Issuu on Google+

Sveučilište Josipa Jurja Strossmayera u Osijeku Sveučilišni poslijediplomski interdisciplinarni doktorski studij Molekularne bioznanosti

Sonja Petrović GENETSKA RAZLIČITOST GERMPLAZME OZIME KRUŠNE PŠENICE (Triticum aestivum L. ssp. vulgare)

Doktorska disertacija predložena Sveučilišnom Vijeću za poslijediplomske interdisciplinarne doktorske studije radi stjecanja akademskog stupnja doktora molekularnih bioznanosti-biologija biljaka

Osijek, 2011.


SADRŽAJ 1. Uvod 2. Hipoteza i ciljevi i istraživanja 2.1. Hipoteza 2.2. Ciljevi istraživanja 3. Pregled literature 3.1. Istraživanja genetske različitosti na temelju agronomsko-morfoloških svojstava 3.2. Istraživanja genetske različitosti na temelju sastava skladišnih bjelančevina zrna 3.3. Istraživanja varijabilnosti genotipova pšenice na temelju količine i sastava škroba 3.4. Istraživanja genetske različitosti na temelju uporabe molekularnih markera 3.5. Istraživanja genetske različitosti pomoću kombinacije agronomsko-morfoloških svojstava i molekularnih markera 3.6. Istraživanja postojanja genetske erozije 4. Materijal i metode 4.1. Biljni materijal 4.2. Metode istraživanja 4.2.1. Poljski pokus, uzgojne mjere i pedoklimatski uvjeti 4.2.2. Morfološka svojstva 4.2.3. Agronomska svojstva 4.3. Laboratorijski pokus 4.3.1. Mjerenja količine i sastava bjelančevina i škroba u zrnu pšenice 4.3.1.1. Određivanje sastava bjelančevina 4.3.1.2. Određivanje sastava škroba 4.3.2. Istraživanja genetske različitosti na razini DNA 4.3.2.1. Uzgoj klijanaca i izolacija genomska DNA 4.3.2.2. Metoda mikrosatelitnih markera 4.3.2.3. AFLP metoda 4.3.2.4. Elektroforeza 4.4. Statistička obrada podataka 4.4.1. Statistička obrada kvantitativnih agronomskih podataka 4.4.2. Statistička obrada morfoloških podataka 4.4.3. Statistička obrada molekularnih podataka 4.4.4. Utvrđivanje ispravnosti i podudarnosti matrica 5. Rezultati istraživanja 5.1. Procjena različitosti ispitivanih genotipova na temelju agronomskih podataka 5.1.1. Varijabilnost visine biljke 5.1.2. Varijabilnost broja biljaka po jedinici površine 5.1.3. Varijabilnost duljine klasa 5.1.4. Varijabilnost broja klasića po klasu 5.1.5. Varijabilnost broja zrna po klasu 5.1.6. Varijabilnost mase 1000 zrna 5.1.7. Varijabilnost hektolitarske mase 5.1.8. Varijabilnost uroda zrna 5.1.9. Procjena različitosti ispitivanih genotipova na temelju količine bjelančevina i škroba u zrnu pšenice 5.2. Procjena različitosti ispitivanih genotipova na temelju morfoloških podataka

1 3 3 3 4 4 6 8 9 12 13 16 16 17 17 20 22 22 22 22 24 25 25 27 29 33 34 34 34 35 37 38 38 38 41 44 47 50 53 56 59 63 65


5.3. Procjena različitosti ispitivanih genotipova na temelju molekularnih podataka 5.3.1. Različitost visokomolekularnih podjedinica glutenina pšenice 5.3.2. Različitost sadržaja škroba u zrnu pšenice 5.3.3. Procjena genetske različitosti na razini DNA 5.3.3.1. Procjena i izračun genetske udaljenosti ispitivanih genotipova pomoću mikrosatelita 5.3.3.2. Procjena i izračun genetske udaljenosti ispitivanih genotipova pomoću AFLP markera 5.4. Analiza molekularne varijance (AMOVA) obzirom na hrvatske i strane sorte, oplemenjivačke programe te razdoblja priznavanja sorti 5.5. Usporedba rezultata provedenih analiza 6. Rasprava 6.1. Različitost ispitivanih genotipova pšenice na temelju agronomskih svojstava 6.2. Različitost na temelju morfoloških podataka 6.3. Genetska različitost na temelju molekularnih podataka 6.3.1. Genetska različitost visokomolekularnih podjedinica glutenina 6.3.2. Genetska različitost na temelju količine amiloze i amilopektina u zrnu 6.3.3. Genetska različitost na temelju mikrosatelita i AFLP markera 6.3.4. Analiza AMOVE 6.3.5. Korelacija između matrica morfoloških i molekularnih podataka 7. Zaključak 8. Literatura 9. Sažetak 10. Abstract 11. Prilozi 11.1. Prilog 1: Tablice LSD vrijednosti za ispitivana agronomska svojstva u vegetacijskoj 2007./2008. i 2008./2009. 11.2. Prilog 2: Matrica genetske sličnosti (RTij) na temelju morfoloških podataka 11.3. Prilog 3: Ishodišna matrica umnoženih alela mikrosatelita u parovima baza 11.4. Prilog 4: Matrica genetske udaljenosti (dij)na temelju mikrosatelitnih početnica 11.5. Prilog 5: Matrica genetske sličnosti (Sij) na temelju kombinacije AFLP početnica 12. Životopis

68 68 71 74 74 78 81 82 83 83 86 88 88 89 90 97 98 99 100 113 114 115 115 134 137 140 143 146


1. UVOD Genetska različitost može se promatrati kroz varijabilnost unutar nukleotida, gena, kromosoma i cijelog genoma nekoga organizma. Zasniva se na složenim odnosima koji nastaju kroz varijancu između alela na pojedinom genskom lokusu, varijancu alela između nekoliko lokusa, između jedinki unutar populacije i između populacija (Smale, 1997.). Genetska različitost je osnova za daljnje genetsko poboljšanje kultiviranog bilja. Razvoj i očuvanje genetske različitosti omogućava pravilan odabir genetski različitih i divergentnih roditelja te u konačnici formiranje visokoprinosnih i visokokvalitetnih sorata i hibrida. Postojanje takvih divergentnih i genetski različitih roditelja ovisi o širini genetske osnove biljnog materijala. Intenzivna selekcija tijekom 20. stoljeća utjecala je na širinu genetske različitosti kulturnih vrsta. Tako Harlan (1970.) upozorava da genetska erozija zahtijeva hitnu akciju za očuvanjem biljnih genetskih resursa kako bi se osigurala sigurnost hrane u budućnosti. Zadnjih desetak godina provedena su brojna istraživanja genetske različitosti kultiviranog bilja s ciljem utvrđivanja stupnja erozije i gubitka alela uslijed dugogodišnje selekcije u oplemenjivačkim programima zobi (Fu i sur., 2003.); kukuruza (van Heerwaarden i sur., 2009.); soje (Hyten i sur., 2006.) i pšenice (Roussel i sur., 2005.; Hao i sur., 2006.; Balfourier i sur., 2007.). Jedna od posljedica genetske erozije je genetski pomak koji za posljedicu ima tzv. genetsku ranjivost tj. osjetljivost na abiotske i biotske stresove. Borlaug (2007.) navodi da je oko 90% svjetske proizvodnje pšenice ugroženo pojavom viruletnog tipa hrđe stabljike (Ug99), obzirom da se gen Sr31 (gen za otpornost na crnu žitnu hrđu pšenice, Puccinia graminis f. sp. tritici) nalazi na translokaciji 1B/1R (Jin i sur., 2006.). Rezultati istraživanja genetske različitosti u pšenice su oprečni, dio istraživanja pokazuje postojanje genetske erozije genoma pšenice (Fu i sur., 2009.), dok s druge strane dio istraživanja nije pokazao genetsku eroziju, štoviše u nekim oplemenjivačkim programima je došlo i do povećanja različitosti (Huang i sur., 2007.; White i sur., 2008.). Bez obzira na oprečne rezultate neophodna je stalna analiza genetske različitosti germplazme pšenice te njen neprestani razvoj. Kriteriji za procjenu genetske različitosti su različiti: morfološki, agronomski, gospodarski, podrijetlo, biokemijski i molekularni. Danas se intenzivno koriste molekularni markeri jer isključuju sve subjektivne procjene, odnosno u velikom broju studija koristi se kombinacija nekoliko kriterija kako bi procjena bila što preciznija (Gupta i sur., 1999.; Marić i sur., 2004.; Schulman, 2007.). U cilju povećanja genetske različitosti velika 1


pažnja posvećuje se i očuvanju biljnih genetskih izvora svih kultiviranih biljaka pohranjujući ih u banke gena. Mogućnost pretraživanja kroz kolekcije pšenice omogućava iskorištavanje varijabilnosti ove kulturne vrste s ciljem poboljšanja i stvaranja novih sorata koje će biti adaptabilnije na nove klimatske prilike i otpornije na bolesti. Upravo uz pomoć novih tehnologija potrebno je razviti strategiju o izolaciji (čuvanju) agronomsko poželjnih gena u gen bankama koristeći molekularnu populacijsku genetiku i biljni genetski potencijal divljih srodnika modernih sorti (Prada, 2009.). Unatoč dostupnosti velikim kolekcijama germplazme njihovo iskorištenje je ograničeno – učinkovit pristup genetskoj različitosti je još uvijek izazov. Glaszmann i sur. (2010.) podržavaju globalni pristup identifikaciji te predlažu zajednički set referentnog biljnog materijala kako bi bilo moguće pregledati germplazmu koristeći zajedničke resurse unutar znanstvene zajednice (R.E.A.D. – Represent existing diversity – Enter the whole collection – Assess phenotypic variation – Dissect trait-gene associations). U Republici Hrvatskoj se u zadnjih 10 godina pristupilo analiziranju genetske različitosti i udaljenosti ozime pšenice na razini genomske DNA. Ispitivana je genetska divergentnost domaće germplazme (Marić i sur., 2004.) koristeći morfološka svojstva, porijeklo i nasumično umnoženu polimorfnu DNA (RAPD-Random Amplified Polymorphic DNA). Provedena je i ocjena genetske različitosti domaće germplazme (Dvojković, 2009.) te usporedba sa stranom germplazmom pomoću mikrosatelitnih markera (SSR-Simple Sequence Repeats). Istraživanja ovoga tipa u Hrvatskoj na domaćoj i stranoj germplazmi pšenice potrebno je intenzivirati u budućnosti, kako bi se omogućio razvoj i izbor germplazme široke genetske varijabilnosti potrebne za stvaranje novih oplemenjivačkih populacija i novih sorata.

2


2. HIPOTEZA I CILJEVI ISTRAŽIVANJA 2.1. Hipoteza Ispitivana germplazma 40 sorti ozime pšenice pokazat će genetsku različitost svojstava te će na temelju toga biti moguće formiranje skupina različitih genotipova koji će činiti osnovu za križanje u novom ciklusu oplemenjivačkih programa.

2.2. Ciljevi istraživanja 1. procijeniti različitost germplazme ispitivanih sorti pšenice pomoću agronomskomorfoloških svojstava i molekularnih markera 2. ispitati postojanje genetske erozije unutar germplazme ozime pšenice 3. ispitati mogućnost korištenja kombinacije agronomsko-morfoloških svojstava i molekularnih markera u cilju procjene genetske različitosti u oplemenjivačke svrhe

3


3. PREGLED LITERATURE 3.1. Istraživanja genetske različitosti na temelju agronomsko-morfoloških svojstava Prvi markeri korišteni u oplemenjivanju su morfološki markeri. Svojstva koja oni bilježe su lako uočljiva te najčešće kvalitativna (npr. boja cvijeta, prisutnost osja, oblik zrna, boja zrna, itd.), a korišteni su u svrhu ocjenjivanja, križanja i kontrole razdvajajućih generacija (Novoselović i sur., 2004.; Dvojković, 2005.) te praćenja oplemenjivačkog napretka tijekom godina (Bede, 1994.; Drezner, 1995.; Denčić i sur., 1997.). Danas se također koriste posebice kao opisni alat u gen bankama, zatim u izradi genskih karata i za lokalizaciju gena. Ocjenjivanje prema morfološkim svojstvima fenotipa opisano je u listama Međunarodnog udruženja za zaštitu novih sorata bilja (UPOV-International Union for the Protection of new Varieties of Plants), a koriste se za ispitivanje različitosti, ujednačenosti i stabilnosti sorata (DUS-Distinctness, Uniformity and Stability) (Law i sur., 1998.; Jones i sur., 2003; Rukavina i sur., 2008.). Ispitivanje genetske različitosti na temelju 15 agronomsko-morfoloških pokazatelja obavili su DeLacy i sur. (2000.) na 465 pojedinačnih klasova krušne pšenice skupljenih na 24 različite lokacije u tri države Meksika. Navode da su podaci vrlo korisni oplemenjivačima i konzervatorima germplazme pšenice. Jones i sur. (2003.) su evaluirali morfološka svojstva DUS testiranja i rezultate elektroforeze skladišnih bjelančevina zrna pšenice (glijadina i visokomolekularnih podjedinica glutenina (HMW GS)) referentne kolekcije sorata pšenice radi grupiranja podataka i usporedbe novih sorata sa onima u bazi podataka. Genetski napredak agronomskih svojstava i kvalitete brašna i kruha između 30 tvrdih ozimih pšenica u Nebraski ispitivali su Fufa i sur. (2005.). Odabrali su sorte prema godinama priznavanja i zastupljenosti u proizvodnji od 1874. do 2000. godine. Utvrdili su da moderne sorte imaju veću masu zrna i broj zrna po klasu nego stare te da imaju poželjne gene koji sudjeluju u morfologiji i kontroli produktivnosti klasa. Rezultati su pokazali da genetska dobit za svojstvo uroda statistički opravdana u broju zrna (r=0,62**) i u broju zrna po klasu (r=0,52**). Suprotno tim rezultatima tijekom godina se u modernih sorata smanjila količina 4


bjelančevina u brašnu u odnosu na starije sorte, dok se sedimentacijska vrijednost povećala. Zaključuju da se oplemenjivanjem smanjila količina bjelančevina, ali su sorte su ipak zadržale svoju funkcionalnu kvalitetu. Bede i sur. (2006.) su ispitivali genetsku različitost kombinacije križanja sa dva roditelja i njihovog potomstva. Različitost se ispitivala temeljem morfoloških (DUS) svojstava, agronomskih svojstava te koristeći parametre kvalitete brašna i kruha. U prvoj kombinaciji križanja (Soissons × Mura) najveća morfološka razlika je bila u datumu klasanja, u potomstvu su dobiveni genotipovi koji su imali raniji datum klasanja od oba roditelja, što su autori pripisali transgresiji ovoga svojstva. Obzirom na ostala svojstva (voštanost prevlake lista zastavičara, zadnjeg internodija i rukavca lista zastavičara) u potomstvu su zamijećena intermedijarnost i parcijalna dominacija. Obzirom na agronomska svojstva i svojstva kvalitete izdvojen je genotip AG 284-04 koji je imao statistički visoko opravdano veći urod zrna u odnosu na oba roditelja, a prema ekstenzografskim i farinografskim pokazateljima je bio bolji od kvalitetnog roditelja (Mure). De Vita i sur. (2007.) su analizirali oplemenjivački napredak (dobit od selekcije) temeljem različitih faza u oplemenjivačkom procesu. Analizirali su morfološko-fiziološka, agronomska te svojstva kvalitete durum pšenica u 20. stoljeću. U analizi su koristili 14 durum pšenica uzgajanih u Italiji od 1900. do 2000. godine. Poljski pokus trajao je dvije godine. Rezultate su pratili po godinama priznavanja sorata, interakciji s okolinom i agrotehničkim tretmanima. Ističu kako je introgresija Rht gena uvelike pridonosi smjeru selekcije sorata s nižom stabljikom, otpornih na polijeganje, te ranozrelih sorata koje su predstavljale osnovu za daljnji oplemenjivački rad. Zabilježili su veliki napredak u povećanju uroda i komponenata uroda te u svojstvima kvalitete zrna. Opsežno istraživanje različitosti agronomskih svojstava, kvalitete zrna, brašna i kruha (ukupno 35) proveli su Bordes i sur. (2008.) uključivši 372 krušne sorte pšenice podrijetlom iz cijeloga svijeta. Najveći raspon fenotipske različitosti utvrđen je u lokalnim populacijama i starim sortama, znatno manje nego u modernim sortama. Istraživanjem su pokazali da postoji dovoljna varijabilnost u starim sortama i populacijama koje mogu služiti kao donori rijetkih alela koji su eliminirani modernim oplemenjivanjem. Naglašavaju da ovakva analiza ima veliki praktični značaj u stvaranju novih oplemenjivačkih programa, a uporabom 5


molekularnih markera istraživanje će se upotpuniti i upotrijebiti u svrhu asocijacijske genetike u oplemenjivanju. Koristeći varijabilnost osam kvantitativnih svojstava analizirano je 70 lokalnih i egzotičnih genotipova pšenice koji su uzgajani u Pakistanu tijekom 2005./2006. godine. Ali i sur. (2008.) su procijenili razlike između genotipova koristeći genotipske (GCV) i fenotipske (PCV) koeficijente varijacije. Utvrdili su značajne razlike u svim svojstvima i između genotipova. Za svojstva uroda po biljci, broja produktivnih vlati po biljci te produktivnost biljke utvrđeni su vrlo visoki GCV i PCV. Koristeći klaster analizu ispitivani genotipovi svrstani su u četiri skupine. Izdvojili su genotipove iz prve skupine koji imaju vrlo visoki urod te se mogu upotrijebiti kao roditelji u hibridizaciji prilikom stvaranja novih sorata, te druge skupine u kojoj su genotipovi koji se mogu koristiti u svrhu oplemenjivanja na svojstva visine stabljike i mase 1000 zrna.

3.2. Istraživanja genetske različitosti na temelju sastava skladišnih bjelančevina zrna Skladišne bjelančevine pšenice, posebno glutenini i glijadini su glavne komponente glutena koji je odgovoran za reološka i svojstva kruha u pšeničnog brašna, tj. za kvalitetu pšenice. (Gianibelli i sur., 2002.). Razlike između njih najčešće se utvrđuju putem elektroforeze. Glutenini čine 85% bjelančevina zrna pšenice, sastavljeni su od dvije glavne grupe polipeptidnih lanaca, visokomolekularnih (HMW) i niskomolekularnih (LMW) podjedinica (MacRitchie i Lafiandra, 1997.; Lásztity, 2002.). Rezultati velikoga broja istraživanja su pokazali da su tri lokusa, koji kodiraju visokomolekularne podjedinice glutenina (HMW GS-High Molecular Weight Glutenin Subunits), vrlo polimorfna te da su bez utjecaja okoline. Najčešće se koriste prilikom razlikovanja i identificiranja sorata pšenice na pekarsku kvalitetu te se primjenjuju u gotovo svim oplemenjivačkim programima pšenice, hrvatskim (Drezner, 1995.; Samobor i sur., 2005.; Horvat i sur., 2008.; Horvat i sur., 2009.) i stranim (Oberforster i Werteker, 1995.; Bedő i sur., 1998.; Denčić, 2006.; Zhang i sur., 2009.). U novije vrijeme kvaliteta pšenice se ispituje u kombinaciji s molekularnim markerima (Gale, 2005.). Yang i sur. (2010.) su utvrdili kompoziciju i količinu HMW i LMW podjedinica glutenina u 224 kineske sorte pšenice s 6


alelno specifičnim PCR markerima i metodom natrij-dodecil-sulfat-poliakrilamid-gel elektroforeze (SDS PAGE-Sodium-dodecil-sulfat-polyacrilamid-gel electrophoresis). Branlard i sur. (2001.) su evaluirali varijabilnost skladišnih bjelančevina i njihov utjecaj na kvalitetu pšenice. U istraživanje je bilo uključeno ukupno 162 sorte pšenice zastupljene na francuskoj ili europskoj sortnoj listi. Analizirana je alelna kompozicija na 12 glavnih lokusa skladišnih bjelančevina pri čemu su rezultati pokazali da je najveća varijabilnost zabilježena u nekoliko lokusa koji kodiraju bjelančevinu glijadin, a najmanja za lokuse glutenina (Glu-A1 i Glu-D3). Tohver (2007.) je utvrdio kompozicije visokomolekularnih podjedinica glutenina u 123 ozime i 106 jarih sorata pšenice porijeklom iz sjeverne i središnje Europe. Na temelju dobivenih vrijednosti složena je baza podataka koja se koristi prilikom identifikacije sorata i kao pomoć oplemenjivačima u poboljšanju kvalitete i ubrzanju procesa selekcije. Sultana i sur. (2007.) su analizirali 121 krušnu pšenicu i evaluirali varijabilnost alela HMW GS. Klaster analiza svrstala je sorte u 26 skupina. Rezultati su pokazali široku varijabilnost HMW GS na osnovu koje je sastavljena baza podataka. Li i sur. (2009.) su ispitivali genetsku različitost i doprinos podjedinica glutenina u poboljšanju kvalitete pšenice u Kini. Odredili su kompozicije visoko i nisko molekularnih podjedinica između 390 starih populacija i 225 priznatih sorata koristeći SDS PAGE metodu. Ukupni broj alela bio je veći u starih populacija, ali je genetski disperzijski indeks bio manji nego u priznatih modernih sorata pšenice. Genetsku varijabilnost skladišnih bjelančevina 119 argentinskih krušnih pšenica (1979.2007.) ispitivali su Lerner i sur. (2009.). Analizirali su sastav HMW i LMW podjedinica glutenina te glijadina. U 90% ispitivanih sorata identificirane su visokomolekularne podjedinice glutenina koje su odgovorne za dobru kvalitetu brašna i kruha prema Glu1ocjeni. Srednja vrijednost genetske različitosti (He) iznosila je 0,589. Najveća varijabilnost je utvrđena za lokus Glu-B1, a najmanja za lokus Glu-D1. Zaključili su da lokusi, korišteni u istraživanju, imaju vrlo veliku razlučivost prilikom utvrđivanja genetske različitosti između ispitivanih sorata pšenice.

7


Koristeći kombinaciju SDS PAGE i visokotlačne tekućinske kromatografije obrnutih faza (RPHPLC-Reversed phase high - performance liquid chromatography) analize i uporabe molekularnih markera Liang i sur. (2010.) odredili su molekularnu karakterizaciju 273 pšenice CIMMYT-a (Centro de International de Mejoramiento de Maíz y Trigo). Odredili su sastav LMW GS, HMW GS i identificirali gene odgovorne za kvalitetu pšenice. Rezultati su pokazali da navedena germplazma pšenice pokazuje veliku varijabilnost za većinu parametara kvalitete te navode da iako je translokacija 1B/1R povezana s negativnim učinkom na kvalitetu brašna i kruha pšenice, određene Glu-1/Glu3 alelne kombinacije kompenziraju taj učinak. Kako bi predvidjeli kvalitetu krušne pšenice Oury i sur. (2010.) su analizirali 130 linija pšenice koje se trenutno koriste u francuskim oplemenjivačkim programima. Biljni materijal je analiziran tijekom dvije vegetacijske godine koristeći sve dostupne tehnološke testove kvalitete brašna, tijesta i kruha te regresijsku analizu. Identificirane su HMW i LMW podjedinice glutenina. Rezultati nisu omogućili zadovoljavajuće predviđanje većine parametara kvalitete uključujući rastezljivost. Jedino se predviđanje parametra snage pokazalo pouzdano. Navode da su podaci o gluteninu značajno poboljšali kvalitetu predikcije za modele koji su koristili količinu bjelančevina u zrnu, tvrdoću zrna, Pelchenke test i SDS sedimentaciju kao prediktore.

3.3. Istraživanja varijabilnosti genotipova pšenice na temelju količine i sastava škroba Škrob je glavni skladišni polisaharid i zauzima najveći dio endosperma. Varijabilnost sastava škroba postoji između i unutar biljnih vrsta kao posljedica genetskih i okolišnih činitelja (Blazek, 2008.). Čine ga dva glukozna polimera, amiloza i amilopektin, koji predstavljaju otprilike 98-99% suhe tvari škrobnih zrnaca. U heksaploidnih pšenica omjer amiloze se kreće od 18 – 35%. Brojna istraživanja navode da je sinteza škroba u pšenici vrlo važna zbog njezine direktne povezanosti s urodom zrna te kvalitetom brašna i kruha (Rahman, 2000.; Burrell, 2003.; Eliason, 2003.). Istraživanja (Regina, 2000.) u smjeru oplemenjivanje pšenica s visokim sadržajem amiloze dovela su do izolacije novih gena koji su uključeni u sintezu škroba povezanih s visokim udjelom amiloze. Hu i sur. (2010.) navode da nedavne kliničke studije ukazuju da je amiloza vrlo važna u smanjenju glikemijskog utjecaja na hranu te da 8


nerazgranate molekule amiloze pridonose njenoj nutritivnoj vrijednosti. Moguće je izvršiti i klasifikaciju pšenica na meke i tvrde temeljem distribucije zrnaca škroba u zrnu i njihovog oblika (Singletary, 2000.) te odabrati one sorte koje imaju određenu kvalitetu škroba za posebne namjene (Ačkar i sur., 2010.). Regina (2000.) je ispitivao utjecaj amiloze na funkcionalna i strukturna svojstva škroba australskih pšenica. Navodi da položaj amiloze u odnosu na amilopektin nije posve razjašnjen, kao i uloga endogenih lipida u škrobu žitarica. Amiloza je glavna odrednica funkcionalnih svojstava i strukture škroba, a amilopektin, kao glavna komponenta škroba, ima značajan utjecaj na tehnološku i nutritivnu kvalitetu škroba. Utjecaj okoliša na količinu škroba te omjer amiloze i amilopektina u pšenice analizirali su Labuschagne i sur. (2007.). U ispitivanje je uključeno 10 jarih sorata pšenice koje su uzgajane na tri različita područja. Rezultati su pokazali da je količina škroba bila pod značajnim utjecajem okoliša. Sadržaj škroba je bio u negativnoj korelaciji s volumenom kruha, sadržajem vlažnog glutena i sadržaja bjelančevina u brašnu, u sva tri područja. Omjer amiloze i amilopektina je bio konstantan obzirom na područje uzgoja, ali nije nađena značajna korelacija s kvalitetom brašna i kruha. Zaključuju da izbor sorata i područja uzgoja utječe na količinu škroba te da sorte koje imaju visok sadržaj škroba ne moraju nužno imati i lošu kvalitetu brašna i kruha. Corcuera i sur. (2007.) su analizirali sastav škroba pet najrasprostranjenijih sorata pšenice u Argentini tijekom tri godine te su ispitivali učinkovitost metoda koje se pri tom koriste. Rezultati su pokazali da se količina škroba kretala od 58% do 59,9%, a statistički opravdane razlike nisu utvrđene niti između godina za svaku sortu niti između sorata, dok su se kvalitativna svojstva škroba razlikovala. Zaključili su da se sadržaj škroba ne može modificirati okolišnim činiteljima jer nisu nađene statistički opravdane razlike tijekom tri godine unutar istoga genotipa. Singh i sur. (2009.) su istraživali različitost strukture amilopektina te temperaturna i pastozna svojstva škroba Indijskih sorata i linija pšenice. Rezultati su pokazali se sastav amiloze kretao između 22% i 28%. Zaključili su da pastozna svojstva škroba ovise o koncentraciji škroba, omjeru amiloze/amilopektina i prisutnosti lipida koji stvaraju komplekse s amilozom. 9


Amilopektin pridonosi bubrenju škrobnih zrnaca i stvaranju tijesta, dok amiloza i lipidi inhibiraju taj proces.

3.4. Istraživanja genetske različitosti na temelju uporabe molekularnih markera Molekularni markeri su korisni u identifikaciju različitosti, samostalno ili u kombinaciji s morfološkim i fiziološkim svojstvima. Molekularnih markera ima mnogo, ne ovise o uzorku i okolišnim činiteljima te omogućavaju identifikaciju u ranom razvojnom stadiju biljke. Jednostavne ponavljajuće sekvence (SSR-Simple sequence Repats) - SSR markeri ili mikrosateliti su sveprisutni u biljaka (Powell i sur., 1996.), imaju vrlo visok stupanj polimorfizma i mogućnost razlikovanja vrlo srodnih genotipova (Morgante i Olivieri, 1993.; Plaschke i sur., 1995.). Izrađen je i veliki broj mikrosatelitnih mapa pšenice što ukazuje na njihovo često korištenje u genetici i oplemenjivanju pšenice (Röder i sur.,1998.; Stephenson i sur., 1998., Paillard i sur., 2003.; Gao i sur., 2004.; Somers i sur., 2004.). Koristeći metodu polimorfizma dužine amplificiranih ulomaka (AFLP-Amplified Fragment Length Polymorphism) Barett i sur. (1998.) su procijenili genetsku različitost 54 sorte ozime i jare pšenice sjevernog Pacifika te dvije diploidne sorte. Koristili su 16 AFLP markera koji su proizveli 229 polimorfnih fragmenata. Srednja procjena genetske različitosti (GDE) ozimih pšenica i jarih pšenica je iznosio 0,58, dok je najmanji GDE bio unutar jarih pšenica (0,49). Klaster analiza, analiza glavnih komponenata (Pincipal Component Analysis - PCA) i analiza molekularne varijance (AMOVA) pokazale su da je genetska različitost između sorata bila hijerarhijska kako su se sorte smještale unutar skupina te prema načina uzgoja. Zaključili su da je AFLP metoda efikasna u pronalaženju genetske različitosti između sorata pšenice. Kako bi evaluirali genetsku različitost 105 argentinskih sorata pšenice priznatih od 1932. do 1995. godine Manifesto i sur. (2001.) su koristili kombinaciju AFLP markerta i mikrosatelita. Utvrdili su da nema statističkih razlika u genetskoj različitosti između privatnih i državnih oplemenjivačkih programa. Prosječna genetska različitost temeljena na mikrosatelitima je bila gotovo identična u četiri analizirana razdoblja, dok je genetska različitost temeljena na AFLP markerima potvrdila da nije došlo do smanjenja različitosti tijekom 60 godina, ali su utvrđene statistički visoko opravdane razlike između sorata priznatih 1970. i 1980. godine. 10


Ahmad (2002.) je analizirao 13 genotipova ozime pšenice sa 43 odabrana mikrosatelita. Otkriveno je 156 alelnih varijanti. PIC vrijednosti kretale su se od 0,10 (gwm264) do 0,89 (gwm471, gwm577). Utvrđen je širok raspon genomske udaljenosti između svih genotipova. Odabrani genotipovi će se koristiti u cilju oplemenjivanja za specifična svojstva i proširenje genetičke osnove. Khlestkina i sur. (2002.) su koristeći četiri različite metode molekularnih markera: polimorfizam

dužine

restrikcijskih

ulomaka

(RFPL-Restriction

Fragment

Length

Polymorphism), RAPD, mjesta označenih sekvencama (STS-Sequence Tagged Site) i mikrosatelita mapirali gene pšenice za boju koleoptile (Rc1, Rc2, Rc3), boju glume (Bg, Rg1) i dlakavost glume (Hg). Tražeći potencijalni izvor genetske varijabilnosti u modernim programima oplemenjivanja pšenice u Sibiru Khlestkina i sur. (2004.) u ispitivanje su uvrstili 54 starih i novih sibirskih sorata jare pšenice. Sorte su analizirane setom od 22 mikrosatelita pri čemu je locirano 23 lokusa na 19 kromosoma. Rezultati su pokazali da nije došlo do smanjenja genetske različitosti te da su stare sibirske sorte jare pšenice vrlo vrijedan izvor varijabilnosti u oplemenjivanju pšenice. McIntosh i sur. (2004.) su uveli jedinstveni način identifikacije žitarica. Koristili su granulebound starch synthase 1 (GBSS 1) gen očuvan kroz evoluciju i domestifikaciju. U ispitivanje su uvrstili rižu, pšenicu, ječam i kukuruz. Metodom pirosekvenciranja dokazali su polimorfizam unutar DNA fragmenata omogućavajući tako identifikaciju na razini vrste. Navode da se navedeni protokol može koristiti i u široj primjeni identifikacije biljnih vrsta i drugih porodica. Roussel i sur. (2004.) su evaluirali molekularnu različitost 559 francuskih krušnih sorata pšenice, koje su uključivale stare populacije i priznate sorte uzgajane u razdoblju od 1800. do 2000. godine. Koristili su set od 41 mikrosatelita. Rezultati su pokazali smanjenje za 25% u broju alela prije i poslije 1970. godine. Isti autori (Roussel i sur. 2005.) su nastavili svoje istraživanje uključivši sorte pšenice porijeklom iz 15 europskih zemalja. Uzorak se sastojao od 480 krušnih pšenica registriranih u razdoblju od 1840. do 2000. godine. Rezultati klaster analize 15 geografskih regija su razdvojeni u dvije skupine, a broj alela u odnosu na geografsko podrijetlo je najveći u španjolskih i portugalskih sorata, a najmanji u francuskih sorata pšenice.

11


You i sur. (2004) su procijenili minimalni broj mikrosatelitnih lokusa koji su potrebni za utvrđivanje genetske povezanosti sorata pšenice. Odabrali su 33 moderne sorte i 63 lokalne populacije. Koristili su 104 para mikrosatelitnih početnica. Genetska različitost utvrđena je u lokalnih populacija je bila veća negu u modernih sorata, a najveće razlike su između lokalnih populacija i modernih sorata zabilježene su u D genomu. Rezultati su pokazali da je broj od 73 polimorfna lokusa dovoljan kako bi se prikazala genetska povezanost između ispitivanih sorata sa 90% pouzdanošću. Jedno od najopsežnijih istraživanja genetske različitosti pšenice izvela je skupina znanstvenika Chenyang i sur. (2006.) uvrstivši u istraživanje 1680 sorata kineske kolekcije pšenica u posljednjih 50 godina. Kolekcija je analizirana sa 78 mikrosatelita pri čemu je proizvedeno 1366 alela, od kojih je 1253 povezano sa 71 lokusom. Od 21 para kromosoma pšenice 7A, 3B i 2D pokazali su najveću različitost, dok su kromosomi 2A, 1B, 4D, 5D i 1D imali najmanju. Rezultati su također pokazali da je najveća udaljenost i različitost bila u 50im godinama, dok je od 1960. utvrđeno postepeno smanjivanje. Autori zaključuju da genetička baza modernih sorata postaje sve uža te da bi njihovi rezultati trebali privući veću pažnju oplemenjivača. Banayi i sur. (2006.) su analizirali 96 sorata pšenice priznatih u Mađarskoj koristeći 15 mikrosatelitnih markera pšenice na različitim krakovima kromosoma. Dobiveno je 94 alela. Većina sorata je bila homozigotna na sve mikrosatelitne lokuse, osim 11 sorata koje su pokazale heterozigotnost na šest lokusa. Najveći stupanj heterozigotnosti imao je gwm312 (4,4%). Procijenili su da je potrebno samo osam mikrosatelita kako bi se uspješno mogle razlikovati 83 sorte. Mikrosateliti pokazuju visoki stupanj polimorfizma i mogu se efikasno koristiti prilikom identifikacije sorata. Stępien i sur. (2007.) su utvrdili genetsku različitost 53 poljske ozime i jare pšenice koristeći 24 mikrosatelita. Proizvedeno je ukupno 166 alela (od tri do 13 alela po lokusu). Odabrali su četiri visokopolimorfna mikrosatelita (gwm186, gwm389, gwm459 i gwm577) koji su bili dovoljni za utvrđivanje različitosti između svih ispitivanih genotipova pšenice. Ukupno 60 sorata ozime pšenice (HRWW-hard red winter wheat) priznate od 1900. do 2005. godine su korištene u istraživanju Prasad i sur. (2009.). Sorte su grupirane u šest dekadskih 12


razdoblja na temelju godine priznavanja, zatim u osam različitih klasa na temelju različitih oplemenjivačkih programa tvrtki i pedigrea. Genetska različitost sorata ozime pšenice procijenjena je pomoću 62 para mikrosatelitnih markera. Utvrđen je ukupno 341 polimorfni alel. Genska različitost varirala je od 0,03 za marker WMC477 do 0,86 za marker WMC707. Procijenjena genetska različitost iznosila je 0,62. Najveću srednja vrijednost broja alela (4,79), genetske različitosti (0,60) i PIC (0,63) su utvrdili za sorte priznate 1990.-ih godina.

3.5. Istraživanja genetske različitosti pomoću kombinacije agronomsko-morfoloških svojstava i molekularnih markera Kako bi se što učinkovitije odredila genetska različitost pšenice, najčešće se koristi kombinacija agronomsko-morfoloških svojstava sa molekularnim markerima. Tako su Law i sur. (1998.) ispitali mogućnost korištenja AFLP markera kako bi proizveli DNA profile za 55 sorata pšenice koje se uzgajaju na području Velike Britanije u posljednjih 60 godina. Dobivene rezultate usporedili su sa 14 morfoloških svojstava (prema UPOV-u). Kriterij različitosti zadovoljen je većim brojem polimorfnih fragmenata u odnosu na ocjenu danu DUS testom. Kobiljski i sur. (2002.) su evaluirali ukupno 710 genotipova pšenice porijeklom iz 38 zemalja (1993.-2000.). Bilježili su ukupno 54 agronomskih, morfoloških i fizioloških svojstava na polju i u kontroliranim uvjetima. Temeljem dobivenih rezultata odabrali su 96 genotipova s najvećom fenotipskom varijabilnošću. Koristili su set od 36 mikrosatelita koji su pokrili sva tri genoma i svih 42 kromosoma pšenice. Nađeno je 46 lokusa i 366 alela. Premali broj lokusa objašnjavaju zahtjevnom i kompleksnom statističkom obradom alela danog mikrosatelita koji se nije distribuirao među genotipovima i nedovoljnim brojem markera koji su trebali pokriti genom dug 3000 cM. Utvrdili su vrlo značajnu povezanost dva važna svojstva - visine stabljike i ranozrelosti. Cooke i Reeves (2003.) su razmotrili mogućnost uključivanja molekularnih markera u sam proces priznavanja novih sorata kulturnoga bilja. Navode da je DUS i VCU ispitivanje i testiranje vrlo efikasno, ali da potencijalna korist od biokemijskih i molekularnih markera može pospješiti i ubrzati sam proces, a pored toga i dodatno zaštiti prava oplemenjivača. 13


Ispitivanjem nekoliko potencijalnih markera (npr.WMS408) koji bi bili idealni prilikom DUS testa, zaključuju da bi se upotrebom mapiranih markera postigla dodatna korist u potvrdi agronomski značajnih svojstava u organskoj, „low input“ ili samoodrživoj proizvodnji. Vieira i sur. (2007.) su kombinirali morfološke i molekularne markere kako bi procijenili genetsku udaljenost između genotipova pšenice i utvrdili povezanost između te dvije metode. Koristili su 19 genotipova ozime pšenice, 229 AFLP markera i 17 morfoloških svojstava. Zaključili su da kombinirana analiza nije efikasna i da bi se rezultati trebali promatrati odvojeno. Noli i sur. (2008.) su uspoređivali morfološki i molekularni pristup koji se koristi prilikom registracije durum sorata pšenice pomoću mikrosatelita i AFLP markera u cilju njihove uporabe prilikom procjene različitosti. Koristili su 96 eksperimentalnih linija dobivenih od četiri kombinacije križanja, dva povratna križanja, uključujući i njihove roditeljske linije. Fenotipska karakterizacija procijenjena je pomoću 17 svojstava prema CPVO (Community Plant Variety Office) pravilniku, dok je genotipska izvršena pomoću 98 mikrosatelitnih markera i sedam kombinacija AFLP markera. Navode da se molekularni markeri trebaju koristiti kao komplementarni alat u utvrđivanju različitosti te da je set od 28 mikrosatelita (jedan po kromosomskom kraku) dovoljan za „pre-screening“ u identifikaciji jedinki koje se razlikuju na molekularnoj razini (≥13 polimorfizama). Time bi se smanjili troškovi testiranja genotipova na poljskim pokusima.

3.6. Istraživanja postojanja genetske erozije Već duže vrijeme vlada zabrinutost da moderno oplemenjivanje bilja dovodi do smanjenja genetske različitosti kulturnog bilja. Velika pažnja posvećuje se očuvanju postojećih izvora varijabilnosti kulturnog bilja. Kultivirani genotipovi su direktan rezultat akumulacije povoljnih alela na mjestima gena, ključnih za kontrolu agronomski važnih svojstava, ali uzimajući u obzir velik broj lokusa koji sudjeluju u ekspresiji fenotipa takvih svojstava malo je vjerojatno da moderni genotipovi u sebi sadrže one povoljne varijante svih alela za sva agronomska svojstva (Tanksley i McCouch, 1997.).

14


Moderne sorte su uniformnije od lokalnih populacija, a velike površine zasijane samo jednom sortom su potencijalno opasne zbog preosjetljivosti na štetnike i bolesti (Tripp i van der Heide, 1996.). Domestifikacija također pridonosi tzv. "bottleneck" efektu u mnogih kulturnih biljaka (Reif i sur., 2005.). Haudry i sur. (2007.) su otkrili je domestifikacija uzrokovala veliko smanjenje nukleotidne različitosti pšenice. Tako se najveći "bottleneck" efekat javio u evoluciji durum pšenice. Osim na pšenici istraživanja su obavljena i na velikom broju kulturog bilja, zobi (Fu i sur., 2003.), kukuruzu (van Heerwaarden i sur., 2009.) i soji (Hayten i sur., 2006.). Khlestkina i sur. (2004.) su koristeći mikrosatelitne markere analizirali 252 primke pšenice porijeklom iz Austrije, Albanije, Indije i Nepala. Biljni materijal je sakupljen između 1920. i 1940. te ponovo između 1970. i 1990. godine. Ispitivali su stabilnost ili gubitak genetske različitosti. Rezultati su pokazali da su otprilike dvije trećine alela zajedničkih u oba perioda, dok je jedna trećina prezentirana specifičnim alelima. Navode da podaci upućuju na to da se navedeni protok alela dogodio tijekom adaptacije tradicionalne prema modernoj poljoprivredi te da genetička različitost nije značajno dovedena u pitanje. Donini i sur. (2005.) su ispitali utjecaj oplemenjivanja na genetsku različitost i eroziju krušne pšenice. U ispitivanje su uvrstili 55 starih i novih britanskih sorata krušne pšenice koristeći pritom 12 mikrosatelita i 14 DUS parametara. Sorte su podijelili u tri zasebna razdoblja i odredili alelne konstitucije za svako pojedino razdoblje. Rezultati su pokazali da iako se vidi pomak u frekvenciji alela niti jedan lokus nije pokazao neto gubitak u odnosu na ukupni broj alela između 1930-ih i 1990-ih godina. Nastale promjene pripisuju dinamičnom sustavu i toku alela tijekom domestifikacije i oplemenjivanja, prilikom čega su neki aleli izgubljeni dok su neki novi uneseni u nove sorte. Mišljenja su da je tijekom zadnje dvije dekade 20. stoljeća zapravo došlo do povećanja različitosti. Martos i sur. (2005.) su odredili filogenetsku povezanost 24 sorata durum pšenice koristeći AFLP markere. Utvrdili su visoku sličnost između starih španjolskih sortaa i kolekcije talijanskih sorata. Paralelno su ispitivali pojavu genetske erozije uzrokovane modernim oplemenjivanjem, zaključili su da je, ako se uzmu u obzir sva razdoblja ispitivanja, sveukupna genetska različitost ostala nedirnuta.

15


Warbourton i sur. (2006.) su proveli istraživanja uvođenja divljih srodnika u oplemenjivanje krušne pšenice kako bi obnovili genetsku različitost. Navode uporabu divljih srodnika, materijala iz drugih oplemenjivačkih programa i sintetske pšenice u proširenju genetske osnove običnih krušnih pšenica. Koristeći mikrosatelite rezultati su pokazali da se udaljenost između nedavno stvorenih oplemenjivačkih linija CIMMYT-a i sorata pšenice iz razdoblja zelene revolucije nije značajno razlikovala od starih populacija. Zaključuju da se urod, otpornost na abiotske stresove i kvaliteta nastavljaju povećavati ukazujući da zelena revolucija traje i danas. Huang i sur. (2007.) su ispitivali genetsku eroziju zbog upotrebe intenzivnih i modernih metoda oplemenjivanja pšenice. U istraživanje su uvrstili kolekciju od 511 široko rasprostranjenih i korištenih sorata pšenice sjeverne i središnje Europe od 1940. do 2000. godine. Koristili su 42 mikrosatelita pšenice. Rezultati pokazuju više kvalitativni nego kvantitativni pomak u različitosti. Promjene su se odnosile na kompoziciju i pojavljivanje alela, a ne u broju alela. Zaključuju da bez obzira što nije dokazana erozija u genetičkom poolu europskih pšenica, koncept unošenja neadaptiranih i divljih germplazmi treba biti uključen u svaki oplemenjivački program. Fu i sur. (2009.) su proveli opsežno istraživanje različitosti 75 jarih sorata pšenice priznatih od 1845. do 2004. godine. Koristili su 320 mikrosatelita koji su pokrili cijeli genom pšenice. Identificirano je 2280 alela. Rezultati su pokazali da se redukcija alela dogodila gotovo u svakom dijelu genoma pšenice. Značajno smanjenje alela započelo je 1930-ih godina. Ukupno smanjenje alela iznosilo je 17%. Zaključuju da njihovi podaci dokazuju smanjenje genetske divergentnosti uzrokovano modernim oplemenjivanjem kanadskih pšenica. Ovakvo istraživanje nastavak je prethodnih istraživanja Fu i sur. (2006.) na genetskoj različitosti jare pšenice. Genetsku različitost i smanjenje alelnog polimorfizma ispitivali su Ganeva i sur. (2010.). U ispitivanje su uključili 136 sorata durum pšenice i 14 polimorfnih mikrosatelita. Rezultati su pokazali manju različitost u prirodnih populacija u odnosu na glavne centre domestifikacije pšenice. Oplemenjivanje je prouzročilo značajno smanjenje alelnog polimorfizma, nestanak rijetkih alela i povećanje broja učestalih alela te frekvenciju dominantnih alela.

16


4. MATERIJAL I METODE 4.1 Biljni materijal U istraživanje je uključeno 40 sorata heksaploidne krušne pšenice (Triticum aestivum ssp. vulgare L.). Odabir sorata obavljen je prema godini priznavanja u Republici Hrvatskoj, zastupljenosti u proizvodnji i području uzgoja (Tablica 1.a i 1.b). Tablica 1.a Podrijetlo i godina priznavanja sorata ozime pšenice Br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20.

Sorta U1 Bezostaja Libellula Zlatna dolina Osječka crvenka Osječka 20 Sana Slavonija Žitarka Soissons Adriana Srpanjka Demetra BC Patria Divana Barbara Ludwig Super žitarka Golubica Edison

Godina 1936. 1963. 1965. 1971. 1976. 1978. 1983. 1984. 1985. 1987. 1988. 1989. 1991. 1994. 1995. 1997. 1997. 1997. 1998. 2001.

Podrijetlo PIO Bivši SSSR Italija Bc institut PIO PIO Bc institut PIO PIO Francuska Bc institut PIO PIO Bc institut Jošt PIO Austrija PIO PIO Austrija

Pedigre Carlotta strampeli/Marquis Skorospelka 2/Lutescens 17 Tevere/Giuliari//San Pastore Zg 414-57/Leonardo Libellula/Bezostaja Osk. 6.9-1-64/V-188-M Mura/CI 14123//Zg 2413-72 Osječka 20/Osk.4.216-2-76 Osk. 6.30-20/Slavonka/3/Eph. M68/Osk. 154-19/Kavkaz Iena/HN 35 ZG 1758-70/TpR-349 Osk. 4.50-1-77/Zg 2696 Osk. 4.216-2-76/Zg 2696 Odesskaya-51/ZG-IPK-8210 /2/ GK-32-82 Favorit/5/Cipriz/4/J.Kwang/2/Atlas66/Comanc./3/Velvet GO 3135/Žitarka Ares/Farmer GO 3135/Žitarka Slavonija/Gemini Agron/Regent//Capo

U Hrvatskoj je kreirana 31 sorta, od kojih su 25 Poljoprivrednog instituta iz Osijeka (PIO), pet sorata Bc instituta i jedna sorta oplemenjivačke kuće Jošt sjeme-istraživanja d.o.o., Križevci. U ispitivanje su uključene i sorte koje služe kao standardi pri priznavanju novih sorata ozime pšenice (Žitarka, Sana i Divana). Devet sorata su stranog porijekla, od kojih je četiri sorte ustupio PIO, a pet sorata prof.dr. Hermann Buerstmayra sa IFA Tulln, Austrija.

16


Tablica 1.b Podrijetlo i godina priznavanja sorata ozime pšenice Br. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Sorta Lucija Bastide BC Elvira Alka Antonius Janica Valerius Eurofit Renata Aida Pipi Katarina Seka Lela Ilirija Felix Zlata Anđelka Mihaela Ružica

Godina 2001. 2002. 2002. 2003. 2003. 2003. 2003. 2005. 2006. 2006. 2006. 2006. 2006. 2006. 2008. 2008. 2008. 2008. 2008. 2008.

Podrijetlo PIO Francuska Bc institut PIO Austrija PIO Austrija Austrija PIO PIO PIO PIO PIO PIO PIO PIO PIO PIO PIO PIO

Pedigre Srpanjka/Kutjevčanka Fertil / Arche Bc 2377-79/MV-C2-33//Irena Osk. 5.140-22-91/Sana Pokal/Karat//Ekspert/Severin Osk. 5.36-9-91/Srpanjka Carolus//Monopol/Karat// Ekspert/Severin Pegassos/Kontrasst Žitarka /2/Osk.7.5-4-82/KB160-86/3/Srpanjka Srpanjka/Rialto Soissons/Osk. 6.83-5-91 Osk.5.B.4-1-94/Osk. 5.140-22-91 Srpanjka/Demetra Srpanjka/Osk. 5.136-8-90 Osk.14.294-16-95/Soissons Srpanjka/K160/86 Srpanjka/Demetra Srpanjka/Demetra Srpanjka/Osk. 5.136-11-90 Osk. 5.36-9-91/Srpanjka//Brea

4.2. Metode istraživanja 4.2.1. Poljski pokus, uzgojne mjere i pedoklimatski uvjeti Sve navedene sorte uključene su u poljski pokus na pokusnom polju Poljoprivrednoga instituta u Osijeku. Prema Romić i sur., (2006.) tip tla je humofluvisol černozemni, srednje duboko oglejeni, nekarbonatan, praškasto glinasto ilovast, a kemijski sastav tla je sljedeći: pH 6,24/1M KCl, humus 2,73%, N 0,13%, 16,39 mg P2O5/100g tla, 32,41 mg K2O/100 mg tla. Sorte su posijane po slučajnom blok rasporedu u tri ponavljanja s veličinom obračunske parcele od 6,5 m2. Opažanja i mjerenja obavljena su tijekom dvije vegetacijske godine (2007./2008. i 2008./2009.). Predkultura prve vegetacijske godine je bio kukuruz, a osnovna gnojidba obavljena je sa 50 kg/ha uree (46%N) i 150 kg/ha NPK 7:20:30. Startna gnojidba obavljena je sa 150 kg/ha NPK 7:20:30 prije sjetva 19.10.2007. Tijekom vegetacije obavljena je jedna prihrana 19.02.2008. sa 125 kg/ha KAN (27%N). Zaštita biljnog materijala obavljena je herbicidom Hussar 0,1 l/ha (u fazi drugoga koljenca) i insekticidom Decis 0,3 l/ha 15.03.2008. radi suzbijanja žitnog balca 17


(Oulema sp.) i lisnih uši (Aphididae). Žetva pokusnih parcela izvršena je 02.07.2008. godine kada je usjev bio u fazi pune zriobe. Predkultura druge vegetacijske godine je bila soja, a osnovna gnojidba je obavljena sa 50 kg/ha uree (46%N) i 200 kg/ha NPK 7:20:30. Startna gnojidba obavljena je 200 kg/ha NPK 7:20:30 prije sjetve 31.10.2008. godine. Tijekom vegetacije obavljene su dvije prihrane, prva 24.02.2009. sa 130 kg/ha KAN (27%N), a druga 22.03.2009. sa 20 kg/ha KAN-a. Zaštita biljnog materijala obavljena je herbicidom Tena 1,5 kg/ha (u fazi dva do tri lista) i insekticidom Zagor 1 l/ha 15.03.2008. godine protiv lisnih uši (Aphididae). Žetva pokusnih parcela izvršena je 12.07.2009. godine kada je usjev bio u fazi pune zriobe. Prema Köppenovoj klasifikaciji klime (Penzar i Penzar, 2000.) na području Osijeka, prevladava umjereno topla kišna klima označen formulom Cfb. Srednja temperatura najhladnijeg mjeseca u godini je između -3 i -18 0C, bez izrazito suhog razdoblja ili s karakterističnom zimskom suhoćom, dok je srednja temperatura najtoplijeg mjeseca u godini je najčešće viša od 10, a niža od 22 0C te uz mnogo kiše početkom ljeta, a u kasnom ljetu sa malo oborina. Klimatski podaci o srednjim mjesečnim temperaturama i oborinama za razdoblje od rujna 2007. do srpnja 2009. dobiveni su iz Meteorološke postaje Osijek.

Tablica 2. Srednje mjesečne temperature zraka (°C) i mjesečne količine oborina (mm) u Osijeku za prvu godinu pokusa (2007./2008.) te višegodišnji prosjek (1961.-2000.)

2008.

2007.

Srednja mjesečna temperatura zraka u °C Rujan Listopad Studeni Prosinac Siječanj Veljača Ožujak Travanj Svibanj Lipanj Srpanj

Količina oborina po mjesecima u mm

Prosjek

1961./2000.

Prosjek

1961./2000.

14,8 10,8 4,0 0,1 1,4 6,0 7,8 12,6 19,3 22,0 22,8

16,6 11,2 5,4 0,9 -1,2 1,6 6,1 11,3 16,5 19,4 21,1

71,2 97,7 100,7 42 33,9 3,8 76,1 50,6 114,5 88,9 70,1

51,8 48,3 60,7 54,4 45,2 37,8 42,2 54,1 58,9 83,5 66,6 18


U prvoj godini poljskoga pokusa tijekom vegetacije pšenice prosječne srednje mjesečne temperature zraka nisu odstupale od višegodišnjega prosjeka (Tablica 2). dok su u siječnju i veljači te svibnju i lipnju 2008. bile više za 2 do 3°C. Tablica 3. Srednje mjesečne temperature zraka (°C) i mjesečne količine oborina (mm) u Osijeku za drugu godinu pokusa (2008./2009.) i višegodišnji prosjek (1961.-2000.)

2009.

2008.

Srednja mjesečna temperatura zraka u °C Rujan Listopad Studeni Prosinac Siječanj Veljača Ožujak Travanj Svibanj Lipanj Srpanj

Količina oborina po mjesecima u mm

Prosjek

1961./2000.

Prosjek

1961./2000.

15,9 13,6 7,5 3,8 -1,4 1,7 6,9 14,6 19,0 19,7 23,6

16,6 11,2 5,4 0,9 -1,2 1,6 6,1 11,3 16,5 19,4 21,1

85,4 38,2 48,6 47,5 57,2 35,4 22,1 15,7 45,5 73,9 31

51,8 48,3 60,7 54,4 45,2 37,8 42,2 54,1 58,9 83,5 66,6

U drugoj godini pokusa tijekom vegetacije pšenice srednje mjesečne temperature zraka također nisu odstupale od višegodišnjega prosjeka osim u travnju i svibnju 2009., kada su prosječne srednje temperature zraka bila više za 2 °C (Tablica 3). U prvoj godini poljskoga pokusa (2007./2008.) zabilježena je veća količina oborina u rujnu, listopadu i studenom 2007. (Grafikon 1) odnosno u sjetvi pšenice. Tijekom faze nicanja i ukorjenjivanja, slijedi nagli nedostatak oborina u veljači 2008. kada je palo samo 3,8 mm, dok je višegodišnji prosjek iznosio 37,8 mm. Veća količina oborina u svibnju, kada je palo 55,6 mm više oborina od višegodišnjeg prosjeka te uz temperaturu zraka višu za 2,8°C pogodovala je razvoju bolesti, takvi uvjeti uzrokom su i kasnijeg klasanja pšenice. U drugoj godini poljskoga pokusa zabilježena je pak manja količina oborina tijekom ožujka i travnja, kada se pšenica nalazi u fenofazi vlatanja, te se zbog povećane transpiracijske površine nalazi u kritičnom razdoblju glede potrebe za vodom. Manja količina oborina u odnosu na višegodišnji prosjek zabilježena je i u mjesecu svibnju (45,5 mm).

19


2007

2008 oborine zbroj

oborine 1961-00

srpanj

lipanj

svibanj

travanj

ožujak

veljača

siječanj

prosinac

studeni

listopad

rujan

kolovoz

-5,0

srpanj

0,0

-15

lipanj

5,0

0 svibanj

10,0

15 travanj

30

ožujak

15,0

veljača

20,0

45

siječanj

25,0

60

prosinac

30,0

75

studeni

35,0

90

listopad

40,0

105

rujan

120

Temperatura (°C)

Oborine (mm)

Walterov klima dijagram za Osijek (3:1)

2009 temperatura prosjek

temperatura 1961-90

Grafikon 1. Klima-dijagram za razdoblje od 2007. do 2009. godine te 30 godišnji prosjek na lokaciji Osijek

4.2.2. Morfološka svojstva Različitost sorata ispitivana je na osnovi morfoloških svojstvia (Tablica 4.) uključenih u listu deskriptora prema vodiču o različitosti, ujednačenosti i postojanosti sorata pšenice (DUS - D = Distinct, U = Uniform, S = Stable) Međunarodnog udruženja za zaštitu novih kultivara bilja (UPOV-International Union for the Protection of New varieties of Plants). Ocjena svojstava obavljena je u poljskim pokusima tijekom dvije vegetacijske godine u sva tri ponavljanja u fazama razvitka biljaka kako je propisano vodičem. Na temelju dobivenih podataka izrađena je matrica za ispitivana morfološka svojstva na principu prisutnosti (1) ili odsutnosti (0) određenoga morfološkog svojstva. Radi lakšeg i preciznijeg mjerenja za svojstvo klasanja, sorte su podijeljene u pet skupina prema datumu klasanja: prvu od 01.05. do 04.05., drugu od 05.05. do 08.05., treću od 09.05. do 12.05., četvrtu od 13.05. do 16.05. i petu od 17.05. do 20.05. Na isti način, svrstavanjem genotipova u pet skupina, pristupljeno je utvrđivanju ocjene za svojstvo visine biljke i duljine klasa.

20


Tablica 4. Ispitivana morfološka svojstva i ocjene prema UPOV tehničkom vodiču za DUS ispitivanje ozime pšenice Br.svojstva

Svojstvo

2.

Biljka: tip busanja

5.

Vrijeme klasanja

6.

List zastavičar: voštana prevlaka na rukavcu

7.

Klas: voštanost

9.

Biljka: visina

12.

Klas: zbijenost

14.

Osje ili produžetak pljevica: prisutnost

15.

Klas: duljina

16.

Klas: boja

24.

Zrno: boja

Ocjena 1 3 5 7 9 1 3 5 7 9 1 3 5 7 9 1 3 5 7 9 1 3 5 7 9 1 3 5 7 9 1 3 5 7 9 1 2 3 1 2 1 2

Opis Erektum Semierektum Intermedijaran Semiprostratum Prostratum Vrlo rano Rano Srednje Kasno Vrlo kasno Nema ili vrlo slaba Slaba Srednja Jaka Vrlo jaka Nema ili vrlo slaba Slaba Srednja Jaka Vrlo jaka Vrlo kratka Kratka Srednja Duga Vrlo duga Vrlo rastresit Rastresit Srednje zbijen Zbijen Jako zbijen Vrlo kratak Kratak Srednji Dugi Vrlo dugi Oboje odsutno Pljevice prisutne Osje prisutno Bijela Obojan Bijela Crvena 21


4.2.3. Agronomska svojstva Tijekom dvije vegetacijske godine mjerena su sljedeća agronomska svojstva: visina biljke do klasa, duljina klasa i broj biljaka po jedinici površine (m2) u fazi voštane zriobe. Za mjerenje broja klasića po klasu i broja zrna po klasu ručno su uzeti klasovi neposredno prije žetve. Za svako svojstvo (osim broja biljaka po jedinici površine) je mjereno na 25 slučajno odabranih biljaka iz srednjeg reda unutar svakoga ponavljanja. Tako je za svaku sortu izmjereno 75 biljaka što ukupno čini 24 000 pojedinačnih mjerenja. Određivanje hektolitra i vlage obavljena su nakon žetve na polju, a zatim je utvrđena masa 1000 zrna i procijenjen je urod zrna.

Laboratorijski pokus

4.3.1. Mjerenja količine i sastava bjelančevina i škroba u zrnu pšenice Nakon žetve u obje vegetacijske godine poljskoga pokusa za svaki genotip (prosjek tri ponavljanja) određena je količina bjelančevina i škroba pomoću uređaja Infratec™ 1241 Grain Analyzer-a (Foss Tecator AB, Švedska) za brzo testiranje parametara kvalitete zrna.

4.3.1.1. Određivanje sastava bjelančevina Sastav bjelančevina tj. visokomolekularnih jedinica glutenina (HMW-GS) određen je metodom natrij-dodecil-sulfat-poliakrilamid-gel elektroforeze (SDS-PAGE). Ispitivanje je provedeno u Laboratoriju za ispitivanje kvalitete Poljoprivrednoga instituta u Osijeku. Izolacija glutenina obavljena je iz 50 mg brašna 16 sorata pšenice koristeći SDS-PAGE pufer (2X stock pufer: 0,125 M Tris-HCl, 4% SDS, 20% glicerol, 0,2 M DTT, 0,02% Bromphenol Blue, pH 6,8). Elektroforeza je obavljena na uređaju Phast System (Pharmacia LKB) u sljedećim uvjetima: 40 min, 250 V, 10 mA, 15 °C i 120 Vh, koristeći PhastGel gradient 4-15 gelove (43 x 50 x 0.45). Gelovi su obojani koristeći 0.1% Coomassie Brilliant Blue R boju. Izračunavanje ocjena kvalitete - Glu-1 vrijednost (Tablica 5) obavljeno je prema Payne i Lawrence (1987.).

22


Tablica 5. Obilježavanje lokusa, alela i HMW podjedinica glutenina i odgovarajuća ocjena kvalitete Lokus

Aleli a Glu-A1 b c b c d Glu-B1 e h i a Glu-D1 b d ˟odlično (4); dobro (3); slabo (2); loše (1)

Podjedinice 1 2* N 7+8 7+9 6+8 20 14+15 17+18 2+12 3+12 5+10

Ocjena kvalitete˟ 3 3 1 3 2 1 3 2 2 4

Klasifikacija sorata prema HMW-GS određena je uspoređujući ih sa poznatim standardima (Chinese Spring i Glenlea) (Slika1). Podaci za ostale genotipove prikupljeni su iz literaturnih podataka (Horvat i sur., 2006.; 2008.; Bekes i sur., 2006. http://www.aaccnet.org/grainbin/gluten_gliadin.asp).

