αγώνες µε Ρόδο και Εθνικό. ΤΟ µοντέλο του Ολυµπιακού µε το στάδιο Καραϊσκάκη θέλει ν’ ακολουθήσει ο Αχ. Μπέος στο Βόλο. Ο µεγαλοµέτοχος του τοπικού Ολυµπιακού ζήτησε από το δήµο την ενοικίαση του ΕΑΚ για τα επόµενα 40 χρόνια.


φωνή

∆ΙΕΘΝΗ

Πέµπτη 15 Απριλίου 2010

3

23

ΤΩΝ ΣΠΟΡ

«Θα επιστρέψει»

ΑΓΓΛΙΑ

Πεπεισµένος ότι θα ξαναπαίξει µε τον Φάµπρεγας στην Μπαρτσελόνα είναι ο Μέσι. ∆ιορία στον Μπενίτεθ φέρεται να έδωσε η Γιουβέντους Του ΖΑΧΑΡΙΑ ΝΙΚΟΛΑΪΔΗ

Π

επεισµένος ότι, αργά ή γρήγορα, θα είναι συµπαίκτης µε τον Τσεσκ Φάµπρεγας στην Μπαρτσελόνα, είναι ο Λιονέλ Μέσι, όπως δήλωσε στην αγγλική εφηµερίδα «Ντέιλι Εξπρές». Ο κορυφαίος ποδοσφαιριστής στον κόσµο επανέλαβε επίσης ότι θέλει να µείνει στο «Καµπ Νου» µέχρι το τέλος της καριέρας του, για να ανταποδώσει στην Μπαρτσελόνα όσα έκανε γι’ αυτόν. «Ο Τσεσκ έχει στην καρδιά του την Αρσεναλ και την Μπαρτσελόνα στο αίµα του. Θέλει να κερδίσει τα µεγαλύτερα τρόπαια και περιµένω αυτό να γίνει µε την Μπαρτσελόνα», είπε ο Αργεντινός, που ήταν συµπαίκτης µε τον Φάµπρεγας στις ακαδηµίες της πρωταθλήτριας Ευρώπης. «Δεν ξέρω πότε θα γίνει αυτό, αλλά πιστεύω ότι κάποια στιγµή θα ξανπαίξουµε µαζί στην Μπαρτσελόνα». Ο Αρσέν Βενγκέρ έχει τονίσει πολλές φορές ότι δεν έχει σκοπό να αφήσει τον Καταλανό να φύγει και ότι η Αρσεναλ δεν έχει ανάγκη από χρήµατα, ωστόσο ο Μέσι πιστεύει πως ο ίδιος ο παίκτης θα κοιτάξει το συµφέ-

Τον Φάµπρεγας θέλει ο Μέσι στην «Μπάρτσα» ρον του: «Ο Αρσέν είναι σαν πατέρας για τον Τσεσκ και είναι λογικό. Οµως, η Βαρκελώνη είναι η πατρίδα του και η Μπαρτσελόνα η οικογένειά του. Υπάρχουν λίγοι παίκτες στον κόσµο που µπορούν να βελτιώσουν την τωρινή οµάδα µας και ένας από αυτούς είναι ο Τσεσκ». Και έκλεισε, αναφερόµενος στην οµάδα του: «Εχω

πει ότι θέλω να µείνω στην Μπαρτσελόνα για όλη µου τη ζωή. Θα είµαι εδώ για όσο µε θέλουν. Θα είµαι για πάντα ευγνώµων στον Ράικαρντ, που µε έβαλε στην πρώτη οµάδα όταν ήµουν 17 και πολλοί του έλεγαν πως δεν θα ψηλώσω αρκετά. Οµως, µε τη Γκουαρδιόλα παίζω το καλύτερο ποδόσφαιρο της ζωής µου.Δεν χρωστάω

στην Μπαρτσελόνα µόνο ότι µου έδωσε την ευκαιρία, της χρωστάω ότι µου άλλαξε τη ζωή». ΑΝΟΙΚΤΟ άφησε το ενδεχόµενο της αποχώρησης του Ράφα Μπενίτεθ από τη Λίβερπουλ ο µάνατζέρ του, λέγοντας µε νόηµα πως «κανείς δεν ξέρει τι θα γίνει τους επόµενους µήνες». Ο εκπρόσωπος του Ισπανού τεχνικού διέψευσε ότι είχε επαφές µε την Γιουβέντους, ωστόσο ο ιταλικός Τύπος γράφει ότι η «κυρία» έδωσε διορία δέκα ηµερών στον Μπενίτεθ για να απαντήσει. Η ιταλική οµάδα µετρά άλλη µία απώλεια για το ντέρµπι µε την Ιντερ, αφού εκτός µάχης τέθηκε και ο Τρεζεγκέ. ΣΤΟ Λίβερπουλ έγινε γνωστό ότι η Goldman Sachs, που εκπροσωπούσε Αµερικανούς επενδυτές, απέσυρε το ενδιαφέρον της για την αγορά της Λίβερπουλ και οι Τζίλετ και Χικές ανέθεσαν σε θυγατρική της Barclays να βρει αγοραστή για το σύλλογο. Στην Ρεάλ, ο Πέρεθ άρχισε να εκνευρίζεται µε τη συνεχιζόµενη απουσία του Κακά (έχει να παίξει 35 µέρες) και κάλεσε τον Βαλντάνο για εξηγήσεις. Ο πρόεδρος της «βασίλισσας» πιστεύει ότι ο Βραζιλιάνος «φυλάγεται» εν όψει Μουντιάλ.

Σίγησαν τα κανόνια ΝΟΚ άουτ από τη «µάχη» του τίτλου της Πρέµιερ Λιγκ βγήκε η Αρσεναλ που, παρά την επανεµφάνιση του Φαν Πέρσι και τις κλασικές ευκαιρίες στα τελευταία λεπτά του αγώνα, έχασε 2-1 από την «αιώνια» αντίπαλό της Τότεναµ (10’ Ρόουζ, 47’ Μπέιλ85’ Μπέντνερ) στο «Γουάιτ Χαρτ Λέιν». Τα «σπιρούνια» ξεπέρασαν γρήγορα το σοκ του αποκλεισµού από τον τελικό του Κυπέλλου και συνεχίζουν να παλεύουν για την τέταρτη θέση, απέχοντας ένα βαθµό από τη Μάντσεστερ Σίτι. Στα άλλα µατς της Πρέµιερ Λιγκ, Αστον Βίλα - Εβερτον 2-2 (72’ Αγκµπονλαχόρ, 90’ Τζαγκιέλκα αυτ - 23’, 74’ Κέιχιλ) και Γουίγκαν - Πόρτσµουθ 0-0. ΙΣΠΑΝΙΑ: Την ευκαιρία να αποκτήσει σηµαντικό πλεονέκτηµα έναντι της Σεβίλλης για την τέταρτη θέση έχασε η Μαγιόρκα που αναδείχθηκε ισόπαλη 1-1 (21’ Σουάσο, 13’ Ρότσα) µε τη Σαραγόσα στο Λα Ροµαρέδα. Οι Νησιώτες έχουν πάντως προβάδισµα ενός βαθµού. Απρόσµενη ήττα υπέστη η ασταθής Ατλέτικο Μαδρίτης που έχασε 2-1 από τη Χερέθ (12’ Φορλάν-9’ Μπερµέχο, 72’ Αρµεντέρος) στο «Βιθέντε Καλδερόν». Στα άλλα δύο µατς, Οσασούνα-Μάλαγα 2-2 (11’, 48’ Παντιάνι-32’ Καϊσέδο, 75’ Μπάχα) και Σανταντέρ-Εσπανιόλ 3-1 (36’ πεν., 50’ Τσιτέ, 90+1 Αράνα-32’ Αλόνσο). Σήµερα ολοκληρώνεται η αγωνιστική µε τους αγώνες Αλµερία - Ρεάλ (23.15 µαγν. ΣΚΑΪ) και Βαλένθια - Μπιλµπάο). ΓΑΛΛΙΑ: Η Μαρσέιγ είναι από χτες ακόµη πιο κοντά στον τίτλο, µετά τη νίκη 1-0 στην έδρα της Σοσό (88΄Εµπία) σε εξ αναβολής µατς για την 30ή αγωνιστική. Η φορµαρισµένη οµάδα της Μασσαλίας έχει πλέον προβάδισµα πέντε βαθµών από την Οσέρ. Η Μπορντό, αντίθετα, δεν δείχνει ικανή να συνέλθει αφού έχασε 2-1 από τη Λε Μαν (17΄Λε Ταγιέκ, 45΄Ντοσεβί -8΄Ενρίκε) και βρίσκεται εννιά βαθµούς µακριά από την κορυφή! ΟΛΛΑΝ∆ΙΑ: Ο Αγιαξ κέρδισε 2-0 τη Βίλεµ (4’ Σουάρες, Πάντελιτς) και µείωσε στον ένα βαθµό τη διαφορά από την πρωτοπόρο Τβέντε.

ºÚÍÞÖÔ-.'$Ü"Ù"

šàÕãÑÓ×ÍàÍßà­ßÑÕãàÛå§ÛØØÑÓÉÛåßàÛ’ÔÙÛàÕ×Ê

Š ˆ ˜£ ¢ œ¢ £ ™ – Ž    – … … £ ’ œ – Ž Š’™†Ž¤’‡›¢Ž¡˜Š™’…Ÿ…–™¢†˜›¢¤™š¢!ˆÂÓÃÍÏÌÔŠ¾Ë»Ï¾Ê¾¤˜ˆ! …©›¡’Ž™¢ˆ©š–™¢! ˆÂÓê¾ÏÆÉ ÌÖ‡¸ÏÊÅԬ˾ËÑÆ7YHR[PRLY¤˜ˆ!

–ÍÆÐÈÂÃÒºÑÂÑÅËÆÐÑÌÐÂɺÁ¾ʾÔ^^^HYPZ[V[LSPVLK\NY ¸°±¥‘°¦£–¦§°¦®¬®¦Ÿš


24

4

φω

ΠΟΔΟΣΦΑΙΡΟ

Πέμπτη 15 Απριλίου 2010

ΤΩΝ Σ

Γ’ ΕΘΝΙΚΗ

Απόλυτο ντέρμπι ΝΤΕΡΜΠΙ με θέα τη Β’ Εθνική είναι αυτό μεταξύ της Αναγέννησης Επανομής και της Βέροιας, που θα γίνει την Κυριακή στην έδρα της πρώτης. Οι δύο ομάδες ισοβαθμούν στην κορυφή, με την ομάδα της Ημαθίας ωστόσο να έχει καλύψει ένα σημαντικό (βαθμολογικό) «χάντικαπ» και τη δεδομένη στιγμή να προβάλλει ως φαβορί. «Πάντα παίζουμε για τη νίκη, αλλά και η ισοπαλία σε μια έδρα όπως της Επανομής δεν είναι καταστροφή», υπογράμμισε ο αμυντικός της Βέροιας, Γ. Ματζιαρίδης. «Ο αντίπαλός μας ίσως παίζει το τελευταίο του «χαρτί», αλλά κι εμείς χρωστάμε στον κόσμο μια νίκη σε εκτός έδρας ντέρμπι. Εάν τα καταφέρουμε, κατά 90% θα είμαστε στη Β’ Εθνική», συμπλήρωσε. Στα Γρεβενά ο Α. Παντζιαράς μετρά τρεις απουσίες (Τζιώρας, Γκαρόζης, Σερέτης) για τον αγώνα απέναντι στη Δόξα Κρανούλας, ενώ στα Γιαννιτσά η προσοχή όλων έχει στραφεί στην αποθεραπεία του Αλ. Μπογκτάν. Ο Ρουμάνος επιθετικός αντιμετωπίζει πρόβλημα τραυματισμού μετά την αναμέτρηση με τη Νίκη Βόλου και η συμμετοχή του στη συνάντηση με το Φωκικό κρίνεται αμφίβολη.

ΠΑΝΘΡΑΚΙΚΟΣ

Στην ουρά για το εισιτ

Η διαδικασία διάθεσης των εισιτηρίων του μεγάλου τελικού της 24ης Απριλίου ξ έσπευσαν στο Χαριλάου. Σηφάκης: «Οι παίκτες το θέλουμε πιο πολύ κι από τον κ Του ΒΑΣΙΛΗ ΜΟΣΧΟΥ

Ο

ι φίλαθλοι του Αρη άρχισαν ήδη να σχηματίζουν ουρές έξω από το «Κλεάνθης Βικελίδης» για να... κλείσουν θέση στον τελικό του Κυπέλλου και οι παράγοντες των «κιτρίνων» εκτιμούν ότι τα 23.480 εισιτήρια θα εξαντληθούν. O διευθυντής της ΠΑΕ, Γιώργος Ελευθερούδης, προέτρεψε ξανά τους οπαδούς να προτιμήσουν την οργανωμένη μετακίνηση στην Αθήνα. «Οι κάτοχοι των εισιτηρίων διαρκείας που έχουν ανανεώσει και για τα πλέι οφ έχουν την απόλυτη προτεραιότητα, ακόμη κι αν δεν επιλέξουν την οργανωμένη μετακίνηση. Το ίδιο ισχύει και για τα μέλη της Λέσχης. Εμείς προτείνουμε την οργανωμένη μετακίνηση για λόγους ασφάλειας». Η ΠΑΕ εξέδωσε χτες διευκρινιστική ανακοίνωση που αφορά και τους υπόλοιπους κατόχους διαρκείας. «Οσοι απέκτησαν διαρκείας μόνο για την κανονική

Δύο τυχεροί φίλαθλοι του Αρη που εξασφάλισαν εισιτήριο για τον τελικό του Κυπέλλου

Τελευταίο «κύμα» Ο ΠΑΝΘΡΑΚΙΚΟΣ θα ολοκληρώσει την Κυριακή στο Περιστέρι τη διαδρομή του στη Σούπερ Λίγκα και την επόμενη μέρα θα «τρέξουν» όλες οι εξελίξεις εν όψει της Β’ Εθνικής. Ο Π. Δερμιτζάκης (φωτό) και οι διοικούντες έκαναν χτες τον τελευταίο απολογισμό και αναμένεται η εισήγηση του προπονητή για τους παίκτες που θα δουν τελευταίοι την πόρτα της εξόδου. Η συντριπτική πλειοψηφία των ξένων θ’ αποτελέσουν παρελθόν, η ομάδα θα στηριχτεί κυρίως σε Ελληνες (με έμφαση στο ντόπιο στοιχείο), ενώ στο Μπάνσκο της Βουλγαρίας ή στη Ρουμανία θα γίνει η θερινή προετοιμασία. ΣΤΑ χέρια πιάστηκαν ο Ντάνιελ Τσέζαρεκ με τον Ισραέλ Νταμόντε στη χτεσινή προπόνηση του Αστέρα Τρίπολης. Οι δύο παίκτες λογομάχησαν κατά τη διάρκεια του εσωτερικού διπλού, συνέχισαν την αντιπαράθεση, με αποτέλεσμα να πέσουν ορισμένες «ψιλές». Με την παρέμβαση του Β. Βλάχου το επεισόδιο θεωρήθηκε λήξαν, αλλά είναι άγνωστο εάν την ίδια άποψη έχει και η διοίκηση για δύο παίκτες που δεν έχουν δώσει στο παρελθόν δικαιώματα.

Ε

Π

Παπακώστας ώς το 2010 ΤΗΝ ανανέωση της συνεργασίας της με τον Γιάννη Παπακώστα για δύο ακόμη χρόνια, ανακοίνωσε χτες η ΠΑΕ ΑΕΛ. Αμεσοι συνεργάτες του για το αντίστοιχο χρονικό διάστημα παραμένουν ο γυμναστής κ. Γκιόκας και ο κ. Κατραμάδος για το σκάουτινγκ των αντιπάλων. Εξάλλου, αναφορικά με τον Γιαν Μπλάζεκ που αγωνίζεται ως δανεικός από τη Σλόβαν Λίμπερετς για να τον αποκτήσει η Λάρισα θα πρέπει να πληρώσει τη ρήτρα του (περίπου 800.000 ευρώ). Στη σκέψη του κ. Πηλαδάκη είναι να αγοράσει μέρος των δικαιωμάτων του Τσέχου. Ο πρόεδρος της ΠΑΕ ΑΕΛ θέλει να κρατήσει γι’ ακόμη ένα χρόνο δανεικό από τον Παναθηναϊκό τον Χρήστο Μελίσση (ρήτρα 1.000.000 ευρώ).

