Page 1

Volume 68 Number 10 - October/2013


CLINICS Editors Wagner Farid Gattaz, Edmund Chada Baracat Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Area Editors Ana Maria de Ulhoa Escobar Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Anna Sara Shafferman Levin Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Antonio Egidio Nardi Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil Anuar Ibrahim Mitre Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Berenice Bilharinho Mendonc¸a Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Bruno Zilberstein Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Carlos Serrano Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Carmen Silvia Valente Barbas Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Claudia Regina Furquim de Andrade Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Emilia Inoue Sato Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Fulvio Alexandre Scorza Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Geraldo Busatto Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Joaquim Prado Moraes-Filho Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Paulo Hoff Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Jose´ Luiz Gomes do Amaral Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Raul Coimbra University of California, San Diego La Jolla, CA, USA

Ludhmila Abrahao Hajjar Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Renato Delascio Lopes Duke University Medical Center Durham, NC, USA

Luiz Fernando Onuchic Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ricardo Bassil Lasmar Universidade Federal Fluminense Nitero´i, RJ, Brazil

Lydia Masako Ferreira Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Rosa Maria Rodrigues Pereira Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Marcos Intaglietta University of California, San Diego San Diego, CA, USA Maria Cecı´lia Solimene Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Mauricio Etchebehere Universidade Estadual de Campinas Campinas, SP, Brazil Michele Correale University of Foggia Foggia, Italy Naomi Kondo Nakagawa Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Nelson Wolosker Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Newton Kara-Junior Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Rubens Belfort Jr. Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ruth Guinsburg Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ruy Jorge Cruz Junior University of Pittsburgh Pittsburgh, PA, USA Sandro Esteves ANDROFERT - Andrology & Human Reproduction Clinic Campinas, SP, Brazil Sergio Paulo Bydlowski Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Simone Appenzeller Universidade Estadual de Campinas Campinas, SP, Brazil

Olavo Pires de Camargo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Sophie Franc¸oise Mauricette Derchain Faculdade de Cieˆncias Me´dicas, Universidade Estadual de Campinas Campinas, SP, Brazil

Heitor Franco de Andrade Jr. Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Oswaldo Keith Okamoto Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Suely Kazue Nagahashi Marie Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Jesus Paula Carvalho Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Patricia Rieken Macedo Rocco Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil

Vale´ria Aoki Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Gustavo Franco Carvalhal Faculdade de Medicina da Pontifı´cia Universidade Cato´lica do Rio Grande do Sul Porto Alegre, Rio Grande do Sul, Brazil

Editorial Board Abhijit Chandra King George’s Medical College Lucknow, India

Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ernest Eugene Moore University of Colorado Denver Denver, CO, USA

Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Adamastor Humberto Pereira Universidade Federal do Rio Grande do Sul Porto Alegre, RS, Brazil

Artur Brum-Fernandes Universite´ de Sherbrooke Que´bec, Canada´

Euclides Ayres Castilho Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ke-Seng Zhao Southern Medical University Guangzhou, China

Adauto Castelo Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Carmita Helena Najjar Abdo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ademar Lopes Fundac¸a˜o Antoˆnio Prudente, Hospital do Caˆncer Sa˜o Paulo, SP, Brazil

Cesar Gomes Victora Faculdade de Medicina da Universidade Federal de Pelotas Pelotas, RS, Brasil

Alberto Azoubel Antunes Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Daniel Romero Mun˜oz Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Alexandre Roberto Precioso Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Edmund Neugebauer Witten/Herdecke University Witten, North Rhine - Westphalia, Germany

Andrea Schmitt University of Goettingen Goettingen, Germany Arnaldo Valdir Zumiotti

Egberto Gaspar de Moura Jr. Universidade do Estado do Rio de Janeiro Rio de Janeiro, RJ, Brazil

Fa´bio Biscegli Jatene Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Laura Cunha Rodrigues London School of Hygiene and Tropical Medicine - University of London London, UK

Francisco Laurindo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Marcelo Zugaib Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Hiroyuki Hirasawa Chiba University School of Medicine Chiba, Japan

Marco Martins Amatuzzi Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Irismar Reis de Oliveira Faculdade de Medicina da Universidade Federal da Bahia Salvador, BA, Brasil Irshad Chaudry University of Alabama Birmingham, AL, USA Ivan Cecconello

Maria Aparecida Shikanai Yasuda Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Mauro Perretti William Harvey Research Institute London, UK


Michael Gregory Sarr Mayo Clinic Rochester, MN, USA

Pedro Puech-Lea˜o Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Milton de Arruda Martins Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Peter Libby Brigham and Women’s Hospital Boston, Boston, MA, USA

Mitchell C. Posner The University of Chicago Medical Center Chicago, IL, USA

Philip Cohen University of Houston Health Center Houston, Texas, USA

Moyses Szklo Johns Hopkins Bloomberg School of Public Health Baltimore, USA

Rafael Andrade-Alegre Santo Toma´s Hospital Republic of Panama´, Panama´

Navantino Alves Faculdade de Cieˆncias Me´dicas de Minas Gerais Belo Horizonte, MG, Brazil

Ricardo Antonio Refinetti Faculdade de Medicina da Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil

Noedir Antonio Groppo Stolf Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Roberto Chiesa San Raffaele Hospital

Milan, Italy Ronald A. Asherson Netcare Rosebank Hospital Rosebank, Johannesburg, South A´frica Samir Rasslan Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Tarcisio Eloy Pessoa de Barros Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Valentim Gentil Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Wagner Farid Gattaz Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Board of Governors Alberto Jose´ da Silva Duarte Aluisio Augusto Cotrim Segurado Ana Claudia Latronico Xavier Berenice Bilharinho de Mendonc¸a Carlos Roberto Ribeiro de Carvalho Clarice Tanaka Claudia Regina Furquim de Andrade Cyro Festa Dalton de Alencar Fischer Chamone Daniel Romero Mun˜oz Edmund Chada Baracat Eduardo Massad Eloisa Silva Dutra de Oliveira Bonfa´ Euripedes Constantino Miguel Fa´bio Biscegli Jatene Flair Jose´ Carrilho Gerson Chadi Gilberto Luis Camanho Giovanni Guido Cerri Irene de Lourdes Noronha Irineu Tadeu Velasco Ivan Cecconello

Jorge Elias Kalil Jose´ Antonio Franchini Ramires Jose´ Antonio Sanches Jose´ Eduardo Krieger Jose´ Ota´vio Costa Auler Jose´ Ricardo de Carvalho Mesquita Ayres Lenine Garcia Branda˜o Luiz Augusto Carneiro D’Albuquerque Luiz Fernando Onuchic Magda Maria Sales Carneiro-Sampaio Manoel Jacobsen Teixeira Marcelo Zugaib Marcus Castro Ferreira Maria Aparecida Shikanai Yasuda Miguel Srougi Milton de Arruda Martins Nelson de Luccia Olavo Pires de Camargo Paulo Andrade Lotufo Paulo Hila´rio Nascimento Saldiva Paulo Manuel Peˆgo Fernandes Paulo Marcelo Gehm Hoff

Editorial Director Kavita Kirankumar Patel-Rolim Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Paulo Rossi Menezes Pedro Puech-Lea˜o Remo Susanna Ricardo Ferreira Bento Ricardo Nitrini Roberto Kalil Roberto Zatz Roger Chammas Samir Rasslan Sandra Josefina Ferraz Ellero Grisi Selma Lancman Tarcı´sio Eloy Pessoa de Barros Uenis Tannuri Umbertina Conti Reed Valentim Gentil Venaˆncio Avancini Ferreira Alves Vicente Odone Wagner Farid Gattaz Werther Brunow de Carvalho William Carlos Nahas Wilson Jacob

Editorial Assistants Nair Gomes Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Daniela Aquemi Higa Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ariane Maris Gomes Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Editorial Office: Rua Dr. Ovı´dio Pires de Campos, 225 - 6 ˚ Andar CEP 05403-010 Sa˜o Paulo/SP Tel.: +55-11-2661-6235 Email: clinics@hc.fm.usp.br Website: www.scielo.br/clinics Submission: http://mc04.manuscriptcentral.com/clinics-scielo Indexations: LILACS; MEDLINE; PubMed; PubMed Central; SciELO; Science Citation Index Expanded (ISI Web of Knowledge); Scopus; Ulrich’s Periodical Directory; Qualis/Capes - Classified as an International Circulation Journal in Medicine. Clinics. Sa˜o Paulo: Scientific Journal of Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, 2005Monthly Periodical: January to December ISSN 1807-5932 printed version ISSN 1980-5322 online version Formerly Revista do Hospital das Clı´nicas da FMUSP, 1946–2004. 1. Medicine-scientific production. 2. Medical Sciences I. Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo. CDD 610


PUBLICATION INFORMATION AND EDITORIAL POLICIES CLINICS publishes peer-reviewed articles of interest to clinicians and researchers in the medical sciences. CLINICS is registered with PubMed Central and SciELO and complies with the policies of funding agencies, such as the Wellcome Trust, the Research Councils UK - (RCUK), the National Institutes of Health (NIH), and the German Research Foundation (DFG), which request or require deposition of the published articles that they fund into publicly available databases. CLINICS supports the position of the International Committee of Medical Journal Editors (http:// www.icmje.org/) on trial registration. All trials initiated after January 1, 2012 must be prospectively registered (before patient recruitment begins) in a publicly accessible registry. Trials initiated before January 1, 2012 must be registered before submission to our journals. See the ICMJE FAQ regarding trial registration for further details. Visit http://www.who.int/ictrp/ network/list_registers/en/index.html for the WHO’s list of approved registries. CLINICS suggests: http://www.clinicaltrials. gov as a user friendly site.

clinical, and surgical research. Original studies must conform to the following format: Title page:

N N N N

Manuscript:

N

Publication Fees CLINICS uses a business model in which expenses are recovered in part by charging a publication fee to the authors or research sponsors for each published article. Our 2013 prices are as follows: fast track: US$ 2,000.00; original articles, review articles and rapid communications: US$ 1,200.00. Invited reviews, editorials and letters to the editors: no charge. * The exchange rate for payments in Brazil-Real is the commercial exchange rate of the day the articles is accepted. Clinics uses the Banco do Brasil currency conversion tool. Manuscripts involving human subjects or the use of laboratory animals must clearly state adherence to appropriate guidelines and approval of protocols by their institutional review boards. Photographs that may identify patients or other human participants of studies shall be acceptable only when a legally valid consent form is signed by the participating patient, other human participant, or his/her legally constituted representative. Manuscripts should be digitalized using a Word *.doc-compatible software program and submitted online in English. Authors are strongly advised to submit the manuscript in its final form to a spell check for English (US). Submissions with excessive spelling or syntax mistakes as well as articles in which the meaning is not sufficiently clear shall be returned to authors for correction. Authors are also strongly advised to use abbreviations sparingly whenever possible to avoid jargon and improve the readability of the manuscript. All abbreviations must be defined the first time that they are used. Only terms or expressions that are used at least 5 times throughout the text should be abbreviated. Never use abbreviations that spell common English words, such as FUN, PIN, SCORE and SUN. Please make sure to submit your manuscript in the exact format that is described below. Failure to do so will cause the submission to be returned to you during the preliminary examination by the Editorial Office.

Manuscripts are invited in the following categories: ORIGINAL STUDY: Complete original studies should be submitted in this category. Three sections are offered: basic,

Title (up to 250 characters); Running title (up to 40 characters, letters and spaces); Full address of corresponding author only; Authors’ names (without titles or degrees). Authors should have participated sufficiently in the work to take public responsibility for appropriate portions of the content. Such participation must be declared in this section of the manuscript.

N N

N

N

N

N

N

Abstract: Abstracts are limited to 250 words and structured into objectives, method, results, and conclusions. Citations or abbreviations (except internationally recognized abbreviations, such as weights, measures, and physical or chemical abbreviations) are not permitted. Authors are strongly encouraged not to display numerical statistical information but to merely state what is significantly different (or not) between the described parameters. Keywords: For keywords, 3–6 items from the Medical Subject Headings (MeSh) should be used. Introduction: The introduction should set the purpose of the study, provide a brief summary (not a review) of previous relevant studies, and state the new advances in the current investigation. The introduction should not include data or conclusions from the work being reported. A final sentence summarizing the novel finding to be presented is permissible. Materials and Methods: This section should briefly give clear and sufficient information to permit the study to be repeated by others. Standard techniques only need to be referenced. Previously published methods may be briefly described following the reference. Ethics: When reporting experiments on human subjects, indicate whether the procedures were in accordance with the ethical standards of the responsible committee on human experimentation (institutional or regional) and with the Helsinki Declaration of 1975, which was revised in 1983. When reporting experiments on animals, indicate whether the institution’s guide, a national research council’s guide, or any national law on the care and use of laboratory animals was followed. Results: The results section should be a concise account of the new information that was discovered, with the least personal judgment. Do not repeat in text all the data in the tables and illustrations but briefly describe what these data comprise. Discussion: The discussion should include the significance of the new information and relevance of the new findings in light of existing knowledge. Only unavoidable citations should be included. Citation to review articles are not encouraged in this section. Acknowledgments: This section should be short, concise, and restricted to acknowledgments that are necessary.


N

N

N

References in text: CLINICS adopts the Vancouver format. Cite references in the text using Arabic numerals in the order of appearance, within parentheses, (1) after the previous word, with spacing as in this example: ‘‘Diabetes (2), hypertension (3,4) and alcoholism (5–9) are complex medical problems (10).’’ Under exceptional circumstances, authors’ names may appear in text: Single author: ‘‘Einstein (11) proposed a new theory …’’, Two authors: ‘‘Watson & Crick (12) reported on the structure of …’’, or Three or more authors: ‘‘Smith et al. (13) described …’’ Reference List: Only citations that appear in the text should be referenced. References must be restricted to directly relevant published works, papers, or abstracts. Unpublished papers, unless accepted for publication, should not be cited. Work that is accepted for publication should be referred to as ‘‘in press’’ and a letter of acceptance of the journal must be provided. Authors are responsible for the accuracy and completeness of their references and for correct text citation. Usually the total number of references should not exceed 35. For up to six authors, list all authors. For more than 6 authors, list first six authors followed by ‘‘et al.’’. Tables and Figures: The maximum number of tables and/or figures is six tables and/or figures. Tables: Should be constructed using the table feature in your word processor or using a spreadsheet program such as Excel. The tables should be numbered in order of appearance in the text, using Arabic numerals. Each table should have a title and an explanatory legend, if necessary. All tables must be referenced and succinctly described in the text. Under no circumstances should a table repeat data that are data presented in an illustration. Statistical measures of variation (i.e., standard deviation or standard error) should be identified, and decimal places in tabular data should be restricted to those with mathematical and statistical significance. Figures: Photographs, illustrations, charts, drawings, line graphs, etc are all defined as figures. Number figures consecutively using Arabic numerals in order of appearance. Figure legend(s) should be descriptive and should allow examination of the figure without reference to text. Images must be of professional quality and uploaded as *.tiff files. Generally, figures will be reduced to fit one column of text. The actual magnification of all photomicrographs should be provided, preferably by placing a scale bar on the print. Line graphs and charts should never be sent as *.jpeg illustrations. We recommend preparing line graphs and charts as ExcelH files and copying these files into a Word *.doc sheet.

FAST TRACK ARTICLES: Fast-track articles should follow the same format described above for original studies. The Editorial Office will produce a first-action response in the shortest possible time and will publish accepted fast track articles in the next available issue. Only one article may be submitted as fast track in any calendar year by any author or co-author. In the Comments section, the authors must explain the justification for fast-track publication. Rejection by journals with a higher impact factor than ours is an acceptable reason for requesting fast-track status. However, the reviewers’ reports from the previous submission

must be included in the current submission. Information contained in the comments is limited to the editor and shall remain confidential. No publication fee discount is allowed for accepted fast track articles. REVIEW ARTICLES: Review articles should cover themes that are relevant to medical practice. Spontaneously submitted reviews are welcome; however, potential authors should bear in mind that they are expected to have expertise in the reviewed field. The sections should be arranged as follows:

N N

Title page: As described in the Original Study section. Manuscript: Abstract, keywords and text should be arranged to cover the subject that is being reviewed. If appropriate, the method of reference collection should be described. The use of headings, subheadings, and paragraph titles is encouraged to improve clarity. Abbreviations, acknowledgments, tables and figures should be formatted as described in the Original Study section. The number of references is at the discretion of the authors. No publication fee discount is allowed for spontaneously submitted review articles that are accepted for publication.

RAPID COMMUNICATIONS:

N N

Title page: As described in the Original Study section. Manuscript: Rapid communications are limited to 1,500 words, not including the reference list, abstract and keywords. Authors should format rapid communications based on the subject at hand. Abstracts are limited to 250 words and structured into objectives, method, results, and conclusions. Citations or abbreviations (except internationally recognized abbreviations, such as weights, measures, and physical or chemical abbreviations) are not permitted. For keywords, 3-6 items from the Medical Subject Headings (MeSh) should be used.

LETTERS TO THE EDITOR: Letters to the editor expressing comments or dissenting opinions concerning articles that have been recently published in CLINICS are not submitted to peer review and are published at the discretion of the editor. A letter is a single section containing untitled text concerning the article under discussion, followed by references. No publication fee is charged for this class of manuscripts. EDITORIAL: Editorials should cover broad aspects of medical or biological sciences. Such manuscripts are not submitted to peer review and are published at the discretion of the editor. No publication fee is charged for this class of manuscripts. COMMENTARY: A commentary is an invited text with respect to an article that is being published by Clinics. No publication fee is charged for this class of manuscripts. INVITED REVIEW: These reviews are by invitation only and follow the format proposed for general reviews. No publication fee is charged for this class of manuscripts. SPECIAL ISSUE ARTICLE: Special issue articles are by invitation only and follow a specific format that is set by the editor in charge of the collection.


Currently CLINICS does not accept: case reports, technical notes, retrospective studies, translations and validations of questionnaires, and articles referring to first demonstration in Brazil. Peer Review: Manuscripts are reviewed by at least two expert consultants. Accepted manuscripts are edited to comply with the journal’s format, remove redundancies, and improve clarity and understanding without altering meaning. The edited text will be presented to authors for approval. Submission: A copyright transfer form, signed by all authors, must be submitted by fax (55-11-2661-7524) or by mail as soon as the manuscript is submitted. Any financial or other relationships that may lead to a conflict of interest must be

disclosed in the copyright transfer form. If the editor considers this conflict of interest relevant to the paper, a footnote will be added to show the equity interest in or affiliation with the identified commercial firm(s). When the authors are satisfied that the manuscript complies with the journal format, our site should be accessed using the website www.clinics.org.br. The system will guide authors through the manuscript submission process and will prompt authors to input information into specific fields as they are submitting their manuscript. The editorial office and authors will be automatically notified of the submission. Progress of the manuscript through the Editorial Office’s procedures will be available to authors at all times.