Slika 1. SDS-PAGE elektroforegram (sorte: Alka (1), Katarina (2), Barbara (3), Chinese Spring (4), Glenlea (5), Golubica (6), Zlatna Dolina (7) i Aida (8)); (foto original)

23


4.3.1.2. Određivanje sastava škroba Postupak je proveden u dvije faze. Sastav škroba odnosno udjel amiloze i amilopektina utvrđen je metodom Megazyme k-amyl 04/06 (Megazyme International Ireland, 2006.) pomoću istoimenog seta. Ispitivanje škroba provedeno je u laboratoriju Katedre za tehnologiju ugljikohidrata Prehrambeno-tehnološkog fakulteta u Osijeku. Prva faza uključuje obradu škroba. Uzorci 40 sorata pšenice samljeveni su u fini prah te je izvagano, za dva ponavljanja, po 25 mg brašna. Uzorci brašna su stavljeni u epruvete od 10 ml, nakon čega je dodano 1 ml DMSO (dimetil sulfoksid). Sadržaj epruvete je promiješan na vrtložnoj miješalici (vorteksu), zatim su epruvete grijane oko 15 minuta u vrućoj kupelji sve dok se uzorak nije potpuno rastopio. Slijedila je inkubacija na sobnoj temperaturi pet minuta, nakon čega je u epruvete dodano 2 ml 96 %-tnog etanola uz miješanje na vorteksu. Zatim je dodano još 4 ml 96 %-tnog etanola, nakon čega se stvorio talog škroba, epruvete su stajale na sobnoj temperaturi 15 minuta. Epruvete su centrifugirane (2.000 g, 5 minuta), supernatant je odbačen, a epruvete su ocijeđene na filter papiru u trajanju od 10 minuta. Talogu škroba dodano je 2 ml DMSO, a nakon toga epruvete su stavljene u vruću kupelj na 15 minuta uz povremeno miješanje. Nakon kupelji dodano je 4 ml Con A otapala (konkanavalin A otopljen u natrij-acetatnom puferu), nakon miješanja sadržaj epruvete je profiltriran i prenesen u odmjerne tikvice volumena 25 ml te nadopunjen istim otapalom. Druga faza temelji se na Con A taloženju amilopektina i određivanje amiloze. Druga faza je izvedena zajedno s trećom koja uključuje određivanje ukupnoga škroba. Dodan je 1 ml otopine iz odmjernih tikvica u Eppendorf tubice volumena 2 ml i 0,50 ml Con A otopine uz miješanje. Tubice su inkubirane sat vremena na sobnoj temperaturi. Slijedilo je centrifugiranje na 14.000 g u trajanju od 10 minuta na temperaturi od 20°C. Količina od 1 ml supernatanta prenesena je u kivete volumena 15 ml i dodano je 3 ml 100 mM natrij-acetat pufera (pH 4,5) uz miješanje. Slijedilo je zagrijavanje u vodenoj kupelji pet minuta (denaturiranje Con A). Zatim je dodano 0,1 ml enzimske smjese amiloglukozidaza/α-amilaze, a kivete su inkubirane 30 minuta na 40°C. Slijedilo je centrifugiranje na 2.000 g u trajanju od pet minuta. Nakon toga je alikvotama od 1 ml dodano 4 ml GOPOD reagensa (smjesa glukoza oksidaze, peroksidaze i 4-aminoantipirina otopljene puferu (smjesa 1 M kalij-fosfatnog pufera (pH 7.4), ρ-hidroksibenzojevoj kiselini i natrijeva azida). Paralelno je na inkubaciju stavljena slijepa proba (smjesa 0,1 natrij-acetat pufera i GOPOD reagensa) i kontrolni uzorak 24


glukoze (0,1 ml standardne glukozne otopine (1mg/ml), 0,9 natrij-acetat pufera i GOPOD reagensa). Nakon inkubacije očitana je apsorbancija, na spektrofotometru Jenway 6300, na 510 nm svakog uzorka u odnosu na slijepu probu. Za izračunavanje sadržaja amiloze korištena je sljedeća formula:

amiloza% =

apsorbancija ConA supernatanta 6,15 * 100 × × apsorbancija alikvota za ukupni škrob 9,2 * 1

*Pri čemu su 6,15 i 9,2 faktori razrjeđenja za Con A i ukupni škrob.

4.3.2. Istraživanja genetske različitosti na razini DNA Istraživanja na DNA razini obavljena su u laboratoriju Odjela za istraživanje žitarica Poljoprivrednoga instituta mađarske akademije znanosti u Martonvàsàru (Mađarska) u suradnji sa dr. Ildikó Karsai.

4.3.2.1. Uzgoj klijanaca i izolacija genomske DNA Po sorti je uzgojeno 20 biljaka. Jedinke su uzgojene u plasteniku tijekom 20 dana gdje je temperatura održavana na 20°C, uz svjetlosni režim 12 sati osvjetljenja i 12 sati bez te uz zalijevanje svakih pet dana. Listovi biljaka prikupljeni su u fazi potpunog razvitka dva i početka razvoja trećega lista. Izdvajanje DNA iz listova provedeno je na 40 sorata ozime pšenice prema cetil-trimetilamonij-bromid (CTAB) metodi (Doyle i Doyle, 1987.) modificirano prema Grljušić, (2003.). Oko 100 mg svježe odrezanih listova biljnoga materijala odvagano je i stavljeno u tarionike, koji su prethodno ohlađeni tekućim dušikom. Listovi su zatim preliveni tekućim dušikom i samljeveni tučkom u fini prah. U svaki uzorak je zatim dodano 1000 µl 2% CTAB pufera (1M Tris-HCl pH 8.0; 0,5M Na2EDTA pH 8.0; 5M NaCl; 10% SDS), koji je prethodno ugrijan u vodenoj kupelji na 68°C. Sadržaj je izliven u pripremljene Eppendorf tubice koje su zatim vorteksirane i inkubirane u vodenoj kupelji 45 minuta uz povremeno okretanje rukom. Nakon inkubacije tubice su stavljene u posudu s ledom, svakom uzorku je dodano 670 µl 25


SEVAG-a (kloroform/izoamilni alkohol 24:1), a zatim je svaki uzorak protresen pojedinačno i stavljen na stalak za mućkanje u trajanju od 30 minuta. Slijedilo je centrifugiranje u trajanju od osam minuta na 14.000 okr/min i odvajanje tekuće od krute faze pipetiranjem u novi set tubica od dva mililitra, pri čemu je konačni volumen iznosio oko 750 µl. Zatim je u tekuću fazu dodano 16 µl RNAze, a uzorci su ostavljeni na sobnoj temperaturi 30 minuta uz lagano ručno okretanje tubica. U tubice je zatim dodano 650 µl 0,7 V hladnog izopropanola i ostavljene su stajati jedan sat. Tubice su centrifugirane u trajanju od jedne minute na 14.000 okr/min pri čemu se na dnu tubice pojavila bijela peleta. Nakon toga je izlivena tekuća faza i slijedilo je pranje pelete u 500 µl 0,2 mM natrij acetat u 76% alkoholu u trajanju od 30 minuta. Tubice su kratko centrifugirane dvije minute na 14.000 okr/min, a tekuća faza je izlivena. Zatim je postupak pranja pelete ponovljen u trajanju od 10 minuta, nakon čega su uzorci ponovo centrifugirani jednu minutu na 14.000 okr/min. Nakon izlijevanja tekuće faze pipetom je odstranjen višak etanola, a tubice su ostavljene otvorene u laminaru oko sat vremena. Nakon sušenja peletama je dodano 100 µl 1× TE pufera, pri čemu su se pelete otopile. Slijedilo je kratko centrifugiranje i uzorci izolirane genomske DNA su pohranjeni na -20 °C. Koncentracija DNA (Tablica 6) izmjerena je spektrofotometrom Thermo Scientific NanoDrop 2000 na sljedeći način. Od svakog uzorka je u pripremljene tubice odvojeno po 2 µl izolirane DNA, prilikom mjerenja korištene su dvije kontrole TE pufer i voda. Tablica 6. Koncentracije DNA, određene spektrofotometrom Thermo Scientific NanoDrop 2000® (uzorci od 1 do 40). 1

2

3

4

5

6

7

8

9

10

A

990,8

361,4

652,8

1232,2

1611,4

762,8

706

641,3

640,6

1798,1

B

448,2

633,3

975,9

743,1

706,7

773,8

732,8

1097,1

733

892

C

655,6

1523,1

1127,2

685

1527

831,2

1401,3

1288,6

953,2

1289,2

D

1360,6

1357,7

1195,6

1493,4

1778,4

1180,7

1474,5

1081

965,5

1124,4

26


Nakon provedenih mjerenja za svaki uzorak je određena potrebna količina DNA i TE pufera da bi se dobili radni uzorci za PCR reakcije. Kvaliteta izdvojene DNA provjerena je elektroforezom uspoređujući ju s lambda-DNA (Slika 2).

1

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16 17

18

19 20

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Slika 2. Kvaliteta izdvojene genomske DNA u usporedbi sa λ-DNA (foto original)

Za ispitivanje različitosti sorata na razini DNA korištene su dvije metode bazirane na PCR reakciji (lančana reakcija polimerazom): Metoda mikrosatelitnih markera i AFLP metoda.

4.3.2.2. Metoda mikrosatlitnih markera Korištene su sekvence parova mikrosatelitnih početnica koje su kreirali Marion Röder i suradnici u Leibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung (IPK) Gatersleben, Njemačka. Odabrane su prema literaturnim navodima Röder i sur. (1998.). Svojstva parova početnica za 19 mikrosatelitnih markera prikazani su u Tablici 7. Odabirom parova mikrosatelitnih početnica nastojalo se da svi genomi i kromosomi pšenice budu ravnomjerno zastupljeni. Genomi A i D su obuhvaćeni sa devet, a genom B sa sedam mikrosatelitnih markera.

27


Tablica 7. Svojstva parova početnica mikrosatelitnih početnica Mikrosatelit Lokus gwm*

Lijeva početnica

Desna početnica

Ta(°C) **

gwm2_1

3A

CTGCAAGCCTGTGATCAACT

CATTCTCAAATGATCGAACA

50

gwm2_2 gwm11 gwm55 gwm68_1 gwm68_2 gwm121_1 gwm121_2 gwm135 gwm149 gwm169 gwm186 gwm 257 gwm 261 gwm311_1 gwm311_2 gwm458 gwm497_1 gwm497_2 gwm497_3 gwm573_1 gwm573_2 gwm609 gwm610 gwm626 gwm 642

3D 1B 6D 5B 7B 5D 7D 1A 4B 6A 5A 2B 2D 2A 2D 1D 1A 2A 3D 7A 7B 4D 4A 6B 1D

CTGCAAGCCTGTGATCAACT GAATAGTCAGACATTTCTTGTG GCATCTGGTACACTAGCTGCC AGGCCAGAATCTGGGAATG AGGCCAGAATCTGGGAATG TCCTCTACAAACAAACACAC TCCTCTACAAACAAACACAC TGTCAACATCGTTTTGAAAAGG CATTGTTTTCTGCCTCTAGCC ACCACTGCAGAGAACACATACG GCAGAGCCTGGTTCAAAAAG AGAGTGCATGGTGGGACC CTCCCTGTACGCCTAAGGC TCACGTGGAAGACGCTCC TCACGTGGAAGACGCTCC AATGGCAATTGGAAGACATAGC GTAGTGAAGACAAGGGCATT GTAGTGAAGACAAGGGCATT GTAGTGAAGACAAGGGCATT AAGAGATAACATGCAAGAAA AAGAGATAACATGCAAGAAA GCGACATGACCATTTTGTTG CTGCCTTCTCCATGGTTTGT GATCTAAAATGTTATTTTCTCTC ACGGCGAGAAGGTGCTC

CATTCTCAAATGATCGAACA GTGAATTGTGTCTTGTATGTCTCC TCATGGATGCATCACATCCT3 CAACCCTCTTAATTTTGTTGGG CAACCCTCTTAATTTTGTTGGG CTCGCAACTAGAGGTGTATG CTCGCAACTAGAGGTGTATG ACACTGTCAACCTGGCAATG CTAGCATCGAACCTGAACAAG GTGCTCTGCTCTAAGTGTGGG CGCCTCTAGCGAGAGCTATG CCAAGACGATGCTGAAGTCA CTCGCGCTACTAGCCATTG CTACGTGCACCACCATTTTG CTACGTGCACCACCATTTTG TTCGCAATGTTGATTTGGC CCGAAAGTTGGGTGATATAC CCGAAAGTTGGGTGATATAC CCGAAAGTTGGGTGATATAC TTCAAATATGTGGGAACTAC TTCAAATATGTGGGAACT AC GATATTAAATCTCTCTATGTGTG AATGGCCAAAGGTTATGAAGG TGACTATCAGCTAAACGTGT CATGAAAGGCAAGTTCGTCA

50 50 60 60 60 50 50 60 55 60 60 60 55 60 60 60 55 55 55 50 50 50 60 50 60

*gwm: Gatersleben Wheat Microsatellites ** Ta(°C) = temperatura nalijeganja početnica

Amplifikacija je obavljena prema protokolu Röder i sur. (1998.), koji je prilagođen je za LICOR® Biosciences 4200 DNA Analyzer. Reakcijska smjesa sastojala se od amplifikacijskih reagensa, mikrosatelitnih početnica i genomske DNA, čije su koncentracije i volumeni navedeni u Tablici 8.

28


Tablica 8. Koncentracije i sastav reakcijske smjese za PCR amplifikaciju

Reakcijska smjesa PCR pufer MgCl2 dNTP mix (10×) M13-30 početnica * L-početnica D-početnica ** Taq polimeraza Genomska DNA dd H20 Total

Koncentracija stock 10 × 500 mM 2 mM 10 µl 10 µl 10 µl 5 U/µl 10 ng/µl -

final

Volumen po jednoj reakciji

1× 1,5 mM 0,2 mM 0,18 µl 0,2 µl 0,02 µl 0,05 U/µl 2,66 µl -

1,5 µl 0,045 µl 1,5 µl 0,27 µl 0,3 µl 0,03 µl 0,15 µl 3,99 µl 7,215 µl 15 µl

* korištena je sljedeća sekvenca početnice M13-30 5'CCCAGTCACGACGTTG 3' označena fluorescentnom bojom IRDye® 700CW ili IRDye® 800CW na 5' kraju radi detekcije na LI-COR-u ** D-početnica obilježena je sa M13-30 sekvencom na kraju 5'

Za PCR reakciju korišten je uređaj GeneAmp® Thermocycler 9700 prema sljedećem programu: 1. korak je bio 5 minuta na 94°; 2. korak je pet ciklusa po 45 sekundi na 95°C, 5 minuta na 68°C (-2°C po ciklusu) i 1 minuta na 72°C; 3. korak je pet ciklusa po 45 sekundi na 95°C, 2 minuta na 58°C (-2°C po ciklusu) i 1 minuta na 72°C; 4. korak je 27 ciklusa po 45 sekundi na 95°C, 75 sekundi na 45°C i 1 minuta na 72°C i završni 5. korak je trajao 10 minuta na 72°C.

3.3.2.3. AFLP metoda AFLP metodu je prvi puta je opisao Vos i sur. (1995.), patentirana je od strane Keygene (NL). Protokol za LI-COR® Biosciences 4200 DNA Analyzer prilagođen je prema dr. Lorenz Hartl, LBP-Freising, Njemačka. Metoda se sastoji od četiri faze. Prethodno se pripreme adapteri jednolančanih oligonukleotida (Tablica 9). Mse-oligonukleotid se razrijedi na koncentraciju od 500 µM, a Sse-oligonukleotid se razrijedi na koncentraciju od 50 µM.

29


Tablica 9. Adapteri jednolančanih oligonukleotida Smjesa za Mse-adapter ADAMse1 (500 µM) (5'GAC GAT GAG TCC TGA G'3) ADAMse2 (500 µM) (5'TAC TCA GGA CTC AT'3) H 2O Ukupno

6 µl 6 µl 48 µl 60 µl 50µM ADAMse

Smjesa za Sse-adapter ADASse1 (50 µM) (5'CTC GTA GAC TGC GTA CAT GCA'3) ADASse2 (50 µM) (5'TGT ACG CAG TCT AC'3) H 2O Ukupno

6 µl 6 µl 48 µl 60 µl 5µM ADASse

Prva faza je digestija genomske DNA. Korištene su restrikcijske endonukleaze tipa II Sse 8371I i MseI. Restrikcijska smjesa (Tablica 10) je inkubirana na 37°C u trajanju od 90 minuta.

Tablica 10. Koncentracija i volumen smjese za restrikciju Restrikcijska smjesa Genomske DNA

Volumen za jednu reakciju 0,25 µg

Sse8387I

2,5 jedinica

MseI

2,5 jedinica

BSA 10× restrikcijski pufer za Sse8387I H2O do ukupnog volumena od

0,01 % 2 µl (1×) 20 µl

Druga faza je ligacija adaptera. Količina od 5 µl ligacijske smjese (Tablica 11) dodana je u svaku tubicu u kojoj se nalazi restrikcijska smjesa, nakon čega je sve inkubirano na 37°C u trajanju od 180 minuta. Nakon inkubacije je slijedila provjera produkata ligacije, 5 µl uzorka naneseno je na 2% agarozni gel pri čemu se pojavio razmaz između 100 i 800 parova baza čime su se stvorili uvjeti za sljedeći korak. U preostalu ligacijsku smjesu (20 µl) dodano je 60 µl H2O, nakon čega je sve dobro promiješano. Navedena smjesa služi kao predložak za preselektivnu amplifikaciju. 30


Tablica 11. Koncentracija i volumen smjese za ligaciju Ligacijska smjesa

Volumen za jednu reakciju

ADASse (5 µM)

0,5 µl

ADAMse (50 µM)

0,5 µl

ATP (10 nM)

0,5 µl

10× restrikcijski pufer za Sse8387I

0,1 µl (1×)

T4 ligaza (1U/ µl)

1,0 µl

H 2O

2,0 µl

Ukupno

5,0 µl

Treća faza je pre-selektivna PCR amplifikacija bez odabranih nukleotida. U pre-selektivnoj smjesi (Tablica 12) odabrana početnica PreSse imala je sekvencu GTA GAC TGC GTA CAT GCA G, dok je početnica PreMse imala sekvencu GAT GAG TCC TGA GTA A. PCR amplifikacija odvijala se prema sljedećem programu: 1. korak je bio 2 minute na 72°; 2. korak je 20 ciklusa po 30 sekundi na 94°C, 60 sekundi na 60°C i 2 minute na 72°C. Slijedila je provjera PCR produkata, 5 µl uzorka naneseno je na 2% agarozni gel pri čemu se pojavio razmaz između 100 i 800 parova baza čime su se stvorili uvjeti za sljedeći korak. Preostala pre-selektivnu PCR amplifikacijsku smjesu (15 µl) se razrijedi sa 285 µl H2O. Ovih 300 µl služi kao predložak za selektivnu PCR amplifikaciju. Tablica 12. Koncentracije i volumen smjese za pre-selektivnu amplifikaciju Pre - selektivna smjesa

Volumen za jednu reakciju

PreSse - početnica (10 µM)

0,6 µl

PreMse - početnica (10 µM)

0,6 µl

dNTP (10 mM)

0,4 µl

10× PCR pufer

2,0 µl

MgCl2 (50 mM)

0,6 µl

Taq-polimeraza (5U/µl)

0,1 µl

Ligacijska DNA

5,0 µl

H 2O

10,7 µl

Ukupno

20,0 µl

31


Četvrta faza je selektivna PCR amplifikacija. U selekcijskoj smjesi (Tablica 13) korištena su četiri para početnica sa dva selektivna nukleotida u sljedećim kombinacijama: Tablica 13. Koncentracije i volumen smjese za selektivnu amplifikaciju Selektivna smjesa

Volumen za jednu reakciju

Sse - početnica (10 µM) (sa dva selektivna nukleotida i IRD 700/800)

0,2 µl

Mse - početnica (10 µM) (sa dva selektivna nukleotida)

0,6 µl

dNTP (10 mM)

0,4 µl

10× PCR pufer

2,0 µl

MgCl2 (50 mM)

0,6 µl

Taq-polimeraza (5U/µl)

0,1 µl

Preamplificirana DNA

3,0 µl

H 2O

13,1 µl

Ukupno

20,0 µl

U prvoj reakciji korišten je prvi par početnica, Sse početnica sekvence GAC TGC GTA CAT GCA GG TC koja je obilježena sa IRDye® 700CW i Mse početnica sekvence GAT GAG TCC TGA GTA A AT. U drugoj reakciji korišten je drugi par početnica, Sse obilježena IRDye® 800CW iste sekevence, ali sa nukleotidnim nastavkom GC te Mse početnica obilježena sa nukleotidnim nastavkom AT. U trećoj reakciji korišten je treći par, Sse početnica obilježena sa IRDye® 700CW i nukleotidnim nastavkom TC te Mse početnica obilježena sa nukleotidnim nastavkom GA. U posljednjoj reakciji korišten je četvrti par početnica, Sse obilježena s IRDye® 800CW i nukleotidnim nastavkom GC i početnica Mse sa nukleotidnim nastavkom GA. Amplifikacija je obavljena prema sljedećem programu na PCR uređaju GeneAmp® Thermocycler 9700: 1. korak je bio 2 minute na 94°; 2. korak je 10 ciklusa po 30 sekundi na 94°C, 30 sekundi na 63°C (-1°C po ciklusu do 54°C) i 2 minuta na 72°C i 3. korak je 23 ciklusa po 30 sekundi na 94°C, 30 sekundi na 54°C i 2 minute na 72°C.

32


4.3.2.4. Elektroforeza Produkti SSR i AFLP amplifikacije su naneseni na 6% poliakrilamidni gel koristeći LI-COR 4300 analyzer u 10× TBE (TRIS, borna kiselina, 0,5M Na2EDTA) puferu. Gel je bio veličine 25 cm, debljine 0,25 mm, a za 6% akrilamid potrebno je bilo: 10,5 g uree, 25ml H2O, 2,5 ml 10×TBE pufera, 3,6 ml 40% akrilamida, 250 µl DMSO (dimetil sulfoksid), 175 µl 10% APS (amonij persulfat) i 25 µl TEMED (tetrametil etilendiamine). Kao standardi za utvrđivanje duljiine mikrosatelitnih početnica i korišteni su IRDye® 350CW, a za dužine AFLP fragmenata IRDye® 700CW i IRDye® 800CW obilježeni markeri. Za izradu binarne matrice podataka (postojanje fragmenta (1) ili nepostojanje fragmenta (0)) na temelju mikrosatelitne i AFLP analize obavljena je ocjena fotografija (Slika 3). Za mikrosatelite je korišten SAGAGT genotyping software program ver 3.2. razvijen od strane LI-COR® Biosciences Saga unix 1.0 (Unix), a za AFLP analizu korišten je Kodak® 1D v.3.6.4 Scientific imaging system.

Slika 3. Mikrosatelit gwm251 na 40 genotipova pšenice. (foto original)

33


4.4. Statistička obrada podataka Statistička analiza dobivenih rezultata istraživanja obuhvatila je obradu agronomskih, morfoloških i molekularnih podataka. 4.4.1. Statistička obrada kvantitativnih agronomskih podataka Podatke za statističku obradu agronomskih svojstava činili su: a) Srednje vrijednosti sljedećih pojedinačnih mjerenja: visina biljke do klasa, duljina klasa, broj biljaka po m2, broja klasića po klasu i broja zrna po klasu. b) Srednje vrijednosti cijele obračunske parcele sljedećih svojstava: masa 1000 zrna, hektolitarska masa, urod, količina bjelančevina i količina škroba u zrnu. Dobivene vrijednosti su sistematizirane po godinama, izračunat je koeficijent varijabilnosti za svako svojstvo i po godinama kao relativni pokazatelj varijabilnosti analiziranih svojstava. Agronomska svojstva statistički su analizirana analizom varijance (ANOVA), genotipovi su međusobno uspoređeni za svako svojstvo Fisher-ovim LSD testom (na razini p<0,05 i p<0,01), koristeći SAS Software 9.1.3 (2002.-2003.).

4.4.2. Statistička obrada morfoloških podataka Osnovne podatke za statističku obradu činilo je 10 morfoloških svojstava: tip busanja, vrijeme klasanja, voštana prevlaka na rukavcu, voštanost klasa, visina biljka, zbijenost klasa, duljina klasa, prisutnost osja ili produžetak pljevica, boja klasa i boja zrna. Na osnovu dobivenih vrijednosti napravljena je standardizirana matrica na osnovu koje je izračunata genetska sličnost. Genetska sličnost je dobivena između svakog para genotipova i i j za morfološka marker svojstva koristeći Rogers i Tanimoto (RT) koeficijent (Rogers i Tanimoto, 1960.).

gdje je n11 = broj mjesta gdje je postojanje svojstva prisutno u oba genotipa, n00 = broj

mjesta gdje nije prisutno svojstvo u oba genotipa i n01 ili n10 = broj mjesta na kojima se

34


genotipovi razlikuju. Sličnosti su izračunate koristeći NTSYS ver.2.2. programa (Rohlf, 2009.). Matrice dobivene na temelju morfoloških podataka korištene su za izradu UPGMA.

4.4.3. Statistička obrada molekularnih podataka Podatke za obradu molekularnih podataka čine: 1. sastav visokomolekularnih podjedinica glutenina (HMW GS) 2. sastav škroba (količina amiloze i amilopektina te omjer amiloze i amilopektina) 3. mikrosatelitni markeri 4. AFLP markeri 1. SDS PAGE metodom utvrđene su HMW GS, izolirane iz 16 genotipova pšenice, podaci za ostale genotipove prikupljeni su iz literaturnih podataka (Horvat i sur., 2006.; Bekes i sur., 2006. http://www.aaccnet.org/grainbin/gluten_gliadin.asp). Izračunat je genetski varijacijski koeficijent prema Nei (1973.):

Prema postojanju alela na gluteninskom lokusu izrađena je binarna matrica na temelju koje je izračunata genetska sličnost prema Jaccard (1908.):

i izrađen je UPGMA dendogram. 2. Dobivene vrijednosti sastava škroba su sistematizirane prema količini amiloze i amilopektina po genotipovima te je izračunat koeficijent varijabilnosti. Dobivene postotne vrijednosti amiloze i amilopektina (Am/Amp) transformirane su u omjer. Dobiveni omjeri Am/Amp statistički su analizirani analizom varijance (ANOVA), genotipovi su međusobno uspoređeni Fisher-ovim LSD testom (na razini p<0,05 i p<0,01), koristeći SAS Software 9.1.3 (2002.-2003.). 35


3. Genetska različitost i polimorfnost mikrosatelitnih markera analizirana je na temelju ukupnog i prosječnog broja alela po markeru (Na) te je procijenjen polimorfizam (PIC) za svaki mikrosatelitni lokus (Botstein i sur., 1980.):

gdje su

učestalost i-tog i j-tog alela na lokusu s I ukupnim brojem alela u populaciji.

Vrijednost PIC-a se koristi kao mjerilo alelne različitosti koja pokazuje vjerojatnost da će genotip potomstva biti korišten kako bi saznali od kojeg roditelja potječu pojedini aleli. Genska različitost (HE) ili očekivana heterozigotnost (Nei, 1973.) procijenjena je za svaki mikrosatelitni marker koristeći formulu:

gdje pi predstavlja učestalost alela i, a I ukupni broj alela. Genska različitost predstavlja

vjerojatnost da su dva nasumično odabrana alela nakon jedne generacije slučajne oplodnje iz

populacije međusobno različita. Navedeni parametri izračunati su koristeći program Powermarker (Liu, 2002.). Binarne matrice alelnih frekvencija dobivene na temelju molekularnih podataka, korištene su za izračunavanje Rogers-ove udaljenosti (

(Rogers, 1972.):

gdje su yisg i yjsg frekvencije alela g na marker lokusu s za varijetet i i j, a S je ukupan broj

lokusa. Matrice udaljenosti su zatim korištene za izradu dendograma koristeći UPGMA metodu. 4. Za svaku kombinaciju AFLP markera utvrđen je broj polimorfnih fragmenata (npi) te je

procijenjen i polimorfizam (PIC) i genska različitost (He) za svaku kombinaciju. Binarne matrice su korištene za izračun koeficijenta genetske sličnosti (Sij) prema Dice (1945.): 36


gdje je Nij broj fragmenata prisutnih u oba genotipa i i j, Ni je broj fragmenata prisutan u genotipu i, a Nj je broj prisutan u genotipu j. Matrice na temelju sličnosti korištene za izradu

dendograma koristeći UPGMA metodu.

Kombinirana matrice na osnovu molekularnih mikrosatelitnih i AFLP podataka (svi aleli su svedeni na binarnu matricu) korištena je za analizu molekularne varijance (AMOVA Excoffier i sur., 1992.) kako bi se utvrdila genotipska varijanca između i unutar ispitivanih setova ozime pšenice. Za izračunavanje molekularne varijance korišten je program ARLEQUIN ver.2.0. (Schneider i sur., 2000.).

4.4.4. Utvrđivanje ispravnosti i podudarnosti matrica Matrice udaljenosti na osnovu različitih tipova podataka o ispitivanim genotipovima su uspoređene kako bi se utvrdila razlika između dobivenih rezultata. Usporedba je provedena koristeći Mantelov test značajnosti i podudarnosti matrica (Mantel, 1967.) prema formuli:

gdje su Xij i Yij elementi ispod dijagonale matrica X i Y. Značajnost Z je bila određena uspoređivanjem vrijednosti Z sa raspodjelom vrijednosti Z nakon 1 000 permutacija.

37


5. REZULTATI ISTRAŽIVANJA 5.1. Procjena različitosti ispitivanih genotipova na temelju agronomskih podataka Analizom varijance utvrđene su statistički opravdane razlike na razini od p<0,01 za sva ispitivana agronomska svojstva između genotipova kroz dvije vegetacijske godine 2007./2008. i 2008./2009. te u dvogodišnjem prosjeku. 5.1.1. Varijabilnost visine biljke Analizom rezultata mjerenja visine biljke u provedenom istraživanju utvrđene su statistički opravdane razlike (p<0,01) između ispitivanih genotipova kako po godinama istraživanja, tako i u prosjeku dvije godine. Između ponavljanja nije bilo statistički značajnih razlika, dok su utvrđena statistički opravdana međuzavisnost (p<0,01) genotipa i godine (Tablica 14).

Tablica 14. Analiza varijance za svojstvo visine biljke Izvor variranja Genotip Godina Ponavljanje Genotip × godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Prosječne vrijednosti (Tablica 15) visine biljke pšenice su se u 2008. godini kretale od 64,92 cm (Srpanjka) do 153,32 cm (U1), u 2009. od 60,47 cm (Srpanjka) do 132,47 cm (U1). U gotovo svih genotipova (osim Žitarke i Super Žitarke) izmjerena je viša stabljika u 2008., nego u 2009. godini. Genotip U1 imao je statistički visoko opravdano višu stabljiku u odnosu na sve ostale ispitivane genotipove u dvogodišnjem prosjeku (Tablica 16). Genotipovi Antonius i Ludwig slijede po visini sa 114,03 cm i 112,65 cm između kojih nema statistički opravdane razlike, ali su statistički visoko značajno viši od 37 ispitivanih genotipova. U genotipovima: Bezostaja, Valerius, Divana, Edison, Eurofit i Ilirija visina stabljike kretala se od 108,69 do 103,47 cm te između njih nema statistički opravdane razlike. Visina stabljike je najviše varirala u genotipa Antonius (14,13%), a najmanje u genotipa Super Žitarka (0,88%). Koeficijent varijacije ovoga svojstva u 2008. godini bio je najviši (18,92%), u 2009. iznosio je 17,%, dok je u dvogodišnjem prosjeku nešto niži nego u prvoj godini poljskoga pokusa (18,44%). 38


Tablica 15. Prosječna visina biljke (cm) ispitivanih genipova Red. Br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 151,28 95,25 84,37 84,04 76,31 67,32 79,11 83,55 80,75 74,99 91,15 74,59 105,16 78,36 71,48 74,24 71,29 81,37 88,99 86,77 85,95 87,96 79,19 85,87 77,41 82,29 91,33 91,24 112,45 104,25 116,09 93,95 90,12 88,05 116,04 120,20 80,60 114,95 107,31 115,12 18,92 165,07 3,691 4,895

2009. 132,47 92,35 78,63 76,40 78,57 60,47 77,27 83,55 76,25 68,33 81,84 71,69 101,79 73,29 63,00 72,23 66,95 79,24 80,47 83,04 78,25 84,98 73,03 77,95 74,17 79,03 84,81 82,53 102,84 92,67 101,28 89,19 80,04 83,49 101,19 105,09 80,64 99,37 104,52 112,93 17,13 174,06 3,027 4,015

2008./2009. 141,87 93,80 81,50 80,22 77,44 63,89 78,19 83,55 78,50 71,66 86,49 73,14 103,47 75,83 67,24 73,23 69,12 80,31 84,73 84,91 82,10 86,47 76,11 81,91 75,79 80,66 88,07 86,89 107,65 98,46 108,69 91,57 85,08 85,77 108,61 112,65 80,62 107,16 105,91 114,03 18,44 85,40 2,449 3,248 39


40

6 15 17 10 12 16 25 14 23 5 7 9 4 18 37 26 3 24 21 8 19 20 33 34 22 11 28 27 32 2 30 13 39 38 29 35 31 36

114,03 40 141,87 1

63,89 67,24 69,12 71,66 73,14 73,23 75,79 75,83 76,11 77,44 78,19 78,50 80,22 80,31 80,62 80,66 81,50 81,91 82,10 83,55 84,73 84,91 85,08 85,77 86,47 86,49 86,89 88,07 91,57 93,80 98,46 103,47 105,91 107,16 107,65 108,61 108,69 112,65

27,84 0,00

0,00

opravdane razlike p<0,05

141,87 114,03 112,65 108,69 108,61 107,65 107,16 105,91 103,47 98,46 93,80 91,57 88,07 86,89 86,49 86,47 1 40 36 31 35 29 38 39 13 30 2 32 27 28 11 22 77,98 50,13 48,75 44,79 44,72 43,75 43,27 42,02 39,58 34,57 29,91 27,67 24,18 22,99 22,60 22,58 74,63 46,79 45,41 41,45 41,37 40,41 39,92 38,67 36,23 31,22 26,56 24,33 20,83 19,65 19,25 19,23 72,75 44,91 43,53 39,57 39,49 38,53 38,04 36,79 34,35 29,34 24,68 22,45 18,95 17,77 17,37 17,35 70,21 42,37 40,99 37,03 36,95 35,99 35,50 34,25 31,81 26,80 22,14 19,91 16,41 15,23 14,83 14,81 68,73 40,89 39,51 35,55 35,47 34,51 34,02 32,77 30,33 25,32 20,66 18,43 14,93 13,75 13,35 13,33 68,64 40,80 39,42 35,46 35,38 34,42 33,93 32,68 30,24 25,23 20,57 18,34 14,84 13,66 13,26 13,24 66,08 38,24 36,86 32,90 32,82 31,86 31,37 30,12 27,68 22,67 18,01 15,78 12,28 11,10 10,70 10,68 66,04 38,20 36,82 32,86 32,78 31,82 31,33 30,08 27,64 22,63 17,97 15,74 12,24 11,06 10,66 10,64 65,76 37,92 36,54 32,58 32,50 31,54 31,05 29,80 27,36 22,35 17,69 15,46 11,96 10,78 10,38 10,36 64,43 36,59 35,21 31,25 31,17 30,21 29,72 28,47 26,03 21,02 16,36 14,13 10,63 9,45 9,05 9,03 63,68 35,84 34,46 30,50 30,42 29,46 28,97 27,72 25,28 20,27 15,61 13,38 9,88 8,70 8,30 8,28 63,37 35,53 34,15 30,19 30,11 29,15 28,66 27,41 24,97 19,96 15,30 13,07 9,57 8,39 7,99 7,97 61,65 33,81 32,43 28,47 28,39 27,43 26,94 25,69 23,25 18,24 13,58 11,35 7,85 6,67 6,27 6,25 61,56 33,72 32,34 28,38 28,30 27,34 26,85 25,60 23,16 18,15 13,49 11,26 7,76 6,58 6,18 6,16 61,25 33,41 32,03 28,07 27,99 27,03 26,54 25,29 22,85 17,84 13,18 10,95 7,45 6,27 5,87 5,85 61,21 33,37 31,99 28,03 27,95 26,99 26,50 25,25 22,81 17,80 13,14 10,91 7,41 6,23 5,83 5,81 60,37 32,53 31,15 27,19 27,11 26,15 25,66 24,41 21,97 16,96 12,30 10,07 6,57 5,39 4,99 4,97 59,96 32,12 30,74 26,78 26,70 25,74 25,25 24,00 21,56 16,55 11,89 9,66 6,16 4,98 4,58 4,56 59,77 31,93 30,55 26,59 26,51 25,55 25,06 23,81 21,37 16,36 11,70 9,47 5,97 4,79 4,39 4,37 58,32 30,48 29,10 25,14 25,06 24,10 23,61 22,36 19,92 14,91 10,25 8,02 4,52 3,34 2,94 2,92 57,14 29,30 27,92 23,96 23,88 22,92 22,43 21,18 18,74 13,73 9,07 6,84 3,34 2,16 1,76 1,74 56,96 29,12 27,74 23,78 23,70 22,74 22,25 21,00 18,56 13,55 8,89 6,66 3,16 1,98 1,58 1,56 56,79 28,95 27,57 23,61 23,53 22,57 22,08 20,83 18,39 13,38 8,72 6,49 2,99 1,81 1,41 1,39 56,10 28,26 26,88 22,92 22,84 21,88 21,39 20,14 17,70 12,69 8,03 5,80 2,30 1,12 0,72 0,70 55,40 27,56 26,18 22,22 22,14 21,18 20,69 19,44 17,00 11,99 7,33 5,10 1,60 0,42 0,02 0,00 55,38 27,54 26,16 22,20 22,12 21,16 20,67 19,42 16,98 11,97 7,31 5,08 1,58 0,40 0,00 54,98 27,14 25,76 21,80 21,72 20,76 20,27 19,02 16,58 11,57 6,91 4,68 1,18 0,00 53,80 25,96 24,58 20,62 20,54 19,58 19,09 17,84 15,40 10,39 5,73 3,50 0,00 50,30 22,46 21,08 17,12 17,04 16,08 15,59 14,34 11,90 6,89 2,23 0,00 48,07 20,23 18,85 14,89 14,81 13,85 13,36 12,11 9,67 4,66 0,00 43,41 15,57 14,19 10,23 10,15 9,19 8,70 7,45 5,01 0,00 38,40 10,56 9,18 5,22 5,14 4,18 3,69 2,44 0,00 35,96 8,12 6,74 2,78 2,70 1,74 1,25 0,00 34,71 6,87 5,49 1,53 1,45 0,49 0,00 34,22 6,38 5,00 1,04 0,96 0,00 33,26 5,42 4,04 0,08 0,00 33,18 5,34 3,96 0,00 29,22 1,38 0,00 visoko opravdane razlike p<0,01

Tablica 16. Rezultati LSD testa za visinu biljke 85,77 34 21,88 18,53 16,65 14,11 12,63 12,54 9,98 9,94 9,66 8,33 7,58 7,27 5,55 5,46 5,15 5,11 4,27 3,86 3,67 2,22 1,04 0,86 0,69 0,00

84,91 20 21,01 17,67 15,79 13,25 11,77 11,68 9,12 9,08 8,80 7,47 6,72 6,41 4,69 4,60 4,29 4,25 3,41 3,00 2,81 1,36 0,18 0,00

LSD0,01 = 3,248

LSD0,05 = 2,449

F test =85,40 **

85,08 33 21,19 17,84 15,96 13,42 11,94 11,85 9,29 9,25 8,97 7,64 6,89 6,58 4,86 4,77 4,46 4,42 3,58 3,17 2,98 1,53 0,35 0,17 0,00

84,73 19 20,83 17,49 15,61 13,07 11,59 11,50 8,94 8,90 8,62 7,29 6,54 6,23 4,51 4,42 4,11 4,07 3,23 2,82 2,63 1,18 0,00

83,55 8 19,65 16,31 14,43 11,89 10,41 10,32 7,76 7,72 7,44 6,11 5,36 5,05 3,33 3,24 2,93 2,89 2,05 1,64 1,45 0,00

82,10 21 18,21 14,86 12,98 10,44 8,96 8,87 6,31 6,27 5,99 4,66 3,91 3,60 1,88 1,79 1,48 1,44 0,60 0,19 0,00

81,91 24 18,01 14,67 12,79 10,25 8,77 8,68 6,12 6,08 5,80 4,47 3,72 3,41 1,69 1,60 1,29 1,25 0,41 0,00

81,50 3 17,61 14,26 12,38 9,84 8,36 8,27 5,71 5,67 5,39 4,06 3,31 3,00 1,28 1,19 0,88 0,84 0,00

80,66 26 16,77 13,42 11,54 9,00 7,52 7,43 4,87 4,83 4,55 3,22 2,47 2,16 0,44 0,35 0,04 0,00

80,31 18 16,41 13,07 11,19 8,65 7,17 7,08 4,52 4,48 4,20 2,87 2,12 1,81 0,09 0,00

19 Zlatna_dolina 20 Golubica

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

80,22 78,50 78,19 77,44 76,11 75,83 75,79 73,23 73,14 71,66 69,12 67,24 63,89 4 9 7 5 23 14 25 16 12 10 17 15 6 16,33 14,61 14,29 13,55 12,21 11,93 11,90 9,34 9,25 7,77 5,23 3,35 0,00 12,98 11,26 10,95 10,20 8,87 8,59 8,55 5,99 5,90 4,42 1,88 0,00 11,10 9,38 9,07 8,32 6,99 6,71 6,67 4,11 4,02 2,54 0,00 8,56 6,84 6,53 5,78 4,45 4,17 4,13 1,57 1,48 0,00 7,08 5,36 5,05 4,30 2,97 2,69 2,65 0,09 0,00 6,99 5,27 4,96 4,21 2,88 2,60 2,56 0,00 4,43 2,71 2,40 1,65 0,32 0,04 0,00 4,39 2,67 2,36 1,61 0,28 0,00 4,11 2,39 2,08 1,33 0,00 2,78 1,06 0,75 0,00 2,03 0,31 0,00 1,72 0,00 0,00

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

80,62 37 16,73 13,38 11,50 8,96 7,48 7,39 4,83 4,79 4,51 3,18 2,43 2,12 0,40 0,31 0,00


5.1.2. Varijabilnost broja biljaka po jedinici površine U provedenom istraživanju utvrđene su statistički opravdane razlike (p<0,01) između ispitivanih genotipova po godinama istraživanja i u dvogodišnjem prosjeku za svojstvo broja biljaka po jedinici površine (m2), dok između ponavljanja nije bilo statistički opravdanih razlika. Utvrđenaje statistički opravdana međuzavisnost (p<0,01) genotipa i godine (Tablica 17). Tablica 17. Analiza varijance za svojstvo broja biljaka po jedinici površine (m2) Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Broj biljaka po jedinici površine u 2008. godini kretao se od 209,67 (Alka) do 121,33 (Edison) biljaka/m2. Ova dva genotipa imala su i u 2009. te u dvogodišnjem prosjeku najveći i najmanji broj biljaka po jedinici površine (Tablica 18). Koeficijent varijacije u 2008. godini iznosio je 13,63%, u 2009. je bio veći i iznosio je 14,44%, dok je u dvogodišnjem prosjeku iznosio 15,07%. Genotip Alka imao je statistički visoko opravdano veći broj biljaka/m2 u odnosu na 35 ispitivanih genotipova (Tablica 19). U odnosu na genotipove Adrianu (190,17) i Osječku crvenku (189,67) utvrđen je statistički opravdano veći broj biljaka/m2, a u odnosu na genotipove Srpanjka (197,17) i Renata (196,00) nema statistički opravdane razlike u broju biljaka po jedinici površine. Statistički visoko opravdano manji broj biljaka/m2 u odnosu na sve ispitivane genotipove utvrđen je u genotipa Edison. Slijede genotipovi Anđelka, BC Patria, Golubica, U1, Katarina, Eurofit i Mihaela između kojih nije bilo statistički opravdanih razlika u broju biljaka po jedinici površine. Obzirom na dvogodišnji prosjek svojstvo broja biljaka po jedinici površine najviše je variralo u genotipa Seka (19,57%), a najmanje u genotipa Žitarka (3,99%).

41


Tablica 18. Prosječne vrijednosti broja biljaka po jedinici površine ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 153,00 202,33 163,67 164,67 178,00 209,33 199,00 182,00 195,33 199,67 166,00 184,33 168,33 165,67 202,33 186,33 155,00 132,33 153,33 160,67 152,67 149,67 148,00 209,67 198,67 159,33 159,33 207,00 159,00 168,67 162,00 143,33 162,67 194,67 156,33 167,67 174,67 121,33 160,33 182,33 13,63 11,48 17,694 23,466

2009. 126,67 177,00 153,67 154,33 173,33 184,67 166,67 152,33 158,00 192,33 147,00 166,33 138,33 131,33 142,00 146,33 129,67 133,33 136,33 118,33 143,33 147,00 134,67 197,33 138,67 148,00 134,33 173,33 129,67 146,33 139,33 127,00 153,00 174,33 134,33 152,00 172,00 113,00 124,00 136,33 14,44 13,52 15,136 20,075

2008./2009. 139,83 189,67 158,67 159,50 175,67 197,17 182,83 167,17 176,67 196,00 156,50 175,33 153,33 148,50 172,17 166,33 142,33 132,83 144,83 139,50 148,00 148,33 141,33 203,33 168,67 153,67 146,83 190,17 144,33 157,50 150,67 135,17 157,83 184,50 145,33 159,83 173,33 117,17 142,17 159,33 15,07 9,85 10,955 14,529 42


43

86,16 70,50 68,16 63,83 63,50 62,00 61,16 61,00 59,00 58,50 58,00 56,50 55,33 55,00 54,83 52,66 50,00 49,66 46,83 45,83 45,50 44,66 44,00 43,83 43,50 37,00 36,16 34,66 31,16 30,00 28,00 27,66 26,66 20,50 18,83 13,66 13,16 7,33

6,16 0,00

38 18 32 20 1 23 39 17 29 19 35 27 21 22 14 31 13 26 11 30 33 3 40 4 36 16 8 25 15 37 12 5 9 7 34 2 28 10

197,17 6 203,33 24

117,17 132,83 135,17 139,50 139,83 141,33 142,17 142,33 144,33 144,83 145,33 146,83 148,00 148,33 148,50 150,67 153,33 153,67 156,50 157,50 157,83 158,67 159,33 159,50 159,83 166,33 167,17 168,67 172,17 173,33 175,33 175,67 176,67 182,83 184,50 189,67 190,17 196,00

0,00

80,00 64,34 62,00 57,67 57,34 55,84 55,00 54,84 52,84 52,34 51,84 50,34 49,17 48,84 48,67 46,50 43,84 43,50 40,67 39,67 39,34 38,50 37,84 37,67 37,34 30,84 30,00 28,50 25,00 23,84 21,84 21,50 20,50 14,34 12,67 7,50 7,00 1,17

78,83 63,17 60,83 56,50 56,17 54,67 53,83 53,67 51,67 51,17 50,67 49,17 48,00 47,67 47,50 45,33 42,67 42,33 39,50 38,50 38,17 37,33 36,67 36,50 36,17 29,67 28,83 27,33 23,83 22,67 20,67 20,33 19,33 13,17 11,50 6,33 5,83 0,00

73,00 57,34 55,00 50,67 50,34 48,84 48,00 47,84 45,84 45,34 44,84 43,34 42,17 41,84 41,67 39,50 36,84 36,50 33,67 32,67 32,34 31,50 30,84 30,67 30,34 23,84 23,00 21,50 18,00 16,84 14,84 14,50 13,50 7,34 5,67 0,50 0,00

72,50 56,84 54,50 50,17 49,84 48,34 47,50 47,34 45,34 44,84 44,34 42,84 41,67 41,34 41,17 39,00 36,34 36,00 33,17 32,17 31,84 31,00 30,34 30,17 29,84 23,34 22,50 21,00 17,50 16,34 14,34 14,00 13,00 6,84 5,17 0,00

67,33 51,67 49,33 45,00 44,67 43,17 42,33 42,17 40,17 39,67 39,17 37,67 36,50 36,17 36,00 33,83 31,17 30,83 28,00 27,00 26,67 25,83 25,17 25,00 24,67 18,17 17,33 15,83 12,33 11,17 9,17 8,83 7,83 1,67 0,00

65,66 50,00 47,66 43,33 43,00 41,50 40,66 40,50 38,50 38,00 37,50 36,00 34,83 34,50 34,33 32,16 29,50 29,16 26,33 25,33 25,00 24,16 23,50 23,33 23,00 16,50 15,66 14,16 10,66 9,50 7,50 7,16 6,16 0,00

59,50 43,84 41,50 37,17 36,84 35,34 34,50 34,34 32,34 31,84 31,34 29,84 28,67 28,34 28,17 26,00 23,34 23,00 20,17 19,17 18,84 18,00 17,34 17,17 16,84 10,34 9,50 8,00 4,50 3,34 1,34 1,00 0,00

58,50 42,84 40,50 36,17 35,84 34,34 33,50 33,34 31,34 30,84 30,34 28,84 27,67 27,34 27,17 25,00 22,34 22,00 19,17 18,17 17,84 17,00 16,34 16,17 15,84 9,34 8,50 7,00 3,50 2,34 0,34 0,00

56,16 40,50 38,16 33,83 33,50 32,00 31,16 31,00 29,00 28,50 28,00 26,50 25,33 25,00 24,83 22,66 20,00 19,66 16,83 15,83 15,50 14,66 14,00 13,83 13,50 7,00 6,16 4,66 1,16 0,00

55,00 39,34 37,00 32,67 32,34 30,84 30,00 29,84 27,84 27,34 26,84 25,34 24,17 23,84 23,67 21,50 18,84 18,50 15,67 14,67 14,34 13,50 12,84 12,67 12,34 5,84 5,00 3,50 0,00

51,50 35,84 33,50 29,17 28,84 27,34 26,50 26,34 24,34 23,84 23,34 21,84 20,67 20,34 20,17 18,00 15,34 15,00 12,17 11,17 10,84 10,00 9,34 9,17 8,84 2,34 1,50 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

58,16 42,50 40,16 35,83 35,50 34,00 33,16 33,00 31,00 30,50 30,00 28,50 27,33 27,00 26,83 24,66 22,00 21,66 18,83 17,83 17,50 16,66 16,00 15,83 15,50 9,00 8,16 6,66 3,16 2,00 0,00

50,00 34,34 32,00 27,67 27,34 25,84 25,00 24,84 22,84 22,34 21,84 20,34 19,17 18,84 18,67 16,50 13,84 13,50 10,67 9,67 9,34 8,50 7,84 7,67 7,34 0,84 0,00

49,16 33,50 31,16 26,83 26,50 25,00 24,16 24,00 22,00 21,50 21,00 19,50 18,33 18,00 17,83 15,66 13,00 12,66 9,83 8,83 8,50 7,66 7,00 6,83 6,50 0,00

42,66 27,00 24,66 20,33 20,00 18,50 17,66 17,50 15,50 15,00 14,50 13,00 11,83 11,50 11,33 9,16 6,50 6,16 3,33 2,33 2,00 1,16 0,50 0,33 0,00

42,33 26,67 24,33 20,00 19,67 18,17 17,33 17,17 15,17 14,67 14,17 12,67 11,50 11,17 11,00 8,83 6,17 5,83 3,00 2,00 1,67 0,83 0,17 0,00

41,50 25,84 23,50 19,17 18,84 17,34 16,50 16,34 14,34 13,84 13,34 11,84 10,67 10,34 10,17 8,00 5,34 5,00 2,17 1,17 0,84 0,00

LSD0,01 = 14,529

LSD0,05 =10,955

F test =9,85 **

42,16 26,50 24,16 19,83 19,50 18,00 17,16 17,00 15,00 14,50 14,00 12,50 11,33 11,00 10,83 8,66 6,00 5,66 2,83 1,83 1,50 0,66 0,00

40,66 25,00 22,66 18,33 18,00 16,50 15,66 15,50 13,50 13,00 12,50 11,00 9,83 9,50 9,33 7,16 4,50 4,16 1,33 0,33 0,00

40,33 24,67 22,33 18,00 17,67 16,17 15,33 15,17 13,17 12,67 12,17 10,67 9,50 9,17 9,00 6,83 4,17 3,83 1,00 0,00

39,33 23,67 21,33 17,00 16,67 15,17 14,33 14,17 12,17 11,67 11,17 9,67 8,50 8,17 8,00 5,83 3,17 2,83 0,00

36,50 20,84 18,50 14,17 13,84 12,34 11,50 11,34 9,34 8,84 8,34 6,84 5,67 5,34 5,17 3,00 0,34 0,00

36,16 20,50 18,16 13,83 13,50 12,00 11,16 11,00 9,00 8,50 8,00 6,50 5,33 5,00 4,83 2,66 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

33,50 31,33 31,16 30,83 29,66 28,16 27,66 27,16 25,16 25,00 24,16 22,66 22,33 18,00 15,66 17,84 15,67 15,50 15,17 14,00 12,50 12,00 11,50 9,50 9,34 8,50 7,00 6,67 2,34 0,00 15,50 13,33 13,16 12,83 11,66 10,16 9,66 9,16 7,16 7,00 6,16 4,66 4,33 0,00 11,17 9,00 8,83 8,50 7,33 5,83 5,33 4,83 2,83 2,67 1,83 0,33 0,00 10,84 8,67 8,50 8,17 7,00 5,50 5,00 4,50 2,50 2,34 1,50 0,00 9,34 7,17 7,00 6,67 5,50 4,00 3,50 3,00 1,00 0,84 0,00 8,50 6,33 6,16 5,83 4,66 3,16 2,66 2,16 0,16 0,00 8,34 6,17 6,00 5,67 4,50 3,00 2,50 2,00 0,00 6,34 4,17 4,00 3,67 2,50 1,00 0,50 0,00 5,84 3,67 3,50 3,17 2,00 0,50 0,00 5,34 3,17 3,00 2,67 1,50 0,00 3,84 1,67 1,50 1,17 0,00 2,67 0,50 0,33 0,00 2,34 0,17 0,00 2,17 0,00 0,00

0,00

203,33 197,17 196,00 190,17 189,67 184,50 182,83 176,67 175,67 175,33 173,33 172,17 168,67 167,17 166,33 159,83 159,50 159,33 158,67 157,83 157,50 156,50 153,67 153,33 150,67 148,50 148,33 148,00 146,83 145,33 144,83 144,33 142,33 142,17 141,33 139,83 139,50 135,17 132,83 117,17 24 6 10 28 2 34 7 9 5 12 37 15 25 8 16 36 4 40 3 33 30 11 26 13 31 14 22 21 27 35 19 29 17 39 23 1 20 32 18 38

Tablica 19. Rezultati LSD testa za broj biljaka po jedinici površine


5.1.3. Varijabilnost duljine klasa Između ispitivanih genotipova u obje godine pokusa te u dvogodišnjem prosjeku za svojstvo duljine klasa utvrđene su statistički opravdane razlike na razini p<0,01. Također je utvrđena opravdana međuzavosnost (p<0,01) genotipa i godine, dok između ponavljanja statistički opravdane razlike nisu utvrđene (Tablica 20.).

Tablica 20. Analiza varijance za svojstvo duljine klasa Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Duljina klasa u vegetacijskoj 2007./2008. kretala se od 10,34 cm (U1) do 6,40 cm (Mihaela). U svih genotipova tijekom vegetacijske 2008./2009. izmjereni su kraći klasovi nego u prvoj godini pokusa. U genotipova U1 i Antonius zabilježeni su najdulji klasovi (9,04 cm), dok je u genotipova Libellula i Renata izmjeren najkraći klas od 5,8 cm (Tablica 21). U dvogodišnjem prosjeku genotip U1 imao je najdulji klas (9,69 cm), dok je genotip Renata imao najkraći (6,11 cm). Koeficijent varijacije ovoga svojstva u 2008. godini iznosio je 12,70%, a u 2009. je je iznosio 14,44%. U dvogodišnjem prosjeku bio je viši nego u prvoj godini poljskoga pokusa (13,24%). Genotip U1 imao je statistički visoko opravdano dulji klas u odnosu na sve ispitivane genotipove u dvogodišnjem prosjeku (Tablica 22). Slijede ga genotipovi Antonius, BC Patria, Ludwig, Golubica i Edison, njihova duljina klasa kretala se od 9,13 do 8,76 cm i između njih nije bilo statistički opravdane razlike. Genotip Renata imao je statistički visoko opravdano kraći klas (6,11 cm) u odnosu na 33 ispitivana genotipa. U odnosu na genotipove Demetru, Luciju i Super Žitarku imao je statistički opravdano kraći klas, dok između genotipova Žitarke, Libellule i Mihaele nije bilo statistički opravdane razlike u duljini klasa. Obzirom na dvogodišnji prosjek svojstvo duljine klasa najviše je variralo u genotipa Edison (12,22%), a najmanje u genotipa Anđelka (1,78%).

44


Tablica 21. Prosječna duljina klasa (cm) ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 10,34 7,21 7,31 7,12 6,68 6,83 6,55 6,60 6,95 6,41 7,77 7,07 7,69 7,99 7,01 6,77 6,40 8,07 7,48 9,12 8,13 7,35 8,20 7,60 7,57 8,03 7,89 8,33 7,21 6,71 8,53 9,36 7,56 8,17 8,36 9,22 8,11 9,73 8,47 9,21 12,70 23,05 0,547 0,726

2009. 9,04 6,55 6,75 6,36 6,22 6,56 6,73 6,42 6,24 5,80 7,14 6,41 7,20 7,49 6,77 6,72 6,01 7,46 6,57 8,73 7,69 6,49 7,88 6,84 6,65 7,55 7,97 7,35 6,71 5,80 7,87 8,67 7,03 7,41 7,85 9,04 7,76 7,79 8,44 8,70 12,74 20,81 0,534 0,709

2008./2009. 9,69 6,88 7,03 6,74 6,45 6,69 6,64 6,51 6,59 6,11 7,46 6,74 7,45 7,74 6,89 6,75 6,21 7,76 7,03 8,93 7,91 6,92 8,04 7,22 7,11 7,79 7,93 7,84 6,96 6,25 8,20 9,01 7,29 7,79 8,11 9,13 7,93 8,76 8,45 8,96 13,24 12,67 0,383 0,508 45


46

10 17 30 5 8 9 7 6 4 12 16 2 15 22 29 3 19 25 24 33 13 11 14 18 26 34 28 21 27 37 23 35 31 39 38 20 40 32

3,58 3,48 3,44 3,24 3,18 3,10 3,05 3,00 2,95 2,95 2,94 2,81 2,80 2,77 2,73 2,66 2,66 2,58 2,47 2,40 2,24 2,23 1,95 1,93 1,90 1,90 1,85 1,78 1,76 1,76 1,65 1,58 1,49 1,24 0,93 0,76 0,73 0,68

3,02 2,92 2,88 2,68 2,62 2,54 2,49 2,44 2,39 2,39 2,38 2,25 2,24 2,21 2,17 2,10 2,10 2,02 1,91 1,84 1,68 1,67 1,39 1,37 1,34 1,34 1,29 1,22 1,20 1,20 1,09 1,02 0,93 0,68 0,37 0,20 0,17 0,12

9,13 36 0,56 0,00 9,69 1 0,00

6,11 6,21 6,25 6,45 6,51 6,59 6,64 6,69 6,74 6,74 6,75 6,88 6,89 6,92 6,96 7,03 7,03 7,11 7,22 7,29 7,45 7,46 7,74 7,76 7,79 7,79 7,84 7,91 7,93 7,93 8,04 8,11 8,20 8,45 8,76 8,93 8,96 9,01

2,90 2,80 2,76 2,56 2,50 2,42 2,37 2,32 2,27 2,27 2,26 2,13 2,12 2,09 2,05 1,98 1,98 1,90 1,79 1,72 1,56 1,55 1,27 1,25 1,22 1,22 1,17 1,10 1,08 1,08 0,97 0,90 0,81 0,56 0,25 0,08 0,05 0,00

2,85 2,75 2,71 2,51 2,45 2,37 2,32 2,27 2,22 2,22 2,21 2,08 2,07 2,04 2,00 1,93 1,93 1,85 1,74 1,67 1,51 1,50 1,22 1,20 1,17 1,17 1,12 1,05 1,03 1,03 0,92 0,85 0,76 0,51 0,20 0,03 0,00

2,82 2,72 2,68 2,48 2,42 2,34 2,29 2,24 2,19 2,19 2,18 2,05 2,04 2,01 1,97 1,90 1,90 1,82 1,71 1,64 1,48 1,47 1,19 1,17 1,14 1,14 1,09 1,02 1,00 1,00 0,89 0,82 0,73 0,48 0,17 0,00

2,65 2,55 2,51 2,31 2,25 2,17 2,12 2,07 2,02 2,02 2,01 1,88 1,87 1,84 1,80 1,73 1,73 1,65 1,54 1,47 1,31 1,30 1,02 1,00 0,97 0,97 0,92 0,85 0,83 0,83 0,72 0,65 0,56 0,31 0,00

2,34 2,24 2,20 2,00 1,94 1,86 1,81 1,76 1,71 1,71 1,70 1,57 1,56 1,53 1,49 1,42 1,42 1,34 1,23 1,16 1,00 0,99 0,71 0,69 0,66 0,66 0,61 0,54 0,52 0,52 0,41 0,34 0,25 0,00

2,09 1,99 1,95 1,75 1,69 1,61 1,56 1,51 1,46 1,46 1,45 1,32 1,31 1,28 1,24 1,17 1,17 1,09 0,98 0,91 0,75 0,74 0,46 0,44 0,41 0,41 0,36 0,29 0,27 0,27 0,16 0,09 0,00

2,00 1,90 1,86 1,66 1,60 1,52 1,47 1,42 1,37 1,37 1,36 1,23 1,22 1,19 1,15 1,08 1,08 1,00 0,89 0,82 0,66 0,65 0,37 0,35 0,32 0,32 0,27 0,20 0,18 0,18 0,07 0,00

1,82 1,72 1,68 1,48 1,42 1,34 1,29 1,24 1,19 1,19 1,18 1,05 1,04 1,01 0,97 0,90 0,90 0,82 0,71 0,64 0,48 0,47 0,19 0,17 0,14 0,14 0,09 0,02 0,00 0,00

1,82 1,72 1,68 1,48 1,42 1,34 1,29 1,24 1,19 1,19 1,18 1,05 1,04 1,01 0,97 0,90 0,90 0,82 0,71 0,64 0,48 0,47 0,19 0,17 0,14 0,14 0,09 0,02 0,00

1,80 1,70 1,66 1,46 1,40 1,32 1,27 1,22 1,17 1,17 1,16 1,03 1,02 0,99 0,95 0,88 0,88 0,80 0,69 0,62 0,46 0,45 0,17 0,15 0,12 0,12 0,07 0,00

1,73 1,63 1,59 1,39 1,33 1,25 1,20 1,15 1,10 1,10 1,09 0,96 0,95 0,92 0,88 0,81 0,81 0,73 0,62 0,55 0,39 0,38 0,10 0,08 0,05 0,05 0,00

1,68 1,58 1,54 1,34 1,28 1,20 1,15 1,10 1,05 1,05 1,04 0,91 0,90 0,87 0,83 0,76 0,76 0,68 0,57 0,50 0,34 0,33 0,05 0,03 0,00 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

1,93 1,83 1,79 1,59 1,53 1,45 1,40 1,35 1,30 1,30 1,29 1,16 1,15 1,12 1,08 1,01 1,01 0,93 0,82 0,75 0,59 0,58 0,30 0,28 0,25 0,25 0,20 0,13 0,11 0,11 0,00

1,68 1,58 1,54 1,34 1,28 1,20 1,15 1,10 1,05 1,05 1,04 0,91 0,90 0,87 0,83 0,76 0,76 0,68 0,57 0,50 0,34 0,33 0,05 0,03 0,00

1,65 1,55 1,51 1,31 1,25 1,17 1,12 1,07 1,02 1,02 1,01 0,88 0,87 0,84 0,80 0,73 0,73 0,65 0,54 0,47 0,31 0,30 0,02 0,00

1,35 1,25 1,21 1,01 0,95 0,87 0,82 0,77 0,72 0,72 0,71 0,58 0,57 0,54 0,50 0,43 0,43 0,35 0,24 0,17 0,01 0,00

1,34 1,24 1,20 1,00 0,94 0,86 0,81 0,76 0,71 0,71 0,70 0,57 0,56 0,53 0,49 0,42 0,42 0,34 0,23 0,16 0,00

LSD0,01 = 0,508

LSD0,05 = 0,383

F test = 12,67 **

1,63 1,53 1,49 1,29 1,23 1,15 1,10 1,05 1,00 1,00 0,99 0,86 0,85 0,82 0,78 0,71 0,71 0,63 0,52 0,45 0,29 0,28 0,00

1,18 1,08 1,04 0,84 0,78 0,70 0,65 0,60 0,55 0,55 0,54 0,41 0,40 0,37 0,33 0,26 0,26 0,18 0,07 0,00

1,11 1,01 0,97 0,77 0,71 0,63 0,58 0,53 0,48 0,48 0,47 0,34 0,33 0,30 0,26 0,19 0,19 0,11 0,00

1,00 0,90 0,86 0,66 0,60 0,52 0,47 0,42 0,37 0,37 0,36 0,23 0,22 0,19 0,15 0,08 0,08 0,00

0,92 0,82 0,78 0,58 0,52 0,44 0,39 0,34 0,29 0,29 0,28 0,15 0,14 0,11 0,07 0,00 0,00

0,92 0,82 0,78 0,58 0,52 0,44 0,39 0,34 0,29 0,29 0,28 0,15 0,14 0,11 0,07 0,00

0,81 0,71 0,67 0,47 0,41 0,33 0,28 0,23 0,18 0,18 0,17 0,04 0,03 0,00

0,78 0,68 0,64 0,44 0,38 0,30 0,25 0,20 0,15 0,15 0,14 0,01 0,00

0,77 0,67 0,63 0,43 0,37 0,29 0,24 0,19 0,14 0,14 0,13 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

0,85 0,75 0,71 0,51 0,45 0,37 0,32 0,27 0,22 0,22 0,21 0,08 0,07 0,04 0,00

0,64 0,54 0,50 0,30 0,24 0,16 0,11 0,06 0,01 0,01 0,00

0,58 0,48 0,44 0,24 0,18 0,10 0,05 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

0,63 0,53 0,49 0,29 0,23 0,15 0,10 0,05 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

0,63 0,53 0,49 0,29 0,23 0,15 0,10 0,05 0,00 0,00

0,53 0,43 0,39 0,19 0,13 0,05 0,00

0,48 0,38 0,34 0,14 0,08 0,00

0,40 0,30 0,26 0,06 0,00

0,34 0,14 0,10 0,00 0,24 0,04 0,00 0,20 0,00 0,00

9,69 9,13 9,01 8,96 8,93 8,76 8,45 8,20 8,11 8,04 7,93 7,93 7,91 7,84 7,79 7,79 7,76 7,74 7,46 7,45 7,29 7,22 7,11 7,03 7,03 6,96 6,92 6,89 6,88 6,75 6,74 6,74 6,69 6,64 6,59 6,51 6,45 6,25 6,21 6,11 1 36 32 40 20 38 39 31 35 23 27 37 21 28 34 26 18 14 11 13 33 24 25 3 19 29 22 15 2 16 4 12 6 7 9 8 5 30 17 10

Tablica 22. Rezultati LSD testa za duljinu klasa


5.1.4. Varijabilnost broja klasića po klasu Analizom rezultata mjerenja broja klasića po klasu u provedenom istraživanju utvrđene su statistički opravdane razlike na razini p<0,01 između ispitivanih genotipova u obje godine, u dvogodišnjem prosjeku te je utvrđena u međuzavisnosti genotipa i godine. Između ponavljanja tijekom dvije vegetacijeske godine i u prosjeku dvije godine nisu utvrđene statističi opravdane razlike (Tablica 23).