Ρήξη χιαστού ο Ζίεντσουκ ΔΥΣΑΡΕΣΤΑ νέα επιφύλασσε για τον Νίκο Κεχαγιά η χτεσινή μέρα καθώς ο τραυματισμός που υπέστη ο Ζιέντσουκ στην προπόνηση της Δευτέρας, αποδείχτηκε αρκετά σοβαρός. Τα αποτελέσματα της μαγνητικής τομογραφίας, στην οποία υποβλήθηκε ο παίκτης έδειξαν ότι έχει υποστεί ρήξη προσθίου χιαστού στο δεξί γόνατο και θα υποβληθεί σε χειρουργική επέμβαση, με συνέπεια να απουσιάσει για αρκετούς μήνες. Στο μεταξύ, στη Γαλλία βρέθηκε τις προηγούμενες μέρες ο τεχνικός διευθυντής της θρακικής ΠΑΕ Κώστας Κωνσταντινίδης, ο οποίος σύμφωνα με δημοσιεύματα έδειξε ενδιαφέρον για τον επιθετικό της Ρεμς (Γ’ κατηγορίας) Σεντρίκ Φορέ (30 συμμ. 20 γκολ).

Από Δευτέρα ανακοινώσεις ΝΙΚΗ ζήτησε ο Κώστας Τσαλίκης από τους παίκτες της Καβάλας στο κυριακάτικο παιχνίδι με τον Πανιώνιο για να κλείσουν θετικά την εξαιρετική χρονιά που έκαναν φέτος ως νεοφώτιστοι στη Σούπερ Λίγκα. Ο Σταύρος Ψωμιάδης συνεχίζει τις επαφές με προπονητές προκειμένου να βρει τον αντικαταστάτη του Ντε Μος. Πηγές αναφέρουν ότι πιθανόν τη Δευτέρα ο πρόεδρος της ΠΑΕ Καβάλα να ανακοινώσει το όνομα του νέου προπονητή. Παράλληλα θα ανακοινώσει και τις νέες αποδεσμεύσεις. Λέγεται ότι στη λίστα του συμπεριλαμβάνονται οι Ορούμα, Σόσιν, Ιτάνζ, Ρινκόν και Λάκης. Οσο για τον Λεοντίου θα επιστρέψει στον Πανθηναϊκό απ’ όπου ήρθε ως δανεκός.

θ μ γ Ζ π τ ξ τ π η τ ο Ν μ α ν Κ Ρ

ε κ ν


ωνή

ΠΟΔΟΣΦΑΙΡΟ

Πέμπτη 15 Απριλίου 2010

5

25

ΣΠΟΡ

τήριο...

ΜΗΝΥΜΑ ΠΑΡΑΜΟΝΗΣ ΑΠΟ ΚΑΜΠΟΡΑ

«Κοντά σε ανανέωση»

ξεκίνησε και οι φίλαθλοι του Αρη κόσμο. Δεν υπάρχει φαβορί στον τελικό» περίοδο, ή μόνο για τα πλέι οφ, μπορούν από το μεσημέρι της Τετάρτης (σ.σ. χτες) να εγγράφονται στις εκδρομές του τουριστικού οργανισμού Ζορπίδη που αποτελεί επίσημο χορηγό της ΠΑΕ Αρης. Οσοι εγγραφούν στις εκδρομές ώς και την Πέμπτη 22 Απριλίου εξασφαλίζουν το εισιτήριο του αγώνα. Η εγγραφή μπορεί να γίνεται είτε στο ARIS MOBILE, είτε στα κατά τόπους καταστήματα του τουριστικού οργανισμού Ζορπίδη. Οσοι από τους παραπάνω επιθυμούν να μετακινηθούν μεμονωμένα θα μπορούν να κατοχυρώσουν το εισιτήριό τους από την Τρίτη 20 Απριλίου στο ARIS MOBILE. Ελεύθερα εισιτήρια, αν και εφόσον απομείνουν, για τον υπόλοιπο κόσμο θα διατεθούν την Τετάρτη 21 Απριλίου και την Πέμπτη 22 Απριλίου από το ARIS MOBILE».

Κούπερ: «Συγκεντρωμένοι στο στόχο» Με το θέμα των εισιτηρίων ασχολούνται ακόμη και οι πο-

δοσφαιριστές που φρόντισαν να κλείσουν πτήση για τα μέλη του στενού οικογενειακού τους κύκλου. Ο Εκτορ Κούπερ, όμως, παρενέβη τονίζοντας: «Ασχοληθείτε με αυτά τα θέματα έως την Κυριακή. Από τη Δευτέρα, στο μυαλό σας θα υπάρχει μόνο το παιχνίδι. Τίποτα άλλο. Πρέπει να είμαστε πανέτοιμοι από κάθε άποψη». Ο Μιχάλης Σηφάκης, που ξεπέρασε τον τραυματισμό του και θα παίξει στον αγώνα με τον Ολυμπιακό, τόνισε ότι οι παίκτες, παλιοί και νέοι, έχουν συνειδητοποιήσει τη σημασία του τελικού. «Οι καινούργιοι παίκτες έχουν μπει στο κλίμα. Ακόμα και οι ξένοι ξέρουν πόσο σημαντικό είναι αυτό το παιχνίδι και τι σημαίνει για τον κόσμο. Εμείς οι παίκτες το θέλουμε πιο πολύ και από τον κόσμο. Δεν υπάρχει φαβορί. Ο Παναθηναϊκός δυσκολεύτηκε πολύ να μας κερδίσει στο πρωτάθλημα και ειδικά στο ΟΑΚΑ νικητής έπρεπε να είναι ο Αρης».

ΕΚΔΗΛΩΣΗ για την παρουσίαση των χορηγών της ΠΑΕ Αρης πραγματοποιήθηκε χτες το βράδυ παρουσία σύσσωμης της διοίκησης, του τεχνικού τιμ και των ποδοσφαιριστών της ομάδας. Είδηση έβγαλε ο Χαβιέρ Κάμπορα, που τόνισε ότι σήμερα έρχεται στη Θεσσαλονίκη ο εκπρόσωπός του, προαναγγέλλοντας έτσι την παραμονή του στην ομάδα. «Είμαστε πολύ κοντά σε συμφωνία με τη διοίκηση για την ανανέωση του συμβολαίου. Αύριο έρχεται ο μάνατζέρ μου και πιστεύω ότι οι συζητήσεις θα έχουν το αποτέλεσμα που όλοι επιθυμούμε». Στο περιθώριο της εκδήλωσης, μίλησε και ο αρχηγός του Αρη, Σέρχιο Κόκε, που ονειρεύεται να σκοράρει στον τελικό του Κυπέλλου. «Τις τελευταίες μέρες ονειρεύομαι ότι σκοράρω στον τελικό. Μακάρι να τα καταφέρω και να πάρουμε το Κύπελλο. Είναι ένα όνειρο ζωής για όλους τους παίκτες και φυσικά για τον κόσμο. Αυτή τη φορά είμαστε πιο έμπειροι και δε θα κάνουμε τα λάθη του 2008».

ΕΠΙΣΤΡΕΦΕΙ Ο ΝΤΟΥΝΤΟΥ ΣΤΟΝ ΟΛΥΜΠΙΑΚΟ

ΙΣΟΠΑΛΟΙ ΟΙ ΝΕΟΙ ΣΤΗ ΣΕΡΒΙΑ

ΠΑΟ: με το μυαλό στον τελικό

Ευθεία επίθεση «Original» σε Ντούσκο

Ο ΠΑΣ προέχει, αλλά το μυαλό όλων στον Παναθηναϊκό είναι πλέον στραμμένο στον τελικό Κυπέλλου με τον Αρη το μεταπροσεχές Σάββατο. Η προετοιμασία για το καταληκτήριο παιχνίδι πρωταθλήματος στους Ζωσιμάδες ξεκίνησε χτες με το Ν. Νιόπλια όμως, να προσαρμόζει τα πλάνα του στις απαιτήσεις του τελευταίου φετινού αγώνα, που θα κρίνει το δεύτερο τη τάξει τίτλο. Ο 45χρονος προπονητής (φωτό) αναμένεται να δώσει ανάσες σε αρκετούς παίκτες και να τους προφυλάξει για το παιχνίδι όπου η ομάδα του θα διεκδικήσει το νταμπλ. Εκτός μάχης είναι οι τιμωρημένοι Καραγκούνης, Νίνης και Σαριέγκι, ενώ αναμένεται να χρησιμοποιηθούν αρκετοί παίκτες με περιορισμένο χρόνο συμμετοχής, όπως οι Καρνέζης, Μπιέρσμιρ, Κλέιτον, Ρουκάβινα και Πετρόπουλος. ΕΚΤΟΣ από απουσίες, ο Ολυμπιακός μετρά και επιστροφές. Ο Ντουντού γυμνάστηκε χτες σε κανονικούς ρυθμούς, για πρώτη φορά μετά από μεγάλο χρονικό διάστημα, και αναμένεται να συμπεριληφθεί στην

ΑΝΑΚΟΙΝΩΣΗ, με την οποία εξαπολύει ευθεία επίθεση προς τον Ντ. Μπάγεβιτς (φωτό), ανάρτησε χτες στην ιστοσελίδα της η «Original». Σ’ αυτήν αφήνει αιχμές κατά του προέδρου της ΠΑΕ, Στ. Αδαμίδη, αλλά και άλλων μελών της διοίκησης για το θέμα του Σκόκο και την κατάσταση αρκετών τμημάτων του συλλόγου. Αφορμή φέρεται να αποτέλεσε το δείπνο που παρέθεσε ο Σερβοέλληνας προπονητής στους παλαιμάχους, την οποία η «Original» θεωρεί κίνηση που αποσκοπεί στην παραμονή του στην τεχνική ηγεσία. Πρόκειται για την πρώτη επίθεση μετά την επιστροφή Μπάγεβιτς στην ΑΕΚ, με την οποία οι οργανωμένοι οπαδοί διακόπτουν μια άτυπη περίοδο «εκεχειρίας». Στο μεταξύ, ενδιαφέρον της ΑΕΚ για τον Μαρκ Μπρεσιάνο αποκαλύπτει η ιταλική ιστοσελίδα «calciomercato.com». Ο 30χρονος Αυστραλός μεσοεπιθετικός μένει ελεύθερος από την Παλέρμο

αποστολή του αγώνα με τον Αρη. Εκτιμάται ότι ανάλογα με την εξέλιξη της αναμέτρησης θα πάρει και χρόνο συμμετοχής έτσι ώστε να είναι στη διάθεση του Μπ. Μπάντοβιτς για τα πλέι οφ. ΣΤΑ χέρια του προέδρου της ΕΠΟ, Σ. Πιλάβιου, βρίσκεται ο τέταρτος φάκελος της ΟΥΕΦΑ με «ύποπτα ματς». Σύμφωνα με πληροφορίες, ο φάκελος περιλαμβάνει τουλάχιστον τέσσερις αγώνες της Β’ Εθνικής, στους οποίους υπάρχουν ενδείξεις ότι «κάτι έγινε», ενώ από τον προηγούμενο φάκελο ξεκαθαρίστηκε πως το ματς Πανθρακικού – ΠΑΣ ήταν «καθαρό». Οι τρεις φάκελοι με τα προηγούμενα ματς έχουν ήδη διαβιβαστεί στην εισαγγελία, ενώ στοιχεία έχει καταθέσει ο ίδιος ο κ. Πιλάβιος στη Βουλή.

στο τέλος της περιόδου. ΙΣΟΠΑΛΗ 1-1 (17’ πέν. Αλεκσιτς - 10’ αυτ. Τσίρκοβιτς) αναδείχτηκε η Εθνική Νέων με την αντίστοιχη της Σερβίας σε φιλικό αγώνα που έγινε στο Βελιγράδι και εντάσσεται στην προετοιμασία του αντιπροσωπευτικού συγκροτήματος για τη συμμετοχή του στην ενδιάμεση φάση του Euro 2010. «Κάναμε κάποιες δοκιμές και πιστεύω ότι μαζί με τα παιδιά που απουσίασαν από το σημερινό (σ.σ. χτεσινό) αγώνα θα κάνουμε μια πολύ δυνατή αποστολή για την ενδιάμεση φάση», δήλωσε ο εκ των ομοσπονδιακών, Κ. Τσάνας. Η Εθνική Νέων αγωνίστηκε με τους Λάμπρου (62’ Καλδέλης), Μαρινάκη (18’ Καρασαλίδης), Ποτουρίδη, Λαγό, Κουτρουμπή, Κοτσαρίδη (46’ Τριανταφύλλου), Βλαχοδήμο, Σταμόγιαννο (62’ Τόσκας), Βασιλείου (46’ Μάνταλος), Καρέλη (62’ Βέλλιος), Κοντοχρήστο (46’ Φορτούνης).


26

6

Πέµπτη 15 Απριλίου 2010

φωνή

ΜΠΑΣΚΕΤ - ΑΛΛΑ ΑΘΛΗΜΑΤΑ

ΤΩΝ ΣΠΟΡ

ΠΑΛΗ

Χωρίς... µετάλλιο ΕΚΤΟΣ βάθρου στο Ευρωπαϊκό Πρωτάθληµα ελευθέρας πάλης, που φιλοξενείται στο Μπακού, έµειναν οι δύο τελευταίοι εκπρόσωποί µας. Ο Μοτσάλιν (74κ.) είχε µία νίκη σε δύο αγώνες, ενώ ο Παπαδόπουλος (96κ.) ηττήθηκε και στους δύο αγώνες του. ΧΑΝΤΜΠΟΛ: Το µεσηµέρι αναχωρεί για την Ουγγαρία η Εθνική Ανδρών, προκειµένου να συµµετάσχει σε διεθνές τουρνουά, µε τη συµµετοχή των Μαγυάρων και της Σλοβακίας. Το αντιπροσωπευτικό συγκρότηµα θα αντιµετωπίσει αύριο (19.00) τη Σλοβακία και την Κυριακή (13.00) την Ουγγαρία. ΤΖΟΥΝΤΟ: Στην 4η θέση της ευρωπαϊκής κατάταξης που ανακοίνωσε χτες η EJU ανέβηκαν οι Μουστόπουλος και Λιλίκιν µετά τις πρωτιές τους στα -73κ. και -60κ. αντίστοιχα στο Ευρωπαϊκό Κύπελλο U20 «Iliadis Cup», ενώ στην 5η θέση των υπερβαρέων ανέβηκε ο Λαµπρινίδης. ΠΟΛΟ: Ισόπαλος 8-8 ήρθε στο Περιστέρι ο Ηρακλής, στο πλαίσιο της 12ης αγωνιστικής της Α2 Ανδρών. ΠΟ∆ΗΛΑΣΙΑ: Στο ποδηλατοδρόµιο των ολυµπιακών εγκαταστάσεων στο Μαρούσι θα διεξαχθεί το Πανελλήνιο Πρωτάθληµα πίστας από σήµερα έως και την Κυριακή, µε απόντα βέβαια τον Γιάννη Ταµουρίδη, ο οποίος βρίσκεται στο στάδιο της αποθεραπείας, µετά τον πρόσφατο τραυµατισµό του. Κ. Μπ.

Πάρτι Ρόουζ Με 39 πόντους κι 7 ασίστ ο άσος των Μπουλς τους οδήγησε σε σπουδαία νίκη επί των Σέλτικς Του ΚΩΣΤΗ ΜΠΟΤΣΑΡΗ

Σ

τη σκιά της αποκάλυψης για το «θερµότατο» επεισόδιο Πάξον - Ντελ Νέγκρο, οι Μπουλς εκµεταλλευόµενοι την έδρα τους και την αποδοτικότερη βραδιά της καριέρας του Ντέρικ Ρόουζ (39π., 7ασ. -φωτό-) νίκησαν τους Μπόστον Σέλτικς 101-93 (Πιρς 28π.) και πήραν προβάδισµα ενός αγώνα έναντι του Τορόντο για την 8η και τελευταία θέση της ανατολικής περιφέρειας που οδηγεί στα πλέι οφ. Για να τη διατηρήσουν θέλουν είτε νίκη στον τελευταίο αγώνα της κανονικής περιόδου στη Σάρλοτ είτε ήττα των Ράπτορς από τους Νιου Γιορκ Νικς. Για τους «Κέλτες» η έκτη ήττα στα τελευταία εννιά παιχνίδια σήµανε την οριστικοποίηση στην 4η θέση. Στο Φίνιξ, οι Σανς συνεχίζουν να εκπλήσσουν θετικά. Επιβλήθηκαν 123-101 (Στούντεµαϊρ 26π. - Κ. Αντονι 29π., 6ρ.) και διασφάλισαν την 4η θέση στη Δύση, ενώ «βλέπουν» ακόµη και την 3η αν τα ξηµερώµατα αλώσουν τη Γιούτα. Σε έναν από τους κρισιµότερους αγώνες της σεζόν οι Τζαζ µάλλον δε θα έχουν στη διάθεσή τους τον Μπούζερ που τραυµατίστηκε στην πύρρεια, όπως αποδείχτηκε, εκτός έδρας νίκη επί των Γκόλντεν Στέιτ Γουόριορς 94-103 (Ντ. Τζορτζ 21π. - Οκούρ 23π., 7ρ. και ρεκόρ καριέρας στα ριµπάουντ ο Μίλσαπ µε 24). Ο κορυφαίος ώς τώρα παί-

κτης των «µορµόνων» σύµφωνα µε πληροφορίες υπέστη θλάση στα πλευρά στο πρώτο 12λεπτο. Με την ολοκλήρωση της περιόδου πήγε στ’ αποδυτήρια και δεν ξαναγύρισε. Στο Λος Αντζελες, οι Λέικερς δίχως τον Κόµπι Μπράουν που παραµένει εκτός εν όψει πλέι οφ, έκλεισαν τις εντός έδρας εµφανίσεις τους στην κανονική περίοδο νικηφόρα, καθώς µε 28π., 8ρ. του Πο Γκαζόλ επικράτησαν των Σακραµέντο Κινγκς 106-100 (Ού-

ντριχ 21π.) κι έδωσαν ραντεβού για την Κυριακή. Τότε, στον πρώτο αγώνα των πλέι οφ θα υποδεχτούν την Οκλαχόµα Σίτι. Εξάλλου, σε επέµβαση θα υποβληθεί ο Μπράντον Ρόι θέτοντας εν αµφιβόλω την παρουσία του στα πλέι οφ, ενώ οι Λ.Α. Κλίπερς δε θα προσεγγίσουν, τελικά, τον Λάρι Μπράουν που εκτός συγκλονιστικού απροόπτου θ’ αφήσει τη Σάρλοτ για να επιστρέψει στη Φιλαντέλφια όπου και βρίσκεται η οικογένειά του.

