Page 1

Ο ΔΗΜΟΤΗΣ

ΑΠΟΨΕΙΣ Αυτοί που φεύγουν και αυτοί που μένουν…

ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ

Η ΕΦΗΜΕΡΙΔΑ ΓΙΑ ΤΗΝ ΤΟΠΙΚΗ ΑΥΤΟΔΙΟΙΚΗΣΗ

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019 ΕΤΟΣ 21ο - ΑΡ. ΦΥΛΛΟΥ 936

Η Παιανία συνεχίζει με τον ίδιο Δήμαρχο Σπύρος Στάμου, Δήμαρχος Παιανίας: Οι πράξεις λένε πάντα την αλήθεια σελ. 12 - 13

Γράφει ο Γιάννης Κοντογεώργος

σελ. 2

Είναι να μη σου τύχει….

Γράφει η Βιργινία Μάρκου

σελ. 4

«Κόκκινα Δάνεια»: Θηλιά στον λαιμό των απροστάτευτων Ελλήνων

Γράφει ο Ιωάννης Β. Σαμέλης

σελ. 9

Εντυπωσιακά μεγάλη προσέλευση για μια ακόμη φορά σε εκδήλωση του Ανδρέα Βασιλόπουλου

Βασίλης Δελαγραμμάτικας: Επιβάλλονται οι συγκλίσεις για ένα σοβαρό και υπεύθυνο Δημοτικό Συμβούλιο

Εκτός Football League ο «Αήττητος Σπάτων»

Νέα Κίνηση για την Κοινότητα Πικερμίου

σελ. 15

σελ. 6 - 7

σελ. 16

σελ. 11


Επικαιρότητα

2

Ο ΔΗΜΟΤΗΣ

ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ

ΙΔΙΟΚΤΗΣΙΑ: ΕΚΔΟΣΕΙΣ ΑΤΤΙΚΗΣ Μ.Ε.Π.Ε. ΕΚΔΟΤΗΣ: ΓΙΑΝΝΗΣ ΚΟΝΤΟΓΕΩΡΓΟΣ ΑΡΧΙΣΥΝΤΑΚΤΡΙΑ: ΒΙΡΓΙΝΙΑ ΜΑΡΚΟΥ ΣΧΕΔΙΑΣΜΟΣ - ΔΙΑΦΗΜΙΣΕΙΣ: ΓΙΑΝΝΗΣ ΚΟΝΤΟΓΕΩΡΓΟΣ ΥΠΕΥΘΥΝΟΣ ΔΙΑΝΟΜΗΣ: ΓΙΑΝΝΗΣ ΚΟΝΤΟΓΕΩΡΓΟΣ ΕΛΕΥΘΕΡΟ ΡΕΠΟΡΤΑΖ: ΔΗΜΗΤΡΗΣ ΠΝΕΥΜΑΤΙΚΑΤΟΣ ΔΗΜΗΤΡΗΣ ΜΑΡΚΟΠΑΝΑΓΙΩΤΗΣ ΕΚΤΥΠΩΣΗ IRIS ΕΚΤΥΠΩΣΕΙΣ Α.Ε.Β.Ε. WEB DESIGNER: PROSPETTIVA SRL ΕΔΡΑ: NEA MAΚΡΗ ΔΗΜΟΥ ΜΑΡΑΘΩΝΟΣ

E-mail: info@dimotisnews.gr

Γράφει o Γιάννης Κοντογεώργος E-mail: kontogeorgos@dimotisnews.gr

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Αυτοί που φεύγουν και αυτοί που μένουν…

Α

ναδιαμορφώνεται συνεχώς, η προεκλογική εικόνα στον Δήμο Μαραθώνα, με διεκδικήσεις, υπαναχωρήσεις, αποχωρήσεις, συνεργασίες και γενικότερα, κινήσεις στελεχών και υποψηφίων, οι οποίοι στοχεύουν στο ματ της κάλπης. Ελάχιστος χρόνος απομένει για το κλείσιμο των ψηφοδελτίων, οπότε και ολοκληρώνεται μία μακρά κι επίπονη προσπάθεια και διαδικασία στελέχωσης, όπου -μοιραία- και «μαχαίρια» βγαίνουν και ανοίγουν τα… σεντούκια της ακατάσχετης υποσχεσιολογίας και ταξίματος (τι μου δίνεις, τι μου φέρνεις, θα σε κάνω αντιδήμαρχο, πρόεδρο κ.λπ.). Οι υποψήφιοι δήμαρχοι Μαραθώνα κ.κ. Στέργιος Τσίρκας, Σπύρος Λιβαθινός, Ευάγγελος Κυπαρίσσης, Νίκος Χατζηγιάννης και Νίκος Στεφανίδης, φαίνεται να έχουν «κλείσει» τις βασικές υποψηφιότητες, αφού έτσι κι αλλιώς, ελάχιστοι μένουν αδέσμευτοι ακόμα, στην πιάτσα, αν κι εκείνοι έχουν δηλώσει συμπάθεια προς τη μία ή την άλλη πλευρά. Όπως μαθαίνουμε, τα πιο μεγάλα «βαρίδια» που στη συνείδηση του κόσμου… κάηκαν πολιτικά, μαζί με τον Ηλία Ψηνάκη στις φωτιές του Ιουλίου, αλλά και στην καταστροφική πενταετή θητεία για τον τόπο, μαζεύονται στον Συνδυασμό του Νίκου Χατζηγιάννη, μετά την οριστική απόφαση του πρώην δημάρχου Μαραθώνα, Ευάγγελου Μέξη, να μην πολιτευτεί. Μία ακόμα εξέλιξη στην περιοχή, των προηγούμενων ημερών, ήταν η αποχώρηση του μέχρι πρότινος υποψήφιου Κώστα Μπούτσικου, από τη διεκδίκηση της δημαρχίας, για λόγους τους οποίους ευθαρσώς και μ’ εντιμότητα ανέλυσε στο προηγούμενο τεύχος της εφημερίδας μας. Οφείλουμε να πούμε ότι κατά κοινή ομολογία, ανεξάρτητα αν κάποιος τον ψήφιζε τελικά ή όχι, ο κ. Μπούτσικος θα ήταν εξαιρετικά χρήσιμος για τον Δήμο μας και θα προσέφερε τα μέγιστα, από όποια θέση και αν εκλεγόταν. Είναι κρίμα και απώλεια για τον τόπο, που αποφάσισε ν’ αποσυρθεί. Επιπροσθέτως, πέραν της διαδικασίας στελέχωσης των ψηφοδελτίων και συναφών επαφών και διεργασιών, κατατίθενται πλέον, και τα τοπικά ψηφοδέλτια, ενώ όπως φαίνεται, οι ρόλοι και αρμοδιότητες των Τοπικών Συμβουλίων, στην ερχόμε-

νη δημοτική περίοδο, θα είναι αναβαθμισμένοι, σε σχέση με το παρελθόν και σύμφωνα με τον Νόμο. Βλέπουμε λοιπόν, να δημιουργούνται ανεξάρτητοι Συνδυασμοί, φαινόμενο που δεν υπήρχε προεκλογικά, ούτε το 2010 ούτε το 2014. Ως τώρα, ξέραμε πως ο κάθε υποψήφιος δήμαρχος «στέγαζε» υπό την Παράταξή του και τους υποψήφιους συμβούλους για τα Τοπικά Συμβούλια. Η κατάσταση έχει φανερά διαφοροποιηθεί, με το πρακτικό ζήτημα και δυσκολία, να έχει βασική ευθύνη για την εν λόγω διαφοροποίηση. Που σημαίνει ότι, ακριβώς επειδή οι Συνδυασμοί που κατεβαίνουν είναι περισσότεροι από κάθε άλλη φορά, η δυσκολία στελέχωσης κι εύρεσης τόσων υποψηφίων (μιλάμε για εκατοντάδες πια) σε μία μικρή σχετικά, περιοχή, είναι προφανής και αναμενόμενη. Πολύ σημαντική τέτοια ανεξάρτητη υποψηφιότητα είναι του πρώην κοινοτάρχη Πικερμίου Θανάση Αδαμόπουλου, με την «Ενωτική Κίνηση Πικερμίου», ο οποίος το επόμενο διάστημα θ’ ανοίξει όλα του τα «χαρτιά» και θα ενημερώσει τους πολίτες, για τον σχεδιασμό του, της επόμενης μέρας, αναφορικά με την πόλη του.

ναι απολύτως λογικό, αλλά θα ήθελα ν’ αναφερθώ σε παρατήρηση που πηγάζει από το περιβάλλον του υποψήφιου δήμαρχου Μαραθώνα, Ευάγγελου Κυπαρίσση, αναφορικά με τη δημιουργία του ανεξάρτητου Συνδυασμού για το Τοπικό Συμβούλιο του Μαραθώνα και τους λόγους για τους οποίους δεν θα συνεργαστεί μαζί τους. «Δεν θα μπορούσα ποτέ ν’ αποδεχτώ τους όρους που τίθενται από την πλευρά του υποψήφιου Τοπικού Συνδυασμού καθώς, τόσο η εν γένει στάση και συμπεριφορά τους -εδώ και μήνες- όσο και αυτοί καθεαυτοί οι όροι τους, είναι αποτρεπτικοί. Πρόκειται για “μη συνεργασίας, όροι και προϋποθέσεις”» δηλώνει χαρακτηριστικά, ο κ. Κυπαρίσσης, συμπληρώνοντας το εξής: «Όταν συζητώ -προσπαθώντας να βρούμε κοινό σημείο επαφής για το καλό του τόπου μας- με τον φερόμενο ως επικεφαλής της συγκεκριμένης ομάδας, με κάποιον μάλιστα, που “φλέρταρε” έντονα με τη διεκδίκηση της δημαρχίας και αυτό το άτομο απαντά μετά από σύσταση του… υποβολέα του, μου είναι εντελώς, αδύνατον, να προχωρήσω σε σοβαρή συνεργασία».

Οφείλουμε να πούμε ότι κατά κοινή ομολογία, ανεξάρτητα αν κάποιος τον ψήφιζε τελικά ή όχι, ο κ. Μπούτσικος θα ήταν εξαιρετικά χρήσιμος για τον Δήμο μας και θα προσέφερε τα μέγιστα, από όποια θέση και αν εκλεγόταν. Είναι κρίμα και απώλεια για τον τόπο, που αποφάσισε ν’ αποσυρθεί.

Στο Γραμματικό έχει ήδη, εδώ και αρκετό καιρό, ανακοινωθεί ανεξάρτητο ψηφοδέλτιο, το «Γραμματικό Μπροστά», ενώ για την πόλη του Μαραθώνα είχαμε πρόσφατη σχετική ανακοίνωση, της «Ανεξάρτητης Ενωτικής Πρωτοβουλίας Κοινότητας Μαραθώνα». Είναι αλήθεια ότι ποικίλουν οι γνώμες και οι απόψεις για τους υποψήφιους συμβούλους Τοπικών Συμβουλίων, κάτι που εί-


Επικαιρότητα

4

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Είναι να μη σου τύχει… Γράφει η Βιργινία Μάρκου Δημοσιογράφος - Συγγραφέας

• Πύρινος ο λόγος του Βασίλη Οικονόμου βουλευτή Επικρατείας Ν.Δ. σε πολιτική συγκέντρωση στη Νέα Μάκρη. • «Η Ρένα Δούρου, αναφερόμενη στον όλεθρο του Καλοκαιριού, δήλωσε το εξής: “Μου έτυχε η άσχημη στη βάρδια μου! τι να κάνουμε;” Δηλαδή, για την κα Δούρου η εξουσία σημαίνει μόνο φρου - φρου, αρώματα, εκδηλώσεις και βεγγέρες και καθόλου ευθύνες, δυσκολίες και… κάπνες» σημείωσε μεταξύ άλλων ο κ. Οικονόμου και συνέχισε: • «Προσπαθούν να μας πείσουν ότι «από καθαρή ατυχία έχουμε νεκρούς και όχι από αδιαφορία, ανοργανωσιά και χύμα κατάσταση!». • «Είναι ασύλληπτο ότι κατεβαίνουν πάλι υποψήφιοι, από τη στιγμή που δεν έχει ξεκαθαρίσει η υπόθεση δικαστικά. Και να σας πω κάτι; Δεν έχετε ιδέα σε τι μπλεξίματα έχουν πέσει όλοι όσοι έχουν κληθεί από τον εισαγγελέα και ας γίνεται τέτοια συντονισμένη προσπάθεια να τους ρίξουν στα ρηχά». • Εν τω μεταξύ, διενεργήθηκε νέα δημοσκόπηση τις προηγούμενες μέρες στον ενιαίο Δήμο Μαραθώνα, για την οποία το μόνο που ξέρουμε σίγουρα, είναι ότι δεν την είχε παραγγείλει ο Στέργιος Τσίρκας. • Κατά τα λοιπά, δεν παίρνουμε όρκο, ούτε ποιος υποψήφιος δήμαρχος βρίσκεται από πίσω (αν κι έχουμε μία ιδέα) ούτε ποια εταιρεία την πραγματοποίησε. • Σοβαρή κι έγκυρη πάντως, αποκλείεται να ήταν, αφού σε σχετική ερώτηση των πολιτών: «από ποια εταιρεία είστε;» η απάντηση ήταν: «είμαστε καινούργιοι στον χώρο και δεν θα μας γνωρίζετε…». • Πέραν αυτού, η «εγκυρότητα» της εν λόγω εταιρείας και κατ’ επέκταση της δημοσκόπησης, αποδεικνύεται και από το γεγονός ότι στη διάρκεια των ερωταπαντήσεων, δίνονταν πληροφορίες στον πολίτη από τον εκπρόσωπο της εταιρείας, για τις μέχρι τότε απαντήσεις και σχόλια!!! • Περιμένουμε λοιπόν, να δούμε εάν κάποιος Συνδυασμός στον Δήμο Μαραθώνα, εμφανίσει στο προσεχές διάστημα αποτελέσματα της συγκεκριμένης μέτρησης. • Θα έχει μεγάλο ενδιαφέρον …και μεγάλη πλάκα! • Πάντως, η προσωπική μας -εντελώς ανεπίσημη- «μέτρηση» από τα μηνύματα που λαμβάνουμε και τις συζητήσεις με συμπολίτες μας, κάνει λόγο για τα εξής:

• Ο υποψήφιος δήμαρχος Μαραθώνα κ. Στέργιος Τσίρκας και η Παράταξη «Πορεία Πράξης» προηγείται ξεκάθαρα, περιμένοντας τον αντίπαλο στη δεύτερη Κυριακή. • Όσο για εκείνους -μέσα από την Παράταξη- οι οποίοι μιλούν για νίκη από την πρώτη Κυριακή, θεωρούμε ότι, είτε είναι πολύ αισιόδοξοι είτε διαθέτουν «άσσους» στα μανίκια, που δεν έχουν ακόμα δημοσιοποιηθεί. • Ένα ακόμα στοιχείο που φαντάζει «σιγουράκι» είναι ότι η πόλη του Μαραθώνα δείχνει να τιμάει δεόντως τον «δικό του» Μαραθωνίτη υποψήφιο δήμαρχο που -ως γνωστό- ακούει στο όνομα του πτέραρχου ε.α. κ. Ευάγγελου Κυπαρίσση. • Βγαίνει και ο Βασίλης Δελαγραμμάτικας στο παρόν φύλλο του «ΔΗΜΟΤΗ» και βάζει τα πράγματα στη θέση τους: • «Η ένσταση κάποιων λίγων εξ αυτών, μάλλον απορρέει από τη μη ανταπόκρισή μας, στην πρόσκληση κομματικού τους, στελέχους για συνεργασία. Σήμερα, προσπαθούν με κομματικές επικλήσεις περιχαράκωσης να κτυπήσουν τη δυναμική της επιλογής της «Δύναμης Πολιτών» να συμπράξει με τον Στέργιο Τσίρκα στην «Πορεία Πράξης». • Άρα, κομματικό στέλεχος της Νέας Δημοκρατίας στην περιοχή της Νέας Μάκρης, είχε ζητήσει συνεργασία με τον Δελαγραμμάτικα και τη «Δύναμη Πολιτών» πλην όμως… έφαγε πόρτα! • Κι έκτοτε, το εν λόγω στέλεχος, το οποίο είναι υποψήφιος δημοτικός σύμβουλος σε αντίπαλη Παράταξη (αντίπαλη της «Πορείας Πράξης») από κοινού με τον επικεφαλής και τους συνυποψήφιούς του, επικρίνουν τη σύμπραξη της «Δύναμης Πολιτών» με τον Τσίρκα.

• Εν ολίγοις, όσα δεν φτάνει η αλεπού τα κάνει κρεμαστάρια! • Για Ραφήνα και Πικέρμι τώρα, φιλοξενούμε αποκλειστικές δηλώσεις του υποψήφιου δήμαρχου Βασίλη Πιστικίδη, ο οποίος συστήνει ψυχραιμία, διαβεβαιώνοντας για πολλοστή φορά, πως θα είναι παρών στην εκλογική μάχη. • Κατανοεί βέβαια, ότι… χαλάει τα σχέδια κάποιων, διασφαλίζοντας -κατά πάσα πιθανότητα- μία θέση στη δεύτερη Κυριακή, αλλά τι να κάνουμε; • Αυτά έχει η ζωή… • Από την άλλη, σχολιάστηκε αρνητικά το γεγονός ότι απείχε ο απερχόμενος δήμαρχος ΡαφήναςΠικερμίου από την αξιόλογη πράγματι, εκδήλωση του υποψήφιου δήμαρχου Ανδρέα Βασιλόπουλου, για τις πυρκαγιές. • Θα έπρεπε λέει, να παραβρεθεί -αν μη τι άλλογια να σηματοδοτήσει τη σημαντικότητα, αφού πρόκειται για ζήτημα ζωής και θανάτου, όπως τραγικά αποδείχτηκε το περασμένο Καλοκαίρι. • Η γνώμη μας είναι κ. Βασιλόπουλε, ότι υπό διαφορετικές συνθήκες και αν η θεματολογία ήταν άλλη, ενδεχομένως και να ερχόταν ο Μπουρνούς. • Σας συμπαθεί κιόλας, προσβλέπει και σε συνεργασία μαζί σας και λοιπά… • Σ’ ενημερωτική ημερίδα όμως, για πυρκαγιές, δεν υπήρχε περίπτωση να εμφανιστεί… • Είναι γνωστό ότι… στον κρεμασμένο δεν μιλούν για σχοινί! • Απείρου κάλλους επεισόδια από την εποχή που ο Θανάσης Αδαμόπουλος ήταν πρόεδρος στην Κοινότητα Πικερμίου κι… έδινε ρέστα στις συνεδριάσεις του Συμβουλίου, θυμηθήκαμε στο Δη-

Βασίλης Οικονόμου: «Είναι ασύλληπτο ότι κατεβαίνουν πάλι υποψήφιοι, από τη στιγμή που δεν έχει ξεκαθαρίσει η υπόθεση δικαστικά...»

• •

μοτικό Συμβούλιο Ραφήνας-Πικερμίου της Τρίτης 2 Απριλίου. «Εδώ και 20 χρόνια προσπαθούμε να βρούμε μία άκρη, προκειμένου να χτιστεί ο ναός στην περιοχή μας. Ας αφήσουμε τα πολλά λόγια και τις ανούσιες διαφωνίες και ας προχωρήσουμε σε συμφωνία να τελειώνουμε με αυτό…». «Όποιος δεν θέλει να ζυμώσει, δέκα μέρες κοσκινίζει» δήλωσε ο Αδαμόπουλος, αγανακτισμένος από την ατέλειωτη συζήτηση επί του θέματος. Έργα, θέλει να βλέπει ο πρώην πρόεδρος Πικερμίου, ενώ η πολυάσχολη καθημερινότητά του, δεν του αφήνει περιθώρια για φλυαρίες και χάσιμο χρόνου. Στον αντίποδα ο Ευάγγελος Μπουρνούς, στον οποίο δώσε μικρόφωνο και πάρτου την ψυχή, που λένε… Μας κουράσατε και πάλι, κύριε δήμαρχε! Δεν είναι δυνατόν να μιλάτε επί μισή ώρα, για την ανέγερση ενός ναού και να χρησιμοποιείτε τόσους τεχνικούς όρους, λες και είμαστε όλοι πολιτικοί μηχανικοί! Να το κοιτάξετε αυτό… ποτέ δεν είναι αργά… Ίσως αυτό να φταίει που δεν προσέρχονται οι δημοτικοί σύμβουλοι της συμπολίτευσης στις συνεδριάσεις και αναγκάζεστε να τους καλείτε στα τηλέφωνα, για να εξασφαλιστεί η πλειοψηφία στις ψηφοφορίες.


ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Επικαιρότητα

Οι αγρότες του Μαραθώνα στο επίκεντρο της «ΣΥΜΜΑΧΙΑΣ» του Σπύρου Λιβαθινού Τα γραφεία του Αγροτικού Συλλόγου Μαραθώνα επισκέφτηκαν τη Δευτέρα 1 Απριλίου, ο υποψήφιος Δήμαρχος Σπύρος Λιβαθινός και οι υποψήφιοι δημοτικοί σύμβουλοι της «ΣΥΜΜΑΧΙΑΣ»: Στέλιος Γεραμάνης, Μανώλης Γκινοσάτης, Νίκος Ζουμπουρλής, Κωνσταντίνος Καβαρνός και Αλέξανδρος Ρέρρας. Κατά τη διάρκεια της δίωρης συζήτησης που πραγματοποιήθηκε με τα μέλη του διοικητικού συμβουλίου ενός συλλόγου που απαριθμεί 350 οργανωμένα μέλη και αποτελεί πρότυπο λειτουργίας για ολόκληρο το Δήμο, ο επικεφαλής της «ΣΥΜΜΑΧΙΑΣ» Σπύρος Λιβαθινός ανέλυσε το πλάνο που εκπονεί ο συνδυασμός προκειμένου να συμβάλλει στην όσο το δυνατόν μεγαλύτερη αγροτική ανάπτυξη της περιοχής, αλλά και στην επίλυση χρόνιων προβλη-

μάτων των αγροτών. Η σύσταση και λειτουργία Γραφείου Αγροτικής Ανάπτυξης, το πρόβλημα υδροδότησης των καλλιεργειών, αλλά κυρίως η αδιαφορία των αρμόδιων υπηρεσιών με την οποία έρχονται καθημερινά αντιμέτωποι οι αγρότες του Μαραθώνα, αποτέλεσαν ορισμένα από τα σημαντικά κεφάλαια της συζήτησης.

Συνάντηση Σπύρου Λιβαθινού Λευτέρη Αυγενάκη Τ

α μεγάλα προβλήματα που αντιμετωπίζει ο Δήμος Μαραθώνα τέθηκαν επί τάπητος κατά τη διάρκεια συνάντησης που είχαν ο επικεφαλής της «ΣΥΜΜΑΧΙΑΣ» και υποψήφιος Δήμαρχος Σπύρος Λιβαθινός, με τον Γραμματέα Π.Ε. της Νέας Δημοκρατίας, Λευτέρη Αυγενάκη. Οι δύο άνδρες συζήτησαν για αρκετή ώρα για την αναγκαιότητα άμεσης αποκατάστασης των πληγέντων περιοχών του Ματιού και του Νέου Βουτζά, την τάχιστη κάλυψη των αναγκών των πυρόπληκτων κατοίκων, το μείζον ζήτημα της λειτουργίας ΧΥΤΑ στο Γραμματικό, αλλά και το οργανωμένο σχέδιο που πρέπει να υποστηριχθεί και από την κεντρική εξουσία, προκειμένου ο Δήμος Μαραθώνα να αποκτήσει ένα παρόν εφάμιλλο και αντάξιο της ιστορικής και πολιτιστικής του κληρονομιάς. Ο Λευτέρης Αυγενάκης εξέφρασε την αμέριστη συμπαράσταση του κόμματος της Νέας Δημο-

κρατίας στην προσπάθεια που έχει ξεκινήσει ο Σπύρος Λιβαθινός (κάτι, άλλωστε, που είχε εκφράσει, σύμφωνα με πληροφορίες, στον υποψήφιο Δήμαρχο Μαραθώνα και ο πρόεδρος της Νέας Δημοκρατίας, Κυριάκος Μητσοτάκης, σε πρόσφατη συνάντηση που πραγματοποιήθηκε στα γραφεία της οδού Πειραιώς), με τους δύο άνδρες να δεσμεύονται σε στενή συνεργασία και μετεκλογικά, προκειμένου ο Δήμος Μαραθώνα να βαδίσει σε μονοπάτια ανάπτυξης.

Κάλεσμα Συμμετοχής στην «Ανεξάρτητη Ενωτική Πρωτοβουλία Κοινότητας Μαραθώνα» Π

αρά τις δύσκολες συνθήκες, υπό τις οποίες ζούμε, δεν παύει να υπάρχει η ελπίδα ότι ο Δήμος, αλλά κυρίως η περιοχή του Μαραθώνα, μπορεί να εξασφαλίσει σε όλους τους κατοίκους της μία καλύτερη ποιότητα ζωής. Έτσι λοιπόν, δημιουργήσαμε μία κίνηση, την «Ανεξάρτητη Ενωτική Πρωτοβουλία Κοινότητας Μαραθώνα», για να φροντίσουμε να βρεθούν οι βέλτιστες λύσεις των προβλημάτων του Μαραθώνα. Με τη βοήθεια και τη συμμετοχή όλων σας, θα πορευτούμε τα επόμενα τέσσερα χρόνια. Ήρθε η στιγμή να δώσουμε τη μάχη για εμάς τους ίδιους, τις οικογένειες μας, το μέλλον των παιδιών μας και για τον ίδιο τον τόπο μας. Πρέπει να αγαπήσουμε τον Μαραθώνα αν θέλουμε να συνεχίσουμε να ζούμε εδώ. Σε αυτή τη μεγάλη αλλαγή καλούμε όλους τους

πολίτες να συμμετέχουν και να συστρατευτούν στο πλευρό μας αδέσμευτα και δημοκρατικά. Συμμετέχουμε ΟΛΟΙ.. Αποφασίζουμε ΟΛΟΙ ΜΑΖΙ… Για την «Ανεξάρτητη Ενωτική Πρωτοβουλία Κοινότητας Μαραθώνα»: Όλια Ασπρίδου, Βασίλης Γκιουρσάνης, Αγγελική Κοκκαλιάρη, Δημήτρης Κυριακός, Μαρία Λαζάρου, Κώστας Λάσκος, Γιώργος Λέπουρης, Σοφία Μπέκα, Ματίνα Μυλωνά, Γιώργος Πάντος

5


Συνέντευξη

6

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

ΒΑΣΊΛΗΣ ΔΕΛΑΓΡΑΜΜΆΤΙΚΑΣ:

Επιβάλλονται οι συγκλίσεις για ένα σοβαρό και υπεύθυνο Δημοτικό Συμβούλιο Συνέντευξη του επικεφαλής της «Δύναμης Πολιτών» και υποψήφιου δημοτικού συμβούλου με την «Πορεία Πράξης» του Στέργιου Τσίρκα στη Βιργινία Μάρκου

Πρόλογος

Γ

νωστός και ιδιαίτερα αγαπητός ο κ. Βασίλης Δελαγράμματικας, στην ευρύτερη περιοχή του Μαραθώνα, τόσο από τη θητεία του ως εκπαιδευτικός και λυκειάρχης όσο και από την τοπική πολιτική δραστηριότητα. Αδιαμφισβήτητα, άτομο με κύρος, σοβαρότητα, μόρφωση και αρχές, αποφασίζει -μαζί με τους συνεργάτες τουνα κάνει πράξη τη θεωρία της σύμπραξης, συναίνεσης και συμπόρευσης προς όφελος των πολιτών και του τόπου, αφήνοντας κατά μέρος κομματικές ιδεολογίες. Στην πολύ ενδιαφέρουσα συνέντευξη που ακολουθεί, απαντά στους επικριτές της σύμπραξης με την «Πορεία Πράξης» και τον Στέργιο Τσίρκα, αφήνοντας σαφώς, να εννοηθεί ότι, εκείνοι που επιχειρηματολογούν εις βάρος της εν λόγω συμφωνίας, είναι οι ίδιοι στους οποίους η «Δύναμη Πολιτών» αρνήθηκε τη στήριξη.

Η συνέντευξη Κύριε Δελαγραμμάτικα όλα δείχνουν πως μπαίνουμε σε μία νέα εποχή στην Αυτοδιοίκηση. Ποια είναι η πρώτη σας εκτίμηση και άποψη για την επόμενη μέρα των εκλογών; Μετά την ολέθρια πενταετία της ΜΗ Δημοτικής Αρχής σίγουρα μπαίνουμε σε μια εποχή μεγάλων απαιτήσεων. Επιβάλλεται ένα πιο σοβαρό και υπεύθυνο Δημοτικό Συμβούλιο. Ούτε κάποια

Είναι καιρός να δώσουμε περιεχόμενο και ουσία στη μικρή Βουλή του Δήμου μας, στο Δ.Σ. Κάτι για το οποίο έχουν ευθύνη οι υποψήφιοι Δήμαρχοι για τις επιλογές τους, έχουν ευθύνη οι πολίτες που θα ψηφίσουν και θα έχουν ευθύνη και όσοι εκλεγούν ανεξαρτήτως Παράταξης. Πρέπει να προσπαθήσουν να συνεννοηθούν μεταξύ τους για να διοικηθεί ο Δήμος.

πλειοψηφία ν’ αυθαιρετεί, αποφασίζοντας επιπόλαια ούτε κάποιοι αντιπολιτευόμενοι ν’ απορρίπτουν αβίαστα προτάσεις. Χρειάζονται συγκλίσεις. Όλοι, τεκμηριωμένα και με προτάσεις, να συμβάλουν. Επιβάλλεται να σοβαρευτούμε καθώς η κρίση που έπληξε τη χώρα από το 2010 είχε τις αιτίες της και στην επιπόλαιη και κακή διαχείριση των αυτοδιοικητικών μας -μεταξύ άλλων- υποθέσεων. Κρίνοντας από τη μέχρι τώρα, στάση και συμπεριφορά του εκλογικού Σώματος, θεωρείτε ότι είμαστε έτοιμοι και ώριμοι γι αυτήν την αλλαγή; Οι συνθήκες ωριμάζουν τους ψηφοφόρους. Το πάθημα του 2014 όπου τόσο επιπόλαια, παρασύρθηκε ένα μεγάλο κομμάτι των ψηφοφόρων, να επιλέξουν έναν λαμπερό, πλην όμως, ανεπαρκέστατο υποψήφιο για δήμαρχο πιστεύω ότι έγινε μάθημα. Πιο σοφά τώρα, θα επιλέξουν με κριτήρια: την εμπειρία, τη γνώση, την ιστορία και την εργατικότητα, αλλά και προσφορά στον τόπο. Εάν δεν ίσχυε ο νέος Νόμος (Κλεισθένης, απλή αναλογική) πιστεύετε ότι θα προχωρούσατε στη σύμπραξη και συνεργασία με τον Συνδυασμό «Πορεία Πράξης» του υποψήφιου δήμαρχου Μαραθώνα κ. Στέργιου Τσίρκα; Ο κόσμος έχει βαρεθεί τις διαμάχες που γίνονται για το θεαθήναι χωρίς ουσιαστικό περιεχόμενο. Η εικόνα που δίνει το σημερινό Δημοτικό Συμβούλιο είναι παράδειγμα προς αποφυγήν. Η πενταετία που τελειώνει, άρχισε με πολλές ελπίδες και γεμάτη τη μεγάλη αίθουσα του Δ.Σ. και κατέληξε σε άδεια καθίσματα (στη μικρή αίθουσα) και τον κόσμο να φεύγει απογοητευμένος. Είναι καιρός να δώσουμε περιεχόμενο και ουσία στη μικρή αυτή, Βουλή του Δήμου μας. Κάτι για το οποίο έχουν ευθύνη οι υποψήφιοι Δήμαρχοι για τις επιλογές τους, έχουν ευθύνη οι πολίτες που θα ψηφίσουν και θα έχουν ευθύνη και όσοι εκλεγούν ανεξαρτήτως Παράταξης. Πρέπει να προσπαθήσουν να συνεννοηθούν μεταξύ τους για να διοικηθεί ο Δήμος. Η λογική της σύμπραξης είναι κεντρική ιδέα της «Δύναμης Πολιτών». Γι’ αυτό, από τον Σεπτέμβριο του 2017 ακόμα, απευθύναμε πρόσκληση στις Αυτοδιοικητικές Δυνάμεις, στους πολίτες και φορείς του Δήμου Μαραθώνα για συγκέντρωση δυνάμεων ώστε να ξεφύγει ο Δήμος μας, από τα τραγικά αδιέξοδα. Ν’ αναλάβουν στελέχη με όραμα και όρεξη για δουλειά, να φέρουν την ανάπτυξη και την ποιότητα ζωής που αξίζει στον τόπο. Καταθέσαμε ένα πλαίσιο αρχών για διαβούλευση, με στόχο μια Νέα Δημοτική Αρχή ευρείας συσπείρωσης, χωρίς ηγεμονίες. Έχοντας τη γνώση και την εμπειρία της δωδεκάχρονη συμμετοχής της Δύναμης Πολιτών στα Δημοτικά Συμβούλια αποφασίσαμε ότι πρέπει να επιδιώξουμε τη σύμπραξη για τη συμμετοχή των συμβούλων μας, σε σχήμα που θ’ αναλάβει διοικητικές ευθύνες και όχι να περιοριστούμε στο ρόλο μειοψηφίας. Κάποιοι πολίτες απορούν με την ένσταση (μικρής μερίδας, είναι αλήθεια) συνδημοτών μας, αναφορικά με τη σύμπραξη. Αναρωτιούνται πώς γίνεται, να έχουν συγκυβερνήσει

Πιο σοφά τώρα, οι συνδημότες μας θα επιλέξουν με κριτήρια: την εμπειρία, τη γνώση, την ιστορία και την εργατικότητα, αλλά και προσφορά στον τόπο.

δύο κόμματα και μάλιστα διαφορετικής ιδεολογίας και να φαντάζει τόσο «δύσκολο» η συνεργασία στη Διοίκηση ενός Δήμου; Η ένσταση κάποιων λίγων εξ αυτών, μάλλον απορρέει από τη μη ανταπόκρισή μας, στην πρόσκληση κομματικού τους στελέχους για συνεργασία. Σήμερα, προσπαθούν με κομματικές επικλήσεις περιχαράκωσης να κτυπήσουν τη δυναμική της επιλογής της «Δύναμης Πολιτών» να συμπράξει με τον Στέργιο Τσίρκα στην «Πορεία Πράξης». Για να το ξεκαθαρίσουμε: η «Δύναμη Πολιτών» δεν είναι Κομματική Παράταξη αλλά ευρεία, ανεξάρτητη συνάντηση πολιτών, που δώδεκα χρόνια τώρα, έχει αποδείξει την προσήλωσή της στα συμφέροντα των πολιτών και της περιοχής μας. Είναι η μοναδική Παράταξη, που λειτουργεί ανοιχτά με καταστατικό κι εκλεγμένο Συντονιστικό. Όσο και να ψάξουν λοιπόν, δεν θα βρουν καμιά παραβίαση των διάφανων θέσεών μας για οποιαδήποτε σκοπιμότητα. Πριν σας ρωτήσουμε το κλασικό «γιατί με τον Στέργιο Τσίρκα» θα θέλαμε να μας υπενθυμίσετε επιγραμματικά, τις σημαντικότερες δράσεις της «Δύναμης Πολιτών». Γιατί ο κ. Τσίρκας προχώρησε σε σύμπραξη μαζί σας; Επειδή η «Δύναμη Πολιτών» με συνέπεια 12 χρόνια τώρα, όχι απλά προτείνει σωστές θέσεις, αλλά αγωνίζεται για την υλοποίηση τους. Από την πρώτη στιγμή της δημαρχίας Ψηνάκη -είχαμε διαβλέψει την ανικανότητά του- δηλώσαμε ότι θα κάνουμε «προγραμματική αντιπολίτευση». Δηλαδή, δεν θα περιοριζόμασταν σε καταγγελίες, αλλά θ’ αγωνιζόμασταν για επίλυση προβλημάτων. Καταθέσαμε πλήθος προτάσεων όπως, για το πρόβλημα του ΟΕΔΑ Γραμματικού να εξασφαλίσει ο Δήμος τεκμηριωμένα στοιχεία με γεωτρήσεις και αξιολόγηση της έκθεσης του ΙΓΜΕ, τη δρομολόγηση της τοπικής διαχείρισης των απορριμμάτων μας, με άμεσα εφικτές λύσεις για ανακύκλωση, όπως του χαρτιού και της κομποστοποίησης των κλαδιών. Δυστυχώς, δεν εισακουστήκαμε, ούτε στην πρόσφατη μελέτη του ΑΠΘ που την πλήρωσε ο Δήμος 25.000€.


Συνέντευξη

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Αναδείξαμε τρόπους χρηματοδότησης για Τοπικά Χωρικά Σχέδια κι εφαρμογή των ρυμοτομικών σχεδίων, καταθέσαμε σχέδιο εκσυγχρονισμού του δημοτικού φωτισμού, κινητοποιηθήκαμε για την αναπλήρωση του γιατρού του Μαραθώνα. Επισημάναμε έγκαιρα τα προβλήματα Πολιτικής Προστασίας και μάλιστα οργανώσαμε το 2017 σχετική ημερίδα. Προτείναμε αναβάθμιση των Εμπορικών Κέντρων και κάναμε μάλιστα και σχετική ημερίδα με καθηγητές του Πολυτεχνείου. Αναδείξαμε ευκαιρίες χρηματοδότησης για τα εμπορικά κέντρα, τον εκσυγχρονισμό του δικτύου ύδρευσης. Πρωτοστατήσαμε στη διαπαραταξιακή οργάνωση της υποστήριξης των πυρόπληκτων συμπολιτών μας κι εργαστήκαμε σιωπηλά, τόσο στην παροχή ειδών κλπ. στο Πολιτιστικό Πάρκο όσο και στην εξυπηρέτησή τους, στην κατάθεση δικαιολογητικών στην Αφετηρία του Μαραθωνίου Δρόμου. Είμαστε πάντα παρόντες εθελοντές στους Μαραθώνιους, στο Κοινωνικό Φροντιστήριο και στις δράσεις του Δήμου. Γιατί λοιπόν, με την «Πορεία Πράξης» και τον Στέργιο Τσίρκα; Από τις επαφές που κάναμε κι έπειτα από τρεις ολομέλειες κι εξαντλητικές συζητήσεις καταλήξαμε με μεγάλη πλειοψηφία, στην απόφαση να συνεργαστούμε με την «Πορεία Πράξης» και τον Στέργιο Τσίρκα ως υποψήφιο δήμαρχο. Επειδή: 1. Ο Στέργιος Τσίρκας είναι ένας ικανός κι έμπειρος γνώστης της Τοπικής Αυτοδιοίκησης. Έχει πρόγραμμα κι έτοιμο σχέδιο δράσης για τον Δήμο. Είναι απλός και χωρίς έπαρση. Δεν πολώνεται και δεν έχει τάσεις αυταρχισμού. 2. Το ψηφοδέλτιο της «Πορείας Πράξης» περιλαμβάνει αξιόλογες προσωπικότητες της κοινωνίας μας, αγωνιστές της Τοπικής Αυ-

Το βιογραφικό μου

Γεννήθηκα στην Αθήνα και μεγάλωσα στη Νέα Σμύρνη. Από τη γέννησή μου παραθέριζα στη Νέα Μάκρη και από το 2000 ζω μόνιμα. Σπούδασα στο Φυσιογνωστικό τμήμα της Φυσικομαθηματικής Σχολής του Αριστοτέλειου Πανεπιστημίου Θεσσαλονίκης. Υπηρέτησα ως καθηγητής στη Μέση Εκπαίδευση. Από το 2000 δίδαξα σε σχολεία της περιοχής μας και ήμουν Διευθυντής του Λυκείου Μαραθώνα μέχρι που συνταξιοδοτήθηκα το 2009. Ιδιαίτερα ευαισθητοποιημένος για τα προβλήματα του τόπου μου αλλά και για την αξία του Μαραθώνα, σημαντικού τόπου τόσο για την ιστορία αλλά και για τις χάρες του, ανέπτυξα σειρά δραστηριοτήτων.

Στη λογική της «Δύναμης Πολιτών» είναι πάντοτε οι συνεργασίες, εννοώντας τις προγραμματικές και όχι τις ευκαιριακές ή χειρότερα «εκβιαστικού τύπου» μετεκλογικές. Πιστεύουμε στη δημοκρατία και στην ευθύνη, αλλά και το ήθος που πρέπει να έχουμε όσοι ασχολούμαστε με τα κοινά.

τοδιοίκησης και δραστήριους πολίτες, οι οποίοι βάζουν τον εαυτό τους στην υπηρεσία του συνόλου. 3. Η «Δύναμη Πολιτών» είναι μια ανεξάρτητη Δημοτική Παράταξη, με μέλη και καταστατικό, με δωδεκάχρονη αγωνιστική παρουσία στη Νέα Μάκρη και τον Μαραθώνα. Η συμμετοχή της, στο ψηφο-

Συμμετείχα σε πρωτοβουλίες για την προστασία του αλλά και την ανάδειξή του. Όπως στην επιτροπή ενάντια στο Τσιμεντονήσι της Νέας Μάκρης το 2004, προστασίας του παραλιακού πευκοδάσους στη Νέα Μάκρη, ενάντια στο ΧΥΤΑ, αποτροπής εγκατάστασης 96 τεράστιων ανεμογεννητριών στον κόλπο του Μαραθώνα, στην καταγγελία για το καρκινογόνο κλοφέν στο παλαιό αντλιοστάσιο της ΕΥΔΑΠ στο Κάτω Σούλι και τελικά την εξυγίανση της περιοχής της Μακαρίας πηγής, τις καταγγελίες για παράνομες απορρίψεις χιλιάδων τόνων απορριμμάτων σε νταμάρια και ρεματιές του Μαραθώνα, στην επαναφορά της 24ώρης λειτουργίας του Κέντρου Υγείας Νέας Μάκρης κ.ά.

