Page 1

 

El Laboratori d’Ictiologia Genètica

Laboratori d’Ictiologia Genètica

8G*

Departament de Biologia. Universitat de Girona

Línees de recerca basades en l’estudi genètic de poblacions Actualment, està format per 8 doctors i 3 investigadors predoctorals Grup qualificat com a Grup de Recerca de Qualitat per la Generalitat de Catalunya l’any 1993 i consolidat l’any 1996. Reconegut com a Grup de Recerca Consolidat (AGAUR 2005SG01065). Grup de Recerca reconegut i finançat per la Generalitat de Catalunya (AGAUR 2009SGR 144)


El Laboratori d’Ictiologia Genètica

S’inicia amb els treballs amb truita comuna. Al cap de pocs anys comencen els treballs amb espècies marines. Més endavant es fan treballs amb mamífers. Recentment s’han iniciat projectes per treballar també amb espècies invasores. Inicialment s’utilitzava l’anàlisi de proteïnes enzimàtiques, que ha estat reemplaçat per les tècniques amb DNA. Els resultats que s’obtenen són d’aplicació en els camps de la gestió pesquera i en la conservació de poblacions i espècies, i també en l’aclariment de relacions taxonòmiques no ben definides.

La importància dels estudis genètics en la gestió i conservació

Conèixer la possibilitat d’adaptació dels individus als canvis ambientals Definir unitats poblacionals diferenciades, i unitats de gestió-conservació Mantenir poblacions viables (evitar l’extinció)

Són els gens, i no els individus, els que es transmeten al llarg de les generacions. La diversitat genètica és la que permetrà a la població, i per extensió a l’espècie, adaptar-se els canvis i sobreviure a llarg termini.


La recerca amb peixos dels rius gironins: la truita comuna i l’espinós

Els treballs amb truita comuna (Salmo trutta) s’inicien el 1988 amb la tesi del Dr. JL García-Marín, a partir d’un contracte amb el DARP i continuen fins a l’actualitat.

Els treballs amb espinós (Gasterosteus aculeatus) s’inicien l’any 2007 en col¡laboració amb l’empresa Sorelló i continuen fins a l’actualitat.  

La truita comuna

La truita comuna Ês la única espècie que es distribueix de forma natural en rius d’alta muntanya dels Pirineus, per sobre dels 1000m d’altitud. Necessita d’aigßes netes, fredes i ben oxigenades (tª òptima 4ºC-19,5ºC)

 


La recerca amb peixos dels rius gironins: la truita comuna

 

La truita comuna Ês una espècie amb un gran valor comercial i sobretot esportiurecreatiu que sostÊ un important sector turístic d’alta muntanya  

La recerca amb peixos dels rius gironins: la truita comuna

La Direcció General del Medi Natural i Biodiversitat, juntament amb el Consell de Pesca Continental de Catalunya i els Consells Territorials de Pesca regulen l’explotació d’aquesta espècie.


La recerca amb peixos dels rius gironins: la truita comuna

LA TRUITA COMUNA ÉS UNA ESPÈCIE VULNERABLE

La recerca amb peixos dels rius gironins: la truita comuna

La principal mesura de gestió aplicada perquè les poblacions poguessin mantenir una pressió de pesca per sobre de la seva capacitat ha estat la repoblació amb exemplars de centre piscícola l’origen nord-centre europeu

Aquestes mal anomenades repoblacions s’han convertit en una de les principals amenaces en la conservació de poblacions autòctones


L’espinós

Al Mediterrani de la Península l’espinós es distribueix en aigües dolces on habita en alguns trams mitjans i baixos de rieres d’aigües netes i clares amb abundant vegetació.

L’espinós

L’espinós no té un interés comercial, i per tant, les seves poblacions no estan incloses en cap pla de regulació.

 

Aquesta espècie, però, representa un element molt important en la biodiversitat dels nostres rius.