ΒΟΛΕΪ

Ρισκάρει η ΕΣΑΠ ΣΥΝΕΧΕΙΑ στο πρωτάθληµα, χωρίς να περιµένει την απόφαση του ΑΣΕΑ∆, προτίθεται να δώσει η ΕΣΑΠ, µε ό,τι αυτό µπορεί να συνεπάγεται. Η Λίγκα ενηµερώθηκε ότι το αθλητικό δικαστήριο δεν θα εκδικάσει σήµερα την προσφυγή του Ηρακλή και έτσι συγκάλεσε για το απόγευµα έκτακτο ∆ιοικητικό Συµβούλιο, προκειµένου να καθορίσει την στάση της. Οι πληροφορίες αναφέρουν ότι προτίθεται να ορίσει τους ηµιτελικούς στις αρχές της επόµενης εβδοµάδας και, ενδεχοµένως, να µειώσει τις νίκες που χρειάζονται σε δύο. Υπάρχει βέβαια το ερώτηµα, τι θα γίνει εφόσον ο Ηρακλής κερδίσει την υπόθεση στο ΑΣΕΑ∆, αφού τότε οι διεξαχθέντες αγώνες του Αρη θα ακυρωθούν και το πρωτάθληµα θα τιναχτεί στον αέρα. Το άρθρο 126, παρ. 3 του αθλητικού νόµου (2725/99) προβλέπει ότι «δεν µπορεί να επικυρωθεί καµία βαθµολογική σειρά αγώνων, εφόσον εκκρεµούν προσφυγές στο ΑΣΕΑ∆, σχετικά µε αποτελέσµατα αγώνων που επηρεάζουν το κύρος και τη βαθµολογία τους». Στο µεταξύ, µε ανακοίνωσή του, το ΤΑΠ Ηρακλής καταφέρεται εναντίον του προέδρου του Αρη και της ΕΣΑΠ, Νίκου Παπαδόπουλου, επειδη ο τελευταίος δήλωσε πως η απόφαση του αθλητικού δικαστή δεν είναι εφέσιµη (τον χαρακτηρίζει µάλιστα ως «αποτυχηµένο πρόεδρο της ΕΣΑΠ»). Aργά το απόγευµα, στους «κυανόλευκους» απάντησε µε δική του ανακοίνωση ο Ενιαίος Αρης, που µεταξύ άλλων αναφέρει ότι «η διοίκηση του Ηρακλή έχει µάθει να λειτουργεί υπό καθεστώς ασυλίας κι ατιµωρησίας». Και ο Αλέκος Λεώνης, µιλώντας σε τηλεοπτικό σταθµό, άφησε ανοικτό το ενδεχόµενο να επιστρέψει στον Ηρακλή «αρκεί να υπάρχουν οι κατάλληλες συνθήκες». O∆ΥΝΗΡΗ ήττα, που την στέλνει πιο κοντά στην Α2, υπέστη χτες η γυναικεία οµάδα του Αρη. Οι «κίτρινες» έχασαν στα Βασιλικά από την ΕΑ Λάρισας µε 3-2 (25-27, 25-20, 25-23, 15-25, 1512) για τα πλέι άουτ και είναι πλέον 0-2 στις νίκες. Ο τρίτος αγώνας θα γίνει το Σάββατο στη Λάρισα. Σήµερα διεξάγονται οι δεύτεροι αγώνες των πλέι οφ µεταξύ Μαρκόπουλου -Ηρακλή (1-0, 19.00 Novasports 1), Κερατέας - Παναθηναϊκού (0-1), Ηρακλή Κηφ. - Ολυµπιακού (0-1) και Πανιωνίου - Πανελληνίου (1-0).


φωνή

ΜΠΑΣΚΕΤ

Πέµπτη 15 Απριλίου 2010

7

27

ΤΩΝ ΣΠΟΡ

Ενας µέσα, ένας έξω

Α1

Ο Καυκής επέστρεψε στις προπονήσεις, ωστόσο ο Γκετσέφσκι ταλαιπωρείται από ίωση και δύσκολα θα προλάβει την ΑΕΚ Του ΚΩΣΤΗ ΜΠΟΤΣΑΡΗ

Ε

ναν πολύ σοβαρό λόγο είχε στη χτεσινή προπόνηση ο Σούλης Μαρκόπουλος για να χαµογελάει. Ο Παναγιώτης Καυκής (φωτό) συµµετείχε κανονικά στο µεγαλύτερο µέρος της προπόνησης και προληπτικά αποχώρησε από το τελευταίο αποδεικνύοντας πως ξεπέρασε το διάστρεµµα που τον κράτησε εκτός δράσης για δύο εβδοµάδες. Ετσι, ο τεχνικός του ΠΑΟΚ είδε µια ακόµη αξιόπιστη λύση να προστίθεται στην περιφέρεια της οµάδας εν όψει του κρίσιµου εκτός έδρας αγώνα µε την ΑΕΚ. Αντίθετα, απών ήταν και χτες ο Γκετσέφκσι καθώς δεν ξεπέρασε την ίωση που τον έχει προσβάλει και οι πιθανότη-

τες συµµετοχής του ολοένα και µειώνονται. Στο µεταξύ, πιστός στην προ ηµερών δέσµευσή του ο Μπράνκο Μιλισάβλιεβιτς τακτοποίησε τις τελευταίες εκκρεµότητές του στη Θεσσαλονίκη και χτες πέρασε από το «παλατάκι». Πριν αναχωρήσει για την πατρίδα του, ο 34χρονος γκαρντ αποχαιρέτησε τα µέλη της οµάδας, επιβεβαιώνοντας το γεγονός ότι ως φίλος ήρθε και ως φίλος έφυγε, άσχετα αν οι τελευταίες εξελίξεις πρόδιδαν κάτι διαφορετικό. Αλλωστε, σ’ αυτό το ύφος ήταν και η σχετική ανακοίνωση της ΚΑΕ: «Η ΚΑΕ ΠΑΟΚ θέλει να ευχαριστήσει τον Branko Milisavljevic για την προσπάθεια που κατέβαλε στο διάστηµα που ήταν µέλος της οµάδας και να του ευχηθεί καλή επιτυχία στη συνέχεια». Λεπτοµέρειες αποµένουν για την τακτοποίηση και του

οικονοµικού θέµατος, µε τις ενδείξεις να προϊδεάζουν θετικά (η λύση ίσως να βρεθεί µέχρι το τέλος της εβδοµάδας). Αυτό ήταν ένα από τα θέµατα που συζητήθηκαν στο χτεσινοβραδινό έκτακτο διοικητικό συµβούλιο της ΚΑΕ, όπου συζητήθηκαν κυρίως οι δικαστικές εκκρεµότητες, ενώ σήµερα θα γίνει πρόταση στον Κούβελα για τα οφειλόµενα. Την καθιερωµένη εβδοµαδιαία επικοινωνία του µε τους εκπροσώπους των ΜΜΕ θα έχει σήµερα (12.30) ο Σούλης Μαρκόπουλος στην PAOK Sports Arena.

Εχουν... φλόγα Θετικό το δείγµα του Αρη στο φιλικό µε τον Ηλυσιακό στην Αθήνα, καθώς οι «κίτρινοι» είχαν καλή απόδοση και κυρίως διάθεση. Το µήνυµα του Μάσεϊ Του ΜΙΛΤΟΥ ΨΩΜΑΔΑΚΗ

ΗΛΥΣΙΑΚΟΣ: Καπινιάρης 4, Κουκουλάς 5, Κάµινγκς 2, Καρύδας 8 (1), Κάρτερ 4, Παπανικολάου 16 (2), Παπαδάκης 3 (1), Χατζής 2, Αθανασούλας 2, Σιούτης, Βιδάλης 6 (1), Γαλιώτος, Ιωάννου 6 (1), Χάντερ 16, Κασελάκης 2. ΑΡΗΣ: Ούολς 12 (1), Κακιούζης 15 (1), Κλαρκ, Ρίτσαρντσον 21 (5), Πάουνιτς 8, Μάιλς 9 (1), Σκορδίλης 9, Αργυρόπουλος, Μπάρλος 5 (1), Ντικούδης 10, Μπετς 13.

Ο

ταν µιλάµε για φιλικό παιχνίδι το ζητούµενο είναι να πειραµατίζονται οι προπονητές, δοκιµάζοντας σχήµατα και επιδιώκοντας αυτοµατισµούς, εντούτοις όσοι παρακολούθησαν το φιλικό του Αρη µε τον Ηλυσιακό στην Αθήνα είχαν αρκετά κολακευτικά σχόλια να καταθέσουν. Ο Αρης επικράτησε µε 76-104 σε παιχνίδι που οι δύο προπονητές συµφώνησαν να παιχτεί ένα έξτρα δεκάλεπτο, τα ευχάριστα για τους «κίτρινους» όµως δεν προκύπτουν απαραίτητα από το τελικό σκορ. Προκύπτουν κυρίως από τη διάθεση των παικτών, που παρά το εύρος του σκορ πάλεψαν µέχρι και την τελευταία φάση, δείχνοντας αποφασισµένοι να βελτιωθούν ώστε να ολοκληρώσουν µε τον καλύτερο τρόπο τη σεζόν. Μελανό σηµείο, πάντως, ήταν ένας ακόµη... διαγραφόµενος τραυµατισµός. Ο Χατζηβρέττας ένιωσε ορισµένες ενοχλήσεις στη γάµπα στο ζέσταµα και δεν αγωνίστηκε. Υπάρχουν φόβοι για θλάση, που θα επιβεβαιωθούν µετά τη σηµερινή εξέταση του αρχηγού. Τα δεκάλεπτα: 21-26, 3049, 38-69, 58-83, 76-104.

Το θέµα Μάσεϊ Πολύ καλή εµφάνιση από τον Ρίτσαρντσον στο χτεσινό φιλικό

ΠΑΝΕΛΛΗΝΙΟΣ

«Πετάει» για Βιτόρια ΤΙΣ δικές του µεγάλες στιγµές ζει ο Πανελλήνιος. Στις 7:30 η αποστολή των «Ολυµπιονικών» µπαίνει µε όνειρα ευρωπαϊκού τίτλου στο τσάρτερ που ναύλωσε η διοίκηση µε προορισµό τη Βιτόρια, όπου το Σαββατοκύριακο θα πραγµατοποιηθεί το Final 4 του EuroCup. Αντίπαλος στον ηµιτελικό είναι η πανίσχυρη Βαλένθια, η οποία όµως δεν... τροµάζει καθώς, όπως δηλώνει και ο Τζούρο Οστοϊτς: «Το παιχνίδι είναι πολύ δύσκολο αλλά είµαστε αισιόδοξοι. Θέλουµε να αποδείξουµε ότι δίκαια φτάσαµε στο Final 4, δεν πάµε για διακοπές στη Βιτόρια».

ΚΑΒΑΛΑ: ευχαριστηµένοι µε τις ηµέρες και τα έργα του Βαγγέλη Αλεξανδρή στην οµάδα είναι οι ιθύνοντες της Καβάλας και καλοβλέπουν την παραµονή του και του χρόνου. Ο έµπειρος κόουτς από την πλευρά του προετοιµάζει την Καβάλα για το παιχνίδι στα Τρίκαλα που δίνει... παραµονή και είναι ικανοποιηµένος για την προσαρµογή των Σίµονς και Ντιν. ΤΡΙΚΑΛΑ: ο Σάββας Μανούσος δε θα φορέσει τελικά τη φανέλα των Τρικάλων, καθώς δεν του δόθηκαν ορισµένες εγγυήσεις που ζήτησε µε αποτέλεσµα να αποχωρήσει από την οµάδα πρόωρα.

Το... σίριαλ Τζέρεµι Μάσεϊ τελειωµό δεν έχει κι όπως φαίνεται, αν δεν επιτευχθεί η µεγάλη επιστροφή, Αρης και παίκτης δε θα ησυχάσουν. Χτες, ο «Τζέρι» έγραψε στη σελίδα του Σάββα Ηλιάδη facebook σε άπταιστα ελληνικά «... µόνο Αρης! Την άλλη εβδοµάδα πάω στον Αρη, θα έρθεις;», και χάρισε ένα ακόµα επεισόδιο. Ο Αµερικανός συνεχίζει να «δένεται» µε συµβόλαιο µε την Οµπραντόριο, που την Κυριακή υποδέχεται τη Σεβίλη στο µατς της χρονιάς για την παραµονή της. Εφόσον από... Δευτέρα ο Μάσεϊ µείνει ελεύθερος φαντάζει βέβαιο πως θα πάρει το αεροπλάνο για τη Θεσσαλονίκη, καθώς ο Αρης τον περιµένει.

«Κατοστάρα» ο Ολυµπιακός ΣΕ εξ αναβολής παιχνίδι για την 22η αγωνιστική ο Ολυµπιακός έκανε... βόλτα στο Περιστέρι, κέρδισε µε 80-102 και πάνω απ’ όλα έδειξε σε καλή κατάσταση εν όψει του Φάιναλ Φορ της Ευρωλίγκας. Ο Μπέβερλι (φωτό) στην επιστροφή του στην Α1 ήταν εξαιρετικός. ΠΕΡΙΣΤΕΡΙ: Χάµοντς 9, Αγαδάκος 4, Παπανικολόπουλος, Μάντζαρης Β. 7 (1), Μπράµος 20 (5), Γκέινς 7 (2), Μάντζαρης Α., Μαργαρίτης, ∆εληγιάννης, Νέλσον 14 (1), Τσιάκος 7 (1), Αρνολντ 12. ΟΛΥΜΠΙΑΚΟΣ: Παπαλουκάς 7 (1), Πεν 3 (1), Τσίλντρες 12 (1), Μπέβερλι 14 (1), Βασιλόπουλος 11 (2), Μπουρούσης 8, Παπανικολάου 3, Κλέιζα 3, Μαυροκεφαλίδης 13, Τεόντοσιτς 16 (4), Γλυνιαδάκης 2, Σχορτσιανίτης 10. Η βαθµολογία (σε 23 αγώνες): Παναθηναϊκός 45, Ολυµπιακός 43, Μαρούσι 39, Πανελλήνιος 38, Κολοσσός 37, ΠΑΟΚ 35, Αρης 34, Περιστέρι 34, Πανιώνιος 32, ΑΕΚ 31, Καβάλα 30, Ηλυσιακός 29, Τρίκαλα 29, Γ.Σ. Ολύµπια 27. ΟΙ διαιτητές της 24ης αγωνιστικής: Σάββατο 17/04: Γ.Σ. Ολύµπια - Μαρούσι (Σπυρίδωνος - Ανδρικόπουλος - Κατραχούρας), Τρίκαλα Καβάλα (Γκόντας - Ψαριανός - Μητσόπουλος), Κολοσσός - Ολυµπιακός (Μουζάκης Κοροµηλάς - Πανταζής), ΑΕΚ - ΠΑΟΚ (Παπαδηµητρίου - Τανατζής - Μπήτης), Περιστέρι Παναθηναϊκός (Χριστοδούλου - Φούφης - Βαρδάλος), Πανιώνιος - Ηλυσιακός (Πηλοΐδης - Παπαπέτρου - Παφίλης). Πέµπτη 22/04: Πανελλήνιος - Αρης (Αναστόπουλος - Καρακατσούνης - Σώµος).