Tablica 23. Analiza varijance za svojstvo broja klasića po klasu Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Broj klasića po klasu u prvoj godini pokusa kretao se od 23,75 (Edison) do 16,15 (Ilirija) klasića. U drugoj godini pokusa zabilježen je manji broj klasića u svih ispitivanih genotipova (Tablica 24). Najveći broj klasića po klasu imao je genotip Antonius (19,65), a genotip Renata imao je najmanji (14,41). U dvogodišnjem prosjeku u genotipa Edison utvrđen je najveći broj klasića po klasu (20,87), dok je Ilirija imala najmanji (15,76). Koeficijent varijacije ovoga svojstva u 2008. te dvogodišnjem prosjeku je bio podjednak i iznosio je 8,51% i 8,60%. dok je u 2009. godini bio najniži i iznosio je 6,71%. Genotip Edison imao je statistički visoko opravdano veći broj klasića po klasu (Tablica 25) u odnosu na sve ispitivane genotipove (20,87). Slijede genotipovi Valerius (19,69), Antonius (19,60), Alka (19,48), Ludwig (19,47) i Seka (19,27) između kojih nije bilo statistički opravdanih razlika. Genotip Ilirija imao je statistički visoko opravdano manji broj klasića u klasu u odnosu na 34 ispitivana genotipa, statistički opravdano manji broj u odnosu na genotipove Osječka 20 i Soissons, a statistički se nije razlikovao od genotipova Žitarke, U1 i Renate. Obzirom na dvogodišnji prosjek svojstvo broja klasića po klasu najviše je variralo u genotipa Edison (15,29%), a najmanje u genotipa Barbara (1,48%).

47


Tablica 24. Prosječni broj klasića po klasu ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 16,63 17,52 16,81 17,04 16,97 17,83 16,63 17,31 18,44 17,21 18,13 17,36 16,15 17,25 17,25 18,25 17,88 18,67 18,80 19,16 19,51 17,64 19,49 20,52 20,36 19,65 18,80 18,67 17,61 18,20 17,95 18,81 19,37 17,72 22,03 19,75 16,90 23,75 18,96 20,23 8,51 30,44 0,763 1,013

2009. 15,60 16,60 15,99 16,49 15,56 16,43 17,70 16,24 17,19 14,41 17,35 16,08 15,38 16,29 16,61 17,47 16,85 17,31 17,80 17,11 18,55 17,79 18,59 18,44 18,17 17,29 18,56 17,43 16,14 16,12 17,31 17,61 18,05 15,07 17,36 19,45 16,80 18,00 17,48 18,71 6,71 19,22 0,691 0,917

2008./2009. 16,11 17,06 16,40 16,77 16,27 17,13 17,16 16,77 17,81 15,81 17,74 16,72 15,76 16,77 16,93 17,86 17,37 17,99 18,30 18,13 19,03 17,71 19,04 19,48 19,27 18,47 18,68 18,05 16,88 17,16 17,63 18,21 18,71 16,39 19,69 19,60 16,85 20,87 18,22 19,47 8,60 17,09 0,510 0,677 48


49

13 10 1 5 34 3 12 4 8 14 37 29 15 2 6 30 7 17 31 22 11 9 16 18 28 20 32 39 19 26 27 33 21 23 25 40 24 36

19,69 35 3,93 3,88 3,58 3,42 3,30 3,29 2,97 2,92 2,92 2,92 2,84 2,81 2,76 2,63 2,56 2,53 2,53 2,32 2,06 1,98 1,95 1,88 1,83 1,70 1,64 1,56 1,48 1,47 1,39 1,22 1,01 0,98 0,66 0,65 0,42 0,22 0,21 0,09

19,69 35 1,18 0,00 20,87 38 0,00

15,76 15,81 16,11 16,27 16,39 16,40 16,72 16,77 16,77 16,77 16,85 16,88 16,93 17,06 17,13 17,16 17,16 17,37 17,63 17,71 17,74 17,81 17,86 17,99 18,05 18,13 18,21 18,22 18,30 18,47 18,68 18,71 19,03 19,04 19,27 19,47 19,48 19,60

20,87 38 5,11 5,06 4,76 4,60 4,48 4,47 4,15 4,10 4,10 4,10 4,02 3,99 3,94 3,81 3,74 3,71 3,71 3,50 3,24 3,16 3,13 3,06 3,01 2,88 2,82 2,74 2,66 2,65 2,57 2,40 2,19 2,16 1,84 1,83 1,60 1,40 1,39 1,27

19,60 36 3,84 3,79 3,49 3,33 3,21 3,20 2,88 2,83 2,83 2,83 2,75 2,72 2,67 2,54 2,47 2,44 2,44 2,23 1,97 1,89 1,86 1,79 1,74 1,61 1,55 1,47 1,39 1,38 1,30 1,13 0,92 0,89 0,57 0,56 0,33 0,13 0,12 0,00

19,48 24 3,72 3,67 3,37 3,21 3,09 3,08 2,76 2,71 2,71 2,71 2,63 2,60 2,55 2,42 2,35 2,32 2,32 2,11 1,85 1,77 1,74 1,67 1,62 1,49 1,43 1,35 1,27 1,26 1,18 1,01 0,80 0,77 0,45 0,44 0,21 0,01 0,00

19,47 40 3,71 3,66 3,36 3,20 3,08 3,07 2,75 2,70 2,70 2,70 2,62 2,59 2,54 2,41 2,34 2,31 2,31 2,10 1,84 1,76 1,73 1,66 1,61 1,48 1,42 1,34 1,26 1,25 1,17 1,00 0,79 0,76 0,44 0,43 0,20 0,00

19,27 25 3,51 3,46 3,16 3,00 2,88 2,87 2,55 2,50 2,50 2,50 2,42 2,39 2,34 2,21 2,14 2,11 2,11 1,90 1,64 1,56 1,53 1,46 1,41 1,28 1,22 1,14 1,06 1,05 0,97 0,80 0,59 0,56 0,24 0,23 0,00

19,04 23 3,28 3,23 2,93 2,77 2,65 2,64 2,32 2,27 2,27 2,27 2,19 2,16 2,11 1,98 1,91 1,88 1,88 1,67 1,41 1,33 1,30 1,23 1,18 1,05 0,99 0,91 0,83 0,82 0,74 0,57 0,36 0,33 0,01 0,00

19,03 21 3,27 3,22 2,92 2,76 2,64 2,63 2,31 2,26 2,26 2,26 2,18 2,15 2,10 1,97 1,90 1,87 1,87 1,66 1,40 1,32 1,29 1,22 1,17 1,04 0,98 0,90 0,82 0,81 0,73 0,56 0,35 0,32 0,00

18,71 33 2,95 2,90 2,60 2,44 2,32 2,31 1,99 1,94 1,94 1,94 1,86 1,83 1,78 1,65 1,58 1,55 1,55 1,34 1,08 1,00 0,97 0,90 0,85 0,72 0,66 0,58 0,50 0,49 0,41 0,24 0,03 0,00

18,47 26 2,71 2,66 2,36 2,20 2,08 2,07 1,75 1,70 1,70 1,70 1,62 1,59 1,54 1,41 1,34 1,31 1,31 1,10 0,84 0,76 0,73 0,66 0,61 0,48 0,42 0,34 0,26 0,25 0,17 0,00

18,30 19 2,54 2,49 2,19 2,03 1,91 1,90 1,58 1,53 1,53 1,53 1,45 1,42 1,37 1,24 1,17 1,14 1,14 0,93 0,67 0,59 0,56 0,49 0,44 0,31 0,25 0,17 0,09 0,08 0,00

18,22 39 2,46 2,41 2,11 1,95 1,83 1,82 1,50 1,45 1,45 1,45 1,37 1,34 1,29 1,16 1,09 1,06 1,06 0,85 0,59 0,51 0,48 0,41 0,36 0,23 0,17 0,09 0,01 0,00

18,21 32 2,45 2,40 2,10 1,94 1,82 1,81 1,49 1,44 1,44 1,44 1,36 1,33 1,28 1,15 1,08 1,05 1,05 0,84 0,58 0,50 0,47 0,40 0,35 0,22 0,16 0,08 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

18,68 27 2,92 2,87 2,57 2,41 2,29 2,28 1,96 1,91 1,91 1,91 1,83 1,80 1,75 1,62 1,55 1,52 1,52 1,31 1,05 0,97 0,94 0,87 0,82 0,69 0,63 0,55 0,47 0,46 0,38 0,21 0,00

18,13 20 2,37 2,32 2,02 1,86 1,74 1,73 1,41 1,36 1,36 1,36 1,28 1,25 1,20 1,07 1,00 0,97 0,97 0,76 0,50 0,42 0,39 0,32 0,27 0,14 0,08 0,00

18,05 28 2,29 2,24 1,94 1,78 1,66 1,65 1,33 1,28 1,28 1,28 1,20 1,17 1,12 0,99 0,92 0,89 0,89 0,68 0,42 0,34 0,31 0,24 0,19 0,06 0,00

17,99 18 2,23 2,18 1,88 1,72 1,60 1,59 1,27 1,22 1,22 1,22 1,14 1,11 1,06 0,93 0,86 0,83 0,83 0,62 0,36 0,28 0,25 0,18 0,13 0,00

Tablica 25. Rezultati LSD testa za broj klasića po klasu 17,81 9 2,05 2,00 1,70 1,54 1,42 1,41 1,09 1,04 1,04 1,04 0,96 0,93 0,88 0,75 0,68 0,65 0,65 0,44 0,18 0,10 0,07 0,00

LSD0,01 = 2,566

LSD0,05 = 1,955

F test = 16,59**

17,86 16 2,10 2,05 1,75 1,59 1,47 1,46 1,14 1,09 1,09 1,09 1,01 0,98 0,93 0,80 0,73 0,70 0,70 0,49 0,23 0,15 0,12 0,05 0,00

17,74 11 1,98 1,93 1,63 1,47 1,35 1,34 1,02 0,97 0,97 0,97 0,89 0,86 0,81 0,68 0,61 0,58 0,58 0,37 0,11 0,03 0,00

17,71 22 1,95 1,90 1,60 1,44 1,32 1,31 0,99 0,94 0,94 0,94 0,86 0,83 0,78 0,65 0,58 0,55 0,55 0,34 0,08 0,00

17,63 31 1,87 1,82 1,52 1,36 1,24 1,23 0,91 0,86 0,86 0,86 0,78 0,75 0,70 0,57 0,50 0,47 0,47 0,26 0,00

17,37 17 1,61 1,56 1,26 1,10 0,98 0,97 0,65 0,60 0,60 0,60 0,52 0,49 0,44 0,31 0,24 0,21 0,21 0,00

17,16 7 1,40 1,35 1,05 0,89 0,77 0,76 0,44 0,39 0,39 0,39 0,31 0,28 0,23 0,10 0,03 0,00 0,00

17,16 30 1,40 1,35 1,05 0,89 0,77 0,76 0,44 0,39 0,39 0,39 0,31 0,28 0,23 0,10 0,03 0,00

17,06 2 1,30 1,25 0,95 0,79 0,67 0,66 0,34 0,29 0,29 0,29 0,21 0,18 0,13 0,00

16,93 15 1,17 1,12 0,82 0,66 0,54 0,53 0,21 0,16 0,16 0,16 0,08 0,05 0,00

16,88 29 1,12 1,07 0,77 0,61 0,49 0,48 0,16 0,11 0,11 0,11 0,03 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

17,13 6 1,37 1,32 1,02 0,86 0,74 0,73 0,41 0,36 0,36 0,36 0,28 0,25 0,20 0,07 0,00

16,77 8 1,01 0,96 0,66 0,50 0,38 0,37 0,05 0,00 0,00 0,00

16,77 14 1,01 0,96 0,66 0,50 0,38 0,37 0,05 0,00 0,00

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

16,85 37 1,09 1,04 0,74 0,58 0,46 0,45 0,13 0,08 0,08 0,08 0,00

16,77 4 1,01 0,96 0,66 0,50 0,38 0,37 0,05 0,00

16,72 12 0,96 0,91 0,61 0,45 0,33 0,32 0,00

16,40 3 0,64 0,59 0,29 0,13 0,01 0,00

16,39 34 0,63 0,58 0,28 0,12 0,00

16,27 5 0,51 0,46 0,16 0,00

16,11 15,81 15,76 1 10 13 0,35 0,05 0,00 0,30 0,00 0,00


5.1.5. Varijabilnost broja zrna po klasu Analizom rezultata mjerenja broja zrna po klasu u provedenom istraživanju utvrđene su statistički opravdane razlike na razini p<0,01 između ispitivanih genotipova kako po godinama istraživanja, tako i u dvogodišnjem prosjeku. U prosjeku dvije godine također je utvrđena statistički opravdana (p<0,01) međuzavisnost godine i genotipa. Između ponavljanja tijekom dvije godine pokusa i u dvogodišnjem prosjeku nisu utvrđene statistički opravdane razlike (Tablica 26).

Tablica 26. Analiza varijance za svojstvo broja zrna po klasu Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Broj zrna po klasu kretao se od 57,25 (Janica) do 33,97 (U1) zrna u 2008. godini (Tablica 27). U 2009., zabilježen je manji broj zrna u svih ispitivanih genotipova, najveći broj zrna po klasu imao je genotip Bastide (53,15), a najmanji U1 (32,07). Koeficijent varijacije ovog svojstva u 2008. godini iznosio je 8,51%, u 2009. je bio viši i iznosio je 11,85%, a u dvogodišnjem prosjeku iznosio je 12,76%. U dvogodišnjem prosjeku genotipovi Bastide, Katarina i Janica imali su statistički visoko opravdano veći broj zrna po klasu u odnosu na sve ispitivane genotipove (Tablica 28). BC Patria i Eurofit su imali statistički visoko opravdano veći broj zrna po klasu u odnosu na 35 ispitivanih genotipova, dok između njih nije bilo statistički opravdanih razlika. Statistički visoko opravdano najmanji broj zrna po klasu utvrđen je u tri genotipa (U1, Divana i Renata), a između nisu utvrđene statistički opravdane razlike. Obzirom na dvogodišnji prosjek, svojstvo broja zrna po klasu najviše je variralo u genotipa Mihaela (10,05%), a najmanje u genotipa Ludwig (2,04%).

50


Tablica 27. Prosječni broj zrna po klasu ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 33,97 41,76 43,73 43,49 42,97 41,84 47,51 45,52 48,91 36,61 41,87 40,28 41,04 46,36 42,00 47,20 40,24 50,17 44,80 49,59 57,25 45,60 55,37 43,20 48,27 44,15 49,12 48,09 34,97 44,65 43,68 52,91 47,27 43,31 50,00 50,71 56,43 51,43 51,29 48,91 8,51 24,32 2,959 3,925

2009. 32,07 35,83 37,69 40,29 39,33 39,36 43,79 39,81 43,20 32,67 40,84 37,71 38,71 39,17 36,24 40,57 33,96 44,99 42,51 42,83 49,01 43,73 51,11 39,13 41,19 42,67 44,87 40,64 32,60 40,80 40,87 48,03 43,17 38,17 45,19 43,16 53,15 44,91 47,09 47,24 11,85 30,54 2,390 3,169

2008./2009. 33,02 38,79 40,71 41,89 41,15 40,60 45,65 42,67 46,05 34,64 41,35 38,99 39,87 42,77 39,12 43,89 37,10 47,58 43,65 46,21 53,13 44,67 53,24 41,17 44,73 43,41 46,99 44,37 33,79 42,73 42,27 50,47 45,22 40,74 47,59 46,93 54,79 48,17 49,19 48,07 12,76 18,93 1,796 2,382 51


52

1 29 10 17 2 12 15 13 6 3 34 5 24 11 4 31 8 30 14 26 19 16 28 22 25 33 7 9 20 36 27 18 35 40 38 39 32

21,77 21,00 20,15 17,69 16,00 15,80 15,67 14,92 14,19 14,08 14,05 13,64 13,62 13,44 12,90 12,52 12,12 12,06 12,02 11,38 11,14 10,90 10,42 10,12 10,06 9,57 9,14 8,74 8,58 7,86 7,80 7,21 7,20 6,72 6,62 5,60 4,32

20,22 19,45 18,60 16,14 14,45 14,25 14,12 13,37 12,64 12,53 12,50 12,09 12,07 11,89 11,35 10,97 10,57 10,51 10,47 9,83 9,59 9,35 8,87 8,57 8,51 8,02 7,59 7,19 7,03 6,31 6,25 5,66 5,65 5,17 5,07 4,05 2,77

20,11 19,34 18,49 16,03 14,34 14,14 14,01 13,26 12,53 12,42 12,39 11,98 11,96 11,78 11,24 10,86 10,46 10,40 10,36 9,72 9,48 9,24 8,76 8,46 8,40 7,91 7,48 7,08 6,92 6,20 6,14 5,55 5,54 5,06 4,96 3,94 2,66

53,13 21 1,66 0,11 0,00 53,24 23 1,55 0,00 54,79 37 0,00

33,02 33,79 34,64 37,10 38,79 38,99 39,12 39,87 40,60 40,71 40,74 41,15 41,17 41,35 41,89 42,27 42,67 42,73 42,77 43,41 43,65 43,89 44,37 44,67 44,73 45,22 45,65 46,05 46,21 46,93 46,99 47,58 47,59 48,07 48,17 49,19 50,47

17,45 16,68 15,83 13,37 11,68 11,48 11,35 10,60 9,87 9,76 9,73 9,32 9,30 9,12 8,58 8,20 7,80 7,74 7,70 7,06 6,82 6,58 6,10 5,80 5,74 5,25 4,82 4,42 4,26 3,54 3,48 2,89 2,88 2,40 2,30 1,28 0,00

16,17 15,40 14,55 12,09 10,40 10,20 10,07 9,32 8,59 8,48 8,45 8,04 8,02 7,84 7,30 6,92 6,52 6,46 6,42 5,78 5,54 5,30 4,82 4,52 4,46 3,97 3,54 3,14 2,98 2,26 2,20 1,61 1,60 1,12 1,02 0,00

15,15 14,38 13,53 11,07 9,38 9,18 9,05 8,30 7,57 7,46 7,43 7,02 7,00 6,82 6,28 5,90 5,50 5,44 5,40 4,76 4,52 4,28 3,80 3,50 3,44 2,95 2,52 2,12 1,96 1,24 1,18 0,59 0,58 0,10 0,00

15,05 14,28 13,43 10,97 9,28 9,08 8,95 8,20 7,47 7,36 7,33 6,92 6,90 6,72 6,18 5,80 5,40 5,34 5,30 4,66 4,42 4,18 3,70 3,40 3,34 2,85 2,42 2,02 1,86 1,14 1,08 0,49 0,48 0,00

14,57 13,80 12,95 10,49 8,80 8,60 8,47 7,72 6,99 6,88 6,85 6,44 6,42 6,24 5,70 5,32 4,92 4,86 4,82 4,18 3,94 3,70 3,22 2,92 2,86 2,37 1,94 1,54 1,38 0,66 0,60 0,01 0,00

14,56 13,79 12,94 10,48 8,79 8,59 8,46 7,71 6,98 6,87 6,84 6,43 6,41 6,23 5,69 5,31 4,91 4,85 4,81 4,17 3,93 3,69 3,21 2,91 2,85 2,36 1,93 1,53 1,37 0,65 0,59 0,00

13,97 13,20 12,35 9,89 8,20 8,00 7,87 7,12 6,39 6,28 6,25 5,84 5,82 5,64 5,10 4,72 4,32 4,26 4,22 3,58 3,34 3,10 2,62 2,32 2,26 1,77 1,34 0,94 0,78 0,06 0,00

13,19 12,42 11,57 9,11 7,42 7,22 7,09 6,34 5,61 5,50 5,47 5,06 5,04 4,86 4,32 3,94 3,54 3,48 3,44 2,80 2,56 2,32 1,84 1,54 1,48 0,99 0,56 0,16 0,00

13,03 12,26 11,41 8,95 7,26 7,06 6,93 6,18 5,45 5,34 5,31 4,90 4,88 4,70 4,16 3,78 3,38 3,32 3,28 2,64 2,40 2,16 1,68 1,38 1,32 0,83 0,40 0,00

12,63 11,86 11,01 8,55 6,86 6,66 6,53 5,78 5,05 4,94 4,91 4,50 4,48 4,30 3,76 3,38 2,98 2,92 2,88 2,24 2,00 1,76 1,28 0,98 0,92 0,43 0,00

12,20 11,43 10,58 8,12 6,43 6,23 6,10 5,35 4,62 4,51 4,48 4,07 4,05 3,87 3,33 2,95 2,55 2,49 2,45 1,81 1,57 1,33 0,85 0,55 0,49 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

13,91 13,14 12,29 9,83 8,14 7,94 7,81 7,06 6,33 6,22 6,19 5,78 5,76 5,58 5,04 4,66 4,26 4,20 4,16 3,52 3,28 3,04 2,56 2,26 2,20 1,71 1,28 0,88 0,72 0,00

11,71 10,94 10,09 7,63 5,94 5,74 5,61 4,86 4,13 4,02 3,99 3,58 3,56 3,38 2,84 2,46 2,06 2,00 1,96 1,32 1,08 0,84 0,36 0,06 0,00

11,65 10,88 10,03 7,57 5,88 5,68 5,55 4,80 4,07 3,96 3,93 3,52 3,50 3,32 2,78 2,40 2,00 1,94 1,90 1,26 1,02 0,78 0,30 0,00

11,35 10,58 9,73 7,27 5,58 5,38 5,25 4,50 3,77 3,66 3,63 3,22 3,20 3,02 2,48 2,10 1,70 1,64 1,60 0,96 0,72 0,48 0,00

10,63 9,86 9,01 6,55 4,86 4,66 4,53 3,78 3,05 2,94 2,91 2,50 2,48 2,30 1,76 1,38 0,98 0,92 0,88 0,24 0,00

10,39 9,62 8,77 6,31 4,62 4,42 4,29 3,54 2,81 2,70 2,67 2,26 2,24 2,06 1,52 1,14 0,74 0,68 0,64 0,00

LSD0,01 = 2,382

LSD0,05 = 1,796

F test = 18,93**

10,87 10,10 9,25 6,79 5,10 4,90 4,77 4,02 3,29 3,18 3,15 2,74 2,72 2,54 2,00 1,62 1,22 1,16 1,12 0,48 0,24 0,00

9,75 8,98 8,13 5,67 3,98 3,78 3,65 2,90 2,17 2,06 2,03 1,62 1,60 1,42 0,88 0,50 0,10 0,04 0,00

9,71 8,94 8,09 5,63 3,94 3,74 3,61 2,86 2,13 2,02 1,99 1,58 1,56 1,38 0,84 0,46 0,06 0,00

9,65 8,88 8,03 5,57 3,88 3,68 3,55 2,80 2,07 1,96 1,93 1,52 1,50 1,32 0,78 0,40 0,00

9,25 8,48 7,63 5,17 3,48 3,28 3,15 2,40 1,67 1,56 1,53 1,12 1,10 0,92 0,38 0,00

8,87 8,10 7,25 4,79 3,10 2,90 2,77 2,02 1,29 1,18 1,15 0,74 0,72 0,54 0,00

8,15 7,38 6,53 4,07 2,38 2,18 2,05 1,30 0,57 0,46 0,43 0,02 0,00

8,13 7,36 6,51 4,05 2,36 2,16 2,03 1,28 0,55 0,44 0,41 0,00

7,72 6,95 6,10 3,64 1,95 1,75 1,62 0,87 0,14 0,03 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

8,33 7,56 6,71 4,25 2,56 2,36 2,23 1,48 0,75 0,64 0,61 0,20 0,18 0,00

7,58 6,81 5,96 3,50 1,81 1,61 1,48 0,73 0,00

6,85 6,08 5,23 2,77 1,08 0,88 0,75 0,00

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

7,69 6,92 6,07 3,61 1,92 1,72 1,59 0,84 0,11 0,00

6,10 5,33 4,48 2,02 0,33 0,13 0,00

5,97 5,20 4,35 1,89 0,20 0,00

5,77 5,00 4,15 1,69 0,00

4,08 1,62 0,77 0,00 3,31 0,85 0,00 2,46 0,00 0,00

54,79 53,24 53,13 50,47 49,19 48,17 48,07 47,59 47,58 46,99 46,93 46,21 46,05 45,65 45,22 44,73 44,67 44,37 43,89 43,65 43,41 42,77 42,73 42,67 42,27 41,89 41,35 41,17 41,15 40,74 40,71 40,60 39,87 39,12 38,99 38,79 37,10 34,64 33,79 33,02 37 23 21 32 39 38 40 35 18 27 36 20 9 7 33 25 22 28 16 19 26 14 30 8 31 4 11 24 5 34 3 6 13 15 12 2 17 10 29 1

Tablica 28. Rezultati LSD testa za broj zrna po klasu


5.1.6. Varijabilnost mase 1000 zrna provedenom istraživanju za svojstvo mase 1000 zrna utvrđene su statistički opravdane razlike (p<0,01) između ispitivanih genotipova tijekom dvije vegetacijske godine i u dvogodišnjem prosjeku. Također je utvrđena statistički opravdana (p<0,01) međuzavisnost genotipa i godine, dok između ponavljanja u pokusu nije bilo statistički opravdanih razlika (Tablica 29).

Tablica 29. Analiza varijance i koeficijenti varijabilnosti za svojstvo mase 1000 zrna Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Prosječna masa 1000 zrna u ispitivanih genotipova u 2008. godini (Tablica 30) kretala se od 40,85 g (Adriana) do 53,1 g (Barbara). U 2009. godini prosječna masa 1000 zrna kretala se od 39,97 g u genotipa Adriana do 50,52 g u genotipa Barbara. Oba genotipa su i u dvogodišnjem prosjeku imali najmanju (Adriana) i najveću (Barbara) masu 1000 zrna. Koeficijent varijacije ovoga svojstva nije previše odstupao po godinama pokusa, u 2008. Iznosio je 7,16%, u 2009. 6,90%, a u dvogodišnjem prosjeku je iznosio 7,48%. Genotipovi Barbara (51,81 g) i Ilirija (51,00 g) imali su statistički visoko opravdano veću masu 1000 zrna od svih ispitivanih genotipova (Tablica 31). Slijede ih genotipovi Pipi i Super Žitarka između kojih nema statistički opravdanih razlika. Genotip Adriana (40,41 g) imao je statistički opravdano manju masu 1000 zrna u odnosu na 29 ispitivanih genotipova, dok je u odnosu na genotipove Seku, Anđelku i Golubicu imao statistički opravdano manju masu 1000 zrna. Slijede genotipovi Zlatna Dolina, Katarina, Srpanjka, Osječka 20, Slavonija, Zlata i Demetra između kojih nije bilo statistički opravdanih razlika u ovom svojstvu. Obzirom na dvogodišnji prosjek svojstvo mase 1000 zrna najviše je variralo u genotipa Osječka Crvenka (8,27%), a najmanje u genotipa Antonius (1,18%).

53


Tablica 30. Prosječna masa 1000 zrna (g) ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 48,40 46,72 41,89 41,77 45,29 42,15 41,51 49,11 44,13 50,63 43,83 50,81 51,57 47,59 42,20 42,62 48,63 44,76 42,13 42,66 43,12 53,10 42,40 44,77 42,61 44,65 47,43 40,85 46,20 44,60 48,58 49,23 47,86 45,29 43,59 43,91 45,18 46,73 46,57 50,03 7,16 26,61 1,695 2,248

2009. 46,45 41,26 40,23 40,35 43,87 40,47 39,82 47,93 42,10 44,96 40,49 47,84 50,42 44,88 39,43 41,22 46,39 43,25 40,82 40,99 41,51 50,52 40,52 43,30 41,35 42,22 45,02 39,97 45,70 42,66 46,93 45,88 45,13 41,50 41,43 44,20 42,17 43,57 43,37 44,40 6,90 19,16 1,807 2,396

2008./2009. 47,43 43,99 41,06 41,06 44,58 41,31 40,67 48,52 43,11 47,80 42,16 49,33 51,00 46,24 40,82 41,92 47,51 44,00 41,48 41,82 42,32 51,81 41,46 44,04 41,98 43,43 46,23 40,41 45,95 43,63 47,75 47,56 46,49 43,40 42,51 44,06 43,68 45,15 44,97 47,22 7,48 13,93 1,227 1,627 54


55

28 7 15 4 3 6 23 19 20 16 25 11 21 35 9 34 26 30 37 2 18 24 36 5 39 38 29 27 14 33 40 1 17 32 31 10 8 12

11,40 11,14 10,99 10,75 10,75 10,50 10,35 10,33 9,99 9,89 9,83 9,65 9,49 9,30 8,70 8,41 8,38 8,18 8,13 7,82 7,81 7,77 7,75 7,23 6,84 6,66 5,86 5,58 5,57 5,32 4,59 4,38 4,30 4,25 4,06 4,01 3,29 2,48

10,59 10,33 10,18 9,94 9,94 9,69 9,54 9,52 9,18 9,08 9,02 8,84 8,68 8,49 7,89 7,60 7,57 7,37 7,32 7,01 7,00 6,96 6,94 6,42 6,03 5,85 5,05 4,77 4,76 4,51 3,78 3,57 3,49 3,44 3,25 3,20 2,48 1,67

51,00 13 0,81 0,00 51,81 22 0,00

40,41 40,67 40,82 41,06 41,06 41,31 41,46 41,48 41,82 41,92 41,98 42,16 42,32 42,51 43,11 43,40 43,43 43,63 43,68 43,99 44,00 44,04 44,06 44,58 44,97 45,15 45,95 46,23 46,24 46,49 47,22 47,43 47,51 47,56 47,75 47,80 48,52 49,33

8,92 8,66 8,51 8,27 8,27 8,02 7,87 7,85 7,51 7,41 7,35 7,17 7,01 6,82 6,22 5,93 5,90 5,70 5,65 5,34 5,33 5,29 5,27 4,75 4,36 4,18 3,38 3,10 3,09 2,84 2,11 1,90 1,82 1,77 1,58 1,53 0,81 0,00

8,11 7,85 7,70 7,46 7,46 7,21 7,06 7,04 6,70 6,60 6,54 6,36 6,20 6,01 5,41 5,12 5,09 4,89 4,84 4,53 4,52 4,48 4,46 3,94 3,55 3,37 2,57 2,29 2,28 2,03 1,30 1,09 1,01 0,96 0,77 0,72 0,00

7,39 7,13 6,98 6,74 6,74 6,49 6,34 6,32 5,98 5,88 5,82 5,64 5,48 5,29 4,69 4,40 4,37 4,17 4,12 3,81 3,80 3,76 3,74 3,22 2,83 2,65 1,85 1,57 1,56 1,31 0,58 0,37 0,29 0,24 0,05 0,00

7,34 7,08 6,93 6,69 6,69 6,44 6,29 6,27 5,93 5,83 5,77 5,59 5,43 5,24 4,64 4,35 4,32 4,12 4,07 3,76 3,75 3,71 3,69 3,17 2,78 2,60 1,80 1,52 1,51 1,26 0,53 0,32 0,24 0,19 0,00

7,15 6,89 6,74 6,50 6,50 6,25 6,10 6,08 5,74 5,64 5,58 5,40 5,24 5,05 4,45 4,16 4,13 3,93 3,88 3,57 3,56 3,52 3,50 2,98 2,59 2,41 1,61 1,33 1,32 1,07 0,34 0,13 0,05 0,00

7,10 6,84 6,69 6,45 6,45 6,20 6,05 6,03 5,69 5,59 5,53 5,35 5,19 5,00 4,40 4,11 4,08 3,88 3,83 3,52 3,51 3,47 3,45 2,93 2,54 2,36 1,56 1,28 1,27 1,02 0,29 0,08 0,00

7,02 6,76 6,61 6,36 6,36 6,11 5,97 5,95 5,61 5,51 5,45 5,27 5,11 4,92 4,32 4,03 4,00 3,79 3,75 3,44 3,43 3,39 3,36 2,85 2,46 2,28 1,47 1,20 1,19 0,93 0,20 -0,01

6,08 5,82 5,67 5,43 5,43 5,18 5,03 5,01 4,67 4,57 4,51 4,33 4,17 3,98 3,38 3,09 3,06 2,86 2,81 2,50 2,49 2,45 2,43 1,91 1,52 1,34 0,54 0,26 0,25 0,00

5,83 5,57 5,42 5,18 5,18 4,93 4,78 4,76 4,42 4,32 4,26 4,08 3,92 3,73 3,13 2,84 2,81 2,61 2,56 2,25 2,24 2,20 2,18 1,66 1,27 1,09 0,29 0,01 0,00

5,82 5,56 5,41 5,17 5,17 4,92 4,77 4,75 4,41 4,31 4,25 4,07 3,91 3,72 3,12 2,83 2,80 2,60 2,55 2,24 2,23 2,19 2,17 1,65 1,26 1,08 0,28 0,00

5,54 5,28 5,13 4,89 4,89 4,64 4,49 4,47 4,13 4,03 3,97 3,79 3,63 3,44 2,84 2,55 2,52 2,32 2,27 1,96 1,95 1,91 1,89 1,37 0,98 0,80 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

6,81 6,55 6,40 6,16 6,16 5,91 5,76 5,74 5,40 5,30 5,24 5,06 4,90 4,71 4,11 3,82 3,79 3,59 3,54 3,23 3,22 3,18 3,16 2,64 2,25 2,07 1,27 0,99 0,98 0,73 0,00

4,74 4,48 4,33 4,09 4,09 3,84 3,69 3,67 3,33 3,23 3,17 2,99 2,83 2,64 2,04 1,75 1,72 1,52 1,47 1,16 1,15 1,11 1,09 0,57 0,18 0,00

4,56 4,30 4,15 3,91 3,91 3,66 3,51 3,49 3,15 3,05 2,99 2,81 2,65 2,46 1,86 1,57 1,54 1,34 1,29 0,98 0,97 0,93 0,91 0,39 0,00

4,17 3,91 3,76 3,52 3,52 3,27 3,12 3,10 2,76 2,66 2,60 2,42 2,26 2,07 1,47 1,18 1,15 0,95 0,90 0,59 0,58 0,54 0,52 0,00

3,63 3,37 3,22 2,98 2,98 2,73 2,58 2,56 2,22 2,12 2,06 1,88 1,72 1,53 0,93 0,64 0,61 0,41 0,36 0,05 0,04 0,00

3,59 3,33 3,18 2,94 2,94 2,69 2,54 2,52 2,18 2,08 2,02 1,84 1,68 1,49 0,89 0,60 0,57 0,37 0,32 0,01 0,00

LSD0,01 = 1,627

LSD0,05 = 1,227

F test = 13,93**

3,65 3,39 3,24 3,00 3,00 2,75 2,60 2,58 2,24 2,14 2,08 1,90 1,74 1,55 0,95 0,66 0,63 0,43 0,38 0,07 0,06 0,02 0,00

3,58 3,32 3,17 2,93 2,93 2,68 2,53 2,51 2,17 2,07 2,01 1,83 1,67 1,48 0,88 0,59 0,56 0,36 0,31 0,00

3,27 3,01 2,86 2,62 2,62 2,37 2,22 2,20 1,86 1,76 1,70 1,52 1,36 1,17 0,57 0,28 0,25 0,05 0,00

3,22 2,96 2,81 2,57 2,57 2,32 2,17 2,15 1,81 1,71 1,65 1,47 1,31 1,12 0,52 0,23 0,20 0,00

3,02 2,76 2,61 2,37 2,37 2,12 1,97 1,95 1,61 1,51 1,45 1,27 1,11 0,92 0,32 0,03 0,00

2,99 2,73 2,58 2,34 2,34 2,09 1,94 1,92 1,58 1,48 1,42 1,24 1,08 0,89 0,29 0,00

2,10 1,84 1,69 1,45 1,45 1,20 1,05 1,03 0,69 0,59 0,53 0,35 0,19 0,00

1,91 1,65 1,50 1,26 1,26 1,01 0,86 0,84 0,50 0,40 0,34 0,16 0,00

1,75 1,49 1,34 1,10 1,10 0,85 0,70 0,68 0,34 0,24 0,18 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

2,70 2,44 2,29 2,05 2,05 1,80 1,65 1,63 1,29 1,19 1,13 0,95 0,79 0,60 0,00

1,57 1,31 1,16 0,92 0,92 0,67 0,52 0,50 0,16 0,06 0,00

1,41 1,15 1,00 0,76 0,76 0,51 0,36 0,34 0,00

1,07 0,81 0,66 0,42 0,42 0,17 0,02 0,00

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

1,51 1,25 1,10 0,86 0,86 0,61 0,46 0,44 0,10 0,00

1,05 0,79 0,64 0,40 0,40 0,15 0,00

0,90 0,64 0,49 0,25 0,25 0,00

0,65 0,39 0,24 0,00 0,00

0,65 0,41 0,26 0,00 0,39 0,15 0,00 0,24 0,00 0,00 0,00

51,81 51,00 49,33 48,52 47,80 47,75 47,56 47,51 47,43 47,22 46,49 46,24 46,23 45,95 45,15 44,97 44,58 44,06 44,04 44,00 43,99 43,68 43,63 43,43 43,40 43,11 42,51 42,32 42,16 41,98 41,92 41,82 41,48 41,46 41,31 41,06 41,06 40,82 40,67 40,41 22 13 12 8 10 31 32 17 1 40 33 14 27 29 38 39 5 36 24 18 2 37 30 26 34 9 35 21 11 25 16 20 19 23 6 3 4 15 7 28

Tablica 31. Rezultati LSD testa za masu 1000 zrna


5.1.7. Varijabilnost hektolitarske mase Analizom rezultata mjerenja hektolitarske mase u provedenom istraživanju utvrđene su statistički opravdane razlike na razini p<0,01 između ispitivanih genotipova u obje godine pokusa. Utvrđeno je statistčki opravdano međudjelovanje (p<0,01) genotipa i godine te statistički opravdane razlike između genotipova u dvogodišnjem prosjeku, dok između ponavljanja statistički opravdanih razlika nije bilo (Tablica 32).

Tablica 32. Analiza varijance i koeficijenti varijabilnosti za svojstvo hektolitarske mase Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Svojstvo hektolitarske mase, u odnosu na ostala mjerena svojstva, najmanje je variralo kako između genotipova, tako i po godinama pokusa te u dvogodišnjem prosjeku (Tablica 33). Najveća prosječna vrijednost hektolitarske mase u 2008. godini i dvogodišnjem prosjeku utvrđena je u genotipa Lela (87,13 kg/hl), dok je genotip Barbara (85,03 kg/hl) imao najveću hektolitarsku masu u 2009. godini. Genotip Bastide je u obje godine pokusa i u dvogodišnjem prosjeku imao najmanju hektolitarsku masu (78,52 kg/hl). Genotip Lela imao je statistički visoko opravdano veću hektolitarsku masu u odnosu na 36 ispitivanih genotipova (Tablica 34), dok u odnosu na genotipove Valerius, Barbara i Antonius nije bilo statistički opravdanih razlika. Statistički visoko opravdano najmanju hektolitarsku masu u odnosu na sve ispitivane genotipove imao je genotip Bastide (78,52 kg/hl). Slijede genotipovi U1 i Sana između kojih nije bilo statistički opravdanih razlika. Obzirom na dvogodišnji prosjek svojstvo hektolitarske mase najviše je variralo u genotipa Libellula (3,43%), a najmanje u genotipa Eurofit (0,50%).

56


Tablica 33. Prosječna hektolitarska masa (kg/hl) ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 80,27 83,77 85,53 84,40 85,67 84,70 82,67 86,77 84,23 84,77 85,30 85,50 85,60 86,00 84,10 82,53 84,20 85,53 83,93 85,53 85,47 86,23 84,53 82,80 83,13 87,13 81,93 82,17 84,80 85,43 84,93 83,93 82,83 83,67 86,57 86,03 79,77 82,70 84,10 84,57 2,03 19,28 1,028 1,364

2009. 80,07 80,10 81,13 81,80 83,03 81,10 79,83 82,83 80,33 81,77 81,63 81,70 83,70 82,70 80,63 80,97 79,97 81,40 80,03 84,07 81,87 85,03 82,13 81,07 80,00 84,37 79,67 80,70 82,07 80,27 82,33 80,40 79,03 81,57 84,70 84,90 77,27 82,33 83,53 82,37 2,17 19,92 1,051 1,394

2008./2009. 80,17 81,93 83,33 83,10 84,35 82,90 81,25 84,80 82,28 83,27 83,47 83,60 84,65 84,35 82,37 81,75 82,08 83,47 81,98 84,80 83,67 85,63 83,33 81,93 81,57 85,75 80,80 81,43 83,43 82,85 83,63 82,17 80,93 82,62 85,63 85,47 78,52 82,52 83,82 83,47 2,66 18,35 0,714 0,947 57


58

37 1 27 33 7 28 25 16 2 24 19 17 32 9 15 38 34 30 6 4 10 3 23 29 11 18 40 12 31 21 39 5 14 13 8 20 36 22

7,23 5,58 4,95 4,82 4,50 4,32 4,18 4,00 3,82 3,82 3,77 3,67 3,58 3,47 3,38 3,23 3,13 2,90 2,85 2,65 2,48 2,42 2,42 2,32 2,28 2,28 2,28 2,15 2,12 2,08 1,93 1,40 1,40 1,10 0,95 0,95 0,28 0,12

7,11 5,46 4,83 4,70 4,38 4,20 4,06 3,88 3,70 3,70 3,65 3,55 3,46 3,35 3,26 3,11 3,01 2,78 2,73 2,53 2,36 2,30 2,30 2,20 2,16 2,16 2,16 2,03 2,00 1,96 1,81 1,28 1,28 0,98 0,83 0,83 0,16 0,00

85,63 35 0,12 0,00 85,75 26 0,00

78,52 80,17 80,80 80,93 81,25 81,43 81,57 81,75 81,93 81,93 81,98 82,08 82,17 82,28 82,37 82,52 82,62 82,85 82,90 83,10 83,27 83,33 83,33 83,43 83,47 83,47 83,47 83,60 83,63 83,67 83,82 84,35 84,35 84,65 84,80 84,80 85,47 85,63

7,11 5,46 4,83 4,70 4,38 4,20 4,06 3,88 3,70 3,70 3,65 3,55 3,46 3,35 3,26 3,11 3,01 2,78 2,73 2,53 2,36 2,30 2,30 2,20 2,16 2,16 2,16 2,03 2,00 1,96 1,81 1,28 1,28 0,98 0,83 0,83 0,16 0,00

6,95 5,30 4,67 4,54 4,22 4,04 3,90 3,72 3,54 3,54 3,49 3,39 3,30 3,19 3,10 2,95 2,85 2,62 2,57 2,37 2,20 2,14 2,14 2,04 2,00 2,00 2,00 1,87 1,84 1,80 1,65 1,12 1,12 0,82 0,67 0,67 0,00

6,28 4,63 4,00 3,87 3,55 3,37 3,23 3,05 2,87 2,87 2,82 2,72 2,63 2,52 2,43 2,28 2,18 1,95 1,90 1,70 1,53 1,47 1,47 1,37 1,33 1,33 1,33 1,20 1,17 1,13 0,98 0,45 0,45 0,15 0,00 0,00

6,28 4,63 4,00 3,87 3,55 3,37 3,23 3,05 2,87 2,87 2,82 2,72 2,63 2,52 2,43 2,28 2,18 1,95 1,90 1,70 1,53 1,47 1,47 1,37 1,33 1,33 1,33 1,20 1,17 1,13 0,98 0,45 0,45 0,15 0,00

6,13 4,48 3,85 3,72 3,40 3,22 3,08 2,90 2,72 2,72 2,67 2,57 2,48 2,37 2,28 2,13 2,03 1,80 1,75 1,55 1,38 1,32 1,32 1,22 1,18 1,18 1,18 1,05 1,02 0,98 0,83 0,30 0,30 0,00

5,83 4,18 3,55 3,42 3,10 2,92 2,78 2,60 2,42 2,42 2,37 2,27 2,18 2,07 1,98 1,83 1,73 1,50 1,45 1,25 1,08 1,02 1,02 0,92 0,88 0,88 0,88 0,75 0,72 0,68 0,53 0,00 0,00

5,83 4,18 3,55 3,42 3,10 2,92 2,78 2,60 2,42 2,42 2,37 2,27 2,18 2,07 1,98 1,83 1,73 1,50 1,45 1,25 1,08 1,02 1,02 0,92 0,88 0,88 0,88 0,75 0,72 0,68 0,53 0,00

5,15 3,50 2,87 2,74 2,42 2,24 2,10 1,92 1,74 1,74 1,69 1,59 1,50 1,39 1,30 1,15 1,05 0,82 0,77 0,57 0,40 0,34 0,34 0,24 0,20 0,20 0,20 0,07 0,04 0,00

5,11 3,46 2,83 2,70 2,38 2,20 2,06 1,88 1,70 1,70 1,65 1,55 1,46 1,35 1,26 1,11 1,01 0,78 0,73 0,53 0,36 0,30 0,30 0,20 0,16 0,16 0,16 0,03 0,00

5,08 3,43 2,80 2,67 2,35 2,17 2,03 1,85 1,67 1,67 1,62 1,52 1,43 1,32 1,23 1,08 0,98 0,75 0,70 0,50 0,33 0,27 0,27 0,17 0,13 0,13 0,13 0,00

4,95 3,30 2,67 2,54 2,22 2,04 1,90 1,72 1,54 1,54 1,49 1,39 1,30 1,19 1,10 0,95 0,85 0,62 0,57 0,37 0,20 0,14 0,14 0,04 0,00 0,00 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

5,30 3,65 3,02 2,89 2,57 2,39 2,25 2,07 1,89 1,89 1,84 1,74 1,65 1,54 1,45 1,30 1,20 0,97 0,92 0,72 0,55 0,49 0,49 0,39 0,35 0,35 0,35 0,22 0,19 0,15 0,00

4,95 3,30 2,67 2,54 2,22 2,04 1,90 1,72 1,54 1,54 1,49 1,39 1,30 1,19 1,10 0,95 0,85 0,62 0,57 0,37 0,20 0,14 0,14 0,04 0,00 0,00

4,95 3,30 2,67 2,54 2,22 2,04 1,90 1,72 1,54 1,54 1,49 1,39 1,30 1,19 1,10 0,95 0,85 0,62 0,57 0,37 0,20 0,14 0,14 0,04 0,00

4,91 3,26 2,63 2,50 2,18 2,00 1,86 1,68 1,50 1,50 1,45 1,35 1,26 1,15 1,06 0,91 0,81 0,58 0,53 0,33 0,16 0,10 0,10 0,00

4,81 3,16 2,53 2,40 2,08 1,90 1,76 1,58 1,40 1,40 1,35 1,25 1,16 1,05 0,96 0,81 0,71 0,48 0,43 0,23 0,06 0,00

4,75 3,10 2,47 2,34 2,02 1,84 1,70 1,52 1,34 1,34 1,29 1,19 1,10 0,99 0,90 0,75 0,65 0,42 0,37 0,17 0,00

LSD0,05 = 0,947

LSD0,05 = 0,714

F test = 18,35**

4,81 3,16 2,53 2,40 2,08 1,90 1,76 1,58 1,40 1,40 1,35 1,25 1,16 1,05 0,96 0,81 0,71 0,48 0,43 0,23 0,06 0,00 0,00

4,58 2,93 2,30 2,17 1,85 1,67 1,53 1,35 1,17 1,17 1,12 1,02 0,93 0,82 0,73 0,58 0,48 0,25 0,20 0,00

4,38 2,73 2,10 1,97 1,65 1,47 1,33 1,15 0,97 0,97 0,92 0,82 0,73 0,62 0,53 0,38 0,28 0,05 0,00

4,33 2,68 2,05 1,92 1,60 1,42 1,28 1,10 0,92 0,92 0,87 0,77 0,68 0,57 0,48 0,33 0,23 0,00

4,10 2,45 1,82 1,69 1,37 1,19 1,05 0,87 0,69 0,69 0,64 0,54 0,45 0,34 0,25 0,10 0,00

4,00 2,35 1,72 1,59 1,27 1,09 0,95 0,77 0,59 0,59 0,54 0,44 0,35 0,24 0,15 0,00

3,85 2,20 1,57 1,44 1,12 0,94 0,80 0,62 0,44 0,44 0,39 0,29 0,20 0,09 0,00

3,65 2,00 1,37 1,24 0,92 0,74 0,60 0,42 0,24 0,24 0,19 0,09 0,00

3,56 1,91 1,28 1,15 0,83 0,65 0,51 0,33 0,15 0,15 0,10 0,00

3,46 1,81 1,18 1,05 0,73 0,55 0,41 0,23 0,05 0,05 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

3,76 2,11 1,48 1,35 1,03 0,85 0,71 0,53 0,35 0,35 0,30 0,20 0,11 0,00

3,41 1,76 1,13 1,00 0,68 0,50 0,36 0,18 0,00 0,00

3,23 1,58 0,95 0,82 0,50 0,32 0,18 0,00

3,05 1,40 0,77 0,64 0,32 0,14 0,00

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

3,41 1,76 1,13 1,00 0,68 0,50 0,36 0,18 0,00 0,00

2,91 1,26 0,63 0,50 0,18 0,00

2,73 1,08 0,45 0,32 0,00

2,41 2,28 1,65 0,00 0,76 0,63 0,00 0,13 0,00 0,00

85,75 85,63 85,63 85,47 84,80 84,80 84,65 84,35 84,35 83,82 83,67 83,63 83,60 83,47 83,47 83,47 83,43 83,33 83,33 83,27 83,10 82,90 82,85 82,62 82,52 82,37 82,28 82,17 82,08 81,98 81,93 81,93 81,75 81,57 81,43 81,25 80,93 80,80 80,17 78,52 26 22 35 36 8 20 13 5 14 39 21 31 12 11 18 40 29 3 23 10 4 6 30 34 38 15 9 32 17 19 2 24 16 25 28 7 33 27 1 37

Tablica 34. Rezultati LSD testa za hektolitarsku masu


5.1.8. Varijabilnost uroda zrna Za svojstvo uroda zrna utvrđene su statistički opravdane razlike na razini p<0,01 između ispitivanih genotipova kako po godinama istraživanja, tako i u dvogodišnjem prosjeku, dok između ponavljanja nisu utvrđene statistički opravdane razlike. Također je utvrđena statistički opravdana (p<0,01) međuzavisnost genotipa i godine u provedenom istraživanju (Tablica 35).

Tablica 35. Analiza varijance i koeficijenti varijabilnosti za svojstvo uroda zrna Izvor variranja Genotip Godina Ponavljanje Genotip×godina

Stupnjevi slobode 39 1 2 39

2008. ** n.s. -

2009. ** n.s. -

2008./2009. ** ** n.s. **

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Urod zrna u 2008. (Tablica 36) kretao se od 11,23 t/ha koji je ostvario genotip BC Patria do 5,04 t/ha koji je ostvario genotip U1. U 2009. godini zabilježen je manji urod u svih ispitivanih genotipova, a kretao se od 8,01 t/ha (Bastide) do 2,90 t/ha (U1). Najmanji pad uroda od vegetacijske 2007./2008. do 2008./2009. zabilježen je u genotipa Žitarka te iznosi 1,44 t/ha, a najveći u genotipa BC Patria i iznosi 4,20 t/ha (Grafikon 2). Koeficijent varijacije ovoga svojstva u 2008. godini iznosio je 12,74%, u 2009. je bio veći i iznosio je 15,00%, a u dvogodišnjem prosjeku iznosio je 22,02%. Statistički visoko opravdano veći urod u odnosu 34 ispitivana genotipa zabilježen je u genotipa Bastide (Tablica 37), dok u odnosu na genotipove BC Patria, Alka, Eurofit i Sanu nije bilo statistički opravdanih razlika. Genotip U1 imao je statistički visoko opravdano najmanji urod zrna od svih ispitivanih genotipova. Slijedi genotip Divana koji je imao statistički opravdano manji urod u odnosu na genotipove Bezostaja i Libelulla, dok između ta dva genotipa nije bilo statistički opravdane razlike. Obzirom na dvogodišnji prosjek svojstvo uroda zrna najviše je variralo u genotipa U1 (30,39%), a najmanje u genotipa Žitarka (10,32%).

59


Tablica 36. Prosječni urod zrna (t/ha) ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV% F_vrijednost LSD_0,05 LSD_0,01

2008. 5,04 8,30 8,69 9,48 8,55 8,99 9,65 8,31 9,41 8,84 9,18 8,55 8,98 9,11 9,83 9,60 8,85 8,63 9,10 8,61 9,03 8,63 10,34 10,75 9,68 9,65 10,28 9,41 6,35 7,38 7,60 10,88 8,75 9,97 9,58 9,14 10,42 9,34 10,42 9,80 12,74 12,42 0,725 0,961

2009. 2,90 5,25 6,08 6,48 7,11 6,97 6,40 6,05 6,36 7,01 6,81 6,53 6,38 6,26 6,58 7,13 6,54 6,16 5,39 6,14 5,94 6,50 7,27 7,36 6,94 7,10 7,45 6,60 4,73 5,06 4,71 7,03 6,58 6,42 6,17 6,77 8,01 7,12 7,21 7,23 15,00 16,81 0,748 0,992

2008./2009. 3,97 6,77 7,39 7,98 7,83 7,98 8,02 7,18 7,89 7,92 7,99 7,54 7,68 7,69 8,20 8,36 7,70 7,40 7,24 7,38 7,49 7,56 8,80 9,06 8,31 8,37 8,86 8,01 5,54 6,22 6,15 8,96 7,66 8,20 7,88 7,95 9,22 8,23 8,82 8,52 22,02 20,54 0,524 0,695 60


61

1 29 31 30 2 22 19 8 20 3 18 21 12 5 14 35 9 28 33 13 10 17 6 34 15 11 36 4 7 38 25 16 26 40 23 27 39

9,13 32 5,16 3,46 3,11 2,97 2,44 1,90 1,89 1,79 1,75 1,74 1,73 1,64 1,46 1,30 1,28 1,25 1,24 1,22 1,21 1,21 1,21 1,18 1,15 1,10 1,09 1,00 0,98 0,96 0,92 0,90 0,82 0,77 0,76 0,62 0,33 0,27 0,19

9,12 24 5,15 3,45 3,10 2,96 2,43 1,89 1,88 1,78 1,74 1,73 1,72 1,63 1,45 1,29 1,27 1,24 1,23 1,21 1,20 1,20 1,20 1,17 1,14 1,09 1,08 0,99 0,97 0,95 0,91 0,89 0,81 0,76 0,75 0,61 0,32 0,26 0,18

9,12 24 0,10 0,01 0,00 9,13 32 0,09 0,00 9,22 37 0,00

3,97 5,67 6,02 6,16 6,69 7,23 7,24 7,34 7,38 7,39 7,40 7,49 7,67 7,83 7,85 7,88 7,89 7,91 7,92 7,92 7,92 7,95 7,98 8,03 8,04 8,13 8,15 8,17 8,21 8,23 8,31 8,36 8,37 8,51 8,80 8,86 8,94

9,22 37 5,25 3,55 3,20 3,06 2,53 1,99 1,98 1,88 1,84 1,83 1,82 1,73 1,55 1,39 1,37 1,34 1,33 1,31 1,30 1,30 1,30 1,27 1,24 1,19 1,18 1,09 1,07 1,05 1,01 0,99 0,91 0,86 0,85 0,71 0,42 0,36 0,28

8,94 39 4,97 3,27 2,92 2,78 2,25 1,71 1,70 1,60 1,56 1,55 1,54 1,45 1,27 1,11 1,09 1,06 1,05 1,03 1,02 1,02 1,02 0,99 0,96 0,91 0,90 0,81 0,79 0,77 0,73 0,71 0,63 0,58 0,57 0,43 0,14 0,08 0,00

8,86 27 4,89 3,19 2,84 2,70 2,17 1,63 1,62 1,52 1,48 1,47 1,46 1,37 1,19 1,03 1,01 0,98 0,97 0,95 0,94 0,94 0,94 0,91 0,88 0,83 0,82 0,73 0,71 0,69 0,65 0,63 0,55 0,50 0,49 0,35 0,06 0,00

8,80 23 4,83 3,13 2,78 2,64 2,11 1,57 1,56 1,46 1,42 1,41 1,40 1,31 1,13 0,97 0,95 0,92 0,91 0,89 0,88 0,88 0,88 0,85 0,82 0,77 0,76 0,67 0,65 0,63 0,59 0,57 0,49 0,44 0,43 0,29 0,00

8,51 40 4,54 2,84 2,49 2,35 1,82 1,28 1,27 1,17 1,13 1,12 1,11 1,02 0,84 0,68 0,66 0,63 0,62 0,60 0,59 0,59 0,59 0,56 0,53 0,48 0,47 0,38 0,36 0,34 0,30 0,28 0,20 0,15 0,14 0,00

8,37 26 4,40 2,70 2,35 2,21 1,68 1,14 1,13 1,03 0,99 0,98 0,97 0,88 0,70 0,54 0,52 0,49 0,48 0,46 0,45 0,45 0,45 0,42 0,39 0,34 0,33 0,24 0,22 0,20 0,16 0,14 0,06 0,01 0,00

8,36 16 4,39 2,69 2,34 2,20 1,67 1,13 1,12 1,02 0,98 0,97 0,96 0,87 0,69 0,53 0,51 0,48 0,47 0,45 0,44 0,44 0,44 0,41 0,38 0,33 0,32 0,23 0,21 0,19 0,15 0,13 0,05 0,00

8,31 25 4,34 2,64 2,29 2,15 1,62 1,08 1,07 0,97 0,93 0,92 0,91 0,82 0,64 0,48 0,46 0,43 0,42 0,40 0,39 0,39 0,39 0,36 0,33 0,28 0,27 0,18 0,16 0,14 0,10 0,08 0,00

8,23 38 4,26 2,56 2,21 2,07 1,54 1,00 0,99 0,89 0,85 0,84 0,83 0,74 0,56 0,40 0,38 0,35 0,34 0,32 0,31 0,31 0,31 0,28 0,25 0,20 0,19 0,10 0,08 0,06 0,02 0,00

8,17 4 4,20 2,50 2,15 2,01 1,48 0,94 0,93 0,83 0,79 0,78 0,77 0,68 0,50 0,34 0,32 0,29 0,28 0,26 0,25 0,25 0,25 0,22 0,19 0,14 0,13 0,04 0,02 0,00

8,15 36 4,18 2,48 2,13 1,99 1,46 0,92 0,91 0,81 0,77 0,76 0,75 0,66 0,48 0,32 0,30 0,27 0,26 0,24 0,23 0,23 0,23 0,20 0,17 0,12 0,11 0,02 0,00

8,13 11 4,16 2,46 2,11 1,97 1,44 0,90 0,89 0,79 0,75 0,74 0,73 0,64 0,46 0,30 0,28 0,25 0,24 0,22 0,21 0,21 0,21 0,18 0,15 0,10 0,09 0,00

8,04 15 4,07 2,37 2,02 1,88 1,35 0,81 0,80 0,70 0,66 0,65 0,64 0,55 0,37 0,21 0,19 0,16 0,15 0,13 0,12 0,12 0,12 0,09 0,06 0,01 0,00

8,03 34 4,06 2,36 2,01 1,87 1,34 0,80 0,79 0,69 0,65 0,64 0,63 0,54 0,36 0,20 0,18 0,15 0,14 0,12 0,11 0,11 0,11 0,08 0,05 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

8,21 7 4,24 2,54 2,19 2,05 1,52 0,98 0,97 0,87 0,83 0,82 0,81 0,72 0,54 0,38 0,36 0,33 0,32 0,30 0,29 0,29 0,29 0,26 0,23 0,18 0,17 0,08 0,06 0,04 0,00

Tablica 37. Rezultati LSD testa za urod zrna 7,98 6 4,01 2,31 1,96 1,82 1,29 0,75 0,74 0,64 0,60 0,59 0,58 0,49 0,31 0,15 0,13 0,10 0,09 0,07 0,06 0,06 0,06 0,03 0,00

7,95 17 3,98 2,28 1,93 1,79 1,26 0,72 0,71 0,61 0,57 0,56 0,55 0,46 0,28 0,12 0,10 0,07 0,06 0,04 0,03 0,03 0,03 0,00

7,92 13 3,95 2,25 1,90 1,76 1,23 0,69 0,68 0,58 0,54 0,53 0,52 0,43 0,25 0,09 0,07 0,04 0,03 0,01 0,00 0,00

7,92 33 3,95 2,25 1,90 1,76 1,23 0,69 0,68 0,58 0,54 0,53 0,52 0,43 0,25 0,09 0,07 0,04 0,03 0,01 0,00

LSD0,01 = 0,511

LSD0,05 = 0,385

F test = 38,39**

7,92 10 3,95 2,25 1,90 1,76 1,23 0,69 0,68 0,58 0,54 0,53 0,52 0,43 0,25 0,09 0,07 0,04 0,03 0,01 0,00 0,00 0,00

7,91 28 3,94 2,24 1,89 1,75 1,22 0,68 0,67 0,57 0,53 0,52 0,51 0,42 0,24 0,08 0,06 0,03 0,02 0,00

7,89 9 3,92 2,22 1,87 1,73 1,20 0,66 0,65 0,55 0,51 0,50 0,49 0,40 0,22 0,06 0,04 0,01 0,00

7,88 35 3,91 2,21 1,86 1,72 1,19 0,65 0,64 0,54 0,50 0,49 0,48 0,39 0,21 0,05 0,03 0,00

7,85 14 3,88 2,18 1,83 1,69 1,16 0,62 0,61 0,51 0,47 0,46 0,45 0,36 0,18 0,02 0,00

7,83 5 3,86 2,16 1,81 1,67 1,14 0,60 0,59 0,49 0,45 0,44 0,43 0,34 0,16 0,00

7,67 12 3,70 2,00 1,65 1,51 0,98 0,44 0,43 0,33 0,29 0,28 0,27 0,18 0,00

7,49 21 3,52 1,82 1,47 1,33 0,80 0,26 0,25 0,15 0,11 0,10 0,09 0,00

7,40 18 3,43 1,73 1,38 1,24 0,71 0,17 0,16 0,06 0,02 0,01 0,00

7,38 20 3,41 1,71 1,36 1,22 0,69 0,15 0,14 0,04 0,00

7,34 8 3,37 1,67 1,32 1,18 0,65 0,11 0,10 0,00

7,24 19 3,27 1,57 1,22 1,08 0,55 0,01 0,00

18 Ružica 19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela

7,39 3 3,42 1,72 1,37 1,23 0,70 0,16 0,15 0,05 0,01 0,00

7,23 22 3,26 1,56 1,21 1,07 0,54 0,00

6,16 30 2,19 0,49 0,14 0,00

6,02 5,67 3,97 31 29 1 2,05 1,70 0,00 0,35 0,00 0,00

38 Edison 39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide

6,69 2 2,72 1,02 0,67 0,53 0,00


62

Grafikon 2. Varijabilnost uroda (t/ha) 40 ispitivanih genotipova ozime pšenice


5.1.9. Procjena različitosti ispitivanih genotipova na temelju količine bjelančevina i škroba u zrnu pšenice Analiza mjerenja količine bjelančevina u zrnu pšenice ispitivanih genotipova pokazala je da se količina bjelančevina u zrnu u 2008. godini je varirala od 10,1% (BC Patria) do 16,9% (U1), a koeficijent varijacije iznosio je 9,43%. U 2009. godini prosječna količina bjelančevina u zrnu kretala se od 11,4% u genotipa Sana do 16,4% u genotipa U1. Koeficijent varijacije iznosio je 8,32% (Tablica 38). Obzirom na dvogodišnji prosjek u 17,5% ispitivanih genotipova količina bjelančevina kretala se od 11% do 12%, u 42,5% između 12 i 13%, u 35% genotipova između 13 i 15%, dok su samo dva genotipa, Divana i U1, (5 %) imala količinu bjelančevina u rasponu od 15% do 17%. Analiza rezultata mjerenja količine škroba (Tablica 38) ispitivanih genotipova pokazala je da se prosječna količina škroba u zrnu u 2008. godini kretala od 64,1% u genotipa Divane do 69,3% u genotipa Zlate, a koeficijent varijacije iznosio je 1,57%. U 2009. godini prosječna količina škroba se kretala od 61,6% (Divana) do 67,7% (Zlatna Dolina). Koeficijent varijacije iznosio je 2,19%. Obzirom na dvogodišnji prosjek ispitivane genotipove možemo svrstati u četiri skupine. Tako su 62,5% genotipova imali količinu škroba od 65-66%, 30% genotipova 67-68%, a samo dva genotipa (5%) imali su količinu škroba od 63-64%. Genotip Divana imao je najmanju količinu škroba (62,9%).