ISSN-1807-5932

CLINICS CONTENTS Clinics 2013 68(10):1293–1383

CLINICAL SCIENCES

Anteroposterior displacement behavior of the center of pressure, without visual reference, in postmenopausal women with and without lumbar osteoporosis ˆ ngela Maggio da Fonseca, Vicente Renato Bagnoli, Edmund Chada Baracat, Ju´lia Maria Guilherme Carlos Brech, A D’Andrea Greve. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1293

Evaluation of the traditional and revised world health organization classifications of dengue cases in Brazil Fa´bio Rocha Lima, Mariana Garcia Croda, Daniella Araujo Muniz, Isabella Trausula Gomes, Karla Roberta de Moraes Soares, Monique Rodrigues Cardoso, Raquel Luciana Angela Marques Tauro, Julio Croda . . . . . . . . . . . . . . . . . . 1299

Duration effect of desflurane anesthesia and its awakening time and arterial concentration in gynecologic patients Tso-Chou Lin, Chih-Cherng Lu, Che-Hao Hsu, Gwo-Jang Wu, Meei-Shyuan Lee, Shung-Tai Ho . . . . . . . . . . . . . 1305

Radiofrequency ablation can reverse the structural remodeling caused by frequent premature ventricular contractions originating from the right ventricular outflow tract even in a ‘‘normal heart’’ Yuqiang Fang, Chunlan Wen, Li Yang, Xiaoqun Zhang, Wei Chu, Chunyu Zeng . . . . . . . . . . . . . . . . . . . . . . . . . 1312

Ocular surface evaluation in patients treated with a fixed combination of prostaglandin analogues with 0.5% timolol maleate topical monotherapy: a randomized clinical trial Heloisa Helena Russ, Pedro Antoˆnio Nogueira-Filho, Jeison de Nadai Barros, Nubia Vanessa Lima de Faria, ´ lvaro Pereira Gomes, Paulo Augusto Arruda Mello . . . . . . . . . . . . . . . . . . . . . 1318 Fabiano Montiani-Ferreira, Jose´ A

Myxovirus resistance, osteopontin and suppressor of cytokine signaling 3 polymorphisms predict hepatitis C virus therapy response in an admixed patient population: comparison with IL28B Ana Luiza Dias Angelo, Lourianne Nascimento Cavalcante, Kiyoko Abe-Sandes, Taı´sa Bonfim Machado, Denise Carneiro Lemaire, Fernanda Malta, Joa˜o Renato Pinho, Luiz Guilherme Costa Lyra, Andre Castro Lyra. . . . . . . . 1325

Early assessment of percutaneous coronary interventions for chronic total occlusions analyzed by novel echocardiographic techniques Ercan Erdogan, Mehmet Akkaya, Ahmet Bacaksiz, Abdurrrahman Tasal, Osman So¨nmez, Mehmet Ali Elbey, Seref Kul, ¨ mer Go¨ktekin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1333 Mehmet Akif Vatankulu, Murat Turfan, O

BASIC RESEARCHES

Tocotrienol supplementation in postmenopausal osteoporosis: evidence from a laboratory study Norliza Muhammad, Douglas Alwyn Luke, Ahmad Nazrun Shuid, Norazlina Mohamed, Ima Nirwana Soelaiman . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1338


Periostin as a modulator of chronic cardiac remodeling after myocardial infarction Marcos F. Minicucci, Priscila P. dos Santos, Bruna P. M. Rafacho, Andre´a F. Gonc¸alves, Lidiane P. Ardisson, Diego F. Batista, Paula S. Azevedo, Bertha F. Polegato, Katashi Okoshi, Elenize J. Pereira, Sergio A. R. Paiva, Leonardo A. M. Zornoff . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1344

Antifibrotic effects of crocetin in scleroderma fibroblasts and in bleomycin-induced sclerotic mice Yinghua Song, Lubing Zhu, Ming Li . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1350

The protective effect of aqueous extracts of roselle (Hibiscus sabdariffa L. UKMR-2) against red blood cell membrane oxidative stress in rats with streptozotocin-induced diabetes Jamaludin Mohamed, Saw Wuan Shing, Muhd Hanis Md Idris, Siti Balkis Budin, Satirah Zainalabidin . . . . . . . . . 1358

REVIEW

Effects of different types of auditory temporal training on language skills: a systematic review Cristina Ferraz Borges Murphy, Eliane Schochat . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1364

RAPID COMMUNICATIONS

PTK2 and PTPN11 expression in myelodysplastic syndromes Mariana Lazarini, Joa˜o Agostinho Machado-Neto, Leticia Fro¨hlich Archangelo, Bruna Fernandes Mendes-Silva, Carolina Louza˜o Bigarella, Fabiola Traina, Sara Teresinha Olalla Saad . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1371

Early transconjunctival needling revision with 5-fluorouracil versus medical treatment in encapsulated blebs: a 12-month prospective study Ricardo Suzuki, Remo Susanna-Jr . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1376

READERS OPINION

Electrocardiographic data should be coupled with tissue-Doppler imaging and clinical follow-up evaluation to determine cardiac involvement in lichen planus ¨ zcan, Dursun Aras, Sinan Aydog˘du. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1380 Ug˘ur Canpolat, Osman Turak, Fırat O

ERRATUM

Retraction 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1382 Retraction 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1383


CLINICAL SCIENCE

Anteroposterior displacement behavior of the center of pressure, without visual reference, in postmenopausal women with and without lumbar osteoporosis ˆ ngela Maggio da Fonseca,II Vicente Renato Bagnoli,II Edmund Chada Baracat,II Guilherme Carlos Brech,I A Ju´lia Maria D’Andrea GreveIII I

Faculdade de Medicina da Universidade de Sa˜o Paulo (FMUSP), Institute of Orthopedics and Traumatology (IOT), Laboratory of Kinesiology, Sa˜o Paulo/SP, Brazil. II Faculdade de Medicina da Universidade de Sa˜o Paulo (FMUSP), Department of Obstetrics and Gynecology, Sa˜o Paulo/SP, Brazil. III Faculdade de Medicina da Universidade de Sa˜o Paulo (FMUSP), Department of Orthopedics and Traumatology, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: The aims of this study were to evaluate the anteroposterior displacement behavior of the center of pressure without any visual reference and determine its relationship with knee muscle strength and reports of falls in postmenopausal women. Among those with osteoporosis, the specific objective was to evaluate the correlation of thoracic kyphosis and vitamin D with center of pressure displacement. METHODS: This was a cross-sectional observational study without intervention. The assessments were performed on 126 postmenopausal women (aged 55-65 years) who were grouped according to their lumbar bone density into osteoporosis and control groups. Center of pressure was evaluated on a force platform (100 Hz frequency and 10 Hz filter), with the subjects standing on both feet with eyes closed for 60 seconds. Knee muscle strength was evaluated using an isokinetic dynamometer in concentric/concentric mode at a velocity of 60 ˚/s. In the osteoporosis group, vitamin D was assayed, and the thoracic spine was radiographed. RESULTS: In the control group, there was a correlation between the center of pressure and knee strength (r = 0.37; p,0.003). Reports of falls were not associated with center of pressure displacement (p = 0.056). In the osteoporosis group, thoracic kyphosis and vitamin D levels were not correlated with the center of pressure. CONCLUSION: Anteroposterior center of pressure displacement without visual influence was not associated with falls, thoracic kyphosis or vitamin D in the osteoporosis group. Only knee muscle strength was associated with center of pressure displacement in the control group. KEYWORDS: Muscle Strength; Osteoporosis; Postmenopause; Postural Balance. Brech GC, Fonseca AM, Bagnoli VR, Baracat EC, D’Andrea Greve JM. Anteroposterior displacement behavior of the center of pressure, without visual reference, in postmenopausal women with and without lumbar osteoporosis. Clinics. 2013;68(10):1293-1298. Received for publication on March 6, 2013; First review completed on March 8, 2013; Accepted for publication on May 2, 2013 E-mail: guibrech@gmail.com / guilhermebrech@yahoo.com.br Tel.: 55 11 2661-7812

osteoporosis displace the COP such that it nears the stability limits, thereby leading to loss of balance and falls. The parameter most used in evaluating postural balance, which is performed using a force platform, is the COP (2). COP sway is a risk factor for falls (4), and elderly people who fall have greater COP sway (5). It is known that maintenance of postural control, consequent to achieving postural balance, depends on the quality of vision (6-7), which is responsible for 23% of balance maintenance (8). Loss of muscle strength and power is a hallmark of the aging process (9) that is associated with poor functional abilities among older adults (10). Several tasks of daily living, including walking, stair climbing and rising from chairs, have been shown to be related to the ability to generate strength and power around the knee joint (11). In women, the decline of estrogen levels after menopause contributes to imbalance and loss of muscle strength (12). Compared to women without osteoporosis, postmenopausal women with

& INTRODUCTION Postural control is the inherent capacity to maintain the center of mass within the base of support, which defines the stability limits. These limits are the edges of the operational areas through which the center of mass can be displaced without the need to move the base of support (1). The center of pressure (COP) is the point of application of the vertical resultant force (in this case, from the human body, when standing on both feet) acting on the base of support (2). According to Lynn et al. (3), changes to the body caused by

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)01

1293


Balance in postmenopausal women Brech GC et al.

CLINICS 2013;68(10):1293-1298

osteoporosis are at greater risk of falling when they present diminished hand grip, trunk extension and lower-limb extension strength (13). Maintenance of muscle strength and power as well as better postural balance among elderly individuals have been correlated with vitamin D supplementation (14). Furthermore, increased thoracic kyphosis is often related to osteoporosis (15) and age, thereby leading to anterior inclination of the trunk (7,16), which is a factor that may increase the risk of falls and fractures in this population (16,17). With advancing age, the habit of going to the bathroom during the night increases. This is often performed without turning the lights on or without putting glasses on; thus, a large portion of the visual references that are essential for maintaining postural balance are lost. In these situations, the risk of falls is high, and among women with osteoporosis, such falls may have severe consequences. Thus, the present study was developed to assess the anteroposterior displacement behavior of the COP with eyes closed and its relationship with knee muscle strength and reports of falls during the past year among postmenopausal women with and without osteoporosis. The secondary objective of this study was to correlate the degree of thoracic kyphosis and 25-OH vitamin D assays with anteroposterior COP displacement among those with osteoporosis.

& METHODS Ethics The study was performed at the Laboratory for the Study of Movement, Institute of Orthopedics and Traumatology, Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo (HC-FMUSP). The study was approved by the Ethics Committee of the University of Sa˜o Paulo (number 320/09). After the study was explained to the patients, they provided signed consent forms.

Sample size The sample size calculation was based on a pilot study that included 15 postmenopausal women and considered the variable of anteroposterior COP displacement with eyes closed. To compare two means, the conditions specified were a test power of 80%, a significance of 5%, a standard deviation of 0.18 and the possibility of detecting a difference of 0.09. To meet these conditions, at least 63 subjects were required in each group (control and osteoporosis).

Figure 1 - Flow diagram for subject selection.

had not been prescribed any antipsychotic medication, had no restrictions on vigorous physical activity, had not undergone any surgery and had not suffered any injury to their legs. Patients were excluded if they presented any blood pressure abnormalities or if they were unable to perform the test.

Experimental design and subjects This was a cross-sectional observational study, without intervention, in which 126 postmenopausal women aged 55 to 65 years were included. The patients originated from two disease groups and were treated at Hospital das Clı´nicas da Faculdade de Medicina da Universidades de Sa˜o Paulo (Figure 1), and two new groups of 63 patients each were selected for the present study: a control group (CG), consisting of women with normal vertebral bone mineral density (BMD) (T-scores greater than 21 SD), and an osteoporosis group (OPG), consisting of women with osteoporotic BMD (T-score lower than 22.5 SD). These groups were defined in accordance with the World Health Organization criteria. BMD was measured using dualenergy X-ray absorptiometry. The subjects had a normal vestibular system and no proprioceptive, auditory or neurological conditions. Within the past six months, they

Measurements Initially, a questionnaire seeking personal and anthropometric data and the international physical activity questionnaire (IPAQ, short version) were administered. The subjects were also asked about any falls that they had experienced during the preceding 12 months. Falls were defined as unintentional events in which the individual ended up at a lower level than the initial position (18). Following this, the subjects underwent static balance assessment (posturography) on a portable force platform (AccuSway Plus; AMTIH, MA, USA). For data acquisition, the force platform was connected to a signal-amplifying interface box (PJB-101) that was attached to a computer by an RS-232 cable. The data were gathered and stored using Balance ClinicH software configured for a frequency of

1294


CLINICS 2013;68(10):1293-1298

100 Hz with a fourth-order Butterworth filter and a cutoff frequency of 10 Hz. All the subjects underwent the test with standardized positioning in relation to the maximum width of the base of support and regarding their arm and head positions. Three 60-second measurements were performed with eyes closed. The arithmetic means from the three tests conducted under each condition were calculated, and the results were processed using Balance ClinicH software. The parameter used to measure the subjects’ stability with eyes closed was the root mean square of the displacements from the center of pressure (COP) in the anteroposterior plane (YSD). Evaluation of knee extension-flexion (concentric-concentric) isokinetics was performed in a Biodex Multi-Joint System 3 dynamometer (Biodex MedicalTM, Shirley, NY, USA). The tests were first performed on the dominant leg. After a standardized warm-up, the subjects were positioned on the equipment in accordance with the manufacturer’s instructions (seated with arms hanging against the body, hands holding the lateral handles and strap stabilization for the trunk, hip and tested thigh). Gravitational correction was performed at with the knee flexed to 40 ˚. Isokinetic testing at 60 ˚/sec (concentric/concentric) was used for data collection. The subjects performed three submaximal repetitions prior to data collection. Five maximal repetitions were performed twice, and a 60-second rest period was used between tests for all subjects. Subsequently, the same procedure was performed for the non-dominant leg. Consistent verbal commands were given during the tests, and all tests were conducted by the same examiner. Peak torque adjusted for body weight (PTQ/BW) was the variable assessed. To analyze the data, only the values from the second set of five maximal repetitions were used due to the effects of motor learning on clinical isokinetic performance (19). The OPG underwent 25-OH vitamin D blood tests to measure the level of vitamin D and radiography on the thoracic spine in lateral view to measure the degree of thoracic kyphosis according to the regional Cobb angle (from the fourth to the ninth thoracic vertebra, i.e., T4-T9) and the overall Cobb angle (from the second to the twelfth thoracic vertebra, i.e., T2-T12) (20).

Balance in postmenopausal women Brech GC et al.

were MinitabH (version 15) and SPSSH (version 18). In the hypothesis tests, the significance level was set at 0.05.

& RESULTS Table 1 shows the mean values and standard deviations of the baseline characteristics in the control (n = 63) and osteoporosis groups (n = 63). The hypothesis of equality between the control and osteoporosis groups was tested, and the results are provided. In the OPG, the mean 25-OH vitamin D level was 26.7¡9.5, the regional degree of kyphosis was 33.4¡8, and the overall mean Cobb angle was 45.4¡10.1. Spearman’s correlation was used to evaluate the correlation between muscle strength and postural balance variables. The coefficients were calculated according to group (CG and OPG). The coefficients (r) and the p-values determined from the significance tests are presented in Table 2. Multiple linear regression models were fitted to examine the associations between the balance variable and group, falls and muscle strength using the anteroposterior COP displacement (YSD response) as the variable. The explanatory variables were group, falls, one muscle strength variable and one interaction term between the group and the strength variable, which allowed the coefficient of the strength variable to differ between groups. This variable was chosen based on the results presented in Table 2 (the variable chosen had to be correlated with the response). Residual analysis was used to evaluate assumptions of normal distribution and equality of variance. YSD response variable:

N

The difference between the YSD means in the two groups depended on PTQ/BW (there was an interaction between YSD and PTQ/BW) (p = 0.015). When comparing the YSD means in the two groups

Table 1 - Baseline characteristics of the groups.

Age (years) Caucasian Bone densitometry Lumbar spine BMD (g/cm2) SD Femoral neck BMD (g/cm2) SD Total hip BMD (g/cm2) SD Dominance (right) Body weight (kg) Height (m) BMI (kg/m2) Physical activity (IPAQ) Active Irregular activity Report of falls in the past year Yes No

Statistical Analysis To investigate associations between the characterization variables of the groups, Student’s t test was used for the quantitative variables, and the chi-square test or likelihood ratio test was used for the qualitative variables. The correlation between the variables of muscle strength and postural balance was evaluated using Spearman’s correlation coefficient. From the correlated variables, a multiple linear regression model was then fitted with YSD as the response variable. The following explanatory variables were considered: group, fall, muscle strength and an interaction term between group and variable power to account for differences in the coefficient of the variable force between groups. In the OPG, the correlations between thoracic kyphosis and 25-OH vitamin D assays and the variables of muscle strength and postural balance were investigated using Spearman’s correlation coefficient. Normal data distributions were verified by constructing graphs of normal probabilities. In the multiple linear regression analysis, the assumptions of normal distribution and equality of error variance were assessed using residual analysis. The software programs used in the data analysis

Osteoporosis Group

Control Group

60.6 (¡3.1) 79%

60.0 (¡3.0) 65%

0.73 (¡0.1) - 3.01 (¡0.5)

1.04 (¡0.1) - 0.10 (¡0.7)

* *

0.70 (¡0.2) - 1.81 (¡0.7)

0.90 (¡0.1) - 0.05 (¡1.2)

* *

0.78 (¡0.1) - 1.63 (¡0.8) 97% 59.8 (¡10.5) 1.52 (¡0.1) 25.8 (¡4.2)

0.98 (¡0.1) 0.01 (¡1.0) 95% 69.2 (¡10.5) 1.55 (¡0.1) 28.9 (¡4.6)

44% 56%

44% 56%

43% 57%

30% 70%

* * * * *

Bone mineral density (BMD); standard deviation (SD); body mass index (BMI); International Physical Activity Questionnaire (IPAQ). *p,0.001.

1295


Balance in postmenopausal women Brech GC et al.

CLINICS 2013;68(10):1293-1298

at these levels did not correlate with anteroposterior COP displacement among the women with postmenopausal osteoporosis. It is known that elderly women frequently present diminished lower-limb muscle strength, and this is believed to be a predisposing factor for falls (21). Posturography is considered to be the gold standard for assessing postural balance, and the variable of COP displacement presents the greatest amplitude along the anteroposterior plane (22). Lynn et al. (3) and Abreu et al. (23) reported that elderly women with osteoporosis had worse postural balance than women without osteoporosis, although Abreu et al. (24), Silva et al. (25) and Brech et al. (26) stated that osteoporosis did not worsen postural balance among elderly women. In the present study on postmenopausal women, there was no association between reports of falls and anteroposterior COP displacement in either group, although other studies found a relationship between reports of falls and side-toside displacement (7). The fact that the present study evaluated women at the start of menopause may be one of the reasons why the reports of falls did not have a relationship with COP displacement. It is possible that the falls reported by these subjects were unrelated to loss of balance. The anteroposterior COP displacement with eyes closed was greater in the control group; this finding differed from those of Abreu et al. (23) and Silva et al. (25), who reported that women with osteoporosis presented greater COP displacement in this plane and under this condition. We have previously reported that greater COP mediolateral displacement is related to the occurrence of falls in the preceding year in postmenopausal women (5). However, Abreu et al. (24) stated that one limit of their own study was the lack of a control for muscle strength, given that better muscle condition could increase COP sway (27). Thus, it is questionable whether greater COP displacement represents imbalance and a risk of falling or whether it might signify greater muscle control, with the capacity to maintain greater COP displacement within the same base of support by nearing the stability limits. Vitamin D acts as a hormone by regulating calcium absorption in the intestine, and it is also extremely important for maintaining muscle strength (28), particularly quadriceps strength (29). According to Bischoff-Ferrari (30), vitamin D supplementation may decrease the risk of falling among elderly women with vitamin D deficiency by up to 49% (31). In the present study, there was no correlation between anteroposterior COP displacement and vitamin D levels, and we found no other studies that identified such correlations. We believe that in the present study, the vitamin D levels of the subjects were not low enough to influence the maintenance of postural balance. Similar to the vitamin D levels, the degree of thoracic kyphosis was also not correlated with anteroposterior COP displacement. However, the subjects did not present very marked kyphosis, given the age group studied, which may have influenced the results. Thoracic kyphosis tends to increase with age (17), and this increase occurs more rapidly (within three years) for women with osteoporosis (32).

Table 2 - Correlation between muscle strength and anteroposterior COP displacement variables. Group Variable

CG

YSD

OPG

YSD

Dominant

r p r p

Non-dominant

Extension

Flexion

Extension

Flexion

PTQ/BW

PTQ/BW

PTQ/BW

PTQ/BW

-0.16 0.225 -0.11 0.409

-0.37 0.003 -0.04 0.757

-0.11 0.394 -0.21 0.105

-0.16 0.208 -0.06 0.625

COP: center of pressure; PTQ/BW: peak torque/body weight; CG: control group; OPG: osteoporosis group; YSD: root mean square of the displacements of the center of pressure in the anteroposterior plane Data representing Pearson’s correlation coefficient (r) with p,0.01 are in bold.

N N

at the midpoint of PTQ/BW, there was a significant difference between the means in the two groups (p = 0.036) such that the mean for the CG was higher than the mean for the OPG. Within the same fall category and the same PTQ/ BW value, there was no significant difference in YSD between the two groups (p = 0.056). In the OPG, there was no association between YSD and PTQ/BW (p = 0.984); in the CG, there was an association between YSD and PTQ/BW (p = 0.001), and YSD decreased by 0.003 cm/s (standard error = 0.0008) with every one-unit increase in PTQ/BW.

Table 3 presents the correlations of the degree of thoracic kyphosis and 25-OH vitamin D assays with the balance variable in the OPG.

& DISCUSSION We were unable to find any previous studies evaluating anteroposterior COP displacement in relation to falls and isokinetic knee muscle strength in association with vitamin D assays and the degree of thoracic kyphosis among postmenopausal women. The results from this study demonstrated that within this age group, the anteroposterior COP displacement was greater among women without osteoporosis. Isokinetic muscle strength was not associated with anteroposterior COP displacement. Thoracic kyphosis and 25-OH vitamin D Table 3 - Correlation of thoracic kyphosis and 25-OH vitamin D with anteroposterior COP displacement. YSD 25-OH vitamin D T2-T12 T4-T9

r p r p r p

-0.01 0.948 0.01 0.951 0.07 0.579

COP: center of pressure; T4-T9: regional Cobb angle from the fourth to the ninth thoracic vertebra; T2-T12: overall Cobb angle from the second to the twelfth thoracic vertebra; YSD: root mean square of the displacements of the center of pressure in the anteroposterior plane Data represent Pearson’s correlation coefficient (r).