28

φωνή

8

ΤΩΝ ΣΠΟΡ

Πέµπτη 15 Απριλίου 2010

«ΟΤΑΝ είναι ν’ ανακοινωθεί κάτι, θ’ ανακοινωθεί στην ώρα του», δήλωσε διπλωµατικά ο ∆ηµήτρης Σαλπιγγίδης για τη συνέχεια της καριέρας του. Ο Θεσσαλονικιός «στράικερ» δεν... ψήθηκε απ’ τα εκατοµµύρια του Πατέρα, τα γλέντια για τον τίτλο, τη συµµετοχή στο Τσάµπιονς Λιγκ. Ετοιµάζεται να επιστρέψει στον ΠΑΟΚ. Οσοι στην «ασπρόµαυρη» κερκίδα δε το θέλουν, ας κάνουν «πάρτι» τις σπάνιες φορές που σκοράρουν ο... Μουσλίµοβιτς και ο Εντίνιο. Γ. Β.

click

ΣΟΒΑΡΟΤΑΤΟ επεισόδιο ανάµεσα στον πρόεδρο των Σικάγο Μπουλς, Τζον Πάξον και τον προπονητή Βίνι Ντελ Νέγκρο αποκάλυψαν τα αµερικανικά ΜΜΕ. Σύµφωνα µε τα δηµοσιεύµατα, µετά το τέλος του αγώνα Σικάγο - Φίνιξ ο Πάξον άρπαξε τον τεχνικό των «ταύρων» από τη γραβάτα ζητώντάς του το λόγο επειδή χρησιµοποίησε γι’ αρκετά λεπτά τον τραυµατία Νοά. Ο τεχνικός επιβεβαίωσε τη διαφωνία, ενώ ο πρόεδρος κάνει λόγο για εσωτερικό θέµα. Κ. Μπ.

Η ΕΙΚΟΝΑ του Ντέγιαν Τοµάσεβιτς στο γήπεδο του ΠΑΟΚ φάνηκε πολύ οικεία σε όλους, εξαιτίας ίσως της πρόσφατης θητείας του στο «∆ικέφαλο». Πιο άνετα απ’ όλους όµως ένιωσε ο ίδιος. Ο 37χρονος Σέρβος έγινε δεκτός µε ιδιαίτερη θέρµη την οποία κι ανταπέδωσε σε κόσµο και παράγοντες αλλά η πλέον καλή σχέση του ήταν πάντα µε τα πρόσωπα που ίδρωσαν µαζί στο παρκέ. Γι’ αυτό και πριν φύγει αναζήτησε τους περσινούς του συµπαίκτες, που αγωνίζονται ακόµη στην οµάδα, για να τους αποχαιρετήσει προσωπικά. Κ. Μπ.

ΣΤΑ διάφορα «σενάρια» για το µέλλον του Ολυµπιακού, ακούστηκε και ότι το καλοκαίρι θα πιάσουν δουλειά στο «λιµάνι» ο Βασίλης Γκαγκάτσης και ο Ζήσης Βρύζας! Για τον πρώην πρόεδρο της ΕΠΟ τίποτα δεν αποκλείεται. Αυτό όµως µε τον πρώην πρόεδρο και νυν αντιπρόεδρο της ΠΑΕ ΠΑΟΚ µοιάζει µε... ανέκδοτο. Πάντως µόνο γέλιο δεν προκαλεί στον «βαµµένο ασπρόµαυρο» και... αντιολυµπιακό Βρύζα. Γ. Β.

φαλτσαριστά Μόνο η µεγαλύτερη κάθοδος οπαδών σε τελικό Κυπέλλου; Και την άνοδο πού τη βάζετε; Στο µεταξύ, η ΕΛΑΣ εγγυάται την άψογη διεξαγωγή του τελικού. Γι’ αυτό µας βλέπετε τόσο ανήσυχους. Μην απορείτε που ο Κακλαµάνης έγινε ασπίδα κατά του γκρεµίσµατος της Λεωφόρου. Σκοπεύει να µπει ο ίδιος µπροστά από τις µπουλντόζες. Ευθεία επίθεση κατά του Μπάγεβιτς έκανε η Original. Πάνω που αρχίσαµε να πιστεύουµε ότι δεν υπάρχει ελπίδα στην ΑΕΚ.

ΒΛΕΠΟΝΤΑΣ ότι τα εισιτήρια του Μουντιάλ εξακολουθούν να µένουν αδιάθετα στη Νότια Αφρική, η ΦΙΦΑ αποφάσισε να αλλάξει πολιτική και θα τα διαθέσει στη χώρα µε πληρωµή µετρητοίς και όχι µέσω διαδικτύου και πιστωτικών καρτών. Οπως ανακοίνωθηκε χτες, περίπου 500.000 εισιτήρια θα διατεθούν µέσω εµπορικών κέντρων και... σούπερ µάρκετ, ωστόσο πρόβληµα εξακολουθεί να αποτελεί η τιµή τους, που είναι αρκετά ακριβή για το εισόδηµα του µέσου Νοτιοαφρικανού. Ζ. Ν.

Ανίκητη η βλακεία Είχαν πλακωθεί ακόµη και σε αγώνα γυναικείου βόλεϊ οι χούλιγκαν, τώρα τα έβαλαν και µε τους πιτσιρικάδες. Αν... βαρέθηκαν να δέρνονται µεταξύ τους, δε φταίνε οι υπόλοιποι, ειδικά οι µικροί αθλητές. Το στιγµιότυπο από τον χτεσινό αγώνα Νέων Παναθηναϊκού-Ολυµπιακού

TVεπιλογές

13.00 15.00 17.30 17.55 19.00 19.00 21.00 21.30 21.30 23.00 23.15 01.00

Μίλαν - Κατάνια (ποδόσφαιρο, Ε) Γουλβς - Στόουκ (ποδόσφαιρο, Ε) Με 100... στα σπορ (εκποµπή, Ζ) Αθλητικές Ειδήσεις (εκποµπή, Ζ) Μαρκόπουλο - Ηρακλής (βόλεϊ, Ζ) Τότεναµ - Αρσεναλ (ποδόσφαιρο, Μ) Novasports News (εκποµπή, Ζ) Ματσεράτα - Μόντενα (βόλεϊ, Ζ) Μπερσότ -Σταντάρ Λ. (ποδόσφαιρο, Ζ) Βαλένθια - Ατλέτικο Μπ. (ποδόσφαιρο, Ζ) Αλµερία - Ρεάλ Μ. (ποδόσφαιρο, Μ) Moto GP Show (εκποµπή)

Novasports 1 Novasports 1 TV 100 ΕΤ-3 Novasports 1 Novasports 2 Novasports 1 sport plus Conn-X2 Conn-X1 Skai TV Skai TV

ΓΙΑ να µην ξεχνιόµαστε: ο Αρης έχει κίνητρο και µάλιστα µεγάλο στον τελευταίο αγώνα πρωταθλήµατος µε τον Ολυµπιακό. ∆εν είναι αγώνας προπόνησης για τον τελικό κι αυτό ο Κούπερ το γνωρίζει καλά. Ο ΗΡΑΚΛΗΣ ποτέ δεν κοίταξε µε σοβαρότητα το περιουσιακό στοιχείο που λέγεται Μπαντής. Τουλάχιστον δε στέκεται εµπόδιο στο αύριο που µπορει να ‘χει αυτό το παιδί. Κάτι είναι κι αυτό.

ΓΚΡΙΝΙΕΣ έχει προκαλέσει στην Ουρουγουάη η επιθυµία του Ζεράρζο Μαρτίνο, να συµπεριλάβει «νατουραλιζέ» Αργεντινούς στην αποστολή του Μουντιάλ. Ο οµοσπονδιακός προπονητής, όµως, είναι ανένδοτος: «∆ε µου φαίνεται λογικό να παραβλέψω κάποιους σηµαντικούς ποδοσφαιριστές. Ο κόσµος θα µε... κρεµάσει αν αποτύχω, όχι αν καλέσω παίκτες που πήραν την υπηκοότητα της Παραγουάης». Τέτοιοι παίκτες είναι οι Σαντάνα, Ορτιγκόζα, Φάµπρο και, κυρίως, ο Λούκας Μπάριος της Ντόρτµουντ. Ζ. Ν.

ΟΙ παρατυπίες της Α1 αποτελούν καθηµερινότητα τα τελευταία χρόνια, µε το Γ.Σ. Ολύµπια, όµως, το πράγµα παράγινε καθώς παίζει δίχως εγγυητική επιστολή. Το Περιστέρι ως η µόνη οµάδα που έχει έννοµο συµφέρον να µηδενιστεί η Ολύµπια (τέσσερις νίκες, τρεις µε Καβάλα, Τρίκαλα, Ηλυσιακό που παλεύουν για την παραµονή και µία µε το Περιστέρι) κίνησε τις σχετικές διαδικασίες, όλες οι υπόλοιπες οµάδες όµως µαζί µε τον ΕΣΑΚΕ σφύριξαν αδιάφορα... Μ. Ψ.

µπρος πίσω ΜΟΝΟ αν... αποχωρήσει από το πρωτάθληµα θα χάσει ο Ηρακλής την (επ)άνοδό του στην Α1. Και αντί όλη η «κυανόλευκη» οικογένεια να πανηγυρίζει αλλά (κυρίως) να καταστρώνει τα πλάνα της για την επιστροφή στα «σαλόνια» ώστε (όπως επιτάσσει η ιστορία της οµάδας) να µη γίνει «ασανσέρ», η απαξίωση και η γκρίνια είναι Από Απότον τη στην ηµερήσια διάταξη, αφού Αντώνη Βίκυ το ταµείον είναι µείον. Τσότσου Γκάτζιο ΣΥΜΦΩΝΟΙ, τα πράγµατα γενικώς δεν πηγαίνουν καλά στο ελληνικό µπάσκετ, όµως στον Ηρακλή το κακό παράγινε. Η οµάδα που

«Εγκληµα» η απαξίωση του Ηρακλή

ανέδειξε τη µισή Εθνική Ανδρών και που έφτασε δύο φορές µέσα σε τρία χρόνια (2002, 2004) στην ελίτ του ελληνικού µπάσκετ αφέθηκε στη µοίρα της µε φυσιολογική συνέπεια τον υποβιβασµό στην Α2. Και πάνω που οι περισσότεροι νόµιζαν ότι το πάθηµα έγινε µάθηµα, βλέπουν ότι η απαξίωση συνεχίζεται. ΚΑΚΑ τα ψέµατα, η οικογένεια του Ηρακλή ποτέ δεν «αγάπησε» το µπάσκετ. Ο Ερασιτέχνης ο οποίος κλήθηκε να αναλάβει τις τύχες της ΚΑΕ εξαιτίας των «εγκληµάτων» που έγιναν στις εποχές των παχιών αγελάδων είπε πολλάκις «απελθέτω απ’εµού το ποτήριον τούτο». Και από τη στιγµή που η ίδια η οµάδα

απαξιώνει ένα από τα «παιδιά» της, είναι λογικό να µην ενδιαφερθεί και κανένας άλλος. ΟΛΑ αυτά είναι γνωστά, όµως το θέµα είναι τι µέλλει γενέσθαι. Οι τελευταίες πληροφορίες µιλούν για ενδιαφέρον επιχειρηµατία εκτός Θεσσαλονίκης για τη σύσταση της νέας ΚΑΕ, όµως άπαντες κρατούν µικρό καλάθι. Θα είναι «έγκληµα» να ανέβει ο Ηρακλής και να... πέσει αύτανδρος λόγω της αδιαφορίας των ίδιων του των ανθρώπων (µε εξαίρεση τη διοικούσα επιτροπή που έκανε ήδη πολλά). Ενα έγκληµα (όπως και τα προηγούµενα) χωρίς τιµωρία...


1.394

νέες θέσεις

338

169

209

θέσεις ωρομισθίων σε ΕΠΚΑ Σ|2

προσλήψεις στο δημόσιο τομέα Σ | 10-11

θέσεις σε εταιρίες της Β. Ελλάδας Σ | 12

εργασία

470 θέσεις εποχικού προσωπικού σε 45 φορείς

ΑΓΓΕΛΙΟΦΟΡΟΣ Πέμπτη 15 Απριλίου 2010 Aρ. Φύλλου 950

Σ|3


εργασία

2

ΑΓΓΕΛΙΟΦΟΡΟΣ Πέμπτη 15 Aπριλίου 2010

Η προσφορά εργασίας στη Θεσσαλονίκη

3

14

ΚΠΑ2 IΩNIAΣ

ΚΠΑ2 Π. ΑΞΙΟΥ

8 ΚΠΑ2 ΝΕΑΠΟΛΗΣ

ΚΠΑ2 ΙΩΝΙΑΣ

301204100243 301204100244 301204100161

1 1 1

ΠΩΛΗΤΕΣ Β. ΦΑΡΜΑΚΟΠ. ΑΠΟΘ. ΖΥΓΙΣΤ. ΕΠΙΠΛΟΠΟΙΟΙ ΚΟΜΜΩΤΕΣ ΕΙΔΙΚ. ΤΕΧΝΙΤ. ΕΠΑΓΓ. ΑΘΛ. ΠΩΛΗΤΕΣ Β. ΛΟΓΙΣΤΩΝ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΠΑΙΔΟΚΟΜΟΙ ΔΙΑΚΟΣΜΗΤΕΣ

1 1 2 1 2 1 1 1 1 1 1 1

301205100415 301205100413 301205100426 301205100427 301205100394 301205100430

ΕΡΓΑΤΕΣ Β. ΦΑΡΜΑΚΟΠΟΙΩΝ ΒΟΗΘΟΙ ΛΟΓΙΣΤΩΝ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΕΡΓΑΤΕΣ ΕΙΔΙΚ. ΠΩΛΗΤΕΣ

2 1 1 1 2 1

ΚΠΑ2 ΘΕΣ/ΝΙΚΗΣ

301201100318 301201101110 301201101064 301201101145 301201101157 301201101139 301201101158 301201101137 301201101138

ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΠΑΡ. ΥΠΗΡ. ΣΥΝΤ. ΗΛ. ΕΞΟΠ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΧΕΙΡ. ΤΗΛ. ΚΕΝΤ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΧΕΙΡ. ΡΑΔΙΟΤ. ΕΞ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

6

ΚΠΑ2 ΘEΣΣAΛONIKHΣ

ΚΠΑ2 ΝΕΑΠΟΛΗΣ

ΚΟΜΜΩΤΕΣ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΑΡΤΟΖΑΧΑΡΟΠ.

ΚΠΑ2 ΠΥΛΗΣ ΑΞΙΟΥ

301203100511 301203100512 301203100482 301203100480 301203100494 301203100493 301203100509 301203100508 301203100470 301203100506 301203100497 301203100496

32

1 1 1 1 1 2 1 1 1

301201101077 301201101141 301201101144 301201101126 301201101150 301201101100 301201101142 301201101140 301201101066 301201100796 301201101053 301201101152 301201101155 301201101156

ΧΕΙΡ. ΔΙΑΓΝ. ΙΑΤΡ. ΕΞ. ΓΡΑΜ. - ΔΑΚΤΥΛ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΠΛΑΝ. ΠΩΛΗΤΕΣ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΠΩΛΗΤΕΣ ΥΠΑΛ. ΠΑΡ. ΥΠΗΡ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΤΕΧΝΟΛΟΓΟΙ ΥΠΑΛ. ΠΑΡ. ΥΠΗΡ. ΑΠΟΘ. ΚΑΙ ΖΥΓ. ΥΠΑΛ. ΠΑΡ. ΥΠΗΡ. ΝΟΣΟΚΟΜΟΙ ΤΕΧΝ. Β. ΒΙΟΛΟΓ.

ΚΠΑ2, TY 25ης MAPTIOY

1 1 2 1 1 8 1 1 1 1 1 1 1 1

ΤΥ, ΚΠΑ2 25ης ΜΑΡΤΙΟΥ

301102001769

ΠΛΥΝΤΕΣ

28

1

301202100386 301202100379 301202100364 301202100382 301202100383

ΚΠΑ2 TOYMΠAΣ

ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΝΟΜ. ΓΡΑΦ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΕΡΓΑΤΕΣ ΥΠΑΛ. ΠΑΡ ΦΡΟΝΤ.

