Page 1

Ο ΔΗΜΟΤΗΣ

ΑΠΟΨΕΙΣ Τα θετικά και τ’ αρνητικά του Δημοτικού Συμβουλίου Μαραθώνα

ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ

Η ΕΦΗΜΕΡΙΔΑ ΓΙΑ ΤΗΝ ΤΟΠΙΚΗ ΑΥΤΟΔΙΟΙΚΗΣΗ

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019 ΕΤΟΣ 21ο - ΑΡ. ΦΥΛΛΟΥ 953

Γράφει ο Γιάννης Κοντογεώργος

σελ. 2

Η ρύπανση του λιμανιού της Ραφήνας από τα πλοία και η ενδεδειγμένη λύση Γράφει ο Γιώργος Δουβίτσας

Δήμος Μαραθώνος: Ο αγώνας κατά του ΧΥΤΥ Γραμματικού συνεχίζεται… σελ. 3

σελ. 8

Η ΑΝ.Α.Σ.Σ.Α στο Δημοτικό Συμβούλιο του Δήμου ΣπάτωνΑρτέμιδος

σελ. 9

Επέκταση του δικτύου φυσικού αερίου σε Κάντζα και Άγιο Νικόλαο του Δήμου Παλλήνης

σελ. 11


Επικαιρότητα

2

Ο ΔΗΜΟΤΗΣ

ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ

ΙΔΙΟΚΤΗΣΙΑ: ΕΚΔΟΣΕΙΣ ΑΤΤΙΚΗΣ Μ.Ε.Π.Ε. ΕΚΔΟΤΗΣ: ΓΙΑΝΝΗΣ ΚΟΝΤΟΓΕΩΡΓΟΣ ΑΡΧΙΣΥΝΤΑΚΤΡΙΑ: ΒΙΡΓΙΝΙΑ ΜΑΡΚΟΥ ΣΧΕΔΙΑΣΜΟΣ - ΔΙΑΦΗΜΙΣΕΙΣ: ΓΙΑΝΝΗΣ ΚΟΝΤΟΓΕΩΡΓΟΣ ΥΠΕΥΘΥΝΟΣ ΔΙΑΝΟΜΗΣ: ΓΙΑΝΝΗΣ ΚΟΝΤΟΓΕΩΡΓΟΣ ΕΛΕΥΘΕΡΟ ΡΕΠΟΡΤΑΖ: ΔΗΜΗΤΡΗΣ ΠΝΕΥΜΑΤΙΚΑΤΟΣ ΕΚΤΥΠΩΣΗ NIKH ΕΚΔΟΤΙΚΗ Α.Ε. WEB DESIGNER: PROSPETTIVA SRL ΕΔΡΑ: NEA MAΚΡΗ ΔΗΜΟΥ ΜΑΡΑΘΩΝΟΣ

E-mail: info@dimotisnews.gr

Γράφει o Γιάννης Κοντογεώργος E-mail: kontogeorgos@dimotisnews.gr

Τα θετικά και τ’ αρνητικά του Δημοτικού Συμβουλίου Μαραθώνα

Σ

ημαντικό μέρος από τη συνεδρίαση του Δημοτικού Συμβουλίου Μαραθώνα που διεξήχθη την Τρίτη 22 Οκτωβρίου αναλώθηκε σε συζήτηση για τις πρόσφατες δραματικές εξελίξεις αναφορικά με την Ολοκληρωμένη Εγκατάσταση Διαχείρισης Απορριμμάτων (ΟΕΔΑ) Γραμματικού. Ο Δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας εμφανίστηκε αποφασισμένος να εξαντλήσει τα περιθώρια αντίστασης και αντίδρασης, ακολουθώντας κυρίως τη νομική οδό, αλλά υποδεικνύοντας και διαφορετικές μορφές κινητοποιήσεων, ενώ διαβεβαίωσε άπαντες πως, θα είναι μπροστάρης σε όλους τους αγώνες, αναλαμβάνοντας την ευθύνη για ό,τι και αν συμβεί. Αναφορικά με την απόφαση του Περιφερειακού Συμβουλίου για δοκιμαστική λειτουργία τους έργου, η οποία απόφαση και πυροδότησε εκ νέου την κατάσταση, ο κ. Στέργιος Τσίρκας δήλωσε ότι το περίμενε πως αργά ή γρήγορα θα γινόταν κάτι τέτοιο, καθώς πρόκειται για ένα σχεδόν έτοιμο έργο και ως εκ τούτου, κάποια στιγμή θα επιχειρείτο η λειτουργία του, έστω και δοκιμαστική. Οφείλουμε να πούμε ότι η Αντιπολίτευση του Δημοτικού Συμβουλίου Μαραθώνα στάθηκε σε γενικές γραμμές στο ύψος της περίστασης, εκφράζοντας τον προβληματισμό για τις εξελίξεις και καταθέτοντας προτάσεις για εμπλουτισμό των κινητοποιήσεων. Σε ήπιους τόνους, ο επικεφαλής της μείζονος αντιπολίτευσης κ. Σπύρος Λιβαθινός ανέφερε πως οι αγώνες των περασμένων ετών, ήταν η αιτία που έχει καθυστερήσει η λειτουργία του έργου και πως σε ό,τι τον αφορά έχει καταθέσει μηνύσεις και αγωγές, αποσκοπώντας και ο ίδιος, στην αναβολή όσο γίνεται, αν όχι στην οριστική διακοπή και αλλαγή της χωροθέτησης του έργου. Ο δήμαρχος κ. Στέργιος Τσίρκας έκανε αποδεκτές όλες τις προτάσεις που κατατέθηκαν, εξαιρουμένων όσων ακούστηκαν για «πιθανή παρεμπόδιση του

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Το κλίμα που επικράτησε στο Δημοτικό Συμβούλιο, αλλά και εν γένει στον Δήμο Μαραθώνος είναι αγωνιστικό… μαραθώνιου δρόμου» ή για «κλείσιμο των εισόδων του έργου με φορτηγά του δήμου» καθώς επίσης και για «εμπλοκή ανηλίκων μαθητών στις κινητοποιήσεις χωρίς την παρουσία γονέων και κηδεμόνων». Ένα διεθνές αγώνισμα όπως ο αυθεντικός μαραθώνιος δρόμος δεν αγγίζεται, τόνισε ο κ. Στέργιος Τσίρκας, ενώ ο Δήμος θα είναι ιδιαίτερα προσεχτικός, τόσο με τους εργαζόμενους, ούτως ώστε να μην έχουν μπλεξίματα με τη Δικαιοσύνη (σ.σ. μέχρι και 3 χρόνια

είναι η ποινή φυλάκισης αν κλείσουν οι είσοδοι) όσο και με τους ανήλικους χωρίς επιτήρηση (σ.σ. ποιος ξεχνά την κατάπτυστη τακτική του πρώην δήμαρχου Ηλία Ψηνάκη, ο οποίος έβαζε τους μαθητές μπροστά, με προφανή στόχο τη μεγαλύτερη προσωπική του προβολή από τα ΜΜΕ). Με υπευθυνότητα λοιπόν, σοβαρότητα, αλλά κι εφικτές ενέργειες που θα φέρουν τα επιθυμητά αποτελέσματα και όχι για παράδειγμα, αποτυχημένες απόπειρες συγκεντρώσεων μ’ ελάχι-

στη συμμετοχή, σκοπεύει να κινηθεί η νέα Δημοτική Αρχή, αντιμετωπίζοντας μία κατάσταση, η οποία… ωριμάζει εδώ και 15 χρόνια. Το κλίμα που επικράτησε στο Δημοτικό Συμβούλιο, αλλά κι εν γένει στον Δήμο Μαραθώνος είναι αγωνιστικό, με τους αρμόδιους να εμφανίζονται ανοιχτοί στις διαπραγματεύσεις και στην ουσιαστική αναζήτηση δίκαιης λύσης, χωρίς να… ταμπουρώνονται σε στείρα και ανώφελη άρνηση και απομόνωση, βάζοντας τους πάντες απέναντι και αντιμετωπίζοντάς τους μ’ εχθρική καχυποψία. Ένα πράγμα ωστόσο που θα θέλαμε ν΄ αναδειχθεί, είναι η ακατανόητη -για εμάς- άρνηση των επικεφαλής των Παρατάξεων της Αντιπολίτευσης κ.κ. Σπύρου Λιβαθινού και Νίκου Χατζηγιάννη, στις δημόσιες εκκλήσεις του δήμαρχου, όπως παραστούν στη συνάντηση με τον περιφερειάρχη, προκειμένου να καταδειχθεί ομοψυχία κι ενότητα από την πλευρά του Δήμου, ενάντια στη λειτουργία του ΧΥΤΑ. Τέλος, για να μη λέμε μόνο τα αρνητικά, θα ήθελα να επισημάνω την παραδειγματική στάση στο Δημοτικό Συμβούλιο, του κ. Στέλιου Γεραμάνη. Πρόκειται για έναν νέο στα δημοτικά πράγματα, σύμβουλο της αντιπολίτευσης (έχει εκλεγεί με τη ΣΥΜΜΑΧΙΑ του Σπύρου Λιβαθινού) ο οποίος δεν δείχνει να θεωρεί ότι ο ρόλος και η υποχρέωσή του απέναντι στην κοινωνία… εξαντλήθηκε με την εκλογή του. Αντιθέτως, έρχεται διαβασμένος κι ενημερωμένος στις συνεδριάσεις, προβαίνοντας σε παρατηρήσεις με περιεχόμενο, αλλά κι εύστοχες ερωτήσεις. Μέχρι στιγμής -ευχόμαστε και στη συνέχεια- ο κ. Στέλιος Γεραμάνης δείχνει τον δρόμο για μία νέα εποχή και για μία παραγωγική αντιπολίτευση, επ’ ωφελεία του Δήμου και των δημοτών, μακριά από ανούσιες και άγονες αντιπαραθέσεις.


Επικαιρότητα

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

3

Μαραθώνιες συνεδριάσεις και διαπραγματεύσεις για τον ΧΥΤΥ Γραμματικού

Σ

ε «κρίσιμο στάδιο» για την επίλυση του προβλήματος που ταλανίζει τα μέγιστα, την ευρύτερη περιοχή, για περισσότερο από 15 χρόνια, έχει εισέλθει ο Δήμος Μαραθώνος. Το ζήτημα της χωροθέτησης, κατασκευής και λειτουργίας της Ολοκληρωμένης Εγκατάστασης Διαχείρισης Απορριμμάτων (ΟΕΔΑ) Γραμματικού έχει τεθεί πλέον, σοβαρά επί τάπητος, με την Περιφερειακή Αρχή της Αττικής και τη Δημοτική Αρχή του Δήμου Μαραθώνος να μεταφέρουν τις προσπάθειες για επίλυση του προβλήματος, από τους δρόμους και τα «χαρακώματα» στο τραπέζι της ειλικρινούς, ουσιαστικής και καλοπροαίρετης συζήτησης και διαπραγμάτευσης. Την Τετάρτη 23 Οκτωβρίου πραγματοποιήθηκε στα γραφεία της Περιφέρειας, μετά από σχετική πρόσκληση του περιφερειάρχη Αττικής κ. Γιώργου Πατούλη, σύσκεψη μεταξύ των δύο ενδιαφερόμενων πλευρών, Περιφέρειας και Δήμου Μαραθώνος. Στην πολύωρη αυτή κι επί της ουσίας διαπραγμάτευση, όπως εξελίχθηκε, έλαβε μέρος αντιπροσωπεία του Δήμου Μαραθώνος μ’ επικεφαλής τον Δήμαρχο κ. Στέργιο Τσίρκα, καθώς και στελέχη της Περιφέρειας, παρουσία φυσικά, του ίδιου του περιφερειάρχη. Είχε προηγηθεί σειρά ενεργειών και δραστηριοτήτων που οδήγησαν στην εν λόγω συνάντηση, η οποία ουδέποτε είχε πραγματοποιηθεί στο παρελθόν, γεγονός που καταδεικνύει αν μη τι άλλο, την αδιαμφισβήτητη πρόθεση των δύο πλευρών, όπως βρεθεί λύση στο χρονίζον αυτό πρόβλημα.

Η υπόθεση «ΧΥΤΑ Γραμματικού» όπως είναι γνωστή, αναθερμάνθηκε με την απόφαση του Περιφερειακού Συμβουλίου (ΠΕ.ΣΥ.) για δοκιμαστική λειτουργία του έργου. Ακολούθησε ομοβροντία αντιδράσεων από τη Δημοτική Αρχή, Συλλόγους και Φορείς της περιοχής, αλλά και συντονισμένες ενέργειες, ήτοι: συνεδριάσεις, τόσο της Συντονιστικής Επιτροπής κατά του έργου, με πρόεδρο τον Δήμαρχο Μαραθώνος κ. Στέργιο Τσίρκα, όσο και του Δημοτικού Συμβουλίου, ενώ ελήφθησαν ομόφωνες αποφάσεις για κινητοποιήσεις και συνέχιση του δικαστικού αγώνα. Ο δήμαρχος Μαραθώνος εξέφρασε πολλάκις, τη δυσαρέσκειά του για τις εξελίξεις, αλλά και την αποφασιστικότητα για δικαίωση του λαού της περιοχής, που αντιδρά από την πρώτη στιγμή, στην επιλογή του χώρου, καταθέτοντας ατράνταχτες αποδείξεις για την ακαταλληλότητά του. Οι οριστικές αποφάσεις πάντως, μετά από όλες αυτές τις συζητήσεις και αντιπαραθέσεις, μετατίθενται για αρκετές εβδομάδες αργότερα, αφού κατά τη διάρκεια της πολύωρης σύσκεψης στην Περιφέρεια Αττικής, αποφασίστηκαν μεταξύ άλλων, τα εξής: σύσταση Ειδικής Επιτροπής από στελέχη της Περιφέρειας, του Δήμου Μαραθώνος, καθώς επίσης κι εκπροσώπους Συλλόγων και Φορέων προκειμένου ν’ αναλυθούν και διερευνηθούν σε βάθος, ενστάσεις και αποκλίσεις, σε αναζήτηση της λεγόμενης «χρυσής τομής». Επίσης, συμφωνήθηκε να επιδειχθεί ψυχραιμία και σύνεση, προς αποφυγήν ανώφελων εντάσεων κι επεισοδίων, ενώ δεν προβλέπεται να υπάρξουν «ανέντιμοι αιφνι-

διασμοί» από τη μία ή την άλλη πλευρά. Τέλος, να διευκρινιστεί ότι, παρά το γεγονός της συγκαταβατικής διάθεσης για πολιτισμένο διάλογο, η Διοίκηση του Δήμου Μαραθώνος επιμένει στη νομική οδό, αναμένοντας τις αποφάσεις των Δικαστηρίων από τις μηνύσεις που έχουν κατατεθεί. Στη σύσκεψη συμμετείχαν, εκτός από τον περιφερειάρχη Αττικής κ. Γιώργο Πατούλη και τον Δήμαρχο Μαραθώνος κ. Στέργιο Τσίρκα, οι: Ν. Πέππας - αντιπεριφερειάρχης Οικονομικών, Β. Κόκκαλης - αντιπεριφερειάρχης Πολιτικής Προστασίας, Γ. Σελίμης - εκτελεστικός Γραμματέας Περιφέρειας, Θ. Κατσιγιάνννης - εντεταλμένος περιφερειακός σύμβουλος, Ελευθέριος Ψαρουδάκης - στέλεχος Υπουργείου Ανάπτυξης αρμόδιος για χρηματοδοτούμενα έργα της Ε.Ε., Ελένη Βελγάκη - Διευθύντρια Αναπτυξιακών έργων Περιφέρειας, Αλέξανδρος Καλογερόπουλος - Διευθυντής Τεχνικών Έργων Περιφέρειας, ο επιστημονικός σύμβουλος της Περιφέρειας σε θέματα διαχείρισης απορριμμάτων Β. Μιχαλόπουλος, ο προϊστάμενος της Νομικής Υπηρεσίας Π. Δημητρόπουλος, ο προϊστάμενος της Διεύθυνσης Τεχνικών Έργων της Περιφέρειας Κ. Φλώρος, Θεοδώρα Αραμπατζή - προϊσταμένη τμήματος

υδραυλικών της Διεύθυνσης Τεχνικών έργων, Ευστράτιος Παγωτέλης - Διευθυντής Πάρκων και Αλσών της Περιφέρειας, Χρήστος Στάμος - Αντιδήμαρχος Δικτύων και Καθαριότητας, Κώστας Τσίρκας - Πρόεδρος Δημοτικού Συμβουλίου Μαραθώνος, Ευάγγελος Κυπαρίσσης - αντιδήμαρχος Μαραθώνος, Δήμητρα Λαπαρού - δημοτική σύμβουλος Μαραθώνος, Νικόλαος Στεφανίδης - δημοτικός σύμβουλος της παράταξης «Λαϊκή Συσπείρωση», Διονύσης Σοχωράκης - Αντιπρόεδρος Περιβαλλοντικού Συλλόγου Βαρνάβα, Δημήτρης Καζαζάκης - Πρόεδρος του Συλλόγου «Κέντρο Βιωσιμότητας και Περιβάλλοντος Β.Α. Αττικής, Ηλέκτρα Κούτρα - Δικηγόρος Ανθρωπίνων Δικαιωμάτων, Κωνσταντίνος Παπαδιγενόπουλος - Επικεφαλής κατοίκων Μαραθώνα, Νίκος Παπαστασινόπουλος - νομικός σύμβουλος Δήμαρχου Μαραθώνος, Κατερίνα Λιούτα - εκπρόσωπος ομάδας πολιτών «Εν δράσει», Αργυρώ Σαλιάρη - εκπρόσωπος του συλλόγου ΣΕΣΙ.