Study Limitations The limitations of the present study include the age group studied (55-65 years), considering that such individuals may not present notable abnormalities in anteroposterior COP

1296


CLINICS 2013;68(10):1293-1298

Balance in postmenopausal women Brech GC et al.

displacement due to their relative youth. However, we chose to evaluate this population because we wanted to examine the behavior of these variables without the influence of musculoskeletal aging. We did not assess ‘‘fear of falling’’, which is an important variable given that individuals with greater fear of falling tend to maintain postures that are more rigid during balance evaluations. Falls among women with osteoporosis may be more closely related to dynamic balance, such as that exerted while walking and changing positions, and less related to static balance. Future studies should seek to assess the balance abilities of these women under more challenging conditions, such as eyes closed on unstable surfaces or eyes closed while performing verbal double tasking. In addition, future studies should seek to evaluate groups with different levels of vitamin D and greater angles of thoracic kyphosis to identify the real influence of these variables on postural balance. Women with osteoporosis present a high rate of fractures related to falls, which may be very serious because of the clinical complications resulting from hospitalizations to treat the fractures. Large numbers of elderly women fall during the night when they are headed to the bathroom. It is known that preventive measures such as keeping a light on and the removal of loose rugs present on the way from the bed to the bathroom are important strategies for preventing falls. The present study has demonstrated that women do not present any predisposition to falls caused by changes in anteroposterior COP displacement at the start of the postmenopausal period, which represents a significant clinical contribution. In addition, the degree of thoracic kyphosis and the 25-OH vitamin D levels measured in the present study were not associated with and did not increase the risk of falls among postmenopausal women with osteoporosis. Postmenopausal women, with or without lumbar osteoporosis, do not present abnormalities in anteroposterior COP displacement when they do not have a visible reference point. This result was independent of knee muscle strength or whether the women suffered falls during the preceding year. Among postmenopausal women with osteoporosis, the degree of kyphosis and the 25-OH vitamin D levels noted in these experiments did not influence anteroposterior COP displacement.

5. 6. 7. 8. 9. 10. 11. 12. 13.

14.

15.

16.

17.

18. 19.

20.

& ACKNOWLEDGMENTS

21.

The authors would like to thank Capes for a PhD scholarship granted to the first author and FAPESP for the support provided (#2009/54568-2).

22.

& AUTHOR CONTRIBUTIONS

23.

Brech GC, Fonseca AM and Bagnoli VR performed the data collection, analysis and prepared the manuscript. Baracat EC and D’Andrea Greve JM supervised the study and revised the manuscript.

24.

& REFERENCES

25.

1. Alexander NB. Postural control in older adults. J Am Geriatr Soc. 1994;42(1):93-108. 2. Duarte M, Freitas SM. Revision of posturography based on force plate for balance evaluation. Rev Bras Fisioter. 2010;14(3):183-92, http://dx.doi. org/10.1590/S1413-35552010000300003. 3. Lynn SG, Sinaki M, Westerlind KC. Balance characteristics of persons with osteoporosis. Arch Phys Med Rehabil. 1997;78(3):273-7, http://dx. doi.org/10.1016/S0003-9993(97)90033-2. 4. Barr R, Macdonald H, Stewart A, McGuigan F, Rogers A, Eastell R, et al. Association between vitamin D receptor gene polymorphisms, falls,

26.

27.

1297

balance and muscle power: results from two independent studies (APOSS and OPUS). Osteoporos Int. 2010;21(3):457-66, http://dx.doi. org/10.1007/s00198-009-1019-6. Brech GC, Plapler PG, de Souza Meirelles E, Marcolino FM, Greve JM. Gait Posture. 2013;38(2):321-5. Lord SR, Menz HB. Visual contributions to postural stability in older adults. Gerontology. 2000;46(6):306-10, http://dx.doi.org/10.1159/ 000022182. Nardone A, Schieppati M. The role of instrumental assessment of balance in clinical decision making. Eur J Phys Rehabil Med. 2010;46(2):221-37. Lord SR, Clark RD, Webster IW. Postural stability and associated physiological factors in a population of aged persons. J Gerontol. 1991;46(3):69-76, http://dx.doi.org/10.1093/geronj/46.3.M69. Hartmann A, Knols R, Murer K, de Bruin ED. Reproducibility of an isokinetic strength-testing protocol of the knee and ankle in older adults. Gerontology. 2009;55(3):259-68, http://dx.doi.org/10.1159/000172832. American College of Sports Medicine. Position Stand on Exercise and physical activity for older adults. Med Sci Sports Exerc. 2009;41(7):151030. Skelton DA, Greig CA, Davies JM, Young A. Strength, power and related functional ability of healthy people aged 65–89 years. Age Ageing. 1994;23(5):371-7, http://dx.doi.org/10.1093/ageing/23.5.371. Naessen T, Lindmark B, Larsen HC. Hormone therapy and postural balance in elderly women. Menopause. 2007;14(6):1020-4. Sinaki M, Brey RH, Hughes CA, Larson DR, Kaufman KR. Balance disorder and increased risk of falls in osteoporosis and kyphosis: significance of kyphotic posture and muscle strength. Osteoporos Int. 2005;16(8):1004-10, http://dx.doi.org/10.1007/s00198-004-1791-2. Dukas L, Schacht E, Runge M. Independent from muscle power and balance performance, a creatinine clearance below 65 ml/min is a significant and independent risk factor for falls and fall-related fractures in elderly men and women diagnosed with osteoporosis. Osteoporos Int. 2010;21(7):1237-45, http://dx.doi.org/10.1007/s00198-009-1064-1. Kado DM, Huang MH, Nguyen CB, Barrett-Connor E, Greendale GA. Hyperkyphotic posture and risk of injurious falls in older persons: the Rancho Bernardo Study. J Gerontol A Biol Sci Med Sci. 2007;62(6):652-7, http://dx.doi.org/10.1093/gerona/62.6.652. Katzman WB, Vittinghoff E, Kado DM. Age-related hyperkyphosis, independent of spinal osteoporosis, is associated with impaired mobility in older community-dwelling women. Osteoporos Int. 2011;22(1):85-90, http://dx.doi.org/10.1007/s00198-010-1265-7. Kado DM, Lui LY, Ensrud KE, Fink HA, Karlamangla AS, Cummings SR. Study of Osteoporotic Fractures. Hyperkyphosis predicts mortality independent of vertebral osteoporosis in older women. Ann Intern Med. 2009;150(10):681-7, http://dx.doi.org/10.7326/0003-4819-150-10-200905 190-00005. Stoddart H, Sharp D, Harvey I, Whitley E. Falls and the use of health services in community-living elderly people. Br J Gen Pract. 2002; 52(484):923-5. Brech GC, Ciolac EG, Secchi LL, Alonso AC, Greve JMA. The effects of motor learning on clinical isokinetic performance of postmenopausal women. Maturitas. 2011;70(4):379-82, http://dx.doi.org/10.1016/j. maturitas.2011.09.004. Sinaki M, Lynn SG. Reducing the risk of falls through proprioceptive dynamic posture training in osteoporotic women with kyphotic posturing: a randomized pilot study. Am J Phys Med Rehabil. 2002;81(4):241-6. Pijnappels M, van der Burg PJ, Reeves ND, van Diee¨n JH. Identification of elderly fallers by muscle strength measures. Eur J Appl Physiol. 2008;102(5):585-92. Rougier PR. Relative contribution of the pressure variatinos under the feet and body weight distribution over both legs in the control of upright stance. J Biomech. 2007;40(11):2477-82, http://dx.doi.org/10.1016/j. jbiomech.2006.11.003. Abreu DC, Trevisan DC, Costa GC, Vasconcelos FM, Gomes MM, Carneiro AA. The association between osteoporosis and static balance in elderly women. Osteoporos Int. 2010;21(9):1487-91, http://dx.doi.org/ 10.1007/s00198-009-1117-5. Abreu DC, Trevisan DC, Reis JG, da Costa GD, Gomes MM, Matos MS. Body balance evaluation in osteoporotic elderly women. Arch Osteoporos. 2009;4(1-2):25-9, http://dx.doi.org/10.1007/s11657-009-0023-y. Silva RB, Costa-Paiva L, Oshima MM, Morais SS, Pinto-Neto AM. Frequency of falls and association with stabilometric parameters of balance in postmenopausal women with and without osteoporosis. Rev Bras Ginecol Obstet. 2009;31(10):496-502, http://dx.doi.org/10.1590/ S0100-72032009001000005. Brech GC, Alonso AC, Luna NM, Greve JM. Correlation of postural balance and knee muscle strength in the sit-to-stand test among women with and without postmenopausal osteoporosis. Osteoporos Int. 2013;24(7):2007-13, http://dx.doi.org/10.1007/s00198-013-2285-x. Laughton CA, Slavin M, Katdare K, Nolan L, Bean JF, Kerrigan DC, et al. Aging, muscle activity, and balance control: physiologic changes


Balance in postmenopausal women Brech GC et al.

CLINICS 2013;68(10):1293-1298

controlled trial. J Bone Miner Res. 2003;18(2):343-51, http://dx.doi.org/ 10.1359/jbmr.2003.18.2.343. 31. Bischoff-Ferrari HA, Conzelmann M, Sta¨ helin HB, Dick W, Carpenter MG, Adkin AL, et al. Is fall prevention by vitamin D mediated by a change in postural or dynamic balance? Osteoporos Int. 2006;17(5):656-63, http://dx.doi.org/10.1007/s00198-005-0030 -9. 32. Roux C, Fechtenbaum J, Kolta S, Said-Nahal R, Briot K, Benhamou CL. Prospective assessment of thoracic kyphosis in postmenopausal women with osteoporosis. J Bone Miner Res. 2010;25(2):362-8., http://dx.doi. org/10.1359/jbmr.090727.

associated with balance impairment. Gait Posture. 2003;18(2):101-8, http://dx.doi.org/10.1016/S0966-6362(02)00200-X. 28. Shinchuk LM, Holick MF. Vitamin d and rehabilitation: improving functional outcomes. Nutr Clin Pract. 2007;22(3):297-304, http://dx.doi. org/10.1177/0115426507022003297. 29. Bischoff-Ferrari HA, Dietrich T, Orav EJ, Hu FB, Zhang Y, Karlson EW, et al. Higher 25-hydroxyvitamin D concentrations are associated with better lower-extremity function in both active and inactive persons aged . or = 60 y. Am J Clin Nutr. 2004;80(3):752-8. 30. Bischoff HA, Sta¨helin HB, Dick W, Akos R, Knecht M, Salis C, et al. Effects of vitamin D and calcium supplementation on falls: a randomized

1298


CLINICAL SCIENCE

Evaluation of the traditional and revised world health organization classifications of dengue cases in Brazil Fa´bio Rocha Lima,I Mariana Garcia Croda,II Daniella Araujo Muniz,I Isabella Trausula Gomes,I Karla Roberta de Moraes Soares,I Monique Rodrigues Cardoso,I Raquel Luciana Angela Marques Tauro,I Julio CrodaI I

Federal University of Grande Dourados, Faculty of Health Sciences, Dourados/MS, Brazil. II Federal University of Grande Dourados, University Hospital, Dourados/MS, Brazil.

OBJECTIVE: Dengue is a worldwide public health problem with approximately 50 million cases reported annually. The World Health Organization proposed a revised classification system in 2008 to more effectively identify the patients who are at increased risk of complications from dengue. Few studies have validated this new classification system in clinical practice. We conducted a cross-sectional study of patients hospitalized for dengue in Dourados, Mato Grosso do Sul, Brazil, to evaluate the capacity of the two classification systems for detecting severe cases of dengue. MATERIALS AND METHODS: We conducted a cross-sectional study of survey data from the medical records of patients admitted to the University Hospital of the Federal University of Grande Dourados under clinical suspicion of dengue during an epidemic from September 2009 to April 2010. RESULTS: The distribution of patients according to the traditional classification system was as follows: dengue fever, 150/181 (82.9%); dengue hemorrhagic fever, 27/181 (14.9%); and dengue hemorrhagic shock, 4/181 (2.2%). Using the revised classification system, the distribution was as follows: dengue without warning signs, 45/181 (24.3%); dengue with warning signs, 107/181 (59.1%); and severe dengue, 29/181 (15.6%). Of the 150 patients classified as having dengue fever, 105 (70%) were reclassified as having dengue with warning signs or severe dengue. CONCLUSION: These data demonstrate that the revised classification system has greater discriminatory power for detecting patients at risk of progression to severe disease and those needing hospitalization. KEYWORDS: Dengue; Dengue Hemorrhagic Fever; Dengue Shock; Severe Dengue; Case Classification. Lima FR, Croda MG, Muniz DA, Gomes IT, Soares KR, Cardoso MR, et al. Evaluation of the traditional and revised world health organization classifications of dengue cases in Brazil. Clinics. 2013;68(10):1299-1304. Received for publication on April 4, 2013; First review completed on April 26, 2013; Accepted for publication on May 2, 2013 E-mail: juliocroda@ufgd.edu.br Tel.: 55 67 3410-2321

million cases require hospitalization, indicating that dengue is a serious global public health concern (8-11). There is no vaccine or specific treatment for preventing the natural progression of the disease, and it is important that physicians have the appropriate tools to diagnose severe forms of dengue rapidly and accurately. This diagnosis requires a clinical classification system that provides simple and quick detection of patients who may develop more severe disease. It is especially important to detect plasma leakage, which is treated with intravenous rehydration, to reduce the mortality of dengue (8,10,12). The 1997 World Health Organization (WHO) classification subdivides dengue into dengue fever (DF), dengue hemorrhagic fever (DHF), and dengue shock syndrome (DSS). The criteria for classifying a patient as having DHF are very rigid; the patient must exhibit four criteria: fever, hemorrhagic manifestations, thrombocytopenia, and evidence of third-space fluid loss (serous effusions, hemoconcentration, or hypoproteinemia) (4,6,12).

& INTRODUCTION Dengue is an important arthropod-borne viral disease found worldwide. Dengue is caused by four serotypes of the genus Flavivirus (DENV-1, DENV-2, DENV-3, and DENV-4) and is transmitted via the bite of the Aedes aegypti mosquito, an urban vector that has adapted to human dwellings (1-7). The worldwide incidence of dengue has increased over the past three decades. There are approximately 50 million symptomatic infections per year, and approximately two

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)02

1299


Classifications of dengue cases in Brazil Lima FR et al.

Several limitations to the practical applicability of these criteria have been noted, particularly in the evaluation of severe cases. Many patients who develop a severe clinical presentation do not meet the criteria for DHF and are ultimately classified as having dengue fever. In 2008, the WHO proposed a new classification system, based on a multicenter study in Asian and Latin American countries, that provided a list of clinical signs suggestive of a severe disease outcome (warning signs). This system classified dengue into dengue without warning signs (DWWS), dengue with warning signs (DWS), and severe dengue (SD) (4,6,12,13). The WHO dengue classification of 1997 aims to stratify dengue patients according to the pathophysiological level of disease progression, particularly with respect to the occurrence of plasma leakage. The WHO dengue classification of 2008 uses clinical signs and symptoms to stratify dengue patients according to disease severity (4,6,12,13). Based on this perspective, a cross-sectional survey was conducted to evaluate the ability of the two classification systems to detect severe cases of dengue based on the medical records of dengue patients who were admitted to the University Hospital of the Federal University of Grande Dourados during the dengue epidemic in the summers of 2009-2010. This study is the first in Brazil to evaluate the revised WHO classification criteria.

CLINICS 2013;68(10):1299-1304

These data were tabulated and analyzed to evaluate the primary variables associated with ICU admission and to compare the traditional and revised WHO clinical classifications regarding the development and clinical severity of disease. ICU admission was used as a proxy for disease severity. The variables were entered into the database of the EpiData program, version 3.0, and analyzed using the SAS statistical software, version 9.1. The distribution pattern of each variable was evaluated, and the statistical methods were selected based on the specific distribution pattern. The variables that exhibited an asymmetric distribution were evaluated using non-parametric tests, whereas those that exhibited a normal distribution were evaluated using parametric tests. Categorical or dichotomous data were analyzed using the chi-square test or Fisher’s exact test when the number of subjects per cell was less than 5. The study was approved by the committee for ethics in research of the Federal University of Grande Dourados under number 01304112.9.0000.5160.

& RESULTS Between September 2009 and April 2010, 7,827 dengue cases were reported to the SINAN (3,913 cases per 100,000 inhabitants), and 495 (6.32%) patients were hospitalized. A total of 211 patients were admitted to the University Hospital of the Federal University of Grande Dourados. Twenty-four cases were excluded: 22 patient records could not be located, and 2 patients were indigenous people. The study included 187 patients from SINAN who were admitted to the University Hospital of the Federal University of Grande Dourados. Of these, 77 (41.4%) were male. The patients ranged in age from 1 to 90 years, with an average age of 37.1 years. The majority of patients (90.8%) lived in the city of Dourados (Table 1). During the epidemic, not all cases were confirmed; 160/187 (86%) patients underwent serological examination; 12% were negative, 57% were positive, and 31% were inconclusive for dengue. The most common classical symptom of dengue was fever, which was present in 173 patients (98.3%), followed by myalgia (84.5%) and headache (78.1%). Warning signs were present in 108 patients (60.7%). Of these warning signs, the most frequent was abdominal pain, which was present in 92 patients (53.5%). Nineteen patients (11.4%) presented with signs of shock (Table 1). Based on the traditional classification, the distribution of the patients in the study was 82.9% DF, 14.9% DHF, and 2.2% DSS. The revised classification placed DWWS at 24.3%, DWS at 59.1%, and SD at 15.6% (Figure 1). Of the 150 patients classified as having DF, 105 (70%) were reclassified as DWS or SD. None of the patients classified as DHF or DSS were reclassified as DWWS (Table 2). With the new classification, 96.2% of patients admitted to the ICU were classified as DWS/SD. By the traditional classification, 53.8% were classified as DHF/DSS (p = 0.4615) (Table 3). With the new classification, 71.8% of patients admitted to the ward were classified as DWS/SD, whereas by the traditional classification, 11.4% were classified as DHF/DSS (p = 0.0061) (Table 4). We found that the majority of the classical signs and symptoms were not associated with disease severity. Most of the warning signs were associated with an indication for ICU admission and were severe. The same results were observed for the

& MATERIAL AND METHODS Data were collected through patient notification obtained from the National Notifiable Diseases Information System (SINAN) and the records of suspected cases of dengue at the University Hospital of the Federal University of Grande Dourados during September 2009 and April 2010 in Dourados, Mato Grosso do Sul. Indigenous patients and patients whose records could not be located were excluded. From the collected records, a survey of the following epidemiological data was conducted: gender, age, and city of residence. The clinical data obtained included reports of fever, headache, myalgia, arthralgia, retro-orbital pain, skin rash, vomiting, diarrhea, epistaxis, petechiae, gingival bleeding, metrorrhagia, hematuria, warning signs, abdominal pain, persistent vomiting, postural hypotension, hepatomegaly, gastrointestinal hemorrhaging, drowsiness/irritability, oliguria, hypothermia, respiratory distress, shock, hypotension, converging blood pressure, cold extremities, cyanosis, rapid and thready pulse, slow capillary refill, and serous effusions (pleural and peritoneal). The laboratory data included a complete blood count (hematocrit, hemoglobin, leukocyte count, and platelet count), liver enzymes (AST and ALT), and liver function tests (albumin, PT, and aPTT). The clinical outcomes included death, admission to the ICU, and the need for blood transfusions (packed red blood cells, plasma, and platelets). The clinical and laboratory data were collected within the first 24 hours of admission. Dengue patients were classified retrospectively based on warning signs and disease severity. The warning signs were as follows: abdominal pain or tenderness, persistent vomiting, clinical fluid accumulation, mucosal bleeding, lethargy/restlessness, liver enlargement greater than 2 cm, and an increase in the hematocrit concurrent with a rapid decrease in platelet count. The criteria used for SD were as follows: shock, fluid accumulation with respiratory distress, severe bleeding, AST or ALT greater than or equal to 1,000, impaired consciousness, and severe involvement of the heart and other organs.

1300


CLINICS 2013;68(10):1299-1304

Classifications of dengue cases in Brazil Lima FR et al.