7

δέλτιο «Πορεία Πράξης» του Στέργιου Τσίρκα, γίνεται στη βάση του σεβασμού της προγενέστερης πορείας και φυσιογνωμίας της, στα πλαίσια ενός ευρύτερου κι ενωτικού σχήματος. 4. Με τον νέο νόμο «Κλεισθένη» καθιερώνεται για πρώτη φορά, η απλή αναλογική στις αυτοδιοικητικές εκλογές. Με την απλή αναλογική, οι συνεργασίες μεταξύ των διαφορετικών παρατάξεων είναι μονόδρομος για να προχωρήσει το δημοτικό έργο. Αυτόν τον δρόμο ακολουθούμε στην «Πορεία Πράξης» και είμαστε βέβαιοι ότι η πλειοψηφία των δημοτών θα συμπαραταχθεί μαζί μας, για την ανεμπόδιστη πρόοδο του τόπου μας. Και για να πούμε επιτέλους, τα πράγματα με τ’ όνομά τους κι επειδή ασκείται κριτική, είναι η ώρα νομίζουμε, να δημοσιοποιήσετε εάν είχατε κάνει συζητήσεις και με τους άλλους υποψήφιους δήμαρχους… Με όλους τους σημερινούς υποψηφίους, αλλά και τους αποσυρθέντες είχαμε επικοινωνήσει και τους δώσαμε την πρόταση συσπείρωσης για μια «Νέα Δημοτική Αρχή». Κάποιοι μάλιστα, παρακολούθησαν αρκετές από τις ολομέλειές μας και ήμασταν σε συχνή επαφή. Κάποιος άλλος, μας ζήτησε να διαλυθούμε για να συνεργαστούμε! Και τέλος, υπήρξε και περίπτωση, που δεν απάντησε καν στην πρόσκλησή μας για συνάντηση. Όπως προανέφερα, στη λογική της «Δύναμης Πολιτών» είναι πάντοτε οι συνεργασίες, εννοώντας τις προγραμματικές και όχι τις ευκαιριακές ή χειρότερα «εκβιαστικού τύπου» μετεκλογικές. Πιστεύουμε στη δημοκρατία και στην ευθύνη, αλλά και το ήθος που πρέπει να έχουμε όσοι ασχολούμαστε με τα κοινά. Έτσι πορευτήκαμε έως τώρα, έτσι και θα συνεχίσουμε!

Συνιδρυτής και επί 11 χρόνια πρόεδρος των Φίλων του Αρχαιολογικού Μουσείου Μαραθώνα που επιδιώκει την προστασία και ανάδειξη της αρχαίας πολιτιστικής μας κληρονομιάς. Είμαι δημοτικός σύμβουλος, επικεφαλής της «Δύναμης Πολιτών» της δημοτικής παράταξης που από το 2006 μάχεται για την προκοπή του τόπου μας μέσα και από τα δημοτικά συμβούλια. Η δράση της «Δύναμης Πολιτών» πάντα στόχευε στην πραγματοποίηση λύσεων και όχι απλά στη διακήρυξή τους. Πάντα επιδιώκαμε τη συνεργασία για την επίλυση των προβλημάτων. Πετύχαμε έτσι από την πρώτη ημέρα μετά την πυρκαγιά, το διαπαραταξιακό συντονισμό στη συνδρομή στους πυρόπληκτους συμπολίτες μας.

Σε αυτό το πνεύμα της συνεργασίας καλέσαμε τις δυνάμεις της περιοχής σε εκλογική σύμπραξη για να ανακάμψει ο Δήμος από την απαράδεκτη κατάσταση που έχει οδηγηθεί. Σε αυτή τη λογική ευοδώθηκε η συνεργασία της «Δύναμης Πολιτών» με τον Στέργιο Τσίρκα με τη δημιουργία του ενωτικού συνδυασμού «ΠΟΡΕΙΑ ΠΡΑΞΗΣ». Ελπίζουμε ότι συμμετέχοντας στη διοίκηση του Δήμου με την επιτυχία της «ΠΟΡΕΙΑΣ ΠΡΑΞΗΣ» θα έχουμε την ευκαιρία με το πείσμα τις καθαρές θέσεις μας αλλά και με την εργατικότητά την εμπειρία και τη γνώση, πιο αποτελεσματικά να βοηθήσουμε τον τόπο και τους κατοίκους της .


Επικαιρότητα

8

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Κοντά στα σχολεία Επιτυχημένη ημερίδα η «Πορεία Πράξης» του Γιώργου Βλάχου του Στέργιου Τσίρκα στο Πυρόπληκτο Μάτι Τ

ην Τρίτη 26 Μαρτίου ο υποψήφιος δήμαρχος Μαραθώνα και επικεφαλής της παράταξης «Πορεία Πράξης» Στέργιος Τσίρκας συναντήθηκε με τον διευθυντή του δημοτικού σχολείου της Αγίας Μαρίνας, Κωνσταντίνο Πατούρη, συνοδευόμενος από τις υποψήφιες δημοτικούς συμβούλους, Βίκυ Λιάπη, Βίκυ Βουκαίνα και Φωτεινή Σακαρίκου Καραγιάννη. Ο κ. Πατούρης αναφέρθηκε σε βασικά προβλήματα που αντιμετωπίζει το σχολείο όπως η πυρασφάλεια, η μη απόδοση φόρου στη σχολική επιτροπή με αποτέλεσμα πολλά από τα έξοδα να καλύπτονται από δωρεές και τώρα που το σχολείο θα υποδεχτεί μαθητές και δασκάλους από το πρόγραμμα erasmus , χρειάζεται ανακαίνιση , βάψιμο και καλή σύνδεση ίντερνετ. Ο Στέργιος Τσίρκας είπε ότι η συζήτηση και η ενημέρωση από τον διευθυντή κ. Πατούρη έδωσε την ευκαιρία να μιλήσουν για λύσεις και πρέπει να γίνονται αυτές οι συναντήσεις σε τακτικά χρονικά διαστήματα! Ο Δήμαρχος και οι δημοτικοί σύμβουλοι πρέπει και οφείλουν να είναι δίπλα στους πολίτες ανά πάσα στιγμή!

Στην Τεχνική Υπηρεσία του Δήμου Μαραθώνος ο Ευάγγελος Κυπαρίσσης Μ

ε τον Διευθυντή της Τεχνικής Υπηρεσίας του Δήμου Μαραθώνος, Γεώργιο Κολοβό συναντήθηκε ο επικεφαλής της παράταξης «ΝΕΟΙ ΟΡΙΖΟΝΤΕΣ» και υποψήφιος Δήμαρχος κ. Ευάγγελος Κυπαρίσσης την Πέμπτη 21 Μαρτίου. Συζήτησαν θέματα που αφορούν στην πυρασφάλεια των Σχολικών Μονάδων του Δήμου. Επισημάνθηκε η ανάγκη της επιτάχυνσης των διαδικασιών εκπόνησης μελετών ενεργητικής πυροπροστασίας των σχολείων του Δήμου, οι οποίες θα δρομολογήσουν την χορήγηση από την πυροσβεστική υπηρεσία του αντίστοιχου πιστοποιητικού πυρασφάλειας σε κάθε σχολείο όπως απαιτείται για την ασφαλή τους λειτουργία. Επίσης καταδείχθηκε ότι για τον λόγο αυτό οι διευθυντές των σχολείων του Δήμου καλούνται ως υπόλογοι σε αίθουσες δικαστηρίων, παρόλο που αυτοί δεν μπορούν να θεραπεύσουν το πρόβλημα, και βρίσκονται αντιμέτωποι με νομικές κυρώσεις.

Με

μεγάλη επιτυχία πραγματοποιήθηκε την Κυριακή 31 Μαρτίου στο Ξενοδοχείο «Μάτι», η ενημερωτική ημερίδα που διοργάνωσε ο Βουλευτής Αττικής Γιώργος Βλάχος με θέμα «Ανάδειξη προβλημάτων της πληγείσας περιοχής της Ανατολικής Αττικής και προτεινόμενες λύσεις». Στην ημερίδα προσήλθαν εκατοντάδες πολίτες οι οποίοι είχαν την ευκαιρία, μαζί με εκπρόσωπους φορέων της περιοχής, να τοποθετηθούν για τα προβλήματα που εξακολουθούν να υπάρχουν από την περσινή καταστροφική πυρκαγιά που στοίχισε τη ζωή σε 101 συμπολίτες μας. Στόχος της ημερίδας ήταν να συμβάλλει στην καταγραφή των απαιτούμενων βημάτων για να αποκατασταθεί η κανονικότητα στην περιοχή, ενώ ο Γιώργος Βλάχος τόνισε μεταξύ άλλων ότι «το κράτος έχει συνέχεια και ότι η επόμενη κυβέρνηση με Πρωθυπουργό τον Κυριάκο Μητσοτάκη, θα ολοκληρώσει τις εκκρεμότητες που αφήνει η σημερινή Κυβέρνηση». Σημείωσε επίσης, ότι όλες οι προτάσεις και τα συμπεράσματα που προέκυψαν από την ημερίδα θα καταγραφούν και ότι ο ίδιος θα ενημερώσει για τα αποτελέσματα τον Πρόεδρο της Νέας Δημοκρατίας.


Επικαιρότητα

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

9

«Κόκκινα Δάνεια»: Θηλιά στον λαιμό των απροστάτευτων Ελλήνων

Η

κυβέρνηση επαίρεται ότι η χώρα βγήκε από τα μνημόνια, όμως η αλήθεια είναι διαφορετική, και οι πολίτες στενάζουν από τα οικονομικά Γράφει ο Ιωάννης Σαμέλης Δικηγόρος - Οικονομολόγος, βάρη που αυτή τους Μέλος Μητρώου Στελεχών ΝΔ φόρτωσε, ή δεν αντιμετώπισε. Αντιθέτως, καταργήθηκε και ο προστατευτικός νόμος Κατσέλη, και οι οφειλέτες αντιμετωπίζουν τα κόκκινα δάνεια, ως βρόγχο που τους πνίγει. Σήμερα ένας στους δύο Έλληνες χρωστάει στην εφορία ή σε κάποιο ταμείο. Οι πολίτες φορτώθηκαν με 29 νέους φόρους, αλλά και με 17 μειώσεις συντάξεων και αυξήσεις εισφορών. Οι κατασχέσεις λογαριασμών έφτασαν τα έξι εκατομμύρια και οι πλειστηριασμοί θα πλησιάσουν τα τρία εκατομμύρια. Όλα αυτά από το κόμμα που εξελέγη υποσχόμενο σεισάχθεια. Δύο στους 10 δυσκολεύονται να πληρώσουν το ρεύμα τους και 4 στους 10 τα φάρμακά τους. Χωρίς ΕΚΑΣ και με τιμές που συνεχώς ανεβαίνουν λόγω ΦΠΑ, τα μεγαλύτερα θύματα είναι οι πιο αδύναμοι συμπολίτες μας. Οι φόροι διέλυσαν, πλέον, και τη μεσαία τάξη που ήταν πάντα η σπονδυλική στήλη της κοινωνίας μας. Τα δυσβάσταχτα πλεονάσματα της κυβέρνησης, πνίγουν την οικονομία. Το ληξιπρόθεσμο ιδιωτικό χρέος αποτελεί το μείζον πρόβλημα για την οικονομία μας που λόγω της ανερμάτιστης πολιτικής του

ΣΥΡΙΖΑ, καθώς αυτό διογκώθηκε αντί να μειωθεί στα τέσσερα χρόνια της διακυβέρνησής του. Ανέρχεται σήμερα στα 223 δισ. ευρώ, από 183 δισ. ευρώ που ήταν το 2014. Από αυτά, περίπου τα 85 δισ. ευρώ είναι «κόκκινα δάνεια» και τα υπόλοιπα είναι χρέη σε εφορίες και ασφαλιστικά ταμεία. Το πρόβλημα είναι σοβαρότατο και η κυβέρνηση -με τέσσερα χρόνια καθυστέρηση κι ύστερα από απίστευτες παλινωδίες- επιχειρεί να ρυθμίσει ένα πολύ μικρό τμήμα του. Έχει, μάλιστα, το θράσος να πανηγυρίζει, μολονότι καταργήθηκε ο νόμος Κατσέλη, ενώ η ρύθμιση που κατέθεσε στη Βουλή θέτει αυστηρότερα όρια προστασίας της πρώτης κατοικίας ακόμη και από αυτά που η ίδια υποσχόταν μέχρι πρότινος. Παράλληλα, δεν προβλέπει στη ρύθμιση καμία επιβράβευση των συνεπών δανειοληπτών οι οποίοι κράτησαν με θυσίες τα τελευταία χρόνια όρθιο το τραπεζικό σύστημα και την οικονομία της χώρας, τιμωρώντας τους ουσιαστικά για την συνέπειά τους. Είναι πραγματικά αδιανόητο ότι η κυβέρνηση ουδέποτε έθεσε στο τραπέζι της διαπραγμάτευσης αυτή την αυτονόητη παράμετρο, κλείνοντας το μάτι στους ασυνεπείς, και αδιαφορώντας για αυτούς που όλα τα χρόνια της κρίσης, πληρώνουν τις υποχρεώσεις τους. Είναι πραγματικά αδιανόητο ότι η κυβέρνηση ουδέποτε έθεσε στο τραπέζι της διαπραγμάτευσης αυτή την αυτονόητη παράμετρο, κλείνοντας το μάτι στους στρατηγικούς κακοπληρωτές, και αδιαφορώντας για τους συνεπείς δανειολήπτες που όλα τα χρόνια της κρίσης, πληρώνουν τις υποχρεώσεις τους. Την ώρα που είναι επιτακτικά αναγκαία μια ρύθμιση για την προστασία της πρώτης κατοικίας των ασθενέστερων δανειοληπτών, ουσιαστική, πρακτική και ορθολογική, και όχι περίπλοκη και γρα-

Το ληξιπρόθεσμο ιδιωτικό χρέος αποτελεί το μείζον πρόβλημα για την οικονομία μας που λόγω της ανερμάτιστης πολιτικής του ΣΥΡΙΖΑ, καθώς αυτό διογκώθηκε αντί να μειωθεί στα τέσσερα χρόνια της διακυβέρνησής του.

φειοκρατική, η κυβέρνηση φέρνει έναν νόμο που συνιστά υποχώρηση έναντι του προστατευτικού πλαισίου που υπήρχε όλα αυτά τα χρόνια, δεν λύνει το πρόβλημα των «κόκκινων δανείων» και τα καθιστά θηλιά στον λαιμό των Ελλήνων, χωρίς καμία πλέον νομική προστασία.


Επικαιρότητα

10

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

«Εργαλείο διοίκησης» χαρακτηρίζει ο Ανδρέας

Βασιλόπουλος τις συναντήσεις με τοπικούς φορείς και συλλόγους

«Η

αξία της πληροφορίας που λαμβάνουμε απευθείας από τον κόσμο πολύτιμο εργαλείο διοίκησης για εμάς. Αυτός είναι και ο λόγος που από το 2014 βρισκόμαστε σε διαρκή επικοινωνία με τοπικούς φορείς και συλλόγους, κάτι που θα συνεχίσουμε να κάνουμε και μετά τον Μάιο του 2019», τονίζει στους συνεργάτες του o Ανδρέας Βασιλόπουλος. Στο πλαίσιο κατάρτισης ενός πλήρους και τεκμηριωμένου προεκλογικού προγράμματος, στο οποίο ξεκάθαρα θα αναφέρονται οι θέσεις και ο τρόπος μετεκλογικής διοίκησης, ο επικεφαλής της «Δύναμης Αναπτυξης», καθηγητής και υποψήφιος δήμαρχος Ραφήνας-Πικερμίου Ανδρέας Βασιλόπουλος, συνεχίζει με έντονο ρυθμό τις συναντήσεις με τους τοπικούς φορείς και συλ-

λόγους. Στόχος του, να ακούσει από πρώτο χέρι τα προβλήματα που αντιμετωπίζουν οι κάτοικοι-μέλη και να συζητήσει με τα μέλη των Διοικητών Συμβουλίων τους βέλτιστους τρόπους αντιμετώπισής τους. Ολοκληρώνοντας τον πρώτο επίσημο κύκλο συναντήσεων, με τον Πολιτιστικό Σύλλογο Πικερμίου «Δεινοθήριο», τον Σύνδεσμο Μονίμων Κατοίκων Διώνης «Ωκεανίς», τον Συνεταιρισμό Υπαλλήλων Εταιρειών Πετρελαίου «το Μελτέμι» και τον Περιβαλλοντικό και Πολιτιστικό Σύλλογο «η Διώνη», συνεχίζει τις επόμενες ημέρες με τους συλλόγους που ήδη έχουν ανταποκριθεί. Όλες οι συναντήσεις γίνονται σε θερμό κλίμα και με ιδιαίτερα εποικοδομητικά αποτελέσματα.

Η Δημοτική Παράταξη «ΝΕΑ ΑΡΧΗ» Εγκληματική αμέλεια στην στον Πολιτιστικό Σύλλογο Πικερμίου «ανακαίνιση» του γηπέδου το «Δεινοθήριο»

Σ

τα πλαίσια των επαφών της Δημοτικής Παράταξης «ΝΕΑ ΑΡΧΗ» με συλλόγους και φορείς του Δήμου Ραφήνας-Πικερμίου, πραγματοποιήθηκε την Δευτέρα 1 Απριλίου 2019 συνάντηση με το Δ.Σ. του Πολιτιστικού Συλλόγου Πικερμίου το «Δεινοθήριο». Στη συνάντηση πήραν μέρος ο επικεφαλής της παράταξης «ΝΕΑ ΑΡΧΗ» και υποψήφιος Δήμαρχος Βασίλης Πιστικίδης καθώς και οι συνεργάτες του υποψήφιοι Δημοτικοί Σύμβουλοι Αντώνης Παλπατζής, Κώστας Παροικάκης και Γιώργος Δουβίτσας. Η σύσκεψη είχε στόχο την αλληλοενημέρωση για θέματα που αφορούν τα πολιτιστικά δρώμενα στο Πικέρμι και στο Δήμο μας γενικότερα. Επιβεβαιώθηκε η κοινή αντίληψη ότι χρειάζεται στενότερη συνεργασία Συλλόγων και Δημοτικού Οργανισμού Πολιτισμού ώστε να προκύψουν τα καλύτερα αποτελέσματα που όλοι επιθυμούμε. Ήταν σαφής η δέσμευση της «ΝΕΑΣ ΑΡΧΗΣ» να συμπεριλάβει στο προεκλογικό της πρόγραμμα,

λύσεις κοινά επεξεργασμένες με στόχο την «πολιτιστική άνοιξη» της περιοχής μας. H «ΝΕΑ ΑΡΧΗ» ευχαριστεί τον πρόεδρο κ. Α. Καφφέζα και τα μέλη του Δ.Σ., για την εποικοδομητική συζήτηση και πιστεύει ότι μέσα από τον γόνιμο και ειλικρινή διάλογο που θα συνεχισθεί, θα δρομολογηθούν -στη νέα δημοτική περίοδο- λύσεις που θα βελτιώσουν την καθημερινότητα όλων αυτών που προσπαθούν να αναδείξουν την Ελληνική παράδοση, τον πολιτισμό και την πνευματική αναβάθμιση στον Δήμο Ραφήνας-Πικερμίου.

Μαρικαίτη Αλβέρτη: Δωρεάν στάθμευση για όλους τους μόνιμους κατοίκους Η

τοπική αγορά αποκλείεται να στηριχθεί από τους ντόπιους όσο η δημοτική αρχή αποφασίζει να χρεώνει τη στάθμευση ακόμα και στους μόνιμους κατοίκους. Δεν είναι το ετήσιο κόστος, αλλά η αδικία και η διάκριση. Από το 2019 σχεδιάζουμε τη δωρεάν κάρτα στάθμευσης για όλους τους μόνιμους κατοί-

κους που στηρίζουν την τοπική αγορά και αυστηρά πρόστιμα για όλους τους μη-δημότες που σταθμεύουν για πάνω από 8 ώρες. *Η Μαρικαίτη Αλβέρτη είναι υποψήφια δημοτική σύμβουλος με τη «Δύναμη Ανάπτυξης» και τον καθηγητή Ανδρέα Βασιλόπουλο.

Διώνης από το Δήμο Ραφήνας-Πικερμίου καταγγέλλει ο Δημήτρης Πόθας

Οι

βασικοί χώροι στους οποίους κινούνται τα παιδιά μας, οι παιδικές χαρές και τα γήπεδα για τις αθλητικές τους δραστηριότητες πρέπει να είναι πάνω απ όλα ασφαλείς. Είναι απαράδεκτο να μην αντιλαμβανόμαστε την τεράστια ευθύνη όταν μιλάμε για ανακαίνιση τέτοιων χώρων! Οι κακοτεχνίες και η προχειρότητα με την οποία έγιναν οι εργασίες «ανακαίνισης» (!) στο γήπεδο της Διώνης το καθιστούν επικίνδυνο! Περιμετρικά του παρκέ υπάρχει ακάλυπτο, εγκληματικά κοφτερό μεταλλικό πλέγμα στήριξης (φωτογραφίες 1 & 2), το οποίο θα προκαλέσει σοβαρό τραυματισμό στους αθλητές και τους εν γένει χρήστες του γηπέδου. Κύριε δήμαρχε, η ασφάλεια των παιδιών και των αθλητών οφείλει να είναι ψηλά στις προτεραιότητες σας. *Ο Δημήτρης Πόθας είναι Μηχανικός Αυτοματισμού, μόνιμος κάτοικος Πικερμίου και υποψήφιος δημοτικός σύμβουλος με τη «Δύναμη Ανάπτυξης» και τον καθηγητή Ανδρέα Βασιλόπουλο.