Δήμος Μαραθώνος: Ο αγώνας κατά του ΧΥΤΥ Γραμματικού συνεχίζεται…

O

Δήμος Μαραθώνος και προσωπικά ο Δήμαρχος κ. Στέργιος Τσίρκας, επανέρχεται με προγραμματισμένες ενέργειες για τη διαχείριση της κρίσεως αναφορικά με την ΟΕΔΑ Γραμματικού. Για το αμέσως επόμενο διάστημα, έχουν προγραμματιστεί τα εξής: 1. Νέα συνάντηση στην Περιφέρεια Αττικής, τη Δευτέρα 4/11 μεταξύ αντιπροσωπείας του Δήμου Μαραθώνος, μ’ επικεφαλής τον Δήμαρχο κ. Στέργιο Τσίρκα και υπηρεσιακών παραγόντων της Πε-

ριφέρειας Αττικής. 2. Σύσκεψη - ενημέρωση της Συντονιστικής Επιτροπής κατά του ΧΥΤΥ την Πέμπτη 31/10 στις 19.00 στην αίθουσα Δημοτικού Συμβουλίου (αφετηρία Μαραθωνίου δρόμου) υπό τον πρόεδρο της Επιτροπής κ. Στέργιο Τσίρκα. 3. Υλοποιώντας σχετικές αποφάσεις που ελήφθησαν στην προηγούμενη συνεδρίαση της Συντονιστικής Επιτροπής (18/10) και στο προηγούμενο Δημοτικό Συμβούλιο (22/10), η Νομική Υπηρεσία

του Δήμου Μαραθώνος προχωρά σε προσφυγή κατά της πρόσφατης απόφασης του Περιφερειακού Συμβουλίου για δοκιμαστική λειτουργία της ΟΕΔΑ ενώ παράλληλα, αποστέλλονται ενημερωτικά δελτία σε όλους τους Συλλόγους και Φορείς της περιοχής. «Ο αγώνας κατά της λειτουργίας του παράνομου έργου στο Γραμματικό συνεχίζεται αμείλικτος και σε όλα τα μέτωπα» δηλώνει ο δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας.


Επικαιρότητα

4

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Ανάσα για τον Δήμο Μαραθώνος η επιμήκυνση αποπληρωμής του δανείου για τον νέο στόλο οχημάτων καθαριότητας

Π

αραδόθηκε ο νέος στόλος οχημάτων στην Υπηρεσία Καθαριότητας του Δήμου Μαραθώνος. Πρόκειται για πέντε απορριμματοφόρα, ένα φορτηγό με γερανό και αρπάγη κι έναν τράκτορα, για τα οποία είχε υπογραφεί σύμβαση χρονομίσθωσης από την προηγούμενη Δημοτική Αρχή του Δήμου Μαραθώνος με την εταιρία Α. Καούσης Α.Ε. κι επαναδιαπραγματεύτηκε η σημερινή Διοίκηση του Δήμου. Από την πρώτη στιγμή ανάληψης των καθηκόντων του κι εφόσον ενημερώθηκε για την εν λόγω σύμβαση, ο Δήμαρχος κ. Στέργιος Τσίρκας ξεκίνησε αλληλογραφία και σκληρές διαπραγματεύσεις με την εταιρία Α. Καούσης Α.Ε. πιέζοντας για συμφερότερους όρους αποπληρωμής του δανείου, ενέργειες οι οποίες έφεραν το προσδοκώμενο αποτέλεσμα και ως εκ τούτου η σύμβαση χρονομίσθωσης για την αποπληρωμή του συνολικού συμβατικού ποσού (1.040.000,00 πλέον ΦΠΑ 24%) θα γίνει σε 8 έτη, αντί των 5 ετών που ήταν η αρχική, χωρίς καμία επιπλέον επιβάρυνση για τον Δήμο Μαραθώνος.

«Ο Δήμος Μαραθώνος παίρνει πραγματικά ανάσες σε πολύ δύσκολους οικονομικά καιρούς ύστερα από την επιτυχή αυτή επα-

ναδιαπραγμάτευση» δηλώνει ικανοποιημένος ο Δήμαρχος κ. Στέργιος Τσίρκας, απευθύνοντας παράλληλα, ευχαριστίες στους συνεργάτες του, αιρετούς και μη, οι οποίοι συνέβαλλαν στην επιτυχία της εν λόγω διαπραγμάτευσης.

Βάφτηκε και άλλαξε όψη το Δημαρχιακό Μέγαρο της Νέας Μάκρης

Ο

ι εργασίες βαφής και συντήρησης του δημαρχιακού μεγάρου στη Νέα Μάκρη ολοκληρώθηκαν, το κτίριο αλλά και ολόκληρο το οικοδομικό τετράγωνο άλλαξε όψη! Εργασίες, οι οποίες έγιναν μετά από πολλά χρόνια και ύστερα από χορηγία του Βρεφονηπιακού Σταθμού Νηπιαγωγείου «Ονειρόσκαλα» τον

οποίο ο Δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας ευχαριστεί θερμά. Ευχαριστήριο Ο Δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας εκφράζει τις θερμές ευχαριστίες του στον Βρεφονηπιακό Σταθμό - Νηπιαγωγείο «Ονειρό-

σκαλα» για την επαναβαφή και συντήρηση των εξωτερικών όψεων του δημαρχιακού μεγάρου της Νέας Μάκρης, καθώς και για την ευγενική προσφορά ενός ελαιόδεντρου. Η ευγενική αυτή προσφορά συνετέλεσε καθοριστικά στην αισθητική αναβάθμιση του κτιρίου και της περιοχής.

Στον Δήμο Μαραθώνος Υπηρεσία Καθαριότητας Ανακύκλωσης - Περιβάλλοντος ο Γενικός Γραμματέας - Πρασίνου Δήμου Μαραθώνος του Υπουργείου Εσωτερικών ΑΝΑΚΟΙΝΩΣΗ Αγαπητές δημότισσες, Αγαπητοί δημότες, Ο σκοπός προβολής καθαρισμού των χώρων στα μέσα κοινωνικής δικτύωσης από τα στερεά απόβλητα (στρώματα - καρέκλες - κλαδευτικά υπολείμματα - και οτιδήποτε άλλο έχει πεταχτεί κι έχει δημιουργήσει σε όλη την περιφέρεια του Δήμου μας, ανεξέλεγκτες χωματερές) δεν έχει να κάνει και να θεωρηθεί ως μέγιστο επίτευγμα της νέας Διοίκησης του Δήμου. Έχει να κάνει όμως, με την προσπάθεια που καταβάλλει η Υπηρεσία Καθαριότητας με τα πενιχρά μηχανολογικά μέσα που διαθέτει, να δημιουργήσει ένα καθαρό περιβάλλον μετά από 5 χρόνια εγκατάλειψης. Όπως όμως, οι δημότες έχουν δικαιώματα ανταποδοτικών παροχών από τα τέλη που καταβάλλουν στον Δήμο, έχουν και υποχρεώσεις. Ανταποδοτικού χαρακτήρα υποχρεώσεις του Δήμου είναι η καθαριότητα - ύδρευση - φωτισμός.

Η ανεξέλεγκτη απόρριψη διαφόρων αντικειμένων που πιο πάνω αναφέραμε, δεν είναι στις ανταποδοτικές παροχές και απαγορεύεται ρητά από τον Κανονισμό Καθαριότητας. Η καθαριότητα είναι καθήκον και υποχρέωση όλων μας, για αυτό φροντίζουμε να μην πετάμε δίπλα στους κάδους οικιακών απορριμμάτων και ανακύκλωσης οτιδήποτε άλλο ή σε άλλους κοινόχρηστους χώρους ή σε εγκαταλειμμένα οικόπεδα, δημιουργώντας εστίες μόλυνσης. Ο Κανονισμός Καθαριότητας προβλέπει την περισυλλογή των κλαδευτικών υπολειμμάτων - άχρηστων αντικειμένων (εκτός μπαζών) κατόπιν ειδοποίησης της Υπηρεσίας Καθαριότητας στα τηλέφωνα: 2294320538-548 και μετά την αυτοψία από τον αρμόδιο επόπτη, καθορίζεται η ημερομηνία αποκομιδής στα πλαίσια των δυνατοτήτων της Υπηρεσίας. Η αυθαίρετη απόρριψη σημαίνει επιβολή προστίμου. Για έναν καθαρό δήμο χρειάζεται η προσπάθεια και η συμβολή όλων μας για να διατηρήσουμε το Περιβάλλον καθαρό και να το απολαμβάνουμε.

Η

στενή, παραγωγική συνεργασία μεταξύ της ηγεσίας του Υπουργείου Εσωτερικών και του Δήμου Μαραθώνος, συνεχίζεται, με τον γενικό γραμματέα του Υπουργείου κ. Μιχάλη Σταυριανουδάκη να περνά αρκετές ώρες (την Παρασκευή 25/10) στο δημαρχιακό μέγαρο της Νέας Μάκρης. Μετά τις επανειλημμένες επισκέψεις του Δήμαρχου Μαραθώνος κ. Στέργιου Τσίρκα στο Υπουργείο Εσωτερικών και τις επαφές με τον υπουργό κ. Τάκη Θεοδωρικάκο, η επίσκεψη του γενικού γραμματέα στον Δήμο Μαραθώνος επιβεβαιώνει την αξιοσημείωτη δουλειά που έχει ξεκινήσει, αναφορικά με την πληρέστερη ενημέρωση για ζητήματα του Δήμου, αλλά και το ενδιαφέρον του αρμόδιου Υπουργείου προκειμένου για την επίλυσή τους.


ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Επικαιρότητα Μαραθώνας, 29-10-2019

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΑΤΤΙΚΗΣ ΔΗΜΟΣ ΜΑΡΑΘΩΝΟΣ ΣΧΟΛΙΚΗ ΕΠΙΤΡΟΠΗ ΔΕΥΤΕΡΟΒΑΘΜΙΑΣ ΕΚΠΑΙΔΕΥΣΗΣ ΔΗΜΟΥ ΜΑΡΑΘΩΝΟΣ Τηλ.: 2294067773 & 2294067774 E-mail: bschoolmarathon@gmail.com ΠΡΟΚΗΡΥΞΗ Δημόσιου πλειοδοτικού διαγωνισμού μίσθωσης κυλικείου 2ου Λυκείου Νέας Μάκρης Ο Πρόεδρος της Σχολικής Επιτροπής Δευτεροβάθμιας Εκπαίδευσης Δήμου Μαραθώνος: Προκηρύσσει Δημόσιο πλειοδοτικό διαγωνισμό με σφραγισμένες προσφορές για την ανάδειξη πλειοδότη μίσθωσης του κυλικείου του 2ου Λυκείου Νέας Μάκρης. Τόπος και χρόνος του διαγωνισμού: Η κατάθεση των προσφορών θα γίνεται στο γραφείο του Διευθυντή του 2ου Λυκείου Νέας Μάκρης τη Δευτέρα 2 Δεκεμβρίου 2019 και ώρες από 09.00π.μ. έως 13.00μ.μ.. Τα δικαιολογητικά θα υποβάλλονται στην αρμόδια για τη διενέργεια του διαγωνισμού Επιτροπή μέσω του Διευθυντή του σχολείου και θα πρωτοκολλούνται στο πρωτόκολλο της Σχολικής Επιτροπής. Η διαδικασία αποσφράγισης των προσφορών θα λάβει χώρα την Τετάρτη 4 Δεκεμβρίου 2019 και ώρα 10.00π.μ. στην έδρα της Σχολικής Επιτροπής Δευτεροβάθμιας Εκπαίδευσης και Γραμματεία της Σχολικής Επιτροπής Γυάλινο Κτίριο, Αφετηρία Μαραθωνίου Δρόμου. Δικαίωμα συμμετοχής έχουν: α) Φυσικά πρόσωπα καθώς και δημοτικά ή κοινοτικά νομικά πρόσωπα. β) Πολίτες των κρατών - μελών της Ευρωπαϊκής Ένωσης, γνώστες της Ελληνικής γλώσσας. Δε γίνονται δεκτοί στο διαγωνισμό: α) Όσοι απασχολούνται στο δημόσιο ή σε Ν.Π.Δ.Δ. με οποιαδήποτε εργασιακή σχέση. β) Συνταξιούχοι. γ) Όσοι έχουν κώλυμα διορισμού στο Δημόσιο σύμφωνα με τα άρθρα 4, (παρ. 1, 2, 3 και 4), 5, 7, 8 και 9 του ν. 3528/2007 Φ.Ε.Κ. 26 τ.Α΄/9.2.07. δ) Όσοι είναι ανάδοχοι εκμετάλλευσης άλλου κυλικείου Δημόσιου ή Ιδιωτικού Σχολείου. Δικαιολογητικά συμμετοχής: α) Έγγραφη αίτηση με πλήρη στοιχεία του διαγωνιζομένου. β) Έγγραφη οικονομική προσφορά για το κατά μαθητή ποσό, η οποία θα τοποθετείται σε ξεχωριστό από τα άλλα δικαιολογητικά κλειστό αδιαφανή φάκελο, καθαρογραμμένη χωρίς ξέσματα, σβησίματα, προσθήκες, διορθώσεις. Το ελάχιστο ποσό προσφοράς από τους ενδιαφερόμενους ορίζεται στα 4 ευρώ ανά μαθητή ετησίως, 189 εργάσιμες ημέρες και θα αποτελεί ποσό εκκίνησης κατά τη διαδικασία του σχετικού διαγωνισμού. γ) Πιστοποιητικό προϋπηρεσίας σε εκμίσθωση σχολικού κυλικείου από την αντίστοιχη σχολική επιτροπή. δ) Πιστοποιητικό πολυτεκνίας από τον αρμόδιο φορέα. ε) Πιστοποιητικό φορολογικής ενημερότητας. στ) Πιστοποιητικό Εισαγγελίας ότι δεν είναι φυγόποινος ή φυγόδικος. ζ) Πιστοποιητικό Ποινικού Μητρώου. η) Ποσό εγγύησης τριακοσίων Ευρώ (300,00) ή αντίστοιχη εγγυητική επιστολή. Η εγγύηση αυτή επιστρέφεται στους ενδιαφερόμενους υποψήφιους μετά την κατακύρωση του διαγωνισμού εκτός του υποψηφίου, στον οποίο κατακυρώθηκε η παραχώρηση του κυλικείου, ο οποίος πρέπει να καταβάλει συμπληρωματικά αντίστοιχο ποσό ή εγγυητική επιστολή που να καλύπτει συνολικά το 20% του ετήσιου μισθώματος ως εγγύηση καλής εκτέλεσης της σύμβασης. Το ποσό αυτό ή η εγγυητική επιστολή παρακρατείται καθόλη τη διάρκεια της σύμβασης και επιστρέφεται μετά τη λήξη της άτοκα, πλην της περιπτώσεως καταγγελίας ή προώρου λήξης της σύμβασης, οπότε καταπίπτει υπέρ της Σχολικής Επιτροπής. θ) Υπεύθυνη δήλωση του ν. 1599/1986 ότι δεν είναι ανάδοχος εκμετάλλευσης άλλου Κυλικείου δημόσιου ή ιδιωτικού σχολείου ι) πιστοποιητικό δημόσιας αρχής από το οποίο να προκύπτει η ιδιότητα γονέα μονογονεϊκής οικογένειας ια) πιστοποιητικό του ΕΦΕΤ ιβ) Πιστοποιητικό περί μη οφειλής στον Δήμο Μαραθώνα Για τη συμμετοχή των δημοτικών ή νομικών προσώπων απαιτούνται όλα τα ανωτέρω δικαιολογητικά εκτός του πιστοποιητικού Εισαγγελίας, της υπεύθυνης δήλωσης του ν. 1599/1986 και του αποσπάσματος ποινικού μητρώου. Απαιτείται, όμως, επιπλέον αποδεικτικό έγγραφο του εξουσιοδοτουμένου να συμμετάσχει στο διαγωνισμό ατόμου. Τα δημοτικά πρόσωπα που συμμετέχουν πρέπει να έχουν τη δυνατότητα λειτουργίας σχολικών κυλικείων εκ του καταστατικού τους. Προς κάθε ενδιαφερόμενο: Το πλήρες κείμενο της παρούσας προκήρυξης, έχει αναρτηθεί στη ΔΙΑΥΓΕΙΑ (ΑΔΑ ΩΞΝΤ465ΘΕΕΣΤΝ), ενώ αντίγραφα των σχετικών με το διαγωνισμό ΦΕΚ διατίθενται σε κάθε ενδιαφερόμενο από τη Γραμματεία της Σχολικής Επιτροπής Δευτεροβάθμιας από Δευτέρα έως Παρασκευή και ώρες 09.00π.μ. με 13.00μ.μ., Αφετηρία Μαραθωνίου Δρόμου, Γυάλινο κτίριο, Μαραθώνας. Ο Πρόεδρος της Σχολικής Επιτροπής Δευτεροβάθμιας Εκπαίδευσης Δήμου Μαραθώνος Νικηφόρος Μπατζές