L’espinós

    



L’alteració de l’hà bitat i la introducció d’espècie al¡lòctones són les principals amenaces a la conservació de les poblacions d’espinós

L’ESPINĂ“S ÉS UNA ESPĂˆCIE EN PERILL D’EXTINCIĂ“

L’espinós



  !

Riu DarĂł

L’Orlina

Ullals de Baltasar


Els estudis genètics amb truita comuna (Salmo trutta)

METODOLOGIA

1.Ter a 2.Ter b 3.Queralbs 4.Massanes 5.Núria 6.Rigart

Els estudis genètics amb truita comuna (Salmo trutta)

Electroforesi de proteïnes enzimàtiques (allozims) Anàlisi del DNA mitocondrial (seqüenciació del DNA) Anàlisi de DNA de seqüències repetitives (microsatèl.lits)

METODOLOGIA


RESULTATS I DISCUSSIÓ

Els estudis genètics amb truita comuna (Salmo trutta)

Distribució dels llinatges mitocondrials a Europa

*90/*100 *90/90

La seqüenciació de la regió control del DNA mitocondrial ens indica que els llinatges evolutius de truita comuna que es distribueixen als rius mediterranis són clarament diferents dels que trobem a la resta d’Europa

2004. Mol. Phyl. Evo. 33: 831-844

Els estudis genètics amb truita comuna (Salmo trutta)

2004. Mol. Phyl. Evo. 33: 831-844

RESULTATS I DISCUSSIÓ


RESULTATS I DISCUSSIĂ“

Els estudis genètics amb truita comuna (Salmo trutta)

Distribució dels principals grups genètics descrits per allozims

Els marcadors proteics (allozims) ens indiquen tambÊ una singularitat genètica en les poblacions mediterrà nies, i una distribució en mosaic dels diferents grups evolutius (adriàtic i mediterrani) en els nostres rius

2000. Can. J. Fish. Aquat. Sci. 57: 2201-2210 2002. Cons. Gen. 3: 385-400

RESULTATS I DISCUSSIĂ“

Els estudis genètics amb truita comuna (Salmo trutta)

 $   ! 

      " )  

' #  %    ' #  ' )      ! 

Reconstrucció filogenètica: CS-NJ  %  *+  #,  *!

" # 

 %&

' ( &

' &  * !  +- . /,- 0 !1- 2" 2 3 - - ! % . 2- !. ' 4 

'' 5+ '" * 3

)/5

' .6  

' %7 2002. Cons. Gen. 3: 385-400

)57

)67 


RESULTATS I DISCUSSIÓ

Els estudis genètics amb truita comuna (Salmo trutta)

Distribució dels principals grups genètics descrits per microsatèl.lits 2,00

CONCA

LOCALITAT

TER

1-Vallter1 2-Vallter2

FRESER

2

3-Núria 4

4-Freser LLOBREGAT

5-Riutort

PALLARESA

6-Pla de Boet

TER 1

3

13 10 14 9 7 12 8 RIBAGORÇANA PALLARESA 11

7-Ermita 8-Palomera

0,00

6

8-Ainet 10-Manyanet

-2,00

11-Filià RIBAGORÇANA

CONCA

12-Conangles

ENTRE RIUS

DINS DE RIUS

13-Cavallers

Ter

27.64 %

3.54 %

14-Nicolau

Noguera Pallaresa

6.43 %

7.23 %

Noguera Ribagorçana

1.85 %

30.66 %

2007. Congres SEG

Els estudis genètics amb truita comuna (Salmo trutta)

RESULTATS I DISCUSSIÓ

Els efectes de les repoblacions

LDH-C*90

LDH-C*100

Les repoblacions s’han fet amb exemplars d’origen nord-centre europeus que són clarament diferents als exemplars natius. En base als diferents marcadors moleculars podem distingir clarament els exemplars natius dels híbrid i dels de centre piscícola, i podem avaluar quin és l’estat de les nostres poblacions


RESULTATS I DISCUSSIÓ

Els estudis genètics amb truita comuna (Salmo trutta)