1 1 1 1 1

ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΠΩΛΗΤΕΣ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΝΟΜ. ΓΡΑΦ. ΕΙΔΙΚ. ΤΕΧΝΙΤΕΣ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΧΕΙΡ. ΤΗΛΕΦ. ΚΕΝΤ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΤΑΜΙΕΣ

1 1 1 1 1 1 10 10 1 1

ΚΠΑ2 ΤΟΥΜΠΑΣ

301206100515 301206100519 301206100530 301206100537 301206100518 301206100538 301206100523 301206100524 301206100532 301206100536

338 ωρομίσθιοι σε 10 φορείς του ΥΠΠΟ Την πλήρωση συνολικά 335 θέσεων ωρομίσθιου προσωπικού προκήρυξαν 10 Εφορείες Προϊστορικών και Κλασικών Αρχαιοτήτων, φορείς που υπάγονται στο υπουργείο Πολιτισμού. Ειδικότερα, η κατανομή των θέσεων ανά ειδικότητα, αριθμό θέσεων και φορέα απασχόλησης έχει ως εξής: - Στην ΚΖ ΕΠΚΑ, που εδρεύει στην Κατερίνη, προκηρύχθηκαν 44 θέσεις εκ των οποίων: α) έξι θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τέσσερις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για απασχόληση 1.320 ωρών στους αρχαιολογικούς χώρους της Βόρειας και Νότιας Πιερίας και β) 22 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τέσσερις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και έξι θέσεις καθαριστών ΥΕ για απασχόληση 990 ωρών στο αρχαιολογικό μουσείο και χώρο του Δίου. - Στην ΛΑ ΕΠΚΑ, που εδρεύει στα Αβδηρα Ξάνθης, προκηρύχθηκαν δύο θέσεις φυλάκων εργοταξίου ημέρας ΔΕ και μία θέση φύλακα εργοταξίου νύχτας ΔΕ για το Αρχαιολογικό Μουσείο. - Στην ΙΕ ΕΠΚΑ, που εδρεύει στη Λάρισα, προκηρύχθηκαν 11 θέσεις εκ των οποίων: α) έξι θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, β) τρεις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και γ) δύο θέσεις καθαριστών ΥΕ. - Στην ΛΒ ΕΠΚΑ, που εδρεύει στην Ηγουμενίτσα, προκηρύχθηκαν 17 θέσεις, εκ των οποίων: α) εννέα θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τρεις θέσεις φυλάκων εργοταξίου

νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για χρονικό διάστημα όχι μεγαλύτερο από 1.320 ώρες και β) τρεις θέσεις φυλάκων εργοταξίου ημέρας ΔΕ για χρονικό διάστημα όχι μεγαλύτερο από 990 ώρες. - Στην Κ ΕΠΚΑ, που εδρεύει στη Μυτιλήνη, προκηρύχθηκαν οκτώ θέσεις εκ των οποίων: α) πέντε θέσεις αρχαιολόγων ΠΕ και β) τρεις θέσεις εργατοτεχνιτών ΥΕ. - Στην ΚΒ ΕΠΚΑ, που εδρεύει στη Ρόδο, προκηρύχθηκαν 117 θέσεις εκ των οποίων: α) 12 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, δύο θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και έξι θέσεις καθαριστών ΥΕ για χρονικό διάστημα όχι μεγαλύτερο από 1.320 ώρες και β) 82 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τέσσε-

ρις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και 11 θέσεις καθαριστών ΥΕ για χρονικό διάστημα όχι μεγαλύτερο από 990 ώρες. Να σημειωθεί, ότι όσοι επιλεγούν για τις παραπάνω θέσεις θα καλύψουν ανάγκες που έχουν προκύψει σε Ρόδο, Κάλυμνο, Κω, Νίσυρο, Λέρο, Κάρπαθο, Αστυπάλαια και Κάσο. - Στην ΚΓ ΕΠΚΑ, που εδρεύει στο Ηράκλειο της Κρήτης, προκηρύχθηκαν 58 θέσεις εκ των οποίων: α) 13 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, οκτώ θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για χρονικό διάστημα όχι μεγαλύτερο από 1.320 ώρες και β) 26 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τέσσερις θέσεις φυλάκων εργοταξίου νύχτας

ΔΕ και πέντε θέσεις καθαριστών ΥΕ για χρονικό διάστημα όχι μεγαλύτερο από 990 ώρες. - Στην ΛΗ ΕΠΚΑ, που εδρεύει στην Καλαμάτα, προκηρύχθηκαν 27 θέσεις εκ των οποίων: α) 10 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τέσσερις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για απασχόληση έως 1.320 ώρες και β) 10 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ και μία θέση καθαριστή ΥΕ για απασχόληση έως 990 ώρες. - Στην ΛΖ ΕΠΚΑ, που εδρεύει στην Κόρινθο, προκηρύχθηκαν 30 θέσεις εκ των οποίων: α) οκτώ θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τέσσερις θέσεις εργοταξίου νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για απασχόληση έως 1.320 ώρες και β) 12 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, μία θέση φύλακα εργοταξίου νύχτας ΔΕ και τρεις θέσεις καθαριστών ΥΕ για απασχόληση έως 990 ώρες. - Στην Ε ΕΠΚΑ, που εδρεύει στη Σπάρτη, προκηρύχθηκαν 23 θέσεις εκ των οποίων: α) 13 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, β) επτά θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και γ) τρεις θέσεις καθαριστών ΥΕ. Για περισσότερες πληροφορίες σχετικά με τα απαιτούμενα προσόντα και δικαιολογητικά, οι ενδιαφερόμενοι μπορούν να επισκέπτονται την ιστοσελίδα του υπουργείου, www.yppo.gr, όπου δημοσιεύονται όλες οι σχετικές προκηρύξεις. Η προθεσμία υποβολής των αιτήσεων είναι κοινή για όλες τις παραπάνω θέσεις και λήγει στις 19 Απριλίου, εκτός από αυτές στην Ε ΕΠΚΑ, όπου η προθεσμία λήγει στις 20 Απριλίου.


εργασία

ΑΓΓΕΛΙΟΦΟΡΟΣ Πέμπτη 15 Απριλίου 2010

470 θέσεις εποχικού προσωπικού σε 45 φορείς ενέκρινε το ΑΣΕΠ Την πλήρωση 470 θέσεων εποχικού προσωπικού με συμβάσεις εργασίας ιδιωτικού δικαίου ορισμένου χρόνου σε 45 φορείς ενέκρινε το Ανώτατο Συμβούλιο Επιλογής Προσωπικού. Οι εν λόγω θέσεις πήραν έγκριση στο διάστημα από τις 23 Μαρτίου έως 8 Απριλίου. Από το σύνολο των θέσεων που θα καλυφθούν: οι 59 αφορούν την κατηγορία

πανεπιστημιακής εκπαίδευσης, οι 28 την κατηγορία τεχνολογικής εκπαίδευσης, οι 156 την κατηγορία δευτεροβάθμιας εκπαίδευσης και οι 227 την κατηγορία υποχρεωτικής εκπαίδευσης. Οι ενδιαφερόμενοι θα πρέπει να απευθύνονται στους ίδιους τους φορείς για περισσότερες πληροφορίες. Η κατανομή των θέσεων έχει ως εξής:

KAT. KΛA∆OΣ/ EI∆IKOTHTA

ΘEΣ.

ΦOPEAΣ

E∆PA / NOMAPXIA HMEP. EΓKP.

ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΤΕ ΥΕ ΥΕ ΥΕ ΥΕ ΥΕ ΥΕ ΔΕ ΥΕ ΤΕ ΥΕ ΠΕ ΥΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΤΕ ΥΕ ΥΕ ΥΕ ΥΕ ΥΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΠΕ ΠΕ ΠΕ ΤΕ ΥΕ ΥΕ ΥΕ ΥΕ ΔΕ ΔΕ ΥΕ

1 2 1 1 8 5 20 18 10 16 1 10 5 3 1 8 2 1 1 1 2 2 2 1 1 10 1 1 1 2 1 1 1 5 20 2 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 3 1 8 1 1 1 2 10 3 1 5

ΔΗΜΟΣ ΓΑΛΑΤΣΙΟΥ ΔΗΜΟΣ ΗΡΑΚΛΕΙΟΥ ΔΗΜΟΣ ΗΡΑΚΛΕΙΟΥ ΔΗΜΟΣ ΗΡΑΚΛΕΙΟΥ ΔΗΜΟΣ ΗΡΑΚΛΕΙΟΥ ΔΗΜΟΣ ΧΟΛΑΡΓΟΥ ΔΗΜ. ΠΑΙΔ. ΒΡΕΦ. ΣΤ. Δ. ΑΧΑΡΝΩΝ ΔΗΜ. ΠΑΙΔ. ΒΡΕΦ. ΣΤ. Δ. ΑΧΑΡΝΩΝ ΔΗΜΟΣ ΓΑΛΑΤΣΙΟΥ ΔΗΜΟΣ ΗΡΑΚΛΕΙΟΥ ΔΗΜΟΣ ΧΟΛΑΡΓΟΥ ΔΗΜΟΣ ΧΟΛΑΡΓΟΥ ΔΗΜ. ΠΑΙΔ. ΒΡΕΦ. ΣΤ. Δ. ΑΧΑΡΝΩΝ ΔΗΜ. ΠΑΙΔ. ΒΡΕΦ. ΣΤ. Δ. ΑΧΑΡΝΩΝ ΔΗΜΟΣ ΑΓΡΙΝΙΟΥ ΔΗΜΟΣ ΑΓΡΙΝΙΟΥ ΠΑΙΔ. ΒΡΕΦ. ΣΤ. Δ. ΑΡΤΕΜΙΔΟΣ ΠΑΙΔ. ΒΡΕΦ. ΣΤ. Δ. ΑΡΤΕΜΙΔΟΣ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. Δ. ΠΡΟΣΟΤΣΑΝΗΣ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. Δ. ΠΡΟΣΟΤΣΑΝΗΣ ΔΗΜΟΣ ΚΑΣΟΥ ΔΗΜΟΣ ΚΑΣΟΥ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ Ν. ΡΟΔΟΥ ΔΗΜΟΣ Ν. ΡΟΔΟΥ ΔΗΜΟΣ Ν. ΡΟΔΟΥ ΔΗΜΟΣ Ν. ΡΟΔΟΥ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ ΚΑΣΟΥ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ ΚΩ ΔΗΜΟΣ Ν. ΡΟΔΟΥ ΔΗΜΟΣ Ν. ΡΟΔΟΥ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. ΟΡΕΣΤΙΑΔΑΣ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. ΟΡΕΣΤΙΑΔΑΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΔΗΜ. Α.Ε. ΑΞ. ΑΚ. ΠΕΡ. Δ. ΑΛΕΞΑΝΔΡ. ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΚΟΙΝ. ΔΗΜ. ΕΠΙΧ. Δ. ΤΡΑΪΑΝΟΥΠΟΛΗΣ ΔΗΜ. Α.Ε. ΑΞ. ΑΚ. ΠΕΡ. Δ. ΑΛΕΞΑΝΔΡ. ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. ΟΡΕΣΤΙΑΔΑΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΕΒΖ ΟΡΕΣΤΙΑΔΟΣ ΔΗΜ. Α.Ε. ΑΞ. ΑΚ. ΠΕΡ. Δ. ΑΛΕΞΑΝΔΡ. ΔΗΜΟΣ ΑΥΛΙΔΑΣ ΔΗΜΟΣ ΑΥΛΙΔΑΣ ΔΗΜΟΣ ΑΥΛΙΔΑΣ

ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΘΗΝΩΝ ΑΙΤΩΛ/ΝΙΑΣ ΑΙΤΩΛ/ΝΙΑΣ ΑΝΑΤ. ΑΤΤΙΚΗΣ ΑΝΑΤ. ΑΤΤΙΚΗΣ ΔΡΑΜΑΣ ΔΡΑΜΑΣ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΔΩΔΕΚΑΝΗΣΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΒΡΟΥ ΕΥΒΟΙΑΣ ΕΥΒΟΙΑΣ ΕΥΒΟΙΑΣ

ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΟΙΚΟΔΟΜΩΝ ΥΔΡΑΥΛΙΚΩΝ ΣΙΔΗΡΟΥΡΓΩΝ ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. Β. ΒΡΕΦΟΝΗΠ. ΒΡΕΦΟΝΗΠ. ΕΡΓ. ΚΑΘΑΡ. ΕΡΓ. ΚΑΘΑΡ. ΕΡΓ. ΝΕΚΡΟΤ. ΕΡΓ. ΚΑΘΑΡ. ΠΡΟΣ. ΚΑΘΑΡ. Β. ΜΑΓΕΙΡΩΝ ΗΛΕΚΤΡΟΛΟΓΩΝ ΕΡΓ. ΚΑΘΑΡ. ΒΡΕΦΟΝΗΠ. ΠΡΟΣ. ΚΑΘΑΡ. ΝΟΣΗΛΕΥΤΙΚΗΣ ΟΙΚΟΓ. ΒΟΗΘ. ΟΔΗΓΩΝ ΔΙΟΙΚΗΤΙΚΟΥ ΟΔΗΓΩΝ ΧΕΙΡ. ΑΜΒΙΕΝΤΕ ΟΔΗΓΩΝ ΔΙΟΙΚΗΤΙΚΩΝ ΗΛΕΚΤΡΟΛΟΓΩΝ ΟΙΚΟΔΟΜΩΝ ΧΕΙΡ. JCB ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΗΛΕΚΤΡΟΤΕΧΝΙΤΩΝ ΠΛΗΡΟΦΟΡΙΚΗΣ ΕΡΓ. ΓΕΝ. ΚΑΘ. ΕΡΓ. ΚΗΠΟΥ ΕΡΓ. ΚΑΘΑΡ. ΕΡΓΑΤΩΝ ΕΡΓ. ΚΑΘΑΡ. ΧΕΙΡ. ΜΗΧ. ΕΡΓ. ΥΔΡΑΥΛΙΚΩΝ ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΥΠΑΛ. ΥΠΟΔ. ΓΕΩΠΟΝΩΝ ΝΟΣΗΛΕΥΤΩΝ ΝΑΥΑΓΟΣΩΣΤΩΝ ΝΟΣΗΛΕΥΤΙΚΗΣ ΕΡΓΑΤΩΝ ΓΕΩΡΓΟΕΡΓΑΤΩΝ ΓΕΩΡΓΟΕΡΓΑΤΩΝ ΚΑΘΑΡΙΣΤΩΝ ΟΔΗΓΩΝ ΧΕΙΡ. ΜΗΧ. ΕΡΓ. ΕΡΓ. ΚΑΘΑΡ.

01/04/10 31/03/10 31/03/10 31/03/10 31/03/10 31/03/10 07/04/10 07/04/10 01/04/10 31/03/10 31/03/10 31/03/10 07/04/10 07/04/10 23/03/10 23/03/10 26/03/10 26/03/10 31/03/10 31/03/10 31/03/10 31/03/10 29/03/10 29/03/10 29/03/10 29/03/10 29/03/10 08/04/10 08/04/10 08/04/10 08/04/10 29/03/10 31/03/10 29/03/10 29/03/10 08/04/10 08/04/10 31/03/10 31/03/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 01/04/10 08/04/10 01/04/10 26/03/10 08/04/10 01/04/10 31/03/10 01/04/10 01/04/10 08/04/10 29/03/10 29/03/10 29/03/10

3

KAT. KΛA∆OΣ/ EI∆IKOTHTA

ΘEΣ.

ΦOPEAΣ

E∆PA / NOMAPXIA HMEP. EΓKP.

ΥΕ ΔΕ ΥΕ ΠΕ ΔΕ ΥΕ ΠΕ ΠΕ ΠΕ ΠΕ ΠΕ ΠΕ ΔΕ ΔΕ ΠΕ ΥΕ ΥΕ ΥΕ ΔΕ ΤΕ ΔΕ ΥΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΠΕ ΠΕ ΠΕ ΠΕ ΠΕ ΤΕ ΥΕ ΔΕ ΔΕ ΥΕ ΔΕ ΔΕ ΔΕ ΠΕ ΤΕ ΥΕ ΥΕ ΥΕ ΔΕ ΥΕ ΔΕ ΔΕ ΥΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΥΕ ΔΕ ΠΕ ΤΕ ΔΕ ΥΕ ΥΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΔΕ ΥΕ ΥΕ ΥΕ ΥΕ ΔΕ ΔΕ ΔΕ ΥΕ ΔΕ ΔΕ ΔΕ ΥΕ

1 1 3 1 1 1 1 1 7 7 7 7 5 2 1 10 20 1 1 1 1 2 8 1 1 2 1 1 1 1 2 1 2 2 3 1 1 6 1 5 1 1 1 2 6 3 1 2 1 1 3 2 2 1 1 1 1 1 1 1 3 6 2 1 2 1 3 1 1 1 1 1 7 4 1 3 1 1 2 17 1 1 6 24