5

Σε πρώτο πλάνο η Παιδεία στον Δήμο Μαραθώνος Τ

ην εταιρεία Κτιριακές Υποδομές ΑΕ (ΚτΥπ ΑΕ) επισκέφτηκε την Παρασκευή 11 Οκτωβρίου αντιπροσωπεία του Δήμου Μαραθώνος, μ’ επικεφαλής τον Δήμαρχο κ. Στέργιο Τσίρκα, ο οποίος έχει δείξει από την πρώτη στιγμή, την ευαισθησία του στα θέματα που αφορούν τη μαθητική κοινότητα και τα οποία αντιμετωπίζει μ’ έμφαση και κατά προτεραιότητα. Ο κ. Στέργιος Τσίρκας συνοδευόμενος από τον αντιδήμαρχο Παιδείας κ. Αργύρη Λάσκο, το μέλος της Δ.Ε.Π. και της Δευτεροβάθμιας Επιτροπής Παιδείας κα Ξένια Μπρισίμη και την μηχανικό του δήμου κα Φωτείνη Αφέντρα, είχαν συνάντηση με τον διευθύνοντα σύμβουλο κ. Ιωάννη Χαρωνίτη, στην συνάντηση παραβρέθηκαν και υπηρεσιακοί παράγοντες της ΚτΥπ ΑΕ., ο οποίος άκουσε με προσοχή τα ζητήματα που ετέθησαν, ανταποκρινόμενος με θετικότητα και δεσμευόμενος για άμεσες λύσεις. Συγκεκριμένα: α) Αναφορικά με το, υπό κατεδάφιση, 1ο Δημοτικό Σχολείο Νέας Μάκρης, ο κ. Χαρωνίτης υποσχέθηκε ότι θα ξεκινήσουν άμεσα οι διαδικασίες έτσι ώστε να συμπληρωθούν οι κτιριακές ανάγκες του σχολείου, με το πέρας της κατεδάφισης της υπάρχουσας κατασκευής. Β) Εξασφαλίστηκε δέσμευση για εξοπλισμό, τόσο του

2ου Λυκείου Νέας Μάκρης όσο και του 4ου Νηπιαγωγείου Νέας Μάκρης στην Ε’ Κατασκήνωση του Αγίου Ανδρέα, που πρόκειται να παραδοθεί το επόμενο διάστημα. Γ) Στο επόμενο διάστημα θα ξεκινήσουν οι διαδικασίες για τη δημοπράτηση του Νηπιαγωγείου Ανατολής, στην περιοχή του Ερυθρού. Δ) Δόθηκε η διαβεβαίωση ότι έχει τακτοποιηθεί το πρόβλημα που έχει προκύψει με τις τουαλέτες του 1ου Γυμνασίου Νέας Μάκρης. H Δημοτική Αρχή του Δήμου Μαραθώνος έχει ήδη δρομολογήσει τις απαραίτητες ενέργειες: α) για μόνιμη λύση στο χρονίζων θέμα του Νηπιαγωγείου Γραμματικού, πολύ σύντομα θα υπάρξουν και οι σχετικές ανακοινώσεις και β) για την ίδρυση δύο νέων Βρεφονηπιακών Σταθμών, σε Μαραθώνα και Νέα Μάκρη.

Σημαντική ευρωπαϊκή δράση από το Δημοτικό Σχολείο Αγίας Μαρίνας Νέας Μάκρης

Μ

ία πολύ σημαντική δράση έλαβε χώρα την εβδομάδα 2125 Οκτωβρίου στο Δημοτικό Σχολείο Αγίας Μαρίνας στη Δημοτική Ενότητα (Δ.Ε.) Νέας Μάκρης στα πλαίσια του Ευρωπαϊκού Προγράμματος Erasmus magical math 6 stations 60 materials, όπου συμμετείχαν 6 χώρες: Ελλάδα, Κύπρος, Βόρεια Ιρλανδία, Ισπανία, Τουρκία και Δημοκρατία της Βόρειας Μακεδονίας. 17 εκπαιδευτικοί από τις ως άνω, ξένες χώρες, παρακολούθησαν πρότυπους, καινοτόμους, αλλά και παιγνιώδεις τρόπους διδασκαλίας των Μαθηματικών από τους Έλληνες συναδέλφους τους, ενώ οι πρωτοποριακοί κι ευχάριστοι αυτοί τρόποι διδασκαλίας, κρίθηκαν και αξιολογήθηκαν. Παράλληλα, οι ξένοι επισκέπτες γνώρισαν κάποιες από τις ομορφιές και τα αξιοθέατα του Δήμου Μαραθώνος και όχι μόνο, όπως είναι: το φράγμα της λίμνης του Μαραθώνα, το Μουσείο Προβολής Μαραθωνίου Δρόμου, το Ίδρυμα Σταύρος Νιάρχος, τον ναό του Ποσειδώνα στο Σούνιο, την Ακρόπολη κ.α. και φυσικά, γεύτηκαν ελληνικές νοστιμιές σε ταβέρνες της περιοχής. Την Πέμπτη 24 Οκτωβρίου συναντήθηκαν με τον Δήμαρχο Μαραθώνος κ. Στέργιο Τσίρκα, όπου σε μια λιτή τελετή έγινε ανταλλαγή αναμνηστικών δώρων. Την έναρξη των εβδομαδιαίων εργασιών κήρυξε το Δημοτικό Σχολείο Αγίας Μαρίνας και ο διευθυντής του σχολείου κ. Κωνσταντίνος Πατούρης τη Δευτέρα 21 Οκτωβρίου σ’ εκδήλωση στον χώρο του γηπέδου μπάσκετ, με τις οικογένειες από τον Σύλλογο Γονέων και Κηδεμόνων του Σχολείου να δεξιώνονται στο τέλος, τους καλεσμένους, με παραδοσιακά χειροποίητα εδέσματα, ενώ αξίζει να σημειωθεί ότι η προσφορά του Συλλόγου ήταν καθημερινή, με δεκατιανά γεύματα για τους επισκέπτες. Χαιρετισμό στις εργασίες, καλωσόρισμα στους φιλοξενούμενους εκπαιδευτικούς, αλλά και πολλά συγχαρητήρια προς τους διοργανωτές και τον διευθυντή του Σχολείου, απηύθυνε ο Δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας, κατά τη διάρκεια της εναρκτήριας εκδήλωσης.


6

Επικαιρότητα

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Το Έπος του ‘40 τιμήθηκε στον Μαραθώνα

Μ

εγάλη επιτυχία γνώρισε η γιορτή μνήμης για το Έπος του ‘40 και την προσφορά των ηρωίδων γυναικών της Hπείρου, που διοργάνωσε -με την ευκαιρία της Εθνικής Επετείου της 28ης Οκτωβρίου- ο Δήμος Μαραθώνος σε συνεργασία με την Αδελφότητα Ηπειρωτών Νέας Μάκρης - Ραφήνας - Μαραθώνα - Πικερμίου «Η Αγία Ειρήνη» και το Ωδείο Μαραθώνα «Δώρα Ρούση». Στην κατάμεστη αίθουσα προβολής του Μουσείου Μαραθωνίου Δρόμου, οι παρευρισκόμενοι έζησαν μια πραγματική μυσταγωγία αλτρουισμού και προσφοράς των άδολων αγωνιστών του Έπους του ‘40 και της ανυπέρβλητης προσφοράς της Ηπειρώτισσας μάνας, συζύγου και αδελφής, που έδωσε και την τελευταία ικμάδα της θέλησης και αντοχής της στον αγώνα. Την εκδήλωση άνοιξε με χαιρετισμό του ο Δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας, ο οποίος τόνισε μεταξύ άλλων: «Σήμερα γιορτάζουμε τη νίκη του Εθνους μας απέναντι στον φασισμό. Το Έπος του '40 μας δίδαξε ότι ενωμένοι είμαστε νικητές. Έτσι και σήμερα που ο Δήμος μας περνά μια δύσκολη στιγμή, σήμερα που ετοιμάζεται ένα οικολογικό έγκλημα εις βάρος μας, όλοι μαζί ενωμένοι, είμαι σίγουρος ότι θα είμαστε νικητές!». Στην συνέχεια, το λόγο πήρε ο αντιδήμαρχος Πολιτισμού & Αθλητισμού κ. Ευάγγελος Κυπαρίσσης και αφού ευχαρίστησε όλους όσους εργάστηκαν εθελοντικά για τη διεξαγωγή της εκδήλωσης, ανέφερε τα εξής: «To ΕΠΟΣ του ‘40 είναι ο αγώνας του στρατού και του λαού μας, ο αγώνας των εθελοντών “Γυναικών της Ηπείρου” για να μην ηττηθεί και υποταχθεί η Ελλάδα στον Ιταλό κατακτητή. Ήταν μια πράξη συνειδητή, ήταν αναγκαιότητα Ελληνική, πηγάζουσα από την πίστη μας στην Ελευθερία και στη Δημοκρατία. Το μήνυμά της παραμένει πάντα επίκαιρο ιδιαίτερα στους δύσκολους καιρούς που διανύει η πατρίδα μας». Ο πρόεδρος της Αδελφότητας Ηπειρωτών κ. Δημήτρης Βασιλείου στον σύντομο χαιρετισμό του, σημείωσε ότι: «Η προσφορά των γυναικών της Ηπείρου αποτελεί λαμπρό παράδειγμα θάρρους και αυταπάρνησης για τους σύγχρονους Έλληνες». Ακολούθησε η κεντρική ομιλία της εκδήλωσης με θέμα «Το Έπος του ‘40 και η προσφορά της Γυναίκας της Ηπείρου» από τον κ. Δημήτρη Κάλλο, μέλος της Αδελφότητας Ηπειρωτών. Την εκδήλωση «έντυσε» μουσικά η Soprano Δώρα Ρούση και η Παιδική Χορωδία του Ωδείου Μαραθώνα, ενώ η αφήγηση του λαογράφου κ. Στέλιου Πλακίτση με τίτλο «Το πρωινό της 28ης Οκτωβρίου 1940 στον Μαραθώνα» ήταν ιδιαίτερα συγκινητική. Την καλλιτεχνική επιμέλεια της εκδήλωσης είχε

ο κ. Γιάννης Χαμαλτζής, την ηχητική ο κ. Γιάννης Θεοδωρακόπουλος και την παρουσίαση της εκδήλωσης έκανε η θεατρολόγος κ. Τζένη Σακοράφα. Την εκδήλωση τίμησαν με την παρουσία τους: ο

ΓΕΝΙΚΟ ΣΥΝΕΡΓΕΙΟ ΑΥΤΟΚΙΝΗΤΩΝ

www.autoservice-karachalios.gr

βουλευτής κ. Βασίλης Οικονόμου, ο αντιπεριφερειάρχης κ. Νίκος Πέππας, οι περιφερειακοί σύμβουλοι κ. Θανάσης Κατσιγιάννης και κα Ζωή Στεφανίδη, ο πρόεδρος του Δημοτικού Συμβουλίου Μαραθώνα κ. Κωνσταντίνος Τσίρκας, ο αντιδή-

Σε εμάς θα βρείτε μεγάλη γκάμα ανταλλακτικών ΤΟΥΟΤΑ YARIS - AYGO - COROLA - AURIS

Service

Αλλαγή λαδιών

μαρχος κ. Αργύρης Λάσκος, ο πρόεδρος της Τουριστικής Επιτροπής κ. Δημήτρης Παπαϊωάννου, ο πρόεδρος της ΚΕΔΜΑ κ. Μανώλης Γεωργάτος, οι δημοτικοί σύμβουλοι κ.κ. Δημήτρης Μακρής, Στέλιος Γεραμάνης, Βασίλης Αλικιώτης και η κα Ελένη Ανδρώνη, ο Πρόεδρος της Κοινότητας Νέας Μάκρης κ. Κωνσταντίνος Κουλούκουσας. και οι τοπικοί σύμβουλοι κ.κ. Γιώργος Πάντος, Σπύρος Ζαγάρης, Κωνσταντίνος Καβαρνός και η κα Αγγελική Ράικου. Κι επειδή η εκδήλωση είχε καθαρό Ηπειρώτικο χρώμα, δεν μπορούσαν ν’ απουσιάζουν, η Ηπειρώτικη μουσική παράδοση, το δρώμενο με την τριχιά και τον ρόλο της και οι Ηπειρώτικοι παραδοσιακοί χοροί από το τμήμα ενηλίκων της Αδελφότητας Ηπειρωτών. Μετά το τέλος της παρουσίασης των χορευτικών χόρεψαν και οι παρευρισκόμενοι, ενώ προσφέρθηκαν, ηπειρώτικο τσίπουρο, κρασί, παραδοσιακά εδέσματα και πίτες, που έφτιαξαν οι γυναίκες, μέλη της Αδελφότητας Ηπειρωτών.