Table 1 - The distribution of demographic, clinical, and laboratory data and the clinical outcomes of patients hospitalized with suspected dengue at the University Hospital of the Federal University of Grande Dourados from September 2009 to April 2010 (N = 187). Variable Demographic data Gender - Male, N (%) Age, mean +/- SD Clinical data Fever, N (%) Myalgia, N (%) Headache, N (%) Vomiting, N (%) Arthralgia, N (%) Skin rash, N (%) Retro-orbital pain, N (%) Diarrhea, N (%) Hemorrhagic signs Petechiae, N (%) Epistaxis, N (%) Gingival bleeding, N (%) Metrorrhagia, N (%) Gastrointestinal hemorrhaging, N (%) Hematuria, N (%) Warning signs, N (%) Abdominal pain, N (%) Serous effusions, N (%) Respiratory distress, N (%) Shock, N (%) Hypotension, N (%) Drowsiness/irritability, N (%) Postural hypotension, N (%) Persistent vomiting, N (%) Hepatomegaly, N (%) Hypothermia, N (%) Cyanosis, N (%) Oliguria, N (%) Rapid and thready pulse, N (%) Cold extremities, N (%) Slow capillary refill, N (%) Converging blood pressure, N (%) Laboratory data Platelet count, mean +/- SD Hematocrit, mean +/- SD Hemoglobin, mean +/- SD Leukocyte count, mean +/- SD AST, mean +/- SD ALT, mean +/- SD Albumin, mean +/- SD TP, mean +/- SD aPTT, mean +/- SD Clinical outcome Death, N (%) ICU admission, N (%) Length of hospitalization (days), mean +/- SD Length of hospitalization in ICU (days), mean +/- SD Blood transfusion, N (%) Packed red blood cells, N (%) Platelets, N (%) Plasma, N (%)

DF

DHF and SSD

p-value

63/150 (42.0%) 37.8 +/- 22.1

11/31 (35.5%) 33.4 +/- 27.6

0.5017 0.5124a

140/142 (98.6%) 115/134 (85.8%) 96/122 (78.7%) 66/114 (57.9%) 51/97 (52.16%) 44/92 (47.8%) 42/95 (44.2%) 34/98 (34.7%)

30/30 (100%) 19/24 (79.2%) 20/26 (76.9%) 19/25 (76.0%) 6/19 (31.6%) 9/19 (47.4%) 3/16 (18.8%) 11/24 (45.8%)

0.5132 0.4029 0.8426 0.0926 0.0941 0.9710 0.0962b 0.3107

63/124 21/116 27/121 15/114

(50.8%) (18.1%) (22.3%) (13.2%)

17/31 (54.8%) 11/30 (36.7%) 6/29 (20.7%) 3/29 (10.3%)

0.6878 0.0285 0.8496 1.0000b

7/113 (6.2%) 80/145 (55.2%) 69/140 (49.3%) 14/136 (10.3%) 11/131 (8.4%) 12/134 (9.0%) 11/129 (8.5%) 6/131 (4.6%) 5/239 (3.9%) 4/131 (3.1%) 5/132 (3.8%) 2/130 (1.5%) 2/127 (1.6%) 2/130 (1.5%) 2/127 (1.6%) 1/127 (0.8%) 1/127 (0.8%) 0/127 (0%)

2/28 (7.1%) 28/31 (90.3%) 23/30 (76.7%) 13/29 (44.8%) 9/26 (34.6%) 7/31 (22.6%) 6/30 (20.0%) 10/30 (33.3%) 4/36 (15.4%) 3/29 (13.8%) 3/29 (10.3%) 4/30 (13.3%) 3/30 (10.0%) 3/29 (10.3%) 2/30 (6.7%) 2/30 (6.7%) 1/30 (3.3%) 0/30

1.0000b 0.0003 0.0063 ,0.0001 0.0002 0.0322 0.0670 ,0.0001 0.0438b 0.0366b 0.1562b 0.0954b 0.0484b 0.0426b 0.1652b 0.0937b 0.3466b

81,9 +/- 87,0 37.9 +/- 5.0 12.4 +/- 2.0 2,1 +/- 1,7 99.1 +/- 63.9 70.5 +/- 5.6 3.5 +/- 0.5 14.6 +/- 2.3 45.4 +/- 13.2

43,8 +/- 62,6 39.1 +/- 6.7 12.8 +/- 2.8 2,3 +/- 1,5 1011.0 +/- 3226.7 431.8 +/- 178.7 2.9 +/- 0.6 18.6 +/- 8.5 58.1 +/- 27.0

0.0219a 0.2600a 0.6041a 0.6409a 0.0058a 0.0002a 0.0010a 0.0026a 0.0254a

1/140 (0.7%) 12/144 (8.3%) 3.5 +/- 3.5 5.5 +/- 9.3 13/147 (8.8%) 5/147 (3.4%) 8/147 (5.4%) 3/147 (2.0%)

2/28 (7.1%) 14/31 (45.2%) 8.8 +/- 10.2 10.2 +/- 12.4 11/29 (37.9%) 6/29 (20.7%) 8/29 (27.6%) 4/29 (13.8%)

0.0724b ,0.0001 ,0.0001a 0.3333a ,0.0001 0.0004 0.0002 0.0149b

N (number of patients), SD (standard deviation), AST (aspartate aminotransferase), ALT (alanine aminotransferase), PT (prothrombin time), aPTT (activated partial thromboplastin time), ICU (intensive care unit), a T-test, b Fisher Exact Test.

variables associated with a specific outcome, such as death or the need for a blood transfusion (Table 5).

of the epidemic in 2010, there were 59,199 reported cases of dengue statewide (13.2% of the cases reported nationally). Mato Grosso do Sul had the 4th highest number of cases of any state in the country and the 2nd highest incidence (2,507.8 cases per 100,000 inhabitants) (14). The frequencies of the classical signs and symptoms, hemorrhagic manifestations, and warning signs of dengue fever observed in this study were similar to those of

& DISCUSSION This study was conducted during a major dengue epidemic in the state of Mato Grosso do Sul from September 2009 to October 2010. During the first 13 weeks

1301


Classifications of dengue cases in Brazil Lima FR et al.

CLINICS 2013;68(10):1299-1304

Figure 1 - Distribution of patients with suspected dengue who were admitted to HU/UFGD from September 2009 to April 2010 according to the traditional and revised WHO classifications (N = 187). DF (dengue fever), DHF (dengue hemorrhagic fever), DSS (dengue shock syndrome), DWWS (dengue without warning signs), DWS (dengue with warning signs), SD (severe dengue).

mm3), hemorrhagic manifestations (positive tourniquet test, hemorrhagic skin, and mucosal bleeding), and plasma leakage due to increased capillary permeability (a 20% increase in hematocrit values over the baseline at admission, a 20% decrease in hematocrit values after the appropriate treatment, and the presence of pleural effusion, ascites, or hypoproteinemia). The requirement of meeting all of the criteria caused difficulty in detecting severe cases. Several authors reported difficulties in determining the criteria and classifying patients as DHF (4,19-21). In many situations, it is difficult to demonstrate hemoconcentration based on a 20% increase in hematocrit values; intravenous fluid replacement may alter hematocrit levels and hamper the use of this criterion. Many countries do not have a normal hematocrit value for their population, making it difficult to determine the 20% limit. Some researchers use hematocrit values to evaluate hemoconcentration during convalescence. This evaluation involves a retrospective diagnosis, which is not intended to predict the risk of developing severe disease (6). Another limitation was the need to perform laboratory tests to diagnose DHF; these tests included hematocrit, platelet count, serum albumin, chest radiography, and abdominal ultrasound tests. The requirement for these tests could complicate the diagnosis in countries in which access to these tests is limited (22). These data demonstrate the low

previously published studies (15-17). Laboratory data, such as platelet counts, were frequently recorded (73% of cases) and were consistent with the frequencies reported by Cortin˜as et al. (70.5%), Barniol et al. (72%), and Moura˜o et al. (89.9%) (6,15,16). Using the traditional 1997 WHO classification, the majority of patients were classified as having dengue fever (82.9%) (18). These data, although slightly higher, were similar in pattern to those reported by Moura˜o et al. (66.3%), Barniol et al. (67.1%), and Narvaez et al. (70.8%) (4,6,16). The use of the traditional classification system as a criterion for admission to the hospital was not useful. The majority of patients admitted to the hospital were classified as DF. Notably, 8.3% of the DF patients required ICU admission, indicating that the traditional classification was unable to identify the patients who developed more severe disease. When the two classifications were compared, the majority of the DF patients (70%) were reclassified as DWS or SD. Similar data were reported in the studies by Barniol et al. (57.6%) and Narvaez et al. (93.4%) (4,6). In the study by Narvaez et al., 6.6% of patients were reclassified as having dengue without warning signs (6). The criteria for DHF were very rigid in the traditional 1997 WHO classifications. Patients could be classified as DHF if they presented with all of the following signs (20): fever for two to seven days, thrombocytopenia (#100,000/ Table 2 - Correlations between the traditional and revised WHO classifications of patients with suspected dengue who were hospitalized at the University Hospital of the Federal University of Grande Dourados from September 2009 to April 2010.

DF DHF DSS TOTAL

DWWS

DWS

SD

TOTAL

p-value

45 (30%) 0 (0%) 0 (0%) 45

90 (60%) 17 (63%) 0 (0%) 107

15 (10%) 10 (37%) 4 (100%) 29

150 27 4 181

,0.0001

Table 3 - Correlations between the traditional and revised WHO classifications of patients with suspected dengue who were admitted to the Intensive Care Unit at the University Hospital of the Federal University of Grande Dourados from September 2009 to April 2010.

DF DHF/DSS TOTAL

DF (dengue fever), DHF (dengue hemorrhagic fever), DSS (dengue shock syndrome), DWWS (dengue without warning signs), DWS (dengue with warning signs), SD (severe dengue).

DWWS

DWS/SD

TOTAL

1 (8.3%) 0 (0%) 1 (8.3%)

11 (91.7%) 14 (100%) 25 (96.2%)

12 (46.2%) 14 (53.8%) 26 (100.0%)

DF (dengue fever), DHF (dengue hemorrhagic fever), DSS (dengue shock syndrome), DWWS (dengue without warning signs), DWS (dengue with warning signs), SD (severe dengue).

1302


CLINICS 2013;68(10):1299-1304

Classifications of dengue cases in Brazil Lima FR et al.

The increased discriminatory power of the revised classification can be explained by the requirement for a single criterion (warning sign) to classify a patient as being at risk of progressing to severe disease (4). The presence of shock, independent of thrombocytopenia or hemoconcentration, is sufficient to classify a patient as having SD (4,23). The classical signs and symptoms of dengue were not significantly correlated with the need for ICU admission. The majority of the warning signs that determine disease severity (with the exception of uncontrollable vomiting, hepatomegaly, and serous effusions) were strongly associated with ICU admission. These warning signs were significantly correlated with disease that resulted in death or the need for a blood transfusion. By using the ICU as a proxy for the severity of illness, we demonstrated that the new classification is more sensitive (96.2%) than the traditional classification, but there is a significant loss of specificity (28.2%). Although patients admitted to the ICU have a higher frequency of warning signs, an indication for ICU admission should not be based

Table 4 - Correlations between the traditional and revised WHO classifications of patients with suspected dengue who were admitted to the general ward at the University Hospital of the Federal University of Grande Dourados from September 2009 to April 2010.

DF DHF/DSS TOTAL

DWWS

DWS/SD

TOTAL

42 (31.8%) 0 (0%) 42 (28.2%)

90 (68.2%) 17 (11.4%) 107 (71.8%)

132 (88.6%) 17 (11.4%) 149 (100.0%)

DF (dengue fever), DHF (dengue hemorrhagic fever), DSS (dengue shock syndrome), DWWS (dengue without warning signs), DWS (dengue with warning signs), SD (severe dengue).

discriminatory power of the traditional classification in detecting severe cases of dengue. Previous studies have demonstrated that the level of detecting severe cases of dengue is 39% for the traditional classification and 92% for the revised classification (6,23).

Table 5 - Clinical outcomes of patients with suspected dengue who were hospitalized at HU/UFGD from September 2009 to April 2010 based on demographic and clinical data compared with the need for ICU admission (N = 187). Variable Demographics Gender - Male, N (%) Clinical data Fever, N (%) Headache, N (%) Myalgia, N (%) Arthralgia, N (%) Retro-orbital pain, N (%) Skin rash, N (%) Vomiting, N (%) Diarrhea, N (%) Epistaxis, N (%) Petechiae, N (%) Gingival bleeding, N (%) (%) Metrorrhagia, N (%) Hematuria, N (%) Warning Signs*, N (%) Abdominal pain, N (%) Uncontrollable vomiting, N (%) Postural hypotension, N (%) Hepatomegaly, N (%) Gastrointestinal hemorrhaging, N (%) Drowsiness, N (%) Oliguria, N (%) Hypothermia, N (%) Respiratory distress, N (%) Shock, N (%) Hypotension, N (%) Converging blood pressure, N (%) Cold extremities, N (%) Cyanosis, N (%) Rapid and thready pulse, N (%) Slow capillary refill, N (%) Serous effusion, N (%) Pleural effusion, N (%) Ascites, N (%) Clinical outcome Death, N (%) Blood transfusion, N (%) Blood transfusion - packed erythrocytes, N (%) Blood transfusion - platelets, N (%) Blood transfusion - plasma, N (%)

Patients admitted to the ICU

Patients not admitted to the ICU

p-value

12/27 (44.4%)

92/104 (60.1%)

0.1281

24/24 (100%) 14/19 (73.7%) 11/16 (68.7%) 3/10 (30.0%) 1/8 (11.1%) 5/13 (38.5%) 15/18 (83.3%) 8/17 (47.1%) 4/21 (19.0%) 10/23 (43.5%) 3/23 (13.0%) 1/16 (5.9%) 2/22 (9.1%) 24/26 (92.3%) 17/23 (73.9%) 2/19 (10.5%) 4/17 (23.5%) 1/19 (5.3%) 10/22 (45.5%) 8/21 (38.1%) 2/19 (10.5%) 5/20 (25.0%) 8/18 (44.4%) 8/23 (34.8%) 7/22 (31.8%) 0/21 (0%) 3/21 (14.3%) 3/21 (14.3%) 4/21 (19.0%) 2/21 (9.5%) 13/20 (65.0%) 7/16 (43.7%) 8/18 (44.4%)

143/146 (97.9%) 99/127 (77.95%) 120/140 (85.7%) 52/104 (50.0%) 46/102 (45.1%) 49/98 (49.0%) 66/118 (55.9%) 36/103 (35.0%) 15/122 (20.5%) 68/130 (52.3%) 30/125 (24.0%) 8/68 (11.8%) 7/117 (6.0%) 82/146 (56.1%) 74/143 (51.7%) 5/137 (3.5%) 5/135 (3.7%) 2/138 (4.4%) 17/139 (12.2%) 8/137 (5.8%) 3/137 (2.2%) 1/137 (0.7%) 12/136 (8.8%) 10/140 (7.1%) 9/135 (6.7%) 0/134 (0%) 0/134 (0%) 2/134 (1.5%) 0/134 (0%) 00/134 (0%) 19/47 (40.4%) 7/32 (21.9%) 15/32 (46.9%)

0.4786 0.6782 0.0797 0.3244a 0.0760a 0.4756 0.0274 0.3372 0.8792 0.4349 0.2907a 0.4687a 0.6339a 0.0005 0.0474 0.2036a 0.0097a 1.0000a 0.0001 ,0.0001 0.1126a 0.0021a ,0.0001 ,0.0001 0.0003 0.0022a 0.0181a ,0.0001a 0.0176a 0.0674 0.1160 0.8685

3/22 (13.6%) 15/23 (65.2%) 9/23 (39.1%) 10/23 (43.5%) 6/23 (26.1%)

0/148 (0%) 8/153 (5.23%) 2/153 (1.2%) 6/153 (3.9%) 0/153 (0%)

0.0019a ,0.0001a ,0.0001a ,0.0001 ,0.0001a

N (number of patients), ICU (intensive care unit), * At least one warning sign,

1303

a

Fisher Exact Test.


Classifications of dengue cases in Brazil Lima FR et al.

CLINICS 2013;68(10):1299-1304

on the presence of warning signs alone. Further studies with a larger sample size are necessary to assess the associated variables that could predict disease severity and ICU admission. Prospective studies involving outpatients should be performed to identify whether the new classification is important in indicating hospitalization in different settings. This study has some limitations and potential confounding factors that are inherent in a retrospective design based on a secondary database. The results of this study are limited by the absence of important variables that may not be recorded in medical charts, including symptoms, physical exams, laboratory findings, and the use of intravenous rehydration. Another relevant limitation is using ICU admission as a proxy for disease severity. ICU admission may not represent all severe cases due to a lack of beds in an ICU. A less common limitation is that ICU admission could be related to the age or comorbidities of a patient. We conclude that the revised WHO classification is more effective than the traditional classification for identifying severe cases of dengue. The revised classification exhibits greater practical applicability in developing countries such as Brazil because it is less dependent on complementary exams. The ability to appreciate and recognize the warning signs of the revised classification is essential for clinicians to identify patients at risk of developing severe disease and to determine an appropriate course of action on a per-case basis. Future research to evaluate the warning signs of patient outcomes and the cost-effectiveness of the new classification system is necessary to ascertain whether the new classification system requires further modification or whether elements of the two classification systems can be combined.

5.

6.

7. 8.

9.

10.

11.

12.

13. 14.

15. 16.

& AUTHOR CONTRIBUTIONS 17.

Lima FR, Croda MG, and Croda J conceived and designed the study. Croda MG, Muniz DA, Gomes IT, Cardoso MR, and Tauro RL collected data from medical records. Lima FR and Croda J performed and interpreted the data analysis. Lima FR and Croda J were responsible for writing the manuscript. Croda MG and Croda J critically revised the manuscript. Croda J is the guarantor of the paper.

18. 19.

& REFERENCES 20.

1. Diaz-Quijano FA. Preditores de sangrado espontaneo en dengue: una revision sistematica de la literature [Predictors of spontaneous bleeding in dengue patients: a systematic review of the literature]. Invest Clin 2008;49(1):111-22. 2. Gibbons RV, Vanghn DW. Dengue: an escalating problem. BMJ. 2002;324(7353):1563-7, http://dx.doi.org/10.1136/bmj.324.7353.1563. 3. Kyle JL, Harris E. Global Spread and Persistence of Dengue. Annu Rev Microbiol. 2008;62:71-92, http://dx.doi.org/10.1146/annurev.micro.62. 081307.163005. 4. Narvaez F, Gutierrez G, Perez MA, Elizondo D, Nun˜ez A, Balmaseda A, et al. Evaluation of the traditional and revised WHO classifications of

21. 22. 23.

1304

dengue disease severity. PLoS Negl Trop Dis. 2011;5(11):e1397, http:// dx.doi.org/10.1371/journal.pntd.0001397. Diaz-Quijano FA, Villar-Centeno LA, Martinez-Veja RA. Complicaciones asociadas a la trombocitopenia profunda em pacientes com dengue [Complications associated to severe thrombocytopenia in patients with dengue]. Rev Med Chil. 2006;134(2):167-73. Barniol J, Gaczkowski R, Barbato EV, Cunha RV, Salgado D, Martinez E, et al. Usefulness and applicability of the revised dengue case classification by disease: multicentre study in 18 countries. BMC Infectious Dis. 2011;11:106, http://dx.doi.org/10.1186/1471-2334-11-106. Gu´sman MG, Kouri G. Dengue: an update. Lancet Infect Dis. 2002;2:3342, http://dx.doi.org/10.1016/S1473-3099(01)00171-2. Araujo JMGA, Schatzmayr HG, Filippis AMB, Santos FB, Cardoso MA, Britto C, et al. A retrospective survey of dengue virus infection in fatal cases from an epidemic in Brazil. J Virol Methods. 2009;155(1):34-8, http://dx.doi.org/10.1016/j.jviromet.2008.09.023. Castro RAC, Castro JA, Barez MYC, Frias MV, Dixit J, Genereux M. Thrombocytopenia associated with dengue hemorrhagic fever responds to intravenous administrations of anti-d (RH0-D) immune globulin. Am J Trop Med Hyg. 2007;76(4):737-42. Monteiro ESC, Coelho ME, Cuha IS, Cavalcante MAS, Carvalho FAA. Aspectos epidemiolo´gicos e vetoriais da dengue na cidade de Teresina, Piauı´ - Brasil, 2002 a 2006 [Epidemiological and vector-related indicators of dengue fever in Teresina city, Piauı´ State, Brazil, from 2002 to 2006]. Epidemiol. Serv. Sau´de [serial on the Internet]. 2009;18(4):365-74. Pontes RJS, Ruffino-Netto A. Dengue em localidade urbana da regia˜o sudeste do Brasil: aspectos epidemiolo´gicos [Dengue in the urban locality of southeastern Brazil: epidemiological aspects]. Rev Sau´de Pu´blica. 1994;28(3):218-27. Alexander N, Balmaseda A, Coelho ICB, Dimaano E, Hien TT, Hung NT, et al. Multicentre prospective study on dengue classification in four Southeast Asian and three Latin American countries. Trop Med and Inter Health. 2011;16(8):936-48, http://dx.doi.org/10.1111/j.1365-3156.2011. 02793.x. WHO Dengue guidelines for diagnosis, treatment, prevention and control. Third edition. Geneva: World Health Organization, 2009. Ministe´rio da Sau´de - Secretaria da Vigilaˆncia em Sau´de - Informe epidemiolo´gico da dengue - ana´lise de situac¸a˜o e tendeˆncia - 2010 [Ministry of Health - Bureau of Health Surveillance - Epidemiological report on dengue - situation and trend analysis - 2010]. Cortinas MG, Gonzalez DV, Cordero JC, Olivers MLL. Dengue hemorra´gico - Estudio clinico de 200 pacientes. [Dengue hemorrhagic fever - A clinical study of 200 patients] Rev Cubana Med. 1999;38(1);13-8. Moura˜o MPG, Lacerda MVG, Macedo VO, Santos JB. Thrombocytopenia in patients with virus infection in the Brazilian Amazon. Platelets. 2007;18(8):605-12, http://dx.doi.org/10.1080/09537100701426604. Srikiatkhachorn A, Gibbons RV, Green S, Libraty DH, Thomas SJ, Endy TP. Dengue hemorrhagic fever: The sensitivity and specificity of the World Health Organization for identification of severe cases of dengue in Thailand, 1994-2005. Clin Infect Dis. 2010;50(8):1135-43, http://dx.doi. org/10.1086/651268. WHO Dengue haemorrhagic fever: diagnosis, treatment, prevention and control. 2nd edition. Geneva: World Health Organization, 1997. Samsi TK, Wulur H, Sugianto D, Bartz CR, Tan R. Some clinical and epidemiological observations on virologically confirmed dengue hemorrhagic fever. Paediatr Indones. 1990;30(11-12):293-303. Lucas GN, Amerasinghe A, Sriranganathan S. Dengue hemorrhagic fever in Sri Lanka. Indian J Pediatr. 2000;67(7):503-4. Srivastava VK, Suri S, Bhasin A, Srivstava L, Bharadwaj M. An epidemic of dengue hemorrhagic fever and dengue shock syndrome in Delhi: a clinical study. Ann Trop Paediatr. 1990;10(4):329-34. Rigau-Pe´rez JG. Severe dengue: the need for new case definitions. Lancet Infect Dis. 2006;6(5):297-302, http://dx.doi.org/10.1016/S1473-3099(06) 70465-0. Hadinegoro SRS. The revised WHO dengue case classification: does the system need to be modified? Paediatr Int Child Health. 2012;32(S1):33-8, http://dx.doi.org/10.1179/2046904712Z.00000000052.