Επικαιρότητα

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Ανεξάρτητο ψηφοδέλτιο με πρωτοβουλία του Θανάση Αδαμόπουλου

Νέα Κίνηση για την Κοινότητα Πικερμίου

11

Γιώργος Ρέμιος: Απαράδεκτη η κατάσταση των δρόμων στο δήμο μας

«Ε

νωτική Κίνηση Πικερμίου» όπως ακριβώς ονομαζόταν ο Συνδυασμός του πρώην κοινοτάρχη της περιοχής, κ. Θανάση Αδαμόπουλου, ονομάζεται ο Συνδυασμός που θα διεκδικήσει την εκπροσώπηση, αλλά και τη διοίκηση της Κοινότητας Πικερμίου στις προσεχείς αυτοδιοικητικές εκλογές. Ο συνδυασμός, ο οποίος θα αποτελείται από μέλη της τοπικής κοινωνίας του Πικερμίου τα οποία έχουν εκδηλώσει ήδη το ενδιαφέρον τους για την πορεία του τόπου τους και είναι έτοιμα να προσφέρουν όλες τους τις δυνάμεις και τα οποια θα ανακοινωθουν τις επομενες ημερες, θα είναι ανεξάρτητος (δεν ανήκει, ούτε αποτελεί «προέκταση» κάποιας υποψήφιας Δημοτικής Παράταξης του Δήμου Ραφήνας-Πικερμίου) καλεί σε συστράτευση όλους τους πολίτες του Πικερμίου, υποσχόμενος ότι «τα συμφέροντα και οι ανάγκες της περιοχής, θα διεκδικούνται δυναμικά και θα καλύπτονται στο έπακρον πλέον, από τη Διοίκηση του ενιαίου Δήμου και της επόμενης Δημοτικής Αρχής. Οι δύο πόλεις θ’ αντιμετωπίζονται ισότιμα» όπως δηλώνει χαρακτηριστικά ο Θανάσης Αδαμόπουλος, ο οποίος πολύ σύντομα, προτίθεται να παραχωρήσει συνέντευξη εφ όλης της ύλης στην εφημερίδα μας.

Α

παραίτητο και σημαντικό είναι κάποιος να μπορεί να κυκλοφορήσει στην περιοχή που ζει με άνεση, ειδικά οι άνθρωποι που χρήζουν κάποια βοήθεια (ΑΜΕΑ, άνθρωποι τρίτης ηλικίας, μαμάδες με καροτσάκια, άτομα με πατερίτσες κ.λπ.). Το θέμα της προσβασιμότητας ξεκινάει από το άνοιγμα της πόρτας του σπιτιού μας και φτά-

νει μέχρι την επιστροφή μας σε αυτό. Στο Δήμο Ραφήνας-Πικερμίου, υπάρχουν ακόμη δρόμοι χωμάτινοι και κακοτράχαλοι, δρόμοι ασφαλτοστρωμένοι μεν γεμάτοι λακούβες δε, δρόμοι μη προσπελάσιμοι και επικίνδυνοι. Η εικόνα αυτής της απαράδεκτης κατάστασης σχεδιάζουμε να αλλάξει γρήγορα. Με σωστές μελέτες, δρομολόγηση και υλοποίηση έργων μικρής και μεγάλης κλίμακας θα βοηθήσουμε ώστε η πόλη μας να γίνει ανθρώπινη και λειτουργική. *Ο Γιώργος Ρέμιος με σπουδές οικονομικών, ανάλυσης και διαχείρισης χαρτοφυλακίου, έχει διατελέσει υψηλόβαθμο στέλεχος του Ταχυδρομικού Ταμιευτηρίου και είναι υποψήφιος δημοτικός σύμβουλος με τη «Δύναμη Ανάπτυξης» και τον καθηγητή Ανδρέα Βασιλόπουλο.


Πρώτο Θέμα

12

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Η Παιανία συνεχίζει με το Σπύρος Στάμου: «Οι πράξεις λένε πάντα την αλήθεια»

Π

ρωτοφανής σε μέγεθος, δυναμισμό και πανηγυρικό τόνο η εκδήλωση για τον απολογισμό της Δημοτικής Αρχής του Δήμου Παιανίας - Γλυκών Νερών, για την Δημοτική Ενότητα Παιανίας, που πραγματοποιήθηκε την Κυριακή 31 Μαρτίου 2019 στο Μουσείο Βορρέ. Ένας θεαματικός απολογισμός του «τι παραλάβαμε» και τι «παραδίδουμε» πληθώρα έργων, αλλά κι άκρως επιτυχημένη προεκλογική εκδήλωση για όσα επίσης, σπουδαία, θ’ ακολουθήσουν στον Δήμο Παιανίας - Γλυκών Νερών υπό την… μπαγκέτα του δημάρχου κ. Σπύρου Στάμου. Είναι χαρακτηριστικό ότι, ενώ οποιοσδήποτε δήμαρχος θα προ-

τιμούσε να διοργανώσει μία συγκέντρωση για αμφότερες τις περιοχές του ενιαίου Δήμου, ο κ. Σπύρος Στάμου τόλμησε -όντας σίγουρος για το αποτέλεσμα- να διοργανώσει δύο διαφορετικές εκδηλώσεις. Σύντομα λοιπόν, το σκηνικό της περασμένης Κυριακής αναμένεται να επαναληφθεί και στα Γλυκά Νερά με τον απολογισμό έργων που έχουν πραγματοποιηθεί στην εν λόγω Δημοτική Ενότητα, καταδεικνύοντας έτσι -από πλευράς Δημοτικής Αρχής- πόσο ισότιμα υπολογίζονται, εκπροσωπούνται και αναδεικνύονται οι δυο Δημοτικές Ενότητες. Ο χώρος του μουσείου «σείστηκε» είναι αλήθεια, από τους εκατοντάδες (περίπου 1.000 άτομα) πολίτες -Παιανιώτες στο σύνο-

λό τους- οι οποίοι έδωσαν βροντερό παρόν στην εκδήλωση, τιμώντας τον δήμαρχο κ. Σπύρο Στάμου και τους συνεργάτες του, για τις υπηρεσίες τους, εδώ και πέντε χρόνια. Αναφορικά δε, με τους συνεργάτες του, ο δήμαρχος Παιανίας ευχαρίστησε αρκετές φορές τον πρώην δήμαρχο Γλυκών Νερών κ. Λάμπρο Κασαγιάννη, ο οποίος κοσμεί πλέον, τον Συνδυασμό του, καθώς και τους κ.κ. Γιώργο Δάβαρη, Θανάση Χατζηδάβαρη και την κα Ξένια Μπαλκανά Ντούγια, οι οποίοι απέσυραν τις υποψηφιότητες τους για τη δημαρχία και συνεργαζόμενοι με τον δήμαρχο κ. Σπύρο Στάμου, προχωρούν ενωμένοι για το συμφέρον των δημοτών των πόλεων της Παιανίας και των Γλυκών Νερών! Ιδιαίτερες ήταν και οι ευχαριστίες του κ. Σπύρου Στάμου προς τον ευεργέτη κ. Θανάση Μαρτίνο για τη χορηγία κατασκευής του νέου υπερσύγχρονου δημαρχιακού μεγάρου, ενώ το γεγονός ότι ο Δήμος Παιανίας - Γλυκών Νερών επιλέχθηκε να είναι και ο πρώτος στα Μεσόγεια όπου θα κατασκευαστεί η αποχέτευση, τονίστηκε μ’ έμφαση. Μία ακόμα πρωτιά για τον Δήμο είναι ότι είναι απαλλαγμένος από χρέη, κάτι για το οποίο ο κ. Σπύρος Στά-

Απολογισμός έργ Αποχέτευση Αντιμετωπίσαμε τον κινδυνο της απένταξης του έργου. Το έργο αυτή τη στιγμή βρίσκεται στο 30% της υλοποίησής του, μετά την αδυναμία του πρώτου αναδόχου για την ολοκλήρωσή του. Πολύ σύντομα οι εργασίες θα συνεχιστούν με τον δεύτερο ανάδοχο. Νέο Δημαρχείο Πρόκειται για ένα κτίριο 2000 τετραγωνικών μέτρων, σύγχρονο και λειτουργικό, που θα κτιστεί ανάμεσα στις δύο πόλεις μας την Παιανία και τα Γλυκά Νερά. Η διαδικασία μελέτης και αδειοδότησης έχουν ήδη δρομολογηθεί (εξασφαλίστηκε η έγκριση από την Πολεοδομία για την ανέγερση), χρηματοδότης και χορηγός είναι ο επιφανής εφοπλιστής, Αθανάσιος Μαρτίνος, γνωστός για το κοινωνικό του έργο. Οι εργασίες ανέγερσης του νέου Δημαρχείου αναμένεται να ξεκινήσουν εντός του 2019. Νέος στόλος και όρχος οχημάτων Προχωρήσαμε στην αγορά 8 νέων και σύγχρονων απορριμματοφόρων οχημάτων στο πλαίσιο της προσπάθειας αύξησης και ανανέωσης του ήδη υπάρχοντος μικρού και γερασμένου στόλου. Νοικιάσαμε χώρο 7 στρεμμάτων επί της Λεωφόρου Μαρκοπούλου, στη θέση «Πούσι Χατζή», με σκοπό να στεγάσει όλα του τα οχήματα. Λειτουργήσαμε τον 4ο Βρεφονηπιακό Σταθμό Το σοβαρό ζήτημα της λειτουργίας του Βρεφονηπιακού Σταθμού Παιανίας, ο οποίος επί πολλά χρόνια παρέμενε κλειστός λόγω έλλειψης προσωπικού και προβλημάτων τα οποία έμοιαζαν απροσπέλαστα, εί-

χε αίσιο τέλος εξαιτίας της επιμονής αλλά και των έντονων πιέσεων που ασκήσαμε προς τους εμπλεκόμενους κρατικούς φορείς. Πλέον έχουμε έναν άρτια εξοπλισμένο και υπερσύγχρονο Βρεφονηπιακό Σταθμό με δυνατότητα φιλοξενίας μέχρι 60 παιδιών (βρεφών και νηπίων). Έργα στα σχολεία Πρώτη φορά στα χρονικά, διατέθηκε το τεράστιο ποσό της τάξεως του 1.500.000,00 ευρώ συνολικά για όλες τις σχολικές μονάδες μας. Ενδεικτικά αναφέρω: κάλυψη λειτουργικών ανάγκών, συντηρήσεις και επισκευές σχολικών μονάδων, αλεξικέραυνα για πρώτη φορά, παλλόμενοι φωτεινοί σηματοδότες, πετρέλαιο για θέρμανση για όλη τη διάρκεια του χειμώνα, κ.λπ. Παιδικές χαρές Νηπιαγωγείων & Παιδικών Σταθμών Ο Δήμος προχώρησε στην αγορά και τοποθέτηση καινούργιων οργάνων, παιχνιδιών, δαπέδων και γενικού εξοπλισμού για την αναβάθμιση των Παιδικών Χαρών που βρίσκονται εντός των προαύλιων χώρων των Νηπιαγωγείων και των Βρεφονηπιακών Σταθμών σε Παιανία και Γλυκά Νερά. Μετά από αυτή τη παρέμβαση, όλοι αυτοί οι χώροι είναι άριστα εξοπλισμένοι με τις πιο σύγχρονες προδιαγραφές και έλαβαν την απαιτούμενη πιστοποίηση σύμφωνα με τα Ευρωπαϊκά πρότυπα ασφαλείας, όπως ακριβώς και οι κοινόχρηστες Παιδικές Χαρές του Δήμου. Ανάπλαση 12 παιδικών χαρών Οι εργασίες που πραγματοποιήθηκαν αφορούν στην αντικατάσταση των οργάνων και των περιφράξεων,

την κατασκευή δαπέδων ασφαλείας και διαδρόμων προσπέλασης, την τοποθέτηση νέου εξοπλισμού και ενημερωτικών πινακίδων, τη διαμόρφωση χώρων πρασίνου, ώστε οι παιδικές χαρές να είναι πλέον σύγχρονες, ασφαλείς και με δυνατότητα πρόσβασης και των παιδιών με κινητικά προβλήματα. Μάλιστα ολοκληρώθηκε και η διαδικασία πιστοποίησής τους από τις αρμόδιες υπηρεσίες. Δημοτικά Ιατρεία Μετά από έναν μεγάλο αγώνα της Δημοτικής Αρχής που στέφθηκε με επιτυχία, οι υπηρεσίες του ΙΚΑ-ΠΕΔΥ στην Παιανία, οι οποίες κινδύνευαν να φύγουν, παρέμειναν οριστικά στον Δήμο μας (Δημοτικά Ιατρεία) και εδώ και 3,5 χρόνια προσφέρουν στους δημότες τις πολύτιμες παροχές Υγείας. Οι Υπηρεσίες Υγείας αναβαθμίστηκαν με επιπλέον γιατρούς και προσωπικό και αυτή τη στιγμή λειτουργούν με μια ιδιαίτερα σημαντική δυναμική, εξυπηρετώντας όλο και περισσότερους δημότες και στις δύο πόλεις μας. Κομποστοποίηση Συμμετέχουμε στη σύγχρονη και οικονομική διαχείριση των Βιοαποβλήτων με τη δημιουργία Μονάδας Κομποστοποίησης στο Μαρκόπουλο. Ο Δήμος μας εναρμονίζεται πλήρως με τη νομοθεσία, και επιλέγει τον πλέον φιλικό περιβαλλοντικά τρόπο διαχείρισης των αποβλήτων αλλά και με την λειτουργία του θα εξοικονομεί ετήσια 1,0 έως 1,5 εκατομμύριο ευρώ, προς όφελος των Δημοτών μας! (Σήμερα δαπανούμε περισσότερα από 3,0 εκατομμύρια) Επαναλειτουργία ΚΕΠ Παιανίας Από τον Οκτώβριο του 2015 άνοιξε ξανά τις πόρ-

τες του για τους Δημότες το Κέντρο Εξυπηρέτησης Πολιτών (ΚΕΠ) Παιανίας, μετά από τιτάνιο αγώνα με την ελληνκή γραφειοκρατία και προσωπικές επαφές με αρμόδιους Υπουργούς. Κυκλοφοριακή μελέτη Ολοκληρώθηκε, για πρώτη φορά στο Δήμο μας, το εξαιρετικά σημαντικό έργο της υλοποίησης της Κυκλοφοριακής Μελέτης και ξεκινάει η διαδικασία για την εφαρμογή της και στην Παιανία και στα Γλυκά Νερά. Υπογειοποίηση καλωδίων ΔΕΗ Ολοκληρώθηκε η πρώτη φάση του μεγάλου έργου υποδομής της υπογειοποίησης των εναερίων δικτύων ρεύματος στο Δήμο Παιανίας, που πραγματοποιείται σε συνεργασία με τον Διαχειριστή Ελληνικού Δικτύου Διανομής Ηλεκτρικής Ενέργειας (Δ.Ε.Δ.Δ.Η.Ε.). Η αρχή έγινε στην κεντρική Πλατεία Ζωοδόχου Πηγής, αλλά και στην Πλατεία Δημοσθένους. Έργα στους Ιερούς Ναούς Ο Δήμος Παιανίας, έχει πραγματοποιήσει από τις αρχές του 2015 μέχρι και σήμερα, σημαντικό έργο στους Ιερούς Ναούς της περιοχής μας. Συγκεκριμένα πραγματοποιήθηκαν εργασίες συντήρησης, αποκατάστασης και εξωραϊσμού σε όλους τους Ιερούς Ναούς και των δύο δημοτικών ενοτήτων. Ως δημοτική αρχή, θεωρούμε την πολιτιστική και θρησκευτική μας κληρονομιά κομβικό σημείο της ιστορικής μας συνέχειας και για το λόγο αυτό συνεχίζουμε να στηρίζουμε και να πραγματοποιούμε έργα που συμβάλλουν προς την κατεύθυνση αυτή.


Πρώτο Θέμα

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

13

ον ίδιο Δήμαρχο

μου δεν παρέλειψε επίσης, να ευχαριστήσει όλους τους συνεργάτες του, για την τιτάνια προσπάθεια τους καθόλη την πενταετία. Πολλοί αυτοδιοικητικοί της Ανατολικής Αττικής παρακολούθησαν την εκδήλωση του Απολογισμού, μεταξύ των παρευρισκόμενων ήταν: ο δήμαρχος Μαρκοπούλου και υποψήφιος περιφερειακός

σύμβουλος Σωτήρης Μεθενίτης, ο αντιπρόεδρος του Περιφερειακού Συμβουλίου Αττικής κι εκ νέου υποψήφιος περιφερειακός σύμβουλος Γιάννης Σμέρος, οι υποψήφιοι περιφερειακοί σύμβουλοι Γεωργία Μπαντούνα, Χριστίνα Τσαντούλη και Χρήστος Καλαποθαράκος και Χριστίνα Παπαθανασίου -όλοι τους με τον Συνδυ-

ασμό του Γιάννη Σγουρού- οι υποψήφιοι περιφερειακοί σύμβουλοι Ιωάννα Κουλουβράκη, Χριστίνα Λυμπερόπουλου και Θανάσης Κατσιγιάννης με τον Συνδυασμό του Γιώργου Πατούλη, ο δημοτικός σύμβουλος Παλλήνης και πρόεδρος της ΕΝΑ Νεκτάριος Καλαντζής.

γων 2014-2019 Κοινωνική πολιτική - πρόνοια Το κοινωνικό πρόσωπο του Δήμου μας, μέσα από τη δράση και την προσφορά της Κοινωνικής Υπηρεσίας έδωσε ένα δυναμικό παρόν από το 2014 μέχρι σήμερα με συστηματικά προγράμματα παροχής αγαθών και υπηρεσιών προς τους δημότες μας. Εξυπηρετούνται περίπου 350 νοικοκυριά τα οποία βρίσκονται σε κατάσταση ένδειας, με τακτικές διανομές τροφίμων, τόσο από το Κοινωνικό Παντοπωλείο όσο και από το πρόγραμμα ΤΕΒΑ. Εκτός των διανομών αυτών, δίδονται τρόφιμα σε αστέγους και σε οικογένειες που ξαφνικά βρέθηκαν σε κατάσταση έκτακτης ανάγκης. Αναφορικά δε, με τους ωφελούμενους οι οποίοι είναι ανήμποροι να μετακινηθούν, πραγματοποιούνται κατ’ οίκον επισκέψεις από το προσωπικό του προγράμματος «Βοήθεια στο Σπίτι». Δράσεις για την Υγεία Από το Σεπτέμβριο του 2014 μέχρι σήμερα στο Δήμο μας έλαβαν χώρα πληθώρα δωρεάν εξετάσεων και εμβολιασμών όπως: 1. Η Δωρεάν ψηφιακή μαστογραφία.με την συνδρομή της Αντικαρκινικής Εταιρίας σε 200 και πλέον Δημότισσες. 2. Ο Δωρεάν αντιγριπικός εμβολιασμός στις ευπαθείς ομάδες του Δήμου. (Πραγματοποιήθηκαν προληπτικές εξετάσεις - εργαστηριακός έλεγχος) 3. Δωρεάν Test ΠΑΠ. (Παρέχεται μέχρι σήμερα στις Δημοτικές Υπηρεσίες Υγείας) Επίσης πραγματοποιείται συστηματική Εθελοντική Αιμοδοσία με εκατοντάδες αιμοδότες που συνεισφέρουν στην Τράπεζα αίματος του Δήμου.

Αδειοδότηση, νομιμοποίηση και έργα υποδομής σε Αθλητικούς χώρους Ολοκληρώθηκε επιτυχώς η προσπάθεια που ξεκίνησε το Νοέμβριο του 2014 για τη διευθέτηση της εκκρεμότητας λειτουργίας και νομιμοποίησης των Αθλητικών Εγκαταστάσεων Ποδοσφαίρου Παιανίας και Γλυκών Νερών αλλά και όλων των δημοτικών χώρων άθλησης, με τη συνδρομή Νομικών και Τεχνικών Συμβούλων. Τα τελευταία 2 χρόνια ξεκίνησαν και ολοκληρώθηκαν οι εργασίες ανακαίνισης και συντήρησης σε αθλητικούς χώρους της πόλης, από τo Δήμο μας. Στόχος των εργασιών είναι η αναβάθμιση των αθλητικών υποδομών και η βελτίωση των παρεχόμενων υπηρεσιών προς τους δημότες. Συγκεκριμένα υλοποιήθηκαν εργασίες ανακαίνισης στα αποδυτήρια και τις τουαλέτες του Κλειστού Δημοτικού Γηπέδου Παιανίας ενώ τοποθετήθηκε και νέο δάπεδο.

χής και σύμφωνα με τα στοιχεία που έδωσε στο Δήμο το ιδιωτικό κτηνιατρείο, ο αριθμός των μέχρι τώρα στειρώσεων και στις δύο Δημοτικές Ενότητες, σε Παιανία και Γλυκά Νερά, ανέρχεται στις 700, ενώ ο αριθμός των υιοθεσιών στο σύνολο του δήμου ανέρχεται στις 170.