Ανταλλακτικά

Έλεγχος ΚΤΕΟ

Φρέον Α/C

Λεωφ. Μαραθώνος 108, Νέα Μάκρη (34ο χλμ.) Τηλ.: 22940 97863 - E-mail: autoservicekarachalios@gmail.com


ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Επικαιρότητα

7

Ο Δήμαρχος Μαραθώνος στη συνέντευξη Τύπου για τον 37ο Αυθεντικό Μαραθώνιο Σ

την τελική ευθεία για τον 37ο Αυθεντικό Μαραθώνιο της Αθήνας, ο οποίος θα διεξαχθεί το διήμερο 9-10 Νοεμβρίου 2019 πραγματοποιήθηκε την Πέμπτη 10 Οκτωβρίου σε κεντρικό ξενοδοχείο της Αθήνας, η καθιερωμένη συνέντευξη Τύπου, όπου το παρόν έδωσαν: ο ΣΕΓΑΣ, θεσμικοί φορείς και συνδιοργανωτές, αλλά και ο μεγάλος χορηγός (ΟΠΑΠ ΑΕ). Παρών στη συνέντευξη και ο Δήμαρχος Μαραθώνος κ. Στέργιος Τσίρκας, ο οποίος επεσήμανε την επιτακτική ανάγκη διεξαγωγής έργων στην αφετηρία για τη φιλοξενία μεγαλύτερου αριθμού δρομέων. Στο ίδιο πνεύμα με τον Δήμαρχο Μαραθώνος και οι περισσότεροι ομιλητές, οι οποίοι αναφέρθηκαν στη μεγάλη σημασία του Μαραθωνίου για τη χώρα μας, εκφράζοντας την ανάγκη στήριξης του αγώνα, όπου φέτος θα συμμετάσχουν 60.000 δρομείς από την Ελλάδα και το εξωτερικό. Συγκεκριμένα, ο Δήμαρχος Μαραθώνος Στέργιος Τσίρκας, ανέφερε: «Είναι τιμή και χαρά για εμάς που για μία ακόμα φορά φιλοξενούμε την εκκίνηση του Μαραθωνίου δρόμου. Μία τόσο μεγάλη διοργάνωση που υπερβαίνει την έννοια ενός απλού αθλητικού γεγονότος. Η παγκόσμια εμβέλεια του μαραθωνίου δρόμου είναι κορυφαίο γεγονός για το δήμο μας. Για πρώτη φορά, όπως είπε και ο πρόεδρος του ΣΕΓΑΣ, στην ιστορία του μαραθώνιου δρόμου οι εκδηλώσεις θα είναι διήμερες, λόγω του ότι υπάρχει μεγάλη συμμετοχή αγωνιζομένων. Καθίσταται επιτακτική ανάγκη για έργα ανάπλασης με στόχο τη διάπλαση της αφετηρίας του μαραθωνίου δρόμου. Για το τόσο σημαντικό αυτό έργο έχουμε προτάσεις, στις οποίες χρειαζόμαστε τη βοήθεια της πολιτείας και της περιφέρειας που είμαστε σίγουροι πως θα την έχουμε. Πάνω σε αυτό εργαζόμαστε ώστε στο προσεχές μέλλον να είμαστε σε θέση να φιλοξενούμε μεγαλύτερο αριθμό αθλητών. Τα οφέλη είναι προφανή όχι μόνο για το δήμο μας και τον αγώνα, αλλά για όλη την Ελλάδα. Γιατί ο Αυθεντικός Μαραθώνιος είναι ο μαραθώνιος της Ελλάδος. Ο μαραθώνιος που δεν κάνει περήφανους μόνο εμάς τους κατοίκους του Μαραθώνα, αλλά πιστεύω και όλης της χώρας». Στη συνέντευξη Τύπου παραβρέθηκαν μεταξύ άλλων: ο υφυπουργός Πολιτισμού & Αθλητισμού Λευτέρης Αυγενάκης, ο περιφερειάρχης Αττικής Γιώργος Πατούλης, εκ μέρους του Δήμου της Αθήνας η πρόεδρος του ΟΠΑΝΔΑ Άννα Ροκοφύλλου, ο πρόεδρος της Ελληνικής Ολυμπιακής Επιτροπής και μέλος της Διεθνούς Ολυμπιακής Επιτροπής Σπύρος Καπράλος, ενώ τον βασικό χορηγό του αγώνα, ΟΠΑΠ ΑΕ, εκπροσώπησε ο διευθυντής μάρκετινγκ και επικοινωνίας, Γιάννης Ρόκας. Μίλησαν επίσης, ο πρόεδρος του ΣΕΓΑΣ Κώστας Παναγόπουλος, καθώς και ο πρόεδρος της Οργανωτικής Επιτροπής του ΑΜΑ και γενικός γραμματέας του ΣΕΓΑΣ Βασίλης Σεβαστής.

«Η διοργάνωση του Μαραθώνιου αποτελεί πρότυπο για το πώς μπορεί να αναπτυχθεί ο αθλητικός τουρισμός και για το πώς ο αθλητισμός αποτελεί μια ισχυρή βιομηχανία που έχει εξαιρετική δυναμική για την οικονομία, τον τουρισμό και την ανάπτυξη. Και αυτό σε

ένα πλαίσιο μακριά από τη λογική του κρατικοδίαιτου μοντέλου. Η Κυβέρνηση αντιμετωπίζει τον αθλητικό τουρισμό ως προϊόν υψηλής προστιθέμενης αξίας. Η στήριξη της επιχειρηματικότητας στον τομέα αυτό σε συνδυασμό με την ανάπτυξη και συντήρηση των αθλητικών υποδομών είναι αναγκαία. Πιστεύουμε ότι η Ελλάδα μπορεί να μεγιστοποιήσει τα έσοδα από τις επενδύσεις στα αθλητικά γεγονότα και να ενισχύσει την ανάπτυξη. Και προς την κατεύθυνση αυτή εργαζόμαστε» τόνισε μεταξύ άλλων στην ομιλία του ο κ. Λευτέρης Αυγενάκης. Ο κ. Κώστας Παναγόπουλος έκανε αναφορά στα πράγματα που θα είναι διαφορετικά σε σχέση με άλλες χρονιές, αφού, όπως είπε, φέτος η αγωνιστική διάρκειά του θα είναι δύο ημέρες (το Σάββατο 9 του μήνα θα γίνει ο αγώνας 10.000μ), η έκθεση EXPO θα ξεκινήσει μία ημέρα νωρίτερα, ενώ και οι δρομείς θα είναι κατά 5.000 περισσότεροι, αφού από 55.000 θα ανέλθουν φέτος στους 60.000. Το διαφορετικό, τόνισε φέτος, θα είναι μόνο τα μετάλλια των αγώνων, για τα οποία σύντομα θα γίνει η επίσημη παρουσίασή τους. Υπογράμμισε ότι απαιτείται η διεξαγωγή έργων στην αφετηρία στο Μαραθώνα (να μεγαλώσει ο χώρος και να δημιουργηθεί δεύτερη όδευση) για να υπάρξει περαιτέρω αναβάθμιση του αγώνα, κάτι για το οποίο έχουν γίνει συζητήσεις με το Δήμο Μα-

ραθώνα, την Περιφέρεια και πολλούς φορείς. Ο κ. Γιώργος Πατούλης, τόνισε ότι ο Μαραθώνιος της Αθήνας αποτελεί μια μεγάλη γιορτή του κλασικού αθλητισμού και, όπως κάθε χρόνο, έτσι κι εφέτος η Περιφέρεια Αττικής θα συμβάλει στη διοργάνωσή του και οικονομικά με το ποσό των 400.000 ευρώ, ενώ η κα Άννα Ροκοφύλλου είπε ότι αποτελεί τιμή και χαρά για την ίδια που εκπροσωπεί το Δήμο Αθήνας, ο οποίος στηρίζει τον αγώνα. Ο κ. Σπύρος Καπράλος επεσήμανε ότι η ΕΟΕ εμπλέκεται με το Μαραθώνιο, αφού παραχωρεί το Παναθηναϊκό στάδιο για τον τερματισμό του αγώνα, και τόνισε ότι αποτελεί πλέον ένα μεγάλο δρώμενο με πάνω από 60.000 δρομείς. Εξάλλου ο κ. Γιάννης Ρόκας δήλωσε ότι στον «ΟΠΑΠ είμαστε υπερήφανοι γιατί είμαστε για 9η χρονιά χορηγοί του Μαραθωνίου, ένα γεγονός παγκόσμιας εμβέλειας». Τέλος, ο κ. Βασίλης Σεβαστής, τόνισε: «Ο Μαραθώνιος της Αθήνας έχει στείλει το μήνυμα σε εκατομμύρια κόσμο ανά την υφήλιο. Η δουλειά μας, θέλω να τελειώσω με αυτό, ολοκληρώνεται την Κυριακή το απόγευμα, όταν τερματίσει και ο τελευταίος δρομέας».


Επικαιρότητα

8

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Η ρύπανση του λιμανιού της Ραφήνας από τα πλοία και η ενδεδειγμένη λύση Γ

ια το οξυμένο πρόπ. Πρόεδρος ΔΟΠΑΠ βλημα ατμοΡαφήνας-Πικερμίου σφαιρικής ρύπανσης από τα πλοία, δίνει λύση σε μεγάλο βαθμό, η Κοινοτική Οδηγία 2016/802 του Ευρωπαϊκού Κοινοβουλίου, η εφαρμογή της οποίας από 1ης Ιανουαρίου 2020, καθιστά υποχρεωτική την μεγάλη πτώση περιεκτικότητας σε θείο των ναυτιλιακών καυσίμων, σε μόλις 0,5%, σε σχέση με τα σημερινά επίπεδα (όφειλαν να είναι 3,5% από τον Ιούνιο του 2014), για όλα τα ανεξαιρέτως τα επιβατηγά και εμπορικά πλοία. Επιπλέον προβλέπει λύσεις μείωσης της ατμοσφαιρικής ρύπανσης από τα ελλιμενισμένα πλοία, που είναι μείζον πρόβλημα για τις πόλεις-λιμάνια, με εναλλακτική λύση ηλεκτροδότησης τους από την ξηρά, εφόσον σήμερα ηλεκτροδοτούνται από βοηθητικούς κινητήρες. Προβλέπει επίσης τοποθέτηση καταλυτών στα φουγάρα των πλοίων, αλλά και μια σειρά από άλλα σημαντικά μέτρα. Οι μειώσεις των εκπομπών οξειδίων του θείου και άρα η μείωση της ρύπανσης, προβλέπεται να έχουν ευεργετικές επιπτώσεις στην ανθρώπινη υγεία, ιδίως σε τμήματα πληθυσμού που υποφέρουν από αναπνευστικές παθήσεις, αλλά και στο περιβάλλον και στην ποιότητα ζωής των κατοίκων. Η δήλωση του υπουργού Ναυτιλίας και Νησιωτικής Πολιτικής κ. Ιωάννη Πλακιωτάκη (5/9/2019) προς τον Γ.Γ. του IMO (Διεθνής Ναυτιλιακός Οργανισμός), δείχνει ότι υπάρχουν περιθώρια βελτίΓράφει o

Γιώργος Δουβίτσας

ωσης της σημερινής κατάστασης και ότι η Ελλάδα θα προωθήσει σύντομα σχετική νομοθεσία για την εφαρμογή αυστηρών κανόνων που θα εγγυώνται την ασφάλεια των καυσίμων. Ως Ευρωπαϊκή χώρα και πολίτες, πρέπει να εναρμονιζόμαστε με ευεργετικές κοινοτικές οδηγίες όπως η 2016/802. Ως Δήμος, πολίτες και τοπικοί φορείς, ΟΛΟΙ ΜΑΖΙ θα πρέπει ΝΑ ΔΙΑΣΦΑΛΙΣΟΥΜΕ την άμεση εφαρμογή της κοινοτικής οδηγίας για το λιμάνι μας. Ας μην ξεχνάμε όμως ότι, πέραν των ρύπων, η μεγάλη εικόνα για την πόλη μας είναι: - Οι εξελίξεις σε σχέση με το MASTER PLAN επέκτασης του λιμανιού, για τις οποίες πρέπει να ενημερώνεται η τοπική κοινωνία. - Οι παρεμβάσεις κυκλοφοριακής αποσυμφόρησης της Πόλης και του λιμανιού που θα ανακουφίσουν την τοπική κοινωνία και τον εμπορικό κόσμο από την Ραφήνα μέχρι το Πικέρμι. - Ο κόμβος στην Δια-

Πρώτη συνάντηση της Η Ένωση Εστιατορίων Δέσποινας Γκικάκη με & Συναφών Αττικής στον τον Βαγγέλη Μπουρνού Οργανισμό Λιμένος Ραφήνας Σ

υνάντηση πραγματοποίησε τη Δευτέρα 21 Οκτωβρίου ο πρόεδρος της Ένωσης Εστιατορίων & Συναφών Αττικής (ΕΕΕΣΑ) κ. Ιωάννης Δαβερώνης και ο Αντιπρόεδρος κ. Παύλος Δημέλης, με τη νέα Διευθύνουσα Σύμβουλο του Οργανισμού Λιμένος Ραφήνας Α.Ε. (Ο.Λ.Ρ. Α.Ε.) κα Δέσποινα Γκικάκη. Σκοπός της συνάντησης ήταν τα καταστήματα μαζικής εστίασης που ανήκουν στον Οργανισμό Λιμένος και τα προβλήματα που αντιμετωπίζουν. Τόσο οι εκπρόσωποι της ΕΕΕΣΑ όσο και η διευθύνουσα σύμβουλος του ΟΛΡ ΑΕ συμφώνησαν στο ότι η επικοινωνία τους να συνεχιστεί σε καθημερινή βάση.

Τ

ην πρώτη τους συνάντηση είχαν στα μέσα Οκτωβρίου η νέα διευθύνουσα σύμβουλος του Οργανισμού Λιμένος Ραφήνας (ΟΛΡ ΑΕ) κα Δέσποινα Γκικάκη και ο δήμαρχος Ραφήνας-Πικερμίου κ. Βαγγέλης Μπουρνούς. Για τη συνάντηση τους η κα Δέσποινα Γκικάκη ανάρτησε στον προσωπικό λογαριασμό της σε κοινωνικό δίκτυο τη σχετική φωτογραφία αλλά και τη δήλωση που ακολουθεί: «Την εβδομάδα που μας πέρασε είχα την χαρά να καλωσορίσω στα γραφεία της ΟΛΡ ΑΕ τον Δήμαρχο της πόλης μας, Ευάγγελο Μπουρνούς. Συζητήσαμε εκτενώς για τα θέματα που αφορούν την κοινή προοπτική της πόλης και του λιμένα και θέσαμε τις βάσεις για μια αμοιβαία πορεία και ειλικρινή συνεργασία».

Στη φωτογραφία (από αριστερά): ο αντιπρόεδρος της ΕΕΕΣΑ κ. Παύλος Δημελης, η Διευθύνουσα Σύμβουλος του ΟΛΡ ΑΕ κα Δέσποινα Γκικάκη και ο πρόεδρος της ΕΕΕΣΑ κ. Ιωάννης Δαβερώνης.