100% 90 80% 70% 60% 50% 40%

allozims *100/100

*90/*100

30% 20%

*90/90

10% 0% 1

4

7

10

13

16

19

22

25

28

microsatèl.lits RFLP-DNA

En base als diferents marcadors moleculars podem distingir clarament els exemplars natius dels híbrid i dels de centre piscícola, i podem avaluar quin és l’estat de les nostres poblacions

RESULTATS I DISCUSSIÓ

Els estudis genètics amb truita comuna (Salmo trutta)

Diversitat genètica Intrapoblacional (HS ) Poblacions naturals actuals Poblacions natives ancestrals

Diferenciació genètica entre poblacions (FST)

0.044

0.472

0.029

0.615 39.6%

28.7%

1993 HT = 0.078 17.5%

1999 HT = 0.075 11.7%

93

99

LDH-C*90 2004. J. Fish Biol. 65 (Supl. A): 28-37

93

99 GST


RESULTATS I DISCUSSIÓ

Els estudis genètics amb truita comuna (Salmo trutta)

1993

1999

2004

2006

Ter

0.000

0.000

0.000

0.000

Núria

0.000

0.000

0.035

0.021

Rigart

0.100

0.000

Massanes

0.000

0.091

Riutort

0.155

0.458

0.250

0.545

Pla de Boet

0.400

0.567

0.714

-

Cardós

0.040

0.000

0.013

0.028

Manyanet

0.000

0.000

0.141

0.024

Filià

0.429

0.519

0.346

0.348

Sant Nicolau

0.179

0.180

0.156

0.116

Cavallers

0.000

0.241

0.284

0.264

Conangles

0.159

0.200

0.118

0.375

PROMEDIO

0.136

0.216

0.206

0.191

2008. Ecol. Freshw. Fish 17: 610-617

Els estudis genètics amb truita comuna (Salmo trutta)

RESULTATS I DISCUSSIÓ

a llare s N. P a

N. Riba gorçan a

Reserves genètiques de truites

Ter

Llobregat Segre

1997

2009. Conserv. Biol. 23: 871-878

2001

2002

Les 1eres van ser creades al Ter i Freser el 1997 La presència d’exemplars de repoblació és escassa o nul·la Està prohibit repoblar però es mantenen les activitats de pesca (lliure o controlada sense mort, o refugi)


RESULTATS I DISCUSSIÓ

Els estudis genètics amb truita comuna (Salmo trutta)

Nº captures / pescador i dia (10 el 1987 a 4 el 2008) RESERVES GENÈTIQUES

8,000,000

talla mínima captures (19 cm 1987 a 22 en 2008)

Repoblacions

7,000,000

30

Pesca sense mort

6,000,000

25

5,000,000

4,000,000

20 3,000,000

15

2,000,000 1,000,000

10 0 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006

Ous

Alevins

Adults

5

0 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008

2009. Conserv. Biol. 23: 871-878

Els estudis genètics amb truita comuna (Salmo trutta)

L’estudi genètic de les poblacions de truita comuna ha permès identificar els patrimonis genètics natius que encara conserven algunes poblacions. A Catalunya, aquests estudis han estat claus per a la definició i el seguiment de la figura de gestió de ‘Reserva Genètica’, creades per primera vegada en els rius Ter i Freser, a les comarques de Girona. Els treballs realitzats amb aquesta espècie s’han contemplat per establir les figures de protecció definides a l’Avantprojecte de la Llei de Pesca Continental de Catalunya.