CLINICAL SCIENCE

Duration effect of desflurane anesthesia and its awakening time and arterial concentration in gynecologic patients Tso-Chou Lin,I Chih-Cherng Lu,V Che-Hao Hsu,I Gwo-Jang Wu,II,III Meei-Shyuan Lee,IV Shung-Tai HoIII,V I Tri-Service General Hospital/National Defense Medical Center, Department of Anesthesiology, Taipei, Taiwan. II Tri-Service General Hospital/National Defense Medical Center, Departments of Obstetrics and Gynecology, Taipei, Taiwan. III National Defense Medical Center, Graduate Institute of Medical Science, Taipei, Taiwan. IV National Defense Medical Center, School of Public Health, Taipei, Taiwan. V Taipei Veterans General Hospital/National Defense Medical Center, Department of Anesthesiology, Taipei, Taiwan.

OBJECTIVES: To determine the awakening arterial blood concentration of desflurane and its relationship with the end-tidal concentration during emergence from various durations of general anesthesia. METHOD: In total, 42 American Society of Anesthesiologists physical status class I-II female patients undergoing elective gynecologic surgery were enrolled. General anesthesia was maintained with fixed 6% inspiratory desflurane in 6 l min-1 oxygen until shutoff of the vaporizer at the end of surgery. One milliliter of arterial blood was obtained for desflurane concentration determination by gas chromatography at 20 and 10 minutes before and 0, 5, 10, 15, and 20 minutes after the discontinuation of desflurane and at the time of eye opening upon verbal command, defined as awakening. Concentrations of inspiratory and end-tidal desflurane were simultaneously detected by an infrared analyzer. RESULTS: The mean arterial blood concentration of desflurane was 1.20% at awakening, which correlated with the awakening end-tidal concentration of 0.96%. The mean time from the discontinuation of desflurane to eye opening was 5.2 minutes (SD = 1.6, range 3-10), which was not associated with the duration of anesthesia (60256 minutes), total fentanyl dose, or body mass index (BMI). CONCLUSIONS: The mean awakening arterial blood concentration of desflurane was 1.20%. The time to awakening was independent of anesthetic duration within four hours. Using well-assisted ventilation, the endtidal concentration of desflurane was proven to represent the arterial blood concentration during elimination and could be a clinically feasible predictor of emergence from general anesthesia. KEYWORDS: Desflurane; Arterial Blood; End-Tidal; Awakening. Lin TC, Lu CC, Hsu CH, Wu GJ, Lee MS, Ho ST. Duration effect of desflurane anesthesia and its awakening time and arterial concentration in gynecologic patients. Clinics. 2013;68(10):1305-1311. Received for publication on December 17, 2012; First review completed on February 25, 2013; Accepted for publication on May 9, 2013 E-mail: stho@vghtpe.gov.tw Tel.: 886-2-28757155

and isoflurane (34% reduction) (3), especially in those individuals undergoing prolonged surgical procedures (4,6). Growing evidence (7-12) indicates that a certain time period is needed for inhaled anesthetics to cross the alveolar membrane and enter the body and brain in the beginning of general anesthesia in order to achieve the minimal alveolar concentration (MAC), the point at which no movement is observed in 50% of patients in response to a surgical stimulus. Similarly, elimination of the inhaled anesthetics from the blood to the lungs during emergence is time-dependent (13). Clinically, the end-tidal concentration has been a feasible predictor of awakening from general anesthesia (14). However, irregular respiration during emergence usually results in the fluctuation of end-tidal concentrations of inhaled anesthetics (15). The arterial blood concentration provides a steadier, more reliable representation of the anesthetic concentration in the brain. Thus, we hypothesized that desflurane, with its low coefficient, would not accumulate in

& INTRODUCTION Desflurane has been clinically used in anesthesia for two decades (1). The major advantages include rapid induction and recovery (2,3), lower cost (4), and myocardial protection during cardiac surgery (5). Due to its lower blood-gas partition coefficient (0.42), the ratio of the dissolved amount in the blood to the amount in the alveolar gas in contact with the blood, desflurane has been clearly proven to provide a shorter time to extubation compared with sevoflurane (20% reduction) (2)

Copyright Ă&#x; 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)03

1305


Desflurane awakening blood concentration Lin TC et al.

CLINICS 2013;68(10):1305-1311

a 20-gauge catheter was placed into the left radial artery for blood sampling. General anesthesia was induced with 1.5 mg kg-1 propofol, and 1.5 mg kg-1 succinylcholine was administered for endotracheal intubation. We maintained anesthesia with 0.1 mg kg-1 cis-atracurium and 6% fixed inspiratory desflurane in 6 l min-1 oxygen during the entire procedure. Nitrous oxide was not used. Fentanyl, 25 or 50 mcg, was titrated to meet the patients’ pain responses beyond desflurane administration. A Datex-Ohmeda Aestiva/5 anesthetic machine (Datex-Ohmeda, Madison, WI) was used with soda lime (CO2 absorbent), and the minute ventilation was adjusted to keep the end-tidal CO2 between 38 and 42 mmHg. The leakage of each system was determined using constant-pressure ventilation with a test lung. The sampled gases (approximately 210 ml min-1) were redirected into the circuit. Both the inspiratory and the end-tidal concentrations of desflurane were detected by an infrared multi-gas analyzer (Datex-Ohmeda S/5 Anesthesia System; Datex-Ohmeda, Helsinki, Finland) that was calibrated according to the manufacturer’s recommendations. A Finometer (FMS, Finapres Measurement Systems, Arnhem, Netherlands) was used to determine cardiac output. Hypotension, defined as a 25% decrease in blood pressure from baseline, was treated with intravenous fluid and ephedrine (5 mg bolus). A nasopharyngeal thermometer was used to measure and maintain the body temperature in the range of 36.5-37.5 ˚C. After the operation was completely finished, the vaporizer was turned off, with 6 l min-1 oxygen for fresh gas flow. Next, 2 mg Neostigmine and 0.4 mg glycopyrrolate were administered intravenously to reverse the neuromuscular blockade. The end-tidal CO2 was maintained between 38 and 42 mmHg with manually assisted ventilation under quiet circumstances, without additional stimulation. Awakening was defined as eye opening upon verbal command and was tested every 30 seconds after the discontinuation of desflurane until the appropriate response. Extubation was accomplished after brief endotracheal suction. The time from the discontinuation of desflurane to awakening and the duration of surgery and

Table 1 - Characteristics of patients (N = 42). Characteristics

Mean (SD)

Range

Median

Age, years Weight, kg Height, cm Body mass index, kg m-2 Fentanyl, mcg kg-1 Duration of anesthesia, min Time to eye opening, min

40.8 (9.7) 61.0 (10.1) 161.0 (6.0) 23.5 (3.6) 2.5 (0.8) 127.9 (44.0)

24-57 45-85 148-174 17.6-32.0 1.4-4.6 60-256

41.0 59.5 161.0 23.0 2.4 122

5.2 (1.6)

3-10

5

the blood and delay emergence after a prolonged duration of general anesthesia. In addition, due to the rapid elimination of desflurane, the end-tidal concentration could reflect the arterial blood concentration during well-assisted ventilation and be used to predict awakening during emergence. The primary aim of this study was to examine the arterial blood concentration of desflurane during emergence and the time to awakening after various durations of general anesthesia. The secondary aim was to examine the validity of the noninvasively determined end-tidal concentration of desflurane as a reliable indicator of the arterial blood concentration.

& MATERIALS AND METHODS Patients After obtaining approval of Institutional Review Board (TSGHIRB-097-05-189) and written informed consent, 42 ASA I or II 20- to 60-year-old gynecologic patients scheduled for elective surgery under general anesthesia were included. Patients with severe cardiopulmonary diseases, irritable airways, such as ongoing asthma or acute upper respiratory infection, hepatic diseases (16), neuropapthy, or regular hypnotic or sedative use were excluded.

Anesthetic management and gas monitoring In the operating room, after premedication with 100 mcg intravenous fentanyl and 0.5 ml subcutaneous 2% lidocaine,

Table 2 - The arterial blood, inspiratory, and end-tidal concentrations of desflurane during emergence from general anesthesia in gynecologic patients (N = 42). Time (min) Arterial concentration Inspiratory concentration End-tidal concentration

-20

-10

0

5

Eye Opening

10

15

20

3.91 (0.37) 6.01 (0.14)

3.87 (0.35) 6.01 (0.12)

3.82 (0.45) 5.99 (0.11)

1.17 (0.29) 0.01 (0.04)

1.20 (0.30) 0.08 (0.13)

0.73 (0.16)

0.57 (0.18)

0.48 (0.17)

5.62 (0.19)

5.61 (0.18)

5.62 (0.15)

1.02 (0.31)

0.96 (0.32)

0.54 (0.17)

0.43 (0.14)

0.33 (0.15)

The values are presented as means (SD). The mean time to eye opening was 5.2 (1.6) minutes. 0 min: Immediately prior to the discontinuation of 6% desflurane.

Table 3 - Hemodynamic and ventilatory variables during emergence (N = 42). Time HR MAP CO CI TPR ETCO2

-20

-10

0

5

Eye Opening

10

15

20

71 (14.8) 94.8 (17.1) 5.4 (1.7) 2.7 (1.0) 1576 (446) 39.1 (3.8)

74 (19.9) 97.1 (15.5) 5.9 (1.6) 3.1 (0.9) 1483 (456) 39.8 (2.7)

75 (15.5) 95.5 (16.1) 5.3 (1.3) 2.8 (0.7) 1518 (448) 39.8 (1.8)

110 (21.2) 117.4 (16.2) 6.0 (1.8) 3.1 (1.0) 1803 (633) 41.2 (6.2)

114 (17.7) 119.8 (21.7) 5.8 (1.9) 3.1 (1.1) 1795 (616) 41.3 (6.7)

91 (15.0) 104.2 (16.5) 5.9 (1.5) 3.1 (1.0) 1619 (546) 40.4 (5.7)

82 (14.5) 98.3 (16.3) 5.6 (1.7) 3.0 (0.8) 1668 (547) 40.1 (6.5)

78 (13.5) 102.2 (14.6) 5.4 (1.6) 2.7 (0.8) 1738 (761) 39.9 (6.9)

The values are presented as means (SD). The mean time to eye opening was 5.2 (1.6) minutes. HR, heart rate; MAP, mean arterial blood pressure; CO, cardiac output; CI, cardiac index; TPR, total physical response; ETCO2, end-tidal CO2.

1306


CLINICS 2013;68(10):1305-1311

Desflurane awakening blood concentration Lin TC et al.

Figure 1 - The correlation between the duration of anesthesia and the arterial concentration of desflurane before discontinuation and at awakening. The arterial concentrations immediately prior to discontinuing 6% desflurane (upper) and at awakening (middle) and the awakening end-tidal concentration (lower) were not correlated with the duration of general anesthesia (60-256 minutes).

seconds by commercial software (Datex-Ohmeda S/5 Collect; Datex-Ohmeda, Madison, WI) until 20 minutes after the discontinuation of desflurane.

anesthesia were recorded. Inspiratory concentration, expired concentration, end-tidal CO2, blood pressure, heart rate, and body temperature data were recorded every 30

1307


Desflurane awakening blood concentration Lin TC et al.

CLINICS 2013;68(10):1305-1311

Figure 2 - Bland-Altman plot displaying the difference between the awakening arterial blood and end-tidal concentrations plotted against the average of the two concentrations. The differences were mostly within the ÂĄ1.96 SD range.

Determination of the arterial blood concentration of desflurane during elimination

& RESULTS Demographic data and anesthetics are summarized in Table 1. The mean time from the discontinuation of desflurane to eye opening upon verbal command was 5.2 (1.6) minutes (range 3-10, median 5 minutes). In total, 10 mg Ephedrine was administered to each of four patients to lower blood pressure after induction and before surgical incision. Table 2 lists the arterial blood, inspiratory, and end-tidal concentrations of desflurane before and during emergence. Before the discontinuation of desflurane, the arterial concentration was 3.82 (0.45) %, and the end-tidal concentration was 5.62 (0.15) %. These values decreased to 1.20 (0.30) % and 0.96 (0.32) %, respectively, at awakening. The decrease in the end-tidal concentration was more prominent than the decrease in the arterial concentration in the initial five minutes after discontinuation. The hemodynamic and ventilatory variables during emergence were within 20% of the preoperative baseline, without apparent differences (Table 3). As shown in Figure 1, the arterial concentrations before discontinuing desflurane and at awakening and the awakening end-tidal concentration were not significantly correlated with the duration of general anesthesia, with p = 0.056, 0.197, and 0.177, respectively. Despite a larger scale of variation, the awakening end-tidal concentration (range 0.19-1.99%, with a 95% confidence interval of 0.331.59%) significantly represented the arterial concentration at awakening (range 0.63-1.85%, with a 95% confidence interval of 0.58-1.74%) (p = 0.001). The Bland-Altman plot (Figure 2) displays the difference between the arterial and the end-tidal concentrations at awakening plotted against the average of the two concentrations. The difference ranged from -0.51 to 1.19% and fell into an acceptable range (ÂĄ1.96 SD), regardless of the length

Prior to induction, 10 ml of blood was collected from each patient to determine the blood-gas partition coefficient (l) of desflurane (8). In each blood sample, Desflurane was converted to the corresponding concentration, based on gas chromatographic measurements, and the blood-gas partition coefficient of desflurane (l) was measured.

Gas chromatography conditions The HP 6890 series GC system (Hewlett-Packard, Wilmington, DE) consists of a headspace sampler (Agilent G1888), an oven, a flame ionization detector, and an integrator. The carrier gas (helium) flow was 25.0 ml min-1. Separation was achieved with a capillary column (HP-5; 30.0 m?0.32 mm ID, 0.25 mm film thickness) (Restek, Bellefonte, PA). An integrator and a data acquisition system were provided by HP CHEMOSTATION software. The method used to create a calibration curve for measuring the blood desflurane concentration was modified according to a previous publication (8).

Statistical analysis Means (SD), ranges, and medians (for the time to eye opening) were used to describe the patients’ characteristics. Clinical parameters were presented as mean (SD) over time. Bivariate relationships between variables were analyzed by simple linear regressions and Pearson correlations. Moreover, a Bland-Altman agreement analysis was used to determine the degree of agreement between the awakening arterial blood and end-tidal desflurane concentrations at three times to awakening with the aid of MedCalc version 12.2.1.0 (MedCalc Software, Marikerke, Belgium). A pvalue,0.05 was considered statistically significant.

1308


CLINICS 2013;68(10):1305-1311

Desflurane awakening blood concentration Lin TC et al.

total, 50% of awakening occurred within five minutes, and 90% occurred within seven minutes, which was not prolonged by the duration of anesthesia, ranging from 60256 minutes, and was not correlated with the total fentanyl dose (p = 0.232) or body mass index (BMI) (p = 0.356).

& DISCUSSION This is the first study to quantitatively demonstrate an awakening arterial blood concentration of desflurane of 1.20 (0.30) % in gynecologic surgery patients. Increasing the duration of desflurane anesthesia to a maximum of four hours did not elevate the arterial concentration before the discontinuation of desflurane and did not prolong the awakening time. During well-assisted ventilation, the end-tidal concentration of desflurane represents the higher arterial concentration at awakening and provides a feasible predictor of eye opening after a surgical procedure completed within 60-256 minutes. The total body uptake and elimination of inhaled anesthetics are supposed to be proportional to the duration of general anesthesia (17,18). However, the lower blood-gas and blood-tissue partition coefficients of desflurane theoretically limit total body uptake, facilitating elimination in patients with longer-duration anesthetics and a higher BMI (19,20). Rohm et al. (4) demonstrated that patients undergoing prolonged surgical procedures (.150 min) showed faster recovery and required lower expenditure after a desflurane/ fentanyl regimen than a propofol/remifentanil regimen. Faster recovery following desflurane, compared with isoflurane, may be desirable after long surgical procedures (.5 hours) (6), enabling the patient’s full cooperation and facilitating the early diagnosis of any potential neurological deficit. Nordmann et al. (21) also demonstrated that increasing the duration of inhalation anesthesia is associated with slower emergence and recovery in children, but this effect was less evident with desflurane compared with isoflurane. In this study, the arterial blood concentration of desflurane provided convincing evidence for the above findings. The arterial concentration before the discontinuation of desflurane was not correlated with the duration of anesthesia (60256 min). In addition, the time to awakening mostly ranged between three and seven minutes in 39 of 42 patients and was not proportionally prolonged by the duration of anesthesia, further indicating limited total uptake and rapid alveolar washout during elimination. The rate of uptake of inhaled anesthetics is dependent on the alveolar concentration and ventilation, blood solubility, and cardiac output (22). During the elimination phase, desflurane washout progresses from the brain and body to the alveolar space via the circulating blood, allowing the lungs to ventilate the anesthetic into the air. The end-tidal CO2 may depict the status of the minute ventilation and cardiac output. Hypoventilation delays the alveolar washout of inhaled anesthetics. However, higher blood CO2 levels elevate cardiac output and cerebral blood flow, which reversely accelerate the elimination of desflurane from the brain. Currently, no direct markers are available to adjust the above impact of alveolar washout and cerebral blood flow in clinical practice. Eventually, when the brain or arterial concentration decreases to a certain level, the patient awakens enough to respond to the verbal command for eye opening. By determining arterial blood concentrations, the clinical influence of the minute ventilation and cardiac output on the elimination of inhaled anesthetics can be clarified. In this

Figure 3 - The time to awakening after discontinuation of 6% desflurane was not prolonged by the duration of anesthesia and was not correlated with the total fentanyl dose or body mass index.

of awakening time. The arterial concentration at awakening was systematically higher than the end-tidal concentration, with a median of 0.2%. The possible contributing factors upon awakening are also analyzed in Figure 3. The time to awakening was within 3-10 minutes, with a 95% confidence interval of 2.2-8.3 minutes. In

1309


Desflurane awakening blood concentration Lin TC et al.