σταύρωση της Ραφήνας που πρέπει να προχωρήσει χωρίς να υποβαθμίζεται αισθητικά και περιβαλλοντικά η περιοχή. - Η θέσπιση και η τήρηση κανόνων για την αντιμετώπιση της επιβάρυνσης στην ζωή των κατοίκων της περιοχής από την ολοένα και αυξανόμενη λειτουργία του αεροδρομίου Ελευθέριου Βενιζέλος. - Και η αναδάσωση των καμμένων από την φονική πυρκαγιά στις 23 Ιουλίου 2018, λαμβάνοντας υπόψη τις ιδιαιτερότητες της περιοχής.

Ως Δήμος, πολίτες και τοπικοί φορείς, ΟΛΟΙ ΜΑΖΙ θα πρέπει ΝΑ ΔΙΑΣΦΑΛΙΣΟΥΜΕ την άμεση εφαρμογή της κοινοτικής οδηγίας για το λιμάνι μας.

Όταν οι μαθητές μηδενίζουν τις αποστάσεις για να βοηθήσουν το Περιβάλλον… Δ

ενδροφύτευση πραγματοποιήθηκε την Κυριακή 13 Οκτωβρίου στο 1ο Επαγγελματικό Λύκειο (ΕΠΑΛ) Ραφήνας από το Μαθηματικό Σχολείο Καρδίτσας. Η όμορφη αυτή πρωτοβουλία των μαθητών από την Καρδίτσα, έτυχε της ένθερμης κι έμπρακτης στήριξης της Δημοτικής Αρχής Ραφήνας-Πικερμίου και προσωπικά του αντιδήμαρχου κ. Ανδρέα Βασιλόπουλου, ο οποίος προέβη στις συνεννοήσεις για την προμήθεια των δένδρων, ενώ απηύθυνε και την πρόσκληση, επιτυγχάνοντας τη συμβολή στη δράση, εθελοντών της περιοχής. Αρωγοί και υποστηριχτές της προσπάθειας, ο δήμαρχος Ραφήνας-Πικερμίου κ. Ευάγγελος Μπουρνούς και ο διευθυντής του 1ου ΕΠΑΛ Ραφήνας κ. Γεράσιμος Καβαλλιεράτος.


ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Πρώτο Θέμα

9

Η ΑΝ.Α.Σ.Σ.Α στο Δημοτικό Συμβούλιο του Δήμου Σπάτων-Αρτέμιδος (Συνεδρίαση της 17ης Οκτωβρίου 2019) Έ

χοντας ως παρακαταθήκη τη στήριξή σας και αποσκοπώντας στην τήρηση της δέσμευσής μας στο ακέραιο, για δυναμική και δημιουργική αντιπολίτευση, και με δεδομένο ότι το κύριο πολιτικό όπλο για την αντιμετώπιση μιας κρυπτόμενης Δημοτικής Αρχής, που αρνείται πεισματικά την LIVE μετάδοση των Συνεδριάσεων του Δημοτικού Συμβουλίου, είναι η ενημέρωση με ίδια μέσα, θα προσπαθήσουμε να σας ενημερώσουμε συνοπτικά και ουσιαστικά, για τη Συνεδρίαση της 17-10-2019.

Α. Από την παράταξή μας, στην αρχή της Συνεδρίασης, όπως προβλέπει ο Κανονισμός του Δημοτικού Συμβουλίου, τέθηκε σειρά θεμάτων προς την Δημοτική Αρχή, με σημαντικότερα τα κάτωθι: 1. Το πρόβλημα της ηχορύπανσης από τον Διεθνή Αερολιμένα Αθηνών (ΔΑΑ) και ειδικότερα το θέμα της έντονης όχλησης της μαθητικής κοινότητας από τις υπερπτήσεις άνωθεν των σχολικών συγκροτημάτων της Αρτέμιδος, κατά τις ώρες της διδασκαλίας. Από την παράταξή μας κατατέθηκαν και μετρικά στοιχεία, ενώ οι συμπολίτες μας αξίζει να διαβάσουν την απάντηση του κου Δημάρχου, που θα δημοσιοποιήσουμε όταν εκδοθούν τα σχετικά Πρακτικά, για να έχουν ιδία γνώμη, καθώς λόγω του απογοητευτικού πολιτικού επιπέδου της, δεν αξίζει περαιτέρω σχολιασμού. 2. Η έμπρακτη στήριξη από πλευράς του Δήμου μας, της γνωστής στο πανελλήνιο οικογένειας που αγωνίζεται για την αντιμετώπιση ιατρικού προβλήματος του παιδιού τους στο εξωτερικό, με την πραγματοποίηση, έναντι αντιτίμου, εκδήλωσης την 2 Νοεμβρίου 2019, πρόταση η οποία έγινε δεκτή από τη Δημοτική Αρχή. 3. Παροχή ενημέρωσης για το, άνω της πενταετίας, σοβαρό πρόβλημα εισροής υδάτων από τη στέγη του Κλειστού Γυμναστηρίου Σπάτων, που αφενός οδηγεί σε αναβολή δεκάδες αγώνες και προπονήσεις και καταστρέφει το καινούργιο αγωνιστικό παρκέ, αφετέρου θέτει σε άμεσο κίνδυνο ατυχήματος τα παιδιά μας. Η Δημοτική Αρχή δήλωσε ότι αδυνατεί να πραγματοποιήσει άμεσα ένα τόσο απλό έργο και γι’ αυτό το λόγο θα υλοποιηθεί με έξοδα εφοπλιστή, γνωστού για τη φιλανθρωπική του δράση, που για άλλη μια φορά έρχεται να καλύψει πολιτικά κενά και διαδικαστικές ανεπάρκειες της Δημοτικής Αρχής. Ευχαριστούμε τον εφοπλιστή για

τη στήριξη που παρέχει στην πόλη και τα παιδιά μας. 4. Παροχή εξηγήσεων από τη Δημοτική Αρχή, για τους λόγους της πρωτοφανούς καθυστέρησης έγκρισης διάθεσης σχολικών χώρων για τις δραστηριότητες των συλλόγων, καθώς και για την ανακριβή ερμηνεία των διαδικασιών παραχώρησής τους. Ο κος Δήμαρχος υποσχέθηκε την άμεση επίλυση του θέματος. Στο σημείο αυτό επισημαίνουμε στον κο Δήμαρχο, με αφορμή το εν λόγω θέμα αλλά και τη στάση που τηρεί απέναντι στη μείζονα αντιπολίτευση, όπως αυτή εκφράστηκε στον ορισμό των μελών των Σχολικών Επιτροπών, ότι οι εκλογές πέρασαν και πλέον είναι Δήμαρχος όλης της πόλης και όχι μόνο αυτών που τον ψήφισαν. 5. Υποβολή ερώτησης στη Δημοτική Αρχή, για το πώς σχεδιάζει να αντιμετωπίσει το ήδη οξυμμένο πρόβλημα παρκαρίσματος στην κεντρική οδό της Λεωφ. Αρτέμιδος, που αναμένεται να επιδεινωθεί με την έναρξη λειτουργίας του νέου κτηρίου των Δημοτικών Υπηρεσιών. Αξίζει οι συμπολίτες μας να διαβάσουν την απάντηση του κου Δημάρχου, που εμπεριέχεται στα Πρακτικά που θα δημοσιοποιήσουμε όταν εκδοθούν, για να αποκτήσουν ιδία γνώμη. Αποτελεί χαρακτηριστική έκφραση του πολιτικού τρόπου σκέψης του, την οποία εμείς ποτέ δε θα ασπαστούμε και θα είμαστε πάντοτε αντίθετοι. 6. Στα εκτός ημερησίας συζήτησης θέματα, αξίζει να αναφερθεί ότι για ακόμη μια φορά η Δημοτική Αρχή έθεσε, με τη διαδικασία του κατεπείγοντος προς συζήτηση και έγκριση, ένα σοβαρότατο θέμα με μεγάλο για τα δεδομένα του Δήμου μας χρηματικό αντικείμενο άνω του 1.000.000 Ευρώ, τη «Μελέτη Αποχέτευσης Αστικών Λυμάτων Νότιας Αρτέμιδος». Εξαιτίας της πολιτικής υπολειτουργίας της Δημοτικής Αρχής, κληθήκαμε για ακόμη μια φορά να ψηφίσουμε χωρίς ενημέρωση και έλεγχο, ένα σοβαρό θέμα, που ήρθε με τη μορφή του κατεπείγοντος. Β. Στα θέματα της ημερήσιας διάταξης, και μάλιστα σε δύο σημαντικά εξ αυτών, προέκυψαν τα κάτωθι: α) Στην 5η αναμόρφωση του Προϋπολογισμού 2019, υπήρξαν, μετά από παρεμβάσεις της πα-

ράταξής μας, στην εισήγηση σημαντικές βελτιώσεις προς το συμφέρον των Δημοτών και του Δήμου μας. β) Στον ορισμό των Διοικητικών Συμβουλίων των ΝΠΔΔ του Δήμου μας, μετά από την άμεση υπόδειξη από την παράταξή μας των προβλημάτων στις εισηγήσεις του Δημάρχου, υπήρξε διακοπή της Συνεδρίασης, ώστε να επαναδιατυπωθούν. Επρόκειτο για ταλαιπωρία για εμάς και τους συμπολίτες μας, που παρακολουθούσαν τη Συνεδρίαση, η οποία θα μπορούσε να έχει αποφευχθεί, εάν η Δημοτική Αρχή ήταν καλύτερα προετοιμασμένη. γ) Τέλος, η επιλογή του κου Δημάρχου να στερήσει από τη μείζονα Αντιπολίτευση, και κατ’ επέκταση από το 49% των δημοτών του, τη δυνατότητα εκπροσώπησης στα Διοικητικά Συμβούλια των Σχολικών Επιτροπών, ενώ είχε τη δυνατότητα να μην το κάνει, δίνοντας έτσι λύση στην πολιτική ακρότητα του νόμου που δεν ορίζει θέση για την αντιπολίτευση (τον οποίο το Υπουργείο Εσωτερικών με διάταξη σε λίγες ημέρες θα αλλάξει, προβλέποντας σχετική θέση ανεξαρτήτως της βούλησης του Δημάρχου), αποκαλύπτει όχι μόνο τον πολιτικό τρόπο σκέψης του κου Δημάρχου, ο οποίος πηγαίνει την πολιτική στην πόλη μας χρόνια πίσω, αλλά και τις αφανείς του πολιτικές συνεργασίες. Σε μια ψηφοφορία που το μήνυμα απέναντι στον αποκλεισμό της μείζονος αντιπολίτευσης (και κατ’ επέκταση του μισού σχεδόν πληθυσμού του Δήμου) από ένα τόσο σημαντικό συλλογικό διοικητικό όργανο με πρωτοβουλία του Δήμαρχου, έπρεπε να είναι ισχυρό από το σύνολο της αντιπολίτευσης, το αποτέλεσμα ήταν το εξής: ΣΤΟΧΕΥΟΥΜΕ ΜΑΖΙ: NAI ΑΝΑΣΣΑ: OXI ΠΡΟΔΕΥΤΙΚΗ ΣΥΜΑΧΙΑ ΠΟΛΙΤΩΝ: NAI ΛΑΙΚΗ ΣΥΣΠΕΙΡΩΣΗ: ΟΧΙ ΠΟΡΕΙΑ ΕΝΩΤΙΚΗ: ΝΑΙ Αφήνουμε τα συμπεράσματα στην κρίση των συμπολιτών μας.


Επικαιρότητα

10

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Νέα μέλη στην ΕΝΑ οι Δημοτικοί Σύμβουλοι ΣπάτωνΑρτέμιδος, Ελένη Τσάκαλη και Βαγγέλης Τσέπας

Η

Ένωση Νέων Αυτοδιοικητικών (Ε.Ν.Α.) Ελλάδος εδώ και πέντε χρόνια με δράση σε όλη τη χώρα, αποτελούμενη από νέους αιρετούς, περιφερειακούς και δημοτικούς συμβούλους, αντιπεριφερειάρχες, έπαρχους και αντιδημάρχους από όλη την Ελλάδα, πιστεύοντας πως η Τοπική Αυτοδιοίκηση πρέπει να βρει καινούργιους και καινοτόμους τρόπους ανάπτυξης και ανάδειξης των τοπικών κοινωνιών, συνεχίζει για ακόμη μια αυτοδιοικητική περίοδο τις παρεμβάσεις της σε όλη την Ελλάδα. Με την ήδη παρουσία εκατοντάδων νέων ανθρώπων, αιρετών, από κάθε σημείο της Ελλάδος, μιας και αποτελείται η ΕΝΑ από νέους αυτοδιοικητικούς από το Καστελόριζο ως την Θράκη και από την Κέρκυρα ως την

Κρήτη, με ιδιαίτερη χαρά ανακοινώνει ως νέα μέλη της, τους Βαγγέλη Τσέπα και Ελένη Τσάκαλη, Δημοτικούς Συμβούλους του Δήμου Σπάτων-Αρτέμιδος και τους καλωσορίζουμε στην πιο επιτυχημένη πρωτοβουλία που έχει γίνει στην αυτοδιοίκηση τα τελευταία χρόνια, με παρέμβαση σε όλη την Ελλάδα και με τους νέους μπροστά.

Ο Εθνικός Ύμνος της Ελλάδας ακούστηκε Πρωταθλήτρια η Ραφηνιώτισσα Λυδία Μπεσμπαλτά στο Βελιγράδι για την Θεοδωροπούλου! στο 5ο Πανελλήνιο Πρωτάθλημα Τένις Η

Μ

ε τα χρώματα της Εθνικής Ελλάδος αγωνίστηκε το Σάββατο (19/10) η αθλήτρια ξιφασκίας του ΑΡΙΣΤΩΝ Παιανίας, Ανδριάνα Θεοδωροπούλου, στο Ευρωπαϊκό Κύπελλο Νεανίδων στο Βελιγράδι της Σερβίας όπου συμμετείχαν συνολικά 85 Νεάνιδες από όλη την Ευρώπη. Η Θεοδωροπούλου ξεκίνησε με εξαιρετική εμφάνιση στον γύρο των πουλ καταφέρνοντας 5 νίκες 1 ήττα περνώντας στον επόμενο γύρο. Στον πρώτο νοκ-αουτ επικράτησε επί της Laura Smilcic Zigic από την Κροατία με σκορ 15-5 μπαίνοντας στις 32 όπου και επικράτησε ξανά επί της Noelia Rommes από το Βέλγιο με σκορ 15-13 περνώντας στις 16 και στη συνέχεια μπήκε στις 8 επικρατώντας της Γαλλίδας Emilie

Berniguad με σκορ 15-12. Για την είσοδο στα μετάλλια έδωσε σκληρή μάχη με την Ουκρανή Yeva Mazur η οποία επικράτησε της Θεοδωροπούλου με σκορ 15-10 και μάλιστα κατέκτησε και την πρώτη θέση. Την Κυριακή (20/10) λόγω έλλειψης Ελλήνων αθλητών αγωνίστηκε σε μικτή ομάδα αποτελούμενη από τις Yeva Mazur (Ουκρανία), Anna Zens (Λουξεμβούργο) και Ανδριάνα Θεοδωρόπουλου (Ελλάδα) οι οποίες έκαναν μια σειρά πολύ δυνατών παιχνιδιών ενάντια σε Λευκορωσία και Ρουμανία, φτάνοντας στο πρώτο σκαλί του βάθρου κερδίζοντας το χρυσό μετάλλιο! Ο Εθνικός Ύμνος ακούστηκε κατά την απονομή του Κυπέλλου δημιουργώντας κλίμα συγκίνησης και υπερηφάνειας!