63


Tablica 38. Količina bjelančevina i škroba u zrnu ispitivanih genotipova 2008. Br.

genotip

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig CV%

bjelančevine 16,9 13,4 13,2 12,2 13,0 12,2 11,7 12,9 11,6 12,3 12,0 12,4 12,9 12,5 11,2 12,1 12,5 13,1 11,8 13,0 12,6 13,3 11,7 11,4 12,1 12,6 11,4 11,3 14,9 13,3 13,3 10,1 10,7 11,5 12,7 14,4 11,5 13,6 12,5 12,6 9,43

2009. škrob 65,4 68,1 68,0 67,7 66,6 68,9 68,8 68,4 69,0 68,4 68,1 68,9 67,9 68,9 69,3 68,8 68,4 67,9 68,0 67,8 67,3 67,7 68,6 68,3 69,0 67,3 67,6 67,5 64,1 68,2 66,5 68,3 66,3 67,5 67,8 66,0 67,9 66,6 67,1 67,5 2,19

bjelančevine 15,8 16,5 14,3 13,0 14,4 12,3 12,6 13,6 12,6 13,5 13,3 13,0 14,2 13,0 12,4 12,7 12,7 13,2 13,6 13,3 13,2 13,6 12,5 11,5 12,5 13,6 11,4 11,9 15,2 13,6 13,3 12,5 12,35 12,0 13,9 14,7 13,15 15,1 12,6 12,4 8,32

Prosjek škrob 62,6 65,4 65,5 63,9 65,2 65,1 67,4 66,9 66,4 63,2 62,7 64,8 66,5 66,0 65,8 66,8 65,1 65,2 67,7 65,1 64,5 65,8 65,7 65,8 66,0 64,6 64,2 63,9 61,6 65,3 63,6 63,9 66,0 63,7 64,8 64,2 62,0 63,2 65,8 63,8 1,57

bjelančevine 16,4 15,0 13,8 12,6 13,7 12,3 12,2 13,3 12,1 12,9 12,7 12,7 13,6 12,8 11,8 12,4 12,6 13,2 12,7 13,2 12,9 13,5 12,1 11,5 12,3 13,1 11,4 11,6 15,1 13,5 13,3 11,3 11,5 11,8 13,3 14,6 12,3 14,4 12,6 12,5 8,90

škrob 64,0 66,8 66,8 65,8 65,9 67,0 68,1 67,7 67,7 65,8 65,4 66,9 67,2 67,5 67,6 67,8 66,8 66,6 67,9 66,5 65,9 66,8 67,2 67,1 67,5 66,0 65,9 65,7 62,9 66,8 65,1 66,1 66,2 65,6 66,3 65,1 65,0 64,9 66,5 65,7 1,65 64


5.2 Procjena različitosti ispitivanih genotipova na temelju morfoloških podataka Analiza genotipova pšenice na temelju ocjena 10 morfoloških svojstava izdvojila je genotip U1 kao najudaljeniji i različitiji od ostalih ispitivanih genotipova. Svojstvo br. 16 (boja klasa) je bilo jednako za sve genotipove, većina je imala bijelu boju klasa, osim u genotipa Osječka Crvenka i Libellula koji su imali obojan klas u zriobi. Obzirom na svojstvo boje zrna (br. 24.) samo je sedam genotipova imalo bijelo zrno dok su ostala 33 genotipa imali crvenu boju zrna (Tablica 39). Na temelju utvrđenih kvalitativnih vrijednosti izrađena je matrica, a na temelju nje je izračunat koeficijent Roger-Tanimotove sličnosti (RTij) između ispitivanih genotipova (Tablica

70, prilog 2). Na temelju matrice sličnosti izrađen je dendogram koristeći UPGMA metodu (Grafikon 3). Prosječna sličnost (RTij) između svih ispitivanih genotipova iznosila je 0,26. Najveći

koeficijent sličnosti (RTij=0,82) utvrđen je između genotipova Katarina i BC Patria te

genotipova Alka i Aida. Prosječna sličnost (RTij) genotipa U1 u usporedbi sa svim ispitivanim

genotipovima je najmanja i iznosi 0,13 što ga čini morfološki najrazličitijim genotipom.

Na dendogramu (Grafikon 3) genotipovi se mogu razdvojiti na četiri skupine. Genotip U1 se izdvaja kao posebna. Drugu skupinu čini 11 genotipova, koji se unutar te skupine mogu podijeliti na još dvije. Podskupinu 2a čine pet genotipova (Osječka Crvenka, Lucija, Zlatna Dolina, Zlata i Seka), dok podskupinu 2b čine šest genotipova (Srpanjka, Renata, Pipi, Libellula, Anđelka i Mihaela). Treću skupinu čini 21 genotip, koja se može podijeliti na još tri podskupine. Deset genotipova su svrstani u podskupinu 3a, od koji su Alka i Aida morfološki jednake. Podskupinu 3b čine šest genotipova, prvi je Soissons, a posljednji Katarina i BC Patria koje se morfološki ne razlikuju te genotip Ružica koji je pridružen toj podskupini. Unutar podskupine 3c su genotipovi Bezostaja, Felix te Janica i Bastide koji se odvajaju od ostalih genotipova treće skupine. U četvrtoj skupini izdvajaju se svi austrijski genotipovi (Eurofit, Ludwig, Edison, Antonius i Valerius) te dva hrvatska genotipa Divana i Ilirija.

65


Tablica 39. Matrica ispitivanih morfoloških svojstava sorata prema UPOV-oj klasifikaciji za DUS Br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

2. 2 4 5 2 6 3 5 3 3 5 3 5 5 5 5 4 2 4 3 3 3 3 4 3 4 3 4 4 4 3 7 4 5 5 7 5 9 5 4 5

5. 6 3 3 3 3 1 3 4 1 1 5 4 5 3 2 3 2 2 5 5 3 4 4 5 3 4 4 4 4 1 6 4 5 4 8 9 6 9 9 9

6. 3 5 7 7 7 3 5 7 5 5 7 5 7 9 7 5 4 4 5 7 6 6 5 7 4 5 7 7 5 3 9 5 7 1 7 4 7 6 5 5

Ocjene prema UPOV-u* 7. 9. 12. 14. 15. 3 9 1 2 9 3 3 5 2 3 5 3 5 2 3 5 3 5 2 1 5 3 7 2 1 3 1 3 2 1 5 3 5 2 1 5 3 5 2 1 3 3 7 2 1 3 1 5 2 1 5 3 5 2 3 3 1 5 3 1 5 5 4 3 3 9 1 5 2 5 3 1 5 2 3 5 1 6 2 1 5 1 7 2 1 6 3 4 2 5 3 3 5 2 3 5 3 3 2 7 6 3 5 1 5 5 3 7 2 3 4 3 5 2 5 6 3 5 2 3 3 1 6 2 3 4 3 6 2 5 7 3 5 2 5 5 3 5 2 5 5 5 4 3 3 3 5 5 1 1 7 5 5 2 5 4 3 5 2 7 5 3 7 2 3 1 3 4 3 5 5 5 7 3 5 4 5 3 3 7 7 3 7 1 5 4 5 5 3 7 4 5 4 2 5 7 7 5 2 7

16. 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1

24. 1 2 2 2 2 2 2 2 1 2 2 2 2 2 1 2 2 2 1 2 2 2 2 2 1 2 2 1 2 2 2 2 2 2 2 2 2 2 1 2

* 2. Biljka: tip busanja, 5. Vrijeme klasanja, 6. List zastavičar: voštana prevlaka na rukavcu, 7. Klas: voštanost, 9. Biljka: visina, 12. Klas: zbijenost, 14. Klas: duljina, 14. Osje ili produžetak pljevica: prisutnost, 16. Klas: boja i 24. Zrno: boja 66


Grafikon 3. Dendogram UPGMA za 40 genotipova na temelju matrice genetske sliÄ?nosti morfoloĹĄkih podataka.

67


5.3. Procjena različitosti ispitivanih genotipova na temelju molekularnih podataka 5.3.1. Različitost visokomolekularnih podjedinica glutenina pšenice Analizom sastava i udjela visokomolekularnih (HMW) podjedinica glutenina (GS) ispitivanih genotipova (35) pšenice utvrđeno je da je nulti alel (N) bio najčešća podjedinica glutenina na Glu-A1 lokusu, ukupno 13 genotipova ili 37,14%, u 12 genotipova utvrđena je podjedinica 2* (34,29%), a u 10 genotipova utvrđena je podjedinica 1 (28,57%). Na lokusu Glu-B1 najčešće GS su bile 7+9 (14 ili 40 %), slijedile su 7+8 s frekvencijom od 37,1%, u četiri genotipa su utvrđene GC 6+8 (11,4%), dva genotipa su imala GS 17+18, po jedan genotip je nosio GS 14+15 (U1) te GS 20 (Libellula). Na Glu-D1 lokusu najzastupljenija je bila GS 2+12, ukupno 18 genotipova ili 51,43%, slijedile su GS 5+10 sa 16 genotipova (45,7%), dok je GS 3+12 imao samo genotip Bastide (Tablica 40). Genotipovi s najvećim brojem bodova (10) su Aida, Pipi, Ilirija, Felix, Katarina i Soissons, slijede genotipovi s devet bodova Demetra, Seka, Bezostaja, Divana, BC Patria, Antonius, Edison i Eurofit. Genotip U1 ostvario je ocjenu 5, a genotip Sana je ostvarila najmanji broj bodova (4). Na temelju matrice HMW GS izračunat je genetski varijacijski index He za svaki lokus (Tablica 41). Prosječna genetska različitost (He) unutar svih ispitivanih genotipova iznosila je 0,31, za lokus Glu-A1 je bila najveća i iznosila 0,44, za lokus Glu-B1 je bila najmanja (0,23), dok je za lokus Glu-D1 iznosila 0,35. Klaster analiza obavljena je pomoću koeficijenta sličnosti te je na temelju matrice izrađen dendogram pomoću UPGMA (Grafikon 4). Ispitivani genotipovi grupirali su se prema Glu-D1 lokusu: prvu skupinu predstavlja ukupno 18 genotipova sa podjedinicama glutenina 2+12, a drugu 17 genotipova sa podjednicama glutenina 5+10. Posebno se izdvojio genotip Bastide koji je jedini imao podjedinicu glutenina 3+12 na Glu-D1 lokusu.

68


Tablica 40. Varijabilnost sastava i udjela HMW podjedinica glutenina genotipova pšenice Visokomolekularne podjedinice glutenina Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Aida Pipi Ilirija Felix Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Antonius Bastide Edison Eurofit Ludwig

Glu-A1

Glu-B1

Glu-D1

Glu 1 – bodovi

2* N N 1 1 N 1 N N 2* 2* 2* 2* 1 1 2* N N N 2* N 1 N N 2* 1 2* 1 2* 2* 1 N 2* 1 N

14+15 7+9 7+8 7+9 7+8 7+8 7+9 7+9 7+8 17+18 7+8 7+8 7+8 7+8 7+9 6+8 7+9 7+9 7+8 7+8 7+8 7+9 6+8 7+8 7+9 20 7+9 7+9 6+8 7+8 7+9 17+18 7+9 7+9 6+8

2+12 5+10 2+12 2+12 2+12 2+12 5+10 2+12 2+12 5+10 5+10 5+10 5+10 2+12 2+12 2+12 2+12 2+12 2+12 5+10 2+12 5+10 2+12 2+12 5+10 2+12 5+10 5+10 2+12 5+10 5+10 3+12 5+10 5+10 5+10

5 7 6 5 8 6 9 5 6 10 10 10 10 8 7 6 5 5 6 10 6 9 4 6 9 6 9 9 6 10 9 6 9 9 6

69


Tablica 41. Frekvencije HMW podjedinica glutenina (GS) u ispitivanim genotipovima i genetska razliÄ?itost (He) Glu-A1 (He=0,44) Podjedinica Alel 1 a 2* b N c

Glu-B1 (He=0,23) Frekv. % Podjedinica Alel 28,6 7+8 b 34,3 7+9 c 37,1 6+8 d 20 e 14+15 h 17+18 i

Glu-D1 (He=0,35) Frekv. % Podjedinica Alel 37,1 2+12 a 40,0 3+12 b 11,4 5+10 d 2,8 2,8 5,7

Frekv. % 51,4 2,8 45,7

Grafikon 4. Dendogram na temelju matrice genetske udaljenosti sastava HMW podjedinica glutenina. 70


5.3.2. Različitost sadržaja škroba u zrnu pšenice U provedenom istraživanju utvrđene su statistički visoko opravdane razlike (p<0,01) između ispitivanih genotipova za svojstvo sastava škroba u zrnu pšenice (Tablica 42). Korišteni su transformirani podaci za količinu amiloze i amilopektina prilikom izračunavanja ANOVA-e. Tablica 42. Analiza varijance omjera amiloze i amilopektina u zrnu pšenice ispitivanih genotipova Izvor variranja Genotip Ponavljanje

Stupnjevi slobode 39 3

F vrijednost 374,88 0,66

Pr>F ** n.s.

**=statistički značajno na razini P<0,01; *=statistički značajno na razini P<0,05; n.s.=nije statistički značajno

Najmanji omjer amiloze i amilopektina (Am/Amp) utvrđen je u genotipa Bezostaja (0,06), a najveći omjer Am/Amp utvrđen je u genotipa Srpanjke (1,00) (Tablica 43). Prosječna vrijednost količine amiloze za sve genotipove iznosila je 20,73%, dok je za amilopektin iznosila 79,27%. Koeficijent varijacije omjera Am/Amp iznosio je 6,94%. Statistički visoko opravdano najveći omjer, odnosno najveći sadržaj amiloze i najmanji sadržaj amilopektina u odnosu na sve ispitivane genotipove, utvrđen je u sorte Srpanjka (Tablica 44). Slijede genotipovi Demetra i Slavonija između kojih nije bilo statistički opravdane razlike. Genotip Bezostaja imao je statistički visoko opravdano najmanji omjer, odnosno najmanji sadržaj amiloze i najveći sadržaj amilopektina u odnosu na 38 ispitivanih genotipova. U odnosu na genotipove Super Žitarka i Valerius nisu postojale statistički opravdane razlike. Većina genotipova (22) je imala sadržaj amiloze u rasponu od 15% do 35%.

71


Tablica 43. Količina i omjer amiloze i amilopektina u zrnu pšenice ispitivanih genotipova Red. br. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40.

Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

%amiloze 9,52 15,55 26,20 45,92 42,74 50,02 46,39 8,26 22,59 17,18 28,22 23,53 20,99 18,89 14,15 25,23 23,72 28,80 13,88 13,16 14,58 16,67 13,49 13,49 10,93 14,35 15,94 15,01 19,37 18,74 5,63 27,27 26,43 12,72 7,56 10,40 18,96 29,49 24,23 16,75

%amilopektina 90,48 84,45 73,80 54,08 57,26 49,98 53,61 91,74 77,41 82,82 71,78 76,47 79,01 81,11 85,85 74,77 76,28 71,20 86,12 86,84 85,42 83,33 86,51 86,51 89,07 85,65 84,06 84,99 80,63 81,26 94,37 72,73 73,57 87,28 92,44 89,60 81,04 70,51 75,77 83,25 CV% F_vrijednost LSD_0,05 LSD_0,01

Omjer Am/Amp 0,11 0,18 0,36 0,85 0,75 1,00 0,87 0,09 0,29 0,21 0,39 0,31 0,27 0,24 0,17 0,35 0,31 0,41 0,16 0,15 0,17 0,20 0,16 0,16 0,13 0,17 0,19 0,18 0,24 0,23 0,06 0,38 0,36 0,15 0,08 0,12 0,24 0,42 0,33 0,20 6,94 374,88 0,0304 0,0402 72


73

31 35 8 1 36 25 34 20 23 24 19 15 26 21 28 2 27 40 22 10 30 37 14 29 13 9 12 17 39 16 3 33 32 11 18 38 5 4

7 0,134 6 0

0,06 0,082 0,09 0,113 0,116 0,127 0,146 0,152 0,156 0,156 0,161 0,165 0,168 0,171 0,177 0,184 0,19 0,198 0,2 0,208 0,231 0,238 0,24 0,241 0,266 0,292 0,308 0,311 0,329 0,346 0,355 0,355 0,375 0,393 0,405 0,418 0,747 0,85

0,867 1,001

1,001 6 0,941 0,919 0,911 0,888 0,885 0,874 0,855 0,849 0,845 0,845 0,84 0,836 0,833 0,83 0,824 0,817 0,811 0,803 0,801 0,793 0,77 0,763 0,761 0,76 0,735 0,709 0,693 0,69 0,672 0,655 0,646 0,646 0,626 0,608 0,596 0,583 0,254 0,151

0

0,867 7 0,807 0,785 0,777 0,754 0,751 0,74 0,721 0,715 0,711 0,711 0,706 0,702 0,699 0,696 0,69 0,683 0,677 0,669 0,667 0,659 0,636 0,629 0,627 0,626 0,601 0,575 0,559 0,556 0,538 0,521 0,512 0,512 0,492 0,474 0,462 0,449 0,12 0,017

0,85 4 0,79 0,768 0,76 0,737 0,734 0,723 0,704 0,698 0,694 0,694 0,689 0,685 0,682 0,679 0,673 0,666 0,66 0,652 0,65 0,642 0,619 0,612 0,61 0,609 0,584 0,558 0,542 0,539 0,521 0,504 0,495 0,495 0,475 0,457 0,445 0,432 0,103 0

0,747 5 0,687 0,665 0,657 0,634 0,631 0,62 0,601 0,595 0,591 0,591 0,586 0,582 0,579 0,576 0,57 0,563 0,557 0,549 0,547 0,539 0,516 0,509 0,507 0,506 0,481 0,455 0,439 0,436 0,418 0,401 0,392 0,392 0,372 0,354 0,342 0,329 0

0,418 38 0,358 0,336 0,328 0,305 0,302 0,291 0,272 0,266 0,262 0,262 0,257 0,253 0,25 0,247 0,241 0,234 0,228 0,22 0,218 0,21 0,187 0,18 0,178 0,177 0,152 0,126 0,11 0,107 0,089 0,072 0,063 0,063 0,043 0,025 0,013 0

0,405 18 0,345 0,323 0,315 0,292 0,289 0,278 0,259 0,253 0,249 0,249 0,244 0,24 0,237 0,234 0,228 0,221 0,215 0,207 0,205 0,197 0,174 0,167 0,165 0,164 0,139 0,113 0,097 0,094 0,076 0,059 0,05 0,05 0,03 0,012 0

0,393 11 0,333 0,311 0,303 0,28 0,277 0,266 0,247 0,241 0,237 0,237 0,232 0,228 0,225 0,222 0,216 0,209 0,203 0,195 0,193 0,185 0,162 0,155 0,153 0,152 0,127 0,101 0,085 0,082 0,064 0,047 0,038 0,038 0,018 0

0,375 32 0,315 0,293 0,285 0,262 0,259 0,248 0,229 0,223 0,219 0,219 0,214 0,21 0,207 0,204 0,198 0,191 0,185 0,177 0,175 0,167 0,144 0,137 0,135 0,134 0,109 0,083 0,067 0,064 0,046 0,029 0,02 0,02 0

0,355 3 0,295 0,273 0,265 0,242 0,239 0,228 0,209 0,203 0,199 0,199 0,194 0,19 0,187 0,184 0,178 0,171 0,165 0,157 0,155 0,147 0,124 0,117 0,115 0,114 0,089 0,063 0,047 0,044 0,026 0,009 0 0

0,346 16 0,286 0,264 0,256 0,233 0,23 0,219 0,2 0,194 0,19 0,19 0,185 0,181 0,178 0,175 0,169 0,162 0,156 0,148 0,146 0,138 0,115 0,108 0,106 0,105 0,08 0,054 0,038 0,035 0,017 0

0,329 39 0,269 0,247 0,239 0,216 0,213 0,202 0,183 0,177 0,173 0,173 0,168 0,164 0,161 0,158 0,152 0,145 0,139 0,131 0,129 0,121 0,098 0,091 0,089 0,088 0,063 0,037 0,021 0,018 0

0,311 17 0,251 0,229 0,221 0,198 0,195 0,184 0,165 0,159 0,155 0,155 0,15 0,146 0,143 0,14 0,134 0,127 0,121 0,113 0,111 0,103 0,08 0,073 0,071 0,07 0,045 0,019 0,003 0

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

0,355 33 0,295 0,273 0,265 0,242 0,239 0,228 0,209 0,203 0,199 0,199 0,194 0,19 0,187 0,184 0,178 0,171 0,165 0,157 0,155 0,147 0,124 0,117 0,115 0,114 0,089 0,063 0,047 0,044 0,026 0,009 0 0

0,308 12 0,248 0,226 0,218 0,195 0,192 0,181 0,162 0,156 0,152 0,152 0,147 0,143 0,14 0,137 0,131 0,124 0,118 0,11 0,108 0,1 0,077 0,07 0,068 0,067 0,042 0,016 0

0,292 9 0,232 0,21 0,202 0,179 0,176 0,165 0,146 0,14 0,136 0,136 0,131 0,127 0,124 0,121 0,115 0,108 0,102 0,094 0,092 0,084 0,061 0,054 0,052 0,051 0,026 0

0,266 13 0,206 0,184 0,176 0,153 0,15 0,139 0,12 0,114 0,11 0,11 0,105 0,101 0,098 0,095 0,089 0,082 0,076 0,068 0,066 0,058 0,035 0,028 0,026 0,025 0

0,241 29 0,181 0,159 0,151 0,128 0,125 0,114 0,095 0,089 0,085 0,085 0,08 0,076 0,073 0,07 0,064 0,057 0,051 0,043 0,041 0,033 0,01 0,003 0,001 0

0,238 37 0,178 0,156 0,148 0,125 0,122 0,111 0,092 0,086 0,082 0,082 0,077 0,073 0,07 0,067 0,061 0,054 0,048 0,04 0,038 0,03 0,007 0

LSD0,05 = 0,0402

LSD0,05 = 0,0304

F test = 374,88**

0,24 14 0,18 0,158 0,15 0,127 0,124 0,113 0,094 0,088 0,084 0,084 0,079 0,075 0,072 0,069 0,063 0,056 0,05 0,042 0,04 0,032 0,009 0,002 0

0,231 30 0,171 0,149 0,141 0,118 0,115 0,104 0,085 0,079 0,075 0,075 0,07 0,066 0,063 0,06 0,054 0,047 0,041 0,033 0,031 0,023 0

0,208 10 0,148 0,126 0,118 0,095 0,092 0,081 0,062 0,056 0,052 0,052 0,047 0,043 0,04 0,037 0,031 0,024 0,018 0,01 0,008 0

0,2 22 0,14 0,118 0,11 0,087 0,084 0,073 0,054 0,048 0,044 0,044 0,039 0,035 0,032 0,029 0,023 0,016 0,01 0,002 0

0,198 40 0,138 0,116 0,108 0,085 0,082 0,071 0,052 0,046 0,042 0,042 0,037 0,033 0,03 0,027 0,021 0,014 0,008 0

0,19 27 0,13 0,108 0,1 0,077 0,074 0,063 0,044 0,038 0,034 0,034 0,029 0,025 0,022 0,019 0,013 0,006 0

0,177 28 0,117 0,095 0,087 0,064 0,061 0,05 0,031 0,025 0,021 0,021 0,016 0,012 0,009 0,006 0

0,171 21 0,111 0,089 0,081 0,058 0,055 0,044 0,025 0,019 0,015 0,015 0,01 0,006 0,003 0

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

0,184 2 0,124 0,102 0,094 0,071 0,068 0,057 0,038 0,032 0,028 0,028 0,023 0,019 0,016 0,013 0,007 0

0,165 15 0,105 0,083 0,075 0,052 0,049 0,038 0,019 0,013 0,009 0,009 0,004 0

39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison

0,168 26 0,108 0,086 0,078 0,055 0,052 0,041 0,022 0,016 0,012 0,012 0,007 0,003 0

0,161 19 0,101 0,079 0,071 0,048 0,045 0,034 0,015 0,009 0,005 0,005 0

0,156 23 0,096 0,074 0,066 0,043 0,04 0,029 0,01 0,004 0 0

0,156 24 0,096 0,074 0,066 0,043 0,04 0,029 0,01 0,004 0

Tablica 44. Rezultati LSD testa za omjer amiloze i amilopektina u ispitivanih genotipova ozime pšenice 0,152 20 0,092 0,07 0,062 0,039 0,036 0,025 0,006 0

0,146 34 0,086 0,064 0,056 0,033 0,03 0,019 0

0,127 25 0,067 0,045 0,037 0,014 0,011 0

0,116 36 0,056 0,034 0,026 0,003 0

0,113 0,09 0,082 0,06 1 8 35 31 0,053 0,03 0,022 0 0,031 0,008 0 0,023 0 0


5.3.3. Procjena genetske različitosti na razini DNA 5.3.3.1. Procjena i izračun genetske udaljenosti ispitivanih genotipova pomoću mikrosatelita Na temelju obavljene molekularne analize genetske različitosti ispitivanih genotipova ozime pšenice umnoženo je ukupno 108 različitih alela koristeći set 26 mikrosatelitnih markera. Amplificirano je ukupno 1022 umnožena proizvoda ili 98,27%, od ukupno 1040, a u 18 slučajeva zabilježena je neuspjela amplifikacija (1,73%). Ishodišna matrica umnoženih alela u parovima baza ispitivanih genotipova prikazana je u tablici 71 (prilog 2). Mikrosateliti gwm2, gwm68, gwm121, gwm311, i gwm573 su se amplificirali na dva nevezana lokusa, gmw497 na tri, a ostali su bili specifični za pojedini lokus. Polimorfnost mikrosatelitnih markera i genetska različitost analizirana je koristeći broj alela (Na), gensku različitosti(He) i polimorfizam (PIC). Broj alela po mikrosatelitu kretao se od dva (gwm311_1) do 11 (gwm609), a prosječni broj iznosio je 3,88 alela. Najveća genska različitost (He=0,81) kao i najveći PIC (0,79) utvrđeni su mikrosatelitom gwm609, a najmanja genska različitost (He=0,26) i najmanji PIC (0,22) mikrosatelitom gwm311_1. Prosječna genska različitost unutar ispitivanih genotipova iznosila je 0,57, a polimorfizam 0,50 (Tablica 45). Između ostalih mikrosatelitnih početnica u istraživanju je korišten i mikrosatelit gwm261 kojim su umnoženi aleli na lokusu Xgwm261 koji je udaljen 0,6 cM od lokusa gena Rht8. Alel duljine 192 parova baza (pb) utvrđen je za ukupno 28 ispitivanih genotipova, od kojih su 26 hrvatskih te od stranih talijanski genotip Libellula i ruski Bezostaja. U šest sorata je utvrđen alel duljine 174 pb, od kojih su tri hrvatske (Aida, Ilirija i Felix), dvije austrijske (Edison i Ludwig) te francuski genotip Soissons. Alel od 165 pb utvrđen je u četiri sorte (U1, Osječka 20, Bastide i Eurofit), dok je jedinstveni alel od 196 pb utvrđen u dva austrijska genotipa (Valerius i Antonius). Ishodišna matrica korištena je za izračun matrice genetske udaljenosti koristeći Rogers-ovu udaljenost (Tablica 72, prilog 2). Prosječna genetska udaljenost (dij) između svih ispitivanih genotipova iznosila je 0,66. Najmanja udaljenost utvrđena je između genotipova Super Žitarka i Barbara (dij=0,21), dok je najveća udaljenost utvrđena između genotipova Zlatna Dolina i Lela (dij=0,98). Na temelju matrice genetske udaljenosti između svih ispitivanih genotipova pomoću UPGMA metode izrađen je dendogram (Grafikon 5). 74


Tablica 45. Mjesto lokusa na kromosomima pšenice, broj alela (Na), genska različitost (He) i polimorfizam (PIC) za 26 mikrosatelitnih markera Mikrosatelitni marker gwm2_1 gwm2_2 gwm11 gwm55 gwm68_1 gwm68_2 gwm121_1 gwm121_2 gwm135 gwm149 gwm169 gwm186 gwm257 gwm261 gwm311_1 gwm311_2 gwm458 gwm497_1 gwm497_2 gwm497_3 gwm573_1 gwm573_2 gwm609 gwm610 gwm626 gwm642

Lokus 3A 3D 1B 6D 5B 7B 5D 7D 1A 4B 6A 5A 2B 2D 2A 2D 1D 1A 2A 3D 7A 7B 4D 4A 6B 1D Prosjek

Na 3 3 6 2 3 4 2 3 4 5 6 4 3 4 2 3 3 4 6 2 3 5 11 3 4 3 3,88

He 0,405 0,591 0,694 0,495 0,620 0,622 0,495 0,646 0,706 0,411 0,723 0,716 0,509 0,475 0,255 0,304 0,646 0,638 0,711 0,469 0,659 0,565 0,814 0,624 0,444 0,541 0,568

PIC 0,368 0,522 0,632 0,372 0,548 0,551 0,372 0,574 0,649 0,381 0,677 0,662 0,402 0,440 0,222 0,282 0,571 0,564 0,657 0,359 0,585 0,519 0,787 0,553 0,365 0,455 0,503

Prema prikazanom dendogramu sve genotipove je bilo moguće razlikovati. Najmanje udaljenosti utvrđene su, osim za gore navedene Super Žitarku i Barbaru, između Slavonije i Golubice (dij=0,27). Ispitivane genotipove možemo svrstati u pet skupina. Prvu skupinu čini 10 genotipova koji su razvrstani u dvije podskupine. U podskupinu 1a svrstano je sedam genotipova, od kojih su pet podrijetlom iz BC instituta te dva genotipa Poljoprivrednog instituta u Osijeku (Alka i Katarina). Podskupinu 1b čine tri genotipa Žitarka, Super Žitarka i Barbara. U drugu skupinu svrstano je ukupno 20 genotipova u dvije podskupine. Podskupinu 2a čine pet genotipova Osječka 20, Slavonija, Golubica, Pipi i Lela. Podskupinu 2b možemo 75


podijeliti na dva dijela. Prvi koju čini 11 genotipova, od koji je Lela prvi, a posljednji Demetra te drugi dio koji čine četiri genotipa (Aida, Srpanjka, Libellula i Osječka Crvenka). Treću skupinu čini genotip Bastide. U četvrtu skupinu svrstano je osam genotipova u dvije podskupine, od kojih dva Divana i Antonius pripadaju podskupini 4a, a skupini 4b pripadaju četiri austrijska (Eurofit, Ludwig, Edison i Valerius), jedan francuski (Soissons) i jedan hrvatski genotip (Ilirija). Genotip U1 pripada posljednjoj petoj skupini. U Tablici 46. prikazan je broj mikrosatelitnih alela u 40 ispitivanih genotipova podijeljenih u tri različita razdoblja prema godinama priznavanja. Također je prikazan broj izgubljenih i novootkrivenih alela u odnosu na razdoblje od 1936. do 1980. godine. Ukupan broj izgubljenih alela za razdoblje od 1981. do 1999. je četiri, dok je za razdoblje od 2000. do 2008. veći i iznosi šest alela. U drugom razdoblju zabilježen je porast novih alela za devet, dok je u trećem razdoblju također zabilježen rast i to za 10 alela, tako je ukupno veći broj novih nego izgubljenih alela (9) s obzirom na prvo razdoblje priznavanja genotipova.

Tablica 46. Broj mikrosatelitnih alela u 40 ispitivanih genotipova prema razdobljima oplemenjivanja Razdoblje oplemenjivanja

Broj genotipova

1. 1936. – 1980.

Broj alela Ukupno

Izgubljeni

Novi

6

74

-

-

2. 1981. – 1999.

13

78

4

9

3. 2000. – 2008.

20

79

6

10

76


Grafikon 5. UPGMA dendogram za 40 genotipova temeljem matrice genetske udaljenosti (dij).

77


5.3.3.2. Procjena i izračun genetske udaljenosti ispitivanih genotipova pomoću AFLP markera Pomoću četiri kombinacije AFLP početnica proizvedeno je ukupno 108 polimorfnih fragmenata. Najviše polimorfnih fragmenata je proizvedeno kombinacijom SseTC/MseGA (33), a najmanje SseTC/MseAT (20) (Tablica 47). Tablica 47. Odabrane kombinacije početnica za AFLP analizu, broj polimorfnih fragmenata i PIC Kombinacija AFLP

Broj polimorfnih

Broj specifičnih

početnica

fragmenata (npi)

fragmenata

SseTC/MseAT

20

SseGC/MseAT

PIC

He

1

0,34

0,44

29

4

0,33

0,42

SseTC/MseGA

33

3

0,35

0,45

SseGC/MseGA

26

5

0,34

0,43

Broj polimorfnih fragmenata se kretao od 20 do 33, sa prosječnom vrijednosti od 27 po kombinaciji početnica. Najveći PIC (0,34) utvrđen je za kombinaciju početnica SseTC/MseGA, najmanji od 0,33 za SseGC/MseAT, dok je prosječna vrijednost polimorfizma iznosila 0,34. Za neke ispitivane genotipove utvrđeni su specifični AFLP fragmenti. Tako je kombinacijom SseGC/MseAT utvrđen specifični AFLP fragment duljine 215 parova baza (pb) u pet genotipova (Žitarka, Super Žitarka, Barbara, Katarina i Soissons). Trećom kombinacijom SseTC/MseGA utvrđen je specifični fragment duljine 530 pb u osam genotipova (Žitarka, Super Žitarka, Felix, Barbara, BC Patria, Valerius, Edison i Ludwig). Specifični fragment duljine 186 pb utvrđen četvrtom kombinacijom AFLP početnica (SseGC/MseGA) pojavio se samo u pet genotipova (Žitarka, Super Žitarka, Barbara, Mihaela i Edison), a fragment duljine 348 pb u osam genotipova (Demetra, Aida, Zlata, Katarina, Alka, Adriana, Valerius i Edison). Ishodišna binarna matrica iskorištena je za izračun genetske sličnosti pomoću Dice koeficijenta (Sij) između ispitivanih genotipova (Tablica 73, prilog 2). Prosječna sličnost (Sij) između ispitivanih genotipova iznosila je 0,54. Najveći koeficijent genetske sličnosti (Sij) 78


utvrđen je za genotipove Žitarka i Barbara i iznosio je 0,82, a najmanji za genotipove Aida i Osječka 20 (Sij=0,20). Na temelju matrice genetske sličnosti između svih ispitivanih genotipova pomoću UPGMA metode izrađen je dendogram (Grafikon 6).

Grafikon 6. UPGMA dendogram za 40 genotipova temeljem matrice genetske sličnosti (Sij).

79


Prema prikazanom dendogramu sve genotipove je bilo moguće razlikovati. Najveći koeficijenti sličnosti utvrđeni su, osim za gore navedene Žitarku i Barbaru, između Super Žitarke i Barbare, te Zlate i Demetre (Sij=0,81). Ispitivane genotipove možemo svrstati u šest skupina. Prvu skupinu čine 33 genotipa koji su međusobno najsličniji i razvrstani su u četiri podskupine. U podskupinu 1a svrstano je 16 genotipova, podijeljenih na još dvije podskupine 1a1 i 1 a2. U poskupini 1a1 su Žitarka, Barbara i Super Žitarka između kojih prosječna sličnost (Sij) iznosi 0,81, zatim genotipovi Libellula i Edison te pridruženi genotip U1, zatim slijede tri austrijska genotipa (Ludwig, Bastide i Eurofit) i genotipa BC instituta (BC Patria). U podskupinu 1a2 svrstano je tri genotipa Poljoprivrednog instituta u Osijeku (Demetra, Zlata i Katarina), dva genotipa BC instituta (Zlatna Dolina i Sana) i genotip Bezostaja. Podskupinu 1b čini pet genotipova, Slavonija i Golubica, između kojih prosječna sličnost (Sij) iznosi 0,78, zatim genotipovi Ružica i Janica te kao pridruženi član Adriana. U podskupinu 1c svrstano je četiri genotipa, među kojima su Pipi, Ilirija i Soissons te pridruženi genotip Valerius. U drugu skupinu svrstano je sedam genotipova Poljoprivrednog instituta u Osijeku, od kojih je prvi Srpanjka, a posljednji Seka. U trećoj skupini su tri genotipa: Osječka Crvenka, Antonius i Mihaela, četvrtu skupinu čini zasebni član BC Elvira. Petu skupinu čine Lela i Divana, a kao posebne grupe (šesta i sedma) izdvojili su se genotipovi Osječka 20 i Aida.

80


5.4. Analiza molekularne varijance (AMOVA) obzirom na hrvatske i strane sorte, oplemenjivačke programe te razdoblja priznavanja sorti Kombinirana matrica molekularnih podataka na temelju sličnosti (Sij) korištena je za provedbu AMOVA-e.

Analizom molekularne varijance provedenom s obzirom na različitost između hrvatskih i stranih sorata (Tablica 48) u ukupnoj molekularnoj varijanci utvrđena je visoko značajna vrijednost udjela varijabilnosti od 4,59% između hrvatskih (HR) i stranih (S) sorata. Najveći udio ukupne molekularne varijabilnosti (95,41%) utvrđen je unutar hrvatskih i stranih sorata.

Tablica 48. Rezultati analize AMOVA-e između i unutar hrvatskih i stranih sorata Izvori varijabilnosti Između HR i S sorata Unutar HR i S sorata

Analizom

Stupnjevi slobode

Komponente varijance

% udio varijabilnosti

ɸST

P (ɸ)

1

0,0119

4,59

0,0459

<0,001

38

0,248

95,41

molekularne

varijance,

provedenom

s

obzirom

na

različitost

između

oplemenjivačkih programa u Hrvatskoj i stranih sorata (Tablica 49) u ukupnoj molekularnoj varijanci, utvrđena je visoko značajna vrijednost udjela varijabilnosti od 6,78% između oplemenjivačkih programa Poljoprivrednog instituta u Osijeku, BC instituta i stranih (S) sorata. Najveći udio ukupne molekularne varijabilnosti (93,22%) utvrđen je između sorata unutar oplemenjivačkih programa.

Tablica 49. Rezultati analize AMOVA-e između i unutar oplemenivačkih programa u Hrvatskoj i stranih sorata Izvori varijabilnosti Između programa Unutar programa

Stupnjevi slobode

Komponente varijance

% udio varijabilnosti

ɸST

P (ɸ)

2

0,01769

6,78

0,0678

<0,001

37

0,2432

93,22

81


Analiza molekularne varijance provedena između i unutar četiri razdoblja priznavanja ispitivanih sorata pokazala je da najveći udio (98,42%) varijabilnosti molekularne varijance uzrokom razlika između sorata unutar razdoblja priznavanja. Najmanji udio varijabilnosti od samo 1,58% uzrokom je razlika između razdoblja te nije značajan (Tablica 50).

Tablica 50. Rezultati analize AMOVA između i unutar razdoblja priznavanja ispitivanih genotipova Izvori varijabilnosti Između razdoblja Unutar razdoblja

Stupnjevi slobode

Komponente varijance

% udio varijabilnosti

ɸST

P (ɸ)

3

0,0040

1,58

0,0158

0,1701

27

0,2495

98,42

5.5. Usporedba rezultata provedenih analiza Mantelovim testom ispitano je postojanje korelacija između matrica dobivenih na temelju različitih podataka: morfoloških svojstava, mikrosatelita (SSR metoda) i AFLP metode (Tablica 51). Tablica 51. Rezultati Mantelovog testa (ispod dijagonale) i opravdanosti (iznad dijagonale) Morfološka svojstva

SSR metoda

AFLP metoda

Morfološka svojstva

-

0,033

0,232

SSR metoda

0,0914

-

0,01

AFLP metoda

0,0553

0,191

-

Mantelov test je pokazao statistički opravdanu korelaciju između SSR i AFLP matrice sličnosti za ispitivane genotipove, iako je koeficijent korelacije bio vrlo slab (r=0,191). Između matrice morfoloških podataka i molekularnih podataka nije postojala korelacija.

82


6. RASPRAVA 6.1. Različitost ispitivanih genotipova pšenice na temelju agronomskih svojstava Agronomska svojstva su nezaobilazan dio testiranja genotipova i novostvorenih sorata u svim oplemenjivačkim programima. Predstavljaju, uz morfološka svojstva, osnovni kriterij prilikom odabira najrazličitijih i najudaljenijih sorata za križanja u klasičnom oplemenjivanju. Velik dio istraživanja je kao cilj oplemenjivanja pšenice, prema konceptu gena, postavio postizanje visokog i stabilnog uroda te visoke kvalitete novostvorenih sorata (Borojević, 1990.; Bede i sur., 1990.; Bede, 1994.; Drezner, 1995.; Oberforster i Werteker, 1995.; Denčić i sur., 1997., Denčić, 2006.). Tijekom zadnjih 100 godina oplemenjivači pšenice u Europi i ostalim dijelovima Svijeta su radili na povećanju uroda pšenice snižavajući visinu stabljike, povećavajući time otpornost na polijeganje u uvjetima intenzivne poljoprivrede. Skraćenje stabljike je najveća promjena koja je napravljena u oplemenjivanju pšenice tj. promjena žetvenog indeksa sa oko 0,30 na oko 0,45 što je rezultiralo povećanjem genetskog potencijala za urod zrna. Trend smanjenja visine bio je značajan korak i u domaćim oplemenjivačkim programima u stvaranju polupatuljastih genotipova visine oko 70cm (Bede, 1994.). Visina biljke je kvantitativno svojstvo pod utjecajem Rht major gena i velikog broja minor gena koji su raspoređeni po svim kromosomima pšenice (Chebotar i sur., 2001.). Utjecaj visine stabljike u oplemenjivanju bilja može se gledati s aspekta otpornosti na polijeganje i povećanja ukupne biomase. Visoke biljke su vrlo osjetljive na polijeganje te imaju tanku i nedovoljno čvrstu građu stabljike što na kraju dovodi do osipanja zrna, a time i do smanjenja uroda posebice u uvjetima velike količine hraniva u tlu. Sniženje visine stabljike ne dovodi samo do povećanja otpornosti na polijeganje (Worland i Snape, 2000.) nego do stvaranja učinkovitije biljke koja svoje asimilate preusmjerava na produkciju zrna, a ne u stabljiku, čime se povećava žetveni indeks.

U ispitivanim genotipovima ovo svojstvo

uzrokom je velike varijabilnosti između njih, što ukazuje na različite pravce u oplemenjivanju i različite roditeljske parove prilikom križanja. Obzirom na godine priznavanja i porijeklo pojedinog genotipa vidljivo je smanjenje stabljike u prosjeku oko 70 cm od 1936. (U1=141,9 cm) do 2008. (Zlata=67,2 cm) godine. Samo osam genotipova imalo je stabljiku višu od 100 cm, takve genotipove možemo svrstati u ekstenzivne koji su prilagođeni određenim agroekološkim uvjetima, većinom iz Austrije i Rusije. S druge strane genotipovi koji su srednje visine do 90 cm ili niže većinom su prilagođeni intenzivnim uvjetima proizvodnje. 83


Klimatske prilike tijekom dvije godine pokusa imale su vrlo velik utjecaj na sva ispitivana agronomska svojstva u gotovo svih genotipova. Nedostatak oborina i više temperature u 2009. godini utjecao je na velike razlike u urodu zrna i komponentama uroda u gotovo svih ispitivanih genotipova. Uvjeti suše posebno su bili naglašeni tijekom ožujka i travnja kada se pšenica nalazi u fenofazi vlatanja (IV., V., VI. I VII. etapa organogeneze) koja je presudna u razvoju broja klasića, broja cvjetova i njihove fertilnosti, nedostatak oborina i visoke temperature utječu na značajan pad uroda (Ozturk i Aydin, 2004.). Koeficijent varijacije, u dvogodišnjem prosjeku, bio je najveći upravo za svojstvo uroda. Svi ispitivani genotipovi imali su manji urod zrna i manji broj zrna po klasu u vegetacijskoj 2008./2009. dok su u 2007./2008., koja je bila klimatski puno povoljnija za uzgoj pšenice, zabilježeni veći urodi zrna, što je u skladu sa rezultatima Drezner i sur. (2010.). U povoljnim uvjetima ostvari se 50% fertilnih vlati po biljci, a u uvjetima stresa stvaranje klasova je mnogo manje što je rezultat interakcije genotipa i okolina (Acevedo, 2002.). Obzirom na komponente uroda genotip Bastide je u dvogodišnjem prosjeku ostvario najveći urod zrna i broj zrna po klasu i najmanju hektolitarsku masu u dvogodišnjem prosjeku. Rezultati su u skladu sa prethodnim istraživanjima Sabo i sur. (2002.) gdje je utvrđena pozitivna korelacija uroda zrna sa brojem zrna po klasu, dok istraživanja Slafer i sur. (1996.) pokazuju da povećanje broja zrna u klasu ne mora rezultirati povećanjem uroda iz razloga što su zrna često manje mase. Istraživanja Guberac i sur. (2008.) su također utvrdili da je svojstvo broja klasića po klasu u negativnoj korelaciji koja je imala direktan negativni učinak na urod zrna. Naime produkcija klasa je komponenta uroda obrnuto proporcionalna broju klasova po biljci, a produkt je broja klasića u klasu, cvjetova u klasiću i mase zrna. Genotip BC Patria je ostvario drugi najveći urod u dvogodišnjem prosjeku, četvrti najveći broj klasića na klasu, ali treći najmanji broj biljaka po jedinici površine što se slaže sa istraživanjima Barić i sur. (2008.). Genetska osnova povećanja uroda povezana je s nekoliko major gena onih koji utječu na visinu biljke (Rht), odgovor biljke na fotoperiod (Ppd) i tip uzgoja (Vrn), a budućnost napretka u genetskom potencijalu uroda, posebno u uvjetima stresa, leži u eksploataciji izvora genetske različitosti unutar prirodnih populacija i divljih srodnika (Skvomand i sur. 2001., Kato i sur., 2000.). Nedavna dostignuća u istraživanju uroda pšenice imaju potencijal da ubrzaju genetsku dobit u pšenice, poboljšavajući učinkovitost fotosinteze, produktivnost klasa, optimizirajući „source:sink“ ravnotežu i koristeći molekularnu tehnologiju i konvencionalni pristup oplemenjivanju za uvrštavanje divljih srodnika roda Triticum, kako bi 84


se proširio „pool“ gena (Reynolds i sur., 2009.). Obzirom na provedeno istraživanje i nove spoznaje možemo zaključiti da genotipovi imaju različitu sposobnost kompenzacije pojedinih komponenata uroda, koja je rezultat genotipa, okoline i njihove međusobne interakcije. Stoga, svaki genotip ozime pšenice ima specifičnu i različitu strukturu uroda zrna, obzirom na udio komponenti u stvaranju uroda. Količina bjelančevina u zrnu pšenice uvelike ovise o genotipskim i okolišnim činiteljima, a varijabilnost sadržaja i količine bjelančevina značajno modificira kvalitetu brašna i kruha. Navedeno svojstvo je još jedno od dijagnostičkih agronomskih svojstava koje svrstava genotipove prema kvaliteti. Dok su pšenične bjelančevine glutena smatrane kao glavni činitelj u određivanju kvalitete pšenice kroz nekoliko desetaka godina, uloga škroba je bila znatno manje istraživana, smatrano je da je škrob samo „punjenje“ u endospermu pšenice. Namirnice od pšenice prehranjuju milijune ljudi diljem Svijeta upravo zbog vrlo vrijednog izvora ugljikohidrata tj. škroba (Singletary, 2000.). Još davne 1941. Harris i Stibbitt su upozorili kako istraživanja na škrobu nisu dobila na značajnosti te kako čak 70% zrna pšenice otpada na škrob i da se očekuje da ima ulogu u kvaliteti brašna i kruha te da ovisi o varijabilnosti sastava škroba, o genotipu i o okolini, prema Rahman i sur. (2000.). Količina bjelančevina i škroba u zrnu ispitivanih genotipova se razlikovala u odnosu na dvije godine zbog prethodno navedenih klimatskih uvjeta tijekom 2009. godine. Količina bjelančevina se povećala u gotovo svih genotipova dok se količina škroba smanjila. Zbog male količine padalina i visoke temperature količina škroba u svih genotipova je bila manja. Slične rezultate dobili su i Labuschagne i sur. (2007.) koji su utvrdili da je na količinu škroba u zrnu pšenice značajno utjecalo povećanje temperature zraka te je utvrđena i značajna pozitivna korelacija sa veličinom i težinom zrna. Chinnusamy i Khanna-Chopra (2003.) su utvrdili znatno manju aktivnost enzima škrobne sintetaze, koja je vrlo osjetljiva na visoke temperature te je odgovorna za sintezu škroba i izravno utječe na smanjenje mase zrna, a time i na urod pšenice. Istraživanja Ozturk i Aydin (2004.) pokazuju da se istovremeno povećava količina dušika u zrnu, a time i količina bjelančevina što je u skladu s rezultatima ovoga istraživanja. Dobiveni rezultati pokazuju postojanje različitosti između ispitivanih genotipova kao i mogućnost odabira udaljenih genotipova za buduća križanja. Pet sorata (Bastide, BC Patria, Alka, Eurofit i Sana) s najboljim urodom podrijetlom je iz različitih oplemenjivačkih centara i 85


iz tri različite zemlje. Francuska, austrijska sorta te sorte BC instituta i Poljoprivrednoga instituta u Osijeku postigle su odlične rezultate uroda zrna uvjetima istočne Slavonije i pokazale postojanje široke adaptabilnosti. Navedene sorte imaju različit pedigree, divergentne su po svom podrijetlu te bi mogle poslužiti kao roditeljske komponente za križanja u budućim oplemenjivačkim programima.

6.2. Različitost na temelju morfoloških podataka Oplemenjivački programi temelje se na odabiru genetski različitih roditelja za križanja. Različitost roditeljskih komponenti određuje se na temelju morfoloških podataka. Primjena morfoloških podataka neizostavna je prilikom stvaranja genskih karata te u svrhu nadzora početne populacije i razdvajajućih generacija. Veliki broj istraživača navode nezaobilaznu primjenu morfoloških svojstava u svrhu zaštite oplemenjivačkih prava te ispitivanja različitosti, ujednačenosti i postojanosti sorti (DUS) prilikom priznavanja novih sorata. Posebno se naglašava potreba njihovog kombiniranja s molekularnim markerima (Jones i sur., 2003.; Cooke i sur. 2003.; Šatović, 1999.) u cilju što preciznije ocjene genetske različitosti i zaštite oplemenjivačkih prava. U provedenom istraživanju zabilježena je relativno mala prosječna sličnost između ispitivanih genotipova što upućuje na veliku morfološku varijabilnost između njih. Slične rezultate dobili su Marić i sur. (2004.) i Salem i sur. (2008.) gdje je utvrđena relativno velika udaljenost između ispitivanih genotipova, a primjenom UPGMA metode sve genotipove je bilo moguće razlikovati. Potpuno suprotne rezultate dobili su Maccaferri i sur. (2007.) koji su utvrdili prosječnu sličnost između genotipova u iznosu od 0,73, a samo vrlo udaljene linije su se uspjele izdvojiti na temelju fenotipa. Genetska različitost ispitivanih genotipova na temelju morfoloških podataka pokazala je grupiranje prema podrijetlu i tipu sorte za koju je postojao određeni oplemenjivački cilj u vrijeme kada je ona stvarana. Stara sorta, Osječka šišulja ili U1 iz 1936. godine se prema očekivanju morfološki posve izdvojila od svih ispitivanih genotipova sa najmanjom prosječnom sličnosti u odnosu na sve ispitivane genotipove (RTij=0,13). Sorta se do početka šezdesetih godina sijala na preko 50.000 ha. U uvjetima uzgoja s malim količinama gnojiva i normama sjetve od 450 do 550 zrna/m2, visina od 140 cm nije bila ograničavajući čimbenik u proizvodnji (Drezner, 1995.). 86


U posebnu skupinu izdvojile su se hrvatske sorte, deset sorata PIO (Osječka 20, Slavonija, Demetra, Žitarka, Super Žitarka, Aida, Alka, Golubica i Barbara) i jedna sorta BC instituta (BC Elvira). Sorte pripadaju konceptu prinosnih sorata niske do srednje visoke stabljike, dobre kvalitete i otpornosti na polijeganje (Bede, 1994.; Drezner, 1995.). Svrstavanje ovih sorata može se povezati i sa pedigreom genotipova. Osječka 20 je jedan od roditelja sorte Slavonija, dok je Slavonija jedan od roditelja sorte Golubica, a sorta Žitarka je jedan od roditelja prilikom stvaranja sorata Super Žitarka i Barbara. Sve sorte pripadaju ranim do srednje ranim sortama, koje imaju srednju do srednje jaku voštanu prevlaku klasa i zadnjeg internodija. Tako se sorta Žitarka prema svojim morfološkim i agronomskim svojstvima izdvaja među ostalim sortama kao vrlo adaptabilna sorta, koja se u razdoblju od 1991. do 1993. godine sijala na 40% površina (Drezner, 1995.), a i danas zauzima velik dio površina u Hrvatskoj, dok je u Sloveniji najraširenija sorta (Drezner i sur., 2010.). Posebnu skupinu čine i pet hrvatskih genotipova (Srpanjka, Renata, Pipi, Anđelka i Mihaela) te talijanska sorta Libellula. Navedene sorte pripadaju izrazito ranim i ranim sortama, te se može reći da je upravo svojstvo datuma klasanja utjecalo na razvrstavanje navedenih sorata pored pedigrea. Sorta Srpanjka se kao jedan od roditelja nalazi u genotipovima Mihaela, Renata i Anđelka, a sorta Libellula korištena je u križanjima za stvaranje sorte Srpanjka. Sve austrijske sorte su se izdvojile i predstavljaju tip sorte stvarane za ekstenzivnu proizvodnju, visoke stabljike i kasnijeg datuma klasanja. Antonius i Ludwig su iz oplemenjivačkog programa u Probstdorfu (Austrija) stvarani za područje Panonske regije, Ludwig kao širokoadaptabilna sorta dobre kvalitete za organsku poljoprivredu, a Antonius kao visokokvalitetna sorta, otporna na zimu. Navedene sorte nastale su iz posebno osmišljenog oplemenjivačkoga programa za organsku poljoprivredu, gdje upravo specifična morfološka svojstva odnosno njihova kombinacija omogućava uspješnu selekciju genotipova (Lӧschenberger i sur., 2008.). Kao jedan od glavnih preduvjeta za molekularni „screening“ genetske različitosti je utvrđivanje fenotipske varijabilnosti pomoću agronomskih i morfoloških svojstava (Kobiljski i sur., 2002.). U provedenom istraživanju utvrđena je vrlo mala sličnost tj. velika različitost morfoloških svojstava između ispitivanih genotipova. Na temelju nevedenih rezultata različitost ispitivanih genotipova ispitana je i uporabom molekularnih markera (mikrosateliti i AFLP). 87


6.3. Genetska različitost na temelju molekularnih podataka 6.3.1. Genetska različitost visokomolekularnih podjedinica glutenina Količina i kvaliteta bjelančevina u zrnu glavni su činitelji u selekciji sorata odgovarajuće pekarske kvalitete. Rezervne bjelančevine zrna pšenice, gluteni, odgovorni su za jedinstvena viskozno-elastična i kohezivna svojstva tijesta pšenice (Gianibelli i sur., 2002.). Mogu se podijeliti na dvije skupine: glijadine i glutenine. Utjecaj količine glijadina i glutenina na reološka svojstva tijesta, volumen i strukturu kruha može znatno varirati što ovisi o genotipu i o okolišnim uvjetima. Glijadini su tako odgovorni za rastezljivost i manje ovisni o okolišnim uvjetima, dok su glutenini odgovorni za čvrstoću i elastičnost tijesta i osjetljivi na promjene u okolišu i proizvodnji (Branlard i sur., 2001.; Lásztity, 2002.; Triboi i sur., 2000.). Glutenini se dijele na visokomolekularne (HMW) i niskomolekularne (LMW) podjedinice (GS). Veliki broj istraživanja dokazao je važnost i vrlo velik utjecaj HMW podjedinica glutenina, posebno onih kontroliranih od strane D genoma (Glu-D1a i Glu-D1d). Genotipovi koji imaju HMW GS 2+12 (a) imaju slabi gluten, dok je jak gluten karakterističan za sorte u kojih su utvrđene HMW GS 5+10 (d) (Tanaka i sur., 2003.; Horvat i sur., 2006.; Tohver, 2007.). U ispitivanim genotipovima kombinacije alela, koje se povezuju sa vrlo dobrom kvalitetom brašna i kruha bbd, bcd, acd i bid (Lerner i sur., 2009.) utvrđene su u 40% genotipova što se može iskoristiti za daljnja istraživanja u smjeru poboljšanja kvalitete brašna i kruha. Dobivena različitost visokomolekularnih podjedinica glutenina između ispitivanih genotipova omogućila je grubu podjelu sorata na temelju Glu-D1a (2+12) i Glu-D1d (5+10) lokusa, bez obzira na podrijetlo genotipa, isti način grupiranja zabilježen je i u istraživanjima Jošt i sur. (1995.) i Sultana i sur. (2007.). HMW GS dobivene za genotipove Divana i Bezostaja (2*, 7+9 i 5+10) zabilježene su i u istraživanjima Jošt i sur. (1995.) i prema katalogu HMW podjedinica glutenina Bekes i sur. (2006.), dok su Horvat i sur. (2006.) za navedene sorte na Glu-A1 lokusu utvrdili nulti alel (N). U provedenom istraživanju također je utvrđen veći postotak (40%) podjedinica glutenina N od GS 2* što se može pripisati većoj genetskoj različitosti na Glu-A1 lokusu i tome što je frekvencija nultog alela više zastupljena u onih genotipova koju su priznati od 1936. do 1998. godine (ukupno njih devet). Nulti alel je i u drugim istraživanjima bio najčešći alel u heksaploidnim pšenicama (Payne i Lawrence, 1983.). Rezultati ovoga istraživanja su u skladu 88


sa istraživanjima Branlard i sur. (2003.) te Izadi-Drabandi i sur. (2010.) koji navode da je većinom u „starijih“ sorata utvrđena veća frekvencija nultoga alela (69,5%). U istraživanjima Sultana i sur. (2007.) utvrđena je dominacija nultog alela (60%) samo u prirodnih populacija, dok je u modernih sorata potpuno zamijenjen Glu-A1b alelom. Isti autor navodi da su oplemenjivači, u nastojanju da stvore što kvalitetnije sorte, doveli do erozije (nestanka) tog alela u populaciji novih sorata. Dominacija Glu-A1b alela (63,9%) i Glu-Dd alela (94,1%) zabilježena je i u istraživanjima Lerner i sur. (2009.) koji su u analizu uključili 119 genotipova ozime pšenice. Dobiveni rezultati su pokazali veliku različitost germplazme pšenice na temelju sastava glutenina. U daljnja istraživanja različitosti sorata pšenice na temelju HMW GS trebalo bi uvrstiti veći broj sorata te prirodnih populacija zbog identifikacije HMW GS, LMW GS i lokusa glijadina u cilju stvaranja baze podataka te implementacije specifičnih molekularnih markera (Gale, 2005.; Yang i sur., 2010). Dobiveni podaci bili bi temelj za stvaranje početne populacije u oplemenjivačkim programima s ciljem stvaranja sorata pšenice za različite namjene (kruh, pecivo, keksi).

6.3.2. Genetska različitost na temelju količine amiloze i amilopektina u zrnu Kako je prethodno navedeno sadržaju i sastavu škroba u pšenice nije se u prošlosti pridavala dovoljna pažnja. Preokret se dogodio kad je otkriveno da su upravo kvaliteta škroba, waxy aleli u pšenice i sadržaj amiloze, primarno odgovorni za kvalitetu japanskih rezanaca („noodles“) (Yamamori i sur., 1992.; Nakamura i sur., 1993.; Miura i Tanii, 1994.). Sukladno takvim istraživanjima utvrđena je i povezanost HMW podjedinica glutenina, Glu-D1d, sa čvrstoćom tijesta kuhanih rezanaca i u sorata u kojima je sadržaj bjelančevina bio vrlo nizak (Yanaka i sur., 2007.). Glavna komponenta pšeničnog brašna je škrob, zauzimajući 65-70% suhe tvari zrna. Sastavljen je od dvije vrste glukoznih polimera: pretežno linearne α-1,4 amiloze i razgranatog α-1,4 i α-1,6 amilopektina. Heksaploidne pšenice većinom sadrže od 15% do 35% amiloze. Različitost strukture amiloze i amilopektina upravo je funkcionalno važna i očituje se u čitavom nizu primjena od hrane do industrije (Burrell, 2003.).