CLINICS 2013;68(10):1305-1311

2. Dexter F, Bayman EO, Epstein RH. Statistical modeling of average and variability of time to extubation for meta-analysis comparing desflurane to sevoflurane. Anesth Analg. 2010;110(2):570-80, http://dx.doi.org/10. 1213/ANE.0b013e3181b5dcb7. 3. Agoliati A, Dexter F, Lok J, Masursky D, Sarwar MF, Stuart SB, et al. Meta-analysis of average and variability of time to extubation comparing isoflurane with desflurane or isoflurane with sevoflurane. Anesth Analg. 2010;110(5):1433-9, http://dx.doi.org/10.1213/ANE.0b013e3181d58052. 4. Rohm KD, Piper SN, Suttner S, Schuler S, Boldt J. Early recovery, cognitive function and costs of a desflurane inhalational vs. a total intravenous anaesthesia regimen in long-term surgery. Acta Anaesthesiol Scand. 2006;50(1):14-8, http://dx.doi.org/10.1111/j.13996576.2006.00905.x. 5. De Hert SG, Cromheecke S, ten Broecke PW, Mertens E, De Blier IG, Stockman BA, et al. Effects of propofol, desflurane, and sevoflurane on recovery of myocardial function after coronary surgery in elderly highrisk patients. Anesthesiology. 2003;99(2):314-23, http://dx.doi.org/10. 1097/00000542-200308000-00013. 6. Boisson-Bertrand D, Laxenaire MC, Mertes PM. Recovery after prolonged anaesthesia for acoustic neuroma surgery: desflurane versus isoflurane. Anaesth Intensive Care. 2006;34(3):338-42. 7. Lu CC, Tsai CS, Ho ST, Chueng CM, Wang JJ, Wong CS, et al. Pharmacokinetics of desflurane uptake into the brain and body. Anaesthesia. 2004;59(3):216-21, http://dx.doi.org/10.1111/j.1365-2044. 2003.03654.x. 8. Lu CC, Lin TC, Hsu CH, Yu MH, Chen TL, Chen RM, et al. Hyperventilation accelerates the rise of arterial blood concentrations of desflurane in gynecologic patients. Clinics. 2012;67(9):1029-34, http://dx. doi.org/10.6061/clinics/2012(09)08. 9. Lu CC, Ho ST, Wong CS, Wang JJ, Tsai CS, Hu OY, et al. Pharmacokinetics of isoflurane: uptake in the body. Pharmacology. 2003;69(3):132-7, http://dx.doi.org/10.1159/000072665. 10. Lu CC, Tsai CS, Ho ST, Chen WY, Wong CS, Wang JJ, et al. Pharmacokinetics of sevoflurane uptake into the brain and body. Anaesthesia. 2003;58(10):951-6, http://dx.doi.org/10.1046/j.1365-2044. 2003.03346.x. 11. Lin TC, Lu CC, Li CY, Chang CC, Ho ST. Arterial blood concentration of sevoflurane during single-breath induction and tracheal intubation in gynecologic patients. J Clin Anesth. 2008;20(7):496-500, http://dx.doi. org/10.1016/j.jclinane.2008.05.011. 12. Lin TC, Lu CC, Kuo CK, Hsu CH, Huang GS, Liu JY, et al. Single vitalcapacity and successive tidal-volume breathing of sevoflurane in induction of anesthesia for tracheal intubation in gynecologic patients. Acta Anaesthesiol Taiwan. 2008;46(2):66-70, http://dx.doi.org/10.1016/ S1875-4597(08)60028-4. 13. Lu CC, Tsai CS, Hu OY, Chen RM, Chen TL, Ho ST. Pharmacokinetics of isoflurane in human blood. Pharmacology. 2008;81(4):344-9, http://dx. doi.org/10.1159/000122960. 14. Eger EI, 2nd. Age, minimum alveolar anesthetic concentration, and minimum alveolar anesthetic concentration-awake. Anesth Analg. 2001;93(4):947-53, http://dx.doi.org/10.1097/00000539-200110000-00029. 15. Einarsson SG, Cerne A, Bengtsson A, Stenqvist O, Bengtson JP. Respiration during emergence from anaesthesia with desflurane/N2O vs. desflurane/ air for gynaecological laparoscopy. Acta Anaesthesiol Scand. 1998;42(10):1192-8, http://dx.doi.org/10.1111/j.1399-6576.1998.tb05276.x. 16. Song JG, Cao YF, Yang LQ, Yu WF, Li Q, Song JC, et al. Awakening concentration of desflurane is decreased in patients with obstructive jaundice. Anesthesiology. 2005;102(3):562-5, http://dx.doi.org/10.1097/ 00000542-200503000-00014. 17. Eger EI, 2nd, Shafer SL. Tutorial: context-sensitive decrement times for inhaled anesthetics. Anesth Analg. 2005;101(3):688-96, http://dx.doi. org/10.1213/01.ANE.0000158611.15820.3D. 18. Bailey JM. Context-sensitive half-times and other decrement times of inhaled anesthetics. Anesth Analg. 1997;85(3):681-6. 19. McKay RE, Malhotra A, Cakmakkaya OS, Hall KT, McKay WR, Apfel CC. Effect of increased body mass index and anaesthetic duration on recovery of protective airway reflexes after sevoflurane vs desflurane. Br J Anaesth. 2010;104(2):175-82, http://dx.doi.org/10.1093/bja/aep374. 20. La Colla L, Albertin A, La Colla G, Mangano A. Faster wash-out and recovery for desflurane vs sevoflurane in morbidly obese patients when no premedication is used. Br J Anaesth. 2007;99(3):353-8, http://dx.doi. org/10.1093/bja/aem197. 21. Nordmann GR, Read JA, Sale SM, Stoddart PA, Wolf AR. Emergence and recovery in children after desflurane and isoflurane anaesthesia: effect of anaesthetic duration. Br J Anaesth. 2006;96(6):779-85, http://dx.doi.org/ 10.1093/bja/ael092. 22. Enekvist B, Bodelsson M, Sturesson LW, Johansson A. Larger tidal volume increases sevoflurane uptake in blood: a randomized clinical study. Acta Anaesthesiol Scand. 2010;54(9):1111-6, http://dx.doi.org/10. 1111/j.1399-6576.2010.02291.x. 23. Greif R, Laciny S, Mokhtarani M, Doufas AG, Bakhshandeh M, Dorfer L, et al. Transcutaneous electrical stimulation of an auricular acupuncture point decreases anesthetic requirement. Anesthesiology. 2002;96(2):30612, http://dx.doi.org/10.1097/00000542-200202000-00014.

study, the minute ventilation and cardiac index of all patients were kept steady before extubation, which revealed a correlation between the awakening arterial blood and endtidal desflurane concentrations. The end-tidal concentration of desflurane decreased more prominently during the initial five minutes after discontinuation and became persistently lower than the arterial concentration, indicating rapid alveolar washout. Compared with the simultaneous arterial blood level, the end-tidal concentration of desflurane was identified as a feasible predictor of emergence from general anesthesia. There are certain limitations of the current study. First, the minute ventilation could hardly be controlled by a ventilator after the reversal of spontaneous breathing during emergence. We, therefore, manually assisted the ventilation to maintain the end-tidal CO2 level between 38 and 42 mmHg before extubation. Despite greater fluctuation, the awakening endtidal concentration represented the actual arterial concentration in this study. Second, all of our patients were female. Women are generally reported to have greater sensitivity to pain than men, and healthy young women require 20% more anesthetics than do healthy age-matched men to prevent movement in response to noxious electrical stimulation (23). A higher MAC has been reported for desflurane-6.2% for women compared to 6.0% for men-although the difference is insignificant (24). Additionally, a longer eye-opening time after general anesthesia with desflurane has been reported-6.0 (1.3) minutes in female patients and 4.9 (0.9) minutes in male patients (p,0.001) (25). Further investigation is needed to verify the gender effect on the awakening arterial blood concentration. Third, the patients received up to four hours of anesthesia, and the maximal BMI was close to 32 kg m22. The clinical inferences should be adjusted based on a patient’s outlying factors, such as morbid obesity and a more prolonged duration of anesthesia. In conclusion, we are the first to demonstrate the awakening arterial concentration of desflurane in gynecologic patients. The arterial concentrations before discontinuation and at awakening were not significantly elevated by the increasing duration of desflurane anesthesia (1-4 hours), which was consistent with the rapid awakening time, indicating suitability for a prolonged duration of anesthesia. Using well-assisted ventilation during emergence, the endtidal concentration of desflurane can be a feasible predictor of awakening from general anesthesia.

& ACKNOWLEDGMENTS We gratefully acknowledge Miss YF Roa, who assisted us in using the gas chromatography headspace sampler system for blood desflurane determination. This study was funded by a grant (NSC98-2314-B-016-007-MY3) from the Taiwan National Council of Science. This work was performed at the Tri-Service General Hospital/National Defense Medical Center, Taipei, Taiwan.

& AUTHOR CONTRIBUTIONS Lin TC, Lu CC, and Hsu HC performed this clinical study and drafted the manuscript. Lee MS performed the statistical analysis. Ho ST conceived the study and provided laboratory support to measure the blood desflurane concentration. Wu GJ participated in the study design and coordination. All authors read and approved the final version of the manuscript.

& REFERENCES 1. Jakobsson J. Desflurane: a clinical update of a third-generation inhaled anaesthetic. Acta Anaesthesiol Scand. 2012;56(4):420-32, http://dx.doi. org/10.1111/j.1399-6576.2011.02600.x.

1310


CLINICS 2013;68(10):1305-1311

Desflurane awakening blood concentration Lin TC et al. 25. Tercan E, Kotanoglu MS, Yildiz K, Dogru K, Boyaci A. Comparison of recovery properties of desflurane and sevoflurane according to gender differences. Acta Anaesthesiol Scand. 2005;49(2):243-7, http://dx.doi. org/10.1111/j.1399-6576.2004.00559.x.

24. Wadhwa A, Durrani J, Sengupta P, Doufas AG, Sessler DI. Women have the same desflurane minimum alveolar concentration as men: a prospective study. Anesthesiology. 2003;99(5):1062-5, http://dx.doi. org/10.1097/00000542-200311000-00010.

1311


CLINICAL SCIENCE

Radiofrequency ablation can reverse the structural remodeling caused by frequent premature ventricular contractions originating from the right ventricular outflow tract even in a ‘‘normal heart’’ Yuqiang Fang, Chunlan Wen, Li Yang, Xiaoqun Zhang, Wei Chu, Chunyu Zeng The Third Military Medical University, Chongqing Institute of Cardiology, Daping Hospital, Department of Cardiology, Chongqing, China.

OBJECTIVE: The aim of this study was to evaluate whether frequent premature ventricular contractions originating from the right ventricular outflow tract remodel the cardiac structure and function in patients with a ‘‘seemingly normal heart’’ and whether radiofrequency ablation can reverse this remodeling. METHODS: Sixty-eight patients with idiopathic frequent premature ventricular contractions originating from the right ventricular outflow tract and normal heart structure and function were enrolled in this study. The patients were divided into three groups according to the therapeutic method: radiofrequency ablation group (24 cases), anti-arrhythmia drug group (26 cases), and control group (18 cases without any treatment). Clinical Registration number: ChiCTR-ONRC-12002834 RESULTS: The basic patient characteristics were comparable between the three groups, except for the premature ventricular contraction rate, which was significantly lower in the control group. After six months of follow up, the premature ventricular contraction rate was significantly reduced in the radiofrequency ablation group, which was accompanied by a significant decrease in the following cardiac cavity inner diameters, as determined by echocardiography: right atrium (33.33¡3.78 vs. 30.05¡2.60 mm, p = 0.001), right ventricle (23.24¡2.40 vs. 21.05¡2.16 mm, p = 0.020), and left ventricle (44.76¡4.33 vs. 41.71¡3.44 mm, p = 0.025). These results were similar in the anti-arrhythmia drug group, although this group exhibited a smaller extent of change (right atrium: 33.94¡3.25 vs. 31.27¡3.11 mm, p = 0.024; right ventricle: 22.97¡3.09 vs. 21.64¡2.33 mm, p = 0.049; left ventricle: 45.92¡6.38 vs. 43.84¡5.67 mm, p = 0.039), but not in the control group (p.0.05). There was a tendency toward improvement in the cardiac functions in both the radiofrequency ablation and anti-arrhythmia drug groups. However, these differences were not statistically significant (p.0.05). CONCLUSIONS: These results indicate that radiofrequency ablation can potentially reverse the cardiac remodeling caused by frequent premature ventricular contractions even in structurally normal hearts and that frequent premature ventricular contractions should be abated even in structurally normal hearts. KEYWORDS: Cardiac Remodeling; Radiofrequency Ablation; Idiopathic Frequency Premature Ventricular Contraction; Right Ventricular Outflow Tract. Fang Y, Wen C, Yang L, Zhang X, Chu W, Zeng C. Radiofrequency ablation can reverse the structural remodeling caused by frequent premature ventricular contractions originating from the right ventricular outflow tract even in a ‘‘normal heart’’. Clinics. 2013;68(10):1312-1317. Received for publication on April 1, 2013; First review completed on April 19, 2013; Accepted for publication on May 12, 2013 E-mail: FYQXNK@163.com Tel.: 86 02368757801

dilated cardiomyopathy, and the suppression of it can reverse the changes in cardiac structure and function in these patients (2,3). One of tachycardia, frequent premature ventricular contraction (FPVC), has been generally considered as benign (4), although some recent studies suggest that long-term FPVC may cause progressive ventricular dysfunction and dilatation and may induce dilated cardiomyopathy (tachycardiomyopathy) or even heart failure (48). The suppression of FPVCs with radiofrequency ablation (RFA) can reduce the inner diameter of the cardiac cavity and improve function significantly in these patients (5-9). However, the patients in these studies have abnormal cardiac function or cardiac cavities. Few studies have

& INTRODUCTION Arrhythmia, especially tachycardia, is commonly encountered in patients with cardiovascular disease and even in healthy subjects (1). Persistent tachycardia can induce

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)04

1312


CLINICS 2013;68(10):1312-1317

RFA can reverse cardiac remodel caused by RVOT-FPVCs Fang Y et al.

investigated the effect of FPVCs on the ‘‘seemingly structurally normal heart.’’ In this study, we hypothesized that, in patients with a normal heart, idiopathic FPVCs originating from the right ventricular outflow tract (RVOT) may remodel the cardiac structure and function but that RFA or anti-arrhythmia drugs could potentially reverse this remodeling. To the best of our knowledge, we are the first to report treatment of patients with a normal heart with FPVCs originating from the RVOT.

no more than 1,000 PVCs per day (10), the doses were continued; otherwise, the doses were increased according to the tolerance of the patient or until there were no more than 1,000 PVCs per day (10,11). All patients underwent extensive baseline evaluation to rule out any structural disease. The evaluation included a clinical history concerning the onset of symptoms, 12-lead electrocardiography (ECG), exercise testing, 24-h Holter monitoring, and echocardiography. Moreover, patients with certain diseases and conditions, including rheumatic heart disease, endocrine disease, hyperthyroidism, thyroid dysfunction, arrhythmogenic drug intake, and electrolyte disturbances, were excluded from this study. Antiarrhythmic drugs were discontinued for at least six half-lives before the study. The PVC burden was evaluated by PVC percentage, which was calculated as the number of PVCs divided by the total number of beats in 24 h. Informed consent forms regarding the RFA therapy and potential complications were signed by all patients. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki as reflected in the a priori approval by the institutional human research committee. This study was registered with an internationally accredited site (ChiCTR-ONRC-12002834 - http://www.chictr.org/).

& PATIENTS Eighty-three patients, hospitalized from September 2009 to June 2012, with RVOT-FPVCs were enrolled in this study. The monomorphic FPVC load of these patients was more than 10% of the total heart rate or more than 5% of the total heart rate with ten monomorphic sustained or unsustained ventricular tachycardia events per day (4,6). The study population included patients with or without symptoms. The patients with symptoms, including palpitation and debilitation, went to the hospital with the expectation of alleviating their symptoms. Some of the patients without symptoms wanted to eliminate the PVCs due to their fear of complications, whereas others did not intend to accept drug or RFA therapy. The patients were divided into different groups according to their treatment preference. Fifteen of the patients were excluded due to loss during follow-up; thus, a total of 68 patients (32 males and 36 females) with ages ranging from 21-66 years (mean age 46.2¡14.66 years) were enrolled in this study. These patients were divided into three groups according to the treatment method (Figure 1): the RFA group (n = 24) included patients who underwent successful ablation, the AAD group (n = 26) included patients who initially chose therapy with an antiarrhythmia drug (n = 24) or who initially chose ablation but failed ablation and then chose drug therapy (n = 2), and the control group (n = 18) included those who refused ablation and drug therapy. In the AAD group, the patients received 0.2 g of Cordarone (Sanofi-Aventis, Hangzhou city, Zhejiang province, China) once per day or metoprolol succinate sustained-release tablets (AstraZeneca AB, Wuxi city, Jiangshu province, China) at a dose of 23.75–47.5 mg per day. If these doses were well tolerated and there were

& DEFINITION OF RVOT-PVC AND EVALUATION OF CARDIAC STRUCTURE AND FUNCTION Standard 12-lead surface ECG was performed before and during treatment. A right ventricular outflow tract-PVC was defined as follows: (1) PVC had a left bundle branch block (LBBB) morphology in V1, (2) the R/S transition zones (first precordial lead with R/S ratio $1) in the PVCs were present in V2–V4, and (3) the R/S transition zones of the PVCs in the precordial lead did not occur earlier than the R/S transition zones of the sinusal QRS on the same 12-lead surface ECG. Ventricular tachycardia was defined by standard electrocardiographic criteria of at least five consecutive PVCs at a rate of more than 120 beats/min. Patients with atrial tachyarrhythmia, including atrial fibrillation, flutter, tachycardia and paroxysmal supraventricular tachycardia, were excluded from this study because of the possibility of tachycardia-induced LV dilation. The region of the LV outflow tract origin was excluded from this study.

Figure 1 - Patient enrollment method.

1313


RFA can reverse cardiac remodel caused by RVOT-FPVCs Fang Y et al.

Cardiac structure and function were evaluated by echocardiography at baseline and during follow-up according to the ASE/ESE method (ProSounda10, ALOKA, Japan and IE33, Philips, Japan). Using two-dimensional and M-type Doppler echocardiography, we measured the end diastolic left ventricular internal diameter (normal range: 47¡4 mm), the left atrial internal diameter (normal range: 27–40 mm), the right basic ventricular internal diameter (normal range: 20–28 mm), the right atrial internal diameter (normal range: 29–44 mm), the inner diameter of the aorta (normal range: ,30 mm) and pulmonary artery (normal range: 12–26 mm), the inter-ventricular septal thickness (normal range: 6– 12 mm), and the left ventricular posterior thickness (normal range: 6–12 mm). The cardiac function parameters were also measured, including the left ventricular ejection fraction (LVEF, normal range: 55–80%), left ventricular fractional shortening (LVFS, normal range: 30–45%) and E/A ratio (normal range: .1).

& MAPPING AND CATHETER ABLATION PROCEDURE

CLINICS 2013;68(10):1312-1317

Ltd, China). During the procedure, intravenous heparin was administered as a 100 IU/kg bolus dose followed by additional boluses of 1,000 IU every hour. Procedural success was defined as the lack of recurrence of culprit PVCs within 72 h after the procedure under electrocardiogram monitoring.

& FOLLOW-UP All the patients were followed up every month for the next six months by 24-h Holter monitoring tests and the assessment of cardiac chamber size and function.

& STATISTICAL ANALYSIS Continuous variables are presented as the mean ¡ SD and were compared using Student’s t-test or one-way ANOVA. Echocardiographic measurements before and after treatment were compared with the paired t-test. A p-value ,0.05 was considered statistically significant.

& RESULTS

All procedures were performed after the signing of the informed consent form. The patients were studied in the fasting state without sedation. Antiarrhythmic drugs were discontinued for at least six half-lives before the procedure. Under local anesthesia, a 7-F deflectable quadripolar ablation catheter (Biosense Webster, Diamond Bar, California, USA) with a 4-mm-tip electrode was percutaneously introduced into the right ventricle. Based on the 12surface-lead electrocardiogram with spontaneous RVOTPVC, pace mapping was conducted using bipolar pacing between the distal pair of the electrodes with a stimulation pulse width of two ms. If the culprit PVCs were not found during the procedure, isoproterenol administration and/or programmed electrical stimulation with a digital stimulator (LEAD 7000B, Sichuan Jinjiang Electronic Science and technology Co., Ltd, China) was performed to induce the PVCs as previously described (5). An optimal pace map was defined as a match of all 12 surface leads when comparing the R/S ratio and subtle notching in the QRS complex during pacing. An identical match was necessary in at least 11 of 12 leads. The RFA was performed based on an optimal pace map for 60-90 s with a preset temperature of 50-60 ˚C and a power limit of 50 Watts. A successful ablation was defined as the non-recurrence and non-inducibility of culprit PVCs with or without isoproterenol administration at the rate of 0.2-0.6 mg/min and/or programmed electrical stimulation for at least 30 min after ablation. All 12 surface electrocardiograms and the bipolar intra-cardiac electrograms (filtered at 30-400 Hz) were recorded and stored using a 48-channel acquisition system (LEAD 7000B, Sichuan Jinjiang Electronic Science and technology Co.,

General characteristics of each group The general characteristics of each group are listed in Table 1. In this study, the PVCs had been present for 0.5–10 years (mean 3.09¡2.61 years). The PVC rate was 8978– 36978/24 h, and 6.5–36.51% (mean 19.19¡7.41%) of the total QRS complexes were affected. A total of six patients had transient ventricular tachycardia (VT) (the morphology of the VT was the same as that of the PVC, and the number of VT events was greater 10 or the persistent time of VT was more than 10 s). There were no differences in the age, gender, or history of the patients with PVCs. However, the PVC rate was higher in the RFA (19.19¡7.41%) and AAD (18.89¡5.16%) groups compared with the control group (13.87¡4.19%). Of the 26 patients who received RFA therapy, 24 (92.31%) were successfully ablated. The two unsuccessfully ablated patients were transferred to the AAD group.