Λυδία Μπεσμπαλτά, αθλήτρια του τένις από την Ραφήνα, αναδείχθηκε πρωταθλήτρια στο 5ο Πανελλήνιο Πρωτάθλημα επιπέδου Ε2 που διεξήχθη στο Χαϊδάρι. Η Λυδία για να φτάσει στην κατάκτηση του τουρνουά απέκλεισε την R32 Κ. Παπανίκου 6-1 και 6-2, την R16 Λ. Στεφάνοβίτς 6-0 και 6-1, την R8 Μ. Παπακωνσταντίνου 6-2 και 6-1, την R4 Μ, Τσεκούρα 6-3 και 6-0 και στον τελικό νίκησε την Ν. Νικολή 6-2 και 6-2. Η Λυδία Μπεσμπαλτά μαζί με την συμπαίκτρια της Σεμίνα Σακογίαννη (Α.Ο Χαιδαρίου) διεκδίκησε και τον τίτλο στα διπλά όπου στον τελικό ηττήθηκαν από τις Μ. Παπακωνσταντίνου και Ε. Τέτσου με σκορ 6-2 και 6-3 καταλαμβάνοντας τη δεύτερη θέση. Την Προσπάθεια της Λυδίας στηρίζουν οι εταιρίες BinaryTree και TARGIT Greece.


Επικαιρότητα

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Πρώτη ΑΝΟΙΧΤΗ ΣΥΝΕΛΕΥΣΗ του ΜΕΡΑ 25 στην ΑΝΑΤΟΛΙΚΗ ΑΤΤΙΚΗ Κυριακή 3 Νοεμβρίου 2019, ώρα 11:00π.μ. στο ΚΑΠΗ Γέρακα (Εθνικής Αντιστάσεως 44, 153 44 Γέρακας) Η ΠΣΕ (Προσωρινή Συντονιστική επιτροπή) Ανατολικής Αττικής του ΜεΡΑ 25, η οποία συγκροτείται από μέλη του που προσήλθαν εθελοντικά κατά την έναρξη της διαδικασίας του προσυνεδριακού διαλόγου, με σκοπό την προετοιμασία των συνελεύσεων του διαλόγου αυτού, σας καλούμε στην Πρώτη ανοιχτή συνέλευση μελών και φίλων του ΜεΡΑ25 στην Ανατολική Αττική. Το Μέτωπο Ρεαλιστικής Ανυπακοής 25 κάνει ανοιχτή πρόσκληση στους πολίτες της Ανατολικής Αττικής να γίνουν μέλη του και να συναποφασίσουν μέσα από Ανοιχτές συνελεύσεις τις θέσεις του μετώπου για το συνέδριο που θα γίνει το Μάιο. Το ΜΕΡΑ 25 υλοποιεί τη Δημοκρατία στη Βάση του. Αποφασίζει το αύριο σε Συνελεύσεις. Ελάτε να συμμετέχετε και να συναποφασίσετε τις θέσεις του συνεδρίου. Τη συνέλευση θα χαιρετίσει η βουλευτής Ανατολικής Αττικής Μαρία Απατζίδη. Η ΠΣΕ Ανατολικής Αττικής Τηλέφωνα επικοινωνίας: 6937176888 - 6970057135 - 6946728906 E-mail: anatol.attiki@mera25.gr

11

Συμφωνία Δήμου Παλλήνης και ΕΔΑ Αττικής για επέκταση του δικτύου φυσικού αερίου σε Κάντζα και Άγιο Νικόλαο

Τ

ην πρόταση του Δήμου Παλλήνης για επέκταση προς Κάντζα και Άγιο Νικόλαο, του δικτύου φυσικού αερίου που υλοποιείται αυτή τη στιγμή σε Γέρακα και Παλλήνη, έκανε αποδεκτή η Εταιρεία Διανομής Αερίου Αττικής (ΕΔΑΑ). Η ΕΔΑΑ έκρινε ότι οι επεκτάσεις που πρότεινε ο Δήμος Παλλήνης, συμβαδίζουν με τους μεσοπρόθεσμους σχεδιασμούς της Εταιρείας και αποφάσισε να συμπεριληφθούν στο νέο επιχειρησιακό σχέδιο που θα καταθέσει στη Ρ.Α.Ε. (Ρυθμιστική Αρχή Ενέργειας) τον Νοέμβριο. Η συμφωνία Δήμου Παλλήνης και ΕΔΑΑ, οριστικοποιήθηκε σε συνάντηση που είχαν την Παρασκευή 11 Οκτωβρίου, ο Δήμαρχος, Θανάσης Ζούτσος και ο Γενικός Γραμματέας του Δήμου, Γιώργος Τέντης με τον Τεχνικό Διευθυντή της ΕΔΑΑ, Χρήστο Σκουλίδα, τον Διευθυντή Ανάπτυξης Υποδομών, Γιάννη Ντρούκα, τον Διευθυντή Σχεδιασμού Ανάπτυξης Υποδομών & Προγραμματισμού, Ιερόθεο Κουφή και τον Μηχανικό Σχεδια-

σμού Υποδομών της ΕΔΑΑ, Χρήστο Χασαπόπουλο. Κατά τη συνάντηση, επιβεβαιώθηκε ακόμα, η τήρηση των χρονοδιαγραμμάτων των έργων επεκτάσεων που ξεκίνησαν πριν ένα χρόνο και υλοποιούνται με ταχείς ρυθμούς. Τα έργα σε Γέρακα και Παλλήνη θα ολοκληρωθούν εντός του 2020. Με τον τρόπο αυτό, ο Δήμος Παλλήνης θα καταστεί ο μόνος Δήμος της Ανατολικής Αττικής με δίκτυο φυσικού αερίου το οποίο καλύπτει πλήρως τον πυκνοδομημένο αστικό ιστό, παρόλο που αρχικά δεν είχε ενταχθεί στον προγραμματισμό επεκτάσεων της ΕΔΑΑ. Αυτό άλλαξε, όταν ο Δήμαρχος Παλλήνης, Θανάσης Ζούτσος, στα μέσα του 2018 και στο πλαίσιο της αναπτυξιακής πολιτικής του Δήμου, κινητοποίησε χιλιάδες κατοίκους ώστε να εκδηλώσουν το ενδιαφέρον τους για εγκατάσταση φυσικού αερίου, γεγονός που «έπεισε» την ΕΔΑΑ ότι η επένδυση στον Δήμο Παλλήνης, είναι ελκυστική και βιώσιμη.

Έκτοτε, ο Δήμος Παλλήνης βρίσκεται στην πρώτη γραμμή των έργων κατασκευής δικτύου φυσικού αερίου από την ΕΔΑΑ και ήδη οι πολίτες μπορούν να υποβάλλουν αίτηση σύνδεσης. Επίσης, στη συνάντηση συζητήθηκαν θέματα που αφορούν στις συνδέσεις των δημοτικών κτηρίων, των Σχολικών μονάδων και των δημοτικών κολυμβητηρίων αλλά και τρόποι συνεργασίας του Δήμου και της ΕΔΑΑ για την αποτελεσματικότερη ενημέρωση των δημοτών και την διευκόλυνση τους στις διαδικασίες σύνδεσης των οικιών και καταστημάτων τους με το δίκτυο φυσικού αερίου.

ΟΡΓΑΝΩΜΕΝΟ ΔΙΚΗΓΟΡΙΚΟ ΓΡΑΦΕΙΟ ΑΙΚΑΤΕΡΙΝΗΣ ΚΥΡΙΑΚΑΚΗ - ΚΟΥΤΕΛΙΕΡΗ & ΣΥΝΕΡΓΑΤΩΝ Εμπειρία 25 ετών συνεχούς μαχόμενης παρουσίας στις αίθουσες των Αστικών & Ποινικών Δικαστηρίων Πανελλαδικά.

Αθήνα, 17 Ιουλίου 2019

ΑΝΑΚΟΙΝΩΣΗ

Αναλαμβάνουμε (και όχι μόνο):

Από το Αρχηγείο της Ελληνικής Αστυνομίας εκδίδεται η παρούσα Ανα-

• Εισπράξεις οικονομικών απαιτήσεων • Ανακοπές - Αναστολές πλειστηριασμών • Υποθέσεις Οικογενειακού και Κληρονομικού δικαίου • Ασφαλιστικές (συνταξιοδοτικά κ.λπ.) - Εργατικές Διαφορές • Τροχαία ατυχήματα, ακίνητα - κτηματολόγιο • Ποινικές υποθέσεις

κοίνωση, η οποία υπέχει θέση αποκατάστασης του Αστυνόμου Α’ (ε.α.)

Δημάρχου Χρήστου Μπέκα και Ικάρου Λουκά Λίγκου 1 (30 μέτρα από το Δημαρχείο - έναντι ΑΒ Βασιλόπουλου) 19004 Σπάτα Αττικής Τηλεφωνικό κέντρο: 210 7751194 (Δεχόμαστε με ραντεβού - το πρώτο δωρεάν)

Κύρου Κωνσταντίνου. Ο προαναφερόμενος, τον Ιούνιο του 2018, αθωώθηκε αμετάκλητα για τα αδικήματα της υπεξαίρεσης και της απιστίας στην υπηρεσία και της ηθικής αυτουργίας σε ψευδή βεβαίωση, για τα οποία είχε κατηγορηθεί το 2000, όταν υπηρετούσε σε Υπηρεσία της Αττικής. Η Ανακοίνωση εκδίδεται κατ’ εφαρμογή του άρθρου 7 του Ν.2713/1999, κατόπιν αιτήσεως του προαναφερόμενου Αξιωματικού.


ΠΡΟΣΦΟΡΑ ΕΡΓΑΣΙΑΣ

ΖΗΤΕΊΤΑΙ ΝΕΑΡΉ ΚΟΠΈΛΑ για εργασία στο ΧΡΩΜΑ καφέ στην πλατεία Νέας Μάκρης. Τηλέφωνο 6906201195. ΖΗΤΕΊΤΑΙ ΥΠΆΛΛΗΛΟΣ για καφετέρια στο Κάτω Σούλι Μαραθώνα. Μισθός ικανοποιητικός, +ΙΚΑ. Τηλέφωνο 6977467419.

Από τις ΕΚΔΟΣΕΙΣ ΑΤΤΙΚΗΣ (εφημερίδα Ο ΔΗΜΟΤΗΣ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ και ηλεκτρονική σελίδα www.dimotisnews. gr), ΖΗΤΟΥΝΤΑΙ συνεργάτες, ΔΗΜΟΣΙΟΓΡΑΦΟΙ και ΠΑΡΑΓΩΓΟΙ ΔΙΑΦΗΜΙΣΕΩΝ, από όλες τις περιοχές της Ανατολικής Αττικής για μόνιμη απασχόληση. Μόνο σοβαρές προτάσεις. Βιογραφικά στο e-mail: info@ dimotisnews.gr.

ΖΗΤΕΊΤΑΙ ΝΈΟΣ Ή ΝΈΑ για πρατήρια υγρών καυσίμων στην περιοχή της Νέας Μάκρης. Τηλέφωνο 6944341574. ΖΗΤΟΎΝΤΑΙ ΣΕΡΒΙΤΌΡΟΙ από εστιατόριο στην παραλία της Νέας Μάκρης. Τηλέφωνο 6986590678. ΖΗΤΕΊΤΑΙ ΨΉΣΤΗΣ από εστιατόριο στην Νέα Μάκρη. Τηλέφωνο 6986590678. ΖΗΤΑΜΕ ΝΕΑΡΗ ΚΥ ΡΙΑ ΓΙΑ ΜΟΝΙΜΗ 5μερη

(ή 3μερη) ΑΠΑΣΧΟΛΗΣΗ, στο εργαστήριο μας κοσμήματος στην Νέα Μάκρη, με ΒΑΣΙΚΕΣ γνώσεις κατασκευής κοσμήματος, οργάνωσης γραφείου και Αγγλικής γλώσσας. Οι ενδιαφερόμενες μπορούν να επικοινωνήσουν στο τηλέφωνο 6937013679. Η ΕΧΠΟΓΟΥΟΡΚ Α.Ε., τεχνική εταιρεία εκθεσιακών κατασκευών με έδρα τα Σπάτα Αττικής, ζητά άτομα για πλήρη απασχόληση ως μόνιμο εργατικό προσωπικό γενικών καθηκόντων στα πλαίσια κατασκευής περιπτέρων και διοργάνωσης εκθέσεων. Προσφέρονται: Βασικός μισθός, ΙΚΑ, bonus. Πληροφορίες: 2103542991. ΖΗΤΕΊΤΑΙ ΠΟΛΙΤΙΚΌΣ ΜΗΧΑΝΙΚΌΣ ή τεχνολόγος μηχανικός σε Τεχνικό Γραφείο στη Νέα Μάκρη.

Απαραίτητα προσόντα, άριστη γνώση Αutocad, Ν.Ο.Κ., τακτοποιήσεις αυθαιρέτων και έκδοση Αδειών Δόμησης. Οι ενδιαφερόμενοι μπορούν να αποστείλουν τα βιογραφικά τους στο E-mail: gpapahronis@ gmail.com ή να επικοινωνήσουν τηλεφωνικά στο 6944942165.

ΖΗΤΗΣΗ ΕΡΓΑΣΙΑΣ ΚΥΡΊΑ ΕΛΛΗΝΊΔΑ, μορφωμένη, ευχάριστος χαρακτήρας, αναλαμβάνει ως γηροκόμος καθώς και κάποιες δουλειές σπιτιού και εξωτερικές δουλειές. Όχι εσωτερική. Τηλέφωνο 6947825774. ΑΝΑΛΑΜΒΆΝΟΥΜΕ φιλοξενίες κατοικίδιων. Σπιτικό περιβάλλον, άνετοι και ασφαλείς χώροι. Τηλέφωνο 6947825774.

ΜΑΘΗΜΑΤΑ ΦΙΛΌΛΟΓΟΣ ΠΤΥΧΙΟΎΧΟΣ του Εθνικού και Καποδιστριακού Πανεπιστημίου

24 ωρη

εξυπηρέτηση ερικό σε Ελλάδα & Εξωτ

ΕΛΛΗΝΙΚΗ ΔΗΜΟΚΡΑΤΙΑ ΝΟΜΟΣ ΑΤΤΙΚΗΣ ΔΗΜΟΣ ΜΑΡΑΘΩΝΟΣ ΔΙΕΥΘΥΝΣΗ ΚΑΘΑΡΙΟΤΗΤΑΣ, ΑΝΑΚΥΚΛΩΣΗΣ, ΠΕΡΙΒΑΛΛΟΝΤΟΣ, ΠΡΑΣΙΝΟΥ & ΣΥΝΤΗΡΗΣΗΣ ΥΠΟΔΟΜΩΝ Ταχ. Διεύθυνση: Οινόης 6 Tαχ. Kώδικας: 19007 Μαραθώνας Τηλ.: 2294320974, 930, 933, 935 E-mail: kathariotita@marathon.gr

ΑΝΑΚΟΙΝΩΣΗ Παρακαλούνται οι συγγενείς που διατηρούν μνήματα στα κοιμητήρια, που ανήκουν στην Δ.Ε. Μαραθώνα (Άνω Σουλίου, Καλεντζίου και Αγίου Αθανασίου), να προσέλθουν στο Δημοτικό Κατάστημα Μαραθώνα (μέχρι και της 13 Δεκεμβρίου 2019), επί της οδού Οινόης 6, στην Υπηρεσία Κοιμητηρίων, 1ος όροφος, γραφείο 8, κατά τις εργάσιμες ημέρες και ώρες 8.30 π.μ. έως 13.30 μ.μ. για την παροχή πληροφοριών και την καταγραφή των μνημάτων, που υπάρχουν στα ανωτέρω κοιμητήρια. Από τη ΔΙΕΥΘΥΝΣΗ

Αθηνών με μεταπτυχιακό στη διδακτική της Νεοελληνικής Γλώσσας και ειδίκευση στις μαθησιακές δυσκολίες παραδίδει μαθήματα σε


μαθητές Δημοτικού, Γυμνασίου και Λυκείου. Προετοιμασία για τις Πανελλήνιες εξετάσεις. Μεθοδικότητα, φροντιστηριακή πείρα και οργανωμένες σημειώσεις. Τιμές προσιτές. Τηλέφωνο 6982306564. ΚΑΘΗΓΗΤΡΙΑ ΦΙΛΌΛΟΓΟΣ παραδίδει φιλολογικά μαθήματα σε μαθητές Γυμνασίου - Λυκείου. Προετοιμασία για Πανελλαδικές εξετάσεις. Προσιτές τιμές. Τηλέφωνο 6981852425.