89


U provedenom istraživanju utvrđene su vrlo velike razlike između ispitivanih genotipova na temelju količine amiloze i amilopektina. Tako se mogu izdvojiti sorte koje imaju oko 50% amiloze (Srpanjka) do sorata koje imaju svega 5% amiloze (Bezostaja). Većina ispitivanih genotipova (22) pripada rasponu od 15 do 35% amiloze što je u skladu sa istraživanjima Labuschagne i sur. (2007.), dok su u istraživanjima Corcuera i sur. (2007.) izdvojili sorte pšenice sa 41% amiloze što je za 5% više od maksimalne vrijednosti te sorte s više od 70% amilopektina. Ovi rezultati su u skladu sa provedenim istraživanjem jer su se izdvojile sorte kao što je Srpanjka, Demetra, Slavonija i Žitarka s više od 40% amiloze, odnosno U1, Super Žitarka, Bezostaja i Valerius sa više od 90% amilopektina. Potencijal sorte s velikim udjelom amiloze (>40%) predstavlja alternativu petrokemijskim izvorima u proizvodnji plastike kao i dijetetskih vlakana koja su neophodna u zdravoj prehrani (Regina, 2000.). Navedeni rezultati mogu se iskoristiti u svrhu stvaranja novih sorata s velikim ili malim udjelom amiloze i amilopektina u cilju dobivanja novih sorata za različite namjene od prehrambene do tekstilne industrije. Potrebno je izvršiti daljnja istraživanja u smjeru utvrđivanja kvalitete kruha i brašna kombinirajući pritom rezultate sastava HMW GS i količine amiloze i amilopektina.

6.3.3. Genetska različitost na temelju mikrosatelita i AFLP markera Kao što je prethodno navedeno utvrđena je varijabilnost između ispitivanih genotipova na temelju agronomskih i morfoloških svojstava. Utvrđivanje genetske različitosti sorata ili oplemenjivačkih linija je nužno za kvalitetan izbor roditeljskih parova za križanja. Moderno oplemenjivanje može dovesti do smanjene genetske različitosti koja se ogleda kroz manju frekvenciju ili gubitak pojedinih alela. Smanjena genetska različitost može voditi ka istoj reakciji različitih sorata na abiotske ili biotske stresne činitelje, a time i ugroziti poljoprivrednu proizvodnju (Manifesto i sur., 2001.; Martos i sur., 2005.; Fu i sur., 2009.). Danas se intenzivno koriste molekularni markeri u svrhu utvrđivanja genetske različitosti jer isključuju subjektivne procjene, kao u morfoloških svojstava i ne ovise o vanjskim utjecajima. Različite tehnike molekularnih markera su korištene u svrhu procjene genetske različitosti i odnosa između genotipova (Barett i Kidwell, 1998.; Marić i sur., 2004.; Noli i sur., 2008.; Prasad i sur., 2009.). 90


U provedenom istraživanju koristeći 26 mikrosatelitnih početnica utvrđeno je ukupno 108 različitih alela u 40 ispitivanih genotipova, od 2 do 11 po lokusu, što je prosječno po mikrosatelitu iznosilo 3,8, a prosječna vrijednost PIC je iznosila 0,50. Slične rezultate utvrdili su Ahmad (2002.) na 13 genotipova sa 43 mikrosatelitna markera uz prosječan broj alela od 3,0 i prosječne vrijednosti PIC od 0,52 te Christiansen i sur. (2002.) na 75 genotipova koristeći 47 mikrosatelitnih markera uz prosječan broj alela po lokusu od 3,6. Navedene vrijednosti su uglavnom manje od rezultata koje su utvrdili Khlestkina i sur. (2004.) na 54 genotipa sa 22 mikrosatelita (prosječan broj alela 6,6, PIC=0,70), Landjeva i sur. (2006.) na 91 genotipu sa 19 mikrosatelita (prosječan broj alela 6,8, PIC=0,51), Stępien i sur. (2007.) na 53 genotipa sa 24 mikrosatelitna markera uz prosječan broj alela od 7,2. Stępien i sur. (2007.) također navode da je kvaliteta biljnog materijala glavni činitelj koji utječe na broj alela po lokusu te da je taj broj veći ukoliko se koristi sjeme iz gen banaka. Prosječna genska različitost (He) u provedenom istraživanju iznosila je 0,57 što je u skladu sa istraživanjima Dresigacker i sur. (2004.) na 68 linija iz CIMMYT-a, a malo veća od 0,56 utvrđene između 134 genotipa durum pšenice (Maccaferri i sur., 2007.). Uglavnom veće vrijednosti utvrdilo je više autora: Rousell i sur. (2005.) na 480 genotipova sa 39 mikrosatelitnih markera, prosječni broj alela po lokusu iznosio je 16,7, uz He= 0,65; Stodart i sur. (2005.) na 44 prirodnih populacija koristeći 63 mikrosatelitne početnice (prosječni broj alela 10,29, uz He=0,69) i drugi. U provedenom istraživanju ispitivane su promjene u broju alela u odnosu na razdoblja priznavanja sorti. Zabilježeno je povećanje ukupnog broja alela u ispitivanim genotipova koji su priznati od 2000. do 2008. (20), u odnosu na genotipove priznate od 1936. do 1980. godine. Iako je broj izgubljenih alela najveći u razdoblju od 2000. do 2008. (6), u istom je razdoblju i dobiveno 10 novih alela. Na temelju toga može se zaključiti da u novim sortama nije došlo do smanjenja broja alela uslijed oplemenjivanja. Fu i sur. (2009.) utvrdili su smanjenje od 17% ukupne varijabilnosti zabilježene mikrosatelitima unutar 20 novih sorata jare pšenice nakon 1930. godine i navode da je to zbog zatvorenog oplemenjivačkoga programa u Kanadi, za razliku od europskih oplemenjivačkih programa u kojima je zabilježen porast genetske različitosti. Promjene u broju alela u odnosu na razdoblje oplemenjivanja mogu se objasniti različitim ciljevima u oplemenjivanju pšenice, korištenjem novih roditelja te tako unošenjem novih alela u križanja. Daljnja istraživanja treba usmjeriti ka utvrđivanju jesu li izgubljeni aleli povezani s nekim važnim svojstvima za pšenicu kao što su otpornost na bolesti, zimu ili količinu bjelančevina u zrnu. 91


U provedenom istraživanju je između 26 mikrosatelitnih markera korišten i gwm261. Mikrosatelit gwm261 je smješten na lokusu Xgwm261 (Rӧder i sur., 1998.) 0,6 cM udaljen od Rht8 gena na 2DS kromosomu koji može uključivati i gen Ppd1za neosjetljivost na fotoperiod (Korzun i sur., 1998.). Za ukupno 28 ispitivanih genotipova utvrđen je alel duljine 192 pb, među kojima su Libellula, Bezostaja i Zlatna Dolina, šest genotipova za koje je zabilježen alel od 174 pb, među kojima je i Soissons što je u skladu s prethodnim rezultatima Worland i sur. (1998.) i Dvojković i sur. (2010.). Za ukupno 26 hrvatskih genotipova zabilježen je alel duljine 192pb. Navedeni dijagnostički alel za Rht8 te za Ppd1 vodi podrijetlo od japanske sorte Akakomugi, koju je u oplemenjivački program unio Nazareno Strampeli te od ruskih sorata Bezostaja, Kavkaz i Aurora (Worland i sur., 1998.; Borojević i Borojević, 2005., Zheleva i sur., 2006.). Navedene talijanske i ruske sorte se nalaze u pedigreima mnogih hrvatskih kultivara za koje je utvrđen alel duljine 192 pb. Worland i sur. (1998.) navodi da je razlog vrlo male učestalosti gena osjetljivih na fotoperiod, Rht1 (Rht-B1b) i Rht2 (Rht-D1b), u odnosu na Rht8 gen, u germplazmi jugoistočne Europe, zbog negativnog učinka interakcija tih gena s pojavom visokih temperatura u vrijeme stvaranja gametofita pšenice čime je produktivnost klasa smanjena. Većina oplemenjivača jugoistočne Europe je selekcijom upravo izabirala adaptirane genotipove sa Ppd1/Rht8, koji su imali svojstvo niže stabljike i ranozrelosti čime bi povećali fertilnost klasića. Veliki broj autora (Korzun i sur., 1998.; Worland i sur., 1998.; Chebotar i sur., 2001.; Zhang i sur., 2006.), navode da alel od 192 pb na Rht8 genu utječe na snižavanje stabljike za 7 do 10 cm, dok Ppd1 gen djeluje plejotropno na ranije klasanje i sazrijevanje pšenice za oko sedam dana te također snižava stabljiku za 10 cm. Navedeni rezultati se slažu sa provedenim istraživanjem, budući da sorte Srpanjka, Zlata i Mihaela imaju prosječnu visinu stabljike od 65 cm i pripadaju skupini vrlo ranih sorata, ali bi se trebalo u nastavku istraživanja utvrditi i postojanje Ppd1 gena. U šest sorata utvrđen je alel dužine 174 pb na lokusu Xgwm261, tri hrvatske sorte (Ilirija, Aida i Felix), dvije austrijske (Edison i Ludwig) te u francuske sorte Soissons koji je jedan od roditelja sorte Ilirija. Navedeni alel koji je povezan sa genom za osjetljivost na fotoperiodizam (Ppd1) prevladava u francuskim, njemačkim te sortama Ujedinjenog Kraljevstva unesenog u oplemenjivačke programe preko japanske sorte Norin 10 (Worland i sur., 1998.; Zheleva i sur., 2006.). Alel sa 165 pb je utvrđen u samo četiri sorte: U1, Osječka 20, Bastide i Eurofit što je u skladu sa rezultatima istraživanja Dvojković i sur. (2010.). Sorte U1 i Eurofit imaju prosječnu visinu stabljike preko 100 cm što je u skladu sa rezultatima Korzun i sur. (1998.) koji su utvrdili da 92


navedeni alel ima utjecaj na povećanje visine stabljike. Navedeni alel je porijeklom također od japanske sorte Saitama 27 te prevladava u germplazmi CIMMYT-a (Worland i sur., 1998.). Genetske udaljenosti (dij) između genotipova u provedenom istraživanju kretale su se od 0,21 do 0,98. Prosječna genetska udaljenost (dij) iznosila je 0,66. Uglavnom slične rezultate genetske udaljenosti utvrdili su i drugi autori primjenom mikrosatelitnih markera. Ahmad i sur. (2002.) su utvrdili genetsku sličnost (Sij) 13 genotipova od 0,30 do 0,90 (što odgovara genetskoj udaljenosti od 0,10 do 0,70), genetska udaljenost (GDNEI) od 0,61 između 91 genotipa pšenice utvrđena je u istraživanju Landjeva i sur. (2006.), Christiansen i sur. (2002.) utvrdili su genetsku udaljenost (GDNEIUB) između 75 skandinavskih pšenica u iznosu od 0,51, genetska sličnost (Sij) u rasponu od 0,90 do 0 utvrđena je između 105 argentinskih genotipova (Manifesto i sur., 2001.), a u istraživanju Khlestkina i sur. (2004.) utvrđene su genetske sličnosti (Sij) u rasponu od 0,19 do 0,96 između 54 genotipa jare pšenice. UPGMA metodom su se uspješno mogli razlikovati svi ispitivani genotipovi. Prvu skupinu čine 10 sorata, koje se dijele na dvije podskupine. Svrstavanje pet sorata BC instituta (Zlatna Dolina, Sana, Adriana, BC Patria i BC Elvira) i dvije sorte PIO (Katarina i Alka) u 1a podskupinu i tri sorte PIO (Žitarka, Super Žitarka i Barbara) u 1b podskupinu se može objasniti genetskom osnovom roditelja u križanjima. Sve sorte BC instituta su u jednom skupu te su vjerojatno prilikom križanja korišteni roditelji koji dijele određenu genetsku osnovu s navedenim sortama, dok je sorta Alka svrstana u navedenu podskupinu jer je nastala križanjem osječke linija Osk. 5.140-229-91 (koja je podrijetlom srodna sorti Srpanjka, prema Dvojković, 2009.) i sorte Sana. Genetska osnova sorte Žitarka bila je ključna u formiranju 1b podskupine jer je jedan od roditelja u sortama Super Žitarka i Barbara, koje dolaze iz iste kombinacije križanja (GO 3135/Žitarka). Slične rezultate je dobio je i Dvojković (2009.). Drugu skupinu čini ukupno 20 sorata. Posebno se odvaja podskupina 2a koju čine sorte Osječka 20, Slavonija i Golubica koje su međusobno povezane genetskom osnovom, budući da se Osječka 20 nalazi kao roditelj u sorti Slavonija, a sorta Golubica dolazi iz kombinacije križanja Slavonija/Gemini. Sorte Pipi i Lela pripadaju istoj podskupini iako bi se sorta Pipi trebala svrstati u 4b skupinu zajedno sa sortom Ilirija jer joj je jedan od roditelja Soissons, dok se sorta Lela trebala svrstati u skupinu 2b jer je nastala iz križanja Srpanjka/Osk. 5.136-8-90. Pojedini autori objašnjavaju da smjerom i intenzitetom selekcije može doći do značajnijeg odstupanja od pretpostavke da potomci dijele 50% genetske osnove sa roditeljima, budući da oplemenjivač 93


modificira selekciju tako što mijenja frekvenciju određenih alela u korist jednoga od roditelja (Corbellini i sur., 2002.; Zhang i sur., 2002.). You i sur. (2004.) navodi da je potrebno 550 mikrosatelitnih markera (73 lokusa) kako bi se izradio pouzdan dendogram koji bi otkrio sve genetske odnose između sorata različite genetske osnove i različitog geografskoga podrijetla. Na grupiranje 2b podskupine najviše su utjecale sorte Srpanjka te Libellula i Bezostaja. Sorte Anđelka, Zlata i Seka su nastale iz kombinacije križanja Srpanjka/Demetra, dok su Mihaela, Renata, Ružica, Felix, Janica, Lucija i Aida u svojim pedigreima imali genetsku osnovu Srpanjke. Demetra i Srpanka dijele roditelja ZG 2696, dok su Libellula i Bezostaja roditelji sorte Osječka Crvenka. U četvrtu skupinu su svrstane sve strane sorte te sorta Divana koja je po svojoj genetskoj osnovi udaljenija od ostalih hrvatskih sorata, dok je Soissons svrstan uz sortu Ilirija, vjerojatno jer je korišten kao jedan od roditelja prilikom križanja. U1 čini posljednju petu skupinu i potpuno se izdvaja od svih ostalih genotipova, što je u skladu sa rezultatima Dvojković (2009.). Razlučivanje genotipova male genetske udaljenosti (Super Žitarka i Barbara) potvrđuje pravilan odabir DNA uzoraka i visok polimorfizam korištenih mikrosatelita za analizu genetske različitosti srodnih jedinki što je u skladu sa rezultatima Morgante i Olivieri (1993.), Plaschke i sur. (1995.) i Banayi i sur. (2006.). Četiri kombinacije AFLP početnica korištenih u ovome istraživanju proizvele su ukupno 108 polimorfnih fragmenata u 40 ispitivanih genotipova. Prosječno je utvrđeno 27 polimorfnih alela po kombinaciji i prosječnom vrijednosti PIC od 0,34. Slične rezultate utvrdili su Manifesto i sur. (2001.) koristeći četiri kombinacije AFLP početnica na 105 argentinskih pšenica sa 18 polimorfnih fragmenata po kombinaciji i vrijednosti PIC od 0,30, Martos i sur. (2005.) na 24 durum sorte pšenice koristeći 14 kombinacija AFLP sa ukupno 13 polimorfnih fragmenata po kombinaciji i prosječnom vrijednosti PIC od 0,34, Maccaferri i sur. (2007.) na 58 durum pšenica koristeći 16 kombinacija AFLP početnica (prosječan broj polimorfnih fragmenata od 14,4, PIC=0,31). Uglavnom veće vrijednosti broja polimorfnih fragmenata i vrijednosti PIC utvrdili su Stodart i sur. (2005.) na 44 prirodne populacije pšenica koristeći 16 AFLP kombinacija početnica (133 polimorfna fragmenta po AFLP početnici, PIC=0,35), Corbellini i sur. (2002.) na 40 sorata pšenice koristeći pet kombinacija AFLP početnica sa 40 polimorfnih fragmenata po početnici, Vieri i sur. (2007.) na 19 pšenica koristeći šest kombinacija AFLP početnica (44 polimorfnih fragmenata po početnici, PIC=0,36) i drugi. 94


U provedenom istraživanju utvrđeni su specifični polimorfni fragmenti koji su se pojavljivali samo u određenim genotipovima. U tri kombinacije AFLP početnica fragmenti duljine 215 (SseGC/MseAT), 530 (SseTC/MseGA) i 186 (SseGC/MseGA) parova baza bili su specifični za tri sorte Žitarka, Super Žitarka i Barbara. Navedene kombinacije se mogu koristiti u svrhu identifikacije ovih sorata. Specifični fragmenti mogu biti vrlo učinkoviti u identificiranju vrlo sličnih linija ili sorata (Maccaferri i sur., 2007.) Između 40 ispitivanih genotipova utvrđena je prosječna genetska sličnost (Sij) od 0,54, kretala se od 0,21 do 0,82. Vrlo slične rezultate su utvrdili i Barrett i sur. (1998.) između 43 jarih i ozimih sorata pšenice s prosječnom vrijednosti genetske udaljenosti (GDE) od 0,54 (što odgovara 0,54 genetskoj sličnosti (Sij) od 0,56), Manifesto i sur. (2001.) su utvrdili prosječnu genetsku sličnost (Sij) od 0,55 u rasponu od 0,24 do 0,91 između 105 argentinskih sorata pšenice, Maccaferri i sur. (2007.) su utvrdili genetsku sličnost (Sij) koja se kretala od 0,29 do 0,99 između 58 durum sorata pšenice. UPGMA metodom je bilo moguće razlikovati sve ispitivane genotipove. Svrstavanje genotipova se razlikovalo od dendograma izrađenog na temelju genetske udaljenosti utvrđene mikrosatelitnim markerima. Hrvatske sorta Aida i Osječka 20 su se izdvojile kao najudaljenije (šesta i sedma skupina), a prosječna genetska sličnost u odnosu na ostale sorte iznosila je 0,44, što je manja sličnost nego prosjek između svih ostalih sorata (Sij=0,54). Petu skupinu čine sorte Lela i Divana, a tri hrvatske i jedna austrijska sorta (Antonius) svrstale su se u treću skupinu, dok se sorta BC Elvira izdvojila kao posebna skupina (4). Na svrstavanje sorata u drugu skupinu najviše je utjecala sorta Srpanjka. Sorte Lucija, Renata, Felix, Anđelka, Alka i Seka u svojoj genetskoj osnovi imaju upravo sortu Srpanjka kao jednog od roditelja. Sorta Alka koja je nastala iz križanja Osk. 5.140-22-91/Sana, a linija Osk. 5.140-22-91 je prema podrijetlu srodan sorti Srpanjka (Dvojković, 2009.) se u dendogramu prema mikrosatelitnim markerima svrstala u skupinu u kojoj je sorta Sana. Većina genotipova prve skupine dijele zajedničke pretke prema matrici genetske sličnosti (Sij). Podskupinu 1c čine dvije sorte PIO, Pipi i Ilirija te francuska sorta Soissons koji je jedan od roditelja u obje sorte, a kao pridruženi član svrstala se austrijska sorta Valerius koja bi se trebala nalaziti u trećoj skupinu jer dijeli zajedničku genetsku osnovu sa sortom Antonius. Sličan način svrstavanja slijedi i u podskupinama 1b i 1a. Tako zajedničke genetske osnove u podskupini 1b dijele Slavonija i Golubica što se podudara za dendogramom prema 95


mikrosatelitnim markerima, te Janica i Ružica koje za jednog od roditelja imaju Srpanjku, dok je sorta BC instituta Adriana pridruženi član ove podskupine. 1a2 podskupinu čine sorte Zlata i Demetra, Zlata je nastala križanjem sorte Srpanjka i Demetra. Zatim slijede Zlatna Dolina i Sana, obje sorte BC instituta, te sorte Katarina i Bezostaja. U 1a1 podskupini se nalaze Žitarka, Barbara i Super Žitarka koje su se i prema metodi mikrosatelita svrstale u istu skupinu kao međusobno slične. Navedene sorte su i prema specifičnim polimorfnim fragmentima AFLP početnica odvojene od ostalih sorata kao genetski srodne što je u skladu sa podacima o pedigreu. No nije poznato da li su ti „anonimni“ fragmenti povezani sa lokusima koji utječu na svojstvo od interesa (Barett i Kidwell, 1998.). Sorta U1 se svrstala u 1a1 skupinu, kao pridruženi član, iako je u prethodno navedenim rezultatima prema morfološkim i mikrosatelitnim početnicama svrstana kao potpuno izdvojeni genotip i skupina. AFLP početnice su po svom karakteru monogenski dominantni markeri, pa navedene sorte nisu svrstane prema pedigreu među skupine kojima bi trebale biti sličnije vjerojatno zbog nedovoljne pokrivenosti genoma pšenice koristeći ove četiri kombinacije AFLP početnica. Mikrosatelitne početnice koje su po svom karakteru kodominantni markeri omogućile su bolju i veću razlučivost između ispitivanih genotipova, svrstavajući ih prema porijeklu i pedigreu. Slična odstupanja u istraživanju utvrdili su i Manifesto i sur. (2001.), te Stodard i sur. (2005.), koji navodi da su odstupanja upravo povezana s razlikama između ta dva tipa markera. Mikrosatelitne početnice učinkovitije su utvrđivanju strukture populacije, dok su AFLP markeri bolje prilagođeni u otkrivanju genetskih odnosa na individualnoj razini (Neigel i sur., 1997.; Schut i sur., 1997.; Stodard i sur., 2005.). S druge strane istraživanja Roy i sur. (2004.) navode vrlo visoku učinkovitost AFLP markera u odnosu na morfološka svojstva i mikrosatelitne markere te da korištenje različitih kombinacija markera daje različite procjene genetske različitosti. AFLP početnice su uspjele utvrditi genetsku različitost između ispitivanih genotipova razvrstavajući ih na temelju individualnog doprinosa svakom genetskom skupu.

96


6.3.4. Analiza AMOVE Provedena analiza AMOVA procijenila je varijabilnost unutar i između ispitivanih genotipova te unutar i između oplemenjivačkih programa. Udio varijabilnosti u ukupnoj molekularnoj varijanci između hrvatske i strane germplazme iznosio je 4,59% i bio je visoko opravdan (P<0,001). Najveći udio ukupne varijabilnosti utvrđen je unutar hrvatske i strane germplazme u provedenom istraživanju (95,41%). Slični omjer varijabilnosti u ukupnoj molekularnoj varijanci utvrđen je i između oplemenjivačkih programa Poljoprivrednog instituta u Osijeku, BC instituta i stranih sorata (6,78%, P<0,001), dok je najveći dio varijabilnosti nastao zbog razlika između sorata unutar oplemenjivačkih programa (93,22%). Između četiri razdoblja oplemenjivanja nisu utvrđene statistički opravdane razlike, manji dio ukupne varijabilnosti odnosio se na razlike između razdoblja (1,58%, P<0,1701), dok je veći dio varijabilnosti uzrokom razlike između sorata unutar razdoblja priznavanja. Veća varijabilnost između sorata unutar oplemenjivačkih programa je rezultat intenzivnog oplemenjivačkog rada u svakom od oplemenjivačkih programa koji su iskoristili genetski različite i udaljene genotipove, što je potvrdila i AMOVA između hrvatskih i stranih oplemenjivačkih programa. Manji udio varijabilnosti između oplemenjivačkih programa i između razdoblja priznavanja proističe iz činjenice da su razmjenom germplazme ponekad korišteni roditelji iste genetske osnove za križanja prilikom stvaranja novih sorti, a i iz činjenice da su te sorte uzgajane u sličnim agroekološkim uvjetima. Velik broj istraživanja je dobio slične rezultate procjenjujući varijabilnost unutar jarih i ozimih sorata, oplemenjivačkih programa, geografskih regija, razdoblja priznavanja, lokalnih populacija i modernih sorata (Barett i Kidwell, 1998.; Christiansen i sur., 2002.; Roussel i sur., 2004; Dreisigacker i sur., 2004.; Dvojković, 2009.; Prasad i sur., 2009.). Ovi rezultati potvrđuju da je značajna količina genetske različitosti ugrađena u ispitivane hrvatske i strane genotipove u provedenom istraživanju. Brižnim odabirom roditelja omogućit će se rekombinacija utvrđene različitosti, koja se može povećati i koristiti za križanja, odnosno stvaranje nove i šire genetske osnove unutar novih oplemenjivačkih programa.

97


6.3.5. Korelacija između matrica morfoloških i molekularnih podataka Mantelovim testom usporedbe različitih matrica genetske sličnosti nisu utvrđene korelacije između morfoloških svojstava i molekularnih podataka. Utvrđena je vrlo slaba korelacija (r=0,191) između SSR i AFLP metode, ali je statistički opravdana (P<0,01). Korelacije između genetske različitosti između SSR i AFLP metode molekularnih markera utvrdili su i Manifesto i sur. (2001.) (r=0,27, P<0,001). Opravdanost korelacija pokazuje da se informacije dobivene temeljem molekularnih markera djelomično odražavaju u rodoslovlju ispitivanih genotipova te da se dvije metode međusobno nadopunjuju. Visoki koeficijent korelacije (r=0,81) između mikrosatelitnih i AFLP markera utvrdili su Maccaferri i sur. (2007.) koji objašnjavaju dobrom pokrivenošću cijelog genoma pšenice molekularnim markerima. Razlike između morfoloških i molekularnih metoda ispitivanja genetske različitosti nastaju zbog pristranih i okolišno uvjetovanih fenotipskih svojstava te mogućih nepouzdanih podataka o pedigreu. Slabu povezanost morfoloških i molekularnih podataka utvrdili su Schut i sur. (1997.), Manifesto i sur. (2001.), Marić i sur. (2004.), Maccaferri i sur. (2007.) i Čupić i sur. (2009.). Različitost na temelju SSR i AFLP metoda se pokazala kao vrlo učinkovita u procjeni genetske različitosti u ispitivanih sorata. Rezultati upućuju na to da je u ovim genotipovima sadržana velika genetska udaljenost i različitost što su preduvjeti za stvaranje novih sorata, pažljivim odabirom roditelja za križanja.

98


7. ZAKLJUČAK Na temelju istraživanja genetske različitosti germplazme ozime pšenice može se zaključiti sljedeće: 1. Utvrđena je značajna varijabilnost između svih ispitivanih genotipova na temelju agronomskih svojstava te je moguće izdvojiti adaptabilne visokorodne sorte (Bastide, BC Patria, Alka, Eurofit i Sana). 2. Utvrđena je velika udaljenost između ispitivanih genotipova na temelju morfoloških podataka. 3. Sastav visokomolekularnih podjedinica glutenina pokazao je veliku varijabilnost između ispitivanih genotipova. 4. Analiza količina amiloze i amilopektina utvrdila je statistički visoko opravdane razlike između ispitivanih genotipova te izdvojila genotipove sa ekstremno niskim sadržajem amiloze (U1, Super Žitarka, Bezostaja i Valerius) i ekstremno visokim sadržajem amilopektina (Srpanjka, Demetra, Slavonija i Žitarka). 5. Procjena različitosti na temelju različitih metoda utvrdila opravdanost korištenja SSR i AFLP metode između kojih je utvrđena značajna korelacija. 6. S obzirom na analizirane podatke kombinacija agronomsko-morfoloških i molekularnih podataka može dovesti do uspješnog izbora genetski različitih i divergentnih roditelja za križanja u budućim oplemenjivačkim programima.

99


8. LITERATURA 1. Acevedo E, Silva P, Silva H (2002) Wheat Growth and Physiology U: Curtis BC, Rajaram S i Gómez Macpherson H (ed.) Bread wheat improvement and production. FAO, Roma, Italy, 1-47. http://www.fao.org/docrep/006/y4011e/y4011e06.htm 2. Ačkar Đ, Babić J, Šubarić D, Kopjar M, Miličević B (2010) Isolation of starch from two wheat varieties and their modification with epichlorohydrin. Carbohydrate polymers 81(1): 76-82 3. Ahmad M (2002) Assessment of genomic diversity among wheat genotypes as determined by simple sequence repeats. Genome 45: 646-651 4. Ali Y, Atta BM, Akhter J, Monneveux P, Lateef Z (2008) Genetic variability, association and diversity studies in wheat (Triticum aestivum L.) germplasm. Pak J. Bot., 40(5): 20872097 5. Balfourier F, Roussel V, Strelchenko P, Exbrayat-Vinson F, Sourdille P, Boutet G, Koenig J, Ravel C, Mitrofanova O, Beckert M, Charmet G (2007) A worldwide core collection arrayed in a 384-well plate. Theor. Appl. Genet. 114: 1265-1275 6. Banayi J Szucs P, Karsai I, Meszaros K, Kuti C, Lang L, Bedo Z (2006) Cultivar identification by molecular markers. Cereal Res. Commun. 34 (2-3): 865-870 7. Barić M, Jurman M, Habuš Jerčić I, Kereša S, Šarčević H (2008) Procjena strukture uroda zrna sorti i linija ozime pšenice. Sjemenarstvo 25 (2): 91-101 8. Barrett BA, Kidwell KK (1998) AFLP-based genetic diversity assessment among wheat cultivars from the Pacific Northwest. Crop Sci. 38: 1261-1271 9. Barrett BA, Kidwell KK, Fox PN (1998) Comparison of AFLP-based on pedigree-based genetic diversity assessment methods using wheat cultivars from the Pacific Northwest. Crop Sci. 38 (5): 1261-1271 10. Bede M (1994) Novi trendovi u oplemenjivanju pšenice. Sjemenarstvo 11(1-2): 5-13 11. Bede M, Petrovic S (2006) Genetska varijabilnost roditelja-uvjet uspješnom oplemenjivanju pšenice. Sjemenarstvo 23(1): 5-11 100


12. Bedő Z, Vida G, Láng L, Karsai I (1998) Breeding for breadmaking quality using old Hungarian varieties. Euphytica 100: 179-182 13. Bekes F, Cavanagh CR, Martinov

S, Bushuk W, Wrigley CW (2006) The gluten

composition of wheat varieties and genotypes, part II. Composition table for the HMW subunits of glutenin. http://www.aaccnet.org/grainbin/gluten_gliadin.asp 14. Blazek J (2008) Role of amylose in structure-function relationship in starches from Australian wheat varieties. Ph.D. thesis. Faculty of Agriculture, Food and Natural Resources. The University of Sydney. Australia 15. Bordes J, Branlard G, Outy EX, Charmet G, Balfourier F (2008) Agronomic characteristics, grain quality and flour rheology of 372 bread wheats in worldwide core collection. Journal of Cereal Science 48: 569-579 16. Borlaug NE (2007) Sixty-two years of fighting hunger: personal recollections. Euphytica 157: 287-297 17. Borojević S (1990) Genetski napredak u povećanju prinosa pšenice. Savremena poljoprivreda 38(1-2): 25-47 18. Borojević K, Borojević K (2005) Historic role of the variety Akakomugi in Sothern and Central European wheat breeding programs. Breeding Science 55: 253-256 19. Botstein D, White RL, Skolnick M, Davis RW (1980) Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics 32: 314-333 20. Branlard G, Dardevet M, Saccomano R, Lagoutte F, Gourdon J (2001) Genetic diversity of wheat storage proteins and bread wheat quality. Euphytica 119: 59-67 21. Branlard G, Dardevet M, Amiour N, Igrejas G (2003) Allelic diversity of HMW and LMW glutenin subunits and omegagliadins in French bread wheat (Triticum aestivum L.). Genet. Resour. Crop Evol. 50: 669-679 22. Burrell MM (2003) Starch: the need for improved quality or quantity-an overview. Journal of Experimental Botany 54(382): 451-456 101


23. Chebotar SV, Korzun VN, Sivolap YM (2001) Allele distribution at locus WMS261 marking the dwarfing gene Rht8 in common wheat cultivars of Southern Ukraine. Russian Journal of Genetics 37(8): 894-898 24. Chenyang H, Wang L, Zhang X, You G, Dong Y, Jia J, Liu X, Shang X, Liu S, Cao Y (2006) Genetic diversity in Chinese modern wheat varieties revealed by microsatellite markers. Science in China: Series C Life Sciences 49(3): 218-226 25. Chinnusamy V, Khanna-Chopra R (2003) Effect of heat stress on grain starch content in diploid, tetraploid and hexaploid wheat species. J. Agronomy & Crop Science 189: 242249 26. Christiansen MJ, Andersen SB, Ortiz R (2002) Diversity changes in intensively bred wheat germplasm during the 20th century. Molecular breeding 9: 1-11 27. Cooke RJ, Reeves JC (2003) Plant genetic resources and molecular markers: variety registration in a new era. Plant Genetic Resources 1(2-3): 81-87 28. Corbellini M, Perenzin M, Accerbi M, Vaccino P, Borghi B (2002) Genetic diversity in bread wheat, as revealed by coefficient of parentage and molecular markers, and its relationships to hybrid performance. Euphytica 123: 273-285 29. Corcuera V, Salmoral EM, Salerno JC, Krisman CR (2007) Starch molecular fractionation of bread wheat varieties. Agriscientia 24(1): 11-18 30. Čupić T, Tucak m, Popović S, Bolarić S, Grljušić S, Kozumplik V (2009) Genetic diversity of pea (Pisum sativum L.) genotypes assessed by pedigree, morphological and molecular data. Journal pf Food, Agriculture & Environment 7(3-4): 343-348 31. DeLacy IH, Skvomand B, Huerta J (2000) Characterization of Mexican wheat landraces using agronomically useful attributes. Genet. Resour. Crop Evol. 47: 591-602 32. Denčić S (1993) Genetski resursi strnih žita. Savremena poljoprivreda, Novi Sad, 46 (1-2): 87-98 33. Denčić S, Pržulj N, Milovanović M, Protić R, Simović M, Simović M, Stojanović Ž, Perović D (1997) Genetski resursi strnih žita. Savremena poljoprivreda 46 (1-2): 87-98 102


34. Denčić S (2006) Genetika i oplemenjivanje strnih žita. Zbornik radova Naučnog instituta za ratarstvo i povrtarstvo, Novi Sad, 42 (2): 377-394 35. De Vita P, Destri Nicosia OL, Nigro F, Platani C, Riefolo C, Di Fonzo N, Cattivelli L (2007) Breeding progress in morpho-physiological, agronomical and qualitative traits of durum wheat cultivars released in Italy during the 20th century. Europ. J. Agronomy 26: 39-53 36. Dice, LR (1945) Measures and amount of ecologic association between species. Ecology, 26: 297-302 37. Donini P, Law JR, Koebner RMD, Reeves JC, Cooke RJ (2005) The impact of breeding on genetic diversity and erosion in bread wheat. Plant Genetic Resources 3(3): 391-399 38. Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin. 19: 11-15. 39. Dreisigacker S, Zhang P, Warburton ML, Skovmand B, Hoisington D, Melchinger AE (2004) Genetic diversity among and within CIMMYT wheat landrace accessions investigated with SSR’s and implications for plant genetic resources management. Crop Sci. 45: 653– 661 40. Drezner G (1995) Oplemenjivanje pšenice na Poljoprivrednim institutu Osijek. Sjemenarstvo 12(1): 13-38 41. Drezner G, Dvojković K, Guberac V, Marić S, Novoselović D, Horvat D, Španić V., Šimenić J, Primorac J (2010) Novi genotipovi pšenice – procjena uroda i kakvoće u više okolina. Zbornik radova 45. hrvatskog i 5. međunarodnog simpozija agronoma, Opatija, Hrvatska, 15. -19. veljače 2010: 399-403 42. Dvojković K (2005) Genetska analiza kvantitativnih svojstava u biparentalnim i recipročnim križancima ozime pšenice. Magistarski rad. Agronomski fakultet Sveučilišta u Zagrebu. 43. Dvojković K (2009) Genetska raznolikost hrvatskih kultivara pšenice. Doktorska disertacija, Osijek.

103


44. Dvojković K, Šatović Z, Drezner G, Somers DJ, Lalić A, Novoselović D, Horvat D, Marić S, Šarčević H (2010) Allelic variability of Croatian wheat cultivars at the microsatellite locus Xgwm261. Poljoprivreda 16(1): 32-37 45. Eliason AC (2003) Starch structure and bread quality. U: Cauvain SP (ed.) Bread making, improving quality. http://books.google.com/books: 145-167 46. Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular variance inferred from metric distance among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131: 479-491 47. Fu YB, Peterson GW, Scoles G, Rossnagel B, Schoen DJ, Richards KW (2003) Allelic diversity changes in 96 Canadian oat cultivars released from 1886 to 2001. Crop Sci. 43: 1989-1995 48. Fu YB, Peterson GW, Yu JK, Gao L, Jia J, Richards KW (2006) Impact of plat breeding on genetic diversity of the Canadian hard red spring wheat germplasm as revealed by ESTderived SSR markers. Theor. Appl. Genet. 112: 1239-1247 49. Fu YB, Somers DJ (2009) Genome wide reduction of genetic diversity in wheat breeding. Crop Sci. 49: 161-168 50. Fufa H, Beazinger PS, Beecher BS, Graybosch RA, Eskridge KM (2005.) Genetic improvement trends in agronomic performances and end-use quality characteristics among hard red winter wheat cultivars in Nebraska. Euphytica 144: 187-198 51. Gale KR (2005) Diagnostic DNA markers for quality traits in wheat. Journal of Cereal Science 41: 181-192 52. Ganeva G, Korzun V, Landjeva S, Popova Z, Christov NK (2010) Genetic diversity assessment of Bulgarian durum wheat (Triticum durum Desf.) landraces and modern cultivars using microsatellite markers. Genet. Resour. Crop Evol. 57(2): 273-285 53. Gao LF, Jing RL, Huo NX, Li Y, Li XP, Zhou RH, Chang XP, Tang JF, Ma ZY, Jia JZ (2004) One hundred and one new microsatellite loci derived from ESTs (EST-SSRs) in bread wheat. Theor. Appl. Genet. 108: 1392-1400

104


54. Gianibelli MC, Larroque OR, MacRitchie F. Wrigley CW (2002): Biochemical, Genetic, and Molecular Characterization of Wheat Endosperm Proteins. Cereal Chemistry 78 (6): 635646 55. Guberac V, Marić S, Drezner G, Petrović S, Dvojković K, Brandić V (2008) Interrelationships of important agronomic traits and kernel yield in winter wheat. 11th IWGS Proceedings, Sydney University Press , Sydney, 1-4 56. Gupta PK, Varshney RK, Sharma PC, Ramesh B (1999) Molecular markers and their application in wheat breeding. Plant breeding 118: 369-390 57. Glaszmann JC, Kilian B, Upadhyaya HD, Varshney RK (2010) Accessing genetic diversity for crop improvement. Curr. Opin. Plant. Biol. 13: 167-173 58. Grljušić S (2003) Genetska varijabilnost kultivara crvene djeteline (Trifolium pratense L.) nakon selekcije u brdsko-planinskim uvjetima. Doktorska disertacija, Agronomski fakultet, Zagreb 59. Hao C, Wang L, Zhang X, You G, Dong Y, Jia J, Liu X, Shang X, Liu S, Cao Y (2006) Genetic diversity in Chinese modern wheat varieties revealed by microsatellite markers. Sci. China C Life Sci. 49: 218–226 60. Harlan JR (1970) Evolution of cultivated plants. http://www2.bioversityinternational.org/publications/Web_version 61. Haudry A, Cenci A, Ravel C, Batallion T, Brunel D, Poncet C, Hochu I, Poirier S, Santoni S, Glemin S, David J (2007) Grinding up wheat: A massive loss of nucleotide diversity since domestification. Mol. Biol. Evol. 24(7): 1506-1517 62. Horvat D, Drezner G, Jurković Z, Šimić G, Magdić D, Dvojković K (2006) The importance of high-molecular-weight glutenin subunits for wheat quality evaluation. Poljoprivreda 12(1): 53-57 63. Horvat D, Drezner G, Šimić G, Mijić A, Magdić D (2008) Quality of wheat cultivars created at the Agricultural Institute Osijek in relation to high molecular weight glutenin subunits (HMW – GS) composition. Periodicum biologorum 110(3): 263-268

105


64. Horvat D, Kurtanjek Ž, Drezner G, Šimić G, Magdić D (2009) Effects of HMM glutenin subunits on wheat quality attributes. Food Technol. Biotechnol. 43(3): 253-259 65. Hu G, Burton C, Yang C (2010) Efficient measurement of amylose content in cereal grains. Journal of cereal Science 51: 35-40 66. Huang XQ, Wolf M, Ganal MW, Orford S, Koebner RMD, Röder M (2007) Did modern plant breeding lead to genetic erosion in European winter wheat varieties? Crop Sci. 47: 343-349 67. Hyten DL, Song Q, Zhu Y, Choi IY, Nelson RL, Costa JM, Specht JE, Schoemaker RC, Cregan PB (2006) Impacts of genetic bottlenecks on soybean genome diversity. PNAS 103(45): 16666-16671 68. Izadi-Darbandi A, YazdiSamadi B, Shanejat-Boushehri AA, Mohammadi M (2010) allelic variation in Glu-1 and Glu-3 loci of historical and modern Iranian bread wheat (Triticum aestivum L.) cultivars. Journal of Genetics 89(2): 193-199 69. Jaccard P (1908) Nouvelles reschearches sur la distribution florale. Bull. Soc. Vaud. Sci. Nat. 44: 223-270 70. Jin Y, Singh RP (2006) Resistance in U.S. wheat to recent African isolates of Puccinia graminis f. sp. tritici with virulence to resistance gene Sr31. Plant Dis. 40(4): 476-480 71. Jones H, Jarman RJ, Austin L, White J, Cook RJ (2003) The management of variety testing reference collection in distinctness, uniformity and stability testing of wheat. Euphytica 132: 175-184 72. Jošt M, Fišter R, Skenderija M, Mrazović B (1995) Genetic basis of breadmaking quality of Croatian wheat cultivars. Prehrambeno-tehnol. biotehnol. rev. 33(2-3): 103-109 73. Kato K, Miura H, Sawada S (2000) Mapping QTLs and controlling grain yield and its components on chromosome 5A of wheat. Theor. Appl. Genet. 101: 1114-1121 74. Khlestkina EK, Pestsova EG, Salina E, Röder MS, Arbuzova VS, Koval SF, Börner A (2002) Genetic mapping and tagging of wheat genes using RAPD, STS and SSR markers. Cell Mol. Biol. Lett. 7: 795-802 106


75. Khlestkina EK, Huang XQ, Quenum FJB, Chebotar S, Röder MS, Börner A (2004) Genetic diversity in cultivated plants – loss or stability? Theor. Appl. Genet. 108: 1466-1472 76. Khlestkina EK, Röder MS, Efremova TT, Börner A, Shumny VK (2004) The genetic diversity of old and modern Siberian varieties of common spring wheat as determined by microsatellite markers. Plant Breeding 123: 122-127 77. Kobiljski B, Quarrie S, Denčić S, Kirby J, Ivegeš M (2002) Genetic diversity of the Novi Sad wheat core collection revealed by microsatellites. Cell Mol. Biol. Lett. 7: 685-694 78. Korzun V, Röder MS, Ganal MW, Worland AJ, Law CN (1998) Genetic analysis of the dwarfing gene (Rht8) in wheat. Part I. Molecular mapping of Rht8 on the short arm of chromosome 2D of bread wheat (Triticum aestivum L.). Theor. Appl. Genet. 96: 11041109 79. Labuschagne MT, Geleta N, Osthoff G (2007) The influence of environment on starch content and amylose to amylopectin ratio in wheat. Starch/Stärke 59: 234-238 80. Landjeva S, Kozun V, Ganeva G (2006) Evaluation of genetic diversity among Bulgarian winter wheat (Triticum aestivum L.) varieties during the period 1925-2003 using microsatellites. Genet. Resour. Crop Evol. 53: 1605-1614 81. Lásztity R (2002): Prediction of wheat quality-success and doubts. Periodica Polytechnica Ser. Chem. Eng. 46 (1-2): 39-49 82. Law JR, Donini P, Koebner RMD, Reeves JC, Cooke RJ (1998) DNA profiling and plant variety registration. III: The statistical assessment of distinctness in wheat using amplified length polymorphism. Euphytica 102: 335-342 83. Lerner SE, Kolman MA, Rogers WJ (2009) Quality and endosperm storage protein variation in Argentinean grown bread wheat. I. Allelic diversity and discrimination between cultivars. Journal of Cereal Science 49: 337-345 84. Li Y, Huang C, Sui X, Fan Q, Li G, Chu X (2009) Genetic variation of wheat glutenin subunits between landraces and varieties and their contributions to wheat quality improvement. Euphytica 169: 159-168

107


85. Liang D, Tang J, Peña RJ, Singh R, He X, Shen X, Yao D, Xia X, He Z (2010) Characterisation of CIMMYT bread wheats for high and low molecular weight glutenin subunits and other quality-related genes with SDS-PAGE, RP-HPLC and molecular markers. Euphytica 172: 235-250 86. Liu J (2002) POWERMARKER – A powerful software for marker data analysis. North Carolina

State

University,

Bioinformatics

Research

Center,

Relaigh,

NC

(http/powermarker.net) 87. Löschenberger F, Fleck A, Grausgruber H, Hetzendorfer H, Hof G, Lafferty J, Marn M, Neumayer A, Pfaffinger G, Birschitzky J (2008) Breeding for organic agriculture: the example of winter wheat in Austria. Euphytica 163 (3): 469-480 88. Maccaferri M, Stefanelli, Rotondo F, Tuberosa R, Sanguineti MC (2007) Relationships among durum wheat accessions. I. Comparative analysis of SSR, AFLP, and phenotypic data. Genome 50: 373-384 89. MacRitchie F, Lafiandra D (1997) Structure – function relationships of wheat proteins. U: Srinivasan D, Paraf A (ed.) Food proteins and their applications. Marcel Dekker, New York, 293-324. http://books.google.com 90. Manifesto MM, Schlatter AR, Hopp HE, Suarez EY, Dubcovsky J (2001) Quantitative evaluation of genetic diversity in wheat germplasm using molecular markers. Crop Sci. 41: 682-690 91. Mantel N (1967) The detection of disease clustering and a generalized regression approach. Cancer Research 27: 209-220 92. Marić S, Bolaric S, Martinčić J, Pejić I, Kozumplik V (2004) Genetic diversity of hexaploid wheat cultivars estimated by RAPD markers, morphological traits and coefficients of parentage. Plant Breeding 123: 366-369 93. Martos V, Royo C, Rharrabti Y, Garcia del Moral LF (2005) Using AFLPs to determine phylogenetic relationships and genetic erosion in durum wheat cultivars released in Italy and Spain throught the 20th century. Field Crops Research 91: 107-116

108


94. McIntosh SR, Pacey-Miller T, Henry RJ (2004) A universal protocol for identification of cereals. Journal of Cereal Science 41: 37-46 95. Miura H, Tanii S (1994) Endosperm starch properties in several wheat cultivars preferred Japanese noodles. Euphytica 72: 171-175 96. Morgante M, Olivieri AM (1993) PCR amplified microsatellites as markers in plant genetics. The Plant Journal 3(1): 01-08 97. Nakamura T, Yamamori M, Hirano H, Hidaka S (1993) Identification of three Wx proteins in wheat (Triticum aestivum L.). Biochemical genetics 31 (1/2): 75-86 98. Nei M (1973) Analysis of gene diversity in subdivided populations. Proceedings of national Academy of Sciences USA 70: 3321-3323 99. Niegel JE (1997) A comparison of alternative strategies for estimating gene flow from genetic markers. Annu. Rev. Syst. 28: 105-28 100.

Noli E, Teriaca MS, Sanguineti MC, Conti S (2008) Utilization of SSR and AFLP markers

for the assessment of distinctness in durum wheat. Mol. Breeding 22: 301-313. 101.

Novoselovic D, Baric M, Drezner G, Gunjaca J, Lalic A (2004) Quantitative inheritance

of some wheat plant traits. Genetics and Molecular Biology 27(1): 92-98 102.

Oberforster M, Werteker M (1995) Wheat breeding and breadmaking quality in

Austria. Sjemenarstvo 12 (6): 413-425 103.

Oury FX, Chiron H, Faye A, Gardet O, Giraud A, Heumez E, Rolland B, Rousset M,

Trotter M, Charmet G, Branlard G (2010) The prediction of wheat quality: joint use of the phenotypic information brought by technological tests and the genetic information brought by HMW and LMW gutenin subunits. Euphytica 171: 87-109 104.

Ozturk A, Aydin F (2004) Effect of water stress at various growth stages on some

quality characteristics of winter wheat. J. Agronomy & Crop Science 190: 93-99 105.

Paillard S, Schnurbusch, Wienzeler M, Messmer M, Sourdille P, Abderhalden O, Kller

B, Schachermayr G (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.). Theor. Appl. Genet. 107: 1235-1242 109


106.

Payne I, Lawrence GJ (1987) Catalogue of alleles for the complex gene loci, Glu-A1,

Glu-B1 and Glu-D1 which code for high-molecular-weight subunits of glutenin in hexaploid wheat. Cereal Res. Commun.11(1): 29-35 107.

Penzar I, Penzar B (2000) Agrometeorologija. Školska knjiga, Zagreb, 155 – 165

108.

Plaschke J, Ganal MW, Röder MS (1995) Detection of genetic diversity in closely

related bread wheat using microsatellite markers. Theor. Appl. Genet. 91:1001-1007 109.

Powell W, Machray GC, Provan J (1996) Polymorphism revealed by simple sequence

repeats. Trends in Plant Science 1(7): 215-222 110.

Prada D (2009) Molecular population genetics and agronomic alleles in seed banks:

searching for a needle in a haystack? Journal of Experimental Botany 60 (9): 2541-2552 111.

Prasad B, Babar MA, Xu XY, Bai GH, Klatt AR (2009) Genetic diversity in the U.S. hard

red winter wheat cultivars as revealed by microsatellite markers. Crop & Pasture Science 60: 16-24 112.

Rahman S, Li Z, Batey I, Cochrane MO, Appels R, Morell M (2000) Genetic alteration

of starch functionality in wheat. Journal of Cereal Science 31: 91-110 113.

Regina A (2000) Genetic variation of starch in Triticum species. Ph.D. thesis. Faculty of

Agriculture. University of Sydney. Australia 114.

Reif JC, Zhang P, Dreisigacker S, Warbourton ML, van Ginkel D, Hoisington M, Bohn

M, Melchinger AE (2005) Trends in genetic diversity during the history of wheat domestification and breeding. Theor. Appl. Genet. 110: 859-864 115.

Reynolds M, Foulkes MJ, Slafer A, Berry P, Parry MAJ, Snape JW, Angus WJ (2009)

Raising yield potential in wheat. Journal of Experimental Botany 60(7): 1899-1918 116.

Röder MS, Korzun V, Wendehake K, Plaschke J, Tixier MH, Leroy P, Ganal MW (1998)

A microsatellite map of wheat. Genetics 149: 2007-2023 117.

Rogers JS (1972) Measures of genetic similarity and genetic distance. Studies in

Genet. VII. Univ. Texas Publ. 7213: 145-153

110


118.

Rogers DG, Tanimoto TT (1960) A computer program for classifying plants. Science

132: 1115-1118 119.

Rohf FJ (2009) NTSYS-pc. Numerical Taxonomy System, ver. 2.21c. Exeter Software,

Setauket, New York, USA 120.

Roussel V, Koenig J, Beckert M, Balfourier F (2004) Molecular diversity in French

bread wheat accessions related to temporal trends and breeding programs. Theor. Appl. Genet. 108: 920-930 121.

Roussel V, Leisova L, Exbrayat F, Stehno Z, Balfourier F (2005) SSR allelic diversity

changes in 480 European bread wheat varieties released from 1840 to 2000. Theor. Appl. Genet. 111: 162-170 122.

Roy JK, Lakshmikumaran MS, Balyan HS, Gupta PK (2004) AFLP-based genetic

diversity and its comparison with diversity based on SSR, SAMPL, and phenotypic traits in bread wheat. Biochemical Genetics 42(1/2): 43-59 123.

Rukavina I, Ore Jurić R, Varnica I (2008) DUS ispitivanje novih sorti ozime pšenice u

Republici Hrvatskoj u razdoblju od 2000. do 2008. godine. Zbornik radova 43. Hrvatskog i 3. Međunarodnog simpozija agronoma u Opatiji. 269-272 124.

Sabo M, Bede M, Hardi ŽU (2002) Variability of grain yield of some winter wheat

genotypes (Triticum aestivum L.). Rostlinná výroba 48 (5): 230-235 125.

SAGAGT genotyping software program ver 3.2. LI-COR® Biosciences Saga unix 1.0

126.

Salem KFM, El-Zanaty AM, Esmail RM (2008) Assessing wheat (Triticum aestivum L.)

genetic diversity using morphological characters and microsatellite markers. World Journal of Agricultural Science 4(5): 538-544 127.

Samobor V, Vukobratović M, Ivanek-Martinčić M, Jošt M (2005) Oplemenjivanje

pšenice na visoku pekarsku kakvoću. Sjemenarstvo 22 (1-2): 5-11 128.

SAS Institute (2003) SAS/STAT User’s Guide, Version 9.1.3. SAS Institute, Inc., Cary,

NC, USA

111


129.

Schulman AH (2007) Molecular markers to asses genetic diversity. Euphytica 158 (3):

313-321 130.

Schut JW, Qi X, Stam (1997) Association between relationship measures based on

AFLP markers, pedigree data and morphological traits in barley. Theor. Appl. Genet. 95: 1161-1168 131.

Schneider S, Roesseli D, Excoffier L (2000) Arlequin ver.2.0.a software for population

genetics data analysis. Genetics and Biometry Laboratory, University of Geneva Switzerland. 132.

Singh N, Singh S, Isono N, Noda T, Singh AM (2009) Diversity in amylopectin structure,

thermal and pasting properties of starches from wheat varieties/lines. Internat. J.Biol. Macromol. 45: 298-304 133.

Singletary GW (2000) Starch synthesis and grain filling in wheat. U: Gupta AK i Kaur N

(ed.) Carbohydrate Reserves in Plants â&#x20AC;&#x201C; Synthesis and Regulation. Elsevier Science B.V., 79-105 134.

Skovmand B, Reynolds MP, Delacy IH (2001) Searching genetic resources for

physiological traits with potential for increasing yield. U: Reynolds MP, Ortiz-Monasterio JI i McNab A (ed.) Application of Physiology in Wheat Breeding. D.F., CIMMYT, 17-28 135.

Slafer, GA, Calderini DF, Miralles DJ (1996): Yield components and compensation in

wheat: opportunities for further increasing yield potential. U: Reynolds, MP, Rajaram S, McNab, A (ed.) Increasing yield potential in wheat: breaking the barriers. Mexico, DF, CIMMYT, 101-133. http://books.google.com/books 136.

Smale M (1997) The green revolution and wheat genetic diversity: some unfounded

assumptions. World development 25(8): 1257-1269 137.

Somers DJ, Isaac P, Edwards K (2004) A high-density microsatellite consensus map for

bread wheat (Triticum aestivum L.) Theor. Appl. Genet. 109: 1105-1114 138.

Stephenson P, Bryan, Kirby J, Collins A, Devos K, Busso C, Gale M (1998) Fifty new

microsatellite loci for the wheat genetic map. Theor. Appl. Genet. 97: 946-949

112


139.

Stępien Ł, Mohler V, Bocianowski J, Koczyk G (2007) Assessing genetic diversity of

Polish wheat (Triticum aestivum) varieties using microsatellite markers. Genet. Resour. Crop Evol. 54: 1499-1506 140.

Stodart BJ, Mackay M, Raman H (2005.) AFLP and SSR analysis of genetic diversity

among landraces of bread wheat (Triticum aestivum L. em. Thell) from different geographic regions. Australian Journal of Agricultural Research 56: 691-697 141. Sultana T, Ghafoor A, Ashraf M (2007) Genetic variability in bread wheat (Triticum aestivum L.) Pakistan based on polymorphism for high molecular weight glutenin subunits. Genet. Resour. Crop Evol.54: 1159-1165 142. Šatović Z (1999) Genetski biljezi i njihova uporaba u biljnoj genetici, oplemenjivanju i sjemenarstvu. Sjemenarstvo 16(1-2): 73-95 143. Tanaka H, Nakata N, Osawa M, Tomita M, Tsujimoto H, Yasamuro Y (2003) Positive effect of the high-molecular-weight glutenin allele, Glu-D1d, on the bread-making quality of common wheat. Plant Breeding 122: 279-280 144. Tanksley SD, McCouch SR (1997) Seed banks and molecular maps: Unlocking genetic potential from the wild. Science 277: 1063-1066 145. Tohver M (2007) High molecular weight (HMW) glutenin subunit composition of some Nordic and Middle European wheats. Genet. Resour. Crop Evol. 54: 67-81 146. Triboi E, Abad A, Michelena A, Lloveras J, Ollier JL, Daniel C (2000) Environmental effects on the quality of two wheat genotypes: 1.quantitative and qualitative variation of storage proteins. European Journal of Agronomy 13: 47-64 147. Tripp R, Van der Heide W (1996) The erosion of crop genetic diversity: challenges, strategies and uncertainties. ODI Natural Resource Perspectives 7: 1-10 148. Van Heerwaarden J, Hellin J, Visser RF, van Eeuwijk FA (2009) estimating erosion in modernized smallholder agriculture. Theor. Appl. Genet. 119: 875-888 149. Vieira EA, de Caravalho FIF, Bertan I, Kopp MM, Zimmer PD, Benin G, da Silva JAG, Hartwig I, Malone G, de Oliveira AC (2007) Association between genetic distances in 113


wheat (Triticum aestivum L.) as estimated by AFLP and morphological markers. Genet. Mol. Biol. 30(2): 392-399 150. Vos P, Hogers R, Bleeker M, Reijans M, van de Le T, Hornes M, Jerina F, Peleman J, Kuiper M, Zabeau M (1995) AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23(21): 4407-4414 151. Warburton ML, Crossa J, Franco J, Kazi M, Trethowan R, Rajaram S, Pfeiffer W, Zhang P, Dreisigacker S, van Ginkel M (2006) Bringing wild relatives back into the family: recovering genetic diversity in CIMMYT improved wheat germplasm. Euphytica 149: 289301 152. White J, Law JR, MacKay I, Chalmers KJ, Smith JSC, Kilian A, Powell W (2008) The genetic diversity of UK, US and Australian cultivars of Triticum aestivum measured by DArT markers and considered by genome. Theor. Appl. Genet. 116 (3): 439-453 153. Worland AJ, Korzun V, RÓ§der M, Ganal MW, Law CN (1998) Genetic analysis of the dwarfing gene (Rht8) in wheat. Part II. The distribution and adaptive significance of allelic variants at the Rht8 locus of wheat as revealed by microsatellite screening. Theor. Appl. Genet. 96: 1110-1120 154.

Worland T, Snape JW (2000) Genetic basis of worldwide wheat varietal improvement.

U: Bonjean AP, Angus WJ (ed.) World wheat book. Lavoisier publishing, Paris, France. 59100 155.

Yamamori M, Nakamura T, Kuroda A (1992) Variations in the content of starch-

granule bound protein among several Japanese cultivars of common wheat (Triticum aestivum L.). Euphytica 64: 215-219 156.

Yanaka M, Takata K, Ikeda TM, Ishikawa N (2007) Effect of the high-molecular-weight

glutenin allele, Glu-D1d, on the noodle quality of common wheat. Breeding Science 57: 243-248 157. Yang FP, Wang LH, Wang JW, He XY, Zhang XK, Shang XW, Yang WX, Xia XC, He ZH (2010) Characterization of high- and low-molecular-weight glutenin subunit genes in Chinese winter wheat cultivars and advanced lines using allele-specific markers and SDSPAGE. Crop & Pasture Science 61: 84-91 114


158. You GX, Zhang XY, Wang LF (2004) An estimation of the minimum number of SSR loci needed to reveal genetic relationships in wheat varieties: Information from 96 random accessions with maximized genetic diversity. Molecular Breeding 14: 397-406 159. Zhang PP, Ma HX, Yao JB, He ZH (2009) Effect of allelic variation and expression quantity at Glu-1 loci on size distribution of glutenin polymer in common wheat. Acta Agronomica Sinica 35(9): 1606-1612 160. Zhang X, Yang S, Zhou Y, He Z, Xia X (2006) Distribution of the Rht-B1b, Rht-D1b and RHT8 reduced height genes in autumn-sown Chinese wheats detected by molecular markers. Euphytica 152: 109-116 161. Zhang XY, Li CW, Wang LF, Wang HM, You GX, Dong YS (2002) An estimation of the minimum number of SSR loci needed to reveal genetic relationships in wheat varieties. I. Information from large-scale planted varieties and cornerstone breeding parents in Chinese wheat improvement. Theor. Appl. Genet. 106: 112-117 162.

Zheleva D, Todorovska E, Jacquemin JM, Atanassov a, Christov N, Panayotov I, Tsenov

N (2006) Allele distribution at microsatellite locus Xgwm261 marking the dwarfing gene Rht8 in hexaploid wheat from Bulgarian and Belgian gene bank collections and its application in breeding programs. Biotechnol. & biotechnol. Eq. 20 (2): 45-56

115


9. SAŽETAK U radu su istraživana tri načina utvrđivanja genetske različitosti sorata ozime krušne pšenice. Ispitana je genetska različitost na temelju agronomskih podataka, morfoloških svojstava i molekularnih podataka. Ciljevi istraživanja bili su: 1. procijeniti različitost germplazme pšenice pomoću agronomskomorfoloških svojstava i molekularnih markera, 2. istražiti postojanje genetske erozije unutar ispitivane germplazme ozime pšenice i 3. ispitati mogućnost korištenja kombinacije agronomsko-morfoloških svojstava i molekularnih markera u procjeni genetske različitosti u oplemenjivačke svrhe. U istraživanje je uključeno 40 sorata ozime krušne pšenice podrijetlom iz Hrvatske, Austrije, Francuske, Italije i Rusije. Poljski pokus je postavljen po slučajnom blok rasporedu u tri ponavljanja tijekom dvije vegetacijske godine (2007./2008., 2008./2009.). U analizu, na temelju agronomskih i morfoloških podataka, uključeno je po 10 svojstava. Sastav visokomolekularnih podjedinica glutenina (HMW GS) utvrđen je za 16 genotipova, a za ostale genotipove podaci su dobiveni na temelju literaturnih podataka. Analiza sastava škroba temeljila se na izdvajanju amiloze i amilopektina te njihove količine i omjera. Za SSR analizu korišteno je 26 mikrosatelita, a za AFLP analizu korišteno je četiri kombinacije početnica. Statističke analize navedenih podataka provedene su pomoću SAS Software 9.1.3, NTSYS ver.2.2., Arlequin ver2.0. i Powermarker ver.3.25. Analizom varijance (ANOVA) utvrđene su statistički visoko opravdane razlike (p<0,001) između svih genotipova za sva ispitivana agronomska svojstva te za količinu amiloze i amilopektina. Utvrđena je velika varijabilnost sastava HMW GS između ispitivanih genotipova. Procijenjena je genetska udaljenost na temelju morfoloških i molekularnih podataka. Obavljene su analize skupina na temelju kojih su sastavljeni dendogrami. Na temelju genetske udaljenosti za molekularne podatke obavljena je analiza molekularne varijance (AMOVA). Unutar i između ispitivanih genotipova utvrđena je genetska različitost za morfološke i molekularne podatke. Mikrosatelitni i AFLP markeri pokazali su visok stupanj polimorfizma između ispitivanih genotipova te sposobnost razlikovanja vrlo srodnih genotipova. Utvrđena je značajna korelacija između dvije molekularne metode, koje su se pokazale učinkovitije za utvrđivanje genetske različitosti u odnosu na agronomska i morfološka svojstva. Ključne riječi: pšenica, genetska različitost, agronomska svojstva, morfološka svojstva, SSR, AFLP 114


10. ABSTRACT In this study three methods of genetic diversity estimation in winter wheat varieties were used. Diversity was analyzed based on agronomic and morphologic traits and molecular data. The main objectives of this study were: 1. to estimate genetic diversity of wheat germplasm using agronomic and morphologic traits and molecular markers, 2. to investigate the existence of genetic erosion within tested wheat germplasm, 3. to explore potential utilization of combination of agronomic, morphologic and molecular markers in plant breeding. Forty winter bread wheat varieties were used originating from Croatia, Austria, France, Italy and Russia. Field trial was conducted during two vegetation years (2007/2008, 2008/2009) in three replications according to randomized block design. Ten traits were included in agronomic and morphologic analysis. Composition of high molecular weight glutenin subunits (HMW GS) was evaluated for 16 varieties, for the rest literature data was used. Starch composition analysis was based on amylose and amylopectin isolation, their quantity and ratio. For the SSR analysis 26 microsatellite primers were used, and for the AFLP analysis four primer combinations. Statistical analysis was performed using SAS Software 9.1.3, NTSYS ver.2.2., Arlequin ver2.0. and Powermarker ver.3.25. Analyzed varieties displayed highly significant differences (p<0,001) for all agronomic traits and for amylose/amylopectin ratio. High variability of HMW GS was found among varieties. Estimation of genetic diversity based on morphologic and molecular data were used to construct dendograms. AMOVA was used to evaluate variability based on molecular data. Genetic diversity was estimated among and within morphologic and molecular data. SSR and AFLP markers showed efficient discrimination power between highly related genotypes. Significant correlation was found between two molecular methods which showed more accurate estimate of genetic diversity than by agronomic and morphologic data. Key words: wheat, genetic diversity, agronomic traits, morphologic traits, SSR, AFLP.