Effect of RFA on PVC burden and cardiac cavity diameters At the six-month follow-up, the PVC rate was only 0.05¡0.12% in the RFA group, which was lower than that in the AAD (6.73¡5.09%) and control (13.61¡4.48%) groups. Among the patients with PVCs in the RFA group, 21 had less than 100 PVCs/day, two patients had 100-300 PVCs/ day, and only one patient had 561 PVCs/day. Compared with the control group, the number of PVCs was significantly lower in the AAD group (Table 1). The diameters of the cardiac cavities were normal in all three groups at baseline, and there were no significant

Table 1 - General characteristics of each group.

Age (years) Gender (male:female) PVC history (years) Basic PVC rate PVC rate after treatment *

p,0.05 vs. control group;

#

RFA group (n = 24)

AAD group (n = 26)

Control group (n = 18)

45.2¡14.66 11:13 3.09¡2.61 19.19¡7.41% * (7.5-36.51%) 0.05¡0.12% (0-0.5%)# D

45.2¡14.66 12:14 3.62¡2.07 18.89¡5.16% (8.1-28.33%)* 6.73¡5.09% (2.3-20.5%)#

47.7¡13.15 9:9 3.02¡2.53 13.87¡4.19% (6.5-20.04%) 13.61¡4.48% (7.0-21.3%)

p,0.05 vs. basic PVC rate; D p,0.001 vs. AAD group.

1314


CLINICS 2013;68(10):1312-1317

RFA can reverse cardiac remodel caused by RVOT-FPVCs Fang Y et al.

differences between the cavities, although the diameters of the right and left atrium and right and left ventricle were larger in the RFA and AAD groups compared with the control group. However, some cardiac cavity diameters decreased significantly and were smaller in the RFA group for 6 months follow-up (right atrium: 33.33¡3.78 mm vs. 30.05¡2.60 mm, p = 0.001; right ventricle: 23.24¡2.40 mm vs. 21.05¡2.16 mm, p = 0.020; left ventricle: 44.76¡4.33 mm vs. 41.71¡3.44 mm, p = 0.025). Similar results were obtained in the AAD group for 6 months follow-up (right atrium: 33.94¡3.25 mm vs. 31.27¡3.11 mm p = 0.024; right ventricle: 22.97¡3.09 mm vs. 21.64¡2.33 mm, p = 0.049; and left ventricle: 45.92¡6.38 mm vs. 43.84¡5.67 mm, p = 0.039). There were no significant differences in the control group (p.0.05) (Table 2). After treatment, the diameters of the RA, RV, LA, and LV were significantly smaller in the RFA and AAD groups compared with the control group (Table 2, p,0.05), and the diameters of the RA, LA, and LV were significantly smaller in the RFA group than in the AAD group (Table 2, p,0.05). To examine the changes in the cardiac cavities, we plotted the absolute changes (Figure 2). The results indicated that the greatest amount of RFA change occurred in the right atrium (3.3¡0.4 mm), followed by the right ventricle (2.0¡0.2 mm) and left ventricle (3.0¡0.22 mm), and the least amount of change occurred in the left atrium (1.52¡0.15 mm). There was no obvious change in the inter-ventricular septal thickness, left ventricular posterior thickness, or inner diameter of the aortic root and pulmonary artery. The results were similar in the AAD group, but no significant change was observed in the control group.

& DISCUSSION FPVC is one of the most common types of arrhythmia in patients without structural heart diseases, and it is observed in 1-4% of the general population (12). Although FPVCs can cause palpitations, they are considered relatively benign because of the good prognosis after long-term follow-up (4,13). However, some recent reports undermine this popular belief. Chugh (9) reported that, in a case of dilated cardiomyopathy and FPVC, RFA therapy resulted in the disappearance of the FPVCs, the return of the dilated ventricle to a normal size, and a significant improvement in cardiac function. Kuroki (3) observed that FPVCs increased pulmonary venous flow regurgitation, pulmonary capillary wedge pressure, right atrial pressure, and left ventricular end-diastolic pressure. After ablation, these aberrant parameters were normalized. Yarlagadda (5) observed that the LVEF increased to a normal level six months after successful RFA in 27 patients with monomorphic FPVCs. Bogun (6) found an inverse correlation between the LVEF and PVC rate and that among 22 patients who received successful RFA and a six-month follow-up, the LVEF increased from 0.34 to 0.59 in 18 patients but decreased from 0.34 to 0.25 in four patients. Facchini (14) observed a subclinical but significant increase in left ventricular dimensions in FPVC patients compared with the control group. Because of these findings, the European Heart Association (EHA) now includes tachycardiomyopathy (TCM) caused by FPVC in their 2008 guidelines (15) and considers it as an indication for an RFA procedure (11). The inverse relationship between cardiac function and PVC rate was further confirmed by Beaufort-Krol (13), who performed a long-term follow-up of children with FPVCs and an anatomically normal heart. The results indicated that the PVCs originating from the left ventricle disappeared in most patients, whereas the PVCs originating from the right ventricle lasted to adulthood and had the possibility of further developing into TCM. However, it was previously unknown whether RFA therapy would have an effect on the structurally normal hearts with FPVCs. Thus, in this study, we enrolled patients with a structurally normal heart and FPVCs originating from the RVOT. After RFA or AMM treatment, cardiac cavity size was significantly decreased in diameter, accompanied by a reduction in FPVC rate, which may indicate the reversal of cardiac remodeling. Although no significant difference existed between cardiac function

Effect of RFA on cardiac function The examination of cardiac function indicated no significant difference with regard to the LVFS, LVEF, and E/A ratio between the three groups before or after treatment. There was a tendency toward improved cardiac function in both the RFA group (LVFS: 34.33¡4.87 vs. 36.23¡2.7 p = 0.066; LVEF: 63.71¡4.94 vs. 66.24¡6.20, p = 0.093; E/A ratio: 1.34¡0.20 vs. 1.31¡0.14, p = 0.290) and AAD group (LVFS: 34.42¡5.07 vs. 35.96¡4.96 p = 0.098; LVEF: 64.04¡5.45 vs. 66.13¡6.80, p = 0.133; E/A ratio: 1.36¡0.31 vs. 1.33¡0.35, p = 0.256). However, the differences were not significant (p.0.05; Table 3).

Table 2 - Changes in cardiac cavity diameter in each group. Diameter of Cardiac Cavity

RFA group (n = 24) Pre-RF

RA (mm) RV (mm) LA (mm) LV (mm) IVS (mm) LVPW (mm) AO (mm) PA (mm)

33.33¡3.78 23.24¡2.40 33.45¡4.12 44.76¡4.33 9.67¡1.66 8.22¡1.14 29.72¡2.67 20.62¡1.99

Post-RF

AAD group (n = 26) p-value

*&

30.05¡2.60 21.05¡2.16& 31.95¡3.06*& 41.71¡3.44*& 9.71¡1.31 8.56¡1.28 28.95¡1.83 20.9¡1.76

0.001 0.020 0.092 0.025 0.467 0.201 0.138 0.312

Pre-treat 33.94¡3.25 22.97¡3.09 32.82¡5.04 45.92¡6.38 9.74¡1.46 8.19¡1.35 30.02¡3.37 20.65¡1.78

Post-treat &

31.27¡3.11 21.64¡2.33& 32.17¡4.36& 43.84¡5.67& 9.77¡1.58 8.61¡1.62 29.18¡2.74 20.76¡1.85

Control group (n = 18) p-value

Basic

Follow-up

p-value

0.024 0.049 0.192 0.039 0.454 0.106 0.159 0.251

32.89¡2.73 22.39¡2.89 32.83¡3.76 43.17¡3.56 9.42¡1.18 8.37¡1.13 29.11¡1.99 20.89¡2.21

32.74¡2.49 22.87¡3.08 32.61¡3.64 43.86¡3.03 9.49¡1.13 8.40¡1.14 29.50¡2.22 20.94¡2.07

0.251 0.192 0.272 0.219 0.428 0.472 0.297 0.470

* p,0.05 vs. AAD group; p,0.05 vs. control group; The p-value in this table indicates the significance between pre-treatment and post-treatment. RA: right atrium; RV: right ventricle; LA: left atrium; LV: left ventricle; IVS: interventricular septum; LVPW: left ventricular posterior wall; AO: aortic opening; PO: pulmonary artery.

1315


RFA can reverse cardiac remodel caused by RVOT-FPVCs Fang Y et al.

CLINICS 2013;68(10):1312-1317

Figure 2 - The absolute change in cardiac cavity diameters in each group. The cavity changes are indicated as absolute changes in the RFA group. Positive changes indicate a reduction in the diameters of the cardiac cavities. * p,0.01 vs. control group, p,0.05 vs. AAD group. RA: right atrium; RV: right ventricle; LA: left atrium; LV: left ventricle; IVS: interventricular septum; LVPW: left ventricular posterior wall; AO: aortic opening; PO: pulmonary artery. ‘

Table 3 - Variation of cardiac function in each group. RFA group (n = 24)

Cardiac function

LVFS LVEF E/A ratio

AAD group (n = 26)

Control group (n = 18)

Pre-RF

Post-RF

p-value

Pre-treat

Post-treat

p-value

Basic

Follow-up

p-value

34.33¡4.87 63.71¡4.94 1.34¡0.20

36.23¡2.70 66.24¡6.20 1.31¡0.14

0.066 0.093 0.290

34.42¡5.07 64.04¡5.45 1.36¡0.31

35.96¡4.96 66.13¡6.80 1.33¡0.35

0.098 0.133 0.256

34.61¡3.38 64.83¡4.30 1.36¡0.17

34.13¡3.45 64.17¡4.51 1.30¡0.13

0.408 0.331 0.164

The p-value is a comparison between the pre-treatment and post-treatment or between the baseline values and the follow-up values of cardiac function. LVFS: left ventricular fractional shortening; LVEF: left ventricular ejection fraction.

before and after treatment with RFA, a tendency toward improvement was observed. This result may indicate that FPVCs play a remodeling role in cardiac cavities and function and that RFA may reverse the remodeling even in structurally normal hearts. The fact that no significant difference was observed in cardiac function may be attributed to the small number of patients included in this study. Therefore, multicenter studies with a larger group of patients who receive a long-term followup investigation need to be conducted in the future. Moreover, the absence of randomization is another limitation of this study. Therefore, a randomized, double-blinded, and multicenter study with long-term fellow-up is expected to be performed in the future to confirm the results of this pilot study. In conclusion, in patients with FPVCs originating from the RVOT and with a structurally normal heart, RFA reduces the FPVC rate and the size of the cardiac cavities and has a tendency to improve cardiac function. These results suggest that FPVCs should be reduced by RFA even in structurally normal hearts.

China (30925018, 31130029, 81070259), and National Institutes of Health (R01HL092196).

& AUTHOR CONTRIBUTIONS Fang Y contributed to the mapping and ablation of PVCs and writing the article. Wen C contributed to the treatment of PVCs with antiarrhythmic drugs. Yang L contributed to the cardiac evaluation by echocardiography. Zhang X contributed to the data collection. Chu W contributed to Holter evaluation of PVCs. Zeng C contributed to the design of the project.

& REFERENCES 1. Nagashima M, Matsushima M, Ogawa A, Ohsuga A, Kaneko T, Yazaki T, et al. Cardiac arrhythmias in healthy children revealed by 24-hour ambulatory ECG monitoring. Pediatr Cardiol. 1987;8(2):103-8, http://dx. doi.org/10.1007/BF02079464. 2. Omichi C, Tanaka T, Kakizawa Y, Yamada A, Ishii Y, Nagashima H, et al. Improvement of cardiac function and neurological remodeling in a patient with tachycardia induced cardiomyopathy after catheter ablation. J Cardiol. 2009;54(1):134-8. 3. Kuroki K, Tada H, Seo Y, Ishizu T, Igawa M, Yamasaki H, et al. Prediction and mechanism of frequent ventricular premature contractions related to haemodynamic deterioration. European Journal of Heart Failure. 2012;14(10):1112-20, http://dx.doi.org/10.1093/eurjhf/hfs095. 4. Gaita F, Giustetto C, Di Donna P, Richiardi E, Libero L, Brusin MC, et al. Long-term follow-up of right ventricular monomorphic extrasystoles. J Am Coll Cardiol. 2001;38(2):364-70, http://dx.doi.org/10.1016/S07351097(01)01403-6. 5. Yarlagadda RK, Iwai S, Stein KM, Markowitz SM, Shah BK, Cheung JW, et al. Reversal of cardiomyopathy in patients with repetitive monomorphic ventricular ectopy originating from the right ventricular

& ACKNOWLEDGMENTS This study was supported in part by grants from the National Basic Research Program of China (973 Program, 2008CB517308, 2012CB517801), Natural Science Foundation Project of CQ (CSTC, 2009BA5044, 2009BB5332), National Natural Science Foundation of

1316


CLINICS 2013;68(10):1312-1317

6.

7.

8.

9.

10.

RFA can reverse cardiac remodel caused by RVOT-FPVCs Fang Y et al. 11. Aliot EM, Stevenson WG, Almendral-Garrote JM, Bogun F, Calkins CH, Delacretaz E, et al. European Heart Rhythm Association (EHRA); Registered Branch of the European Society of Cardiology (ESC); Heart Rhythm Society (HRS); American College of Cardiology (ACC); American Heart Association (AHA). EHRA/HRS consensus on catheter ablation of ventricular arrhythmias. Heart Rhythm. 2009;6(6):886-933, http://dx.doi.org/10.1016/j.hrthm.2009.04.030. 12. Kostis JB, McCrone K, Moreyra AE, Gotzoyannis S, Aglitz NM, Natarajan N, et al. Premature ventricular complexes in the absence of identifiable heart disease. Circulation. 1981;63(6):1351-6, http://dx.doi. org/10.1161/01.CIR.63.6.1351. 13. Beaufort-Krol GC, Dijkstra SS, Bink-Boelkens MT. Natural history of ventricular premature contractions in children with a structurally normal heart: does origin matter? Europace. 2008;10(8):998-1003, http://dx.doi. org/10.1093/europace/eun121. 14. Facchini M, Malfatto G, Ciambellotti F, Chianca R, Bragato R, Branzi G, et al. Increased left ventricular dimensions in patients with frequent nonsustained ventricular arrhythmia and no evidence of underlying heart disease. J Cardiovasc Electrophysiol. 1999;10(11):1433-8, http://dx. doi.org/10.1111/j.1540-8167.1999.tb00202.x. 15. Elliott P, Andersson B, Arbustini E, Bilinska Z, Cecchi F, Charron P, et al. Classification of the cardiomyopathies: a position statement from the European Society of Cardiology Working Group on Myocardial and Pericardial Diseases. Eur Heart J. 2008;29(2):270-6.

outflow tract. Circulation. 2005;112(8):1092-7, http://dx.doi.org/10. 1161/CIRCULATIONAHA.105.546432. Bogun F, Crawford T, Reich S, Koelling TM, Armstrong W, Good E, et al. Radiofrequency ablation of frequent, idiopathic premature ventricular complexes: comparison with a control group without intervention. Heart Rhythm. 2007;4(7):863-7, http://dx.doi.org/10. 1016/j.hrthm.2007.03.003. Taieb JM, Maury P, Shah D, Duparc A, Galinier M, Delay M, et al. Reversal of dilated cardiomyopathy by the elimination of frequent left or right premature ventricular contractions. J Interv Card Electrophysiol. 2007;20(1-2):9-13, http://dx.doi.org/10.1007/s10840-007-9157-2. Sternick EB, Correa F, Negri R, Scarpelli RB, Gerken LM. Reversible cardiomyopathy provoked by focal ventricular arrhythmia orginating from the base of the posterior papillary muscle. J Interv Card Electrophysiol. 2009;25(1):67-72, http://dx.doi.org/10.1007/s10840-008-9341-z. Chugh SS, Shen WK, Luria DM, Smith HC. First evidence of premature ventricular complex induced cardiomyopathy: a potentially reversible cause of heart failure. J Cardiovasc Electrophysiol. 2000;11(3):328-9, http://dx.doi.org/10.1111/j.1540-8167.2000.tb01802.x. Sekiguchi Y, Aonuma K, Yamauchi Y, Obayashi T, Niwa A, Hachiya H, et al. Chronic hemodynamic effects after radiofrequency catheter ablation of frequent monomorphic ventricular premature beats. J Cardiovasc Electrophysiol. 2005;16(10):1057-63, http://dx.doi.org/10. 1111/j.1540-8167.2005.40786.x.

1317


CLINICAL SCIENCE

Ocular surface evaluation in patients treated with a fixed combination of prostaglandin analogues with 0.5% timolol maleate topical monotherapy: a randomized clinical trial Heloisa Helena Russ,I,II Pedro Antoˆnio Nogueira-Filho,II,III Jeison de Nadai Barros,III Nubia Vanessa Lima de Faria,III Fabiano Montiani-Ferreira,IV Jose´ A´lvaro Pereira Gomes,II,III Paulo Augusto Arruda MelloV I

Graefe Institute of Ophthalmology, Glaucoma Department, Curitiba/PR, Brazil. II Federal University of Sa˜o Paulo, CASO-Ocular Surface Advanced Center, Sa˜o Paulo/SP, Brazil. III Brası´lia Base Hospital, Glaucoma Department, Brasilia/DF, Brazil. IV Federal University of Parana´, Veterinary Department, Curitiba/ PR, Brazil. V Federal University of Sa˜o Paulo, Ophthalmology, Sa˜o Paulo/SP, Brazil.

OBJECTIVES: To compare ocular surface changes induced via glaucoma treatment in patients using fixed combinations of prostaglandin analogues (travoprost, latanoprost and bimatoprost) with 0.5% timolol maleate. METHODS: A prospective, multicenter, randomized, parallel group, single-blind clinical trial was performed in 33 patients with ocular hypertension or open angle glaucoma who had not been previously treated. The ocular surface was evaluated prior to and three months after treatment, with a daily drop instillation of one of the three medications. The main outcome measurements included the tear film break-up time, Schirmer’s test, Lissamine green staining, the Ocular Surface Disease Index questionnaire, impression cytology using HE and PAS and immunocytochemistry for interleukin-6 and HLA-DR. Ensaiosclinicos.gov.br: UTN - U1111-1129-2872 RESULTS: All of the drugs induced a significant reduction in intraocular pressure. Decreases in the Schirmer’s test results were observed with all of the drugs. Decreases in tear-film break-up time were noted with travoprost/ timolol and latanoprost/timolol. An increase in the Lissamine green score was noted with travoprost/timolol and bimatoprost/timolol. The Ocular Surface Disease Index score increased after treatment in the travoprost/timolol group. Impression cytology revealed a significant difference in cell-to-cell contact in the same group, an increase in cellularity in all of the groups and an increase in the number of goblet cells in all of the groups. The fixed combinations induced an increase in IL-6 expression in the travoprost/timolol group, in which there was also an increase in HLA-DR expression. CONCLUSIONS: All of the fixed combinations induced a significant reduction in intraocular pressure, and the travoprost/timolol group showed increased expression of the inflammatory markers HLA-DR and interleukin-6. All three tested medications resulted in some degree of deterioration in the ocular surface after three months of glaucoma treatment. KEYWORDS: Glaucoma; Conjunctiva; Immunohistochemistry; Inflammation; Treatment. Russ HH, Nogueira-Filho PA, Barros JN, Faria NV, Montiani-Ferreira F, Gomes JA, et al. Ocular surface evaluation in patients treated with a fixed combination of prostaglandin analogues with 0.5% timolol maleate topical monotherapy: a randomized clinical trial. Clinics. 2013;68(10):13181324. Received for publication on April 3, 2013; First review completed on April 8, 2013; Accepted for publication on May 13, 2013 E-mail: heloisaruss@onda.com.br Tel.: 55 41 3015-6222

hypotensive medications (1). Several classes of drugs are currently available to treat this condition, including prostaglandin (PG) analogues as well as fixed combinations (FCs) of prostaglandin/prostamide analogues combined with 0.5% timolol maleate (2). Beta-blockers are often used to treat glaucoma and were considered the ‘‘gold standard’’ for starting glaucoma treatment until recently, when they were replaced by prostaglandin analogues (2). Beta-blockers have many systemic side effects, especially bradycardia and bronchospasms, as well as effects on the central nervous system.