ΕΝΟΙΚΙΑΖΕΤΑΙ ΝΕΑ ΜΑΚΡΗ ΚΕΝΤΡΟ, ενοικιάζεται γραφείο 75 τ.μ., 1ου ορόφου, προσόψεως, κατασκευή 2004, νεοκλασικό, ενεργειακής κλάσης Α+, 1 wc, ανοικτό πάρκινγκ μιας θέσης, τριφασικό ρεύμα, ασανσέρ, κλιματισμός, άριστη κατάσταση, τιμή 500€/ μήνα (συζητήσιμη). Τηλέφωνο 6977232183.

ΜΑΘΗΜΑΤΙΚΑ - ΦΥΣΙΚΗ - ΧΗΜΕΙΑ από έμπειρο καθηγητή μαθηματικών, φυσικής και χημείας για όλες τις τάξεις Γυμνασίου - Λυκείου από 10€/ώρα. Τηλέφωνο 6945621035.

ΠΩΛΗΣΕΙΣ ΟΙΚΙΑΚΩΝ ΣΥΣΚΕΥΩΝ ΠΩΛΕΙΤΑΙ μαντεμένια τζακόσομπα 76Χ48Χ72 (ΜΧΒΧΥ) με τα μπουριά, γωνίες, καπέλο κ.λπ., λειτουργίας ενός έτους, λόγω αλλαγής θέρμανσης. Τιμή 300€. Τηλέφωνο 6945558082.

ΠΩΛΗΣΕΙΣ ΗΛΕΚΤΡΟΝΙΚΩΝ ΣΥΣΚΕΥΩΝ ΠΩΛΕΊΤΑΙ iPhone 6s silver 16GB σε καλή κατάσταση. Τιμή 150€. Τηλέφωνο 6977232183.

ΕΝΟΙΚΙΑΣΕΙΣ ΑΚΙΝΗΤΩΝ ΕΝΟΙΚΙΑΖΕΤΑΙ ισόγειο διπλοκατοικίας στην Ανατολή Νέας Μάκρης κατασκευής '80 με ανακαινισμένη κουζίνα, μπάνιο, 3 υπνοδωμάτια, μεγάλο σαλόνι, μεγάλη κουζίνα, μεγάλη βεράντα, κήπος με οπωροφόρα και ανοιχτό πάρκινγκ. Τι-

μή 400€/μήνα. Τηλέφωνο 6945558082. ΕΝΟΙΚΙΆΖΕΤΑΙ στον Μαραθώνα, εντός του οικισμού, κατοικία 120 τ.μ. Τιμή 470 Ευρώ. Τηλέφωνο 6936612255. ΕΝΟΙΚΙΑΖΕΤΑΙ μονοκατοικία στη Διασταύρωση Ραφήνας, 2 υπνοδωμάτια, σαλόνι, τραπεζαρία, αποθήκη. Τηλέφωνα 2294077380 6971788336.

ΠΩΛΗΣΕΙΣ ΑΚΙΝΗΤΩΝ ΝΕΑ ΜΑΚΡΗ ΚΕΝΤΡΟ, πωλείται γραφείο 75 τ.μ., 1ου ορόφου, προσόψεως, κατασκευή 2004, νεοκλασικό, ενεργειακής κλάσης Α+, 1 wc, ανοικτό πάρκινγκ μιας θέσης, τριφασι-

λόνι, τραπεζαρία, αποθήκη. Τηλέφωνα 2294077380 - 6971788336.

κό ρεύμα, ασανσέρ, κλιματισμός, άριστη κατάσταση. Τιμή 120.000€. Τηλέφωνο 6977232183. Π Ω Λ Ε ΊΤ Α Ι Μ Ο Ν Ο Κ ΑΤΟΙΚΊΑ 67 τ.μ. στον Μαραθώνα, σε κτήμα 2.000 τ.μ. με ελιές και οπωροφόρα δέντρα, βεράντες 140 τ.μ., αποθήκη, τζάκι, ψησταριά, πάρκινγκ και εξαιρετική θέα της πόλης του Μαραθώνα. Τηλέφωνο 6977877820.

ΚΑΤΩ ΧΑΛΚΙΑΝΙΚΑ ΑΧΑΪΑΣ, πλησίον Ζαρούχλας και χιονοδρομικού κέντρου Καλαβρύτων, πωλείται εξοχική κατοικία, μεζονέτα 120 τ.μ. σε άριστη κατάσταση κατασκευής του 1982, σε δύο άρτια και οικοδομήσιμα οικόπεδα 1.200 τ.μ., με 3 Υ/Δ, 2 μπάνια, κεντρική θέρμανση, τζάκι, εξωτερική αποθήκη και θέα στον Χελμό. Ευκαιρία, μόνο σοβαρές προτάσεις. Τηλέφωνο 6944640581.

ΖΗΤΗΣΗ ΑΚΙΝΗΤΩΝ ΠΡΩΤΕΥΣ - N.Γ. ΣΠΕΤΣΙΩΤΗΣ: ΖΗΤΟΥΝΤΑΙ ΑΚΙΝΗΤΑ Β.Α. ΑΤΤΙΚΗΣ πλησίον παραλίας ή με θέα θαλάσσης για αγορά μετρητοίς ή ενοικιάσεις μόνιμες - βραχυπρόθεσμες επιπλωμένων ή μη. Δυνατότης χορηγήσεως Στεγαστικών Δανείων. ΜΕΓΑΛΕΣ ΕΠΕΝΔΥΤΙΚΕΣ ΕΥΚΑΙΡΙΕΣ. www.proteus - properties.com. Τηλέφωνα: 6972702828 2294026145.

ΚΟΙΝΩΝΙΚΑ Ο ΣΠΥΡΊΔΩΝ ΔΙΑΚΟΥΜΆΚΟΣ του Ηλία και της Παναγιώτας, το γένος Μούτουλα, που γεννήθηκε

ΠΩΛΕΙΤΑΙ ΜΟΝΟΚΑΤΟΙΚΊΑ στη Διασταύρωση Ραφήνας, 2 υπνοδωμάτια, σα-

και κατοικεί στον Πειραιά Αττικής και η ΑΙΚΑΤΕΡΊΝΗ ΚΟΥΤΣΟΥΒΈΛΗ του Νικολάου και της Πελαγίας, το γένος Αθανασόπουλου, που γεννήθηκε στην Αθήνα και κατοικεί στο Κρυονέρι Αττικής, θα έλθουν σε γάμο που θα γίνει στον Πειραιά Αττικής. Ο ΕΥΘΎΜΙΟΣ ΓΕΡΟΔΉΜΟΣ του Θεοδώρου και της Ελένης, το γένος Δαμασκηνού, που γεννήθηκε στο Μαρούσι Αττικής και κατοικεί στον Πειραιά Αττικής και η ΜΑΡΊΑ ΚΟΥΤΣΟΥΒΈΛΗ του Νικολάου και της Πελαγίας, το γένος Αθανασοπούλου, που γεννήθηκε στην Αθήνα και κατοικεί στο Κρυονέρι Αττικής, θα έλθουν σε γάμο που θα γίνει στο Κρυονέρι Αττικής.

ΒΕΛΟΝΙΣΜΟΣ για όλους

Ο

ιατρικός βελονισμός είναι μια ανώδυνη συμπληρωματική θεραπευτική μέθοδος που ξεκίνησε στην Κίνα και βασίζεται στην τοποθέτηση λεπτών αποστειρωμένων βελονών μιας χρήσεως σε συγκεκριμένα βελονιστικά σημεία του σώματος και μπορεί να εφαρμοστεί σε όλες τις ηλικιακές ομάδες. Σύμφωνα με απόφαση του Κεντρικού Συμβουλίου Υγείας (αποφ.4 της 270ης/06.07.2018) ο βελονισμός αποτελεί στην χώρα μας συμπληρωματική ιατρική πράξη που χρησιμοποιείται παράλληλα με την Κλασική Ιατρική και πρέπει να εφαρμόζεται αποκλειστικά από εξειδικευμένους ιατρούς. Οι ενδείξεις του ιατρικού βελονισμού σύμφωνα με τον Παγκόσμιο Οργανισμό Υγείας (WHO) είναι

πολλές : Παθήσεις αναπνευστικού: οξεία ιγμορίτιδα, οξεία/αλλεργική ρινίτιδα, βρογχικό άσθμα, αλλεργίες, Παθήσεις γαστρεντερικού: οξεία και χρόνια κολίτιδα, σύνδρομο ευερέθιστου εντέρου, Μυοσκελετικά νοσήματα: αυχεναλγία, περιαρθρίτιδα ώμου, επικονδυλίτιδα, οσφυαλγία, ισχιαλγία, άλγος γονάτων, οστεοαρθρίτιδα, ρευματοειδής αρθρίτιδα Νευρολογικές παθήσεις: κεφαλαλγία - ημικρανία, νευραλγία τριδύμου, πάρεση προσωπικού,Ψυχοσωματικές παθήσεις: αϋπνία, άγχος, κατάθλιψη, Eξαρτήσεις (Παχυσαρκία, κάπνισμα ), Γυναικολογικές παθήσεις: διαταραχές εμμήνου ρύσεως και εμμηνόπαυσης (δυσμηνόρροια, εξάψεις), Δερματοπάθειες: ψωρίαση, κνησμός, έρπητας ζωστήρας.

* Η ιατρός Βιοπαθολόγος Γαρυφαλλιά Καβαρνού, είναι Επιστημονικά Υπεύθυνη του Εργαστηρίου και του Τμήματος Βελονισμού του Διαγνωστικού Πολυιατρείου «Attica Medpoint». Διαθέτει μεγάλη εμπειρία στο Αδυνάτισμα με ηλεκτροβελονισμό και ωτοβελονισμό, δυνατότητα κατ' οίκον επισκέψεων. Μπορείτε να επικοινωνείτε με την ιατρό για να σας κατευθύνει κατάλληλα και υπεύθυνα στα τηλέφωνα 6972228138 - 2108310700, e-mail: gkavarnou@gmail.com, ιστοσελίδα: www.atticamedpoint.com, facebook: Βελονισμός για όλους-Καβαρνού Γαρυφαλλιά.


Εκπαίδευση

14

ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

ΠΑΝΕΛΛΗΝΙΕΣ 2020 - ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ

Τα Φροντιστήρια ΠΡΟΟΠΤΙΚΗ βρίσκονται και φέτος -όπως κάθε χρόνο- στο πλευρό των μαθητών της Γ΄ Λυκείου για τις εξετάσεις του Ιουνίου . Με αυτό το σκοπό συνεχίζουν μία συνεργασία με την εφημερίδα «Ο ΔΗΜΟΤΗΣ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ» στην οποία θα δημοσιεύονται θέματα στο πνεύμα των εξετάσεων που θα επιμελούνται οι έμπειροι καθηγητές των φροντιστηρίων μας. Σκοπός μας δεν είναι να υποκατασταθεί η προετοιμασία των μαθητών, αλλά να προσφερθεί μία ακόμα αφορμή για εξάσκηση. Γι’ αυτό το λόγο δε δίνονται και οι λύσεις των θεμάτων. Συνεπώς οι υποψήφιοι καλούνται να δοκιμάσουν μόνοι τους τις δυνατότητές τους. Για κάθε διευκρίνιση ή απορία αλλά και για τις λύσεις των θεμάτων, οι μαθητές μπορούν να επικοινωνούν με το Φροντιστήριο ΠΡΟΟΠΤΙΚΗ Νέας Μάκρης στο τηλέφωνο 22940 91119.

ΑΡΧΑΙΑ ΕΛΛΗΝΙΚΑ - ΑΔΙΔΑΚΤΟ ΚΕΙΜΕΝΟ Στο απόσπασμα από το έργο του Ισοκράτη, «Περί Ειρήνης», ο ρήτορας αναφέρεται στα πλεονεκτή-

ΒΙΟΛΟΓΙΑ - ΠΡΟΤΕΙΝΟΜΕΝΑ ΘΕΜΑΤΑ 1.

ματα από την επικράτηση της ειρήνης. Ταῦτα μὲν οὖν διὰ παντὸς τοῦ λόγου πειρασόμεθα διδάσκειν ὑμᾶς, περὶ δὲ τῆς εἰρήνης πρῶτον δι-

2.

αλεχθῶμεν, καὶ σκεψώμεθα τί ἂν ἐν τῷ παρόντι γενέσθαι βουληθεῖμεν ἡμῖν. ἢν γὰρ ταῦτα καλῶς

καὶ περὶ τῶν ἄλλων. ἆρ' οὖν ἂν ἐξαρκέσειεν ἡμῖν, εἰ τήν τε πόλιν ἀσφαλῶς οἰκοῖμεν καὶ τὰ περὶ τὸν

3. 4. 5.

βίον εὐπορώτεροι γιγνοίμεθα καὶ τά τε πρὸς ἡμᾶς αὐτοὺς ὁμονοοῖμεν καὶ παρὰ τοῖς Ἕλλησιν εὐδο-

6.

κιμοῖμεν; ἐγὼ μὲν γὰρ ἡγοῦμαι τούτων ὑπαρξάντων τελέως τὴν πόλιν εὐδαιμονήσειν. ὁ μὲν τοίνυν

7.

ὁρισώμεθα καὶ νοῦν ἐχόντως, πρὸς ταύτην τὴν ὑπόθεσιν ἀποβλέποντες ἄμεινον βουλευσόμεθα

πόλεμος ἁπάντων ἡμᾶς τῶν εἰρημένων ἀπεστέρηκεν· καὶ γὰρ πενεστέρους πεποίηκε, καὶ πολλοὺς κινδύνους ὑπομένειν ἠνάγκασε, καὶ πρὸς τοὺς Ἕλληνας διαβέβληκε, καὶ πάντας τρόπους τεταλαιπώρηκεν ἡμᾶς. ἢν δὲ τὴν εἰρήνην ποιησώμεθα καὶ τοιούτους ἡμᾶς αὐτοὺς παράσχωμεν οἵους αἱ κοιναὶ

8. 9. 10.

συνθῆκαι προστάττουσι, μετὰ πολλῆς μὲν ἀσφαλείας τὴν πόλιν οἰκήσομεν, ἀπαλλαγέντες πολέμων καὶ κινδύνων καὶ ταραχῆς, εἰς ἣν νῦν πρὸς ἀλλήλους καθέσταμεν, καθ' ἑκάστην δὲ τὴν ἡμέραν πρὸς εὐπορίαν ἐπιδώσομεν [...].

11. 12. 13.

Ισοκράτης, Περί Ειρήνης (Πίστις: §18–20)

14.

ΠΑΡΑΤΗΡΗΣΕΙΣ:

15. 1.