«Σπίτι του Βόλεϊ» - Ολυμπιακά Ακίνητα Τα Ολυμπιακά ακίνητά πέρασαν στην κυριότητα του Δήμου μας μετά από συντονισμένες προσπάθειες και ταυτόχρονα εξασφαλίσαμε χρηματοδότηση ύψους 500.000,00€ από την Περιφέρεια, για τη συντήρηση και επισκευή τους. Όταν ολοκληρωθει το έργο θα αποδοθεί προς χρήση στους αθλητικούς φορείς του Δήμου Παιανίας και την Ελληνική Ομοσπονδία Πετοσφαίρισης.

Αναβίωση των αγώνων «Σκιάδεια» Προχωρήσαμε στην αναβίωση του θεσμού των «Σκιαδείων», των αγώνων δρόμου, που ξεκίνησαν μετά το πέρας του Β' Παγκοσμίου Πολέμου στην περιοχή της Παιανίας προς τιμήν του Βαλκανιονίκη Παιανιώτη αθλητή, Ιωάννη Σκιαδά. Οι Αγώνες αυτοί είναι ένα ύψιστης σημασίας γεγονός για την διάσωση και ανάδειξη της Ιστορίας της Παιανίας αλλά και για την ενίσχυση της Αθλητικής Ιδέας στην αντίληψη όλων. Φέτος θα διεξαχθούν την Κυριακή 14 Απριλίου 2019, με εκκίνηση και τερματισμό την Κεντρική Πλατεία της Παιανίας με κοινωνικό χαρακτήρα και σκοπό την ενίσχυση του Κοινωνικού Παντοπωλείου του Δήμου Παιανίας.

Μέριμνα για τα αδέσποτα Για πρώτη φορά στο δήμο μας καταρτίστηκε και υλοποιείται ολοκληρωμένο πρόγραμμα διαχείρισης των αδέσποτων ζώων. Προχωρήσαμε στην Υπογραφή Σύμβασης Έργου με ιδιωτικό κτηνιατρείο της περιο-

Πολιτισμός και Τοπικοί Σύλλογοι Από το 2014 θεσμοθετήσαμε μια σειρά Πολιτιστικών Εκδηλώσεων στο Δήμο ώστε να προσφέρουμε ποιοτική ψυχαγωγία & διασκέδαση και να τιμήσουμε μεγάλους Πολιτιστικούς και Θρησκευτικούς θεσμούς σε συνδυασμό με την Ελληνική Παράδοση. (Χρστούγεννα, Απόκριες, Καθαρά Δευτέρα, Πάσχα) Ταυτόχρονα, ο Δήμος μας ενίσχυσε οικονομικά όλους τους ενεργούς Συλλόγους και τους Φορείς Παιανίας και Γλυκών Νερών με την ετήσια επιχορήγηση στηρίζοντας έμπρακτα το σημαντικό έργο τους.

Συμβουλευτική Γονέων Ο Δήμος μας, ανταποκρινόμενος στην ανάγκη της σύγχρονης οικογένειας για συμβουλευτική, ψυχολογική υποστήριξη σε θέματα που αφορούν τις σχέσεις των παιδιών με το ευρύτερο περιβάλλον τους, δημιούργησε για πρώτη φορά, Συμβουλευτικό Κέντρο. Η πρωτοβουλία αυτή, βασίζεται στον εθελοντισμό και προσφέρεται ΔΩΡΕΑΝ σε όλους τους Δημότες. Ελεύθερο Λαϊκό Πανεπιστήμιο Ο Δήμος μας ανταποκρινόμενος στις ανάγκες της εποχής για ουσιαστική επιμόρφωση και επικοινωνία "υιοθέτησε" την ιδέα του Λαϊκού Πανεπιστημίου και από το 2018 το υλοποιεί χωρίς κανένα κόστος για τους συμμετέχοντες. Η φοίτηση είναι ΔΩΡΕΑΝ για όλους. Στόχος της δημοτικής μας αρχής είναι το Ελεύθερο Λαϊκό Πανεπιστήμιο να γίνει θεσμός και να πραγματοποιούνται πολλές διαλέξεις κατά την διάρκεια του έτους. Κοινωνικό Φροντιστήριο Το Κοινωνικό Φροντιστήριο εντάσσεται στο πλαίσιο της στρατηγικής ανάπτυξης της Κοινωνικής Πολιτικής του Δήμου Παιανίας και της δημιουργίας ενός δικτύου αλληλεγγύης. Το Κοινωνικό Φροντιστήριο λειτούργησε για πρώτη χρονιά κατά το σχολικό έτος 2017-18. Τα μαθήματα πραγματοποιηθούν στα λύκεια του Δήμου μας, με την βοήθεια εθελοντών καθηγητών, αλλά και γονέων οι οποίοι έχουν την διοικητική υποστήριξη και λειτουργία σε συνεργασία με την Ένωση Συλλόγων Γονέων και Κηδεμόνων Μαθητών Παιανίας.


Επικαιρότητα

14

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Βασίλης Πιστικίδης: «Συνεχίζουμε τις συνομιλίες και παράλληλα, συγκροτούμε έναν νικηφόρο Συνδυασμό» Σε

σχετική ερώτηση του «ΔΗΜΟΤΗ» για τις επαφές που συνεχίζουν να γίνονται μεταξύ των υποψήφιων δημάρχων και Παρατάξεων στον Δήμο Ραφήνας-Πικερμίου, αλλά και για την πορεία και τον προεκλογικό σχεδιασμό του Συνδυασμού «Νέα Αρχή» ο υποψήφιος δήμαρχος κ. Βασίλης Πιστικίδης, δηλώνει τα εξής: «Επειδή γίνεται μία αήθη, κακεντρεχή, συνεχή προσπάθεια ευτελισμού και γελοιοποίησης του γεγονότος ότι διενεργούνται προεκλογικές επαφές και συνομιλίες με άλλες Παρατάξεις, δράττομαι την ευκαιρία από την ερώτησή σας, να βάλουμε τα πράγματα στη σωστή τους θέση και διάσταση. Έτσι κι αλλιώς, ισχύει η δέσμευσή μας, ότι θα δημοσιοποιούμε τις κινήσεις μας, όπως φυσικά και τις τελικές αποφάσεις και συμφωνίες, όταν και αν προκύψουν. Όσο για εκείνους, οι οποίοι ενοχλούνται (γιατί άραγε;) κάθε φορά που μαθαίνουν ότι συζητούμε οι υποψήφιοι μεταξύ μας, τους συστήνω ψυχραιμία. Αντιλαμβάνομαι ότι κοιμούνται και ξυπνούν υπό τον φόβο και την αγωνία της απώλειας της εξουσίας, αλλά δεν μπορώ να κάνω κάτι για να βοηθήσω ως προς αυτό. Και αν θέλετε να ξέρετε,

Μ

κατά την ταπεινή μου άποψη και κρίνοντας από τις μηνύματα που μας στέλνουν οι δημότες, ο φόβος τους είναι απολύτως δικαιολογημένος, είτε τελικά, πραγματοποιηθούν συμπράξεις μεταξύ Συνδυασμών είτε όχι. Έχουμε και λέμε, λοιπόν: Με διάθεση δημιουργίας κλίματος συναίνεσης κατά τις επιταγές του ΚΛΕΙΣΘΕΝΗ Ι, με ζητούμενο τη συμμετοχικότητα, τη σύνθεση και με πνεύμα συνεργατικής δημιουργίας προσπαθούμε να βρούμε κοινά σημεία ώστε να βοηθήσουμε από την καλύτερη δυνατή και ισχυρή θέση τον τόπο μας, σε μία εποχή διαίρεσης, ανασφάλειας κι επίφοβης ακυβερνησίας που ξημερώνει. Έως σήμερα, δεν μπορούμε να πούμε ότι έχουμε καταλήξει σε μία σοβαρή και άξια λόγου σύμπραξη και συνεννόηση. Παρά ταύτα και ως την τελευταία ημέρα της κατάθεσης ψηφοδελτίων, θα συνεχίσουμε τις συνομιλίες, ενώ παράλληλα εργαζόμαστε ακατάπαυστα για τη συγκρότηση ενός δυνατού, αξιόλογου και νικηφόρου Συνδυασμού. Επίσης, μέσω των επαφών μας, με τα Διοικητικά Συμβούλια Συλλόγων και Φορέων, καθώς και με συνδημότες μας, επιχειρούμε τη σύνθεση απόψεων και προτά-

σεων του προεκλογικού μας προγράμματος, ώστε να προκύψει ο σχεδιασμός και το πρόγραμμα της επόμενης μέρας. Πολλές φορές, μπαίνει το ερώτημα “ποιους αποκλείετε από τις συζητήσεις” κι εκεί απαντούμε ότι “δεν υπάρχουν αποκλεισμοί σε μας, ούτε μένουμε σε αντιπαραθέσεις και δυστοκίες του παρελθόντος, είτε απώτερου είτε πρόσφατου όταν οι προθέσεις είναι ειλικρινείς και δεν χαρακτηρίζονται από ηγεμονισμό”. Πάντα βλέπουμε μπροστά κι εφόσον διαπιστώσουμε όμοιες προθέσεις, λογικά επιχειρήματα και υγιή συλλογιστική απαλλαγμένα από τον… ιό της στείρας, αδιέξοδης προσωπικής φιλοδοξίας, είμαστε διατεθειμένοι να συμφωνήσουμε σε ένα κοινό πρόγραμμα στόχων, η οποία θα σηματοδοτήσει μια πραγματικά νέα αρχή για τη Ραφήνα και το Πικέρμι. Δεν τοποθετούμε τίποτα πάνω από το συμφέρον των συνδημοτών μας και του τόπου. Παράλληλα όμως, δεν σκοπεύουμε ν’ αμαυρώσουμε με διάφορα "παζάρια" και παράλογες δοσοληψίες και υποχωρήσεις, τη μακρά και διαφανή αυτοδιοικητική μας πορεία».

Κάθε χρόνο και καλύτερα ο «Αραφήνειος Δρόμος»

ε μεγάλη επιτυχία πραγματοποιήθηκε την περασμένη Κυριακή, 31 Μαρτίου 2019, ο 5ος «Αραφήνειος Δρόμος» με εκκίνηση και τερματισμό το Πάρκο Αναψυχής (Κολυμβητήριο Ραφήνας). Παρά τα 8 μποφόρ και τις δυσκολίες που προέκυψαν από τους ανέμους, οι συμμετοχές ξεπέρασαν κάθε ρεκόρ και η διάθεση του κόσμου ήταν τέτοια που ο αέρας μόνο εμπόδιο δεν ήταν... Αθλητές από όλες τις ηλικίες πήραν μέρος στους αγώνες των 1.000 μέτρων αλλά και των 5 και 10 χιλιομέτρων. Η αθλητική αλληλεγγύη, το αθλητικό ιδεώδες, η συ-

νεργασία και ομαδική δουλειά κέρδισαν για άλλη μια χρονιά το στοίχημα στον Αραφήνειο Δρόμο που πλέον αποτελεί το μεγαλύτερο αθλητικό γεγονός του Δήμου Ραφήνας-Πικερμίου. Για την ιστορία να αναφέρουμε ότι η θεσμοθέτηση και η υλοποίηση του μεγαλύτερου δρομικού γεγονότος στην ιστορία του Δήμου Ραφήνας-Πικερμίου έγινε επί δημαρχίας Βασίλη Πιστικίδη, τον Μάρτιο του 2015, από τον τότε Πρόεδρο του Δ.Ο.Π.Α.Π. Γιώργο Δουβίτσα. Τα «Δημητροπούλεια 2015» ήταν ο πρόδρομος του Αραφήνειου Δρόμου.

Ιωάννης Ξουρίκης: Πλήρης αδιαφορία της δημοτικής αρχής για τα εύφλεκτα οικόπεδα!

Βασίλης Μπελιάς: Απαιτείται σοβαρότητα όταν συζητάμε για την Δημόσια Υγεία

Μ

Η

ε αγωνία αλλά και αγανάκτηση παρακολουθούμε τόσο καιρό το θέμα του καθαρισμού των εύφλεκτων οικοπέδων. Είναι ανεπίτρεπτο 8 μήνες μετά από την φονική πυρκαγιά, να υπάρχει τέτοια αδιαφορία με κίνδυνο να ζήσουμε άλλη μια τραγωδία. Είναι προφανές ότι πρόκειται για ένα ακόμη τρομακτικό δείγμα ανευθυνότητας της δημοτικής αρχής που δε δί-

νει καμία σημασία στα ουσιαστικά θέματα πρόληψης γύρω από αυτό το θέμα της πυρασφάλειας. Το σύστημα ηλεκτρονικής καταγραφής εύφλεκτων οικοπέδων υπάρχει από τον Αύγουστο του 2018, παραχωρήθηκε δωρεάν στη δημοτική αρχή, αλλά ο δήμος αρνείται πεισματικά να το χρησιμοποιήσει γιατί αναπτύχθηκε χάρη στην ικανότητα και πρωτοβουλία του «αντιπάλου» Ανδρέα Βασιλόπουλου και της ομάδας του RPSOS. Ας καταλάβουν πλέον κάποιοι ότι τέτοια δείγματα μικροπολιτικής βλάπτουν μόνο τους δημότες και την ασφάλεια τους. *Ο Ιωάννης Ξουρίκης είναι πρόεδρος του συλλόγου «Η Ενότητα» της Διασταύρωσης Ραφήνας και υποψήφιος δημοτικός σύμβουλος με τη «Δύναμη Ανάπτυξης» και τον καθηγητή Ανδρέα Βασιλόπουλο.

καθυστέρηση της απομάκρυνσης του αμίαντου (ελενίτ) από τις καμένες περιοχές και η ανικανότητα της δημοτικής αρχής και του υπουργείου να δώσουν σαφή απάντηση στους κατοίκους και λύση στο πρόβλημα, είναι κάτι παραπάνω από εμφανής. Είναι ντροπή, οι διοικούντες να είναι πρωταγωνιστές στα

τηλεοπτικά και ραδιοφωνικά μέσα, να κάνουν μεγάλες εξαγγελίες, αλλά στην ουσία όλοι να αποφεύγουν τις ευθύνες, την ουσία και τις πράξεις, σκεπτόμενοι ότι οι συνέπειες στην υγεία των κατοίκων των πυρόπληκτων περιοχών δεν είναι άμεσες, αλλά θα φανούν σε λίγα χρόνια. *O Βασίλης Μπελιάς έχει εργαστεί επί σειρά ετών στη Διεύθυνση Πληροφορικής της ΔΕΗ και είναι υποψήφιος δημοτικός σύμβουλος με τη «Δύναμη Ανάπτυξης» και τον καθηγητή Ανδρέα Βασιλόπουλο.


ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Επικαιρότητα

15

Εντυπωσιακά μεγάλη προσέλευση για μια ακόμη φορά σε εκδήλωση του Ανδρέα Βασιλόπουλου

Ρεπορτάζ - επιμέλεια: Γιάννης Κοντογεώργος

Μ

ετά την πρώτη επιτυχημένη εκδήλωση για τους τρόπους θωράκισης των πολιτών απέναντι στην εγκληματικότητα, που έγινε την περασμένη εβδομάδα, μια ακόμη «δυνατή» θεματική ενημερωτική εκδήλωση πραγματοποιήθηκε αυτή την Κυριακή 31 Μαρτίου στο ξενοδοχείο «Αύρα» στο κέντρο της Ραφήνας, με τίτλο: «Πυρκαγιά - Πρόληψη και Αντιμετώπιση». Διοργανωτής, αλλά και εκ των ομιλητών της ημερίδας, ήταν ο καθηγητής και υποψήφιος δήμαρχος Ραφήνας-Πικερμίου Ανδρέας Βασιλόπουλος, επικεφαλής της Δημοτικής Παράταξης «Δύναμη Ανάπτυξης». Την εκδήλωση τίμησαν με την παρουσία τους υψηλόβαθμα στελέχη της Πυροσβεστικής, της περιφέρειας Αττικής, των δήμων Μαραθώνος και Σπάτων-Αρτέμιδος, ενώ στην κατάμεστη αίθουσα βρέθηκαν και ο υποψήφιος περιφερειάρχης Αττικής, Γιάννης Σγουρός, ο αντιδήμαρχος Σπάτων-Αρτέμιδος Αντώνης Τούντας καθώς και πολλοί εκπρόσωποι τοπικών φορέων και συλλόγων. Βασικοί ομιλητές και ειδικοί επί του θέματος, ο κ. Νικόλαος Διαμαντής, Υποστράτηγος Πυροσβεστικού Σώματος ε.α. και Νομικός Σύμβουλος Πυρασφάλειας & Πολιτικής Προστασίας και ο κ. Ιωάννης Σταμούλης, Αρχιπύραρχος και Διοικητή Πυροσβεστικών Υπηρεσιών Πειραιά, ενώ την εκδήλωση χαιρέτισε και ο κ. Κωνσταντίνος Θεοφιλόπουλος, Διευθυντής Πυροσβεστικών Επιχειρήσεων Ελλάδος. Η ατζέντα της ημερίδας κάλυψε όλο τον κύκλο συζήτησης αναφορικά με το μείζον προκείμενο ζήτημα, από τα προληπτικά μέτρα, μέχρι συμβουλές σε περίπτωση πυρκαγιάς και διαδικασία εκκένωσης καταφυγής. Ιδιαίτερη αίσθηση προκάλεσε η παρουσίαση ενός καινοτόμου συστήματος έγκαιρης προειδοποίησης μέσω SMS, η οποία πραγματοποιήθηκε για πρώτη φορά στην Ελλάδα και μάλιστα με ζωντανή επίδειξη δοκιμαστικής λειτουργίας, η οποία ήταν απόλυτα επιτυχής. Είναι χαρακτηριστικό ότι τόσο το νέο σύστημα ΠΥΡSOS/Alert247, όσο και η πλατφόρμα καταγραφής εύφλεκτων οικοπέδων του καθηγητή, που λειτουργεί από πέρσι τον Αύγουστο, έγιναν αποδεκτές μ’ ενθουσιασμό από τους κατοίκους που γέμισαν ασφυκτικά την αίθουσα για να παρακολουθήσουν την έγκυρη και ουσιαστικού περιεχομένου, ημερίδα, η οποία «δεν θύμιζε σε τίποτα, προεκλογικές φιέστες και ανούσιες εκδηλώσεις για το θεαθήναι» όπως έντονα σχολιάστηκε. Επρόκειτο ομολογουμένως, για μία πολύ πετυχημένη εκδήλωση, όχι μόνο από την άποψη προσέλευσης κόσμου, αλλά και από το υψηλό επίπεδο ενημέρωσης. Με το πέρας των ομιλιών και των παρουσιάσεων, ακολούθησε ενδιαφέρουσα συζήτηση με ερωτήσεις του κοινού που κατέθεσε έντονο προβληματισμό για το γεγονός ότι δεν έχει γίνει τίποτα από τη δημοτική αρχή ενόψει της αντιπυρικής περιόδου την οποία ήδη διανύουμε. Ο κ. Βασιλόπουλος απαντώντας απέφυγε να δώσει οποιαδήποτε προεκλογική χροιά στην εκδήλωση δηλώνοντας πως σκοπός της εκδήλωσης δεν είναι να αποδοθούν ευθύνες αλλά να σταθούμε στο πως προετοιμαζόμαστε, Δήμος και πολίτες, για να είμαστε ασφαλείς το καλοκαίρι που μας έρχεται. Είναι λογικά τα πολλά συγχαρητήρια των πολι-

Για 2η συνεχόμενη εβδομάδα και παρά τις παράλληλες εκδηλώσεις της ημέρας (Αραφήνειο Δρόμο και εκδήλωση βουλευτή της Ν.Δ.) ο Ανδρέας Βασιλόπουλος υποδέχθηκε πλήθος κόσμου στην ημερίδα για την Πυρασφάλεια που διοργάνωσε στην πυρόπληκτη Ραφήνα, δίνοντας στοχευμένη και ουσιαστική ενημέρωση, με προτεραιότητα την ασφάλεια των πολιτών.

τών που εισέπραξε ο κ. Ανδρέας Βασιλόπουλος, όχι μόνο για την πρωτοβουλία, την επιλογή των έμπειρων ομιλητών και την άψογη διοργάνωση, αλλά και για την απόφασή του να μην έχει καταγγελτικό λόγο κατά τη διάρκεια της εκδήλωσης. Τέλος, δεν παρέλειψαν να κατακρίνουν την απουσία της δημοτικής αρχής και του κ. Μπουρνού, από μία τόσο σημαντική εκδήλωση, κρίνοντας ότι θα όφειλε -αν μη τι άλλο, συμβολικά- να έδινε το παρόν στην ημερίδα, ειδικά μετά την τραγωδία του περασμένου καλοκαιριού. Ως απαντητικό σχόλιο δε, στην «ανεπάρκεια και αδιαφορία του Δήμου Ραφήνας-Πικερμίου» οι πολίτες ευχήθηκαν «καλή επιτυχία» στον κ. Βασιλόπουλο, καθώς όπως ανέφεραν «έδειξε ετοιμότητα και σοβαρότητα ενόψει ανάληψης διοικητικών καθηκόντων στην επόμενη Δημοτική Αρχή».