ΔΗΜΟΣ ΑΥΛΙΔΑΣ ΔΗΜΟΣ ΚΑΣΤΡΟΥ ΚΥΛΛΗΝΗΣ ΔΗΜΟΣ ΚΑΣΤΡΟΥ ΚΥΛΛΗΝΗΣ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. Δ. ΠΛΑΤΕΟΣ ΔΗΜΟΣ ΣΥΒΟΤΩΝ ΔΗΜΟΣ ΣΥΒΟΤΩΝ ΔΗΜ. ΕΠΙΧ. ΚΟΙΝ. ΠΡ. Δ. ΧΟΡΤΙΑΤΗ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. ΧΑΛΑΣΤΡΑΣ ΠΕΡΙΦΕΡΕΙΑ ΗΠΕΙΡΟΥ ΠΕΡΙΦΕΡΕΙΑ ΗΠΕΙΡΟΥ ΠΕΡΙΦΕΡΕΙΑ ΗΠΕΙΡΟΥ ΠΕΡΙΦΕΡΕΙΑ ΗΠΕΙΡΟΥ ΔΗΜΟΣ ΘΑΣΟΥ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. ΧΡΥΣΟΥΠΟΛΗΣ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. ΧΡΥΣΟΥΠΟΛΗΣ ΔΗΜΟΣ ΕΛΕΥΘΕΡΟΥΠΟΛΗΣ ΔΗΜΟΣ ΘΑΣΟΥ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. ΧΡΥΣΟΥΠΟΛΗΣ Δ. ΕΠΙΧ. ΠΟΛ. ΚΟΙΝ. ΑΝ. Δ. ΑΡΓ. ΟΡΕΣΤ. Δ. ΕΠΙΧ. ΠΟΛ. ΚΟΙΝ. ΑΝ. Δ. ΑΡΓ. ΟΡΕΣΤ. ΔΗΜΟΣ ΓΑΛΛΙΚΟΥ ΔΗΜΟΣ ΓΑΛΛΙΚΟΥ ΔΕΥΑ ΚΟΖΑΝΗΣ ΔΕΥΑ ΚΟΖΑΝΗΣ ΔΕΥΑ ΚΟΖΑΝΗΣ ΔΕΥΑ ΚΟΖΑΝΗΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΔΕΥΑ ΚΟΖΑΝΗΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΠΕΡΙΦΕΡΕΙΑ Δ. ΜΑΚΕΔΟΝΙΑΣ ΔΕΥΑ ΚΟΖΑΝΗΣ ΔΗΜΟΣ ΕΞΩΜΒΟΥΡΓΟΥ ΔΗΜΟΣ ΕΞΩΜΒΟΥΡΓΟΥ ΔΗΜΟΣ ΕΞΩΜΒΟΥΡΓΟΥ ΔΗΜΟΣ ΚΙΛΕΛΕΡ ΕΒΖ ΛΑΡΙΣΑΣ ΕΒΖ ΛΑΡΙΣΑΣ ΕΒΖ ΛΑΡΙΣΑΣ ΕΒΖ ΛΑΡΙΣΑΣ ΔΗΜΟΣ ΚΙΛΕΛΕΡ ΔΗΜΟΣ ΚΙΛΕΛΕΡ ΕΒΖ ΛΑΡΙΣΑΣ ΔΗΜ. ΕΠΙΧ. ΥΔΡ.-ΑΠΟΧ. ΑΓ. ΝΙΚΟΛΑΟΥ ΔΗΜ. ΕΠΙΧ. ΥΔΡ.-ΑΠΟΧ. ΑΓ. ΝΙΚΟΛΑΟΥ ΔΗΜΟΣ ΜΕΛΙΓΑΛΑ ΔΗΜΟΣ ΜΕΛΙΓΑΛΑ ΔΗΜΟΣ ΜΕΛΙΓΑΛΑ ΔΗΜΟΣ ΠΕΡΑΜΑΤΟΣ ΔΗΜΟΣ ΑΙΓΕΙΡΟΥ ΔΗΜΟΣ ΑΙΓΕΙΡΟΥ ΔΗΜΟΣ ΑΙΓΕΙΡΟΥ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. Δ. ΗΡΑΚΛΕΙΑΣ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. Δ. ΗΡΑΚΛΕΙΑΣ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. Δ. ΗΡΑΚΛΕΙΑΣ ΔΗΜ. ΕΠΙΧ. ΥΔΡ. ΑΠΟΧ. Δ. ΗΡΑΚΛΕΙΑΣ ΔΗΜ. ΚΟΙΝ. ΕΠΙΧ. Δ. Κ. ΜΗΤΡΟΥΣΙΟΥ ΠΕΡΙΦΕΡΕΙΑ ΣΤ. ΕΛΛΑΔΑΣ ΠΕΡΙΦΕΡΕΙΑ ΣΤ. ΕΛΛΑΔΑΣ ΠΕΡΙΦΕΡΕΙΑ ΣΤ. ΕΛΛΑΔΑΣ ΔΗΜΟΣ ΑΜΦΙΣΣΑΣ ΔΗΜΟΣ ΑΜΦΙΣΣΑΣ ΔΗΜΟΣ ΑΜΦΙΣΣΑΣ ΔΗΜΟΣ ΣΤΑΓΕΙΡΩΝ ΑΚΑΝΘΟΥ ΔΗΜΟΣ ΤΡΙΓΛΙΑΣ ΤΟΥΡ. ΕΠΙΧ. ΤΟΡΩΝΗΣ ΤΟΥΡ. ΕΠΙΧ. ΤΟΡΩΝΗΣ ΤΟΥΡ. ΕΠΙΧ. ΤΟΡΩΝΗΣ ΤΟΥΡ. ΕΠΙΧ. ΤΟΡΩΝΗΣ ΔΗΜΟΣ ΣΤΑΓΕΙΡΩΝ ΑΚΑΝΘΟΥ ΔΗΜΟΣ ΤΡΙΓΛΙΑΣ ΤΟΥΡ. ΕΠΙΧ. ΤΟΡΩΝΗΣ ΤΟΥΡ. ΕΠΙΧ. ΤΟΡΩΝΗΣ ΔΗΜΟΣ ΠΛΑΤΑΝΙΑ ΔΗΜΟΣ ΠΛΑΤΑΝΙΑ ΔΗΜΟΣ ΠΛΑΤΑΝΙΑ ΔΗΜΟΣ ΠΛΑΤΑΝΙΑ ΔΗΜΟΣ ΙΩΝΙΑΣ ΔΗΜΟΣ ΙΩΝΙΑΣ ΔΗΜΟΣ ΧΙΟΥ ΔΗΜΟΣ ΧΙΟΥ

ΕΥΒΟΙΑΣ ΗΛΕΙΑΣ ΗΛΕΙΑΣ ΗΜΑΘΙΑΣ ΘΕΣΠΡΩΤΙΑΣ ΘΕΣΠΡΩΤΙΑΣ ΘΕΣΣΑΛΟΝΙΚΗΣ ΘΕΣΣΑΛΟΝΙΚΗΣ ΙΩΑΝΝΙΝΩΝ ΙΩΑΝΝΙΝΩΝ ΙΩΑΝΝΙΝΩΝ ΙΩΑΝΝΙΝΩΝ ΚΑΒΑΛΑΣ ΚΑΒΑΛΑΣ ΚΑΒΑΛΑΣ ΚΑΒΑΛΑΣ ΚΑΒΑΛΑΣ ΚΑΒΑΛΑΣ ΚΑΣΤΟΡΙΑΣ ΚΑΣΤΟΡΙΑΣ ΚΙΛΚΙΣ ΚΙΛΚΙΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΟΖΑΝΗΣ ΚΥΚΛΑΔΩΝ ΚΥΚΛΑΔΩΝ ΚΥΚΛΑΔΩΝ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΡΙΣΑΣ ΛΑΣΙΘΙΟΥ ΛΑΣΙΘΙΟΥ ΜΕΣΣΗΝΙΑΣ ΜΕΣΣΗΝΙΑΣ ΜΕΣΣΗΝΙΑΣ ΠΕΙΡΑΙΩΣ ΡΟΔΟΠΗΣ ΡΟΔΟΠΗΣ ΡΟΔΟΠΗΣ ΣΕΡΡΩΝ ΣΕΡΡΩΝ ΣΕΡΡΩΝ ΣΕΡΡΩΝ ΣΕΡΡΩΝ ΦΘΙΩΤΙΔΑΣ ΦΘΙΩΤΙΔΑΣ ΦΘΙΩΤΙΔΑΣ ΦΩΚΙΔΑΣ ΦΩΚΙΔΑΣ ΦΩΚΙΔΑΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΛΚΙΔΙΚΗΣ ΧΑΝΙΩΝ ΧΑΝΙΩΝ ΧΑΝΙΩΝ ΧΑΝΙΩΝ ΧΙΟΥ ΧΙΟΥ ΧΙΟΥ ΧΙΟΥ

ΕΡΓ. ΥΔΡ. - ΑΠΟΧ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΕΡΓΑΤΩΝ ΚΟΙΝΩΝΙΟΛΟΓΩΝ ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΕΡΓΑΤΩΝ ΝΟΣΗΛΕΥΤΩΝ ΚΟΙΝΩΝΙΟΛΟΓΩΝ ΔΙΟΙΚ. - ΟΙΚΟΝ. ΔΙΟΙΚ. - ΟΙΚΟΝ. ΔΙΟΙΚ. - ΟΙΚΟΝ. ΔΙΟΙΚ. - ΟΙΚΟΝ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΕΠΙΜ. ΠΡΟΝ. ΚΟΙΝ. ΦΡΟΝΤ. ΝΟΣΗΛΕΥΤΩΝ ΕΡΓ. ΚΑΘΑΡ. ΕΡΓ. ΚΑΘΑΡ. Β. ΕΡΓΑΣΙΩΝ Β. ΒΡΕΦΟΚΟΜ. ΒΡΕΦΟΚΟΜΩΝ ΟΔΗΓ. ΚΑΘΑΡ. ΕΡΓ. ΚΑΘΑΡ. Β. ΥΔΡΑΥΛΙΚΟΥ ΗΛΕΚΤΡΟΤΕΧΝΙΤΩΝ ΜΗΧΑΝΟΤΕΧΝΙΤΩΝ ΟΙΚΟΔΟΜΩΝ ΔΙΟΙΚ. - ΓΡΑΜ. ΔΙΟΙΚ. - ΓΡΑΜ. ΤΟΠΟΓΡ. – ΜΗΧ. ΔΙΟΙΚ. ΟΙΚΟΝ. ΔΙΟΙΚ. ΟΙΚΟΝ. ΔΙΟΙΚ. ΟΙΚΟΝ. ΔΙΟΙΚ. ΟΙΚΟΝ. ΠΛΗΡΟΦΟΡΙΚΗΣ ΟΙΚΟΔΟΜΩΝ ΧΕΙΡ. ΜΗΧ. ΕΡΓ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΕΡΓ. ΚΑΘΑΡ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΑΓΓΕΛΙΟΦ. ΨΕΚΑΣΜ. ΓΕΩΠΟΝΩΝ Β. ΓΕΩΠΟΝΙΚΟΥ ΣΥΝ. ΑΠΟΡΡΙΜ. ΕΡΓ. ΚΑΘΑΡ. ΑΓΡΕΡΓΑΤΩΝ ΧΕΙΡ. ΜΗΧ. ΕΡΓ. ΕΡΓΑΤΩΝ ΥΔΡΑΥΛΙΚΩΝ ΗΛΕΚΤΡΟΛΟΓΩΝ ΕΡΓ. ΚΑΘΑΡ. ΟΙΚΟΔΟΜΩΝ ΗΛΕΚΤΡΟΤΕΧΝΙΤΩΝ ΔΙΟΙΚ. - ΓΡΑΜ. ΔΟΜΙΚΩΝ ΧΕΙΡ. JCB ΥΔΡΑΥΛΙΚΩΝ ΗΛΕΚΤΡΟΤΕΧΝΙΤΩΝ ΚΑΤΑΜΕΤΡΗΤΩΝ ΟΙΚΟΓ. ΒΟΗΘΩΝ ΔΙΟΙΚ. - ΓΡΑΜ. ΔΙΟΙΚ. - ΟΙΚΟΝ. ΔΙΟΙΚ. ΛΟΓ. ΧΕΙΡ. ΜΗΧ. ΕΡΓ. ΕΡΓ. ΚΑΘΑΡ. ΕΡΓ. ΥΔΡ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΥΠΕΥΘ. ΚΑΜΠ. ΥΠΕΥΘ. ΚΑΜΠ. ΔΙΟΙΚ. ΛΟΓ. ΔΙΟΙΚ. - ΓΡΑΜ. ΕΡΓ. ΚΑΘΑΡ. ΕΡΓ. ΚΑΘΑΡ. ΕΡΓ. ΚΑΘΑΡ. ΣΦΑΓ. ΕΡΓ. ΓΕΝ. ΚΑΘ. ΧΕΙΡ. ΣΑΡΩΘΡΟΥ ΗΛΕΚΤΡΟΛΟΓΩΝ ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΕΡΓ. ΚΑΘΑΡ. ΟΔΗΓΩΝ ΟΔΗΓΩΝ ΟΔΗΓ. ΑΠΟΡΡΙΜ. ΕΡΓ. ΚΑΘΑΡ.

29/03/10 06/04/10 06/04/10 06/04/10 31/03/10 31/03/10 06/04/10 31/03/10 01/04/10 01/04/10 01/04/10 01/04/10 08/04/10 26/03/10 26/03/10 30/03/10 08/04/10 26/03/10 06/04/10 06/04/10 30/03/10 30/03/10 26/03/10 26/03/10 26/03/10 26/03/10 07/04/10 07/04/10 26/03/10 07/04/10 07/04/10 07/04/10 07/04/10 07/04/10 26/03/10 31/03/10 31/03/10 31/03/10 30/03/10 31/03/10 31/03/10 31/03/10 31/03/10 30/03/10 30/03/10 31/03/10 30/03/10 30/03/10 08/04/10 08/04/10 08/04/10 08/04/10 08/04/10 08/04/10 08/04/10 06/04/10 06/04/10 06/04/10 06/04/10 01/04/10 31/03/10 31/03/10 31/03/10 08/04/10 08/04/10 08/04/10 08/04/10 08/04/10 31/03/10 31/03/10 31/03/10 31/03/10 08/04/10 08/04/10 31/03/10 31/03/10 07/04/10 07/04/10 07/04/10 07/04/10 31/03/10 31/03/10 31/03/10 31/03/10


10

εργασία

ΕΘΝΙΚΟ ΙΔΡΥΜΑ ΚΩΦΩΝ Την πλήρωση 15 θέσεων διαφόρων ειδικοτήτων με συμβάσεις μίσθωσης έργου διάρκειας 12 μηνών ανακοίνωσε το Εθνικό Ιδρυμα Κωφών, προκειμένου να καλύψει ανάγκες των υπηρεσιών του στην Αθήνα, τη Θεσσαλονίκη και την Πάτρα. Ειδικότερα, θα καλυφθούν: Στη Θεσσαλονίκη α) μία θέση ειδικού παιδαγωγού πανεπιστημιακής εκπαίδευσης (ΠΕ), β) μία θέση δασκάλου αγωγής λόγου ΠΕ ή τεχνολογικής εκπαίδευσης (ΤΕ) και γ) μία θέση ψυχολόγου ΠΕ. Στην Αθήνα α) δύο θέσεις ειδικών παιδαγωγών ΠΕ, β) δύο θέσεις δασκάλων αγωγής λόγου ΠΕ ή ΤΕ, γ) μία θέση κοινωνικού λειτουργού ΠΕ ή ΤΕ, δ) μία θέση γιατρού ΩΡΛ ΠΕ, ε) μία θέση ακουομετρητή ΠΕ ή ΤΕ και ζ) μία θέση ψυχολόγου ΠΕ. Στην Πάτρα α) μία θέση ειδικού παιδαγωγού ΠΕ, β) μία θέση δασκάλου αγωγής λόγου ΠΕ ή ΤΕ, γ) μία θέση κοινωνικού λειτουργού ΠΕ ή ΤΕ και δ) μία θέση ψυχολόγου ΠΕ. Οι ενδιαφερόμενοι μπορούν να αναζητήσουν όλες τις απαραίτητες πληροφορίες στη σχετική ανακοίνωση η οποία δημοσιεύεται στην ιστοσελίδα του υπουργείου Υγείας www.yyka. gov.gr. Για περισσότερες πληροφορίες μπορούν να καλούν στο τηλέφωνο 210 - 6440159. Η προθεσμία υποβολής των αιτήσεων λήγει αύριο.

ΠΕΡΙΦΕΡΕΙΑ Κ. ΜΑΚΕΔΟΝΙΑΣ Την κάλυψη 31 θέσεων με συμβάσεις εργασίας ιδιωτικού δικαίου ορισμένου χρόνου προκήρυξε η Περιφέρεια Κεντρικής Μακεδονίας. Τα άτομα που θα προσληφθούν, θα καλύψουν εποχικές ή παροδικές ανάγκες της Διεύθυνσης Αστικής Κατάστασης, Αλλοδαπών και Μετανάστευσης στη Θεσσαλονίκης και σε άλλους τέσσερις νομούς της Περιφέρειας. Σε όλες τις περιπτώσεις η διάρκεια των συμβάσεων δεν υπερβαίνει τους οκτώ μήνες. Ειδικότερα, θα καλυφθούν: α) πέντε θέσεις διοικητικού - οικονομικού ΠΕ, δύο θέσεις πληροφορικής ΠΕ, δύο θέσεις διοικητικού - λογιστικού ΤΕ, μία θέση πληροφορικής ΤΕ και έξι θέσεις διοικητικών γραμματέων ΔΕ στη Θεσσαλονίκη, β) δύο θέσεις διοικητικού - οικονομικού ΠΕ στις Σέρρες, γ) μία θέση διοικητικού - οικονομικού ΠΕ και μία θέση διοικητικού - γραμματέα ΔΕ στον Πολύγυρο, δ) μία θέση διοικητικού - οικονομικού ΠΕ και μία θέση πληροφορικής ΤΕ στη Βέροια, ε) τρεις θέσεις διοικητικού - οικονομικού ΠΕ, τρεις θέσεις διοικητικών - γραμματέων ΔΕ, δύο θέσεις διοικητικού - λογιστικού ΤΕ και μία θέση πληροφορικής ΤΕ στην Εδεσσα. Κατά την επιλογή των υποψηφίων θα ληφθεί υπόψη το κριτήριο της εντοπιότητας. Βάσει αυτού, προτεραιότητα έχουν οι κάτοικοι των νομών, στους οποίους προκηρύσσονται οι θέσεις, και ακολουθούν οι μόνιμοι κάτοικοι των υπολοίπων νομών της ελληνικής επικράτειας. Οι ενδιαφερόμενοι θα πρέπει να αποστείλουν τις αιτήσεις τους μαζί με τα δικαιολογητικά είτε αυτοπροσώπως είτε ταχυδρομικά με συστημένη επιστολή στα γραφεία της έδρας της Περιφέρειας επί της οδού Τάκη Οικονομίδη. Για περισσότερες πληροφορίες σχετικά με τα απαιτούμενα προσόντα και δικαιολογητικά, οι υποψήφιοι θα πρέπει να καλούν στα τηλέφωνα 2313 - 309163 και 2313 - 309203 ή να επισκέπτονται τον δικτυακό τόπο της Περιφέρειας, www.rcm.gr, όπου βρίσκεται δημοσιευμένη η σχετική προκήρυξη. Η υποβολή των αιτήσεων λήγει αύριο.