Να μεταφράσετε στα νέα ελληνικά το απόσπασμα “ἆρ' οὖν ἂν ἐξαρκέσειεν...πόλιν εὐδαιμο-

Διατάξτε τα παρακάτω κατά αυξανόμενη ποσότητα γενετικού υλικού: 1. Νουκλεόσωμα 4. Γονίδιο (1000ζ.β.) 2. Νουκλεοτίδιο 5. Ανθρώπινο ινίδιο χρωματίνης Νο 9 3. Ανθρώπινο γονιδίωμα 6. Ανθρώπινο μεταφασικό χρωμόσωμα Νο9 Να αναφέρετε δύο περιπτώσεις που σχηματίζεται δίκλωνο τμήμα RNA-RNA και δύο περιπτώσεις που σχηματίζεται δίκλωνο τμήμα DNA-RNA σε βιολογικές διαδικασίες μέσα στο ευκαρυωτικό κύτταρο. Ποιες περιοχές του DΝΑ δεν μεταγράφονται; Ποιες περιοχές τον DΝΑ δεν μεταφράζονται σε αμινοξέα; Ποιες περιοχές του DNA μεταγράφονται αλλά δεν μεταφράζονται σε αμινοξέα; Ποιους νουκλεοπρωτεϊνικούς σχηματισμούς του ευκαρυωτικού κυττάρου γνωρίζετε; Ποια γονίδια εκφράζονται σε όλους τους κυτταρικούς τύπους ανεξαρτήτως κυτταρικής διαφοροποίησης; Ποιες πρωτείνες υπάρχουν στον πυρήνα ευκαρυωτικού κυττάρου; Ποιος είναι ο μεγαλύτερος και ποιος ο μικρότερος αριθμός μορίων DNA που μπορεί να εντοπιστούν σε σωματικό ανθρώπινο κύτταρο το οποίο στο κυτταρόπλασμά του έχει 50 μιτοχόνδρια; Ποιες ασθένειες γνωρίζετε που να μεταδίδονται μέσω εντόμων ή ζώων; Ποιο από αυτά θα μπορούσε να έχει βλαπτική επίδραση στο ανοσοβιολογικό σύστημα λόγω των οργάνων που επηρεάζει; Θα μπορούσε το πύον να χρησιμοποιηθεί ως εμβόλιο; Εξηγήστε. Να αναφέρετε όλες τις αντιμικροβιακές ουσίες της άμυνας του ανθρώπινου οργανισμού. Να αναφέρατε περιπτώσεις όπου συμβαίνει διαστολή αιμοφφόρων αγγείων στο οργανισμό μας. Να αναφέρετε δύο περιπτώσεις μικροοργανισμών που ζουν συμβιωτικά με τον ανθρώπινο οργανισμό. Τη στιγμή 0 των αξόνων κάποιος μολύνθηκε από μικρόβιο μη μεταλλασσόμενο.

νήσειν."

Μονάδες 10 2.

Ποιές ήταν οι καταστροφικές συνέπειες του πολέμου και ποιές είναι οι απαραίτητες προυποθέσεις ώστε να προοδεύσει η πόλη; Μονάδες 10

3.

α) “ἆρ' οὖν ἂν ἐξαρκέσειεν ἡμῖν, εἰ τήν τε πόλιν ἀσφαλῶς οἰκοῖμεν καὶ τὰ περὶ τὸν βίον εὐπορώτεροι γιγνοίμεθα καὶ τά τε πρὸς ἡμᾶς αὐτοὺς ὁμονοοῖμεν καὶ παρὰ τοῖς Ἕλλησιν εὐδοκιμοῖμεν; ἐγὼ μὲν γὰρ ἡγοῦμαι τούτων ὑπαρξάντων τελέως τὴν πόλιν εὐδαιμονήσειν.” Να με-

ταφέρετε τους υπογραμμισμένους ρηματικούς τύπους στον αόριστο. β) Να βρείτε μία προσωπική, μία αυτοπαθητική και μία αναφορική αντωνυμία και να τις μεταφέρετε στον αντίθετο αριθμό. Μονάδες 10 4.

4. α) “ἐγὼ μὲν γὰρ ἡγοῦμαι τούτων ὑπαρξάντων τελέως τὴν πόλιν εὐδαιμονήσειν.” Να μεταφερθεί στον ευθύ λόγο. β) απαλλαγέντες: να αναλύσετε την μετοχή στην αντίστοιχη επιρρηματική πρόταση. Μονάδες 10

Επιμέλεια: Τίνα Δαλαμάγκα, Τζένη Νικητοπούλου, Σοφία Γιαννακέα, Νίκος Μπαϊρακτάρης

ΗΜΕΡΕΣ α) Εξηγήστε το είδος της ανοσοβιολογικής απόκρισης που εκδήλωσε το άτομο. Είχε συμπτώματα; Μπορεί να είχε κάνει στο παρελθόν εμβόλιο; Αν είχε κάνει τι ανοσία θα είχε; Εξηγήστε. β) Εξηγήστε το είδος του μικροβίου. Περιγράψτε τη δράση των ιντερφερονών. Του είχε δοθεί αντιβιοτικό ως θεραπεία κατά του μικροβίου; Εξηγήστε. γ) Ποια λεμφοκύτταρα ενεργοποιήθηκαν συνολικά στην απόκριση αυτή; Ποια ακριβώς κύτταρα παρήγαγαν τα κατάλληλα αντισώματα σε μεγάλες ποσότητες; δ) Σε περίπτωση δεύτερης μόλυνσης αργότερα από το ίδιο μικρόβιο, τι απόκριση θα εκδηλωθεί και ποια λεμφοκύτταρα θα ενεργοποιηθούν; 16. Παρακάτω δίνεται γονίδιο από το οποίο μεταγράφεται ένα tRNA καθώς και ο υποκινητής του., όπως και αλληλουχίες λήξης της μεταγραφής του. ΣΗΜΕΙΟ 1 ΣΗΜΕΙΟ 2 ΣΗΜΕΙΟ 3 5΄ATTCGATACCGTACCGGTTAAATCGGTAGCCC3΄ 3΄TAAGCTATGGCATGGCCAATTTAGCCATCGGG5΄ Αν το σημειωμένο τμήμα 1 είναι ο υποκινητής του γονιδίου , το σημειωμένο τμήμα 2 αντιστοιχεί στη λειτουργική τριπλέτα του tRNA που παράγεται και το

σημείο 3 είναι οι Α.Λ.Μ. Ποια από την παραπάνω αλληλουχία είναι το γονίδιο; Ποιο είναι το tRNA που παράγεται και ποιο είναι το αμινοξύ που έχει συνδεδεμένο πάνω του. (ΣΥΜΒΟΥΛΕΥΤΕΙΤΕ ΤΟΝ ΓΕΝΕΤΙΚΟ ΚΩΔΙΚΑ) 17. Δύο ανθρώπινα σπερματοζωάρια έχουν διαφορά στην ποσότητα πυρηνικού γενετικού υλικού κατά 15Mbp (1Μbp=106 ζεύγη βάσεων) Επίσης δίνεται ότι το Υ χρωμόσωμα (μόριο DNA) έχει μήκος 10Mbp . Δίνεται ακόμα ότι το πυρηνικό DNA ενός σωματικού κυττάρου θηλυκού ατόμου προ αντιγραφής έχει μήκος 900Mbp α) να υπολογίσετε το μήκος του Χ μορίου DNA. β) να υπολογίσετε το μήκος των αυτοσωμικών μορίων DNA προ αντιγραφής σε σωματικό κύτταρο. γ) να υπολογίσετε το μήκος το πυρηνικού DNA σε ένα ωάριο και σε ένα σπερματοζωάριο. δ) το μήκος του πυρηνικού DNA αρσενικού ατόμου σε μεταφασικό σωματικό κύτταρο (ΝΑ ΜΗΝ ΛΗΦΘΟΥΝ ΥΠΟΨΗ ΓΟΝΙΔΙΑΚΕΣ ΜΕΤΑΛΛΑΞΕΙΣ ΠΟΥ ΤΥΧΟΝ ΕΠΗΡΕΑΖΟΥΝ ΣΕ ΜΙΚΡΟ ΒΑΘΜΟ ΤΗΝ ΠΟΣΟΤΗΤΑ ΓΕΝΕΤΙΚΟΥ ΥΛΙΚΟΥ. ΕΠΙΣΗΣ ΤΑ ΚΎΤΤΑΡΑ ΠΟΥ ΑΝΑΦΕΡΟΝΤΑΙ ΣΤΗΝ ΑΣΚΗΣΗ ΕΙΝΑΙ ΦΥΣΙΟΛΟΓΙΚΑ ΣΕ ΑΡΙΘΜΟ ΚΑΙ ΔΟΜΗ ΧΡΩΜΟΣΩΜΑΤΩΝ) 18. Το παρακάτω τμήμα DNA ανήκει σε πυρηνικό ινίδιο χρωματίνης και είναι μέρος γονίδιο που φέρει τη γενετική πληροφορία για ολιγοπεπτίδιο. Το υπογραμμισμένο τμήμα είναι εσώνιο. …ATACGGTTATGTTCGCGATCTAATTGGAATAGGACΑTCGATACOH…..Ι αλυσίδα …TATGCCΑATACAAGCGCTAGATTAACCTTATCCTGΤAGCTATG …. ΙΙ αλυσίδα α) Ποιοι οι προσανατολισμοί του μορίου; (ΑΙΤΙΟΛΟΓΗΣΗ) Όταν το παραπάνω τμήμα DNA μεταγράφεται , ποια αλυσίδα του μορίου DNA είναι η μη κωδική; (ΑΙΤΙΟΛΌΓΗΣΗ) Αριστερά ή δεξιά του γονιδίου είναι ο υποκινητής του και γιατί; β) Ποιο το αρχικά παραγόμενο mRNA από το παραπάνω γονίδιο και ποιο αυτό που μεταφράζεται στο ριβόσωμα; Περιγράψτε τη διαδικασία της ωρίμανσης του αρχικού mRNA. Πού γίνεται; Στα δύο mRNA (πρόδρομο και ώριμο ) δείξτε τις περιοχές τους. Εξηγήστε το ισοζύγιο νερού κατά την ωρίμανση. γ) Αν το mRNA έκανε τη μέγιστη σύνδεση στο ριβόσωμα (με αλληλουχία όπως προέκυψε από το παραπάνω τμήμα DNA) ώστε να ξεκινήσει η μετάφραση, να γράψετε την αλληλουχία και το προσανατολισμό του rRNA της μικρής υπομονάδας του ριβοσώματος αυτού. Ποιο αντίστοιχο τμήμα είχε το γονίδιο από το οποίο μεταγράφηκε αυτό το rRNA; Ποια η κωδική και ποια η μη κωδική αλυσίδα του καθώς και η διεύθυνση μεταγραφής; δ) Με χρονική σειρά να γράψετε τα αντικωδικόνια των tRNA που πήραν μέρος στη μετάφραση. (αιτιολογήστε) Τη στιγμή που μόλις ήρθε το 4ο tRNA , πόσοι δεσμοί υδρογόνου είχαν διασπαστεί από την έναρξη της μετάφρασης και μετά; (ΣΥΜΒΟΥΛΕΥΤΕΙΤΕ ΤΟΝ ΓΕΝΕΤΙΚΟ ΚΩΔΙΚΑ) 19. Φαίνεται ένα μέρος της αντιγραφής μορίου DNA στον πυρήνα ευκαρυωτικού κυττάρου. Σχηματίζεται διχάλα αντιγραφής από τη ΘΕΑ και μετά στην οποία έγιναν 3 πρωταρχικά τμήματα. 1 2 ↓ ↓ ΜΗΤΡΙΚΟΣ ΚΛΩΝΟΣ Ι .....TGA CAAΤT GTAΑCGTATAΑGCAA..... . . . . . A C T G Τ U Α A C A U Τ G C A T A T U C G U U . . . . . . . . . U G A C Α U T G T A Α C G T A T A A G C A A . . . . . ΜΗΤΡΙΚΟΣ ΚΛΩΝΟΣ ΙΙ . . . . . Α C T G T T A A C A T Τ G C A T A T T C G T Τ . . . . . α. Πώς χαρακτηρίζεται ο μηχανισμός της αντιγραφής και γιατί; β. Η 1 ή η 2 θέση είναι η Θ.Ε.Α; γ. Ποιοι είναι οι προσανατολισμοί των μητρικών κλώνων; δ. Εντοπίστε τα 3 Π.Τ. που έγιναν στη σχηματιζόμενη διχάλα. Ποιοι οι προσανατολισμοί τους; Ποιος κλώνος αντιγράφεται συνεχώς και ποιος ασυνεχώς; ε. Αν η αντιγραφή των μητρικών κλώνων γίνεται με ταχύτητα 92 νουκλεοτίδια /min, σε πόσo χρόνο θα ολοκλκηρωθεί η αντιγραφή του παραπάνω τμήματος DNA; Επιμέλεια: Φώτης Αλπέτζος

ΜΑΡΑΘΩΝΑΣ:

ΝΕΑ ΜΑΚΡΗ:

ΡΑΦΗΝΑ:

ΠΙΚΕΡΜΙ:

ΣΠΑΤΑ:

Σπηλαίου Πανός 10 τηλ. 2294067757

Δημητριάδη & Καφετζή τηλ. 2294091119

Λ. Φλέμινγκ 40-42 τηλ. 2294026060

Αγίου Χριστοφόρου 15 τηλ. 2106036096

Β. Παύλου 119-121 τηλ. 2106630100


ΠΑΡΑΣΚΕΥΗ 1 ΝΟΕΜΒΡΙΟΥ 2019

Υγεία

15

ΧΡΗΣΙΜΑ ΤΗΛΕΦΩΝΑ ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΝΕΑΣ ΜΑΚΡΗΣ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Αρτέμιδος, 19005 Νέα Μάκρη Τηλέφωνα: 2294321100 2294321111 - 2294321136 Fax: 2294321150 E-mail: nmak1@sismanoglio.gr ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΡΑΦΗΝΑΣ-ΠΙΚΕΡΜΙΟΥ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Ανδρέα Παπανδρέου 36, 19009 Ραφήνα Τηλέφωνα: 2294320039 2294320250 - 2294377777 Fax: 2294077182 ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΣΠΑΤΩΝ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Περιφερειακός Σπύρου Μπέκα & Πικερμίου 1, 19004 Σπάτα Τηλέφωνα: 2132030900 Fax: 2132030945 ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΚΑΠΑΝΔΡΙΤΙΟΥ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Γραμματικογιάννη, 19014 Καπανδρίτι Τηλέφωνα: 2295052612 - 2295052885 2295052222 - 2295320019 Fax: 2295054163 E-mail: iatr-ky1@otenet.gr

25 Χρόνια ΜΑΡΑΘΩΝΕΙΟ & 21 Χρόνια ΔΗΜΟΤΗΣ Ο ΔΗΜΟΤΗΣ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ σε συνεργασία με το ΜΑΡΑΘΩΝΕΙΟ ΔΙΚΤΥΟ ΥΠΗΡΕΣΙΩΝ ΥΓΕΙΑΣ προσφέρει:

ΕΝΤΕΛΩΣ ΔΩΡΕΑΝ Έλεγχος AIDS και ΗΠΑΤΙΤΙΔΑΣ σε νέους 15-55 ετών!

Γενική Αίματος

(Ολική χοληστερόλη, HDL, LDL, TGL και Σάκχαρο) ΟΙ ΠΡΟΣΦΟΡΕΣ ισχύουν για όλους τους αναγνώστες του ΔΗΜΟΤΗ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ με την χρήση του κουπονιού. Τηλέφωνο για ραντεβού:

6936162510


ΓΙΝΕ ΚΑΙ ΕΣΥ

ΕΘΕΛΟΝΤΗΣ Βοήθησε στη διατήρηση και στην ανάπλαση του Πεντελικού Πληροφορίες: 2106131461 - 2108033622

Σύνδεσμος Δήμων για την Προστασία και Ανάπλαση του Πεντελικού (Σ.Π.Α.Π.) info@spap.org.gr

www.spap.org.gr

Κέντρο Επιχειρήσεων : Ηρώων Πολυτεχνείου 27, 152 39 Νέα Πεντέλη

Profile for dhmoths anatolikis attikis

DHM_953_1.11.2019  

DHM_953_1.11.2019  

Profile for dhmoths
Advertisement