Επικαιρότητα

16

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Εκτός Football League είναι από τις 23 Μαρτίου 2019 ο «Αήττητος Σπάτων» Συνέντευξη του προέδρου του Συλλόγου Νίκου Κατσιγιάννη στον Δημήτρη Πνευματικάτο

Μ

ια είδηση συγκλόνισε και αναστάτωσε τελευταία τον αθλητικό, κυρίως όμως ποδοσφαιρικό κόσμο του Δήμου ΣπάτωνΑρτέμιδος. Από 23/3/2019, εκτός του ποδοσφαιρικού πρωταθλήματος Football League (Β΄ Εθνική Κατηγορία) είναι πλέον η ποδοσφαιρική ομάδα «Αήττητος Σπάτων». Το «παράπτωμα» της δεν είναι αγωνιστικό, ηθικό, ή νομικό, αλλά οικονομικό. Απλά δεν κατέθεσε εγκαίρως το Μετοχικό της Κεφάλαιο. Όλο το παρασκήνιο της αποπομπής της ομάδος και τα επόμενα βήματα της διοίκησης του «Αήττητου Σπάτων» σε συνέντευξη με τον πρόεδρο και ιδιοκτήτη της ομάδος κ. Νίκο Κατσιγιάννη. Ωστόσο, σημειώνουμε, πως το αθλητικό αυτό «κτύπημα» που υπέστη η ομάδα του Δήμου Σπάτων-Αρτέμιδος, ουσιαστικά το υπέστησαν οι νέοι που ασχολούνται με τον αθλητισμό και το δημοφιλές σπορ του ποδοσφαίρου. Γεγονός είναι ότι καθυστερημένα, -έπρεπε να είχε κατατεθεί από τις 15 Δεκεμβρίου 2018- κι ύστερα από συνεχείς παρατάσεις που λάμβανε, ο «Αήττητος Σπάτων» κατέθεσε το μετοχικό του κεφάλαιο με τη συνδρομή ιδιώτη και ομάδα ιδιωτών επιχειρηματιών. Ωστόσο, όσοι φρόντισαν έστω και στην

ύστατη ώρα να συμμετάσχουν στη διάσωση της ομάδας δυστυχώς «λασπώθηκαν», όπως λάσπη ρίχνουν και στο πρόεδρο του Συλλόγου, κ. Νίκο Κατσιγιάννη, για την ανάμειξή του στο ιδιοκτησιακό καθεστώς του «Αήττητου».

Η συνέντευξη Κύριε Κατσιγιάννη, λίγα επαγγελματικά λόγια για σας. Έχω εταιρεία ιατρικών ειδών από το 2007. Και από το 2011 ίδρυσα μια ακόμα εταιρεία που ασχολείται με τη Μεσογειακή Αναιμία, αντλίες χημειοθεραπείας για κάποιες μορφές καρκίνου και τελευταία συνεργάζομαι με μια πολυεθνική εταιρεία για βοηθήματα διαβήτη. Πως αναμειχθήκατε με τα ποδοσφαιρικά; Το 2007 έγινα πρόεδρος στην ερασιτεχνική ομάδα της Προοδευτικής Πειραιά. Μετά και λόγο καταγωγής της συζύγου μου, στην αθλητική ομάδα Χανίων. Όμως από το 2011 είμαι δημότης Σπάτων. Καταλαβαίνεται, εφόσον μου αρέσει να ασχολούμαι με τα αθλητικά και μια και μένω εδώ, εγκατέλειψα όλες τις άλλες μακρινές αθλητικές ασχολίες μου και ασχολήθηκα με την ομάδα της πόλης που κατοικώ. Με πολλή δουλειά καταφέραμε η ομάδα από Β΄ Τοπικό σήμερα να παίζει στο πρωτάθλημα της Β΄ Εθνικής.

δεν τηρήθηκε ούτε μία. Ο Δήμος τα μόνα χρήματα που έχει διαθέσει είναι περίπου 18.000 Ευρώ για να πληρωθούν χρέη προηγούμενων διοικήσεων. Από τους αγώνες έχει έσοδα η ομάδα; Δυστυχώς όχι. Τις περισσότερες φορές ίσα-ίσα καλύπτονται τα έξοδα του αγώνα. Ένας εκτός έδρας αγώνας κατά μέσο όρο στοιχίζει περίπου 5.000 Ευρώ. Πότε προέκυψε το πρόβλημα της μη κατάθεσης του κεφαλαίου; Αν και είμαστε αρκετά εκπρόθεσμοι κάποιες ομάδες κάνανε ενστάσεις. Μας κάλεσε η Επιτροπή Επαγγελματικού Ποδοσφαίρου (ΕΑΠ) να αποδείξουμε ότι έχουμε καταθέσει το μετοχικό κεφάλαιο. Το οικονομικό κομμάτι το λύσαμε, τώρα χρειάζεται να λύσουμε το νομικό που είμαστε εκπρόθεσμοι. Να σημειωθεί ότι η ομάδα δεν έχει πουθενά χρέη, προσφυγές, δεν χρωστά σε ποδοσφαιριστές, δημόσιο κ.λπ. Με ποιόν τρόπο το λύσατε; Ένας όμιλος επιχειρηματιών του Δήμου, με μπροστάρη τον γιό του κ. Γιάννη Ραφτόπουλου, Γιάννη, ή Τζόνυ για να ξεχωρίζει από τον πατέρα του, κατέθεσαν εγγυητική επιστολή στην τράπεζα ύψους 200.000 Ευρώ, όσα έλειπαν να συμπληρωθεί το κεφάλαιο.

O Δήμος Σπάτων-Αρτέμιδος μας είχε υποσχεθεί ότι θα αγοράσει μετοχές της ομάδας και εισιτήρια διαρκείας.

Μπορείτε να μας κάνετε σαφές αυτό; Στη Γενική Συνέλευση της ομάδας που κάναμε παρουσία του δημάρχου κ. Δημήτρη Μάρκου και του Γενικού Γραμματέα κ. Γιώργου Σμέρου μας δόθηκαν οι εξής υποσχέσεις: Ότι ο δήμος θα αγοράσει μετοχές της ομάδας και εισιτήρια διαρκείας. Επίσης ότι θα γίνουν δύο (2) πολιτιστικές εκδηλώσεις και θα μας δοθούν τα έσοδα. Από αυτές τις υποσχέσεις

Έχετε ελπίδες να μη χαθεί η κατηγορία και η χρονιά; Την Τρίτη 2 Μαρτίου εκδικάζεται από την ΕΕΑ η υπόθεση μας. Ελπίζω να γίνει κατανοητό ότι η εκπρόθεσμη κατάθεση του μετοχικού κεφαλαίου είναι συνέπεια της επικρατούσας οικονομικής κατάστασης της χώρας και όχι εσκεμμένης ενέργειας μας.

Επίλογος

Τι ακριβώς συμβαίνει και πριν λίγες ημέρες η ομάδα υποβιβάστηκε; Οι λόγοι καθαρά είναι οικονομικοί. Δεν καταθέσαμε το χρηματικό ποσό που απαιτείται ως εγγύηση για την κάλυψη των αγωνιστικών αναγκών της ομάδας. Ο προϋπολογισμός τις ομάδος ανέρχεται στις 600.000 Ευρώ. Τόσα περίπου χαλάστηκαν και για να ανέβει κατηγορίες η ομάδα. Εσείς σαν πρόεδρος και ιδιοκτήτης της ομάδος άκουσα ότι θα διαθέτατε περίπου 200.000 Ευρώ. Τα υπόλοιπα χρήματα από πού τα περιμένατε; Είμαστε Α.Ε. Έχουμε φτιάξει τμήμα μάρκετινγκ ώστε να μπορέσουμε να βρούμε χορηγούς και τρόπους αύξησης των εισοδημάτων μας. Συν τοις άλλοις περιμέναμε να υλοποιήσει τις υποσχέσεις της η Δημοτική Αρχή.

Αν τελικά δικαιωθεί ο «Αήττητος Σπάτων» θα οφείλεται στον «συναγερμό» που τέθηκε η οικογένεια του Γιάννη Ραφτόπουλου και σε κάποιους άλλους επιχειρηματίες που θέλουν να μην αναφερθούν τα ονόματά τους.

Η ομάδα δεν έχει πουθενά χρέη, προσφυγές, δεν χρωστά σε ποδοσφαιριστές, δημόσιο κ.λπ.

Η Δημοτική Αρχή με την άνοδο της ομάδας στη Β΄ Εθνική, διέθεσε το ποσόν των 230.000 Ευρώ (περίπου) για να επισκευάσει το γήπεδο ποδοσφαίρου ώστε να γίνει κατάλληλο για αγώνες υψηλής κατηγορίας. Επίσης έχουμε πληροφορίες ότι σύντομα θα γίνει διαγωνισμός για την αλλαγή χόρτου, προϋπολογισμού 200.000 Ευρώ. Αν τελικά δικαιωθεί ο «Αήττητος Σπάτων» θα οφείλεται στον «συναγερμό» που τέθηκε η οικογένεια του Γιάννη Ραφτόπουλου και κάποιοι άλλοι επιχειρηματίες που θέλουν να μην αναφερθούν τα ονόματά τους. Δυστυχώς παρόλο που η πράξη τους αυτή ήταν και είναι προς όφελος των νέων μας, ήδη ο «Αήττητος Σπάτων» στις ακαδημίες του έχει 230 παιδιά, δέχθηκαν «λάσπη». Κάποιοι δημότες κακοπροαίρετα συνδύασαν το γεγονός πως επειδή η κα Άννα Ραφτοπούλου, κόρη του Γιάννη και αδελφή του Τζόνυ, είναι υποψήφια δήμαρχος, ότι έκαναν το έκαναν για ψηφοθηρικούς και μόνο λόγους. Γεγονός είναι ότι η προσπάθεια διατήρησης της ομάδος σε υψηλά επίπεδα έγινε, ελπίζουμε δε να έχει αίσιο τέλος η περιπέτεια και όσο γι αυτούς που την κοιτούν «πίσω από την κουρτίνα» θα παραμείνουν να την κοιτούν, αρκεί η ομάδα να μην πέσει εξωαγωνιστικά κατηγορία.


ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Επικαιρότητα

17

Ο Χαράλαμπος Στρατίκης, υποψήφιος Δήμαρχος Σπάτων-Αρτέμιδος Φ

ίλες και Φίλοι, Αγαπητοί μου Συμπολίτες, Είναι τιμή για μένα, η πρόκρισή μου από ένα συλλογικό όργανο ενεργών πολιτών και δη αυτοδιοικητικών στελεχών, να ηγηθώ, ως υποψήφιος δήμαρχος, δημοτικής παράταξης, στις προσεχείς εκλογές. Με διάθεση προσφοράς, ανιδιοτελώς και με

ειλικρινείς προθέσεις, προσέρχομαι ως υποψήφιος δήμαρχος, στις δημοτικές εκλογές του Μαΐου, τρέχοντος έτους και με πλήρη συνείδηση των ευθυνών και συνεπειών του επωμισθέντος ρόλου μου. Με πίστη και αφοσίωση, στην ποιότητα ζωής των δημοτών και το συλλογικό συμφέρον των κοινωνιών μας και με στοχευμένες επιδιώξεις, φιλοδοξώ να κάνω πράξη τα οράματά μας. Αναγνωρίζω το δίπολο του δήμου μας και κατανοώ απόλυτα, τα ιδιαίτερα χαρακτηριστικά των δύο πόλεων, αλλά και το δικαίωμα των πολιτών, να ζουν εν αρμονία και με σχέσεις αμφοτερίζουσες και πάντοτε με θετικό πρόσημο. Με σαφή προσανατολισμό, στην ανάπτυξη και πρόοδο του τόπου μας και με πρόγραμμα ει-

λικρινές και υλοποιήσιμο, θα επιδιώξουμε, να βάλουμε από την αφάνεια και την παρακμή τις πόλεις μας, που ασμένως μαραζώνουν, με νοσηρό τρόπο. Με σθεναρό τρόπο θα υπερασπιστώ το δικαίωμα στην ποιότητα ζωής των πολιτών σε αυτόν τον περιούσιο τόπο. Σε αυτή την προσπάθεια, καλώ όλους τους ενεργούς πολίτες και ιδιαίτερα τους νέους μας χωρίς προκαταλήψεις, σε μια ισότιμη συνεργασία, για να ανταπεξέλθουμε στις απαιτήσεις των καιρών και να δώσουμε χαρά, ελπίδα και προοπτική, στους κουρασμένους ήδη συμπολίτες μας, από τις συνέπειες των πολύμορφων και πολλαπλών κρίσεων που μαστίζουν τον τόπο μας.

Ρεαλισμός και τόλμη θα είναι το επίσημο δόγμα της πολιτικής μας, στη διαχείριση των δημοτικών υποθέσεων με κυρίαρχο γνώρισμα, την αντιληπτική διαδικασία, τη γνώση και την πράξη. Χωρίς ωραιοποιήσεις και συναισθηματισμούς, αλλά με ξεκάθαρο, ευθύ απλό τρόπο, αντιμετώπιση της καθημερινότητας των πολιτών. Πάνω σε στέρεες αρχές, θα οικοδομήσουμε μία άλλη πραγματικότητα, με όραμα και προοπτική, σε ένα ανθρωπογενές περιβάλλον χωρίς κηδεμονίες και φεουδάρχες. Να είστε πάντα καλά. Χαράλαμπος Στρατίκης Υποψήφιος Δήμαρχος Σπάτων-Αρτέμιδος


Επικαιρότητα

18

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

ΟΜΟΣΠΟΝΔΙΑ ΕΞΩΡΑΙΣΤΙΚΩΝ - ΕΚΠΟΛΙΤΙΣΤΙΚΩΝ ΣΥΛΛΟΓΩΝ ΑΡΤΕΜΙΔOΣ-ΣΠΑΤΩΝ ΑΤΤΙΚΗΣ:

Να τελειώνουμε… με τους συκοφάντες! Α

γαπητοί Συμπολίτες,

Παρακολουθούμε επί πολλούς μήνες μία πρωτοφανή, συστηματική και συντονισμένη επίθεση με συκοφαντίες, λασπολογία και ενοχοποίηση της Ομοσπονδίας μας, προερχόμενη από γνωστά κέντρα διαπλοκής με υπόγειες συμμαχίες και ανεξάντλητη αλλά διεστραμμένη φαντασία. Προκατασκευασμένες, ανυπόστατες και έωλες κατηγορίες, συνοδευόμενες μάλιστα από υποτιθέμενες ετυμηγορίες, διασπορά δήθεν αποκαλύψεων και ανακαλύψεων, διαδίδονται μέσω του τύπου, του διαδικτύου και προφορικά, με σκοπό την σπίλωση οικογενειών και προσώπων. Ραδιουργίες και πλεκτάνες μιας ασήμαντης και ποταπής μικροπαρέας με πολλά ψεύτικα προφίλ που συνομιλούν μεταξύ τους για να φαίνονται πολλοί!!! Η Ομοσπονδία μας, όλο αυτό το διάστημα, δεν ακολούθησε και ούτε θα ακολουθήσει τον βόρβορο και την δυσοσμία που αποπνέουν οι εμπνευστές και ενορχηστρωτές της διεστραμμένης αυτής επίθεσης. Έχει όμως ηθική υποχρέωση, πλέον, να σας ενημερώσει και να σας προφυλάξει, δημοσιεύοντας επίσημα και κυρίως γνήσια έγγραφα που κατακρημνίζουν όλες τις συκοφαντίες, τα ψεύδη και τους εν κενώ κραδασμούς παραπλανητικών εγγράφων, προκειμένου να αποκαταστήσει και να γνωρίζετε την αλήθεια. Ξεκαθαρίζουμε, λοιπόν, οριστικά και αμετάκλητα τα ακόλουθα:

τά τον Νομοθέτη το Ελεγκτικό Συνέδριο -και όχι ο Δήμος- είναι το μόνο αρμόδιο για τον έλεγχο πρωτοτύπων παραστατικών και πάντα εφόσον αυτό ζητηθεί να κατατεθούν σε αυτό και ΜΟΝΟ. Οποιοσδήποτε άλλος ισχυρισμός αποτελεί στρεψοδικία που εξυπηρετεί προφανώς θολά συμφέροντα και σκοπιμότητες με δόλωμα την δήθεν νομιμότητα. Συνιστούμε να μην μας προκαλέσουν περαιτέρω γιατί μπορούμε να ανοίξουμε και θέμα παραποιημένων εγγράφων και αντικρουόμενης αλληλογραφίας… Σύμφωνα, τέλος, με τον Ν 4129/2013 περί επιχορηγήσεων, περιγράφεται η ακριβής διαδικασία την οποία και ακολούθησε η Ομοσπονδία. Επισημαίνεται δε ότι Εποπτεύουσα Αρχή για την ΟΜΟΣΠΟΝΔΙΑ δεν είναι ο Δήμος αλλά η Περιφέρεια, από όπου δεν υπάρχει καμία παρατήρηση. Καταδεικνύεται λοιπόν απερίφραστα ότι η Ομοσπονδία είναι καθόλα σύννομη και αυτή είναι η μοναδική αλήθεια, σε πείσμα των συκοφαντών της. Ουδεμία αρμοδιότητα, επαναλαμβάνουμε, επ’ αυτού έχει ο Δήμος και ας σωπάσουν επιτέλους οι περιττολόγοι αυτοχρισθέντες κατήγοροι με τις στημένες παραπλανήσεις τους. Θα πρέπει να γνωρίζουν ότι ουδείς υπεράνω του νόμου, πόσο μάλλον όταν σε πολλές περιπτώσεις είναι ήδη νομικά υπόλογοι! (Έγγραφα 02, 03, 04)

Έγγραφο 01

Έγγραφο 02

3. Μη σύννομες ενέργειες του ΣτΔΕ 1. Σχετικά με τα ΠΡΩΤΟΤΥΠΑ ΠΑΡΑΣΤΑΤΙΚΑ Όπως μας διαβεβαίωσε η αρμόδια υπηρεσία, δηλαδή το Ελεγκτικό Συνέδριο, η Ομοσπονδία ΔΕΝ ΥΠΟΧΡΕΟΥΤΑΙ να καταθέσει πρωτότυπα παραστατικά σε επίπεδο Δήμου. Για το θέμα αυτό μεσολάβησε αναλυτική τηλεφωνική ενημέρωση από το Ελεγκτικό Συνέδριο προς τον Προϊστάμενο Οικονομικών Υπηρεσιών του Δήμου και απόρροια αυτής της ενημέρωσης-διευκρίνησης είναι το ΕΠΙΣΗΜΟ έγγραφο του Δήμου 35479/ 6//12/2018, που αποκαθιστά με τον πλέον επίσημο τρόπο την αλήθεια και δικαιώνει απόλυτα την Ομοσπονδία μας. Το απύθμενο θράσος των κατηγόρων και δυστυχώς υπηρετούντων θεσμούς έγκειται στο γεγονός ότι αν και είναι πλήρως ενήμεροι για τα ανωτέρω, εν τούτοις συνεχίζουν επιμένοντες στη διασπορά ψευδών, την παραπληροφόρηση και την παραχάραξη της αλήθειας. (Έγγραφο 01)

2. Η Διαύγεια… της ΟΜΟΣΠΟΝΔΙΑΣ Όπως διαυγέστατα μπορεί οποιοσδήποτε να δει στο αντίστοιχο αναρτημένο έγγραφο της Διαύγειας (πρώτη σελίδα), έχουν υποβληθεί από την ΟΜΟΣΠΟΝΔΙΑ τα προβλεπόμενα στο ΥΠΟΥΡΓΕΙΟ ΔΙΟΙΚΗΤΙΚΗΣ ΑΝΑΣΥΓΚΡΟΤΗΣΗΣ/ΜΗΤΡΩΟ ΕΠΙΧΟΡΗΓΟΥΜΕΝΩΝ ΦΟΡΕΩΝ. Επίσης, στο σχετικό αναρτημένο επίσημο έγγραφο φαίνεται η κατάθεση εγγράφων στο ΕΛΕΓΚΤΙΚΟ ΣΥΝΕΔΡΙΟ. Δηλαδή, πλήρης συμμόρφωση της Ομοσπονδίας με τους Νόμους και αυτό με αποδεικτικά στοιχεία και όχι λόγια. Επαναλαμβάνουμε ότι κα-

Οι περί της νομιμότητας φωνασκούντες κατήγοροί μας, καλά θα κάνουν να σωπάσουν από εδώ και στο εξής γιατί εύκολα μπορούν να μετατραπούν σε κατηγορούμενους. Ο Περιφερειακός Συμπαραστάτης του Πολίτη και της Επιχείρησης στην Περιφέρεια Αττικής, κατακεραυνώνει με έγγραφό του, τις μη σύννομες και πρωτοφανείς ενέργειες του ΣτΔΕ του Δήμου προς την Περιφέρεια, εφιστώντας του την προσοχή για παράνομη εκμαίευση και πιθανή διαρροή προσωπικών δεδομένων από τις ενέργειές του και οι οποίες μπορεί να έχουν νομικές συνέπειες κατά παράβαση της νομοθεσίας περί Προσωπικών δεδομένων. Επισυνάπτουμε το σχετικό έγγραφο της Περιφέρειας και αφήνουμε στην κρίση σας τους περί την νομιμότητα ωρυόμενους. (Έγγραφο 05)

4. «Διαρροές» …δικαστικής ετυμηγορίας; Όσον αφορά τις «διαρροές» για δικαστική εξέλιξη υποθέσεων που αφορούν την Ομοσπονδία, οι οποίες όχι μόνο προκαταλαμβάνουν την ετυμηγορία της Δικαιοσύνης αλλά και διαχέουν φανταστικές και προκατασκευασμένες δικαστικές αποφάσεις, συνιστούμε στους «πληροφοριοδότες», να είναι ιδιαίτερα προσεκτικοί καθόσον οι πράξεις τους εμπίπτουν στα αδικήματα του Ποινικού Κώδικα. Απευθυνόμενοι στους ευτελείς λασπολόγους, τόσο τους επώνυμους όσο και καλυπτόμενους πίσω από ψεύτικα προφίλ, διαμηνύουμε ότι αν συνεχίσουν την αήθη τακτική τους, η ΟΜΟΣΠΟΝΔΙΑ θα

Έγγραφο 04

Έγγραφο 03

υπερασπιστεί την νομιμότητα, την διαφάνεια, την ακεραιότητα και την εντιμότητα των ενεργειών της με κάθε πρόσφορο και νόμιμο μέσο, πόσο μάλλον όταν εκ μέρους τους έχουν ήδη λάβει χώρα πλήθος ενεργειών και πράξεων χαρακτηριστικά αποκλίνουσες από τον Νόμο. Διαβεβαιώνουμε, τέλος, εσάς, τους συμπολίτες μας, ότι οι δραστηριότητες της Ομοσπονδίας μας είναι καθόλα νόμιμες και σας προτείνουμε να αντιμετωπίσετε με αδιαφορία και περιφρόνηση τους συκοφάντες και τα σκοτεινά τους σχέδια. Η ΟΜΟΣΠΟΝΔΙΑ είναι η ενωμένη δύναμη των ενεργών πολιτών και η φωνή όλων των συμπολιτών μας και αυτή τη δύναμη επιδιώκουν να μειώσουν. Εκείνους τους ενώνουν η ιδιοτέλεια, η μικροπολιτική, οι καρέκλες, τα προσωπικά συμφέροντα… Εμάς, μας ενώνουν η αγάπη για την πόλη μας και

Έγγραφο 05

τα μεγάλα προβλήματα που χρόνια τώρα παλέψαμε και παλεύουμε χέρι-χέρι και απέναντι στην κρατική αδιαφορία και αναλγησία. Εκείνοι βλέπουν το θλιβερό τέλος τους και αντιδρούν υστερικά… Εμείς θα είμαστε και πάλι εδώ, απέναντι στους επόμενους καιροσκόπους και ενωμένοι στα καυτά ζητήματα της ζωής και του τόπου μας.


ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Επικαιρότητα

Ξεκινάει το έργο της αποχέτευσης των Γλυκών Νερών

Με

πρωτοφανείς για τα ελληνικά δεδομένα ταχείες διαδικασίες, ξεκίνησαν οι εργασίες για την κατασκευή της αποχέτευσης σε Γλυκά Νερά και Φούρεσι. Στις 8 Οκτωβρίου 2018 ξεκίνησε ο διαγωνισμός για την εύρεση αναδόχου, ο οποίος έληξε στις 12 Νοεμβρίου 2018, η αποσφράγιση των προσφορών έγινε στις 16 Νοεμβρίου 2018 και με τον ορισμό του αναδόχου σήμανε και η έναρξη των εργασιών. Ανάδοχος του έργου η Ερτέκα Α.Ε. ενεργό μέλος του κατασκευαστικού τομέα τα τελευταία 40 χρόνια. Πρόκειται για ένα τεράστιο έργο κόστους 22 εκατομμυρίων Ευρώ (συν ΦΠΑ) το οποίο θ’ αλλάξει βελτιωτικά την ποιότητα ζωής των δημοτών μας. Από την υπογραφή της σύμβασης και μετά, ο ανάδοχος είχε 24 μήνες και γι’ αυτόν το λόγο τα έργα άρχισαν άμεσα και σε πολλά μέτωπα. Εγγυητής της εύρυθμης υλοποίησης του έργου είναι μία από τις καλύτερες μελετητικές εταιρίες της Ευρώπης, η ΕΥΔΑΠ, στην οποία ο Δήμος Παιανίας - Γλυκών Νερών εμπιστεύθηκε και τη μελέτη. Συνολικά προβλέπεται η κατασκευή περίπου 59 χιλιομέτρων αγωγών (38 στα Γλυκά Νερά και 21 στο Φούρεσι). Επίσης προβλέπεται η κα-

τασκευή 2 αντλιοστασίων, ένα στα Γλυκά Νερά, στην οδό Παπαδιαμάντη πριν τη συμβολή της με τη Λεωφόρο Λαυρίου κι ένα στο Φούρεσι, στην οδό Ολυμπιονικών, σε δημοτικό ελεύθερο χώρο που έχει παραχωρηθεί για τον σκοπό αυτό από τον Δήμο Παιανίας. Ένα ακόμη θετικό στοιχείο που πρέπει να σημειωθεί είναι ότι το μεγαλύτερο μέρος του κόστους της σύνδεσης για κάθε σπίτι των Γλυκών Νερών και του Φούρεσι με την αποχέτευση, μετά από συντονισμένες ενέργειες και προσπάθειες του Δήμου, θα είναι πολύ χαμηλό -περίπου στα 350€- ενώ στους όμορους Δήμους κυμαίνεται από τα 1700€ μέχρι και τα 2000€. Έχει επίσης, τη σημασία του ν’ αναφερθεί ότι είναι το πρώτο έργο αποχέτευσης που εγκρίθηκε στην Ανατολική Αττική, καθώς και το πρώτο που θα υλοποιηθεί, κάτι που σαφέστατα και αποδεδειγμένα οφείλεται στις ταχύτατες ενέργειες της Διοίκησης του Δήμου και προσωπικά του δημάρχου κ. Σπύρου Στάμου, καθώς και του πρώην αντιδημάρχου Τεχνικών Υπηρεσιών κ. Δημήτρη Αλεξίου.

Δ' φάση του έργου Αντιπλημμυρικής Προστασίας, Κατασκευής Αποχέτευσης Ομβρίων του κυρίως οικισμού Καλυβίων Σ

υνεχίζονται τα αντιπλημμυρικά έργα στην δυτική πλευρά του κυρίως οικισμού της πόλης των Καλυβίων, με την ολοκλήρωση των οποίων θα θωρακιστεί και αυτή η πλευρά του οικισμού. Το έργο χρηματοδοτείται από την Περιφέρεια Αττικής και ο προϋπολογισμός του ανέρχεται στα 2.160.000 Ευρώ. Η μελέτη του έργου είχε κατατεθεί για χρηματοδότηση από την προηγούμενη Δημοτική Αρχή με Δήμαρχο τον Πέτρο Φιλίππου και χρηματοδοτήθηκε, δημοπρατήθηκε και κατασκευάζεται από την Περιφέρεια Αττικής μετά από εισήγηση προς το Περιφερειακό Συμβούλιο του Αντιπεριφερειάρχη Ανατολικής Αττικής Πέτρου Φιλίππου. Το έργο αναμένεται να ολοκληρωθεί τους επόμενους και έτσι ολοκληρώνεται η αντιπλημμυρική προστασία σε ολόκληρο τον οικισμό των Καλυβίων.

19

Μήνυμα του δήμαρχου Παιανίας - Γλυκών Νερών Σπύρου Στάμου

«Αγαπητοί Συνδημότες, Είμαι στην ευχάριστη θέση να σας ανακοινώσω, πως μετά από ένα πολύ μεγάλο αγώνα της Δημοτικής Αρχής, η αποχέτευση Γλυκών Νερών ξεκινά. Το μεγάλο αυτό έργο υποδομής και πολιτισμού βρίσκεται σήμερα στο σημείο εκκίνησης, χάρις στον άψογο συντονισμό και στη σύμπραξη των συνεργατών μου, με την Τεχνική Υπηρεσία του Δήμου -την οποία και ευχαριστώ- με πρωτεργάτη τον εντεταλμένο στα μεγάλα έργα του Δήμου κ. Δημήτρη Αλεξίου, πρώην Αντιδήμαρχο Τεχνικών Υπηρεσιών. Για τη χρηματοδότηση του έργου, η Δημοτική Αρχή εξασφάλισε 22 εκ. ευρώ, μέσω της Περιφέρειας, από Ευρωπαϊκά Προγράμματα. Μετά την προγραμματική σύμβαση, ο Δήμος ανέθεσε τη διαδικασία του διαγωνισμού και της κατασκευής του έργου της αποχέτευσης, στην Ε.ΥΔ.Α.Π. η οποία πλέον είναι και η διευθύνουσα Αρχή του έργου. Πρόσφατα, ολοκληρώθηκε η διαγωνιστική διαδικασία και ο ανάδοχος του έργου, που προέκυψε είναι η εταιρία ΕΡΤΕΚΑ Α.Ε. Η έναρξη των εργασιών προσδιορίζεται άμεσα, σε 30 περίπου ημέρες από σήμερα. Το έργο δημοπρατήθηκε για 22.200.000,00 ευρώ, ενώ από τη διαδικασία δημοπράτησης προέκυψεη ανάδοχος εταιρία, η οποία μειοδότησε με μέση έκπτωση 56,79%. Δηλαδή, το συνολικό κόστος κατασκευής του έργου μαζί με έξτρα προβλεπόμενα κόστη, συν το Φ.Π.Α., ανέρχεται στα 11.86.054,18 ευρώ. Από την υπογραφή της σύμβασης και μετά, ο ανάδοχος έχει 24 μήνες για την κατασκευή και για αυτό το λόγο, τα έργα θα αρχίσουν άμεσα και σε πολλά μέτωπα. Το συνολικό μήκος των αγωγών που θα κατασκευαστούν αγγίζει τα 60 χλμ. και αφορά τις περιοχές ολόκληρου του παλαιού σχεδίου των Γλυκών Νερών και το Φούρεζι. Επίσης, προβλέπεται η κατασκευή δύο (2) αντλιοστασίων, ένα στα Γλυκά Νερά, στην οδό Παπαδιαμάντη πριν τη συμβολή της με τη Λεωφόρο Λαυρίου και ένα στο Φούρεζι, στην οδό Ολυμπιονικών. Ο κύριος αγωγός θα οδεύει κατά μήκος της Λεωφόρου Λαυρίου και θα συνδεθεί με τον ήδη κατασκευασμένο αγωγό που βρίσκεται στη θέση «Λαγός» στη Δημοτική Ενότητα Παιανίας. Κλείνοντας, πρέπει να τονίσω ότι η Αποχέτευση Γλυκών Νερών είναι η το πρώτο έργο αποχέτευσης που εγκρίθηκε στην Ανατολική Αττική, καθώς και το πρώτο που θα υλοποιηθεί και αυτό οφείλεται στις συντονισμένες ενέργειες της Δημοτικής Αρχής. Οφείλεται στους εκλεκτούς συνεργάτες, με τους οποίους έχω την τιμή να συμπορεύομαι, στον κοινό μας αγώνα για τον τόπο μας. Σας ευχαριστώ!»


Επικαιρότητα

20

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

Άνοδος στην Α’ ΕΣΠΑΑΑ για τη Γυναικεία Ομάδα Volley του Επιμορφωτικού Συλλόγου Νέας Μάκρης Η

Τετάρτη 27 Μαρτίου 2019, γράφτηκε στην ιστορία του τμήματος Volley του Επιμορφωτικού Συλλόγου Νέας Μάκρης με χρυσά γράμματα! Τα κορίτσια της Νέας Μάκρης, υπό τις οδηγίες του coach Γιάννη Φάκα, στην τελευταία αγωνιστική του πρωταθλήματος, παίζοντας βόλεϊ υψηλού επιπέδου, μπροστά σε ένα κατάμεστο από κόσμο γήπεδο, όχι μόνο κατάφεραν να κερδίσουν την Α.Ο. Δεξαμενή Μεταμόρφωσης με 3-0 σετ (όσο είχαν χάσει στον πρώτο γύρο του πρωταθλήματος της Β΄ Τοπικής Κατηγορίας ΕΣΠΑΑΑ), αλλά να πάρουν και την απαραίτητη διαφορά πόντων, που τους χάρισε τον τίτλο του Πρωταθλητή 2018-2019 για την Β΄ ΕΣΠΑΑΑ Γυναικών (τα σετ του αγώνα: 25-14, 25-15, 25-17). Μέσα σε μια πανηγυρική και πάνω από όλα φίλαθλη ατμόσφαιρα, που δημιούργησαν οι 100αδες φίλοι του αθλήματος που βρέθηκαν στο Κλειστό Γήπεδο «Γιάννης Δημητριάδης» του Αθλητικού και Πολιτιστικού Πάρκου Νέας Μάκρης, οι αθλήτριες και το τεχνικό επιτελείο του Επιμορφωτικού Συλλόγου Νέας Μάκρης, μετά το τέλος του αγώνα γιόρτασαν με την ψυχή τους την απευθείας άνοδο στην Α’ ΕΣΠΑΑΑ για πρώτη φορά στην ιστορία του Συλλόγου!

ΣΚΙΑΔΕΙΑ 2019: Αγώνας Παραδόθηκε προς χρήση, - γιορτή για την Παιανία! το νέο Δημοτικό Γυμναστήριο Γ Δήμου Μαρκοπούλου ια 5η συνεχόμενη χρονιά (σ.σ. από το 2015) ο Δήμος Παιανίας και ο Πολιτιστικός Αθλητικός Οργανισμός του Δήμου Παιανίας, διοργάνωνουν την Κυριακή 14 Απριλίου 2019, τον ιστορικότερο Αγώνα Δρόμου της Παιανίας, τα ΣΚΙΑΔΕΙΑ 2019, με εκκίνηση και τερματισμό την κεντρική πλατεία της πόλης. Οι Αγώνες είναι αφιερωμένοι στη μνήμη του Βαλκανιονίκη αθλητή από την Παιανία Ιωάννη Σκιαδά και περιλαμβάνουν αγώνες 5χλμ., 10χλμ., 1.500μ. Fun Race και Παιδικούς Αγώνες.

Μπορείτε να συμπληρώσετε την ηλεκτρονική φόρμα εγγραφής που θα βρείτε στην ιστοσελίδα του Αγώνα www.skiadia.gr Για ακόμα μία χρονιά, ο Αγώνας Δρόμου ΣΚΙΑΔΕΙΑ έχει κοινωνικό χαρακτήρα και συνδέεται με την Ενίσχυση του Κοινωνικού Παντοπωλείου του Δήμου Παιανίας. Οι δρομείς των 5χλμ. και 10χλμ. αντί αντιτίμου συμμετοχής καλούνται να προμηθευτούν δωροεπιταγές των 5 Ευρώ από γνωστές αλυσίδες Σούπερ Μάρκετ και να τις παραδώσουν στην γραμματεία του Αγώνα κατά την παραλαβή των starter pack τους.

Ο

λοκληρώθηκαν όλες οι απαραίτητες εργασίες και παραδόθηκε προς χρήση, το νέο Δημοτικό Γυμναστήριο του Δήμου Μαρκοπούλου, που στεγάζεται στις καινούργιες κερκίδες του Δημοτικού Σταδίου. Το νέο Δημοτικό Γυμναστήριο, εξοπλίστηκε με δαπάνη του Νομικού Προσώπου «Βραυρώνιος», με σύγχρονο, ασφαλή και ποιοτικό εξοπλισμό για μυϊκή ενδυνάμωση. Ενδεικτικά, στον χώρο του Γυμναστηρίου, υπάρχουν Μηχανήματα για ασκήσεις στήθους (multi press, peck dec), τρικέφαλων (leg extension), δικεφάλων (leg curl), απαγωγών - προσαγωγών - γλουτών, κωπηλατική, πάγκους δικεφάλων, κοιλιακών και ραχιαίων,

Cross Over και άλλα. Το Γυμναστήριο, στελεχώνεται από Καθηγητές Φυσικής Αγωγής, οι οποίοι θα επιβλέπουν τους αθλούμενους και θα μεριμνούν για την ασφαλή εκγύμνασή τους. Η χρήση του χώρου, είναι ελεύθερη σε όλους τους πολίτες, άνω των 16 ετών, που το επιθυμούν, εφόσον προηγηθεί εγγραφή στο Πρόγραμμα «Αθλητισμός & Πολιτισμός για Όλους». Επίσης, τα Αθλητικά Σωματεία του Δήμου Μαρκοπούλου, θα μπορούν να χρησιμοποιούν το Δημοτικό Γυμναστήριο για την ενδυνάμωση των αθλητών τους και την βέλτιστη απόδοσή τους, μετά από διαδικασία παραχώρησης.


Εκπαίδευση

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

21

ΠΑΝΕΛΛΗΝΙΕΣ 2019 - ΕΠΑΝΑΛΗΠΤΙΚΑ ΘΕΜΑΤΑ Τα Φροντιστήρια ΠΡΟΟΠΤΙΚΗ βρίσκονται και φέτος -όπως κάθε χρόνο- στο πλευρό των μαθητών της Γ΄ Λυκείου για τις εξετάσεις του Ιουνίου . Γι’ αυτό το σκοπό ξεκινούν μία συνεργασία με την εφημερίδα «Ο ΔΗΜΟΤΗΣ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ» στην οποία θα δημοσιεύονται θέματα στο πνεύμα των εξετάσεων που θα επιμελούνται οι έμπειροι καθηγητές των φροντιστηρίων μας. Σε κάθε δημοσίευση θα υπάρχουν θέματα που αφορούν και τους τρεις προσανατολισμούς της Γ΄ Λυκείου. Σκοπός μας δεν είναι να υποκατασταθεί η προετοιμασία των μαθητών, αλλά να προσφερθεί μία ακόμα αφορμή για εξάσκηση. Γι’ αυτό το λόγο δε δίνονται και οι λύσεις των θεμάτων. Συνεπώς οι υποψήφιοι καλούνται να δοκιμάσουν μόνοι τους τις δυνατότητές τους. Για κάθε διευκρίνιση ή απορία αλλά και για τις λύσεις των θεμάτων, οι μαθητές μπορούν να επικοινωνούν με το Φροντιστήριο ΠΡΟΟΠΤΙΚΗ Νέας Μάκρης στο τηλέφωνο 22940 91119.

ΑΡΧΑΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ - ΓΝΩΣΤΟ ΚΕΙΜΕΝΟ ΠΟΛΙΤΙΚΑ ΑΡΙΣΤΟΤΕΛΗ (ΕΝΟΤΗΤΕΣ 15,16,18)

Τῷ περὶ πολιτείας ἐπισκοποῦντι, καὶ τίς ἑκάστη καὶ ποία τις, σχεδὸν πρώτη σκέψις περὶ πόλεως ἰδεῖν, τί ποτέ ἐστιν ἡ πόλις. Νῦν γὰρ ἀμφισβητοῦσιν, οἱ μὲν φάσκοντες τὴν πόλιν πεπραχέναι τὴν πρᾶξιν, οἱ δ’ οὐ τὴν πόλιν ἀλλὰ τὴν ὀλιγαρχίαν ἢ τὸν τύραννον· τοῦ δὲ πολιτικοῦ καὶ τοῦ νομοθέτου πᾶσαν ὁρῶμεν τὴν πραγματείαν οὖσαν περὶ πόλιν, ἡ δὲ πολιτεία τῶν τὴν πόλιν οἰκούντων ἐστὶ τάξις τις. Ἐπεὶ δ’ ἡ πόλις τῶν συγκειμένων, καθάπερ ἄλλο τι τῶν ὅλων μὲν συνεστώτων δ’ ἐκ πολλῶν μορίων, δῆλον ὅτι πρότερον ὁ πολίτης ζητητέος˙ ἡ γὰρ πόλις πολιτῶν τι πλῆθός ἐστιν. Ὥστε τίνα χρὴ καλεῖν πολίτην καὶ τίς ὁ πολίτης ἐστὶ σκεπτέον. Καὶ γὰρ ὁ πολίτης ἀμφισβητεῖται πολλάκις· οὐ γὰρ τὸν αὐτὸν ὁμολογοῦσι πάντες εἶναι πολίτην· ἔστι γάρ τις ὃς ἐν δημοκρατίᾳ πολίτης ὢν ἐν ὀλιγαρχίᾳ πολλάκις οὐκ ἔστι πολίτης. (κειμενο 1) Ὁ πολίτης οὐ τῷ οἰκεῖν που πολίτης ἐστίν (καὶ γὰρ μέτοικοι καὶ δοῦλοι κοινωνοῦσι τῆς οἰκήσεως),οὐδ’ οἱ τῶν δικαίων μετέχοντες οὕτως ὥστε καὶ δίκην ὑπέχειν καὶ δικάζεσθαι (τοῦτο γὰρ ὑπάρχει καὶ τοῖς ἀπὸ συμβόλων κοινωνοῦσιν)˙ … πολίτης δ’ ἁπλῶς οὐδενὶ τῶν ἄλλων ὁρίζεται μᾶλλον ἢ τῷ μετέχειν κρίσεως καὶ ἀρχῆς. … Τίς μὲν οὖν ἐστιν ὁ πολίτης, ἐκ τούτων φανερόν˙ ᾧ γὰρ ἐξουσία κοινωνεῖν ἀρχῆς βουλευτικῆς καὶ κριτικῆς, πολίτην ἤδη λέγομεν ειναι τοιαύτης της πόλεως,πόλιν δὲ τὸ τῶν τοιούτων πλῆθος ἱκανὸν πρὸς αὐτάρκειαν ζωῆς, ὡς ἁπλῶς εἰπεῖν. (κείμενο 2) Η άποψη ότι την εξουσία στην πόλη πρέπει μάλλον να την ασκεί το πλήθος παρά οι άριστοι που είναι λίγοι, νομίζω ότι μπορεί να συζητηθεί –με το νόημα ότι είναι μια άποψη που παρουσιάζει, βέβαια, κάποιες δυσκολίες, που περιέχει όμως ίσως και κάποια αλήθεια. Για το πλήθος μπορεί κανείς να πει τούτο: το κάθε επιμέρους άτομο μπορεί να μην είναι τίποτε το αξιόλογο, ενωμένοι όμως όλοι μαζί είναι ενδεχόμενο να είναι, όχι σαν άτομα αλλά σαν σύνολο, καλύτεροι από εκείνους – όπως ακριβώς τα δείπνα που γίνονται με τη συνεισφορά πολλών είναι καλύτερα από εκείνα που γίνονται με έξοδα ενός μόνο ανθρώπου. Πολλοί καθώς είναι, ο καθένας διαθέτει ένα μόριο αρετής και φρόνησης, και έτσι, ενωμένοι οι πολλοί γίνονται, κατά κάποιο τρόπο, ένας άνθρωπος με πολλά πόδια, με πολλά χέρια και με πολλές αισθήσεις –και με ανάλογη, βέβαια, αρετή και εξυπνάδα. Γι’ αυτό και οι πολλοί είναι σε θέση να κρίνουν καλύτερα τα έργα της μουσικής και των ποιητών: ο ένας κρίνει ένα μέρος, ο άλλος ένα άλλο, και όλοι μαζί το σύνολο.(κείμενο 3)

ΠΑΡΑΤΗΡΗΣΕΙΣ: ΘΕΜΑ Α. 1. Να χαρακτηριστούν οι παρακάτω προτάσεις με Σ/Λ ανάλογα με τα παραπάνω αποσπάσματα: -Την ευθύνη μιας πολιτικής πράξης την έχει ο λαός. -Ο νομοθέτης δραστηριοποιείται εκτός πόλεως. -Για την έννοια του πολίτη υπάρχει γενική συμφωνία. -Τα «σύμβολα» καθόριζαν τον πολίτη μιας πόλης. (μον.4) 2.Ποιός είναι ο ορισμός του πολιτεύματος σύμφωνα με τον Αριστοτέλη ;(κείμενο 1) 6 Μονάδες

ΘΕΜΑ Β 1. «Καί γάρ ο πολίτης αμφισβητειται πολλάκις»: να σχολιάσετε τη φράση αυτή και να δείξετε ποιά είναι η σχέση του πολίτη με την πόλη και το πολίτευμα. (μον.10) 2. Πως σύμφωνα με το κείμενο 2 η συμμετοχή στις δικαστικές λειτουργίες και στα αξιώματα ορίζει την έννοια του πολίτη; 10 Μονάδες ΘΕΜΑ Γ 1. Να χαρακτηρίσετε Σωστές ή Λανθασμένες τις προτάσεις που ακολουθούν: -Στην Ακαδημία οι Λόγιοι προωθούσαν όλοι μαζί την επιστημονική έρευνα. -Ο Αριστοτέλης επιμελήθηκε μια καινούρια έκδοση των Ομηρικών Επών. -Στην 3η φάση της φιλοσοφικής του δραστηριότητας γράφει μόνο τα Πολιτικά. -Το επιθυμητικόν μέρος της ψυχής σχετίζεται με τις ηθικές αρετές. -Η ψυχή είναι η κατοικία του δαίμονος υποστήριζε ο Ηράκλειτος. 5 Μονάδες 2. Πως ορίζει την ευδαιμονία ο Αριστοτέλης; 5 Μονάδες ΘΕΜΑ Δ Α Β Ορωμεν άφιξη Ομολογουσι σκόπιμος Σκεπτέον τηλεόραση Ορίζεται λογοκλοπή Ικανόν περιορισμός Ορκομωσία 5 Μονάδες 2. Να γράψετε δυο ομόρριζες λέξεις στα νέα Ελληνικά για καθεμιά από τις παρακάτω λέξεις: Ορωμεν, μετέχοντες, αμφισβητουσιν,πεπραχέναι, φανερόν. 5 Μονάδες ΘΕΜΑ Ε «κι οι πιο αχαμνοί ,σαν πουν να σμίξουνε, κάτι θα κάνουν πάντα».Αυτός ο στίχος ανήκει στην ραψωδία Ν της Ιλιάδας στην οποία ο ποιητής περιγράφει μια φοβερή μάχη Αχαιών και Τρώων ,βάζοντας τον Ποσειδόνα να πει αυτή τη φράση για να εμψυχώσει τον Ιδομενέα.Εξετάζοντας αυτό το στίχο παράλληλα με το μεταφρασμένο κείμενο 3 να δείξετε την ιδέα της αθροιστικής θεωρίας που υπάρχει και στα δυο αποσπάσματα.Θεωρείτε ότι αυτή η θεωρία εφαρμόζεται στις σύγχρονες κοινωνίες; 10 Μονάδες

Επιμέλεια: Τίνα Δαλαμάγκα, Σοφία Γιαννακέα, Τζένη Νικητοπούλου, Νίκος Μπαϊρακτάρης

ΒΙΟΛΟΓΙΑ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ 1) Φαίνεται πυρηνικό γονίδιο ευκαρυωτικού κυττάρου, όπου σημειώνεται η θέση των Α.Λ.Μ. Είναι επίσης γνωστό ότι ο κλώνος Ι είναι ο μεταγραφόμενος. α) να εξηγήσετε τη διεύθυνση της μεταγραφής β) να εξηγήσετε τους προσανατολισμούς των δύο κλώνων γ) να εξηγήσετε αν η θέση του υποκινητή του γονιδίου είναι η περιοχή 1 ή 2. δ) αν το προιόν της μεταγραφής επιτελεί το ρόλο του στο χώρο του κυττάρου όπου και παράχθηκε, να εξηγήσετε για τι ακριβώς γονιδιακό προιόν πρόκειται και να αναλύσετε το ρόλο του. ε) αν στα αριστερά φαίνεται η τελευταία θέση έναρξης αντιγραφής σε αυτό το μόριο DNA, να εξηγήσετε στη διχάλα αντιγραφής που θα ανοίξει και θα περιλαμβάνει το γονίδιο, ποιος κλώνος θα αντιγραφεί με συνεχή και ποιος με ασυνεχή αντιγραφή. ΘΕΑ ΑΚΡO ΜΟΡΙΟΥ DNA …._↓______________________________________________________________________________________________ ↓ Ι … .1_Ι________ΓΟΝΙΔΙΟ______________________________________________________________________Ι_2___ ΙΙ ↑ ↑ ΑΛΛΗΛΟΥΧΙΕΣ ΛΗΞΗΣ ΜΕΤΑΓΡΑΦΗΣ ΑΚΡΟ ΓΟΝΙΔΙΟΥ 2) (ΕΛΑΦΙ) ΣΥΜΠΛΗΡΩΣΤΕ ΤΟΝ ΠΙΝΑΚΑ ΖΕΥΓΗ ΒΑΣΕΩΝ

ΑΡΙΘΜΟΣ ΧΡΩΜΟΣΩΜΑΤΩΝ (Α ΚΑΙ Φ)

ΑΡΙΘΜΟΣ ΜΟΡΙΩΝ DNA (Α ΚΑΙ Φ)

ΙΝΙΔΙΑ ΧΡΩΜΑΤΙΝΗΣ

ΧΡΩΜΑΤΙΔΕΣ

ΖΕΥΓΗ ΟΜΟΛΟΓΩΝ ΧΡΩΜΟΣΩΜΑΤΩΝ (Α ΚΑΙ Φ)

ΚΕΝΤΡΟΜΕΡΙΔΙΑ

ΒΡΑΧΙΟΝΕΣ Φ.ΔΕΣΜΟΙ

ΣΩΜΑΤΙΚΟ ΚΥΤΤΑΡΟ ΑΡΧΗ ΜΕΣΟΦΑΣΗΣ ΣΩΜΑΤΙΚΟ 8.108 ΚΥΤΤΑΡΟ ΣΤΗ ΜΕΤΑΦΑΣΗ ΓΑΜΕΤΗΣ ΤΟΥ ΕΛΑΦΙΟΥ

20

2) Στο παρακάτω σχήμα φαίνεται η αντιγραφή ενός τμήματος δίκλωνου DNA. Σημειώνονται ΟΛΑ τα πρωταρχικά τμήματα (π.τ.) που έγιναν. Να εξηγήσετε τον τρόπο αντιγραφής του κάθε μητρικού κλώνου στην προκειμένη περίπτωση καθώς και τους προσανατολισμούς των μητρικών κλώνων και των πρωταρχικών τμημάτων σημειώνοντας τη φορά σύνθεσης των π.τ. με βελάκι. Που βρίσκεται η Θ.Ε.Α; στη θέση 1,2, ή3; Αιτιολογήστε ποιες ΘΕΑ αποκλείσατε. Ποια είναι η αλληλουχία του π.τ. Χ ; Ποιο ένζυμο έφτιαξε τα π.τ. και ποιο τα αντικαθιστά με αλληλουχίες DNA; 3 1 2 ↓ ↓ ↓ p TACGGTAATTCTAAGTACCGGTAT CGATA ______ Χ ___ ____ ____ ATGCCATTAAGATTCATGGCCATA GCTAT ↑ ↑ ↑ 3 1 2 Επιμέλεια: Φώτης Αλπέτζος

ΗΜΕΡΙΔΑ ΕΠΑΓΓΕΛΜΑΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΝΕΟ ΕΚΠΑΙΔΕΥΤΙΚΟ ΣΥΣΤΗΜΑ - ΣΧΟΛΕΣ & ΕΠΑΓΓΕΛΜΑΤΑ ΜΕ ΜΕΛΛΟΝ Κυριακή 14 Απριλίου 11.00 π.μ. στον Κινηματογράφο «Αλίκη» στο Αθλητικό & Πολιτιστικό Πάρκο Νέας Μάκρης Ομιλητής: Δρ Κωνσταντίνος Κότιος, συνιδρυτής του εκπαιδευτικού ομίλου EMPLOY, o οποίος δραστηριοποιείται στους τομείς του Επαγγελματικού Προσανατολισμού, της Στρατηγικής Καριέρας και της Δια Βίου Εκπαίδευσης.

Η ΕΙΣΟΔΟΣ ΕΙΝΑΙ ΕΛΕΥΘΕΡΗ ΓΙΑ ΟΛΟΥΣ ΤΟΥΣ ΜΑΘΗΤΕΣ ΚΑΙ ΤΟΥΣ ΓΟΝΕΙΣ ΤΟΥ ΔΗΜΟΥ ΜΑΣ Την εκδήλωση διοργανώνουν τα Φροντιστήρια ΠΡΟΟΠΤΙΚΗ

ΜΑΡΑΘΩΝΑΣ:

ΝΕΑ ΜΑΚΡΗ:

ΡΑΦΗΝΑ:

ΠΙΚΕΡΜΙ:

ΣΠΑΤΑ:

ΠΑΛΛΗΝΗ:

Σπηλαίου Πανός 10 τηλ. 2294067757

Δημητριάδη & Καφετζή τηλ. 2294091119

Λ. Φλέμινγκ 40-42 τηλ. 2294026060

Αγίου Χριστοφόρου 15 τηλ. 2106036096

Β. Παύλου 119-121 τηλ. 2106630100

Λ. Λεονταρίου 17 τηλ. 2106664240


ΠΡΟΣΦΟΡΑ ΕΡΓΑΣΙΑΣ

ΖΗΤΗΣΗ ΑΚΙΝΗΤΩΝ

ΠΩΛΕΊΤΑΙ ΛΕΥΚΌ IPHONE 4S 8GB σε άριστη κατάσταση. Τιμή 70€. Τηλέφωνο 6977232183.

ΕΝΟΙΚΙΑΣΕΙΣ ΑΚΙΝΗΤΩΝ ΑΠΌ ΤΙΣ ΕΚΔΟΣΕΙΣ ΑΤΤΙΚΗΣ (εφημερίδα Ο ΔΗΜΟΤΗΣ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ και ηλεκτρονική σελίδα www.dimotisnews.gr), ΖΗΤΟΥΝΤΑΙ συνεργάτες, ΔΗΜΟΣΙΟΓΡΑΦΟΙ και ΠΑΡΑΓΩΓΟΙ ΔΙΑΦΗΜΙΣΕΩΝ, από όλες τις περιοχές της Ανατολικής Αττικής για μόνιμη απασχόληση. Μόνο σοβαρές προτάσεις. Βιογραφικά στο e-mail: info@dimotisnews.gr. ΖΗΤΕΊΤΑΙ σερβιτόρα για καφετέρια και σερβιτόρα ή σερβιτόρος για ταβέρνα στο Κάτω Σούλι Μαραθώνος. Μισθός ικανοποιητικός. Τηλέφωνα 2294064182 6977467419.

ΝΈΑ ΜΆΚΡΗ, πλησίον Αθλητικού και Πολιτιστικού Κέντρου Νέας Μάκρης, ενοικιάζεται αυτόνομη ανακαινισμένη μονοκατοικία 70 τ.μ. σε συγκρότημα κατοικιών, σε οικόπεδο 4.000τ.μ. ισόγεια, κατασκευή 2007, 1υ/δ επιπλωμένο με εντοιχιζομενες ντουλαπες, επιπλωμένο καθιστικό με τζάκι, παρέχονται οικιακές συσκευές, 1 μπάνιο, μεγάλη βεράντα-αυλή, αυτόνομη θέρμανση, κλιματισμός, ηλιακός, ανοικτό πάρκιν, 800μ. από τη θάλασσα, κοινοχρηστος μεγάλος κήπος με bbq. Τιμη 350€. Διατίθεται και μη επιπλωμένο. Τηλέφωνο 6988025274.

ΠΩΛΗΣΕΙΣ ΑΚΙΝΗΤΩΝ

ΠΩΛΗΣΕΙΣ ΗΛΕΚΤΡΟΝΙΚΩΝ ΣΥΣΚΕΥΩΝ ΠΩΛΕΊΤΑΙ TABLET SONY Z1 10,1'' μαύρο σε άριστη κατάσταση, πολύ λίγο χρησιμοποιημένo. Τιμή 100€. Τηλέφωνο 6977232183.

ΝΕΑ ΜΑΚΡΗ ΚΕΝΤΡΟ, πωλείται γραφείο 75 τ.μ., 1ου ορόφου, προσόψεως, κατασκευή 2004, νεοκλασικό, ενεργειακής κλάσης Α+,

24 ωρη

εξυπηρέτηση ερικό σε Ελλάδα & Εξωτ

1 wc, ανοικτό πάρκινγκ μιάς θέσης, τριφασικό ρεύμα, ασανσέρ, κλιματισμός, μισθωμένο, άριστη κατάσταση, τιμή 120.000€ (συζητήσιμη). Τηλέφωνο 6977232183.

ΚΑΤΩ ΧΑΛΚΙΑΝΙΚΑ ΑΧΑΪΑΣ, πλησίον Ζαρούχλας και χιονοδρομικού κέντρου Καλαβρύτων, πωλείται εξοχική κατοικία, μεζονέτα 120 τ.μ. σε άριστη κατάσταση κατασκευής του 1982, σε δύο άρτια και οικοδομήσιμα οικόπεδα 1.200 τ.μ., με 3 Υ/Δ, 2 μπάνια, κεντρική θέρμανση, τζάκι, εξωτερική αποθήκη και θέα στον Χελμό. Ευκαιρία, μόνο σοβαρές προτάσεις. Τηλέφωνο 6944640581.

ΠΡΩΤΕΥΣ - N.Γ. ΣΠΕΤΣΙΩΤΗΣ: ΖΗΤΟΥΝΤΑΙ ΑΚΙΝΗΤΑ Β.Α. ΑΤΤΙΚΗΣ πλησίον παραλίας ή με θέα θαλάσσης για αγορά μετρητοίς ή ενοικιάσεις μόνιμες - βραχυπρόθεσμες επιπλωμένων ή μη. Δυνατότης χορηγήσεως Στεγαστικών Δανείων. ΜΕΓΑΛΕΣ ΕΠΕΝΔΥΤΙΚΕΣ ΕΥΚΑΙΡΙΕΣ. www.proteus - properties. com. Τηλέφωνα: 6972702828 2294026145. ΕΥΧΑΡΙΣΤΗΡΙΟ Ο Α.Π.Σ. ΤΕΛΜΗΣΣΟΣ ΝΈΑΣ ΜΆΚΡΗΣ ΜΑΡΑΘΏΝΟΣ θα ήθελε να ευχαριστήσει θερμά ΤΟΝ ΥΠΟΨΉΦΙΟ ΔΉΜΑΡΧΟ ΜΑΡΑΘΏΝΟΣ Κ. ΣΠΎΡΟ ΛΙΒΑΘΙΝΌ για την πολύτιμη προσφορά του, αγοράς απινιδωτή και αθλητικού υλικού που θα χρησιμοποιηθεί για τις ανάγκες και δραστηριότητες του συλλόγου. Ευχόμαστε από τα βάθη της καρδιάς μας καλή επιτυχία στους στόχους και στο πολύτιμο έργο του. Με τα τιμής ΤΟ ΔΙΟΙΚΗΤΙΚΌ ΣΥΜΒΟΎΛΙΟ

ΚΟΙΝΩΝΙΚΑ Ο ΣΤΥΛΙΑΝΌΣ ΤΣΈΛΙΓΚΑΣ του Κωνσταντίνου και της Κωνσταντίνας, το γένος Σωτηράκη, που γεννήθηκε στην Αθήνα και κατοικεί στον Μαραθώνα Αττικής

και η ΙΦΙΓΈΝΕΙΑ ΑΡΓΥΡΆΚΗ του Ευστάθιου και της Αγγελικής, το γένος Ζάκκα που γεννήθηκε στην Καλαμάτα και κατοικεί

στον Μαραθώνα Αττικής, πρόκειται να παντρευτούν και ο γάμος τους θα γίνει στον Μαραθώνα Αττικής.


Υγεία

ΠΑΡΑΣΚΕΥΗ 5 ΑΠΡΙΛΙΟΥ 2019

23

ΧΡΗΣΙΜΑ ΤΗΛΕΦΩΝΑ ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΝΕΑΣ ΜΑΚΡΗΣ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Αρτέμιδος, 19005 Νέα Μάκρη Τηλέφωνα: 2294321100 2294321111 - 2294321136 Fax: 2294321150 E-mail: nmak1@sismanoglio.gr

ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΡΑΦΗΝΑΣ-ΠΙΚΕΡΜΙΟΥ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Ανδρέα Παπανδρέου 36, 19009 Ραφήνα Τηλέφωνα: 2294320039 2294320250 - 2294377777 Fax: 2294077182

ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΣΠΑΤΩΝ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Περιφερειακός Σπύρου Μπέκα & Πικερμίου 1, 19004 Σπάτα Τηλέφωνα: 2132030900 Fax: 2132030945

ΚΕΝΤΡΟ ΥΓΕΙΑΣ ΚΑΠΑΝΔΡΙΤΙΟΥ

Ώρες: Ανοιχτό όλο το 24ωρο Διεύθυνση: Γραμματικογιάννη, 19014 Καπανδρίτι Τηλέφωνα: 2295052612 - 2295052885 2295052222 - 2295320019 Fax: 2295054163 E-mail: iatr-ky1@otenet.gr

25 Χρόνια ΜΑΡΑΘΩΝΕΙΟ & 21 Χρόνια ΔΗΜΟΤΗΣ Ο ΔΗΜΟΤΗΣ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ σε συνεργασία με το ΜΑΡΑΘΩΝΕΙΟ ΔΙΚΤΥΟ ΥΠΗΡΕΣΙΩΝ ΥΓΕΙΑΣ προσφέρει:

ΕΝΤΕΛΩΣ ΔΩΡΕΑΝ Έλεγχος AIDS και ΗΠΑΤΙΤΙΔΑΣ σε νέους 15-55 ετών!

Γενική Αίματος

(Ολική χοληστερόλη, HDL, LDL, TGL και Σάκχαρο) ΟΙ ΠΡΟΣΦΟΡΕΣ ισχύουν για όλους τους αναγνώστες του ΔΗΜΟΤΗ ΤΗΣ ΑΝΑΤΟΛΙΚΗΣ ΑΤΤΙΚΗΣ με την χρήση του κουπονιού. Τηλέφωνο για ραντεβού:

6936162510


Profile for dhmoths anatolikis attikis

DHM_936_5.4.2019  

DHM_936_5.4.2019  

Profile for dhmoths
Advertisement