115


11. PRILOZI 11.1. Prilog 1 Tablice LSD vrijednosti za ispitivana agronomska svojstva u vegetacijskoj 2007./2008. Tablica 54. Rezultati LSD testa za visinu biljke Tablica 55. Rezultati LSD testa za broj biljaka po jedinici povrĹĄine Tablica 56. Rezultati LSD testa za duljinu klasa Tablica 57. Rezultati LSD testa za broj klasiÄ&#x2021;a po klasu Tablica 58. Rezultati LSD testa za broj zrna po klasu Tablica 59. Rezultati LSD testa za masu 1000 zrna Tablica 60. Rezultati LSD testa za hektolitarsku masu Tablica 61. Rezultati LSD testa za urod zrna

116


117

4,11 0,00

6 17 15 16 12 10 5 25 14 7 23 37 9 18 26 8 4 3 24 21 20 22 34 19 33 11 28 27 32 2 30 13 39 29 38 40 35

116,09 31 35,19 120,20 36 31,08 151,28 1 0,00

67,32 71,29 71,48 74,24 74,59 74,99 76,31 77,41 78,36 79,11 79,19 80,60 80,75 81,37 82,29 83,55 84,04 84,37 85,87 85,95 86,77 87,96 88,05 88,99 90,12 91,15 91,24 91,33 93,95 95,25 104,25 105,16 107,31 112,45 114,95 115,12 116,04

120,20 36 52,88 48,91 48,72 45,96 45,61 45,21 43,89 42,79 41,84 41,09 41,01 39,60 39,45 38,83 37,91 36,65 36,16 35,83 34,33 34,25 33,43 32,24 32,15 31,21 30,08 29,05 28,96 28,87 26,25 24,95 15,95 15,04 12,89 7,75 5,25 5,08 4,16

151,28 1 83,96 79,99 79,80 77,04 76,69 76,29 74,97 73,87 72,92 72,17 72,09 70,68 70,53 69,91 68,99 67,73 67,24 66,91 65,41 65,33 64,51 63,32 63,23 62,29 61,16 60,13 60,04 59,95 57,33 56,03 47,03 46,12 43,97 38,83 36,33 36,16 35,24

0,00

116,09 31 48,77 44,80 44,61 41,85 41,50 41,10 39,78 38,68 37,73 36,98 36,90 35,49 35,34 34,72 33,80 32,54 32,05 31,72 30,22 30,14 29,32 28,13 28,04 27,10 25,97 24,94 24,85 24,76 22,14 20,84 11,84 10,93 8,78 3,64 1,14 0,97 0,05

116,04 35 48,72 44,75 44,56 41,80 41,45 41,05 39,73 38,63 37,68 36,93 36,85 35,44 35,29 34,67 33,75 32,49 32,00 31,67 30,17 30,09 29,27 28,08 27,99 27,05 25,92 24,89 24,80 24,71 22,09 20,79 11,79 10,88 8,73 3,59 1,09 0,92 0,00

115,12 40 47,80 43,83 43,64 40,88 40,53 40,13 38,81 37,71 36,76 36,01 35,93 34,52 34,37 33,75 32,83 31,57 31,08 30,75 29,25 29,17 28,35 27,16 27,07 26,13 25,00 23,97 23,88 23,79 21,17 19,87 10,87 9,96 7,81 2,67 0,17 0,00

114,95 38 47,63 43,66 43,47 40,71 40,36 39,96 38,64 37,54 36,59 35,84 35,76 34,35 34,20 33,58 32,66 31,40 30,91 30,58 29,08 29,00 28,18 26,99 26,90 25,96 24,83 23,80 23,71 23,62 21,00 19,70 10,70 9,79 7,64 2,50 0,00

112,45 29 45,13 41,16 40,97 38,21 37,86 37,46 36,14 35,04 34,09 33,34 33,26 31,85 31,70 31,08 30,16 28,90 28,41 28,08 26,58 26,50 25,68 24,49 24,40 23,46 22,33 21,30 21,21 21,12 18,50 17,20 8,20 7,29 5,14 0,00

107,31 39 39,99 36,02 35,83 33,07 32,72 32,32 31,00 29,90 28,95 28,20 28,12 26,71 26,56 25,94 25,02 23,76 23,27 22,94 21,44 21,36 20,54 19,35 19,26 18,32 17,19 16,16 16,07 15,98 13,36 12,06 3,06 2,15 0,00

105,16 13 37,84 33,87 33,68 30,92 30,57 30,17 28,85 27,75 26,80 26,05 25,97 24,56 24,41 23,79 22,87 21,61 21,12 20,79 19,29 19,21 18,39 17,20 17,11 16,17 15,04 14,01 13,92 13,83 11,21 9,91 0,91 0,00

104,25 30 36,93 32,96 32,77 30,01 29,66 29,26 27,94 26,84 25,89 25,14 25,06 23,65 23,50 22,88 21,96 20,70 20,21 19,88 18,38 18,30 17,48 16,29 16,20 15,26 14,13 13,10 13,01 12,92 10,30 9,00 0,00

93,95 32 26,63 22,66 22,47 19,71 19,36 18,96 17,64 16,54 15,59 14,84 14,76 13,35 13,20 12,58 11,66 10,40 9,91 9,58 8,08 8,00 7,18 5,99 5,90 4,96 3,83 2,80 2,71 2,62 0,00

91,33 27 24,01 20,04 19,85 17,09 16,74 16,34 15,02 13,92 12,97 12,22 12,14 10,73 10,58 9,96 9,04 7,78 7,29 6,96 5,46 5,38 4,56 3,37 3,28 2,34 1,21 0,18 0,09 0,00

91,24 28 23,92 19,95 19,76 17,00 16,65 16,25 14,93 13,83 12,88 12,13 12,05 10,64 10,49 9,87 8,95 7,69 7,20 6,87 5,37 5,29 4,47 3,28 3,19 2,25 1,12 0,09 0,00

91,15 11 23,83 19,86 19,67 16,91 16,56 16,16 14,84 13,74 12,79 12,04 11,96 10,55 10,40 9,78 8,86 7,60 7,11 6,78 5,28 5,20 4,38 3,19 3,10 2,16 1,03 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

95,25 2 27,93 23,96 23,77 21,01 20,66 20,26 18,94 17,84 16,89 16,14 16,06 14,65 14,50 13,88 12,96 11,70 11,21 10,88 9,38 9,30 8,48 7,29 7,20 6,26 5,13 4,10 4,01 3,92 1,30 0,00

90,12 33 22,80 18,83 18,64 15,88 15,53 15,13 13,81 12,71 11,76 11,01 10,93 9,52 9,37 8,75 7,83 6,57 6,08 5,75 4,25 4,17 3,35 2,16 2,07 1,13 0,00

88,99 19 21,67 17,70 17,51 14,75 14,40 14,00 12,68 11,58 10,63 9,88 9,80 8,39 8,24 7,62 6,70 5,44 4,95 4,62 3,12 3,04 2,22 1,03 0,94 0,00

Tablica 54. Rezultati LSD testa za visinu biljke u 2007./2008. 88,05 34 20,73 16,76 16,57 13,81 13,46 13,06 11,74 10,64 9,69 8,94 8,86 7,45 7,30 6,68 5,76 4,50 4,01 3,68 2,18 2,10 1,28 0,09 0,00

86,77 20 19,45 15,48 15,29 12,53 12,18 11,78 10,46 9,36 8,41 7,66 7,58 6,17 6,02 5,40 4,48 3,22 2,73 2,40 0,90 0,82 0,00

85,95 21 18,63 14,66 14,47 11,71 11,36 10,96 9,64 8,54 7,59 6,84 6,76 5,35 5,20 4,58 3,66 2,40 1,91 1,58 0,08 0,00

LSD0,01 = 4,895

LSD0,05 = 3,691

F test =165,07 **

87,96 22 20,64 16,67 16,48 13,72 13,37 12,97 11,65 10,55 9,60 8,85 8,77 7,36 7,21 6,59 5,67 4,41 3,92 3,59 2,09 2,01 1,19 0,00

85,87 24 18,55 14,58 14,39 11,63 11,28 10,88 9,56 8,46 7,51 6,76 6,68 5,27 5,12 4,50 3,58 2,32 1,83 1,50 0,00

84,37 3 17,05 13,08 12,89 10,13 9,78 9,38 8,06 6,96 6,01 5,26 5,18 3,77 3,62 3,00 2,08 0,82 0,33 0,00

84,04 4 16,72 12,75 12,56 9,80 9,45 9,05 7,73 6,63 5,68 4,93 4,85 3,44 3,29 2,67 1,75 0,49 0,00

83,55 8 16,23 12,26 12,07 9,31 8,96 8,56 7,24 6,14 5,19 4,44 4,36 2,95 2,80 2,18 1,26 0,00

81,37 18 14,05 10,08 9,89 7,13 6,78 6,38 5,06 3,96 3,01 2,26 2,18 0,77 0,62 0,00

80,75 9 13,43 9,46 9,27 6,51 6,16 5,76 4,44 3,34 2,39 1,64 1,56 0,15 0,00

80,60 37 13,28 9,31 9,12 6,36 6,01 5,61 4,29 3,19 2,24 1,49 1,41 0,00

18 Ružica 19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela

82,29 26 14,97 11,00 10,81 8,05 7,70 7,30 5,98 4,88 3,93 3,18 3,10 1,69 1,54 0,92 0,00

79,19 23 11,87 7,90 7,71 4,95 4,60 4,20 2,88 1,78 0,83 0,08 0,00

78,36 14 11,04 7,07 6,88 4,12 3,77 3,37 2,05 0,95 0,00

77,41 25 10,09 6,12 5,93 3,17 2,82 2,42 1,10 0,00

38 Edison 39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide

79,11 7 11,79 7,82 7,63 4,87 4,52 4,12 2,80 1,70 0,75 0,00

76,31 5 8,99 5,02 4,83 2,07 1,72 1,32 0,00

74,99 10 7,67 3,70 3,51 0,75 0,40 0,00

74,59 12 7,27 3,30 3,11 0,35 0,00

74,24 16 6,92 2,95 2,76 0,00

71,48 71,29 67,32 15 17 6 4,16 3,97 0,00 0,19 0,00 0,00


118

38 18 32 23 22 21 1 19 17 35 29 26 27 39 20 31 33 3 4 14 11 36 13 30 37 5 8 40 12 16 34 9 25 7 10 2

15 28 24 6

121,33 132,33 143,33 148,00 149,67 152,67 153,00 153,33 155,00 156,33 159,00 159,33 159,33 160,33 160,67 162,00 162,67 163,67 164,67 165,67 166,00 167,67 168,33 168,67 174,67 178,00 182,00 182,33 184,33 186,33 194,67 195,33 198,67 199,00 199,67 202,33

202,33 207,00 209,33 209,67

7,34 2,67 0,34 0,00

209,67 6 88,34 77,34 66,34 61,67 60,00 57,00 56,67 56,34 54,67 53,34 50,67 50,34 50,34 49,34 49,00 47,67 47,00 46,00 45,00 44,00 43,67 42,00 41,34 41,00 35,00 31,67 27,67 27,34 25,34 23,34 15,00 14,34 11,00 10,67 10,00 7,34

7,00 2,33 0,00

209,33 24 88,00 77,00 66,00 61,33 59,66 56,66 56,33 56,00 54,33 53,00 50,33 50,00 50,00 49,00 48,66 47,33 46,66 45,66 44,66 43,66 43,33 41,66 41,00 40,66 34,66 31,33 27,33 27,00 25,00 23,00 14,66 14,00 10,66 10,33 9,66 7,00

4,67 0,00

207,00 28 85,67 74,67 63,67 59,00 57,33 54,33 54,00 53,67 52,00 50,67 48,00 47,67 47,67 46,67 46,33 45,00 44,33 43,33 42,33 41,33 41,00 39,33 38,67 38,33 32,33 29,00 25,00 24,67 22,67 20,67 12,33 11,67 8,33 8,00 7,33 4,67

0,00

202,33 2 81,00 70,00 59,00 54,33 52,66 49,66 49,33 49,00 47,33 46,00 43,33 43,00 43,00 42,00 41,66 40,33 39,66 38,66 37,66 36,66 36,33 34,66 34,00 33,66 27,66 24,33 20,33 20,00 18,00 16,00 7,66 7,00 3,66 3,33 2,66 0,00

202,33 15 81,00 70,00 59,00 54,33 52,66 49,66 49,33 49,00 47,33 46,00 43,33 43,00 43,00 42,00 41,66 40,33 39,66 38,66 37,66 36,66 36,33 34,66 34,00 33,66 27,66 24,33 20,33 20,00 18,00 16,00 7,66 7,00 3,66 3,33 2,66 0,00

199,67 10 78,34 67,34 56,34 51,67 50,00 47,00 46,67 46,34 44,67 43,34 40,67 40,34 40,34 39,34 39,00 37,67 37,00 36,00 35,00 34,00 33,67 32,00 31,34 31,00 25,00 21,67 17,67 17,34 15,34 13,34 5,00 4,34 1,00 0,67 0,00

199,00 7 77,67 66,67 55,67 51,00 49,33 46,33 46,00 45,67 44,00 42,67 40,00 39,67 39,67 38,67 38,33 37,00 36,33 35,33 34,33 33,33 33,00 31,33 30,67 30,33 24,33 21,00 17,00 16,67 14,67 12,67 4,33 3,67 0,33 0,00

198,67 25 77,34 66,34 55,34 50,67 49,00 46,00 45,67 45,34 43,67 42,34 39,67 39,34 39,34 38,34 38,00 36,67 36,00 35,00 34,00 33,00 32,67 31,00 30,34 30,00 24,00 20,67 16,67 16,34 14,34 12,34 4,00 3,34 0,00

195,33 9 74,00 63,00 52,00 47,33 45,66 42,66 42,33 42,00 40,33 39,00 36,33 36,00 36,00 35,00 34,66 33,33 32,66 31,66 30,66 29,66 29,33 27,66 27,00 26,66 20,66 17,33 13,33 13,00 11,00 9,00 0,66 0,00

194,67 34 73,34 62,34 51,34 46,67 45,00 42,00 41,67 41,34 39,67 38,34 35,67 35,34 35,34 34,34 34,00 32,67 32,00 31,00 30,00 29,00 28,67 27,00 26,34 26,00 20,00 16,67 12,67 12,34 10,34 8,34 0,00

186,33 16 65,00 54,00 43,00 38,33 36,66 33,66 33,33 33,00 31,33 30,00 27,33 27,00 27,00 26,00 25,66 24,33 23,66 22,66 21,66 20,66 20,33 18,66 18,00 17,66 11,66 8,33 4,33 4,00 2,00 0,00

184,33 12 63,00 52,00 41,00 36,33 34,66 31,66 31,33 31,00 29,33 28,00 25,33 25,00 25,00 24,00 23,66 22,33 21,66 20,66 19,66 18,66 18,33 16,66 16,00 15,66 9,66 6,33 2,33 2,00 0,00

182,00 8 60,67 49,67 38,67 34,00 32,33 29,33 29,00 28,67 27,00 25,67 23,00 22,67 22,67 21,67 21,33 20,00 19,33 18,33 17,33 16,33 16,00 14,33 13,67 13,33 7,33 4,00 0,00

178,00 5 56,67 45,67 34,67 30,00 28,33 25,33 25,00 24,67 23,00 21,67 19,00 18,67 18,67 17,67 17,33 16,00 15,33 14,33 13,33 12,33 12,00 10,33 9,67 9,33 3,33 0,00

174,67 37 53,34 42,34 31,34 26,67 25,00 22,00 21,67 21,34 19,67 18,34 15,67 15,34 15,34 14,34 14,00 12,67 12,00 11,00 10,00 9,00 8,67 7,00 6,34 6,00 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

182,33 40 61,00 50,00 39,00 34,33 32,66 29,66 29,33 29,00 27,33 26,00 23,33 23,00 23,00 22,00 21,66 20,33 19,66 18,66 17,66 16,66 16,33 14,66 14,00 13,66 7,66 4,33 0,33 0,00

168,67 30 47,34 36,34 25,34 20,67 19,00 16,00 15,67 15,34 13,67 12,34 9,67 9,34 9,34 8,34 8,00 6,67 6,00 5,00 4,00 3,00 2,67 1,00 0,34 0,00

168,33 13 47,00 36,00 25,00 20,33 18,66 15,66 15,33 15,00 13,33 12,00 9,33 9,00 9,00 8,00 7,66 6,33 5,66 4,66 3,66 2,66 2,33 0,66 0,00

167,67 36 46,34 35,34 24,34 19,67 18,00 15,00 14,67 14,34 12,67 11,34 8,67 8,34 8,34 7,34 7,00 5,67 5,00 4,00 3,00 2,00 1,67 0,00

166,00 11 44,67 33,67 22,67 18,00 16,33 13,33 13,00 12,67 11,00 9,67 7,00 6,67 6,67 5,67 5,33 4,00 3,33 2,33 1,33 0,33 0,00

164,67 4 43,34 32,34 21,34 16,67 15,00 12,00 11,67 11,34 9,67 8,34 5,67 5,34 5,34 4,34 4,00 2,67 2,00 1,00 0,00

LSD0,01 = 23,466

LSD0,05 = 17,694

F test = 11,48 **

165,67 14 44,34 33,34 22,34 17,67 16,00 13,00 12,67 12,34 10,67 9,34 6,67 6,34 6,34 5,34 5,00 3,67 3,00 2,00 1,00 0,00

163,67 3 42,34 31,34 20,34 15,67 14,00 11,00 10,67 10,34 8,67 7,34 4,67 4,34 4,34 3,34 3,00 1,67 1,00 0,00

Tablica 55. Rezultati LSD testa za broj biljaka po jedinici površine u 2007./2008. 162,67 33 41,34 30,34 19,34 14,67 13,00 10,00 9,67 9,34 7,67 6,34 3,67 3,34 3,34 2,34 2,00 0,67 0,00

162,00 31 40,67 29,67 18,67 14,00 12,33 9,33 9,00 8,67 7,00 5,67 3,00 2,67 2,67 1,67 1,33 0,00

160,33 39 39,00 28,00 17,00 12,33 10,66 7,66 7,33 7,00 5,33 4,00 1,33 1,00 1,00 0,00

159,33 26 38,00 27,00 16,00 11,33 9,66 6,66 6,33 6,00 4,33 3,00 0,33 0,00 0,00

17 Mihaela 18 Ružica 19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka

160,67 20 39,34 28,34 17,34 12,67 11,00 8,00 7,67 7,34 5,67 4,34 1,67 1,34 1,34 0,34 0,00

159,33 27 38,00 27,00 16,00 11,33 9,66 6,66 6,33 6,00 4,33 3,00 0,33 0,00

159,00 29 37,67 26,67 15,67 11,00 9,33 6,33 6,00 5,67 4,00 2,67 0,00

155,00 17 33,67 22,67 11,67 7,00 5,33 2,33 2,00 1,67 0,00

153,33 153,00 152,67 149,67 148,00 143,33 132,33 121,33 19 1 21 22 23 32 18 38 32,00 31,67 31,34 28,34 26,67 22,00 11,00 0,00 21,00 20,67 20,34 17,34 15,67 11,00 0,00 10,00 9,67 9,34 6,34 4,67 0,00 5,33 5,00 4,67 1,67 0,00 3,66 3,33 3,00 0,00 0,66 0,33 0,00 0,33 0,00 0,00

37 Bastide 38 Edison 39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius

156,33 35 35,00 24,00 13,00 8,33 6,66 3,66 3,33 3,00 1,33 0,00


119

17 10 7 8 5 30 16 6 9 15 12 4 2 29 3 22 19 33 25 24 13 11 27 14 26 18 37 21 34 23 28 35 39 31 20 40 36 32

9,73 38 10,34 1

6,40 6,41 6,55 6,60 6,68 6,71 6,77 6,83 6,95 7,01 7,07 7,12 7,21 7,21 7,31 7,35 7,48 7,56 7,57 7,60 7,69 7,77 7,89 7,99 8,03 8,07 8,11 8,13 8,17 8,20 8,33 8,36 8,47 8,53 9,12 9,21 9,22 9,36

9,73 38 3,33 3,32 3,18 3,13 3,05 3,02 2,96 2,90 2,78 2,72 2,66 2,61 2,52 2,52 2,42 2,38 2,25 2,17 2,16 2,13 2,04 1,96 1,84 1,74 1,70 1,66 1,62 1,60 1,56 1,53 1,40 1,37 1,26 1,20 0,61 0,52 0,51 0,37

0,61 0,00 0,00

10,34 1 3,94 3,93 3,79 3,74 3,66 3,63 3,57 3,51 3,39 3,33 3,27 3,22 3,13 3,13 3,03 2,99 2,86 2,78 2,77 2,74 2,65 2,57 2,45 2,35 2,31 2,27 2,23 2,21 2,17 2,14 2,01 1,98 1,87 1,81 1,22 1,13 1,12 0,98

9,36 32 2,96 2,95 2,81 2,76 2,68 2,65 2,59 2,53 2,41 2,35 2,29 2,24 2,15 2,15 2,05 2,01 1,88 1,80 1,79 1,76 1,67 1,59 1,47 1,37 1,33 1,29 1,25 1,23 1,19 1,16 1,03 1,00 0,89 0,83 0,24 0,15 0,14 0,00

9,22 36 2,82 2,81 2,67 2,62 2,54 2,51 2,45 2,39 2,27 2,21 2,15 2,10 2,01 2,01 1,91 1,87 1,74 1,66 1,65 1,62 1,53 1,45 1,33 1,23 1,19 1,15 1,11 1,09 1,05 1,02 0,89 0,86 0,75 0,69 0,10 0,01 0,00

9,21 40 2,81 2,80 2,66 2,61 2,53 2,50 2,44 2,38 2,26 2,20 2,14 2,09 2,00 2,00 1,90 1,86 1,73 1,65 1,64 1,61 1,52 1,44 1,32 1,22 1,18 1,14 1,10 1,08 1,04 1,01 0,88 0,85 0,74 0,68 0,09 0,00

9,12 20 2,72 2,71 2,57 2,52 2,44 2,41 2,35 2,29 2,17 2,11 2,05 2,00 1,91 1,91 1,81 1,77 1,64 1,56 1,55 1,52 1,43 1,35 1,23 1,13 1,09 1,05 1,01 0,99 0,95 0,92 0,79 0,76 0,65 0,59 0,00

8,53 31 2,13 2,12 1,98 1,93 1,85 1,82 1,76 1,70 1,58 1,52 1,46 1,41 1,32 1,32 1,22 1,18 1,05 0,97 0,96 0,93 0,84 0,76 0,64 0,54 0,50 0,46 0,42 0,40 0,36 0,33 0,20 0,17 0,06 0,00

8,47 39 2,07 2,06 1,92 1,87 1,79 1,76 1,70 1,64 1,52 1,46 1,40 1,35 1,26 1,26 1,16 1,12 0,99 0,91 0,90 0,87 0,78 0,70 0,58 0,48 0,44 0,40 0,36 0,34 0,30 0,27 0,14 0,11 0,00

8,36 35 1,96 1,95 1,81 1,76 1,68 1,65 1,59 1,53 1,41 1,35 1,29 1,24 1,15 1,15 1,05 1,01 0,88 0,80 0,79 0,76 0,67 0,59 0,47 0,37 0,33 0,29 0,25 0,23 0,19 0,16 0,03 0,00

8,33 28 1,93 1,92 1,78 1,73 1,65 1,62 1,56 1,50 1,38 1,32 1,26 1,21 1,12 1,12 1,02 0,98 0,85 0,77 0,76 0,73 0,64 0,56 0,44 0,34 0,30 0,26 0,22 0,20 0,16 0,13 0,00

8,17 34 1,77 1,76 1,62 1,57 1,49 1,46 1,40 1,34 1,22 1,16 1,10 1,05 0,96 0,96 0,86 0,82 0,69 0,61 0,60 0,57 0,48 0,40 0,28 0,18 0,14 0,10 0,06 0,04 0,00

8,13 21 1,73 1,72 1,58 1,53 1,45 1,42 1,36 1,30 1,18 1,12 1,06 1,01 0,92 0,92 0,82 0,78 0,65 0,57 0,56 0,53 0,44 0,36 0,24 0,14 0,10 0,06 0,02 0,00

8,11 37 1,71 1,70 1,56 1,51 1,43 1,40 1,34 1,28 1,16 1,10 1,04 0,99 0,90 0,90 0,80 0,76 0,63 0,55 0,54 0,51 0,42 0,34 0,22 0,12 0,08 0,04 0,00

8,07 18 1,67 1,66 1,52 1,47 1,39 1,36 1,30 1,24 1,12 1,06 1,00 0,95 0,86 0,86 0,76 0,72 0,59 0,51 0,50 0,47 0,38 0,30 0,18 0,08 0,04 0,00

8,03 26 1,63 1,62 1,48 1,43 1,35 1,32 1,26 1,20 1,08 1,02 0,96 0,91 0,82 0,82 0,72 0,68 0,55 0,47 0,46 0,43 0,34 0,26 0,14 0,04 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

8,20 23 1,80 1,79 1,65 1,60 1,52 1,49 1,43 1,37 1,25 1,19 1,13 1,08 0,99 0,99 0,89 0,85 0,72 0,64 0,63 0,60 0,51 0,43 0,31 0,21 0,17 0,13 0,09 0,07 0,03 0,00

Tablica 56. Rezultati LSD testa za duljinu klasa u 2007./2008. 7,99 14 1,59 1,58 1,44 1,39 1,31 1,28 1,22 1,16 1,04 0,98 0,92 0,87 0,78 0,78 0,68 0,64 0,51 0,43 0,42 0,39 0,30 0,22 0,10 0,00

7,89 27 1,49 1,48 1,34 1,29 1,21 1,18 1,12 1,06 0,94 0,88 0,82 0,77 0,68 0,68 0,58 0,54 0,41 0,33 0,32 0,29 0,20 0,12 0,00

7,69 13 1,29 1,28 1,14 1,09 1,01 0,98 0,92 0,86 0,74 0,68 0,62 0,57 0,48 0,48 0,38 0,34 0,21 0,13 0,12 0,09 0,00

7,60 24 1,20 1,19 1,05 1,00 0,92 0,89 0,83 0,77 0,65 0,59 0,53 0,48 0,39 0,39 0,29 0,25 0,12 0,04 0,03 0,00

LSD0,01 = 0,726

LSD0,05 = 0,547

F test = 23,05**

7,77 11 1,37 1,36 1,22 1,17 1,09 1,06 1,00 0,94 0,82 0,76 0,70 0,65 0,56 0,56 0,46 0,42 0,29 0,21 0,20 0,17 0,08 0,00

7,57 25 1,17 1,16 1,02 0,97 0,89 0,86 0,80 0,74 0,62 0,56 0,50 0,45 0,36 0,36 0,26 0,22 0,09 0,01 0,00

7,56 33 1,16 1,15 1,01 0,96 0,88 0,85 0,79 0,73 0,61 0,55 0,49 0,44 0,35 0,35 0,25 0,21 0,08 0,00

7,48 19 1,08 1,07 0,93 0,88 0,80 0,77 0,71 0,65 0,53 0,47 0,41 0,36 0,27 0,27 0,17 0,13 0,00

7,35 22 0,95 0,94 0,80 0,75 0,67 0,64 0,58 0,52 0,40 0,34 0,28 0,23 0,14 0,14 0,04 0,00

7,31 3 0,91 0,90 0,76 0,71 0,63 0,60 0,54 0,48 0,36 0,30 0,24 0,19 0,10 0,10 0,00

7,21 29 0,81 0,80 0,66 0,61 0,53 0,50 0,44 0,38 0,26 0,20 0,14 0,09 0,00

7,12 4 0,72 0,71 0,57 0,52 0,44 0,41 0,35 0,29 0,17 0,11 0,05 0,00

7,07 12 0,67 0,66 0,52 0,47 0,39 0,36 0,30 0,24 0,12 0,06 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

7,21 2 0,81 0,80 0,66 0,61 0,53 0,50 0,44 0,38 0,26 0,20 0,14 0,09 0,00 0,00

7,01 15 0,61 0,60 0,46 0,41 0,33 0,30 0,24 0,18 0,06 0,00

6,77 16 0,37 0,36 0,22 0,17 0,09 0,06 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

6,83 6 0,43 0,42 0,28 0,23 0,15 0,12 0,06 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

6,95 9 0,55 0,54 0,40 0,35 0,27 0,24 0,18 0,12 0,00

6,71 30 0,31 0,30 0,16 0,11 0,03 0,00

6,68 5 0,28 0,27 0,13 0,08 0,00

6,60 8 0,20 0,19 0,05 0,00

6,55 6,41 6,40 7 10 17 0,15 0,01 0,00 0,14 0,00 0,00


120

13 1 7 3 37 5 4 10 14 15 8 12 2 29 22 34 6 17 31 11 30 16 9 18 28 19 27 32 39 20 33 23 21 26 36 40 25 24

22,03 35 23,75 38

16,15 16,63 16,63 16,81 16,90 16,97 17,04 17,21 17,25 17,25 17,31 17,36 17,52 17,61 17,64 17,72 17,83 17,88 17,95 18,13 18,20 18,25 18,44 18,67 18,67 18,80 18,80 18,81 18,96 19,16 19,37 19,49 19,51 19,65 19,75 20,23 20,36 20,52

1,72 0,00

0,00

opravdane razlike p<0,05

LSD0,01 = 1,013

19 Zlatna_dolina 20 Golubica

39 Eurofit 40 Ludwig

23,75 22,03 20,52 20,36 20,23 19,75 19,65 19,51 19,49 19,37 19,16 18,96 18,81 18,80 18,80 18,67 18,67 18,44 18,25 18,20 18,13 17,95 17,88 17,83 17,72 17,64 17,61 17,52 17,36 17,31 17,25 17,25 17,21 17,04 16,97 16,90 16,81 16,63 16,63 16,15 38 35 24 25 40 36 26 21 23 33 20 39 32 19 27 18 28 9 16 30 11 31 17 6 34 22 29 2 12 8 14 15 10 4 5 37 3 1 7 13 7,60 5,88 4,37 4,21 4,08 3,60 3,50 3,36 3,34 3,22 3,01 2,81 2,66 2,65 2,65 2,52 2,52 2,29 2,10 2,05 1,98 1,80 1,73 1,68 1,57 1,49 1,46 1,37 1,21 1,16 1,10 1,10 1,06 0,89 0,82 0,75 0,66 0,48 0,48 0,00 7,12 5,40 3,89 3,73 3,60 3,12 3,02 2,88 2,86 2,74 2,53 2,33 2,18 2,17 2,17 2,04 2,04 1,81 1,62 1,57 1,50 1,32 1,25 1,20 1,09 1,01 0,98 0,89 0,73 0,68 0,62 0,62 0,58 0,41 0,34 0,27 0,18 0,00 0,00 7,12 5,40 3,89 3,73 3,60 3,12 3,02 2,88 2,86 2,74 2,53 2,33 2,18 2,17 2,17 2,04 2,04 1,81 1,62 1,57 1,50 1,32 1,25 1,20 1,09 1,01 0,98 0,89 0,73 0,68 0,62 0,62 0,58 0,41 0,34 0,27 0,18 0,00 6,94 5,22 3,71 3,55 3,42 2,94 2,84 2,70 2,68 2,56 2,35 2,15 2,00 1,99 1,99 1,86 1,86 1,63 1,44 1,39 1,32 1,14 1,07 1,02 0,91 0,83 0,80 0,71 0,55 0,50 0,44 0,44 0,40 0,23 0,16 0,09 0,00 6,85 5,13 3,62 3,46 3,33 2,85 2,75 2,61 2,59 2,47 2,26 2,06 1,91 1,90 1,90 1,77 1,77 1,54 1,35 1,30 1,23 1,05 0,98 0,93 0,82 0,74 0,71 0,62 0,46 0,41 0,35 0,35 0,31 0,14 0,07 0,00 6,78 5,06 3,55 3,39 3,26 2,78 2,68 2,54 2,52 2,40 2,19 1,99 1,84 1,83 1,83 1,70 1,70 1,47 1,28 1,23 1,16 0,98 0,91 0,86 0,75 0,67 0,64 0,55 0,39 0,34 0,28 0,28 0,24 0,07 0,00 6,71 4,99 3,48 3,32 3,19 2,71 2,61 2,47 2,45 2,33 2,12 1,92 1,77 1,76 1,76 1,63 1,63 1,40 1,21 1,16 1,09 0,91 0,84 0,79 0,68 0,60 0,57 0,48 0,32 0,27 0,21 0,21 0,17 0,00 6,54 4,82 3,31 3,15 3,02 2,54 2,44 2,30 2,28 2,16 1,95 1,75 1,60 1,59 1,59 1,46 1,46 1,23 1,04 0,99 0,92 0,74 0,67 0,62 0,51 0,43 0,40 0,31 0,15 0,10 0,04 0,04 0,00 6,50 4,78 3,27 3,11 2,98 2,50 2,40 2,26 2,24 2,12 1,91 1,71 1,56 1,55 1,55 1,42 1,42 1,19 1,00 0,95 0,88 0,70 0,63 0,58 0,47 0,39 0,36 0,27 0,11 0,06 0,00 0,00 6,50 4,78 3,27 3,11 2,98 2,50 2,40 2,26 2,24 2,12 1,91 1,71 1,56 1,55 1,55 1,42 1,42 1,19 1,00 0,95 0,88 0,70 0,63 0,58 0,47 0,39 0,36 0,27 0,11 0,06 0,00 6,44 4,72 3,21 3,05 2,92 2,44 2,34 2,20 2,18 2,06 1,85 1,65 1,50 1,49 1,49 1,36 1,36 1,13 0,94 0,89 0,82 0,64 0,57 0,52 0,41 0,33 0,30 0,21 0,05 0,00 6,39 4,67 3,16 3,00 2,87 2,39 2,29 2,15 2,13 2,01 1,80 1,60 1,45 1,44 1,44 1,31 1,31 1,08 0,89 0,84 0,77 0,59 0,52 0,47 0,36 0,28 0,25 0,16 0,00 6,23 4,51 3,00 2,84 2,71 2,23 2,13 1,99 1,97 1,85 1,64 1,44 1,29 1,28 1,28 1,15 1,15 0,92 0,73 0,68 0,61 0,43 0,36 0,31 0,20 0,12 0,09 0,00 6,14 4,42 2,91 2,75 2,62 2,14 2,04 1,90 1,88 1,76 1,55 1,35 1,20 1,19 1,19 1,06 1,06 0,83 0,64 0,59 0,52 0,34 0,27 0,22 0,11 0,03 0,00 6,11 4,39 2,88 2,72 2,59 2,11 2,01 1,87 1,85 1,73 1,52 1,32 1,17 1,16 1,16 1,03 1,03 0,80 0,61 0,56 0,49 0,31 0,24 0,19 0,08 0,00 6,03 4,31 2,80 2,64 2,51 2,03 1,93 1,79 1,77 1,65 1,44 1,24 1,09 1,08 1,08 0,95 0,95 0,72 0,53 0,48 0,41 0,23 0,16 0,11 0,00 5,92 4,20 2,69 2,53 2,40 1,92 1,82 1,68 1,66 1,54 1,33 1,13 0,98 0,97 0,97 0,84 0,84 0,61 0,42 0,37 0,30 0,12 0,05 0,00 5,87 4,15 2,64 2,48 2,35 1,87 1,77 1,63 1,61 1,49 1,28 1,08 0,93 0,92 0,92 0,79 0,79 0,56 0,37 0,32 0,25 0,07 0,00 5,80 4,08 2,57 2,41 2,28 1,80 1,70 1,56 1,54 1,42 1,21 1,01 0,86 0,85 0,85 0,72 0,72 0,49 0,30 0,25 0,18 0,00 5,62 3,90 2,39 2,23 2,10 1,62 1,52 1,38 1,36 1,24 1,03 0,83 0,68 0,67 0,67 0,54 0,54 0,31 0,12 0,07 0,00 Legenda: 5,55 3,83 2,32 2,16 2,03 1,55 1,45 1,31 1,29 1,17 0,96 0,76 0,61 0,60 0,60 0,47 0,47 0,24 0,05 0,00 1 U1 21 Janica 5,50 3,78 2,27 2,11 1,98 1,50 1,40 1,26 1,24 1,12 0,91 0,71 0,56 0,55 0,55 0,42 0,42 0,19 0,00 2 Osjecka_crvenka 22 Barbara 5,31 3,59 2,08 1,92 1,79 1,31 1,21 1,07 1,05 0,93 0,72 0,52 0,37 0,36 0,36 0,23 0,23 0,00 3 Osjecka_20 23 Katarina 5,08 3,36 1,85 1,69 1,56 1,08 0,98 0,84 0,82 0,70 0,49 0,29 0,14 0,13 0,13 0,00 0,00 4 Slavonija 24 Alka 5,08 3,36 1,85 1,69 1,56 1,08 0,98 0,84 0,82 0,70 0,49 0,29 0,14 0,13 0,13 0,00 5 Žitarka 25 Seka 4,95 3,23 1,72 1,56 1,43 0,95 0,85 0,71 0,69 0,57 0,36 0,16 0,01 0,00 0,00 6 Srpanjka 26 Lela 4,95 3,23 1,72 1,56 1,43 0,95 0,85 0,71 0,69 0,57 0,36 0,16 0,01 0,00 7 Demetra 27 Sana 4,94 3,22 1,71 1,55 1,42 0,94 0,84 0,70 0,68 0,56 0,35 0,15 0,00 8 Super_žitarka 28 Adriana 4,79 3,07 1,56 1,40 1,27 0,79 0,69 0,55 0,53 0,41 0,20 0,00 9 Lucija 29 Divana 4,59 2,87 1,36 1,20 1,07 0,59 0,49 0,35 0,33 0,21 0,00 10 Renata 30 Libellula 4,38 2,66 1,15 0,99 0,86 0,38 0,28 0,14 0,12 0,00 11 Aida 31 Bezostaja 4,26 2,54 1,03 0,87 0,74 0,26 0,16 0,02 0,00 12 Pipi 32 BC_Patria 4,24 2,52 1,01 0,85 0,72 0,24 0,14 0,00 13 Ilirija 33 BC_Elvira 4,10 2,38 0,87 0,71 0,58 0,10 0,00 14 Felix 34 Soissons 4,00 2,28 0,77 0,61 0,48 0,00 15 Zlata 35 Valerius 3,52 1,80 0,29 0,13 0,00 F test = 30,44** 16 Andelka 36 Antonius 3,39 1,67 0,16 0,00 17 Mihaela 37 Bastide LSD0,05 = 0,764 18 Ružica 38 Edison 3,23 1,51 0,00 visoko opravdane razlike p<0,01

Tablica 57. Rezultati LSD testa broj klasića po klasu u 2007./2008.


121

1 29 10 17 12 13 2 6 15 5 34 4 11 31 3 26 30 19 24 8 22 14 16 33 7 28 25 40 9 27 20 35 18 36 39 38 32 23

37 21

33,97 34,97 36,61 40,24 40,28 41,04 41,76 41,84 42,00 42,97 43,31 43,49 43,53 43,68 43,73 44,15 44,65 44,80 44,87 45,52 45,60 46,36 47,20 47,27 47,51 48,09 48,27 48,91 48,91 49,12 49,59 50,00 50,17 50,71 51,29 51,43 52,91 55,37

56,43 57,92

1,49 0,00

57,92 21 23,95 22,95 21,31 17,68 17,64 16,88 16,16 16,08 15,92 14,95 14,61 14,43 14,34 14,24 14,19 13,77 13,27 13,12 13,05 12,40 12,32 11,56 10,72 10,65 10,41 9,83 9,65 9,01 9,01 8,80 8,33 7,92 7,75 7,21 6,63 6,49 5,01 2,55

0,00

56,43 37 22,46 21,46 19,82 16,19 16,15 15,39 14,67 14,59 14,43 13,46 13,12 12,94 12,85 12,75 12,70 12,28 11,78 11,63 11,56 10,91 10,83 10,07 9,23 9,16 8,92 8,34 8,16 7,52 7,52 7,31 6,84 6,43 6,26 5,72 5,14 5,00 3,52 1,06

55,37 23 21,40 20,40 18,76 15,13 15,09 14,33 13,61 13,53 13,37 12,40 12,06 11,88 11,79 11,69 11,64 11,22 10,72 10,57 10,50 9,85 9,77 9,01 8,17 8,10 7,86 7,28 7,10 6,46 6,46 6,25 5,78 5,37 5,20 4,66 4,08 3,94 2,46 0,00

52,91 32 18,94 17,94 16,30 12,67 12,63 11,87 11,15 11,07 10,91 9,94 9,60 9,42 9,33 9,23 9,18 8,76 8,26 8,11 8,04 7,39 7,31 6,55 5,71 5,64 5,40 4,82 4,64 4,00 4,00 3,79 3,32 2,91 2,74 2,20 1,62 1,48 0,00

51,43 38 17,46 16,46 14,82 11,19 11,15 10,39 9,67 9,59 9,43 8,46 8,12 7,94 7,85 7,75 7,70 7,28 6,78 6,63 6,56 5,91 5,83 5,07 4,23 4,16 3,92 3,34 3,16 2,52 2,52 2,31 1,84 1,43 1,26 0,72 0,14 0,00

51,29 39 17,32 16,32 14,68 11,05 11,01 10,25 9,53 9,45 9,29 8,32 7,98 7,80 7,71 7,61 7,56 7,14 6,64 6,49 6,42 5,77 5,69 4,93 4,09 4,02 3,78 3,20 3,02 2,38 2,38 2,17 1,70 1,29 1,12 0,58 0,00

50,71 36 16,74 15,74 14,10 10,47 10,43 9,67 8,95 8,87 8,71 7,74 7,40 7,22 7,13 7,03 6,98 6,56 6,06 5,91 5,84 5,19 5,11 4,35 3,51 3,44 3,20 2,62 2,44 1,80 1,80 1,59 1,12 0,71 0,54 0,00

50,17 18 16,20 15,20 13,56 9,93 9,89 9,13 8,41 8,33 8,17 7,20 6,86 6,68 6,59 6,49 6,44 6,02 5,52 5,37 5,30 4,65 4,57 3,81 2,97 2,90 2,66 2,08 1,90 1,26 1,26 1,05 0,58 0,17 0,00

50,00 35 16,03 15,03 13,39 9,76 9,72 8,96 8,24 8,16 8,00 7,03 6,69 6,51 6,42 6,32 6,27 5,85 5,35 5,20 5,13 4,48 4,40 3,64 2,80 2,73 2,49 1,91 1,73 1,09 1,09 0,88 0,41 0,00

49,59 20 15,62 14,62 12,98 9,35 9,31 8,55 7,83 7,75 7,59 6,62 6,28 6,10 6,01 5,91 5,86 5,44 4,94 4,79 4,72 4,07 3,99 3,23 2,39 2,32 2,08 1,50 1,32 0,68 0,68 0,47 0,00

48,91 9 14,94 13,94 12,30 8,67 8,63 7,87 7,15 7,07 6,91 5,94 5,60 5,42 5,33 5,23 5,18 4,76 4,26 4,11 4,04 3,39 3,31 2,55 1,71 1,64 1,40 0,82 0,64 0,00 0,00

48,91 40 14,94 13,94 12,30 8,67 8,63 7,87 7,15 7,07 6,91 5,94 5,60 5,42 5,33 5,23 5,18 4,76 4,26 4,11 4,04 3,39 3,31 2,55 1,71 1,64 1,40 0,82 0,64 0,00

48,27 25 14,30 13,30 11,66 8,03 7,99 7,23 6,51 6,43 6,27 5,30 4,96 4,78 4,69 4,59 4,54 4,12 3,62 3,47 3,40 2,75 2,67 1,91 1,07 1,00 0,76 0,18 0,00

48,09 28 14,12 13,12 11,48 7,85 7,81 7,05 6,33 6,25 6,09 5,12 4,78 4,60 4,51 4,41 4,36 3,94 3,44 3,29 3,22 2,57 2,49 1,73 0,89 0,82 0,58 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

49,12 27 15,15 14,15 12,51 8,88 8,84 8,08 7,36 7,28 7,12 6,15 5,81 5,63 5,54 5,44 5,39 4,97 4,47 4,32 4,25 3,60 3,52 2,76 1,92 1,85 1,61 1,03 0,85 0,21 0,21 0,00

47,51 7 13,54 12,54 10,90 7,27 7,23 6,47 5,75 5,67 5,51 4,54 4,20 4,02 3,93 3,83 3,78 3,36 2,86 2,71 2,64 1,99 1,91 1,15 0,31 0,24 0,00

47,27 33 13,30 12,30 10,66 7,03 6,99 6,23 5,51 5,43 5,27 4,30 3,96 3,78 3,69 3,59 3,54 3,12 2,62 2,47 2,40 1,75 1,67 0,91 0,07 0,00

LSD0,01 = 4,619

19 Zlatna_dolina 20 Golubica

39 Eurofit 40 Ludwig

47,20 46,36 45,60 45,52 44,87 44,80 44,65 44,15 43,73 43,68 43,53 43,49 43,31 42,97 42,00 41,84 41,76 41,04 40,28 40,24 36,61 34,97 33,97 16 14 22 8 24 19 30 26 3 31 11 4 34 5 15 6 2 13 12 17 10 29 1 13,23 12,39 11,63 11,55 10,90 10,83 10,68 10,18 9,76 9,71 9,56 9,52 9,34 9,00 8,03 7,87 7,79 7,07 6,31 6,27 2,64 1,00 0,00 12,23 11,39 10,63 10,55 9,90 9,83 9,68 9,18 8,76 8,71 8,56 8,52 8,34 8,00 7,03 6,87 6,79 6,07 5,31 5,27 1,64 0,00 10,59 9,75 8,99 8,91 8,26 8,19 8,04 7,54 7,12 7,07 6,92 6,88 6,70 6,36 5,39 5,23 5,15 4,43 3,67 3,63 0,00 6,96 6,12 5,36 5,28 4,63 4,56 4,41 3,91 3,49 3,44 3,29 3,25 3,07 2,73 1,76 1,60 1,52 0,80 0,04 0,00 6,92 6,08 5,32 5,24 4,59 4,52 4,37 3,87 3,45 3,40 3,25 3,21 3,03 2,69 1,72 1,56 1,48 0,76 0,00 6,16 5,32 4,56 4,48 3,83 3,76 3,61 3,11 2,69 2,64 2,49 2,45 2,27 1,93 0,96 0,80 0,72 0,00 5,44 4,60 3,84 3,76 3,11 3,04 2,89 2,39 1,97 1,92 1,77 1,73 1,55 1,21 0,24 0,08 0,00 5,36 4,52 3,76 3,68 3,03 2,96 2,81 2,31 1,89 1,84 1,69 1,65 1,47 1,13 0,16 0,00 5,20 4,36 3,60 3,52 2,87 2,80 2,65 2,15 1,73 1,68 1,53 1,49 1,31 0,97 0,00 4,23 3,39 2,63 2,55 1,90 1,83 1,68 1,18 0,76 0,71 0,56 0,52 0,34 0,00 3,89 3,05 2,29 2,21 1,56 1,49 1,34 0,84 0,42 0,37 0,22 0,18 0,00 3,71 2,87 2,11 2,03 1,38 1,31 1,16 0,66 0,24 0,19 0,04 0,00 3,62 2,78 2,02 1,94 1,29 1,22 1,07 0,57 0,15 0,10 3,52 2,68 1,92 1,84 1,19 1,12 0,97 0,47 0,05 0,00 3,47 2,63 1,87 1,79 1,14 1,07 0,92 0,42 0,00 3,05 2,21 1,45 1,37 0,72 0,65 0,50 0,00 2,55 1,71 0,95 0,87 0,22 0,15 0,00 2,40 1,56 0,80 0,72 0,07 0,00 2,33 1,49 0,73 0,65 0,00 1,68 0,84 0,08 0,00 Legenda: 1,60 0,76 0,00 1 U1 21 Janica 0,84 0,00 2 Osjecka_crvenka 22 Barbara 0,00 3 Osjecka_20 23 Katarina 4 Slavonija 24 Alka 5 Žitarka 25 Seka 6 Srpanjka 26 Lela 7 Demetra 27 Sana 8 Super_žitarka 28 Adriana 9 Lucija 29 Divana 10 Renata 30 Libellula 11 Aida 31 Bezostaja 12 Pipi 32 BC_Patria 13 Ilirija 33 BC_Elvira 14 Felix 34 Soissons 15 Zlata 35 Valerius F test = 17,54** 16 Andelka 36 Antonius 17 Mihaela 37 Bastide LSD0,05 = 3,483 18 Ružica 38 Edison

Tablica 58. Rezultati LSD testa za za broj zrna po klasu u 2007./2008.


122

28 7 4 3 19 6 15 23 25 16 20 21 35 11 36 9 30 26 18 24 37 5 34 29 39 2 38 27 14 33 1 31 17 8 32 40 10 12

51,57 13 53,10 22

40,85 41,51 41,77 41,89 42,13 42,15 42,20 42,40 42,61 42,62 42,66 43,12 43,59 43,83 43,91 44,13 44,60 44,65 44,76 44,77 45,18 45,29 45,29 46,20 46,57 46,72 46,73 47,43 47,59 47,86 48,40 48,58 48,63 49,11 49,23 50,03 50,63 50,81

1,53 0,00

0,00

opravdane razlike p<0,05

LSD0,01 = 2,248

19 Zlatna_dolina 20 Golubica

39 Eurofit 40 Ludwig

53,10 51,57 50,81 50,63 50,03 49,23 49,11 48,63 48,58 48,40 47,86 47,59 47,43 46,73 46,72 46,57 46,20 45,29 45,29 45,18 44,77 44,76 44,65 44,60 44,13 43,91 43,83 43,59 43,12 42,66 42,62 42,61 42,40 42,20 42,15 42,13 41,89 41,77 41,51 40,85 22 13 12 10 40 32 8 17 31 1 33 14 27 38 2 39 29 34 5 37 24 18 26 30 9 36 11 35 21 20 16 25 23 15 6 19 3 4 7 28 12,25 10,72 9,96 9,78 9,18 8,38 8,26 7,78 7,73 7,55 7,01 6,74 6,58 5,88 5,87 5,72 5,35 4,44 4,44 4,33 3,92 3,91 3,80 3,75 3,28 3,06 2,98 2,74 2,27 1,81 1,77 1,76 1,55 1,35 1,30 1,28 1,04 0,92 0,66 0,00 11,59 10,06 9,30 9,12 8,52 7,72 7,60 7,12 7,07 6,89 6,35 6,08 5,92 5,22 5,21 5,06 4,69 3,78 3,78 3,67 3,26 3,25 3,14 3,09 2,62 2,40 2,32 2,08 1,61 1,15 1,11 1,10 0,89 0,69 0,64 0,62 0,38 0,26 0,00 11,33 9,80 9,04 8,86 8,26 7,46 7,34 6,86 6,81 6,63 6,09 5,82 5,66 4,96 4,95 4,80 4,43 3,52 3,52 3,41 3,00 2,99 2,88 2,83 2,36 2,14 2,06 1,82 1,35 0,89 0,85 0,84 0,63 0,43 0,38 0,36 0,12 0,00 11,21 9,68 8,92 8,74 8,14 7,34 7,22 6,74 6,69 6,51 5,97 5,70 5,54 4,84 4,83 4,68 4,31 3,40 3,40 3,29 2,88 2,87 2,76 2,71 2,24 2,02 1,94 1,70 1,23 0,77 0,73 0,72 0,51 0,31 0,26 0,24 0,00 10,97 9,44 8,68 8,50 7,90 7,10 6,98 6,50 6,45 6,27 5,73 5,46 5,30 4,60 4,59 4,44 4,07 3,16 3,16 3,05 2,64 2,63 2,52 2,47 2,00 1,78 1,70 1,46 0,99 0,53 0,49 0,48 0,27 0,07 0,02 0,00 10,95 9,42 8,66 8,48 7,88 7,08 6,96 6,48 6,43 6,25 5,71 5,44 5,28 4,58 4,57 4,42 4,05 3,14 3,14 3,03 2,62 2,61 2,50 2,45 1,98 1,76 1,68 1,44 0,97 0,51 0,47 0,46 0,25 0,05 0,00 10,90 9,37 8,61 8,43 7,83 7,03 6,91 6,43 6,38 6,20 5,66 5,39 5,23 4,53 4,52 4,37 4,00 3,09 3,09 2,98 2,57 2,56 2,45 2,40 1,93 1,71 1,63 1,39 0,92 0,46 0,42 0,41 0,20 0,00 10,70 9,17 8,41 8,23 7,63 6,83 6,71 6,23 6,18 6,00 5,46 5,19 5,03 4,33 4,32 4,17 3,80 2,89 2,89 2,78 2,37 2,36 2,25 2,20 1,73 1,51 1,43 1,19 0,72 0,26 0,22 0,21 0,00 10,49 8,96 8,20 8,02 7,42 6,62 6,50 6,02 5,97 5,79 5,25 4,98 4,82 4,12 4,11 3,96 3,59 2,68 2,68 2,57 2,16 2,15 2,04 1,99 1,52 1,30 1,22 0,98 0,51 0,05 0,01 0,00 10,48 8,95 8,19 8,01 7,41 6,61 6,49 6,01 5,96 5,78 5,24 4,97 4,81 4,11 4,10 3,95 3,58 2,67 2,67 2,56 2,15 2,14 2,03 1,98 1,51 1,29 1,21 0,97 0,50 0,04 0,00 10,44 8,91 8,15 7,97 7,37 6,57 6,45 5,97 5,92 5,74 5,20 4,93 4,77 4,07 4,06 3,91 3,54 2,63 2,63 2,52 2,11 2,10 1,99 1,94 1,47 1,25 1,17 0,93 0,46 0,00 9,98 8,45 7,69 7,51 6,91 6,11 5,99 5,51 5,46 5,28 4,74 4,47 4,31 3,61 3,60 3,45 3,08 2,17 2,17 2,06 1,65 1,64 1,53 1,48 1,01 0,79 0,71 0,47 0,00 9,51 7,98 7,22 7,04 6,44 5,64 5,52 5,04 4,99 4,81 4,27 4,00 3,84 3,14 3,13 2,98 2,61 1,70 1,70 1,59 1,18 1,17 1,06 1,01 0,54 0,32 0,24 0,00 9,27 7,74 6,98 6,80 6,20 5,40 5,28 4,80 4,75 4,57 4,03 3,76 3,60 2,90 2,89 2,74 2,37 1,46 1,46 1,35 0,94 0,93 0,82 0,77 0,30 0,08 0,00 9,19 7,66 6,90 6,72 6,12 5,32 5,20 4,72 4,67 4,49 3,95 3,68 3,52 2,82 2,81 2,66 2,29 1,38 1,38 1,27 0,86 0,85 0,74 0,69 0,22 0,00 8,97 7,44 6,68 6,50 5,90 5,10 4,98 4,50 4,45 4,27 3,73 3,46 3,30 2,60 2,59 2,44 2,07 1,16 1,16 1,05 0,64 0,63 0,52 0,47 0,00 8,50 6,97 6,21 6,03 5,43 4,63 4,51 4,03 3,98 3,80 3,26 2,99 2,83 2,13 2,12 1,97 1,60 0,69 0,69 0,58 0,17 0,16 0,05 0,00 8,45 6,92 6,16 5,98 5,38 4,58 4,46 3,98 3,93 3,75 3,21 2,94 2,78 2,08 2,07 1,92 1,55 0,64 0,64 0,53 0,12 0,11 0,00 8,34 6,81 6,05 5,87 5,27 4,47 4,35 3,87 3,82 3,64 3,10 2,83 2,67 1,97 1,96 1,81 1,44 0,53 0,53 0,42 0,01 0,00 8,33 6,80 6,04 5,86 5,26 4,46 4,34 3,86 3,81 3,63 3,09 2,82 2,66 1,96 1,95 1,80 1,43 0,52 0,52 0,41 0,00 Legenda: 7,92 6,39 5,63 5,45 4,85 4,05 3,93 3,45 3,40 3,22 2,68 2,41 2,25 1,55 1,54 1,39 1,02 0,11 0,11 0,00 1 U1 21 Janica 7,81 6,28 5,52 5,34 4,74 3,94 3,82 3,34 3,29 3,11 2,57 2,30 2,14 1,44 1,43 1,28 0,91 0,00 0,00 2 Osjecka_crvenka 22 Barbara 7,81 6,28 5,52 5,34 4,74 3,94 3,82 3,34 3,29 3,11 2,57 2,30 2,14 1,44 1,43 1,28 0,91 0,00 3 Osjecka_20 23 Katarina 6,90 5,37 4,61 4,43 3,83 3,03 2,91 2,43 2,38 2,20 1,66 1,39 1,23 0,53 0,52 0,37 0,00 4 Slavonija 24 Alka 6,53 5,00 4,24 4,06 3,46 2,66 2,54 2,06 2,01 1,83 1,29 1,02 0,86 0,16 0,15 0,00 5 Žitarka 25 Seka 6,38 4,85 4,09 3,91 3,31 2,51 2,39 1,91 1,86 1,68 1,14 0,87 0,71 0,01 0,00 6 Srpanjka 26 Lela 6,37 4,84 4,08 3,90 3,30 2,50 2,38 1,90 1,85 1,67 1,13 0,86 0,70 0,00 7 Demetra 27 Sana 5,67 4,14 3,38 3,20 2,60 1,80 1,68 1,20 1,15 0,97 0,43 0,16 0,00 8 Super_žitarka 28 Adriana 5,51 3,98 3,22 3,04 2,44 1,64 1,52 1,04 0,99 0,81 0,27 0,00 9 Lucija 29 Divana 5,24 3,71 2,95 2,77 2,17 1,37 1,25 0,77 0,72 0,54 0,00 10 Renata 30 Libellula 4,70 3,17 2,41 2,23 1,63 0,83 0,71 0,23 0,18 0,00 11 Aida 31 Bezostaja 4,52 2,99 2,23 2,05 1,45 0,65 0,53 0,05 0,00 12 Pipi 32 BC_Patria 4,47 2,94 2,18 2,00 1,40 0,60 0,48 0,00 13 Ilirija 33 BC_Elvira 3,99 2,46 1,70 1,52 0,92 0,12 0,00 14 Felix 34 Soissons 3,87 2,34 1,58 1,40 0,80 0,00 15 Zlata 35 Valerius 3,07 1,54 0,78 0,60 0,00 F test = 26,61** 16 Andelka 36 Antonius 2,47 0,94 0,18 0,00 17 Mihaela 37 Bastide LSD0,05 = 1,695 18 Ružica 38 Edison 2,29 0,76 0,00 visoko opravdane razlike p<0,01

Tablica 59. Rezultati LSD testa za masu 1000 zrna u 2007./2008.