ΔΗΜΟΣ ΘΕΡΜΑΪΚΟΥ Την πλήρωση 30 θέσεων με συμβάσεις εργασίας ιδιωτικού δικαίου ορισμένου χρόνου, διάρκειας οκτώ μηνών, ανακοίνωσε ο δήμος Θερμαϊκού, προκειμένου να καλύψει εποχικές ή παροδικές ανάγκες των υπηρεσιών του. Ειδικότερα, η κατανομή των θέσεων ανά ειδικότητα και αριθμό ατόμων έχει ως εξής: α) πέντε θέσεις οδηγών απορριμματοφόρων ΔΕ, β) 24 θέσεις εργατών καθαριότητας ΥΕ και γ) μία θέση χειριστή μηχανημάτων έργου (γκρέϊντερ) ΔΕ. Οι υποψήφιοι θα πρέπει να είναι ηλικίας από 18 έως 65 ετών και να μη έχουν κώλυμα

ΑΓΓΕΛΙΟΦΟΡΟΣ Πέμπτη 15 Απριλίου 2010

169 θέσεις και ευρύτερο κατά το άρθρο 22 του Υπαλληλικού Κώδικα. Ως κύρια προσόντα για την ειδικότητα οδηγών απορριμματοφόρων ΔΕ ορίζονται τα εξής: α) δίπλωμα ΙΕΚ ειδικοτήτων τεχνικού αυτοκινήτων οχημάτων ή εκπαιδευτή υποψηφίων οδηγών αυτοκινήτων ή πτυχίο Α ή Β κύκλου σπουδών Τεχνικού Επαγγελματικού Εκπαιδευτηρίου (ΤΕΕ) ειδικότητας μηχανών και συστημάτων αυτοκινήτου ή απολυτήριος τίτλος ενιαίου πολυκλαδικού λυκείου του τμήματος μηχανικών αυτοκινήτων ή τεχνικής επαγγελματικής σχολής δευτεροβάθμιας εκπαίδευσης ειδικότητας μηχανών αυτοκινήτου ή Σχολής Μαθητείας του ΟΑΕΔ του Ν. 1346/ 83 ειδικότητας μηχανοτεχνίτη αυτοκινήτου ή συναφούς ειδικότητας, δηλαδή τεχνικού ηλεκτρολόγου αυτοκινήτων οχημάτων ή τεχνικού μηχανοτρονικής ΙΕΚ ή ηλεκτρολογικών συστημάτων αυτοκινήτου ή ηλεκτρομηχανικών συστημάτων και αυτοματισμών αυτοκινήτου ΤΕΕ ή ηλεκτρικού συστήματος αυτοκινήτου ΤΕΣ δευτεροβάθμιας εκπαίδευσης ή ηλεκτροτεχνίτη αυτοκινήτων Σχολής Μαθητείας του ΟΑΕΔ του Ν. 146/ 83 (ΦΕΚ 46Α) ή άλλος ισότιμος τίτλος σχολικής μονάδας της ημεδαπής ή αλλοδαπής αντίστοιχης ειδικότητας, β) επαγγελματική άδεια οδήγησης Γ κατηγορίας σε ισχύ και γ) Πιστοποιητικό Επαγγελματικής Ικανότητας (ΠΕΙ) αρχικής επιμόρφωσης μεταφοράς εμπορευμάτων (ΠΔ 74/ 2008 σύμφωνα με τα οριζόμενα στις σχετικές επισημάνσεις). Για την ειδικότητα χειριστή μηχανημάτων έργου ΔΕ τα κύρια προσόντα είναι τα εξής: α) ομώνυμος ή αντίστοιχος τίτλος ΙΕΚ ή ΤΕΕ Α ή Β κύκλου σπουδών ή ενιαίου πολυκλαδικού λυκείου ή τεχνικού επαγγελματικού λυκείου ή τεχνικών επαγγελματικών σχολών δευτεροβάθμιας εκπαίδευσης ή Σχολών Μαθητείας του ΟΑΕΔ του Ν. 1346/ 1983 (ΦΕΚ 46Α) ή άλλος ισότιμος τίτλος σχολικών μονάδων της ημεδαπής ή αλλοδαπής αντίστοιχης ειδικότητας, ο οποίος οδηγεί στην απαιτούμενη άδεια άσκησης επαγγέλματος και β) άδεια μηχανοδηγού - χειριστή μηχανημάτων εκτέλεσης τεχνικών έργων ομάδας Ζ τάξης Γ. Στην προκήρυξη εκτός από τα κύρια προσόντα που απαιτούνται για τις παραπάνω ειδικότητες αναφέρονται και τα επικουρικά, που θα χρησιμοποιηθούν εφόσον δεν βρεθούν υποψήφιοι που κατέχουν τα πρώτα, ενώ για την ειδικότητα εργατών καθαριότητας ΥΕ δεν απαιτούνται ειδικά τυπικά προσόντα. Για περισσότερες πληροφορίες, οι ενδιαφερόμενοι μπορούν να επικοινωνούν με το δήμο στο τηλέφωνο 23923 - 30039 ή να επισκέπτονται την ιστοσελίδα www.thermaikos. gr, όπου βρίσκεται δημοσιευμένη η σχετική προκήρυξη.

Η προθεσμία υποβολής των αιτήσεων λήγει στις 19 Απριλίου.

ΥΠΟΥΡΓΕΙΟ ΔΙΚΑΙΟΣΥΝΗΣ Την πλήρωση 24 θέσεων δικαστικών επιμελητών με διαγωνισμό προκήρυξε το υπουργείο Δικαιοσύνης Διαφάνειας και Ανθρωπίνων Δικαιωμάτων. Ο διαγωνισμός θα διεξαχθεί την Παρασκευή 28 Μαΐου του 2010 στο κατάστημα του Εφετείου της έδρας κάθε Συλλόγου Δικαστικών Επιμελητών. Ειδικότερα, η κατανομή των θέσεων έχει ως εξής: - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείου Θεσσαλονίκης: πέντε θέσεις στο Πρωτοδικείο Θεσσαλονίκης. - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείου Θράκης: μία θέση στο Πρωτοδικείο Αλεξανδρούπολης. - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείων Αθηνών - Πειραιώς - Αιγαίου - Δωδεκανήσου και Λαμίας: πέντε θέσεις στο Πρωτοδικείο Αθηνών, δύο θέσεις στο


εργασία

ΑΓΓΕΛΙΟΦΟΡΟΣ Πέμπτη 15 Aπριλίου 2010

στο Δημόσιο δημόσιο τομέα Ποινική Δικονομία και γ) στον Αστικό Κώδικα και το Εμπορικό Δίκαιο. Οι ενδιαφερόμενοι θα πρέπει να καταθέσουν αιτήσεις συμμετοχής στη Γραμματεία του Πρωτοδικείου της πρώτης επιλογής τους το αργότερο μέχρι 20 ημέρες πριν από το διαγωνισμό. Στην αίτησή τους μπορούν να δηλώσουν και δεύτερη προτίμηση για την περιφέρεια μόνο του Πρωτοδικείου που υπάγεται στην αρμοδιότητα του ίδιου συλλόγου. Με την αίτησή τους οι υποψήφιοι θα πρέπει να προσκομίσουν και τα ακόλουθα δικαιολογητικά: α) πιστοποιητικό του οικείου συλλόγου δικαστικών επιμελητών για τη θεωρητική και πρακτική άσκηση, β) τίτλο σπουδών (απολυτήριο λυκείου ή εξατάξιου γυμνασίου), γ) υπεύθυνη δήλωση για την ύπαρξη των προσόντων και την έλλειψη των κωλυμάτων συμμετοχής στο διαγωνισμό και δ) απόδειξη καταβολής του ποσού των 50 ευρώ για εξέταστρα. Οι επιτυχόντες θα πρέπει να παρακολουθήσουν κύκλο επιμορφωτικών σεμιναρίων. Ολες οι απαραίτητες πληροφορίες αναφέρονται στη σχετική προκήρυξη, η οποία δημοσιεύεται στην ηλεκτρονική διεύθυνση: www.ministryofjustice.gr (προσλήψεις).

ΔΕΗ ΑΕ

Πρωτοδικείο Μυτιλήνης, μία θέση στο Πρωτοδικείο Πειραιώς, μία θέση στο Πρωτοδικείο Σάμου και μία θέση στο Πρωτοδικείο Χίου. - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείου Πατρών: δύο θέσεις στο Πρωτοδικείο Πατρών, μία θέση στο Πρωτοδικείο Αγρινίου και μία θέση στο Πρωτοδικείο Κεφαλληνίας. - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείων Ιωαννίνων και Κέρκυρας: μία θέση στο Πρωτοδικείο Θεσπρωτίας. - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείων Ναυπλίου και Καλαμάτας: δύο θέσεις στο Πρωτοδικείο Κυπαρισσίας. - Περιφέρεια του Συλλόγου Δικαστικών Επιμελητών Εφετείου Κρήτης: μία θέση στο Πρωτοδικείο Ηρακλείου. Ο διαγωνισμός θα είναι ενιαίος για όλη τη χώρα και δικαίωμα συμμετοχής θα έχουν όσοι γεννήθηκαν από το 1975 έως και το 1988. Οι υποψήφιοι θα εξεταστούν γραπτώς: α) στον Κώδικα Δικαστικών Επιμελητών και την Πολιτική Δικονομία και β) στον Ποινικό Κώδικα και

Την κάλυψη 27 θέσεων με συμβάσεις εργασίας ιδιωτικού δικαίου ορισμένου χρόνου διάρκειας οκτώ μηνών ανακοίνωσε η ΔΕΗ ΑΕ. Το εν λόγω προσωπικό θα καλύψει εποχικές ή παροδικές ανάγκες των μονάδων της Διεύθυνσης Πωλήσεων της εταιρίας. Ειδικότερα, η κατανομή των θέσεων έχει ως εξής: α) δύο θέσεις λογιστικού - διοικητικού (ταμιών) ΔΕ στη Λαμία, β) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ και δύο θέσεις διοικητικών γραμματέων (υπαλλήλων γραφείου) ΔΕ στην Πάτρα, γ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στη Λευκάδα, δ)μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στη Μεγαλόπολη, ε) μία θέση διοικητικού γραμματέα (υπαλλήλου γραφείου) ΔΕ στην Κέρκυρα, στ) μία θέση διοικητικού γραμματέα (υπαλλήλου γραφείου) ΔΕ στη Ναύπακτο, ζ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ και τέσσερις θέσεις διοικητικών γραμματέων (υπαλλήλων γραφείου) ΔΕ στη Θεσσαλονίκη, η) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στο Λαγκαδά,

θ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στην Εδεσσα, ι) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στην Κατερίνη, ια) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στις Σέρρες, ιβ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στον Πολύγυρο, ιγ) μία θέση διοικητικού γραμματέα (υπαλλήλου γραφείου) ΔΕ στα Νέα Μουδανιά, ιδ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στην Κοζάνη, ιε) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στην Πτολεμαΐδα, ιστ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στην Κομοτηνή, ιζ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στο Ρέθυμνο, ιη) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στον Αγιο Νικόλαο, ιθ) μία θέση λογιστικού - διοικητικού (ταμία) ΔΕ στην Κω. Για περισσότερες πληροφορίες οι ενδιαφερόμενοι για τις θέσεις της Βόρειας Ελλάδας μπορούν να καλούν στα τηλέφωνα 2310 - 482277 και 2310- 454054. Για τις υπόλοιπες θέσεις μπορούν να καλούν στο 210 - 3642119 ή να επικοινωνούν με τα κατά τόπους καταστήματα. Η προθεσμία υποβολής των αιτήσεων λήγει στις 22 Απριλίου.

ΔΗΜΟΣ ΜΑΚΕΔΝΩΝ Την πλήρωση οκτώ θέσεων μερικής απασχόλησης ανακοίνωσε ο δήμος Μακεδνών, που βρίσκεται στην Καστοριά. Ειδικότερα, η κατανομή των θέσεων έχει ως εξής: α) μία θέση οικονομολόγου ΠΕ, β) μία θέση γεωπόνου ΤΕ, γ) δύο θέσεις διοικητικού ΔΕ και δ) τέσσερις θέσεις γενικών καθηκόντων ΥΕ. Για περισσότερες πληροφορίες σχετικά με τα απαιτούμενα προσόντα και δικαιολογητικά, οι ενδιαφερόμενοι θα πρέπει να καλούν στο 24670 - 74570. Οι αιτήσεις των υποψηφίων θα γίνονται δεκτές έως και σήμερα.

ΔΗΜΟΣ ΧΑΣΙΩΝ Την πλήρωση δύο θέσεων μερικής απασχόλησης με συμβάσεις εργασίας ιδιωτικού δικαίου ορισμένου χρόνου μερικής απασχόλησης επαναπροκήρυξε ο δήμος Χασίων του νομού Γρεβενών. Οι προσλήψεις αφορούν εργάτες γενικών καθηκόντων και καθαριότητας ΥΕ. Για περισσότερες λεπτομέρειες σχετικά με την προκήρυξη, οι ενδιαφερόμενοι θα πρέπει να επικοινωνούν με το δήμο στο τηλέφωνο 24623 - 51804. Η προθεσμία υποβολής των αιτήσεων λήγει αύριο.

11

ΙΗ΄ ΕΠΚΑ Την πλήρωση 32 θέσεων ωρομίσθιου προσωπικού ανακοίνωσε η ΙΗ’ Εφορεία Προϊστορικών και Κλασικών Αρχαιοτήτων που εδρεύει στην Καβάλα. Ειδικότερα, οι εν λόγω θέσεις πρόκειται να καλυφθούν ως εξής: α) τέσσερις θέσεις φυλάκων εργοταξίου ημέρας δευτεροβάθμιας εκπαίδευσης (ΔΕ) και β) δύο θέσεις φυλάκων εργοταξίου νύχτας ΔΕ για το Αρχαιολογικό Μουσείο και χώρους της Καβάλας, γ) τρεις θέσεις φυλάκων εργοταξίου ημέρας ΔΕ και δ) μία φύλακα εργοταξίου νύχτας ΔΕ για το Αρχαιολογικό Μουσείο και χώρους της Θάσου, ε) τρεις θέσεις φυλάκων εργοταξίου ημέρας ΔΕ και στ) δύο φυλάκων εργοταξίου νύχτας ΔΕ για το Αρχαιολογικό Μουσείο και χώρους των Φιλίππων, ζ) μία θέση φύλακα εργοταξίου ημέρας ΔΕ και η) μία φύλακα εργοταξίου νύχτας για το Αρχαιολογικό Μουσείο Δράμας για διάστημα έως 1.320 ώρες, θ) έξι θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, ι) μία φύλακα εργοταξίου νύχτας ΔΕ και ια) μία καθαριστή ΥΕ για το Αρχαιολογικό Μουσείου και χώρους των Φιλίππων, ιβ) έξι θέσεις φυλάκων εργοταξίου ημέρας ΔΕ και ιγ) μία καθαριστή ΥΕ για το Αρχαιολογικό Μουσείο και χώρους της Θάσου για διάστημα όχι μεγαλύτερο των 990 ωρών. Η προθεσμία υποβολής των αιτήσεων από τους ενδιαφερόμενους λήγει σήμερα.