RESULTATS I DISCUSSIÓ


METODOLOGIA

Els estudis genètics amb espinós (Gasterosteus aculeatus)

Ullals (Estocs U08 i U09) OR PE Muga

Onyar BU VA RE Tordera

DA C

Daró

Calonge 10 Km

+ Estoc de Calonge (C08 i C09)

Els estudis genètics amb espinós (Gasterosteus aculeatus)

METODOLOGIA

Anàlisi de seqüències repetitives (microsatèl.lits). Són seqüències curtes, entre 90 i 400 bp i generalment contenen entre 10 i 50 vegades la unitat de repetició. Són altament variables. Homozigots: …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7 …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7

Heterozigots: …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7 …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)9


RESULTATS I DISCUSSIÓ

Els estudis genètics amb espinós (Gasterosteus aculeatus)

Diversitat genètica i grandrària efectiva (Ne) de les poblacions

1

HS

0.5

0

Ne

OR

PE

BU

DA

C

VA

RE

C08

C09

U08

U09

38.94

63.84

18.03

31.89

16.44

26.20

9.24

19.33

22.38

8.54

20.49

2011. Freshwater Biology

Els estudis genètics amb espinós (Gasterosteus aculeatus)

RESULTATS I DISCUSSIÓ

Reconstrucció filogenètica: Da-NJ

1 03 0.

) 42 .0 ) -0 99 00 .0 .0 -0 (0 01 .0 (0

DA RE VA BU

OR

0.014 (0.000-0.043)

2 01 0.

C C08 C09

U09

0.006 (0.000-0.020)

U08

PE

0.018 (0.002-0.049)

FST = 0.436 0.007 (0.000-0.023)

2011. Freshwater Biology


RESULTATS I DISCUSSIÓ

Els estudis genètics amb espinós (Gasterosteus aculeatus)

Correlació distància genètica-distància geogràfica

r = 0.759***

AÏLLAMENT PER DISTÀNCIA

2011. Freshwater Biology

RESULTATS I DISCUSSIÓ

Els estudis genètics amb espinós (Gasterosteus aculeatus)

MUGA ONYAR

DARÓ

CALONGE

Distribució dels grups genètics detectats

OR

PE

BU

DA

C

VA

RE

OR

PE

BU

DA

C

VA

RE

2011. Freshwater Biology

TORDERA

C08

C09

U08 U09


RESULTATS I DISCUSSIĂ“

Els estudis genètics amb espinós (Gasterosteus aculeatus)

ONYAR

OR

PE

TORDERA

BU

DA

C

VA

RE

C08

C09

U08 U09

Les conques de l’Onyar i la Tordera van poder estar connectades a travÊs dels Estanys de Sils fins a mitjans de s. XIX

"

2011. Freshwater Biology

RESULTATS I DISCUSSIĂ“

OR DARĂ“

•

PE

BU

DA

CALONGE

DARĂ“

Els estudis genètics amb espinós (Gasterosteus aculeatus)

C

1 HS

• •

• •

CALONGE

0.5

0 Ne 2011. Freshwater Biology

DA

C

31.8

16.4

VA

RE

C08

C09

U08 U09


Els estudis genètics amb espinós (Gasterosteus aculeatus)

ONYAR

RESULTATS I DISCUSSIÓ

TORDERA OR PE Muga

Onyar OR

PE

BU

DA

C

VA

RE

BU

VA RE

1

Tordera

D AC

Daró

Calonge 10 Km

HS 0.5

0 Ne

BU

VA

RE

18.0

26.2

9.24

GRAN AÏLLAMENT DE LES POBLACIONS FRAGMENTACIÓ DE L’HÀBITAT!!!

2011. Freshwater Biology

Els estudis genètics amb espinós (Gasterosteus aculeatus)

Definició d’unitats de gestió operatives (OCU)

• •

MUGA

TER DARÓ

ONYAR

• •

• •

TORDERA

2011. Freshwater Biology

CALONGE

RESULTATS I DISCUSSIÓ


La recerca amb peixos dels rius gironins: la truita comuna i l’espinós

Profile for Consorci de l'Estany

5_gen_tica_conservaci__nuria_sanz_web1  

5_gen_tica_conservaci__nuria_sanz_web1

5_gen_tica_conservaci__nuria_sanz_web1  

5_gen_tica_conservaci__nuria_sanz_web1

Advertisement