123

37 1 27 28 16 7 38 24 33 25 34 2 19 32 15 39 17 9 4 23 40 6 10 29 31 11 30 21 12 3 18 20 13 5 14 36 22 35

86,77 8 87,13 26

79,77 80,27 81,93 82,17 82,53 82,67 82,70 82,80 82,83 83,13 83,67 83,77 83,93 83,93 84,10 84,10 84,20 84,23 84,40 84,53 84,57 84,70 84,77 84,80 84,93 85,30 85,43 85,47 85,50 85,53 85,53 85,53 85,60 85,67 86,00 86,03 86,23 86,57

0,36 0,00

0,00

opravdane razlike p<0,05

LSD0,01 = 1,364

20 Golubica

40 Ludwig

87,13 86,77 86,57 86,23 86,03 86,00 85,67 85,60 85,53 85,53 85,53 85,50 85,47 85,43 85,30 84,93 84,80 84,77 84,70 84,57 84,53 84,40 84,23 84,20 84,10 84,10 83,93 83,93 83,77 83,67 83,13 82,83 82,80 82,70 82,67 82,53 82,17 81,93 80,27 79,77 26 8 35 22 36 14 5 13 3 18 20 12 21 30 11 31 29 10 6 40 23 4 9 17 15 39 19 32 2 34 25 33 24 38 7 16 28 27 1 37 7,36 7,00 6,80 6,46 6,26 6,23 5,90 5,83 5,76 5,76 5,76 5,73 5,70 5,66 5,53 5,16 5,03 5,00 4,93 4,80 4,76 4,63 4,46 4,43 4,33 4,33 4,16 4,16 4,00 3,90 3,36 3,06 3,03 2,93 2,90 2,76 2,40 2,16 0,50 0,00 6,86 6,50 6,30 5,96 5,76 5,73 5,40 5,33 5,26 5,26 5,26 5,23 5,20 5,16 5,03 4,66 4,53 4,50 4,43 4,30 4,26 4,13 3,96 3,93 3,83 3,83 3,66 3,66 3,50 3,40 2,86 2,56 2,53 2,43 2,40 2,26 1,90 1,66 0,00 5,20 4,84 4,64 4,30 4,10 4,07 3,74 3,67 3,60 3,60 3,60 3,57 3,54 3,50 3,37 3,00 2,87 2,84 2,77 2,64 2,60 2,47 2,30 2,27 2,17 2,17 2,00 2,00 1,84 1,74 1,20 0,90 0,87 0,77 0,74 0,60 0,24 0,00 4,96 4,60 4,40 4,06 3,86 3,83 3,50 3,43 3,36 3,36 3,36 3,33 3,30 3,26 3,13 2,76 2,63 2,60 2,53 2,40 2,36 2,23 2,06 2,03 1,93 1,93 1,76 1,76 1,60 1,50 0,96 0,66 0,63 0,53 0,50 0,36 0,00 4,60 4,24 4,04 3,70 3,50 3,47 3,14 3,07 3,00 3,00 3,00 2,97 2,94 2,90 2,77 2,40 2,27 2,24 2,17 2,04 2,00 1,87 1,70 1,67 1,57 1,57 1,40 1,40 1,24 1,14 0,60 0,30 0,27 0,17 0,14 0,00 4,46 4,10 3,90 3,56 3,36 3,33 3,00 2,93 2,86 2,86 2,86 2,83 2,80 2,76 2,63 2,26 2,13 2,10 2,03 1,90 1,86 1,73 1,56 1,53 1,43 1,43 1,26 1,26 1,10 1,00 0,46 0,16 0,13 0,03 0,00 4,43 4,07 3,87 3,53 3,33 3,30 2,97 2,90 2,83 2,83 2,83 2,80 2,77 2,73 2,60 2,23 2,10 2,07 2,00 1,87 1,83 1,70 1,53 1,50 1,40 1,40 1,23 1,23 1,07 0,97 0,43 0,13 0,10 0,00 4,33 3,97 3,77 3,43 3,23 3,20 2,87 2,80 2,73 2,73 2,73 2,70 2,67 2,63 2,50 2,13 2,00 1,97 1,90 1,77 1,73 1,60 1,43 1,40 1,30 1,30 1,13 1,13 0,97 0,87 0,33 0,03 0,00 4,30 3,94 3,74 3,40 3,20 3,17 2,84 2,77 2,70 2,70 2,70 2,67 2,64 2,60 2,47 2,10 1,97 1,94 1,87 1,74 1,70 1,57 1,40 1,37 1,27 1,27 1,10 1,10 0,94 0,84 0,30 0,00 4,00 3,64 3,44 3,10 2,90 2,87 2,54 2,47 2,40 2,40 2,40 2,37 2,34 2,30 2,17 1,80 1,67 1,64 1,57 1,44 1,40 1,27 1,10 1,07 0,97 0,97 0,80 0,80 0,64 0,54 0,00 3,46 3,10 2,90 2,56 2,36 2,33 2,00 1,93 1,86 1,86 1,86 1,83 1,80 1,76 1,63 1,26 1,13 1,10 1,03 0,90 0,86 0,73 0,56 0,53 0,43 0,43 0,26 0,26 0,10 0,00 3,36 3,00 2,80 2,46 2,26 2,23 1,90 1,83 1,76 1,76 1,76 1,73 1,70 1,66 1,53 1,16 1,03 1,00 0,93 0,80 0,76 0,63 0,46 0,43 0,33 0,33 0,16 0,16 0,00 3,20 2,84 2,64 2,30 2,10 2,07 1,74 1,67 1,60 1,60 1,60 1,57 1,54 1,50 1,37 1,00 0,87 0,84 0,77 0,64 0,60 0,47 0,30 0,27 0,17 0,17 0,00 0,00 3,20 2,84 2,64 2,30 2,10 2,07 1,74 1,67 1,60 1,60 1,60 1,57 1,54 1,50 1,37 1,00 0,87 0,84 0,77 0,64 0,60 0,47 0,30 0,27 0,17 0,17 0,00 3,03 2,67 2,47 2,13 1,93 1,90 1,57 1,50 1,43 1,43 1,43 1,40 1,37 1,33 1,20 0,83 0,70 0,67 0,60 0,47 0,43 0,30 0,13 0,10 0,00 0,00 3,03 2,67 2,47 2,13 1,93 1,90 1,57 1,50 1,43 1,43 1,43 1,40 1,37 1,33 1,20 0,83 0,70 0,67 0,60 0,47 0,43 0,30 0,13 0,10 0,00 2,93 2,57 2,37 2,03 1,83 1,80 1,47 1,40 1,33 1,33 1,33 1,30 1,27 1,23 1,10 0,73 0,60 0,57 0,50 0,37 0,33 0,20 0,03 0,00 2,90 2,54 2,34 2,00 1,80 1,77 1,44 1,37 1,30 1,30 1,30 1,27 1,24 1,20 1,07 0,70 0,57 0,54 0,47 0,34 0,30 0,17 0,00 2,73 2,37 2,17 1,83 1,63 1,60 1,27 1,20 1,13 1,13 1,13 1,10 1,07 1,03 0,90 0,53 0,40 0,37 0,30 0,17 0,13 0,00 Legenda: 2,60 2,24 2,04 1,70 1,50 1,47 1,14 1,07 1,00 1,00 1,00 0,97 0,94 0,90 0,77 0,40 0,27 0,24 0,17 0,04 0,00 1 U1 21 Janica 2,56 2,20 2,00 1,66 1,46 1,43 1,10 1,03 0,96 0,96 0,96 0,93 0,90 0,86 0,73 0,36 0,23 0,20 0,13 0,00 2 Osjecka_crvenka 22 Barbara 2,43 2,07 1,87 1,53 1,33 1,30 0,97 0,90 0,83 0,83 0,83 0,80 0,77 0,73 0,60 0,23 0,10 0,07 0,00 3 Osjecka_20 23 Katarina 2,36 2,00 1,80 1,46 1,26 1,23 0,90 0,83 0,76 0,76 0,76 0,73 0,70 0,66 0,53 0,16 0,03 0,00 4 Slavonija 24 Alka 2,33 1,97 1,77 1,43 1,23 1,20 0,87 0,80 0,73 0,73 0,73 0,70 0,67 0,63 0,50 0,13 0,00 5 Žitarka 25 Seka 2,20 1,84 1,64 1,30 1,10 1,07 0,74 0,67 0,60 0,60 0,60 0,57 0,54 0,50 0,37 0,00 6 Srpanjka 26 Lela 1,83 1,47 1,27 0,93 0,73 0,70 0,37 0,30 0,23 0,23 0,23 0,20 0,17 0,13 0,00 7 Demetra 27 Sana 1,70 1,34 1,14 0,80 0,60 0,57 0,24 0,17 0,10 0,10 0,10 0,07 0,04 0,00 8 Super_žitarka 28 Adriana 1,66 1,30 1,10 0,76 0,56 0,53 0,20 0,13 0,06 0,06 0,06 0,03 0,00 9 Lucija 29 Divana 1,63 1,27 1,07 0,73 0,53 0,50 0,17 0,10 0,03 0,03 0,03 0,00 10 Renata 30 Libellula 1,60 1,24 1,04 0,70 0,50 0,47 0,14 0,07 0,00 0,00 0,00 11 Aida 31 Bezostaja 1,60 1,24 1,04 0,70 0,50 0,47 0,14 0,07 0,00 0,00 12 Pipi 32 BC_Patria 1,60 1,24 1,04 0,70 0,50 0,47 0,14 0,07 0,00 13 Ilirija 33 BC_Elvira 1,53 1,17 0,97 0,63 0,43 0,40 0,07 0,00 14 Felix 34 Soissons 1,46 1,10 0,90 0,56 0,36 0,33 0,00 15 Zlata 35 Valerius 1,13 0,77 0,57 0,23 0,03 0,00 16 Andelka 36 Antonius 1,10 0,74 0,54 0,20 0,00 F test = 19,28** 17 Mihaela 37 Bastide 0,90 0,54 0,34 0,00 18 Ružica 38 Edison LSD0,05 = 1,028 19 Zlatna_dolina 39 Eurofit 0,56 0,20 0,00 visoko opravdane razlike p<0,01

Tablica 60. Rezultati LSD testa za hektolitarsku masu u 2007./2008.


124

1 29 31 30 2 22 12 5 20 18 8 3 10 17 6 21 19 36 28 33 38 9 14 11 13 4 15 35 16 34 7 26 25 40 27 23 37 39

10,87 24 11,23 32

5,04 6,54 7,34 7,64 7,84 8,40 8,55 8,55 8,61 8,63 8,64 8,69 8,84 8,98 8,99 9,03 9,10 9,14 9,21 9,27 9,34 9,41 9,45 9,45 9,47 9,48 9,49 9,58 9,60 9,64 9,65 9,65 9,68 10,14 10,28 10,34 10,42 10,66

0,36 0,00

0,00

opravdane razlike p<0,05

LSD0,01 = 0,751

11,23 10,87 10,66 10,42 10,34 10,28 10,14 9,68 9,65 9,65 9,64 9,60 9,58 9,49 9,48 9,47 9,45 9,45 9,41 9,34 9,27 9,21 9,14 9,10 32 24 39 37 23 27 40 25 26 7 34 16 35 15 4 13 11 14 9 38 33 28 36 19 6,19 5,83 5,62 5,38 5,30 5,24 5,10 4,64 4,61 4,61 4,60 4,56 4,54 4,45 4,44 4,43 4,41 4,41 4,37 4,30 4,23 4,17 4,10 4,06 4,69 4,33 4,12 3,88 3,80 3,74 3,60 3,14 3,11 3,11 3,10 3,06 3,04 2,95 2,94 2,93 2,91 2,91 2,87 2,80 2,73 2,67 2,60 2,56 3,89 3,53 3,32 3,08 3,00 2,94 2,80 2,34 2,31 2,31 2,30 2,26 2,24 2,15 2,14 2,13 2,11 2,11 2,07 2,00 1,93 1,87 1,80 1,76 3,59 3,23 3,02 2,78 2,70 2,64 2,50 2,04 2,01 2,01 2,00 1,96 1,94 1,85 1,84 1,83 1,81 1,81 1,77 1,70 1,63 1,57 1,50 1,46 3,39 3,03 2,82 2,58 2,50 2,44 2,30 1,84 1,81 1,81 1,80 1,76 1,74 1,65 1,64 1,63 1,61 1,61 1,57 1,50 1,43 1,37 1,30 1,26 2,83 2,47 2,26 2,02 1,94 1,88 1,74 1,28 1,25 1,25 1,24 1,20 1,18 1,09 1,08 1,07 1,05 1,05 1,01 0,94 0,87 0,81 0,74 0,70 2,68 2,32 2,11 1,87 1,79 1,73 1,59 1,13 1,10 1,10 1,09 1,05 1,03 0,94 0,93 0,92 0,90 0,90 0,86 0,79 0,72 0,66 0,59 0,55 2,68 2,32 2,11 1,87 1,79 1,73 1,59 1,13 1,10 1,10 1,09 1,05 1,03 0,94 0,93 0,92 0,90 0,90 0,86 0,79 0,72 0,66 0,59 0,55 2,62 2,26 2,05 1,81 1,73 1,67 1,53 1,07 1,04 1,04 1,03 0,99 0,97 0,88 0,87 0,86 0,84 0,84 0,80 0,73 0,66 0,60 0,53 0,49 2,60 2,24 2,03 1,79 1,71 1,65 1,51 1,05 1,02 1,02 1,01 0,97 0,95 0,86 0,85 0,84 0,82 0,82 0,78 0,71 0,64 0,58 0,51 0,47 2,59 2,23 2,02 1,78 1,70 1,64 1,50 1,04 1,01 1,01 1,00 0,96 0,94 0,85 0,84 0,83 0,81 0,81 0,77 0,70 0,63 0,57 0,50 0,46 2,54 2,18 1,97 1,73 1,65 1,59 1,45 0,99 0,96 0,96 0,95 0,91 0,89 0,80 0,79 0,78 0,76 0,76 0,72 0,65 0,58 0,52 0,45 0,41 2,39 2,03 1,82 1,58 1,50 1,44 1,30 0,84 0,81 0,81 0,80 0,76 0,74 0,65 0,64 0,63 0,61 0,61 0,57 0,50 0,43 0,37 0,30 0,26 2,25 1,89 1,68 1,44 1,36 1,30 1,16 0,70 0,67 0,67 0,66 0,62 0,60 0,51 0,50 0,49 0,47 0,47 0,43 0,36 0,29 0,23 0,16 0,12 2,24 1,88 1,67 1,43 1,35 1,29 1,15 0,69 0,66 0,66 0,65 0,61 0,59 0,50 0,49 0,48 0,46 0,46 0,42 0,35 0,28 0,22 0,15 0,11 2,20 1,84 1,63 1,39 1,31 1,25 1,11 0,65 0,62 0,62 0,61 0,57 0,55 0,46 0,45 0,44 0,42 0,42 0,38 0,31 0,24 0,18 0,11 0,07 2,13 1,77 1,56 1,32 1,24 1,18 1,04 0,58 0,55 0,55 0,54 0,50 0,48 0,39 0,38 0,37 0,35 0,35 0,31 0,24 0,17 0,11 0,04 0,00 2,09 1,73 1,52 1,28 1,20 1,14 1,00 0,54 0,51 0,51 0,50 0,46 0,44 0,35 0,34 0,33 0,31 0,31 0,27 0,20 0,13 0,07 0,00 2,02 1,66 1,45 1,21 1,13 1,07 0,93 0,47 0,44 0,44 0,43 0,39 0,37 0,28 0,27 0,26 0,24 0,24 0,20 0,13 0,06 0,00 1,96 1,60 1,39 1,15 1,07 1,01 0,87 0,41 0,38 0,38 0,37 0,33 0,31 0,22 0,21 0,20 0,18 0,18 0,14 0,07 0,00 1,89 1,53 1,32 1,08 1,00 0,94 0,80 0,34 0,31 0,31 0,30 0,26 0,24 0,15 0,14 0,13 0,11 0,11 0,07 0,00 1,82 1,46 1,25 1,01 0,93 0,87 0,73 0,27 0,24 0,24 0,23 0,19 0,17 0,08 0,07 0,06 0,04 0,04 0,00 1,78 1,42 1,21 0,97 0,89 0,83 0,69 0,23 0,20 0,20 0,19 0,15 0,13 0,04 0,03 0,02 0,00 0,00 1,78 1,42 1,21 0,97 0,89 0,83 0,69 0,23 0,20 0,20 0,19 0,15 0,13 0,04 0,03 0,02 0,00 1,76 1,40 1,19 0,95 0,87 0,81 0,67 0,21 0,18 0,18 0,17 0,13 0,11 0,02 0,01 0,00 1,75 1,39 1,18 0,94 0,86 0,80 0,66 0,20 0,17 0,17 0,16 0,12 0,10 0,01 0,00 1,74 1,38 1,17 0,93 0,85 0,79 0,65 0,19 0,16 0,16 0,15 0,11 0,09 0,00 1,65 1,29 1,08 0,84 0,76 0,70 0,56 0,10 0,07 0,07 0,06 0,02 0,00 1,63 1,27 1,06 0,82 0,74 0,68 0,54 0,08 0,05 0,05 0,04 0,00 1,59 1,23 1,02 0,78 0,70 0,64 0,50 0,04 0,01 0,01 0,00 1,58 1,22 1,01 0,77 0,69 0,63 0,49 0,03 0,00 0,00 1,58 1,22 1,01 0,77 0,69 0,63 0,49 0,03 0,00 1,55 1,19 0,98 0,74 0,66 0,60 0,46 0,00 1,09 0,73 0,52 0,28 0,20 0,14 0,00 0,95 0,59 0,38 0,14 0,06 0,00 0,89 0,53 0,32 0,08 0,00 F test = 30,44** 0,81 0,45 0,24 0,00 LSD0,05 = 0,566 0,57 0,21 0,00 visoko opravdane razlike p<0,01

Tablica 61. Rezultati LSD testa za urod zrna u 2007./2008. 9,03 21 3,99 2,49 1,69 1,39 1,19 0,63 0,48 0,48 0,42 0,40 0,39 0,34 0,19 0,05 0,04 0,00

8,99 6 3,95 2,45 1,65 1,35 1,15 0,59 0,44 0,44 0,38 0,36 0,35 0,30 0,15 0,01 0,00

8,84 10 3,80 2,30 1,50 1,20 1,00 0,44 0,29 0,29 0,23 0,21 0,20 0,15 0,00

8,69 3 3,65 2,15 1,35 1,05 0,85 0,29 0,14 0,14 0,08 0,06 0,05 0,00

8,64 8 3,60 2,10 1,30 1,00 0,80 0,24 0,09 0,09 0,03 0,01 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

8,98 17 3,94 2,44 1,64 1,34 1,14 0,58 0,43 0,43 0,37 0,35 0,34 0,29 0,14 0,00

8,63 18 3,59 2,09 1,29 0,99 0,79 0,23 0,08 0,08 0,02 0,00

8,55 12 3,51 2,01 1,21 0,91 0,71 0,15 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

8,55 5 3,51 2,01 1,21 0,91 0,71 0,15 0,00 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

8,61 20 3,57 2,07 1,27 0,97 0,77 0,21 0,06 0,06 0,00

8,40 22 3,36 1,86 1,06 0,76 0,56 0,00

7,84 2 2,80 1,30 0,50 0,20 0,00

7,64 30 2,60 1,10 0,30 0,00

7,34 6,54 5,04 31 29 1 2,30 1,50 0,00 0,80 0,00 0,00


Tablice LSD vrijednosti za ispitivana agronomska svojstva u vegetacijskoj 2008./2009. Tablica 62. Rezultati LSD testa za visinu biljke Tablica 63. Rezultati LSD testa za broj biljaka po jedinici povrĹĄine Tablica 64. Rezultati LSD testa za duljinu klasa Tablica 65. Rezultati LSD testa za broj klasiÄ&#x2021;a po klasu Tablica 66. Rezultati LSD testa broj zrna po klasu Tablica 67. Rezultati LSD testa za masu 1000 zrna Tablica 68. Rezultati LSD testa za hektolitarsku masu Tablica 69. Rezultati LSD testa za urod zrna

125


126

0,00

6 15 17 10 12 16 23 14 25 9 4 7 24 21 5 3 26 18 33 19 37 11 28 20 34 8 27 22 32 2 30 38 35 31 13 29 39 36

112,93 40 19,54 132,47 1 0,00

60,47 63,00 66,95 68,33 71,69 72,23 73,03 73,29 74,17 76,25 76,40 77,27 77,95 78,25 78,57 78,63 79,03 79,24 80,04 80,47 80,64 81,84 82,53 83,04 83,49 83,55 84,81 84,98 89,19 92,35 92,67 99,37 101,19 101,28 101,79 102,84 104,52 105,09

112,93 40 52,46 49,93 45,98 44,60 41,24 40,70 39,90 39,64 38,76 36,68 36,53 35,66 34,98 34,68 34,36 34,30 33,90 33,69 32,89 32,46 32,29 31,09 30,40 29,89 29,44 29,38 28,12 27,95 23,74 20,58 20,26 13,56 11,74 11,65 11,14 10,09 8,41 7,84

132,47 1 72,00 69,47 65,52 64,14 60,78 60,24 59,44 59,18 58,30 56,22 56,07 55,20 54,52 54,22 53,90 53,84 53,44 53,23 52,43 52,00 51,83 50,63 49,94 49,43 48,98 48,92 47,66 47,49 43,28 40,12 39,80 33,10 31,28 31,19 30,68 29,63 27,95 27,38

105,09 36 44,62 42,09 38,14 36,76 33,40 32,86 32,06 31,80 30,92 28,84 28,69 27,82 27,14 26,84 26,52 26,46 26,06 25,85 25,05 24,62 24,45 23,25 22,56 22,05 21,60 21,54 20,28 20,11 15,90 12,74 12,42 5,72 3,90 3,81 3,30 2,25 0,57 0,00

104,52 39 44,05 41,52 37,57 36,19 32,83 32,29 31,49 31,23 30,35 28,27 28,12 27,25 26,57 26,27 25,95 25,89 25,49 25,28 24,48 24,05 23,88 22,68 21,99 21,48 21,03 20,97 19,71 19,54 15,33 12,17 11,85 5,15 3,33 3,24 2,73 1,68 0,00

102,84 29 42,37 39,84 35,89 34,51 31,15 30,61 29,81 29,55 28,67 26,59 26,44 25,57 24,89 24,59 24,27 24,21 23,81 23,60 22,80 22,37 22,20 21,00 20,31 19,80 19,35 19,29 18,03 17,86 13,65 10,49 10,17 3,47 1,65 1,56 1,05 0,00

101,79 13 41,32 38,79 34,84 33,46 30,10 29,56 28,76 28,50 27,62 25,54 25,39 24,52 23,84 23,54 23,22 23,16 22,76 22,55 21,75 21,32 21,15 19,95 19,26 18,75 18,30 18,24 16,98 16,81 12,60 9,44 9,12 2,42 0,60 0,51 0,00

101,28 31 40,81 38,28 34,33 32,95 29,59 29,05 28,25 27,99 27,11 25,03 24,88 24,01 23,33 23,03 22,71 22,65 22,25 22,04 21,24 20,81 20,64 19,44 18,75 18,24 17,79 17,73 16,47 16,30 12,09 8,93 8,61 1,91 0,09 0,00

101,19 35 40,72 38,19 34,24 32,86 29,50 28,96 28,16 27,90 27,02 24,94 24,79 23,92 23,24 22,94 22,62 22,56 22,16 21,95 21,15 20,72 20,55 19,35 18,66 18,15 17,70 17,64 16,38 16,21 12,00 8,84 8,52 1,82 0,00

99,37 38 38,90 36,37 32,42 31,04 27,68 27,14 26,34 26,08 25,20 23,12 22,97 22,10 21,42 21,12 20,80 20,74 20,34 20,13 19,33 18,90 18,73 17,53 16,84 16,33 15,88 15,82 14,56 14,39 10,18 7,02 6,70 0,00

92,67 30 32,20 29,67 25,72 24,34 20,98 20,44 19,64 19,38 18,50 16,42 16,27 15,40 14,72 14,42 14,10 14,04 13,64 13,43 12,63 12,20 12,03 10,83 10,14 9,63 9,18 9,12 7,86 7,69 3,48 0,32 0,00

89,19 32 28,72 26,19 22,24 20,86 17,50 16,96 16,16 15,90 15,02 12,94 12,79 11,92 11,24 10,94 10,62 10,56 10,16 9,95 9,15 8,72 8,55 7,35 6,66 6,15 5,70 5,64 4,38 4,21 0,00

84,98 22 24,51 21,98 18,03 16,65 13,29 12,75 11,95 11,69 10,81 8,73 8,58 7,71 7,03 6,73 6,41 6,35 5,95 5,74 4,94 4,51 4,34 3,14 2,45 1,94 1,49 1,43 0,17 0,00

84,81 27 24,34 21,81 17,86 16,48 13,12 12,58 11,78 11,52 10,64 8,56 8,41 7,54 6,86 6,56 6,24 6,18 5,78 5,57 4,77 4,34 4,17 2,97 2,28 1,77 1,32 1,26 0,00

83,55 8 23,08 20,55 16,60 15,22 11,86 11,32 10,52 10,26 9,38 7,30 7,15 6,28 5,60 5,30 4,98 4,92 4,52 4,31 3,51 3,08 2,91 1,71 1,02 0,51 0,06 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

92,35 2 31,88 29,35 25,40 24,02 20,66 20,12 19,32 19,06 18,18 16,10 15,95 15,08 14,40 14,10 13,78 13,72 13,32 13,11 12,31 11,88 11,71 10,51 9,82 9,31 8,86 8,80 7,54 7,37 3,16 0,00

Tablica 62. Rezultati LSD testa za visinu biljke u 2008./2009. 83,49 34 23,02 20,49 16,54 15,16 11,80 11,26 10,46 10,20 9,32 7,24 7,09 6,22 5,54 5,24 4,92 4,86 4,46 4,25 3,45 3,02 2,85 1,65 0,96 0,45 0,00

83,04 20 22,57 20,04 16,09 14,71 11,35 10,81 10,01 9,75 8,87 6,79 6,64 5,77 5,09 4,79 4,47 4,41 4,01 3,80 3,00 2,57 2,40 1,20 0,51 0,00

82,53 28 22,06 19,53 15,58 14,20 10,84 10,30 9,50 9,24 8,36 6,28 6,13 5,26 4,58 4,28 3,96 3,90 3,50 3,29 2,49 2,06 1,89 0,69 0,00

80,64 37 20,17 17,64 13,69 12,31 8,95 8,41 7,61 7,35 6,47 4,39 4,24 3,37 2,69 2,39 2,07 2,01 1,61 1,40 0,60 0,17 0,00

80,47 19 20,00 17,47 13,52 12,14 8,78 8,24 7,44 7,18 6,30 4,22 4,07 3,20 2,52 2,22 1,90 1,84 1,44 1,23 0,43 0,00

LSD0,01 = 4,015

LSD0,05 = 3,027

F test =174,06 **

81,84 11 21,37 18,84 14,89 13,51 10,15 9,61 8,81 8,55 7,67 5,59 5,44 4,57 3,89 3,59 3,27 3,21 2,81 2,60 1,80 1,37 1,20 0,00

80,04 33 19,57 17,04 13,09 11,71 8,35 7,81 7,01 6,75 5,87 3,79 3,64 2,77 2,09 1,79 1,47 1,41 1,01 0,80 0,00

79,24 18 18,77 16,24 12,29 10,91 7,55 7,01 6,21 5,95 5,07 2,99 2,84 1,97 1,29 0,99 0,67 0,61 0,21 0,00

79,03 26 18,56 16,03 12,08 10,70 7,34 6,80 6,00 5,74 4,86 2,78 2,63 1,76 1,08 0,78 0,46 0,40 0,00

78,63 3 18,16 15,63 11,68 10,30 6,94 6,40 5,60 5,34 4,46 2,38 2,23 1,36 0,68 0,38 0,06 0,00

78,57 5 18,10 15,57 11,62 10,24 6,88 6,34 5,54 5,28 4,40 2,32 2,17 1,30 0,62 0,32 0,00

77,95 24 17,48 14,95 11,00 9,62 6,26 5,72 4,92 4,66 3,78 1,70 1,55 0,68 0,00

77,27 7 16,80 14,27 10,32 8,94 5,58 5,04 4,24 3,98 3,10 1,02 0,87 0,00

76,40 4 15,93 13,40 9,45 8,07 4,71 4,17 3,37 3,11 2,23 0,15 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

78,25 21 17,78 15,25 11,30 9,92 6,56 6,02 5,22 4,96 4,08 2,00 1,85 0,98 0,30 0,00

76,25 9 15,78 13,25 9,30 7,92 4,56 4,02 3,22 2,96 2,08 0,00

73,03 23 12,56 10,03 6,08 4,70 1,34 0,80 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

73,29 14 12,82 10,29 6,34 4,96 1,60 1,06 0,26 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

74,17 25 13,70 11,17 7,22 5,84 2,48 1,94 1,14 0,88 0,00

72,23 16 11,76 9,23 5,28 3,90 0,54 0,00

71,69 12 11,22 8,69 4,74 3,36 0,00

68,33 10 7,86 5,33 1,38 0,00

66,95 63,00 60,47 17 15 6 6,48 2,53 0,00 3,95 0,00 0,00


127

34 23,00 18,00 10,34 2 20,33 15,33 7,67 6 12,66 7,66 0,00 10 5,00 0,00 24 0,00

174,33 177,00 184,67 192,33 197,33

184,67 6 71,67 66,34 60,67 58,00 57,67 55,00 55,00 53,34 51,34 50,34 50,34 50,00 48,34 48,34 46,34 46,00 45,34 42,67 41,34 38,34 38,34 37,67 37,67 36,67 32,67 32,34 31,67 31,00 30,34 26,67 18,34 18,00 12,67 11,34 11,34

38 20 39 1 32 17 29 14 18 27 35 23 19 40 13 25 31 15 21 16 30 11 22 26 36 8 33 3 4 9 12 7 37 5 28

192,33 10 79,33 74,00 68,33 65,66 65,33 62,66 62,66 61,00 59,00 58,00 58,00 57,66 56,00 56,00 54,00 53,66 53,00 50,33 49,00 46,00 46,00 45,33 45,33 44,33 40,33 40,00 39,33 38,66 38,00 34,33 26,00 25,66 20,33 19,00 19,00

113,00 118,33 124,00 126,67 127,00 129,67 129,67 131,33 133,33 134,33 134,33 134,67 136,33 136,33 138,33 138,67 139,33 142,00 143,33 146,33 146,33 147,00 147,00 148,00 152,00 152,33 153,00 153,67 154,33 158,00 166,33 166,67 172,00 173,33 173,33

197,33 24 84,33 79,00 73,33 70,66 70,33 67,66 67,66 66,00 64,00 63,00 63,00 62,66 61,00 61,00 59,00 58,66 58,00 55,33 54,00 51,00 51,00 50,33 50,33 49,33 45,33 45,00 44,33 43,66 43,00 39,33 31,00 30,66 25,33 24,00 24,00

2,67 0,00

177,00 2 64,00 58,67 53,00 50,33 50,00 47,33 47,33 45,67 43,67 42,67 42,67 42,33 40,67 40,67 38,67 38,33 37,67 35,00 33,67 30,67 30,67 30,00 30,00 29,00 25,00 24,67 24,00 23,33 22,67 19,00 10,67 10,33 5,00 3,67 3,67

0,00

174,33 34 61,33 56,00 50,33 47,66 47,33 44,66 44,66 43,00 41,00 40,00 40,00 39,66 38,00 38,00 36,00 35,66 35,00 32,33 31,00 28,00 28,00 27,33 27,33 26,33 22,33 22,00 21,33 20,66 20,00 16,33 8,00 7,66 2,33 1,00 1,00

173,33 5 60,33 55,00 49,33 46,66 46,33 43,66 43,66 42,00 40,00 39,00 39,00 38,66 37,00 37,00 35,00 34,66 34,00 31,33 30,00 27,00 27,00 26,33 26,33 25,33 21,33 21,00 20,33 19,66 19,00 15,33 7,00 6,66 1,33 0,00 0,00

173,33 28 60,33 55,00 49,33 46,66 46,33 43,66 43,66 42,00 40,00 39,00 39,00 38,66 37,00 37,00 35,00 34,66 34,00 31,33 30,00 27,00 27,00 26,33 26,33 25,33 21,33 21,00 20,33 19,66 19,00 15,33 7,00 6,66 1,33 0,00

172,00 37 59,00 53,67 48,00 45,33 45,00 42,33 42,33 40,67 38,67 37,67 37,67 37,33 35,67 35,67 33,67 33,33 32,67 30,00 28,67 25,67 25,67 25,00 25,00 24,00 20,00 19,67 19,00 18,33 17,67 14,00 5,67 5,33 0,00

166,67 7 53,67 48,34 42,67 40,00 39,67 37,00 37,00 35,34 33,34 32,34 32,34 32,00 30,34 30,34 28,34 28,00 27,34 24,67 23,34 20,34 20,34 19,67 19,67 18,67 14,67 14,34 13,67 13,00 12,34 8,67 0,34 0,00

166,33 12 53,33 48,00 42,33 39,66 39,33 36,66 36,66 35,00 33,00 32,00 32,00 31,66 30,00 30,00 28,00 27,66 27,00 24,33 23,00 20,00 20,00 19,33 19,33 18,33 14,33 14,00 13,33 12,66 12,00 8,33 0,00

158,00 9 45,00 39,67 34,00 31,33 31,00 28,33 28,33 26,67 24,67 23,67 23,67 23,33 21,67 21,67 19,67 19,33 18,67 16,00 14,67 11,67 11,67 11,00 11,00 10,00 6,00 5,67 5,00 4,33 3,67 0,00

154,33 4 41,33 36,00 30,33 27,66 27,33 24,66 24,66 23,00 21,00 20,00 20,00 19,66 18,00 18,00 16,00 15,66 15,00 12,33 11,00 8,00 8,00 7,33 7,33 6,33 2,33 2,00 1,33 0,66 0,00

153,00 33 40,00 34,67 29,00 26,33 26,00 23,33 23,33 21,67 19,67 18,67 18,67 18,33 16,67 16,67 14,67 14,33 13,67 11,00 9,67 6,67 6,67 6,00 6,00 5,00 1,00 0,67 0,00

152,33 8 39,33 34,00 28,33 25,66 25,33 22,66 22,66 21,00 19,00 18,00 18,00 17,66 16,00 16,00 14,00 13,66 13,00 10,33 9,00 6,00 6,00 5,33 5,33 4,33 0,33 0,00

152,00 36 39,00 33,67 28,00 25,33 25,00 22,33 22,33 20,67 18,67 17,67 17,67 17,33 15,67 15,67 13,67 13,33 12,67 10,00 8,67 5,67 5,67 5,00 5,00 4,00 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

153,67 3 40,67 35,34 29,67 27,00 26,67 24,00 24,00 22,34 20,34 19,34 19,34 19,00 17,34 17,34 15,34 15,00 14,34 11,67 10,34 7,34 7,34 6,67 6,67 5,67 1,67 1,34 0,67 0,00

148,00 26 35,00 29,67 24,00 21,33 21,00 18,33 18,33 16,67 14,67 13,67 13,67 13,33 11,67 11,67 9,67 9,33 8,67 6,00 4,67 1,67 1,67 1,00 1,00 0,00

147,00 11 34,00 28,67 23,00 20,33 20,00 17,33 17,33 15,67 13,67 12,67 12,67 12,33 10,67 10,67 8,67 8,33 7,67 5,00 3,67 0,67 0,67 0,00 0,00

147,00 22 34,00 28,67 23,00 20,33 20,00 17,33 17,33 15,67 13,67 12,67 12,67 12,33 10,67 10,67 8,67 8,33 7,67 5,00 3,67 0,67 0,67 0,00

146,33 16 33,33 28,00 22,33 19,66 19,33 16,66 16,66 15,00 13,00 12,00 12,00 11,66 10,00 10,00 8,00 7,66 7,00 4,33 3,00 0,00 0,00

Tablica 63. Rezultati LSD testa za broj biljaka po jedinici površine u 2008./2009. 143,33 21 30,33 25,00 19,33 16,66 16,33 13,66 13,66 12,00 10,00 9,00 9,00 8,66 7,00 7,00 5,00 4,66 4,00 1,33 0,00

LSD0,01 = 20,075

LSD0,05 = 15,136

F test = 13,52 **

146,33 30 33,33 28,00 22,33 19,66 19,33 16,66 16,66 15,00 13,00 12,00 12,00 11,66 10,00 10,00 8,00 7,66 7,00 4,33 3,00 0,00

142,00 15 29,00 23,67 18,00 15,33 15,00 12,33 12,33 10,67 8,67 7,67 7,67 7,33 5,67 5,67 3,67 3,33 2,67 0,00

139,33 31 26,33 21,00 15,33 12,66 12,33 9,66 9,66 8,00 6,00 5,00 5,00 4,66 3,00 3,00 1,00 0,66 0,00

138,33 13 25,33 20,00 14,33 11,66 11,33 8,66 8,66 7,00 5,00 4,00 4,00 3,66 2,00 2,00 0,00

136,33 19 23,33 18,00 12,33 9,66 9,33 6,66 6,66 5,00 3,00 2,00 2,00 1,66 0,00 0,00

16 Andelka 17 Mihaela 18 Ružica 19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata

138,67 25 25,67 20,34 14,67 12,00 11,67 9,00 9,00 7,34 5,34 4,34 4,34 4,00 2,34 2,34 0,34 0,00

136,33 40 23,33 18,00 12,33 9,66 9,33 6,66 6,66 5,00 3,00 2,00 2,00 1,66 0,00

134,67 23 21,67 16,34 10,67 8,00 7,67 5,00 5,00 3,34 1,34 0,34 0,34 0,00

134,33 133,33 131,33 129,67 129,67 127,00 126,67 124,00 118,33 113,00 35 18 14 17 29 32 1 39 20 38 21,33 20,33 18,33 16,67 16,67 14,00 13,67 11,00 5,33 0,00 16,00 15,00 13,00 11,34 11,34 8,67 8,34 5,67 0,00 10,33 9,33 7,33 5,67 5,67 3,00 2,67 0,00 7,66 6,66 4,66 3,00 3,00 0,33 0,00 7,33 6,33 4,33 2,67 2,67 0,00 4,66 3,66 1,66 0,00 0,00 4,66 3,66 1,66 0,00 3,00 2,00 0,00 1,00 0,00 0,00

36 Antonius 37 Bastide 38 Edison 39 Eurofit 40 Ludwig

21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libellula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius

134,33 27 21,33 16,00 10,33 7,66 7,33 4,66 4,66 3,00 1,00 0,00 0,00


128

10 30 17 5 9 4 12 8 22 2 6 19 25 29 16 7 3 15 24 33 11 13 28 34 18 14 26 21 37 38 35 31 23 27 39 32 40 20

9,04 36 3,24 3,24 3,03 2,82 2,80 2,68 2,63 2,62 2,55 2,49 2,48 2,47 2,39 2,33 2,32 2,31 2,29 2,27 2,20 2,01 1,90 1,84 1,69 1,63 1,58 1,55 1,49 1,35 1,28 1,25 1,19 1,17 1,16 1,07 0,60 0,37 0,34 0,31

9,04 1 0,00 0,00 9,04 36 0,00

5,80 5,80 6,01 6,22 6,24 6,36 6,41 6,42 6,49 6,55 6,56 6,57 6,65 6,71 6,72 6,73 6,75 6,77 6,84 7,03 7,14 7,20 7,35 7,41 7,46 7,49 7,55 7,69 7,76 7,79 7,85 7,87 7,88 7,97 8,44 8,67 8,70 8,73

9,04 1 3,24 3,24 3,03 2,82 2,80 2,68 2,63 2,62 2,55 2,49 2,48 2,47 2,39 2,33 2,32 2,31 2,29 2,27 2,20 2,01 1,90 1,84 1,69 1,63 1,58 1,55 1,49 1,35 1,28 1,25 1,19 1,17 1,16 1,07 0,60 0,37 0,34 0,31

8,73 20 2,93 2,93 2,72 2,51 2,49 2,37 2,32 2,31 2,24 2,18 2,17 2,16 2,08 2,02 2,01 2,00 1,98 1,96 1,89 1,70 1,59 1,53 1,38 1,32 1,27 1,24 1,18 1,04 0,97 0,94 0,88 0,86 0,85 0,76 0,29 0,06 0,03 0,00

8,70 40 2,90 2,90 2,69 2,48 2,46 2,34 2,29 2,28 2,21 2,15 2,14 2,13 2,05 1,99 1,98 1,97 1,95 1,93 1,86 1,67 1,56 1,50 1,35 1,29 1,24 1,21 1,15 1,01 0,94 0,91 0,85 0,83 0,82 0,73 0,26 0,03 0,00

8,67 32 2,87 2,87 2,66 2,45 2,43 2,31 2,26 2,25 2,18 2,12 2,11 2,10 2,02 1,96 1,95 1,94 1,92 1,90 1,83 1,64 1,53 1,47 1,32 1,26 1,21 1,18 1,12 0,98 0,91 0,88 0,82 0,80 0,79 0,70 0,23 0,00

8,44 39 2,64 2,64 2,43 2,22 2,20 2,08 2,03 2,02 1,95 1,89 1,88 1,87 1,79 1,73 1,72 1,71 1,69 1,67 1,60 1,41 1,30 1,24 1,09 1,03 0,98 0,95 0,89 0,75 0,68 0,65 0,59 0,57 0,56 0,47 0,00

7,97 27 2,17 2,17 1,96 1,75 1,73 1,61 1,56 1,55 1,48 1,42 1,41 1,40 1,32 1,26 1,25 1,24 1,22 1,20 1,13 0,94 0,83 0,77 0,62 0,56 0,51 0,48 0,42 0,28 0,21 0,18 0,12 0,10 0,09 0,00

7,88 23 2,08 2,08 1,87 1,66 1,64 1,52 1,47 1,46 1,39 1,33 1,32 1,31 1,23 1,17 1,16 1,15 1,13 1,11 1,04 0,85 0,74 0,68 0,53 0,47 0,42 0,39 0,33 0,19 0,12 0,09 0,03 0,01 0,00

7,87 31 2,07 2,07 1,86 1,65 1,63 1,51 1,46 1,45 1,38 1,32 1,31 1,30 1,22 1,16 1,15 1,14 1,12 1,10 1,03 0,84 0,73 0,67 0,52 0,46 0,41 0,38 0,32 0,18 0,11 0,08 0,02 0,00

7,85 35 2,05 2,05 1,84 1,63 1,61 1,49 1,44 1,43 1,36 1,30 1,29 1,28 1,20 1,14 1,13 1,12 1,10 1,08 1,01 0,82 0,71 0,65 0,50 0,44 0,39 0,36 0,30 0,16 0,09 0,06 0,00

7,79 38 1,99 1,99 1,78 1,57 1,55 1,43 1,38 1,37 1,30 1,24 1,23 1,22 1,14 1,08 1,07 1,06 1,04 1,02 0,95 0,76 0,65 0,59 0,44 0,38 0,33 0,30 0,24 0,10 0,03 0,00

7,69 21 1,89 1,89 1,68 1,47 1,45 1,33 1,28 1,27 1,20 1,14 1,13 1,12 1,04 0,98 0,97 0,96 0,94 0,92 0,85 0,66 0,55 0,49 0,34 0,28 0,23 0,20 0,14 0,00

7,55 26 1,75 1,75 1,54 1,33 1,31 1,19 1,14 1,13 1,06 1,00 0,99 0,98 0,90 0,84 0,83 0,82 0,80 0,78 0,71 0,52 0,41 0,35 0,20 0,14 0,09 0,06 0,00

7,49 14 1,69 1,69 1,48 1,27 1,25 1,13 1,08 1,07 1,00 0,94 0,93 0,92 0,84 0,78 0,77 0,76 0,74 0,72 0,65 0,46 0,35 0,29 0,14 0,08 0,03 0,00

7,46 18 1,66 1,66 1,45 1,24 1,22 1,10 1,05 1,04 0,97 0,91 0,90 0,89 0,81 0,75 0,74 0,73 0,71 0,69 0,62 0,43 0,32 0,26 0,11 0,05 0,00

7,41 34 1,61 1,61 1,40 1,19 1,17 1,05 1,00 0,99 0,92 0,86 0,85 0,84 0,76 0,70 0,69 0,68 0,66 0,64 0,57 0,38 0,27 0,21 0,06 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

7,76 37 1,96 1,96 1,75 1,54 1,52 1,40 1,35 1,34 1,27 1,21 1,20 1,19 1,11 1,05 1,04 1,03 1,01 0,99 0,92 0,73 0,62 0,56 0,41 0,35 0,30 0,27 0,21 0,07 0,00

Tablica 64. Rezultati LSD testa za duljinu klasa u 2008./2009. 7,35 28 1,55 1,55 1,34 1,13 1,11 0,99 0,94 0,93 0,86 0,80 0,79 0,78 0,70 0,64 0,63 0,62 0,60 0,58 0,51 0,32 0,21 0,15 0,00

7,20 13 1,40 1,40 1,19 0,98 0,96 0,84 0,79 0,78 0,71 0,65 0,64 0,63 0,55 0,49 0,48 0,47 0,45 0,43 0,36 0,17 0,06 0,00

7,03 33 1,23 1,23 1,02 0,81 0,79 0,67 0,62 0,61 0,54 0,48 0,47 0,46 0,38 0,32 0,31 0,30 0,28 0,26 0,19 0,00

6,84 24 1,04 1,04 0,83 0,62 0,60 0,48 0,43 0,42 0,35 0,29 0,28 0,27 0,19 0,13 0,12 0,11 0,09 0,07 0,00

LSD0,01 = 0,709

LSD0,05 = 0,534

F test = 20,81**

7,14 11 1,34 1,34 1,13 0,92 0,90 0,78 0,73 0,72 0,65 0,59 0,58 0,57 0,49 0,43 0,42 0,41 0,39 0,37 0,30 0,11 0,00

6,77 15 0,97 0,97 0,76 0,55 0,53 0,41 0,36 0,35 0,28 0,22 0,21 0,20 0,12 0,06 0,05 0,04 0,02 0,00

6,75 3 0,95 0,95 0,74 0,53 0,51 0,39 0,34 0,33 0,26 0,20 0,19 0,18 0,10 0,04 0,03 0,02 0,00

6,73 7 0,93 0,93 0,72 0,51 0,49 0,37 0,32 0,31 0,24 0,18 0,17 0,16 0,08 0,02 0,01 0,00

6,72 16 0,92 0,92 0,71 0,50 0,48 0,36 0,31 0,30 0,23 0,17 0,16 0,15 0,07 0,01 0,00

6,65 25 0,85 0,85 0,64 0,43 0,41 0,29 0,24 0,23 0,16 0,10 0,09 0,08 0,00

6,57 19 0,77 0,77 0,56 0,35 0,33 0,21 0,16 0,15 0,08 0,02 0,01 0,00

6,56 6 0,76 0,76 0,55 0,34 0,32 0,20 0,15 0,14 0,07 0,01 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

6,71 29 0,91 0,91 0,70 0,49 0,47 0,35 0,30 0,29 0,22 0,16 0,15 0,14 0,06 0,00

6,55 2 0,75 0,75 0,54 0,33 0,31 0,19 0,14 0,13 0,06 0,00

6,41 12 0,61 0,61 0,40 0,19 0,17 0,05 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

6,42 8 0,62 0,62 0,41 0,20 0,18 0,06 0,01 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

6,49 22 0,69 0,69 0,48 0,27 0,25 0,13 0,08 0,07 0,00

6,36 4 0,56 0,56 0,35 0,14 0,12 0,00

6,24 9 0,44 0,44 0,23 0,02 0,00

6,22 5 0,42 0,42 0,21 0,00

6,01 5,80 5,80 17 10 30 0,21 0,00 0,00 0,21 0,00 0,00


129

10 34 13 5 1 3 12 30 29 8 14 6 4 2 15 37 17 20 9 26 31 18 11 35 28 16 39 32 7 22 19 38 33 25 24 21 27 23

18,71 40 4,30 3,64 3,33 3,15 3,11 2,72 2,63 2,59 2,57 2,47 2,42 2,28 2,22 2,11 2,10 1,91 1,86 1,60 1,52 1,42 1,40 1,40 1,36 1,35 1,28 1,24 1,23 1,10 1,01 0,92 0,91 0,71 0,66 0,54 0,27 0,16 0,15 0,12

18,71 40 0,74 0,00 19,45 36 0,00

14,41 15,07 15,38 15,56 15,60 15,99 16,08 16,12 16,14 16,24 16,29 16,43 16,49 16,60 16,61 16,80 16,85 17,11 17,19 17,29 17,31 17,31 17,35 17,36 17,43 17,47 17,48 17,61 17,70 17,79 17,80 18,00 18,05 18,17 18,44 18,55 18,56 18,59

19,45 36 5,04 4,38 4,07 3,89 3,85 3,46 3,37 3,33 3,31 3,21 3,16 3,02 2,96 2,85 2,84 2,65 2,60 2,34 2,26 2,16 2,14 2,14 2,10 2,09 2,02 1,98 1,97 1,84 1,75 1,66 1,65 1,45 1,40 1,28 1,01 0,90 0,89 0,86

18,59 23 4,18 3,52 3,21 3,03 2,99 2,60 2,51 2,47 2,45 2,35 2,30 2,16 2,10 1,99 1,98 1,79 1,74 1,48 1,40 1,30 1,28 1,28 1,24 1,23 1,16 1,12 1,11 0,98 0,89 0,80 0,79 0,59 0,54 0,42 0,15 0,04 0,03 0,00

18,56 27 4,15 3,49 3,18 3,00 2,96 2,57 2,48 2,44 2,42 2,32 2,27 2,13 2,07 1,96 1,95 1,76 1,71 1,45 1,37 1,27 1,25 1,25 1,21 1,20 1,13 1,09 1,08 0,95 0,86 0,77 0,76 0,56 0,51 0,39 0,12 0,01 0,00

18,55 21 4,14 3,48 3,17 2,99 2,95 2,56 2,47 2,43 2,41 2,31 2,26 2,12 2,06 1,95 1,94 1,75 1,70 1,44 1,36 1,26 1,24 1,24 1,20 1,19 1,12 1,08 1,07 0,94 0,85 0,76 0,75 0,55 0,50 0,38 0,11 0,00

18,44 24 4,03 3,37 3,06 2,88 2,84 2,45 2,36 2,32 2,30 2,20 2,15 2,01 1,95 1,84 1,83 1,64 1,59 1,33 1,25 1,15 1,13 1,13 1,09 1,08 1,01 0,97 0,96 0,83 0,74 0,65 0,64 0,44 0,39 0,27 0,00

18,17 25 3,76 3,10 2,79 2,61 2,57 2,18 2,09 2,05 2,03 1,93 1,88 1,74 1,68 1,57 1,56 1,37 1,32 1,06 0,98 0,88 0,86 0,86 0,82 0,81 0,74 0,70 0,69 0,56 0,47 0,38 0,37 0,17 0,12 0,00

18,05 33 3,64 2,98 2,67 2,49 2,45 2,06 1,97 1,93 1,91 1,81 1,76 1,62 1,56 1,45 1,44 1,25 1,20 0,94 0,86 0,76 0,74 0,74 0,70 0,69 0,62 0,58 0,57 0,44 0,35 0,26 0,25 0,05 0,00

18,00 38 3,59 2,93 2,62 2,44 2,40 2,01 1,92 1,88 1,86 1,76 1,71 1,57 1,51 1,40 1,39 1,20 1,15 0,89 0,81 0,71 0,69 0,69 0,65 0,64 0,57 0,53 0,52 0,39 0,30 0,21 0,20 0,00

17,80 19 3,39 2,73 2,42 2,24 2,20 1,81 1,72 1,68 1,66 1,56 1,51 1,37 1,31 1,20 1,19 1,00 0,95 0,69 0,61 0,51 0,49 0,49 0,45 0,44 0,37 0,33 0,32 0,19 0,10 0,01 0,00

17,70 7 3,29 2,63 2,32 2,14 2,10 1,71 1,62 1,58 1,56 1,46 1,41 1,27 1,21 1,10 1,09 0,90 0,85 0,59 0,51 0,41 0,39 0,39 0,35 0,34 0,27 0,23 0,22 0,09 0,00

17,61 32 3,20 2,54 2,23 2,05 2,01 1,62 1,53 1,49 1,47 1,37 1,32 1,18 1,12 1,01 1,00 0,81 0,76 0,50 0,42 0,32 0,30 0,30 0,26 0,25 0,18 0,14 0,13 0,00

17,48 39 3,07 2,41 2,10 1,92 1,88 1,49 1,40 1,36 1,34 1,24 1,19 1,05 0,99 0,88 0,87 0,68 0,63 0,37 0,29 0,19 0,17 0,17 0,13 0,12 0,05 0,01 0,00

17,47 16 3,06 2,40 2,09 1,91 1,87 1,48 1,39 1,35 1,33 1,23 1,18 1,04 0,98 0,87 0,86 0,67 0,62 0,36 0,28 0,18 0,16 0,16 0,12 0,11 0,04 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

17,79 22 3,38 2,72 2,41 2,23 2,19 1,80 1,71 1,67 1,65 1,55 1,50 1,36 1,30 1,19 1,18 0,99 0,94 0,68 0,60 0,50 0,48 0,48 0,44 0,43 0,36 0,32 0,31 0,18 0,09 0,00

17,43 28 3,02 2,36 2,05 1,87 1,83 1,44 1,35 1,31 1,29 1,19 1,14 1,00 0,94 0,83 0,82 0,63 0,58 0,32 0,24 0,14 0,12 0,12 0,08 0,07 0,00

17,36 35 2,95 2,29 1,98 1,80 1,76 1,37 1,28 1,24 1,22 1,12 1,07 0,93 0,87 0,76 0,75 0,56 0,51 0,25 0,17 0,07 0,05 0,05 0,01 0,00

17,35 11 2,94 2,28 1,97 1,79 1,75 1,36 1,27 1,23 1,21 1,11 1,06 0,92 0,86 0,75 0,74 0,55 0,50 0,24 0,16 0,06 0,04 0,04 0,00

Tablica 65. Rezultati LSD testa za broj klasića po klasu u 2008./2009. 17,31 31 2,90 2,24 1,93 1,75 1,71 1,32 1,23 1,19 1,17 1,07 1,02 0,88 0,82 0,71 0,70 0,51 0,46 0,20 0,12 0,02 0,00

17,29 26 2,88 2,22 1,91 1,73 1,69 1,30 1,21 1,17 1,15 1,05 1,00 0,86 0,80 0,69 0,68 0,49 0,44 0,18 0,10 0,00

LSD0,01 = 0,917

LSD0,05 = 0,691

F test = 19,22**

17,31 18 2,90 2,24 1,93 1,75 1,71 1,32 1,23 1,19 1,17 1,07 1,02 0,88 0,82 0,71 0,70 0,51 0,46 0,20 0,12 0,02 0,00 0,00

17,19 9 2,78 2,12 1,81 1,63 1,59 1,20 1,11 1,07 1,05 0,95 0,90 0,76 0,70 0,59 0,58 0,39 0,34 0,08 0,00

17,11 20 2,70 2,04 1,73 1,55 1,51 1,12 1,03 0,99 0,97 0,87 0,82 0,68 0,62 0,51 0,50 0,31 0,26 0,00

16,85 17 2,44 1,78 1,47 1,29 1,25 0,86 0,77 0,73 0,71 0,61 0,56 0,42 0,36 0,25 0,24 0,05 0,00

16,80 37 2,39 1,73 1,42 1,24 1,20 0,81 0,72 0,68 0,66 0,56 0,51 0,37 0,31 0,20 0,19 0,00

16,61 15 2,20 1,54 1,23 1,05 1,01 0,62 0,53 0,49 0,47 0,37 0,32 0,18 0,12 0,01 0,00

16,49 4 2,08 1,42 1,11 0,93 0,89 0,50 0,41 0,37 0,35 0,25 0,20 0,06 0,00

16,43 6 2,02 1,36 1,05 0,87 0,83 0,44 0,35 0,31 0,29 0,19 0,14 0,00

16,29 14 1,88 1,22 0,91 0,73 0,69 0,30 0,21 0,17 0,15 0,05 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

16,60 2 2,19 1,53 1,22 1,04 1,00 0,61 0,52 0,48 0,46 0,36 0,31 0,17 0,11 0,00

16,24 8 1,83 1,17 0,86 0,68 0,64 0,25 0,16 0,12 0,10 0,00

16,08 12 1,67 1,01 0,70 0,52 0,48 0,09 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

16,12 30 1,71 1,05 0,74 0,56 0,52 0,13 0,04 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

16,14 29 1,73 1,07 0,76 0,58 0,54 0,15 0,06 0,02 0,00

15,99 3 1,58 0,92 0,61 0,43 0,39 0,00

15,60 1 1,19 0,53 0,22 0,04 0,00

15,56 5 1,15 0,49 0,18 0,00

15,38 15,07 14,41 13 34 10 0,97 0,66 0,00 0,31 0,00 0,00


130

2,04 0,00

1 29 10 17 2 15 14 3 12 34 13 24 5 6 8 11 28 4 16 30 31 25 19 26 20 36 33 9 22 7 27 38 18 35 39 40 32 21

51,11 23 53,15 37

32,07 32,60 32,67 33,96 35,83 36,24 36,51 36,69 37,71 38,17 38,71 39,13 39,33 39,36 39,81 39,84 39,97 40,29 40,57 40,80 40,87 41,19 42,51 42,67 42,83 43,16 43,17 43,20 43,73 43,79 44,87 44,91 44,99 45,19 47,09 47,24 48,03 49,01

53,15 37 21,08 20,55 20,48 19,19 17,32 16,91 16,64 16,46 15,44 14,98 14,98 14,02 13,82 13,79 13,34 13,31 13,18 12,86 12,58 12,35 12,28 11,96 10,64 10,48 10,32 9,99 9,98 9,95 9,42 9,36 8,28 8,24 8,16 7,96 6,06 5,91 5,12 4,14

0,00

51,11 23 19,04 18,51 18,44 17,15 15,28 14,87 14,60 14,42 13,40 12,94 12,94 11,98 11,78 11,75 11,30 11,27 11,14 10,82 10,54 10,31 10,24 9,92 8,60 8,44 8,28 7,95 7,94 7,91 7,38 7,32 6,24 6,20 6,12 5,92 4,02 3,87 3,08 2,10

49,01 21 16,94 16,41 16,34 15,05 13,18 12,77 12,50 12,32 11,30 10,84 10,84 9,88 9,68 9,65 9,20 9,17 9,04 8,72 8,44 8,21 8,14 7,82 6,50 6,34 6,18 5,85 5,84 5,81 5,28 5,22 4,14 4,10 4,02 3,82 1,92 1,77 0,98 0,00

48,03 32 15,96 15,43 15,36 14,07 12,20 11,79 11,52 11,34 10,32 9,86 9,86 8,90 8,70 8,67 8,22 8,19 8,06 7,74 7,46 7,23 7,16 6,84 5,52 5,36 5,20 4,87 4,86 4,83 4,30 4,24 3,16 3,12 3,04 2,84 0,94 0,79 0,00

47,24 40 15,17 14,64 14,57 13,28 11,41 11,00 10,73 10,55 9,53 9,07 9,07 8,11 7,91 7,88 7,43 7,40 7,27 6,95 6,67 6,44 6,37 6,05 4,73 4,57 4,41 4,08 4,07 4,04 3,51 3,45 2,37 2,33 2,25 2,05 0,15 0,00

47,09 39 15,02 14,49 14,42 13,13 11,26 10,85 10,58 10,40 9,38 8,92 8,92 7,96 7,76 7,73 7,28 7,25 7,12 6,80 6,52 6,29 6,22 5,90 4,58 4,42 4,26 3,93 3,92 3,89 3,36 3,30 2,22 2,18 2,10 1,90 0,00

45,19 35 13,12 12,59 12,52 11,23 9,36 8,95 8,68 8,50 7,48 7,02 7,02 6,06 5,86 5,83 5,38 5,35 5,22 4,90 4,62 4,39 4,32 4,00 2,68 2,52 2,36 2,03 2,02 1,99 1,46 1,40 0,32 0,28 0,20 0,00

44,99 18 12,92 12,39 12,32 11,03 9,16 8,75 8,48 8,30 7,28 6,82 6,82 5,86 5,66 5,63 5,18 5,15 5,02 4,70 4,42 4,19 4,12 3,80 2,48 2,32 2,16 1,83 1,82 1,79 1,26 1,20 0,12 0,08 0,00

44,91 38 12,84 12,31 12,24 10,95 9,08 8,67 8,40 8,22 7,20 6,74 6,74 5,78 5,58 5,55 5,10 5,07 4,94 4,62 4,34 4,11 4,04 3,72 2,40 2,24 2,08 1,75 1,74 1,71 1,18 1,12 0,04 0,00

44,87 27 12,80 12,27 12,20 10,91 9,04 8,63 8,36 8,18 7,16 6,70 6,70 5,74 5,54 5,51 5,06 5,03 4,90 4,58 4,30 4,07 4,00 3,68 2,36 2,20 2,04 1,71 1,70 1,67 1,14 1,08 0,00

43,73 22 11,66 11,13 11,06 9,77 7,90 7,49 7,22 7,04 6,02 5,56 5,56 4,60 4,40 4,37 3,92 3,89 3,76 3,44 3,16 2,93 2,86 2,54 1,22 1,06 0,90 0,57 0,56 0,53 0,00

43,20 9 11,13 10,60 10,53 9,24 7,37 6,96 6,69 6,51 5,49 5,03 5,03 4,07 3,87 3,84 3,39 3,36 3,23 2,91 2,63 2,40 2,33 2,01 0,69 0,53 0,37 0,04 0,03 0,00

43,17 33 11,10 10,57 10,50 9,21 7,34 6,93 6,66 6,48 5,46 5,00 5,00 4,04 3,84 3,81 3,36 3,33 3,20 2,88 2,60 2,37 2,30 1,98 0,66 0,50 0,34 0,01 0,00

43,16 36 11,09 10,56 10,49 9,20 7,33 6,92 6,65 6,47 5,45 4,99 4,99 4,03 3,83 3,80 3,35 3,32 3,19 2,87 2,59 2,36 2,29 1,97 0,65 0,49 0,33 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

43,79 7 11,72 11,19 11,12 9,83 7,96 7,55 7,28 7,10 6,08 5,62 5,62 4,66 4,46 4,43 3,98 3,95 3,82 3,50 3,22 2,99 2,92 2,60 1,28 1,12 0,96 0,63 0,62 0,59 0,06 0,00

42,83 20 10,76 10,23 10,16 8,87 7,00 6,59 6,32 6,14 5,12 4,66 4,66 3,70 3,50 3,47 3,02 2,99 2,86 2,54 2,26 2,03 1,96 1,64 0,32 0,16 0,00

LSD0,01 = 4,135

19 Zlatna_dolina 20 Golubica

39 Eurofit 40 Ludwig

42,67 42,51 41,19 40,87 40,80 40,57 40,29 39,97 39,84 39,81 39,36 39,33 39,13 38,71 38,17 37,71 36,69 36,51 36,24 35,83 33,96 32,67 32,60 32,07 26 19 25 31 30 16 4 28 11 8 6 5 24 13 34 12 3 14 15 2 17 10 29 1 10,60 10,44 9,12 8,80 8,73 8,50 8,22 7,90 7,77 7,74 7,29 7,26 7,06 6,64 6,10 5,64 4,62 4,44 4,17 3,76 1,89 0,60 0,53 0,00 10,07 9,91 8,59 8,27 8,20 7,97 7,69 7,37 7,24 7,21 6,76 6,73 6,53 6,11 5,57 5,11 4,09 3,91 3,64 3,23 1,36 0,07 0,00 10,00 9,84 8,52 8,20 8,13 7,90 7,62 7,30 7,17 7,14 6,69 6,66 6,46 6,04 5,50 5,04 4,02 3,84 3,57 3,16 1,29 0,00 8,71 8,55 7,23 6,91 6,84 6,61 6,33 6,01 5,88 5,85 5,40 5,37 5,17 4,75 4,21 3,75 2,73 2,55 2,28 1,87 0,00 6,84 6,68 5,36 5,04 4,97 4,74 4,46 4,14 4,01 3,98 3,53 3,50 3,30 2,88 2,34 1,88 0,86 0,68 0,41 0,00 6,43 6,27 4,95 4,63 4,56 4,33 4,05 3,73 3,60 3,57 3,12 3,09 2,89 2,47 1,93 1,47 0,45 0,27 0,00 6,16 6,00 4,68 4,36 4,29 4,06 3,78 3,46 3,33 3,30 2,85 2,82 2,62 2,20 1,66 1,20 0,18 0,00 5,98 5,82 4,50 4,18 4,11 3,88 3,60 3,28 3,15 3,12 2,67 2,64 2,44 2,02 1,48 1,02 0,00 4,96 4,80 3,48 3,16 3,09 2,86 2,58 2,26 2,13 2,10 1,65 1,62 1,42 1,00 0,46 0,00 4,50 4,34 3,02 2,70 2,63 2,40 2,12 1,80 1,67 1,64 1,19 1,16 0,96 0,54 0,00 4,50 4,34 3,02 2,70 2,63 2,40 2,12 1,80 1,67 1,64 1,19 1,16 0,96 0,54 0,00 3,54 3,38 2,06 1,74 1,67 1,44 1,16 0,84 0,71 0,68 0,23 0,20 0,00 3,34 3,18 1,86 1,54 1,47 1,24 0,96 0,64 0,51 0,48 0,03 0,00 3,31 3,15 1,83 1,51 1,44 1,21 0,93 0,61 0,48 0,45 0,00 2,86 2,70 1,38 1,06 0,99 0,76 0,48 0,16 0,03 0,00 2,83 2,67 1,35 1,03 0,96 0,73 0,45 0,13 0,00 2,70 2,54 1,22 0,90 0,83 0,60 0,32 0,00 2,38 2,22 0,90 0,58 0,51 0,28 0,00 2,10 1,94 0,62 0,30 0,23 0,00 1,87 1,71 0,39 0,07 0,00 Legenda: 1,80 1,64 0,32 0,00 1 U1 21 Janica 1,48 1,32 0,00 2 Osjecka_crvenka 22 Barbara 0,16 0,00 3 Osjecka_20 23 Katarina 0,00 4 Slavonija 24 Alka 5 Žitarka 25 Seka 6 Srpanjka 26 Lela 7 Demetra 27 Sana 8 Super_žitarka 28 Adriana 9 Lucija 29 Divana 10 Renata 30 Libellula 11 Aida 31 Bezostaja 12 Pipi 32 BC_Patria 13 Ilirija 33 BC_Elvira 14 Felix 34 Soissons 15 Zlata 35 Valerius F test = 18,65** 16 Andelka 36 Antonius 17 Mihaela 37 Bastide LSD0,05 = 3,118 18 Ružica 38 Edison

Tablica 66. Rezultati LSD testa za broj zrna po klasu u 2008./2009.