εργασία

Πέμπτη 15 Απριλίου 2010

Οι κενές θέσεις στη Βόρεια Ελλάδα ΚΠΑ2 ΚΑΒΑΛΑΣ 201201100604 ΕΚΦΩΝ. ΡΑΔΙΟΦ. 201201100594 ΕΙΔΙΚ. ΠΩΛΗΤΕΣ 201201100591 ΕΙΔΙΚ. ΠΩΛΗΤΕΣ 201201100603 ΜΑΓΕΙΡΕΣ 201201100589 ΟΔΗΓΟΙ 201201100576 ΚΟΜΜΩΤΕΣ 201201100568 ΥΠΑΛ. ΥΠΟΔ. 201201100590 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 201201100601 ΠΩΛΗΤΕΣ

1 2 1 1 1 1 1 1 1

ΚΠΑ2 ΘΑΣΟΥ 201204100059 201204100064 201204100057 201204100055 201204100054 201204100001 201204100058 201204100065 201204100060 201204100004 201204100056

ΣΕΡΒΙΤΟΡΟΙ ΚΑΘΑΡΙΣΤΕΣ ΟΙΚΙΑΚ. ΒΟΗΘ. ΜΑΓΕΙΡΕΣ ΜΑΓΕΙΡΕΣ ΜΑΓΕΙΡΕΣ ΥΠΑΛ. ΥΠΟΔ. ΟΔΗΓΟΙ ΣΕΡΒΙΤΟΡΟΙ ΣΥΝΑΡ. ΗΛ. ΕΞΟΠ. ΣΕΡΒΙΤΟΡΟΙ

3 4 1 1 1 1 1 1 3 1 1

ΚΠΑ ΣΕΡΡΩΝ 202201100540 202201100543 202201100549 202201100546 202201100541 202201100544 202201100545 202201100553

ΣΧΕΔ. ΑΡΧΙΤ. ΣΧΕΔ. ΤΕΧΝ. ΗΛΕΚΤΡ. ΚΟΜΜΩΤΕΣ ΠΩΛΗΤΕΣ ΕΡΓ. ΜΕΤ. ΒΙΟΜ. ΤΕΧΝ. ΔΟΜ. ΕΡΓ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

1 1 2 1 1 1 1 1

ΚΠΑ2 ΔΡΑΜΑΣ 203201100520 ΣΕΡΒΙΤΟΡΟΙ 203201100535 ΚΟΜΜΩΤΕΣ 203201100524 ΟΔΗΓΟΙ 203201100509 ΕΡΓΑΤΕΣ

1 1 1 1

203201100519 203201100523 203201100529 203201100521 203201100533

ΜΑΓΕΙΡΕΣ ΑΠΟΘ.- ΖΥΓ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΚΑΘΑΡΙΣΤΕΣ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

1 1 1 1 1

ΚΠΑ2 ΞΑΝΘΗΣ 204201100457 ΤΕΧΝ. Β. ΙΑΤΡΙΚΗΣ 204201100458 ΚΑΘΑΡΙΣΤΕΣ 204201100459 ΤΕΧΝ. ΥΓΙΕΙΝ. 204201100451 ΚΟΜΜΩΤΕΣ 204201100455 ΚΑΘΑΡΙΣΤΕΣ 204201100461 ΕΙΔΙΚ. ΤΕΧΝ.

1 1 1 1 2 1

ΚΠΑ2 ΚΟΜΟΤΗΝΗΣ 205201100436 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 205201100445 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 205201100442 ΤΕΧΝ. ΔΟΜ. ΕΡΓ. 205201100448 ΠΩΛΗΤΕΣ 205201100434 ΕΠΑΓΓ. ΑΘΛΗΤ. 205201100451 ΠΩΛΗΤΕΣ 205201100453 ΠΩΛΗΤΕΣ 205201100452 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 205201100441 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 205201100444 ΜΑΓΕΙΡΕΣ 205201100447 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 205201100449 ΚΑΘΑΡΙΣΤΕΣ

1 1 1 1 1 1 1 1 1 1 1 1

ΚΠΑ2 ΑΛΕΞΑΝΔΡΟΥΠΟΛΗΣ 206201100410 Β. ΛΟΓΙΣΤΩΝ 206201100407 ΜΗΧ. ΑΥΤΟΚ. 206201100411 ΠΩΛΗΤΕΣ 206201100415 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΚΠΑ2 ΟΡΕΣΤΙΑΔΑΣ 206202100141 ΠΩΛΗΤΕΣ 206202100139 ΜΑΓΕΙΡΕΣ 206202100030 Β. ΛΟΓΙΣΤΩΝ

1 1 1 1

1 1 1

ΚΠΑ2 ΔΙΔΥΜΟΤΕΙΧΟΥ 206203100106 ΣΕΡΒΙΤΟΡΟΙ 206203100107 ΣΕΡΒΙΤΟΡΟΙ

1 2

ΚΠΑ2 ΛΑΓΚΑΔΑ 301208100083 ΠΩΛΗΤΕΣ

1

ΚΠΑ2 ΠΟΛΥΓΥΡΟΥ 302201100123 ΚΑΘΑΡΙΣΤΕΣ 302201100122 ΥΠΑΛ. ΠΑΡ. ΥΠΗΡ. 302201100121 ΟΙΚ. ΒΟΗΘΟΙ 302201100120 ΣΕΡΒΙΤΟΡΟΙ 302201100119 ΜΑΓΕΙΡΕΣ 302201100111 ΟΙΚ. ΒΟΗΘΟΙ 302201100109 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

2 1 2 2 2 1 1

ΚΠΑ2 Ν. ΜΟΥΔΑΝΙΩΝ 302202100289 ΕΡΓΑΤΕΣ 302202100290 ΜΟΝΤΑΔΟΡΟΙ 302202100282 ΣΦΑΓΕΙΣ 302202100281 ΠΩΛΗΤΕΣ 302202100286 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 302202100283 ΥΠΑΛ. ΤΑΞΙΔ. ΓΡΑΦ. 302202100285 ΣΕΡΒΙΤΟΡΟΙ 302202100284 ΕΡΓΑΤΕΣ

1 1 1 1 1 1 2 2

ΚΠΑ2 ΑΡΝΑΙΑΣ 302203100023 ΣΕΡΒΙΤΟΡΟΙ

1

ΚΠΑ2 ΚΙΛΚΙΣ 303201100202 303201100216 303201100207 303201100211 303201100210 303201100201 303201100206

ΣΕΡΒΙΤΟΡΟΙ ΠΑΤΡΟΝΙΣΤ ΣΥΝ. ΗΛΕΚ. ΕΞΟΠ. ΔΙΔΑΚ. ΠΡΟΣ. ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

ΚΠΑ2 ΓΟΥΜΕΝΙΣΣΑΣ 303202100008 ΕΙΔΙΚ. ΤΕΧΝ.

ΚΠΑ2 ΕΔΕΣΣΑΣ 304202100218 Β. ΛΟΓΙΣΤΗΡ. 304202100219 ΜΗΧ. ΓΕΩΡ. ΜΗΧ.

1 1

ΤΥ, ΚΠΑ2 ΚΑΤΕΡΙΝΗΣ 305001002871 ΧΗΜΙΚΟΙ 305001001696 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 305201100500 ΤΕΧΝ. ΟΙΚΟΔΟΜΟΙ 305201100471 ΜΑΓΕΙΡΕΣ 305201100505 ΕΙΔΙΚ. ΤΕΧΝ. 305201100509 ΕΡΓΑΤΕΣ 305201100506 ΦΥΣΙΚΟΘΕΡΑΠ. 305201100498 ΠΩΛΗΤΕΣ 305201100499 ΜΑΓΕΙΡΕΣ 305201100508 Β. ΛΟΓΙΣΤΩΝ 305201100503 ΠΩΛΗΤΕΣ

1 1 3 1 1 1 1 4 1 1 1

ΤΥ ΚΟΖΑΝΗΣ 306001002995 ΜΑΓΕΙΡEΣ

1

1 1 1 1 1 1 1

ΚΠΑ2 ΚΟΖΑΝΗΣ 306201100648 ΜΑΓΕΙΡΕΣ 306201100646 ΣΕΡΒΙΤΟΡΟΙ 306201100654 ΠΩΛΗΤΕΣ 306201100656 ΑΡΤΟΖΑΧΑΡΟΠΛ. 306201100658 ΑΡΤΟΖΑΧΑΡΟΠΛ. 306201100645 ΚΟΙΝΩΝΙΟΛΟΓΟΙ 306201100660 ΜΑΓΕΙΡΕΣ 306201100637 ΣΕΡΒΙΤΟΡΟΙ 306201100659 ΠΩΛΗΤΕΣ 306201100588 ΓΟΥΝΟΠΟΙΟΙ 306201100629 ΕΡΓΑΤΕΣ 306201100636 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 306201100639 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 306201100650 ΠΩΛΗΤΕΣ 306201100631 ΠΩΛΗΤΕΣ 306201100632 ΠΩΛΗΤΕΣ

1 1 1 1 1 1 1 1 1 1 1 1 1 1 3 1

1

ΚΠΑ2 ΠΤΟΛΕΜΑΪΔΑΣ 306202100401 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

1

306202100338 306202100423 306202100287 306202100426 306202100427 306202100422

Β. ΛΟΓΙΣΤΩΝ ΧΕΙΡ. ΓΕΡΑΝΩΝ ΕΡΓΑΤΕΣ ΕΡΓΑΤΕΣ ΥΠΑΛ. ΓΡΑΦΕΙΟΥ ΧΕΙΡ. ΜΗΧ. ΕΠΕΞ. ΚΡΕΑΤ.

ΤΥ, ΚΠΑ2 ΒΕΡΟΙΑΣ 307001000914 ΕΡΓ. ΟΙΚΟΔΟΜΩΝ 307201100230 ΜΗΧ. ΑΥΤΟΚΙΝΗΤ. 307201100234 ΔΙΕΥΘ. ΠΩΛΗΣ. 307201100226 ΕΡΓΑΤΕΣ 307201100236 ΠΩΛΗΤΕΣ ΚΠΑ2 ΝΑΟΥΣΑΣ 307203100110 ΣΕΡΒΙΤΟΡΟΙ 307203100124 ΠΩΛΗΤΕΣ

1 1 1 1 1 1

1 2 1 1 1

1 40

ΚΠΑ2 ΚΑΣΤΟΡΙΑΣ 308201100397 ΥΠΑΛ. ΠΑΡ. ΥΠΗΡ. 308201100396 ΣΕΡΒΙΤΟΡΟΙ 308201100399 ΠΩΛΗΤΕΣ

1 1 1

ΚΠΑ2 ΦΛΩΡΙΝΑΣ 309201100192 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ 309201100191 ΕΚΠΑΙΔΕΥΤΙΚΟΙ 309201100187 ΠΩΛΗΤΕΣ 309201100185 ΜΑΓΕΙΡΕΣ 309201100188 ΟΔΗΓΟΙ 309201100184 ΣΕΡΒΙΤΟΡΟΙ

1 1 1 1 1 1

ΚΠΑ2 ΑΜΥΝΤΑΙΟΥ 309202100101 ΣΕΡΒΙΤΟΡΟΙ 309202100099 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

1 1

ΚΠΑ2 ΓΡΕΒΕΝΩΝ 407201100134 ΥΠΑΛ. ΓΡΑΦΕΙΟΥ

1

117 θέσεις σε έξι Εφορείες Βυζαντινών Αρχαιοτήτων Την πρόσληψη 117 ωρομίσθιων υπαλλήλων προκήρυξαν έξι φορείς του υπουργείου Πολιτισμού. Οσοι επιλεγούν θα απασχοληθούν σε Εφορείες Βυζαντινών Αρχαιοτήτων, προκειμένου να καλύψουν έκτακτες υπηρεσιακές ανάγκες που έχουν προκύψει. Η κατανομή των θέσεων ανά ειδικότητα, αριθμό και φορέα απασχόλησης έχει ως εξής: - Στην 2η ΕΒΑ, που εδρεύει στην Αθήνα, προκηρύχθηκαν 10 θέσεις εκ των οποίων: α) οκτώ θέσεις φυλάκων εργοταξίου ημέρας ΔΕ για τη Μήλο, την Κίμωλο, τη Σίφνο, τη Θήρα και τη Σίκινο, β) μία θέση φύλακα εργοταξίου νύχτας ΔΕ και μία θέση καθαριστή ΥΕ για την Αθήνα. Οσοι προσληφθούν θα απασχοληθούν για χρονικό διάστημα όχι μεγαλύτερο από 1.320 ώρες. - Στην 7η ΕΒΑ, που εδρεύει στη Λάρισα, προκηρύχθηκαν 10 θέσεις εκ των οποίων: α) έξι θέσεις φυλάκων εργοταξίου ημέρας ΔΕ για το Διαχρονικό Μουσείο Λάρισας, το Κάστρο Δολίχης του δήμου Λιβαδίου, το Κάστρο Βελίκας του δήμου Μελιβοίας και τους αρχαιολογικούς χώρους στη Νέα Αγχίαλο και τα Παλαιά Βόλου, β) τρεις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ για το Διαχρονικό Μουσείο Λάρισας και τον αρχαιολογικό χώρο στη Νέα Αγχίαλο και γ) μία θέση καθαριστή ΥΕ για τα γραφεία της Εφορείας. - Στην 6η ΕΒΑ, που εδρεύει στην Πάτρα,

προκηρύχθηκαν 13 θέσεις για απασχόληση έως 1.320 ώρες εκ των οποίων: α) τρεις θέσεις φυλάκων εργοταξίου ημέρας ΔΕ για το Κάστρο της Πάτρας και το Φρούριο του Ρίου και πέντε της ίδιας ειδικότητας για το Κάστρο Χλεμούτσι, β) δύο θέσεις φυλάκων εργοταξίου νύχτας ΔΕ για το Κάστρο της Πάτρας και το Φρούριο του Ρίου και μία θέση της ίδιας ειδικότητας για το Κάστρο Χλεμούτσι και γ) από μία θέση καθαριστή ΥΕ για τους νομούς Ηλείας και Αχαΐας. - Στην 4η ΕΒΑ, που εδρεύει στη Ρόδο, προκηρύχθηκαν 54 θέσεις εκ των οποίων: α) 41

θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, δύο θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για απασχόληση έως 990 ώρες στο Παλάτι του Μεγάλου Μαγίστρου και το Κάστρο Νερατζιάς στην Κω και β) εννέα θέσεις φυλάκων εργοταξίου ημέρας ΔΕ για το Αρχοντικό Παπακωνσταντή του οικισμού Λίνδου, για το Αρχοντικό Νικολαΐδη του οικισμού Πάτμου, για το Μουσείο και τον Οικισμό της Σύμης, για τον Οικισμό Χάλκης, για τον αρχαιολογικό χώρο Κάστρου του Οικισμού Αστυπάλαιας, για το Αρχοντικό Βουβάλη στην Κάλυμνο, για το Μουσείο και τον Οικισμό

Καστελόριζου και για τον Οικισμό Μεσαιωνικής Πόλης στη Ρόδο. - Στην 25η ΕΒΑ, που εδρεύει στην Κόρινθο, προκηρύχθηκαν 28 θέσεις εκ των οποίων: α) 10 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ, τρεις θέσεις φυλάκων εργοταξίου νύχτας ΔΕ και δύο θέσεις καθαριστών ΥΕ για απασχόληση έως 1.320 ώρες στα μνημεία και μουσεία των νομών Αργολίδος, Κορινθίας και Αρκαδίας και στις επαρχίες Ερμιονίδος, Αργους, Ναυπλίας, Μαντινείας, Γορτυνίας και Μεγαλοπόλεως, β) 11 θέσεις φυλάκων εργοταξίου ημέρας ΔΕ και δύο θέσεις καθαριστών ΥΕ για απασχόληση έως 990 ώρες στο Φρούριο Παλαμηδίου στο Ναύπλιο και το Κάστρο Ακροκορίνθου. - Στην 5η ΕΒΑ, που εδρεύει στη Σπάρτη, προκηρύχθηκε μία θέση αρχιτέκτονα - μηχανικού (με ειδίκευση στην αποκατάσταση και ανάδειξη μνημείων) ΠΕ και μία θέση συντηρητή ΠΕ ή ΤΕ ή ΔΕ για το Κάστρο Μονεμβασίας και για χρονικό διάστημα όχι μεγαλύτερο από 990 ώρες. Περισσότερες πληροφορίες σχετικά με τα απαραίτητα προσόντα και δικαιολογητικά παρέχονται από την ιστοσελίδα του υπουργείου, www.yppo.gr, όπου δημοσιεύονται όλες οι σχετικές προκηρύξεις. Για όλες τις παραπάνω θέσεις, οι ενδιαφερόμενοι μπορούν να υποβάλουν τις αιτήσεις τους έως και τις 19 Απριλίου, οπότε και λήγει η προθεσμία.

O πίνακας ανανεώνεται με βάση τα στοιχεία του ΟΑΕΔ. Οι ενδιαφερόμενοι θα πρέπει να επικοινωνούν με τα Κέντρα Προώθησης Απασχόλησης (ΚΠΑ) και τις Τοπικές Υπηρεσίες (ΤΥ) του Οργανισμού

12

ΑΓΓΕΛΙΟΦΟΡΟΣ

ΑΓΓΕΛΙΟΦΟΡΟΣ 15/04/2010  

ΑΓΓΕΛΙΟΦΟΡΟΣ ΤΕΥΧΟΣ 4070

Advertisement