131

0,10 0,00

15 7 28 3 4 6 11 23 19 20 16 2 25 35 34 21 9 37 26 30 18 24 39 38 5 36 40 14 10 27 33 29 32 17 1 31 12 8

50,42 13 50,52 22

39,43 39,82 39,97 40,23 40,35 40,47 40,49 40,52 40,82 40,99 41,22 41,26 41,35 41,43 41,50 41,51 42,10 42,17 42,22 42,66 43,25 43,30 43,37 43,57 43,87 44,20 44,40 44,88 44,96 45,02 45,13 45,70 45,88 46,39 46,45 46,93 47,84 47,93

50,52 22 11,09 10,70 10,55 10,29 10,17 10,05 10,03 10,00 9,70 9,53 9,30 9,26 9,17 9,09 9,02 9,01 8,42 8,35 8,30 7,86 7,27 7,22 7,15 6,95 6,65 6,32 6,12 5,64 5,56 5,50 5,39 4,82 4,64 4,13 4,07 3,59 2,68 2,59

0,00

opravdane razlike p<0,05

LSD0,01 = 2,396

19 Zlatna_dolina 20 Golubica

39 Eurofit 40 Ludwig

50,42 47,93 47,84 46,93 46,45 46,39 45,88 45,70 45,13 45,02 44,96 44,88 44,40 44,20 43,87 43,57 43,37 43,30 43,25 42,66 42,22 42,17 42,10 41,51 41,50 41,43 41,35 41,26 41,22 40,99 40,82 40,52 40,49 40,47 40,35 40,23 39,97 39,82 39,43 13 8 12 31 1 17 32 29 33 27 10 14 40 36 5 38 39 24 18 30 26 37 9 21 34 35 25 2 16 20 19 23 11 6 4 3 28 7 15 10,99 8,50 8,41 7,50 7,02 6,96 6,45 6,27 5,70 5,59 5,53 5,45 4,97 4,77 4,44 4,14 3,94 3,87 3,82 3,23 2,79 2,74 2,67 2,08 2,07 2,00 1,92 1,83 1,79 1,56 1,39 1,09 1,06 1,04 0,92 0,80 0,54 0,39 0,00 10,60 8,11 8,02 7,11 6,63 6,57 6,06 5,88 5,31 5,20 5,14 5,06 4,58 4,38 4,05 3,75 3,55 3,48 3,43 2,84 2,40 2,35 2,28 1,69 1,68 1,61 1,53 1,44 1,40 1,17 1,00 0,70 0,67 0,65 0,53 0,41 0,15 0,00 10,45 7,96 7,87 6,96 6,48 6,42 5,91 5,73 5,16 5,05 4,99 4,91 4,43 4,23 3,90 3,60 3,40 3,33 3,28 2,69 2,25 2,20 2,13 1,54 1,53 1,46 1,38 1,29 1,25 1,02 0,85 0,55 0,52 0,50 0,38 0,26 0,00 10,19 7,70 7,61 6,70 6,22 6,16 5,65 5,47 4,90 4,79 4,73 4,65 4,17 3,97 3,64 3,34 3,14 3,07 3,02 2,43 1,99 1,94 1,87 1,28 1,27 1,20 1,12 1,03 0,99 0,76 0,59 0,29 0,26 0,24 0,12 0,00 10,07 7,58 7,49 6,58 6,10 6,04 5,53 5,35 4,78 4,67 4,61 4,53 4,05 3,85 3,52 3,22 3,02 2,95 2,90 2,31 1,87 1,82 1,75 1,16 1,15 1,08 1,00 0,91 0,87 0,64 0,47 0,17 0,14 0,12 0,00 9,95 7,46 7,37 6,46 5,98 5,92 5,41 5,23 4,66 4,55 4,49 4,41 3,93 3,73 3,40 3,10 2,90 2,83 2,78 2,19 1,75 1,70 1,63 1,04 1,03 0,96 0,88 0,79 0,75 0,52 0,35 0,05 0,02 0,00 9,93 7,44 7,35 6,44 5,96 5,90 5,39 5,21 4,64 4,53 4,47 4,39 3,91 3,71 3,38 3,08 2,88 2,81 2,76 2,17 1,73 1,68 1,61 1,02 1,01 0,94 0,86 0,77 0,73 0,50 0,33 0,03 0,00 9,90 7,41 7,32 6,41 5,93 5,87 5,36 5,18 4,61 4,50 4,44 4,36 3,88 3,68 3,35 3,05 2,85 2,78 2,73 2,14 1,70 1,65 1,58 0,99 0,98 0,91 0,83 0,74 0,70 0,47 0,30 0,00 9,60 7,11 7,02 6,11 5,63 5,57 5,06 4,88 4,31 4,20 4,14 4,06 3,58 3,38 3,05 2,75 2,55 2,48 2,43 1,84 1,40 1,35 1,28 0,69 0,68 0,61 0,53 0,44 0,40 0,17 0,00 9,43 6,94 6,85 5,94 5,46 5,40 4,89 4,71 4,14 4,03 3,97 3,89 3,41 3,21 2,88 2,58 2,38 2,31 2,26 1,67 1,23 1,18 1,11 0,52 0,51 0,44 0,36 0,27 0,23 0,00 9,20 6,71 6,62 5,71 5,23 5,17 4,66 4,48 3,91 3,80 3,74 3,66 3,18 2,98 2,65 2,35 2,15 2,08 2,03 1,44 1,00 0,95 0,88 0,29 0,28 0,21 0,13 0,04 0,00 9,16 6,67 6,58 5,67 5,19 5,13 4,62 4,44 3,87 3,76 3,70 3,62 3,14 2,94 2,61 2,31 2,11 2,04 1,99 1,40 0,96 0,91 0,84 0,25 0,24 0,17 0,09 0,00 9,07 6,58 6,49 5,58 5,10 5,04 4,53 4,35 3,78 3,67 3,61 3,53 3,05 2,85 2,52 2,22 2,02 1,95 1,90 1,31 0,87 0,82 0,75 0,16 0,15 0,08 0,00 8,99 6,50 6,41 5,50 5,02 4,96 4,45 4,27 3,70 3,59 3,53 3,45 2,97 2,77 2,44 2,14 1,94 1,87 1,82 1,23 0,79 0,74 0,67 0,08 0,07 0,00 8,92 6,43 6,34 5,43 4,95 4,89 4,38 4,20 3,63 3,52 3,46 3,38 2,90 2,70 2,37 2,07 1,87 1,80 1,75 1,16 0,72 0,67 0,60 0,01 0,00 8,91 6,42 6,33 5,42 4,94 4,88 4,37 4,19 3,62 3,51 3,45 3,37 2,89 2,69 2,36 2,06 1,86 1,79 1,74 1,15 0,71 0,66 0,59 0,00 8,32 5,83 5,74 4,83 4,35 4,29 3,78 3,60 3,03 2,92 2,86 2,78 2,30 2,10 1,77 1,47 1,27 1,20 1,15 0,56 0,12 0,07 0,00 8,25 5,76 5,67 4,76 4,28 4,22 3,71 3,53 2,96 2,85 2,79 2,71 2,23 2,03 1,70 1,40 1,20 1,13 1,08 0,49 0,05 0,00 8,20 5,71 5,62 4,71 4,23 4,17 3,66 3,48 2,91 2,80 2,74 2,66 2,18 1,98 1,65 1,35 1,15 1,08 1,03 0,44 0,00 7,76 5,27 5,18 4,27 3,79 3,73 3,22 3,04 2,47 2,36 2,30 2,22 1,74 1,54 1,21 0,91 0,71 0,64 0,59 0,00 Legenda: 7,17 4,68 4,59 3,68 3,20 3,14 2,63 2,45 1,88 1,77 1,71 1,63 1,15 0,95 0,62 0,32 0,12 0,05 0,00 1 U1 21 Janica 7,12 4,63 4,54 3,63 3,15 3,09 2,58 2,40 1,83 1,72 1,66 1,58 1,10 0,90 0,57 0,27 0,07 0,00 2 Osjecka_crvenka 22 Barbara 7,05 4,56 4,47 3,56 3,08 3,02 2,51 2,33 1,76 1,65 1,59 1,51 1,03 0,83 0,50 0,20 0,00 3 Osjecka_20 23 Katarina 6,85 4,36 4,27 3,36 2,88 2,82 2,31 2,13 1,56 1,45 1,39 1,31 0,83 0,63 0,30 0,00 4 Slavonija 24 Alka 6,55 4,06 3,97 3,06 2,58 2,52 2,01 1,83 1,26 1,15 1,09 1,01 0,53 0,33 0,00 5 Žitarka 25 Seka 6,22 3,73 3,64 2,73 2,25 2,19 1,68 1,50 0,93 0,82 0,76 0,68 0,20 0,00 6 Srpanjka 26 Lela 6,02 3,53 3,44 2,53 2,05 1,99 1,48 1,30 0,73 0,62 0,56 0,48 0,00 7 Demetra 27 Sana 5,54 3,05 2,96 2,05 1,57 1,51 1,00 0,82 0,25 0,14 0,08 0,00 8 Super_žitarka 28 Adriana 5,46 2,97 2,88 1,97 1,49 1,43 0,92 0,74 0,17 0,06 0,00 9 Lucija 29 Divana 5,40 2,91 2,82 1,91 1,43 1,37 0,86 0,68 0,11 0,00 10 Renata 30 Libellula 5,29 2,80 2,71 1,80 1,32 1,26 0,75 0,57 0,00 11 Aida 31 Bezostaja 4,72 2,23 2,14 1,23 0,75 0,69 0,18 0,00 12 Pipi 32 BC_Patria 4,54 2,05 1,96 1,05 0,57 0,51 0,00 13 Ilirija 33 BC_Elvira 4,03 1,54 1,45 0,54 0,06 0,00 14 Felix 34 Soissons 3,97 1,48 1,39 0,48 0,00 15 Zlata 35 Valerius 3,49 1,00 0,91 0,00 F test = 19,16** 16 Andelka 36 Antonius 2,58 0,09 0,00 17 Mihaela 37 Bastide LSD0,05 = 1,807 18 Ružica 38 Edison 2,49 0,00 visoko opravdane razlike p<0,01

Tablica 67. Rezultati LSD testa za masu 1000 zrna u 2008./2009.


132

37 33 27 7 17 25 19 1 2 30 9 32 15 28 16 24 6 3 18 34 11 12 10 4 21 29 23 31 38 40 14 8 5 39 13 20 26 35

84,90 36 7,63 5,87 5,23 5,07 4,93 4,90 4,87 4,83 4,80 4,63 4,57 4,50 4,27 4,20 3,93 3,83 3,80 3,77 3,50 3,33 3,27 3,20 3,13 3,10 3,03 2,83 2,77 2,57 2,57 2,53 2,20 2,07 1,87 1,37 1,20 0,83 0,53 0,20

84,90 36 0,13 0,00 85,03 22 0,00

77,27 79,03 79,67 79,83 79,97 80,00 80,03 80,07 80,10 80,27 80,33 80,40 80,63 80,70 80,97 81,07 81,10 81,13 81,40 81,57 81,63 81,70 81,77 81,80 81,87 82,07 82,13 82,33 82,33 82,37 82,70 82,83 83,03 83,53 83,70 84,07 84,37 84,70

85,03 22 7,76 6,00 5,36 5,20 5,06 5,03 5,00 4,96 4,93 4,76 4,70 4,63 4,40 4,33 4,06 3,96 3,93 3,90 3,63 3,46 3,40 3,33 3,26 3,23 3,16 2,96 2,90 2,70 2,70 2,66 2,33 2,20 2,00 1,50 1,33 0,96 0,66 0,33

84,70 35 7,43 5,67 5,03 4,87 4,73 4,70 4,67 4,63 4,60 4,43 4,37 4,30 4,07 4,00 3,73 3,63 3,60 3,57 3,30 3,13 3,07 3,00 2,93 2,90 2,83 2,63 2,57 2,37 2,37 2,33 2,00 1,87 1,67 1,17 1,00 0,63 0,33 0,00

84,37 26 7,10 5,34 4,70 4,54 4,40 4,37 4,34 4,30 4,27 4,10 4,04 3,97 3,74 3,67 3,40 3,30 3,27 3,24 2,97 2,80 2,74 2,67 2,60 2,57 2,50 2,30 2,24 2,04 2,04 2,00 1,67 1,54 1,34 0,84 0,67 0,30 0,00

84,07 20 6,80 5,04 4,40 4,24 4,10 4,07 4,04 4,00 3,97 3,80 3,74 3,67 3,44 3,37 3,10 3,00 2,97 2,94 2,67 2,50 2,44 2,37 2,30 2,27 2,20 2,00 1,94 1,74 1,74 1,70 1,37 1,24 1,04 0,54 0,37 0,00

83,70 13 6,43 4,67 4,03 3,87 3,73 3,70 3,67 3,63 3,60 3,43 3,37 3,30 3,07 3,00 2,73 2,63 2,60 2,57 2,30 2,13 2,07 2,00 1,93 1,90 1,83 1,63 1,57 1,37 1,37 1,33 1,00 0,87 0,67 0,17 0,00

83,53 39 6,26 4,50 3,86 3,70 3,56 3,53 3,50 3,46 3,43 3,26 3,20 3,13 2,90 2,83 2,56 2,46 2,43 2,40 2,13 1,96 1,90 1,83 1,76 1,73 1,66 1,46 1,40 1,20 1,20 1,16 0,83 0,70 0,50 0,00

83,03 5 5,76 4,00 3,36 3,20 3,06 3,03 3,00 2,96 2,93 2,76 2,70 2,63 2,40 2,33 2,06 1,96 1,93 1,90 1,63 1,46 1,40 1,33 1,26 1,23 1,16 0,96 0,90 0,70 0,70 0,66 0,33 0,20 0,00

82,83 8 5,56 3,80 3,16 3,00 2,86 2,83 2,80 2,76 2,73 2,56 2,50 2,43 2,20 2,13 1,86 1,76 1,73 1,70 1,43 1,26 1,20 1,13 1,06 1,03 0,96 0,76 0,70 0,50 0,50 0,46 0,13 0,00

82,70 14 5,43 3,67 3,03 2,87 2,73 2,70 2,67 2,63 2,60 2,43 2,37 2,30 2,07 2,00 1,73 1,63 1,60 1,57 1,30 1,13 1,07 1,00 0,93 0,90 0,83 0,63 0,57 0,37 0,37 0,33 0,00

82,33 31 5,06 3,30 2,66 2,50 2,36 2,33 2,30 2,26 2,23 2,06 2,00 1,93 1,70 1,63 1,36 1,26 1,23 1,20 0,93 0,76 0,70 0,63 0,56 0,53 0,46 0,26 0,20 0,00 0,00

82,33 38 5,06 3,30 2,66 2,50 2,36 2,33 2,30 2,26 2,23 2,06 2,00 1,93 1,70 1,63 1,36 1,26 1,23 1,20 0,93 0,76 0,70 0,63 0,56 0,53 0,46 0,26 0,20 0,00

82,13 23 4,86 3,10 2,46 2,30 2,16 2,13 2,10 2,06 2,03 1,86 1,80 1,73 1,50 1,43 1,16 1,06 1,03 1,00 0,73 0,56 0,50 0,43 0,36 0,33 0,26 0,06 0,00

82,07 29 4,80 3,04 2,40 2,24 2,10 2,07 2,04 2,00 1,97 1,80 1,74 1,67 1,44 1,37 1,10 1,00 0,97 0,94 0,67 0,50 0,44 0,37 0,30 0,27 0,20 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

82,37 40 5,10 3,34 2,70 2,54 2,40 2,37 2,34 2,30 2,27 2,10 2,04 1,97 1,74 1,67 1,40 1,30 1,27 1,24 0,97 0,80 0,74 0,67 0,60 0,57 0,50 0,30 0,24 0,04 0,04 0,00

81,87 21 4,60 2,84 2,20 2,04 1,90 1,87 1,84 1,80 1,77 1,60 1,54 1,47 1,24 1,17 0,90 0,80 0,77 0,74 0,47 0,30 0,24 0,17 0,10 0,07 0,00

81,80 4 4,53 2,77 2,13 1,97 1,83 1,80 1,77 1,73 1,70 1,53 1,47 1,40 1,17 1,10 0,83 0,73 0,70 0,67 0,40 0,23 0,17 0,10 0,03 0,00

Tablica 68. Rezultati LSD testa za hektolitarsku masu u 2008./2009. 81,77 10 4,50 2,74 2,10 1,94 1,80 1,77 1,74 1,70 1,67 1,50 1,44 1,37 1,14 1,07 0,80 0,70 0,67 0,64 0,37 0,20 0,14 0,07 0,00

81,63 11 4,36 2,60 1,96 1,80 1,66 1,63 1,60 1,56 1,53 1,36 1,30 1,23 1,00 0,93 0,66 0,56 0,53 0,50 0,23 0,06 0,00

81,57 34 4,30 2,54 1,90 1,74 1,60 1,57 1,54 1,50 1,47 1,30 1,24 1,17 0,94 0,87 0,60 0,50 0,47 0,44 0,17 0,00

LSD0,01 = 1,394

LSD0,05 = 1,051

F test = 19,92**

81,70 12 4,43 2,67 2,03 1,87 1,73 1,70 1,67 1,63 1,60 1,43 1,37 1,30 1,07 1,00 0,73 0,63 0,60 0,57 0,30 0,13 0,07 0,00

81,40 18 4,13 2,37 1,73 1,57 1,43 1,40 1,37 1,33 1,30 1,13 1,07 1,00 0,77 0,70 0,43 0,33 0,30 0,27 0,00

81,13 3 3,86 2,10 1,46 1,30 1,16 1,13 1,10 1,06 1,03 0,86 0,80 0,73 0,50 0,43 0,16 0,06 0,03 0,00

81,10 6 3,83 2,07 1,43 1,27 1,13 1,10 1,07 1,03 1,00 0,83 0,77 0,70 0,47 0,40 0,13 0,03 0,00

81,07 24 3,80 2,04 1,40 1,24 1,10 1,07 1,04 1,00 0,97 0,80 0,74 0,67 0,44 0,37 0,10 0,00

80,97 16 3,70 1,94 1,30 1,14 1,00 0,97 0,94 0,90 0,87 0,70 0,64 0,57 0,34 0,27 0,00

80,63 15 3,36 1,60 0,96 0,80 0,66 0,63 0,60 0,56 0,53 0,36 0,30 0,23 0,00

80,40 32 3,13 1,37 0,73 0,57 0,43 0,40 0,37 0,33 0,30 0,13 0,07 0,00

80,33 9 3,06 1,30 0,66 0,50 0,36 0,33 0,30 0,26 0,23 0,06 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

80,70 28 3,43 1,67 1,03 0,87 0,73 0,70 0,67 0,63 0,60 0,43 0,37 0,30 0,07 0,00

80,27 30 3,00 1,24 0,60 0,44 0,30 0,27 0,24 0,20 0,17 0,00

80,03 19 2,76 1,00 0,36 0,20 0,06 0,03 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

80,07 1 2,80 1,04 0,40 0,24 0,10 0,07 0,04 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

80,10 2 2,83 1,07 0,43 0,27 0,13 0,10 0,07 0,03 0,00

80,00 25 2,73 0,97 0,33 0,17 0,03 0,00

79,97 17 2,70 0,94 0,30 0,14 0,00

79,83 7 2,56 0,80 0,16 0,00

79,67 79,03 77,27 27 33 37 2,40 1,76 0,00 0,64 0,00 0,00


133

1 30 31 29 19 2 21 8 22 3 20 18 35 14 9 13 34 33 15 28 7 12 11 4 40 17 25 6 10 32 26 5 38 16 36 39 23 24

7,45 27 4,55 2,76 2,74 2,65 2,06 1,91 1,51 1,40 1,38 1,37 1,31 1,29 1,28 1,19 1,09 1,07 1,03 0,87 0,87 0,85 0,67 0,65 0,64 0,59 0,56 0,53 0,51 0,48 0,44 0,42 0,35 0,34 0,33 0,32 0,28 0,24 0,18 0,09

7,45 27 0,56 0,00 8,01 37 0,00

2,90 4,69 4,71 4,80 5,39 5,54 5,94 6,05 6,07 6,08 6,14 6,16 6,17 6,26 6,36 6,38 6,42 6,58 6,58 6,60 6,78 6,80 6,81 6,86 6,89 6,92 6,94 6,97 7,01 7,03 7,10 7,11 7,12 7,13 7,17 7,21 7,27 7,36

8,01 37 5,11 3,32 3,30 3,21 2,62 2,47 2,07 1,96 1,94 1,93 1,87 1,85 1,84 1,75 1,65 1,63 1,59 1,43 1,43 1,41 1,23 1,21 1,20 1,15 1,12 1,09 1,07 1,04 1,00 0,98 0,91 0,90 0,89 0,88 0,84 0,80 0,74 0,65

7,36 24 4,46 2,67 2,65 2,56 1,97 1,82 1,42 1,31 1,29 1,28 1,22 1,20 1,19 1,10 1,00 0,98 0,94 0,78 0,78 0,76 0,58 0,56 0,55 0,50 0,47 0,44 0,42 0,39 0,35 0,33 0,26 0,25 0,24 0,23 0,19 0,15 0,09 0,00

7,27 23 4,37 2,58 2,56 2,47 1,88 1,73 1,33 1,22 1,20 1,19 1,13 1,11 1,10 1,01 0,91 0,89 0,85 0,69 0,69 0,67 0,49 0,47 0,46 0,41 0,38 0,35 0,33 0,30 0,26 0,24 0,17 0,16 0,15 0,14 0,10 0,06 0,00

7,21 39 4,31 2,52 2,50 2,41 1,82 1,67 1,27 1,16 1,14 1,13 1,07 1,05 1,04 0,95 0,85 0,83 0,79 0,63 0,63 0,61 0,43 0,41 0,40 0,35 0,32 0,29 0,27 0,24 0,20 0,18 0,11 0,10 0,09 0,08 0,04 0,00

7,17 36 4,27 2,48 2,46 2,37 1,78 1,63 1,23 1,12 1,10 1,09 1,03 1,01 1,00 0,91 0,81 0,79 0,75 0,59 0,59 0,57 0,39 0,37 0,36 0,31 0,28 0,25 0,23 0,20 0,16 0,14 0,07 0,06 0,05 0,04 0,00

7,13 16 4,23 2,44 2,42 2,33 1,74 1,59 1,19 1,08 1,06 1,05 0,99 0,97 0,96 0,87 0,77 0,75 0,71 0,55 0,55 0,53 0,35 0,33 0,32 0,27 0,24 0,21 0,19 0,16 0,12 0,10 0,03 0,02 0,01 0,00

7,12 38 4,22 2,43 2,41 2,32 1,73 1,58 1,18 1,07 1,05 1,04 0,98 0,96 0,95 0,86 0,76 0,74 0,70 0,54 0,54 0,52 0,34 0,32 0,31 0,26 0,23 0,20 0,18 0,15 0,11 0,09 0,02 0,01 0,00

7,11 5 4,21 2,42 2,40 2,31 1,72 1,57 1,17 1,06 1,04 1,03 0,97 0,95 0,94 0,85 0,75 0,73 0,69 0,53 0,53 0,51 0,33 0,31 0,30 0,25 0,22 0,19 0,17 0,14 0,10 0,08 0,01 0,00

7,10 26 4,20 2,41 2,39 2,30 1,71 1,56 1,16 1,05 1,03 1,02 0,96 0,94 0,93 0,84 0,74 0,72 0,68 0,52 0,52 0,50 0,32 0,30 0,29 0,24 0,21 0,18 0,16 0,13 0,09 0,07 0,00

7,01 10 4,11 2,32 2,30 2,21 1,62 1,47 1,07 0,96 0,94 0,93 0,87 0,85 0,84 0,75 0,65 0,63 0,59 0,43 0,43 0,41 0,23 0,21 0,20 0,15 0,12 0,09 0,07 0,04 0,00

6,97 6 4,07 2,28 2,26 2,17 1,58 1,43 1,03 0,92 0,90 0,89 0,83 0,81 0,80 0,71 0,61 0,59 0,55 0,39 0,39 0,37 0,19 0,17 0,16 0,11 0,08 0,05 0,03 0,00

6,94 25 4,04 2,25 2,23 2,14 1,55 1,40 1,00 0,89 0,87 0,86 0,80 0,78 0,77 0,68 0,58 0,56 0,52 0,36 0,36 0,34 0,16 0,14 0,13 0,08 0,05 0,02 0,00

6,92 17 4,02 2,23 2,21 2,12 1,53 1,38 0,98 0,87 0,85 0,84 0,78 0,76 0,75 0,66 0,56 0,54 0,50 0,34 0,34 0,32 0,14 0,12 0,11 0,06 0,03 0,00

6,89 40 3,99 2,20 2,18 2,09 1,50 1,35 0,95 0,84 0,82 0,81 0,75 0,73 0,72 0,63 0,53 0,51 0,47 0,31 0,31 0,29 0,11 0,09 0,08 0,03 0,00

opravdane razlike p<0,05

visoko opravdane razlike p<0,01

7,03 32 4,13 2,34 2,32 2,23 1,64 1,49 1,09 0,98 0,96 0,95 0,89 0,87 0,86 0,77 0,67 0,65 0,61 0,45 0,45 0,43 0,25 0,23 0,22 0,17 0,14 0,11 0,09 0,06 0,02 0,00

Tablica 69. Rezultati LSD testa za urod zrna u 2008./2009. 6,86 4 3,96 2,17 2,15 2,06 1,47 1,32 0,92 0,81 0,79 0,78 0,72 0,70 0,69 0,60 0,50 0,48 0,44 0,28 0,28 0,26 0,08 0,06 0,05 0,00

6,81 11 3,91 2,12 2,10 2,01 1,42 1,27 0,87 0,76 0,74 0,73 0,67 0,65 0,64 0,55 0,45 0,43 0,39 0,23 0,23 0,21 0,03 0,01 0,00

6,78 7 3,88 2,09 2,07 1,98 1,39 1,24 0,84 0,73 0,71 0,70 0,64 0,62 0,61 0,52 0,42 0,40 0,36 0,20 0,20 0,18 0,00

6,60 28 3,70 1,91 1,89 1,80 1,21 1,06 0,66 0,55 0,53 0,52 0,46 0,44 0,43 0,34 0,24 0,22 0,18 0,02 0,02 0,00

LSD0,01 = 0,676

LSD0,05 = 0,51

F test = 25,91**

6,80 12 3,90 2,11 2,09 2,00 1,41 1,26 0,86 0,75 0,73 0,72 0,66 0,64 0,63 0,54 0,44 0,42 0,38 0,22 0,22 0,20 0,02 0,00

6,58 15 3,68 1,89 1,87 1,78 1,19 1,04 0,64 0,53 0,51 0,50 0,44 0,42 0,41 0,32 0,22 0,20 0,16 0,00 0,00

6,58 33 3,68 1,89 1,87 1,78 1,19 1,04 0,64 0,53 0,51 0,50 0,44 0,42 0,41 0,32 0,22 0,20 0,16 0,00

6,42 34 3,52 1,73 1,71 1,62 1,03 0,88 0,48 0,37 0,35 0,34 0,28 0,26 0,25 0,16 0,06 0,04 0,00

6,38 13 3,48 1,69 1,67 1,58 0,99 0,84 0,44 0,33 0,31 0,30 0,24 0,22 0,21 0,12 0,02 0,00

6,36 9 3,46 1,67 1,65 1,56 0,97 0,82 0,42 0,31 0,29 0,28 0,22 0,20 0,19 0,10 0,00

6,17 35 3,27 1,48 1,46 1,37 0,78 0,63 0,23 0,12 0,10 0,09 0,03 0,01 0,00

6,16 18 3,26 1,47 1,45 1,36 0,77 0,62 0,22 0,11 0,09 0,08 0,02 0,00

6,14 20 3,24 1,45 1,43 1,34 0,75 0,60 0,20 0,09 0,07 0,06 0,00

19 Zlatna_dolina 20 Golubica

Legenda: 1 U1 2 Osjecka_crvenka 3 Osjecka_20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super_žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Andelka 17 Mihaela 18 Ružica

6,26 14 3,36 1,57 1,55 1,46 0,87 0,72 0,32 0,21 0,19 0,18 0,12 0,10 0,09 0,00

6,08 3 3,18 1,39 1,37 1,28 0,69 0,54 0,14 0,03 0,01 0,00

5,94 21 3,04 1,25 1,23 1,14 0,55 0,40 0,00

Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libellula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison

6,05 8 3,15 1,36 1,34 1,25 0,66 0,51 0,11 0,00

39 Eurofit 40 Ludwig

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38

6,07 22 3,17 1,38 1,36 1,27 0,68 0,53 0,13 0,02 0,00

5,54 2 2,64 0,85 0,83 0,74 0,15 0,00

5,39 19 2,49 0,70 0,68 0,59 0,00

4,80 29 1,90 0,11 0,09 0,00

4,71 4,69 2,90 31 30 1 1,81 1,79 0,00 0,02 0,00 0,00


11.2. Prilog 2 Tablica 70. Matrica genetske sliÄ?nosti (RTij) na temelju morfoloĹĄkih podataka

134


135

br. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anðelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

1

1,00 0,11 0,11 0,18 0,11 0,25 0,11 0,11 0,25 0,18 0,11 0,11 0,05 0,11 0,25 0,11 0,18 0,11 0,25 0,11 0,05 0,11 0,11 0,11 0,25 0,11 0,11 0,18 0,05 0,11 0,18 0,11 0,11 0,05 0,05 0,05 0,11 0,05 0,18 0,11

2

1,00 0,43 0,33 0,25 0,18 0,43 0,25 0,25 0,33 0,33 0,25 0,11 0,25 0,25 0,33 0,11 0,25 0,43 0,18 0,25 0,25 0,43 0,33 0,33 0,25 0,33 0,25 0,25 0,25 0,18 0,43 0,25 0,18 0,05 0,05 0,11 0,11 0,18 0,25

3

1,00 0,67 0,54 0,18 0,67 0,54 0,18 0,33 0,67 0,25 0,43 0,43 0,43 0,33 0,25 0,25 0,33 0,43 0,33 0,43 0,33 0,54 0,25 0,25 0,43 0,43 0,25 0,11 0,25 0,33 0,67 0,33 0,25 0,18 0,25 0,25 0,11 0,33

4

1,00 0,67 0,25 0,67 0,67 0,25 0,33 0,54 0,25 0,25 0,33 0,25 0,43 0,43 0,25 0,25 0,43 0,33 0,33 0,33 0,43 0,18 0,25 0,43 0,43 0,18 0,18 0,25 0,33 0,43 0,25 0,25 0,11 0,25 0,18 0,11 0,25

5

1,00 0,25 0,54 0,54 0,33 0,25 0,43 0,18 0,25 0,25 0,18 0,43 0,43 0,25 0,18 0,43 0,25 0,43 0,25 0,33 0,18 0,25 0,33 0,33 0,18 0,11 0,18 0,25 0,54 0,18 0,33 0,11 0,33 0,11 0,11 0,18

6

1,00 0,25 0,33 0,43 0,54 0,25 0,33 0,11 0,25 0,25 0,33 0,33 0,18 0,25 0,33 0,18 0,25 0,18 0,25 0,25 0,25 0,18 0,11 0,11 0,43 0,18 0,18 0,18 0,11 0,11 0,18 0,11 0,11 0,11 0,18

7

1,00 0,54 0,33 0,54 0,43 0,43 0,25 0,43 0,25 0,54 0,33 0,25 0,33 0,33 0,33 0,33 0,43 0,33 0,18 0,33 0,33 0,33 0,25 0,18 0,25 0,43 0,43 0,33 0,18 0,18 0,18 0,25 0,18 0,43

8

1,00 0,33 0,33 0,67 0,33 0,25 0,25 0,25 0,33 0,33 0,25 0,33 0,54 0,33 0,54 0,43 0,54 0,11 0,43 0,54 0,54 0,25 0,25 0,25 0,43 0,43 0,33 0,25 0,11 0,25 0,18 0,11 0,25

9

1,00 0,43 0,25 0,25 0,05 0,11 0,25 0,25 0,25 0,18 0,54 0,25 0,18 0,33 0,25 0,25 0,25 0,33 0,18 0,25 0,11 0,25 0,11 0,25 0,25 0,11 0,11 0,05 0,18 0,05 0,25 0,18 1,00 0,25 0,67 0,18 0,43 0,43 0,43 0,33 0,18 0,33 0,18 0,18 0,18 0,33 0,25 0,25 0,25 0,25 0,18 0,18 0,33 0,25 0,33 0,25 0,25 0,11 0,18 0,11 0,25 0,18 0,43

10

Tablica 70. Matrica genetske sličnosti (RTij) na temelju morfoloških podataka

1,00 0,18 0,43 0,25 0,33 0,25 0,25 0,25 0,54 0,67 0,33 0,54 0,33 0,82 0,18 0,33 0,43 0,43 0,25 0,18 0,25 0,33 0,67 0,25 0,25 0,11 0,25 0,18 0,11 0,25

11

1,00 0,25 0,33 0,33 0,33 0,25 0,11 0,25 0,11 0,18 0,18 0,33 0,18 0,18 0,25 0,25 0,18 0,33 0,25 0,18 0,33 0,18 0,43 0,18 0,25 0,11 0,33 0,11 0,33

12

1,00 0,18 0,25 0,18 0,18 0,18 0,18 0,33 0,11 0,25 0,11 0,33 0,11 0,11 0,18 0,18 0,54 0,11 0,18 0,11 0,54 0,25 0,43 0,33 0,18 0,33 0,18 0,18

13

1,00 0,33 0,33 0,25 0,25 0,18 0,18 0,33 0,18 0,33 0,25 0,25 0,25 0,33 0,25 0,11 0,11 0,43 0,25 0,25 0,33 0,18 0,18 0,18 0,25 0,18 0,33

14

1,00 0,18 0,25 0,18 0,43 0,18 0,11 0,18 0,18 0,33 0,43 0,11 0,25 0,33 0,11 0,11 0,18 0,18 0,33 0,18 0,11 0,11 0,11 0,18 0,18 0,25

15

1,00 0,43 0,25 0,18 0,25 0,18 0,25 0,33 0,18 0,43 0,33 0,25 0,25 0,33 0,11 0,18 0,33 0,25 0,11 0,18 0,11 0,11 0,11 0,25 0,25

16

1,00 0,33 0,11 0,25 0,11 0,33 0,18 0,18 0,25 0,18 0,18 0,18 0,18 0,11 0,18 0,18 0,33 0,11 0,25 0,18 0,18 0,11 0,11 0,18

17

1,00 0,18 0,25 0,33 0,25 0,43 0,33 0,25 0,33 0,43 0,33 0,25 0,05 0,25 0,33 0,25 0,25 0,18 0,18 0,25 0,11 0,33 0,18

18

1,00 0,33 0,25 0,33 0,33 0,54 0,33 0,33 0,25 0,33 0,18 0,18 0,18 0,33 0,33 0,18 0,05 0,05 0,11 0,11 0,25 0,25

19

1,00 0,25 0,43 0,25 0,54 0,11 0,33 0,33 0,33 0,18 0,11 0,18 0,33 0,54 0,18 0,25 0,25 0,25 0,18 0,11 0,25

20


136

br. 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Genotip Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

21 1,00 0,33 0,33 0,43 0,11 0,33 0,33 0,25 0,11 0,25 0,25 0,25 0,18 0,33 0,18 0,11 0,33 0,25 0,11 0,18

1,00 0,33 0,43 0,18 0,43 0,33 0,33 0,33 0,11 0,18 0,33 0,54 0,25 0,25 0,11 0,25 0,18 0,11 0,18

22

1,00 0,33 0,18 0,67 0,67 0,54 0,33 0,11 0,33 0,82 0,25 0,43 0,18 0,18 0,25 0,25 0,43 0,33

23

1,00 0,18 0,33 0,43 0,33 0,18 0,18 0,25 0,33 0,54 0,25 0,18 0,11 0,25 0,18 0,11 0,25

24

1,00 0,18 0,18 0,25 0,18 0,05 0,11 0,18 0,18 0,05 0,05 0,11 0,05 0,05 0,25 0,11

25

1,00 0,43 0,33 0,25 0,11 0,25 0,54 0,25 0,33 0,18 0,18 0,25 0,18 0,33 0,25

26

1,00 0,67 0,25 0,11 0,43 0,54 0,33 0,43 0,25 0,11 0,43 0,18 0,25 0,33

27

1,00 0,25 0,05 0,25 0,43 0,33 0,33 0,25 0,05 0,25 0,11 0,33 0,18

28

1,00 0,11 0,18 0,33 0,25 0,25 0,33 0,25 0,11 0,25 0,33 0,18

29

1,00 0,18 0,11 0,05 0,11 0,11 0,11 0,11 0,18 0,05 0,11

30

1,00 0,25 0,18 0,25 0,33 0,18 0,33 0,25 0,25 0,33

31

Tablica 70. Matrica genetske sliÄ?nosti (RTij) na temelju morfoloĹĄkih podataka - nastavak

1,00 0,25 0,33 0,11 0,25 0,18 0,33 0,33 0,43

32

1,00 0,25 0,33 0,18 0,33 0,18 0,11 0,25

33

1,00 0,25 0,25 0,25 0,33 0,11 0,25

34

1,00 0,25 0,33 0,25 0,18 0,11

35

1,00 0,11 0,67 0,25 0,33

36

1,00 0,11 0,11 0,18

37

1,00 0,25 0,43

38

1,00 0,25

39

1,00

40


11.3. Prilog 3 Tablica 71. Ishodišna matrica umnoženih alela mikrosatelita u parovima baza -

u tablicu su uključeni 40 sorata ozime pšenice na temelju 26 mikrosatelita

-

u dužinu alela u parovima baza uključeno je i 19 nukleotida početnice M13

137


138

Br. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

1 gwm2_1 135 145 135 150 145 135 135 135 135 150 135 135 135 135 135 135 150 135 135 135 135 135 135 135 135 150 135 135 145 135 135 135 135 135 135 150 145 150 135 135

2 gwm2_2 235 248 235 237 248 235 235 237 237 248 235 235 235 235 235 235 248 235 235 235 235 237 237 235 235 235 235 237 248 235 235 237 237 235 235 248 237 248 237 237 213 213 208

208 210 210 210 210 210 210 213 210 208 210 213 213 208 208/213 208/210 210 213 213 210 210 213 213 210 208

3 gwm11 213 208 213 208 208 213 208 210 208 213

4 gwm55 148 153 153 153 153 148 148 153 148 148 148 148 153 148 148 148 148 148 153 153 148 153 148 153 148 148 153 153 148 153 153 148 153 148 148 153 148 153 153 148 172 172 172 172 175 175

172

175 172

175 172

172 175 175 175 172 172

175 175 175 172

175 175 175 172 175 175 175 175 175 175 175

5 gwm68_1

mikrosatelitni marker 6 7 8 gwm68_2 gwm121_1 gwm121_2 205/200 120 145 194 120 155 122 155 120 155 120 155 194 122 150 200 122 155 122 155 194 122 150 122 150 194 120 145 120 155 200 120 145 120 150 120 150 122 155 200 122 155 120 155 200 122 155 194 120 155 120 150 122 155 200 120 150 200 122 155 200 122 150 120 150 122 155 200 120 145 194 122 150 120 155 194 120 150 200 120 155 122 155 200 122 145 120 145 122 145 120 145 122 145 200 120 145 200 120 145

Tablica 71. Ishodišna matrica umnoženih alela mikrosatelita u parovima baza

9 gwm135 155 202 155 195 202 153 202 202 202 153 155 202 155 202 202 202 155 155 155 195 153 202 155 153 153 153 153 155 202 155 202 195 155 155 153 202 153 153 202 153 177/181 168 168 177 177/181 168 168 168 168 177/181 168 168 168 168 177/181 168 168 168 168 168 181 168

10 gwm149 168 168 168 168 168 168 181 177 168 168 168 168 168 168 168 181 168

202 240 218 202 202 209 202 209 240 202 202 202

209 240 202 240 240 202 240 202 240 240 212 209 240 202 202 202 240 240 240 209

240 209 240

11 gwm169 218 240

12 gwm186 145 137 139 139 139 137 125 139 137 139 137 137 145 139 137 137 139 125 125 125 125 139 137 125 125 139 125 145 125 137 137 125 137 125 139 139 139 139 139 145

13 gwm257 211 215 213 213 213 215 213 213 213 215 213 215 213 213 213 215 215 213 213 213 213 213 213 213 213 215 213 213 215 215 215 213 215 215 215 215 213 213 215 215


139

Br. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anđelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC Patria BC Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

mikrosatelitni marker 14 15 16 17 18 19 20 21 22 23 gwm261 gwm311_1gwm311_2gwm458 gwm497_1 gwm497_2 gwm497_3 gwm573_1 gwm573_2 gwm609 184 135 130 160 137 115 229 117 211 135 128 137/143 115 226 119/129 184 175 130 170 197 231 125 211 135 130 160 115 231 123/125 211 135 134 170 137 226 122 211 135 128 170 231 122 211 135 130 150 115 195 231 119/129 211 135 130 170 226 122 211 135 130 115 195 231 119 211 135 128 170 143 195 231 125/129 193 168 134 170 231 122 211 175 134 137 195 231 129 193 135 134 137 197 231 123 193 135 128 160/170 137 195 229 122 211 135 130 170 197 229 122 211 135 128 170 150 197 231 129 211 135 128 170 195 229 123 211 135 128 137 195 229 122 211 135 130 150 115 231 119/129 211 135 175 130 160 137 231 125 211 135 130 137 197 231 122 211 135 130 170 226 123 211 135 134 137/150 231 119 211 135 128 170 143 231 123 211 135 130 170 150 197 231 129 211 175 128 170 195 231 125 211 168 128 150 115 197 223/231 129 211 135 134 150 115 231 119/129 211 135 128 160 137 115 223 119/129 211 135 128 143 197 226 125 211 135 130 137/150 115 195 223 129 211 135 128 137/143 231 117/122 211 135 134 150 115 231 119/129 193 135 134 137 197 231 125 215 135 128 160 115 197 231 123 215 135 130 160 115 195 229 119 184 135 134 150 195 229 123 193 135 128 160 115 197 231 123 184 135 128 160 137 197 229 119/129 193 168 128 115 197 231 125

Tablica 71. Ishodišna matrica umnoženih alela mikrosatelita u parovima baza (nastavak).

24 gwm610 185 180 185 183 180 180 183 180 183 183 180 185 183 185 180 183 183 183 185 183 183 180 180 180 183 183 185 185 183 185 183 180 185 180 183 183 183 183 183 183 120 120 147 120 120 147 120 120/147 120 120 147 120 147 120 120 120 120

25 gwm626 120 120 147 147 120 120 120 147 120 120/147 120 147 147 120 120 120 120 120 120 147 120 120/147

26 gwm642 215 215 204 204 204 215 215 204 215 215 215 215 215 215 215 215 215 204 198 204 204 198 204 198 215 204 204 204 215 204 215 215 204 215 215 215 204 215 215 215


11.4. Prilog 4 Tablica 72. Matrica genetske udaljenosti (dij) na temelju mikrosatelitnih poÄ?etnica

140


141

br.

Genotip 1 U1 2 Osječka Crvenka 3 Osječka 20 4 Slavonija 5 Žitarka 6 Srpanjka 7 Demetra 8 Super Žitarka 9 Lucija 10 Renata 11 Aida 12 Pipi 13 Ilirija 14 Felix 15 Zlata 16 Anðelka 17 Mihaela 18 Ružica 19 Zlatna Dolina 20 Golubica 21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libelula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison 39 Eurofit 40 Ludwig

1 0,00 0,83 0,67 0,85 0,88 0,72 0,74 0,94 0,73 0,77 0,65 0,75 0,64 0,60 0,64 0,80 0,75 0,71 0,68 0,79 0,70 0,89 0,79 0,80 0,70 0,93 0,84 0,69 0,73 0,67 0,64 0,74 0,77 0,64 0,63 0,78 0,70 0,76 0,67 0,71

3

0,00 0,53 0,74 0,73 0,75 0,52 0,81 0,78 0,70 0,67 0,64 0,72 0,69 0,76 0,78 0,73 0,57 0,54 0,64 0,63 0,76 0,65 0,71 0,59 0,61 0,71 0,88 0,51 0,84 0,85 0,67 0,62 0,81 0,78 0,77 0,70 0,79 0,83

2

0,00 0,91 0,64 0,45 0,46 0,69 0,70 0,46 0,65 0,65 0,56 0,85 0,67 0,61 0,57 0,62 0,75 0,78 0,68 0,77 0,65 0,77 0,62 0,72 0,71 0,79 0,77 0,54 0,45 0,56 0,58 0,67 0,82 0,73 0,62 0,81 0,73 0,69 0,70 0,00 0,57 0,76 0,67 0,54 0,55 0,71 0,79 0,65 0,70 0,72 0,73 0,77 0,72 0,66 0,72 0,27 0,54 0,64 0,76 0,69 0,63 0,47 0,76 0,68 0,77 0,57 0,73 0,63 0,74 0,83 0,74 0,56 0,64 0,64 0,79 0,74

4

0,00 0,71 0,75 0,43 0,71 0,77 0,69 0,70 0,76 0,67 0,60 0,82 0,72 0,63 0,71 0,67 0,60 0,53 0,68 0,64 0,74 0,76 0,64 0,67 0,77 0,65 0,70 0,65 0,68 0,78 0,79 0,63 0,59 0,69 0,78 0,90

5

0,00 0,71 0,71 0,50 0,43 0,41 0,61 0,79 0,57 0,45 0,46 0,57 0,67 0,70 0,65 0,59 0,71 0,66 0,41 0,49 0,59 0,69 0,82 0,59 0,48 0,59 0,56 0,64 0,61 0,59 0,83 0,77 0,65 0,71 0,68

6

0,00 0,69 0,37 0,63 0,74 0,60 0,75 0,66 0,56 0,43 0,66 0,56 0,48 0,63 0,49 0,64 0,72 0,63 0,37 0,75 0,62 0,64 0,66 0,80 0,59 0,65 0,70 0,73 0,71 0,69 0,76 0,77 0,67 0,69

7

0,00 0,68 0,81 0,78 0,80 0,77 0,68 0,51 0,68 0,73 0,63 0,60 0,58 0,67 0,21 0,69 0,68 0,79 0,74 0,67 0,63 0,83 0,72 0,74 0,67 0,64 0,80 0,89 0,68 0,81 0,83 0,77 0,97

8

0,00 0,54 0,57 0,53 0,77 0,58 0,48 0,52 0,62 0,68 0,68 0,60 0,51 0,63 0,66 0,70 0,39 0,64 0,80 0,68 0,54 0,71 0,51 0,63 0,67 0,80 0,70 0,60 0,65 0,70 0,74 0,60

9

0,00 0,77 0,63 0,79 0,62 0,61 0,50 0,42 0,67 0,83 0,82 0,56 0,70 0,74 0,60 0,50 0,46 0,74 0,89 0,46 0,63 0,63 0,63 0,71 0,72 0,49 0,65 0,67 0,44 0,55 0,57

10

Tablica 72. Matrica genetske udaljenosti (dij)na temelju mikrosatelitnih početnica

0,00 0,59 0,56 0,52 0,45 0,64 0,69 0,65 0,78 0,68 0,64 0,78 0,61 0,64 0,62 0,74 0,77 0,69 0,88 0,67 0,75 0,67 0,77 0,56 0,68 0,94 0,62 0,75 0,85 0,60

11

0,00 0,68 0,56 0,60 0,49 0,72 0,67 0,85 0,64 0,63 0,85 0,76 0,80 0,61 0,47 0,76 0,83 0,69 0,55 0,58 0,76 0,73 0,60 0,75 0,74 0,80 0,95 0,78 0,72

12

0,00 0,64 0,63 0,72 0,68 0,64 0,74 0,56 0,58 0,72 0,68 0,69 0,61 0,84 0,76 0,52 0,74 0,74 0,65 0,60 0,76 0,42 0,49 0,74 0,66 0,51 0,65 0,56

13

0,00 0,38 0,54 0,54 0,44 0,80 0,63 0,53 0,68 0,79 0,70 0,62 0,64 0,71 0,77 0,70 0,61 0,59 0,64 0,90 0,71 0,55 0,73 0,60 0,64 0,62 0,70

14

0,00 0,48 0,63 0,51 0,74 0,64 0,37 0,45 0,57 0,66 0,51 0,71 0,73 0,76 0,69 0,63 0,47 0,52 0,78 0,71 0,59 0,79 0,74 0,74 0,68 0,72

15

0,00 0,46 0,54 0,73 0,68 0,61 0,63 0,76 0,63 0,42 0,64 0,62 0,77 0,64 0,54 0,50 0,67 0,67 0,70 0,52 0,80 0,77 0,73 0,55 0,65

16

0,00 0,54 0,73 0,75 0,76 0,62 0,77 0,54 0,59 0,56 0,73 0,79 0,62 0,63 0,63 0,63 0,71 0,71 0,48 0,58 0,54 0,54 0,69 0,70

17

0,00 0,65 0,49 0,37 0,68 0,66 0,65 0,62 0,67 0,61 0,64 0,72 0,53 0,67 0,56 0,75 0,71 0,65 0,88 0,62 0,80 0,74 0,78

18

0,00 0,62 0,66 0,55 0,50 0,39 0,60 0,98 0,46 0,45 0,78 0,61 0,72 0,67 0,35 0,67 0,83 0,76 0,85 0,73 0,84 0,94

19

0,00 0,48 0,68 0,74 0,57 0,57 0,61 0,61 0,66 0,70 0,53 0,59 0,53 0,77 0,69 0,73 0,75 0,73 0,78 0,80 0,84

20


142

br.

Genotip 21 Janica 22 Barbara 23 Katarina 24 Alka 25 Seka 26 Lela 27 Sana 28 Adriana 29 Divana 30 Libelula 31 Bezostaja 32 BC_Patria 33 BC_Elvira 34 Soissons 35 Valerius 36 Antonius 37 Bastide 38 Edison 39 Eurofit 40 Ludwig

21 0,00 0,67 0,60 0,61 0,33 0,53 0,60 0,73 0,67 0,63 0,60 0,60 0,76 0,65 0,54 0,81 0,61 0,63 0,76 0,56

23

0,00 0,63 0,71 0,78 0,80 0,49 0,71 0,68 0,78 0,62 0,38 0,64 0,79 0,92 0,66 0,79 0,83 0,85

22

0,00 0,69 0,52 0,73 0,84 0,72 0,63 0,83 0,72 0,69 0,56 0,59 0,91 0,73 0,78 0,76 0,68 0,66 0,86 0,00 0,50 0,74 0,48 0,71 0,75 0,53 0,74 0,48 0,64 0,67 0,64 0,88 0,67 0,54 0,79 0,81

24

0,00 0,62 0,56 0,74 0,64 0,72 0,58 0,58 0,83 0,59 0,57 0,75 0,61 0,62 0,77 0,60

25

0,00 0,78 0,91 0,69 0,60 0,76 0,83 0,88 0,76 0,64 0,72 0,64 0,77 0,83 0,59

26

0,00 0,60 0,82 0,60 0,65 0,63 0,58 0,79 0,64 0,84 0,73 0,64 0,86 0,74

27

0,00 0,89 0,65 0,76 0,57 0,36 0,78 0,77 0,87 0,66 0,79 0,72 0,74

28

0,00 0,76 0,61 0,68 0,72 0,61 0,62 0,58 0,83 0,63 0,63 0,70

29

0,00 0,62 0,63 0,50 0,65 0,70 0,87 0,77 0,74 0,68 0,72

30

0,00 0,70 0,70 0,78 0,59 0,61 0,79 0,73 0,62 0,77

31

0,00 0,68 0,68 0,61 0,89 0,77 0,66 0,68 0,64

32

0,00 0,73 0,74 0,77 0,74 0,69 0,70 0,79

33

Tablica 72. Matrica genetske udaljenosti (dij)na temelju mikrosatelitnih poÄ?etnica (nastavak).

0,00 0,64 0,69 0,82 0,67 0,76 0,62

34

0,00 0,57 0,51 0,34 0,54 0,42

35

0,00 0,70 0,50 0,67 0,78

36

0,00 0,57 0,69 0,70

37

0,00 0,56 0,54

38

0,00 0,54

39

0,00

40


11.5. Prilog 5 Tablica 73. Matrica genetske sliÄ?nosti (Sij) na temelju kombinacije AFLP poÄ?etnica

143


144

br. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Genotip U1 Osječka Crvenka Osječka 20 Slavonija Žitarka Srpanjka Demetra Super Žitarka Lucija Renata Aida Pipi Ilirija Felix Zlata Anðelka Mihaela Ružica Zlatna Dolina Golubica Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

1

1,00 0,53 0,54 0,58 0,71 0,37 0,52 0,55 0,54 0,50 0,36 0,64 0,55 0,42 0,53 0,42 0,51 0,42 0,68 0,60 0,54 0,68 0,65 0,39 0,44 0,45 0,55 0,58 0,52 0,67 0,61 0,63 0,60 0,53 0,51 0,47 0,64 0,54 0,62 0,57

2

1,00 0,36 0,54 0,60 0,49 0,43 0,44 0,58 0,54 0,33 0,47 0,50 0,51 0,48 0,36 0,54 0,55 0,57 0,50 0,53 0,59 0,54 0,43 0,37 0,44 0,48 0,47 0,44 0,65 0,53 0,58 0,43 0,54 0,48 0,62 0,49 0,55 0,44 0,53

3

1,00 0,64 0,56 0,24 0,38 0,67 0,47 0,41 0,20 0,64 0,45 0,34 0,35 0,36 0,32 0,45 0,49 0,53 0,44 0,60 0,43 0,45 0,41 0,46 0,41 0,39 0,43 0,42 0,55 0,50 0,45 0,40 0,37 0,36 0,43 0,38 0,46 0,42

4

1,00 0,63 0,49 0,62 0,70 0,60 0,51 0,35 0,71 0,60 0,45 0,60 0,46 0,30 0,63 0,66 0,78 0,66 0,68 0,57 0,58 0,55 0,47 0,57 0,59 0,51 0,67 0,72 0,60 0,55 0,47 0,52 0,45 0,54 0,56 0,57 0,53

5

1,00 0,42 0,57 0,78 0,59 0,63 0,37 0,59 0,62 0,57 0,59 0,50 0,53 0,53 0,67 0,62 0,63 0,82 0,61 0,46 0,45 0,55 0,63 0,56 0,55 0,71 0,63 0,66 0,60 0,55 0,58 0,51 0,59 0,68 0,56 0,63

6

1,00 0,49 0,36 0,67 0,59 0,49 0,37 0,44 0,58 0,62 0,55 0,48 0,60 0,38 0,50 0,58 0,45 0,50 0,53 0,53 0,50 0,46 0,44 0,40 0,45 0,52 0,45 0,31 0,45 0,42 0,42 0,46 0,45 0,45 0,52

7

1,00 0,50 0,53 0,56 0,60 0,48 0,48 0,53 0,81 0,66 0,45 0,44 0,71 0,60 0,60 0,58 0,62 0,56 0,65 0,45 0,69 0,59 0,53 0,59 0,62 0,57 0,53 0,47 0,50 0,45 0,57 0,58 0,57 0,60

8

1,00 0,45 0,53 0,31 0,67 0,53 0,52 0,47 0,47 0,38 0,55 0,55 0,61 0,53 0,81 0,50 0,47 0,46 0,59 0,53 0,49 0,53 0,55 0,65 0,60 0,47 0,50 0,65 0,38 0,52 0,64 0,56 0,59

9

1,00 0,61 0,49 0,46 0,60 0,57 0,59 0,54 0,44 0,52 0,53 0,64 0,65 0,60 0,59 0,54 0,55 0,50 0,56 0,57 0,49 0,60 0,60 0,63 0,43 0,48 0,47 0,50 0,59 0,48 0,51 0,62 1,00 0,48 0,45 0,55 0,71 0,57 0,67 0,57 0,63 0,54 0,59 0,59 0,63 0,63 0,68 0,55 0,53 0,64 0,61 0,40 0,60 0,49 0,51 0,47 0,55 0,53 0,48 0,56 0,50 0,48 0,70

10

Tablica 73. Matrica genetske sličnosti (Sij)na temelju kombinacije AFLP početnica

1,00 0,27 0,33 0,49 0,58 0,62 0,47 0,45 0,43 0,40 0,49 0,39 0,45 0,48 0,41 0,44 0,50 0,52 0,43 0,42 0,44 0,44 0,35 0,40 0,43 0,44 0,54 0,45 0,53 0,51

11

1,00 0,67 0,42 0,48 0,44 0,39 0,53 0,61 0,66 0,51 0,66 0,54 0,49 0,51 0,48 0,52 0,56 0,47 0,62 0,53 0,56 0,51 0,65 0,62 0,45 0,50 0,55 0,57 0,55

12

1,00 0,48 0,45 0,51 0,46 0,49 0,60 0,56 0,62 0,59 0,49 0,49 0,56 0,48 0,57 0,60 0,43 0,55 0,56 0,55 0,49 0,62 0,55 0,43 0,55 0,54 0,65 0,50

13

1,00 0,63 0,62 0,58 0,46 0,50 0,55 0,51 0,61 0,58 0,63 0,45 0,47 0,55 0,55 0,41 0,52 0,53 0,57 0,38 0,55 0,57 0,45 0,51 0,58 0,47 0,65

14

1,00 0,64 0,50 0,47 0,67 0,62 0,63 0,59 0,67 0,65 0,57 0,48 0,70 0,57 0,49 0,59 0,63 0,61 0,47 0,48 0,49 0,46 0,59 0,63 0,51 0,58

15

1,00 0,41 0,53 0,47 0,51 0,54 0,52 0,43 0,61 0,65 0,44 0,55 0,56 0,39 0,50 0,50 0,53 0,33 0,51 0,55 0,36 0,63 0,50 0,58 0,54

16

1,00 0,41 0,50 0,41 0,47 0,56 0,56 0,46 0,44 0,48 0,57 0,46 0,44 0,45 0,46 0,49 0,41 0,52 0,46 0,50 0,43 0,45 0,45 0,49

17

1,00 0,47 0,71 0,73 0,51 0,45 0,57 0,54 0,48 0,55 0,54 0,47 0,53 0,58 0,51 0,38 0,51 0,49 0,43 0,46 0,48 0,52 0,52

18

1,00 0,67 0,58 0,73 0,69 0,50 0,49 0,50 0,75 0,66 0,64 0,64 0,68 0,67 0,63 0,60 0,52 0,56 0,66 0,65 0,61 0,65

19

1,00 0,73 0,65 0,62 0,58 0,57 0,50 0,59 0,67 0,53 0,61 0,65 0,61 0,50 0,56 0,53 0,48 0,57 0,53 0,57 0,58

20


145

br. 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

Genotip Janica Barbara Katarina Alka Seka Lela Sana Adriana Divana Libelula Bezostaja BC_Patria BC_Elvira Soissons Valerius Antonius Bastide Edison Eurofit Ludwig

21 1,00 0,62 0,55 0,54 0,64 0,49 0,61 0,60 0,49 0,56 0,61 0,55 0,44 0,51 0,43 0,39 0,55 0,54 0,58 0,53

1,00 0,63 0,51 0,53 0,59 0,63 0,58 0,60 0,66 0,66 0,69 0,51 0,55 0,66 0,47 0,65 0,65 0,60 0,65

22

1,00 0,58 0,49 0,52 0,68 0,61 0,41 0,56 0,65 0,53 0,60 0,56 0,49 0,52 0,52 0,53 0,51 0,58

23

1,00 0,58 0,37 0,70 0,64 0,33 0,53 0,52 0,51 0,38 0,48 0,43 0,37 0,52 0,54 0,50 0,52

24

1,00 0,33 0,53 0,55 0,41 0,48 0,49 0,48 0,38 0,56 0,48 0,32 0,43 0,45 0,48 0,45

25

1,00 0,42 0,40 0,51 0,41 0,58 0,39 0,44 0,38 0,46 0,37 0,48 0,45 0,47 0,45

26

1,00 0,68 0,46 0,62 0,64 0,68 0,54 0,55 0,51 0,53 0,62 0,61 0,58 0,68

27

1,00 0,41 0,56 0,50 0,64 0,45 0,58 0,54 0,46 0,61 0,50 0,57 0,58

28

1,00 0,44 0,62 0,56 0,45 0,42 0,51 0,34 0,55 0,50 0,53 0,54

29

1,00 0,54 0,65 0,54 0,57 0,55 0,62 0,64 0,68 0,58 0,63

30

1,00 0,65 0,55 0,50 0,57 0,48 0,59 0,61 0,62 0,58

31

1,00 0,42 0,58 0,62 0,61 0,67 0,64 0,67 0,71

32

Tablica 73. Matrica genetske sliÄ?nosti (Sij)na temelju kombinacije AFLP poÄ?etnica (nastavak).

1,00 0,44 0,41 0,49 0,49 0,57 0,41 0,55

33

1,00 0,59 0,55 0,58 0,55 0,65 0,55

34

1,00 0,53 0,54 0,63 0,58 0,61

35

1,00 0,48 0,56 0,47 0,62

36

1,00 0,61 0,71 0,64

37

1,00 0,58 0,61

38

1,00 0,57

39

1,00

40


12. ŽIVOTOPIS Rođena sam 23. siječnja 1977. godine u Osijeku. Osnovnu školu završila sam 1991., a Prirodoslovnu matematičku gimnaziju 1995. godine u Osijeku. Godine 1999. upisujem Poljoprivredni fakultet u Osijeku, smjer ratarstvo. Diplomirala sam 05. svibnja 2005. godine. Od 01. travnja 2002. do 31. kolovoza 2005. zaposlena sam u tvrtki Agrigenetics d.o.o. u Osijeku kao suradnik. Godine 2004. pohađala sam metodološki tečaj iz biologije i medicine „DNA i RNA iz biljaka“ na Instutu Ruđer Bošković. Od 01. rujna 2005. do danas radim na Poljoprivrednom fakultetu kao asistent na predmetu Genetika na Katedri za genetiku, oplemenjivanje bilja i sjemenarstvo. Godine 2006. upisala sam interdisciplinarni doktorski studij "Molekularne bioznanosti". Suradnik sam na znanstvenom projektu Ministarstva znanosti obrazovanja i športa “Identifikacija germplazme pšenice SSR markerima” kojega je voditeljica prof.dr.sc. Sonja Marić te na bilateralnom projektu „Assessing genetic and phenotypic diversity in wheat breeding materials adapted to the environmental conditions of the Carpathian Basin“ sa Poljoprivrednim institutom iz Martonvàsàra (Agricultural Research Instutute Of The Hungarian Academy Of Science). Tijekom 2008. i 2009. godine bila sam suradnik na bilateralnom projektu „Microsatellite markers in wheat breeding“ sa Institute for Biotechnology in Plant Production, Department IFA-Tulln, University of Natural Resources and Applied Life Sciences Vienna u Austriji. U sklopu TEMPUS projekta od 04. siječnja do 09. veljače 2006. boravila sam na BOKU (University of Natural Resources and Applied Life Sciences, Vienna) Beč – Sveučilišni Odjel za poljoprivrednu biotehnologiju – Zavod za biljnu biotehnologiju. Tijekom boravka, bila sam uključena u rad Laboratorija za SSR markere. Od svibnja 2007. godine uključena sam u rad COST akcije FA0604 „TritiGen“, radna grupa 1. „Tools for Assessing, Harvesting and Applying Genetic Diversity“. Godine 2008. sam dobila stipendiju Nacionalne zaklade za znanost, visoko školstvo i tehnologijski razvoj Republike Hrvatske, u sklopu koje sam provela tri mjeseca (od 11. veljače do 11. svibnja 2008.) na Poljoprivrednom institutu (Agricultural Research Instutute Of The Hungarian Academy Of Science) u Martonvàsàru, Mađarska. Sudjelovala sam na nekoliko doma ćih i međunarodnih znanstvenih skupova agronoma, genetičara i prehrambenih tehnologa. Bila sam voditelj jednoga završnog rada. Kao autor i koautor objavila sam šest a1 i dva a2 rada. Član sam Hrvatskoga agronomskog društva i EUCARPIA-e. Udana sam i majka dvoje djece.

146


Doktorski rad Sonja Petrović