& INTRODUCTION Glaucoma is a chronic, multifactorial, progressive optic neuropathy that requires long-term treatment with topical

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)05

1318


CLINICS 2013;68(10):1318-1324

A cytopathological and immunohistochemistry study Russ HH et al.

administration of a topical beta-blocker; sinus bradycardia, second-degree or third-degree atrioventricular block, sinoatrial block, overt cardiac failure, or cardiogenic shock that would preclude the safe administration of a topical betablocker; or a severe medical or psychiatric condition were also excluded from the study. A prospective, randomized, single-blind, multicenter, parallel group, interventional study was conducted between March 2009 and September 2010 at the Federal University of Sa˜o Paulo (UNIFESP) in Sa˜o Paulo, Brazil. The participants were allocated to each treatment group following the sequence of a randomization table. The randomization table was generated using software (Stata, version 11, College Station, Texas, USA) and a block size of three. The participants were enrolled and assigned to each group by the study coordinator. After the sample size was calculated, 33 patients were selected (11 patients were randomly distributed into three different groups according to medication regimen) by two examiners (HR and NL) and were allocated using permuted-block randomization (block size = 3; allocation rate 1:1:1) into the following three groups, independently of age, sex or residence: latanoprost+timolol (LT); bimatoprost+timolol (BT); or travoprost+timolol (TT) (Figure 1). The medications were administered once daily in the evening for 12 weeks in selected patients in all of the groups. The clinical data collected included the patients’ demographic data (age, sex and ethnicity). All of the patients underwent routine ophthalmological examinations prior to and after three months of treatment. The ocular surface evaluation included biomicroscopic examination of the lids, conjunctiva, cornea and tear film. The diagnostic tests included Schirmer’s test with anesthesia, Lissamine green vital staining, tear film break-up time (TBUT) and impression cytology. The OSDI questionnaire was also applied. After the ocular surface evaluation, intraocular pressure (IOP) was measured with the Goldmann applanation tonometer. The patients were examined at two centers (Graefe Institute of Ophthalmology and Brasilia Base Hospital), following instructions provided by the Cornea and External Disease Service in the Department of Ophthalmology, UNIFESP. All of the IOP measurements were obtained at the same time (8 a.m.). The rooms where the examinations were performed had neither air conditioning nor windows, and the air humidity and temperature were controlled with specific equipment. Prior to the examination, the patients rested for 20 minutes with the door to the room closed. The tests were performed by two researchers (HR and NL) and were analyzed at the Ocular Surface Advanced Center (CASO) by two blinded investigators (JB and PANF). Those investigators who assessed the primary outcomes of the study were blinded to the allocation status of the participants. The statistician who performed the data analysis was blinded to all information. Dry eye was defined as a TBUT score of ,5 seconds (2% fluorescein, Ophthalmos, Sa˜o Paulo, SP, Brazil), ,5 mm wetting in the Schirmer’s test (Schirmer strips, Ophthalmos, Sa˜o Paulo, SP, Brazil) with topical anesthesia (0.5% proxymetacaine chlorohydrate, AnestalconH, Alcon Laborato´rios do Brasil, Sa˜o Paulo, SP, Brazil) and corneal and conjunctival

While the systemic side effects induced by topical PG analogues are rare, iris hyperpigmentation, excessive eyelash growth and conjunctival hyperemia have been reported among the local side effects caused by these drugs (3-5). Conditions suggestive of the stimulation or reactivation of ocular inflammatory responses, such as anterior uveitis or cystoid macular edema, have also been associated with the use of PG analogues (6). Ocular surface dysfunction has also been related to glaucoma treatment. Beta-blockers have been known to induce conjunctival hyperemia, punctate keratitis and corneal anesthesia, as well as dry eye and allergic blepharoconjunctivitis (7-9). Previous studies with patients who received long-term treatment with topical medications showed that both hypotensive drugs and their preservatives (especially benzalkonium chloride – BAK) could increase the number of inflammatory cells and fibroblasts in the substantia propria of the conjunctiva and reduce the number of goblet cells, thereby inducing ocular surface changes manifested clinically as dry eye (8-11). The length of administration, concentration and amount of these drugs have been related to the severity of the side effects. In addition, there has been strong evidence suggesting that these changes might increase the risk of trabeculectomy failure (12,13). However, most of the information on this subject was published prior to the introduction of PG analogues. The purpose of this study was to evaluate (clinically, histologically and via immunocytochemistry) the ocular surface changes induced by glaucoma treatment with topical FCs of PG analogues and timolol.

& MATERIALS AND METHODS Inclusion criteria Eligible patients were adults ($18 years of age) with a clinical diagnosis of primary open-angle glaucoma (POAG) or ocular hypertension (OH) in at least one eye and with no previous topical hypotensive treatment. The selected patients had a open iridocorneal angle upon gonioscopy examination. POAG was diagnosed on the basis of characteristic optic disc changes and/or glaucomatous visual field loss demonstrated on the Humphrey visual field analyzer (HFA) (Humphrey Instruments, Inc., Zeiss Humphrey, San Leandro, California, USA). IOP, measured at 8 a.m., had to be between 26 mm Hg and 35 mm Hg in the study eye(s). In addition, patients were required to have a corrected distance visual acuity (CDVA) of 20/70 or better in each eye, and those with glaucoma had to have a recent (within three months) visual field examination showing a mean deviation greater than -15 dB and no fixation threat. Finally, the eligible patients were required to be able to follow instructions, to be willing and able to attend all of the study visits, and to provide informed consent prior to screening.

Exclusion criteria Patients were excluded if they met any of the following criteria: previous ocular surgery; active ocular inflammation; or clinically diagnosed dry eye. Patients with hypersensitivity or poor tolerance to any components of the study medication; with bronchial asthma or history of bronchial asthma; with bronchial hyperreactivity or severe chronic obstructive pulmonary disease that would preclude the safe

1319


A cytopathological and immunohistochemistry study Russ HH et al.

CLINICS 2013;68(10):1318-1324

Figure 1 - Flow diagram of the progress through the phases of this parallel, randomized trial of three groups.

staining with 1% Lissamine green (Ophthalmos, SaËœo Paulo, SP, Brazil) $3 on the van Bijsterveld scale (0 to 9).

total score 0-3), B (borderline; total score 4-6) or C (abnormal; total score .6). The goblet cell densities were considered normal when the cells were abundant, borderline when there was a slightly or moderately reduced number of cells and abnormal when there was a distinct reduction in the number of cells (the presence of one or no goblet cells).

Impression cytology After the ocular surface evaluation, all of the patients were subjected to impression cytology (IC) sampling by two researchers (HR and NL). Following topical anesthesia, IC specimens were collected (HAWP 304, Millipore, Bedford, Massachusetts, USA) from an exposed area of the bulbar conjunctiva (temporal region) and an unexposed area of the conjunctiva (superior region) adjacent to the corneal limbus. All of the strips were processed for periodic acid Schiff and Gill’s hematoxylin staining. Glass slides mounted with Entellan (Merck, Darmstadt, Germany) were examined with a blinded procedure under light microscopy by an experienced professional (JNB). For quality control, only IC specimens were included with at least one third of the filter surface covered by visible epithelial cells. The conjunctiva samples were evaluated according to established techniques for the following parameters: cellularity; cell-to-cell contact; nuclear-to-cytoplasmic (N/C) ratio; nuclear chromatin; goblet cell density; keratinization; and distribution of inflammatory cells. A score of 0 to 3 was assigned to each of these features: 0 - normal findings; 1 borderline features; and 2 and 3 - abnormal features (29,30). The total score for each sample was classified as A (normal;

Immunocytochemistry Other conjunctival impression cytology samples were obtained from the same areas as the first samples, using Biopore membranes (Millicell-CM 0.4 mm PICM 012550, Millipore Corp, Bedford, Massachusetts, USA), and were immunostained with monoclonal antibodies to HLA-DR and IL-6. The samples with cells covering more than 80% of the membrane area or samples covering between 40% and 80% (where the cells were confluent and present in a discrete area) were considered suitable for immunocytological analysis. Samples with cellularity of less than 40% were considered unsuitable. The number of cells positive for HLA-DR and IL-6 and the total number of cells in five adjacent microscopic high-power fields (40X) were counted by the two masked observers (JNB and PANF). The results for each phenotype were expressed as a percentage of the total number of cells and were compared pre- and posttreatment.

1320


CLINICS 2013;68(10):1318-1324

A cytopathological and immunohistochemistry study Russ HH et al.

The ocular surface evaluations revealed a significant decrease in the Schirmer’s test values for the patients treated with all of the drugs: the mean value for the TT group was 8.95¡0.21 mm (95% CI 8.53-9.37) prior to treatment and 7.18¡0.73 mm (95% CI 5.72-8.64) after treatment (p = 0.0001); the corresponding figures for the LT group were 13.77¡4.72 mm (95% CI 4.33-23.21) and 9.09¡3.65 mm (95% CI 1.79-16.39) (p = 0.0007), respectively, and they were 12.45¡3.85 mm (95% CI 4.75-20.15) and 9.95¡3.68 mm (95% CI 2.59-17.31) (p = 0.0333), respectively, for the BT group. The TBUT decreased significantly in the TT and LT groups. The mean values for the former were 11.95¡1.49 seconds (95% CI 8.97-14.93) prior to treatment and 9.54¡0.85 seconds (95% CI 7.84-11.24) after treatment (p,0.0001), and for the latter, the values were 13.86¡3.18 seconds (95% CI 7.5-20.22) and 11.68¡3.38 seconds (95% CI 4.92-18.44), respectively (p = 0.0025). For the BT group, the difference was not statistically significant (p = 0.45). Scores for Lissamine green staining increased significantly in patients treated with TT (mean score of 2.36¡0.65 [95% CI 1.06-3.66] prior to treatment and 6¡0.01 [95% CI 5.98-6.02] after treatment [p,0.0001]) and with BT (mean score of 2¡1.48 [95% CI 0.94-4.96] prior to treatment and 3.27¡1.45 [95% CI 0.37-6.17] after treatment [p = 0.0007]). For the LT group, this difference was not statistically significant (p = 0.22). The OSDI scores increased in all of the groups, but the difference was only significantly different in the TT group (mean score 33.74¡6.88 [95% CI 19.98-47.5] prior to treatment and 39.94¡3.92 [95% CI 32.1-47.78] after treatment [p = 0.02]). All of the groups could be classified as having mild to moderate dry eye on the OSDI scale. Table 2 summarizes the clinical ocular surface data for the three groups.

Statistical analysis The sample size calculation was based on a pilot study performed at one of the study sites. Two principal outcomes, the Schirmer’s test and impression cytology, were selected for this purpose. To detect a difference of 3 mm (SD 2 mm) with the Schirmer’s test at two points in time (preand post-treatment), a sample size of 10 was necessary to obtain a power of 80% at the 5% significance level. This sample size (N = 10) would provide a power of 94% to detect a difference of 0.4 cells (SD 0.2 cells) in the mean number of cells in the impression cytology test. Therefore, a sample size of 11 per treatment group was used in this study. The Kolmogorov-Smirnov (K-S) test was used to determine whether the continuous variables had a normal distribution. One-way ANOVA with a significance level of 5% was used to compare the continuous variables, and the Kruskal-Wallis test was used to compare the continuous variables with a non-Gaussian distribution. When statistically significant differences were found, the data were further analyzed using post hoc comparisons with Fisher’s exact test (for comparisons of up to three groups) or the Tukey-Kramer test (comparisons of more than three groups) for p-value correction. The calculations were performed with StatView statistical software (SAS Institute Inc., Cary, North Carolina, USA). The level of statistical significance was set at p = 0.05.

Ethics The study was approved by the UNIFESP Medical Ethics Committee (reference no. 0954/06) and was registered with an internationally accredited site (UTN U1111-1129-2872; RBR-7mmp6k- www.ensaiosclinicos.gov.br) in accordance with the guidelines set forth in the Declaration of Helsinki. All of the patients provided informed consent. The research was funded by the Federal University of Sa˜o Paulo/ FAPESP.

Impression cytology Although the total score (histological classification) was worse for all of the groups after treatment, this change was not statistically significant. However, when specific IC parameters were considered, an increase in cellularity could be observed in all of the groups: TT - 0.04¡0.30 cells (95% CI -0.56-0.64) prior to treatment and 0.386¡0.58 cells (95% CI -0.774-1.546) after treatment (p = 0.0008); BT - 0.27¡0.66 (95% CI -1.05-1.59) and 0.70¡0.82 cells (95% CI -0.94-2.34) prior to and after treatment, respectively (p = 0.008); and LT 0.182¡0.54 (95% CI -1.498-1.862) and 0.545¡0.85 cells (95% CI -1.155-2.245) prior to and after treatment, respectively (p = 0.0022). The TT group had 0.29¡0.63 goblet cells (95% CI -0.971.55) prior to treatment and 0.86¡0.93 cells (95% CI -1.02.72) after treatment (p = 0.012). For the BT group, the

& RESULTS The results of the statistical analysis were unaffected by the demographic data (age, sex and ethnicity) (Table 1). All three combinations (LT, BT and TT) produced a statistically significant reduction in IOP (p = 0.0001). The mean IOP for the TT group was 24.72¡1.03 mm Hg (95% CI 22.6626.78) prior to treatment and 14.00¡0.44 mm Hg (95% CI 13.12-14.88 mm Hg) after treatment; the corresponding figures for the BT group were 22.32¡5.58 mm Hg (95% CI 11.1633.48) and 12.10¡2.96 mm Hg (95% CI 6.18-18.02), respectively, and for the LT group, they were 20.32¡4.99 mm Hg (95% CI 10.34-30.3) and 11.59¡3.11 mm Hg, respectively (95% CI 5.37-17.81). Table 1 - Demographic data: age, sex and ethnicity.

Age (mean¡sd) Ethnicity White caucasian African american Hispanic Asian Sex (male:female)

TT group

BT group

LT group

p-value

61.9¡6.91

60.5¡4.61

63.65¡5.12

p.0.05

3 1 7 0 (4:7)

4 1 5 1 (5:6)

3 1 6 1 (6:5)

p.0.05 p.0.05 p.0.05 p.0.05 p.0.05

* There were significant differences between African American and Asian patients, compared with Caucasians and Hispanics, but not between the African American and Asian groups or between the Caucasian and Hispanic groups, respectively.

1321


A cytopathological and immunohistochemistry study Russ HH et al.

CLINICS 2013;68(10):1318-1324

Table 2 - Clinical data prior to and three months after treatment with a fixed combination of travoprost 0.004%/timolol 0.5%, bimatoprost 0.03%/timolol 0.5% or latanoprost 0.005%/timolol 0.5% in naı¨ve patients; n = 33. Travatan/Timolol pre-treatment post-treatment (mean¡SD) (mean¡SD) Schirmer TBUT LGT OSDI HLA-DR IL-6 IOP

8.95¡0.21 11.95¡1.49 2.36¡0.65 33.74¡6.88 39.50¡70.56 54.48¡91.70 24.72¡1.03

7.18¡0.73 9.54¡0.85 6.00 39.94¡3.92 88.77¡116.28 150.52¡171.31 14.00¡0.44

Bimatoprost/Timolol

Latanoprost/Timolol

p-value

pre-treatment (mean¡SD)

post-treatment (mean¡SD)

p-value

pre-treatment (mean¡SD)

post-treatment (mean¡SD)

p-value

0.00 0.00 ,0.001 0.02 0.02 0.00 0.00

12.45¡3.85 11.90¡3.22 2.00¡1.48 29.76¡15.93 126.86¡149.20 93.97¡124.17 22.32¡5.58

9.95¡3.68 11.18¡3.21 3.27¡1.45 30.30¡17.17 95.79¡108.01 120.59¡130.13 12.10¡2.96

0.03 0.45 0.00 0.94 0.26 0.33 0.00

13.77¡4.72 13.86¡3.18 0.86¡1.12 8.06¡7.10 176.79¡185.95 171.75¡126.28 20.32¡4.99

9.09¡3.65 11.68¡3.38 1.41¡1.71 11.16¡11.59 172.95¡167.09 198.16¡128.65 11.59¡3.11

0.00 0.00 0.22 0.47 0.92 0.33 0.00

trabeculectomy, as a result of postoperative fibrosis (9,12,13). In the present study, we observed that all three drugs induced a subclinical inflammatory reaction. This reaction was only detected via immunocytochemistry, which revealed cells positive for inflammatory markers, such as IL-6 and HLA-DR. No increase in inflammatory cells was detected via IC. Subclinical inflammation associated with the use of latanoprost has been reported by other authors who, using histopathology and immunohistochemical markers (HLADR, IL-6 and IL-8), have described a strong correlation between dry eye and inflammatory cells in the conjunctival epithelium and substantia propria (15,17,18). Immunocytochemistry after three months of treatment did not reveal any changes in total score. However, we observed changes in other related parameters, such as cellularity, number of goblet cells and cell-to-cell contact. The increase in cellularity without an inflammatory reaction was likely related to reactive hyperplasia of the conjunctival epithelial cells in response to the toxic effects of the drugs. Authors such as Guenoun et al. have correlated the increase in goblet cells induced by PG analogues with a possible protective effect against BAK-induced toxicity to the ocular surface (19). In a previous study, we also observed an increase in the number of goblet cells in groups treated with PG analogues (latanoprost, travoprost and bimatoprost), but this increase was not sustained over six months (15,18,20). This effect has been controversial; hyperplasia in goblet cells seems to represent a protective mechanism in the initial phase of chronic aggression to the ocular surface, as observed in allergies or responses to pollution, but it is followed by a decrease in the number of these cells if the aggressive factor becomes chronic (21,22). Changes in cell-to-cell contact result in a loss of ‘‘gap junctions’’ and in edema, which are reflected in the epithelial architecture and which lead to keratopathy. These pathological changes in the ocular surface could partly explain the occurrence of dry eye symptoms in patients using hypotensive drugs. Herrera et al. reported that prolonged use (longer than six months) of 0.5% timolol maleate might lead to a higher incidence of dry eye, with lower TBUT values and Schirmer’s test scores (7). Several reports have also demonstrated that timolol could cause a decrease in the number of goblet cells and keratoconjunctivitis sicca (7,8,13). Reductions in TBUT values and Schirmer’s test scores have been described in many studies investigating the effects of the length of glaucoma treatment, the number of medications used and preservative concentrations (16,23,24).

corresponding figures were 0.57¡0.873 (95% CI -1.1762.316) and 0.93¡0.873 (95% CI -0.816-2.676) (p = 0.054) and 0.182¡0.54 (95% CI -0.898-1.262) and 0.545¡0.85 (95% CI 1.155-2.245) (p = 0.0186) for the LT group, respectively. The mean cell-to-cell contact was 0.136¡0.40 (95% CI 0.664-0.936) in the TT group prior to treatment and 0.59¡0.73 (95% CI -0.87-2.05) after treatment (p = 0.0005). For the BT group, the mean values were 0.27¡0.54 (95% CI 0.81-1.35) and 0.41¡0.58 (95% CI -0.75-1.57) prior to and after treatment (p = 0.26), respectively, and for the LT group, the corresponding values were 0.16¡0.43 (95% CI -0.7-1.02) and 0.38¡0.66 (95% CI -0.94-1.7), respectively (p = 0.07). There were no changes in inflammatory cells, keratinization or N/C ratio (Table 3).

Immunocytochemistry While TT induced a statistically significant increase in HLA-DR expression (the mean count of cells positive for HLA-DR in the TT group was 39.5¡70.56 [95% CI -101.62180.62] prior to treatment and 88.77¡116.28 [95% CI -143.79321.33] after treatment (p = 0.0184) [Figure 2]), BT and LT showed a decrease in HLA-DR expression that was not statistically significant for either group (BT, p = 0.26; LT, p = 0.92). Similarly, TT induced a significant increase in IL-6positive cells (Figure 3): the mean count was 58.48¡91.70 (95% CI -124.92-241.88) prior to treatment and 150.52¡ 171.31 (95% CI -192.1-493.14) after treatment (p = 0.0023). BT and LT also showed an increase in HLA-DR expression, but this increase was not statistically significant for either group (BT, p = 0.33; LT, p = 0.33).

& DISCUSSION All three medications produced a statistically significant reduction in IOP, with no difference among them. Our results were similar to those described by Centofanti et al. regarding fixed combinations (14). Impaired tear film production associated with glaucoma treatment has been described in many articles (8,10). Strong evidence provided by previous clinical and experimental studies has indicated that the chronic use of antiglaucoma drugs might induce ocular surface changes, causing discomfort at instillation, conjunctival inflammation, tear film instability, subconjunctival fibrosis, apoptosis of conjunctival epithelial cells and corneal surface changes (15-17). These changes could result in a greater risk of failure when patients undergo antiglaucoma surgery, particularly

1322


CLINICS 2013;68(10):1318-1324

A cytopathological and immunohistochemistry study Russ HH et al.

Table 3 - Impression cytology scores. Several parameters were analyzed, but significant differences after three months of treatment were only found in: (a) cell-to-cell contact in the TT group; (b) cellularity in all of the groups; and (c) number of goblet cells in the TT and LT groups. NC: not counted. Travoprost+Timolol

Keratinization Cell-to-cell Contact Inflammatory cells Cellularity (b) Goblet cells (C) N/C ratio

(a)

Pre

Post

NC 0.136 NC 0.045 0.295 NC

NC 0.591 NC 0.386 0.864 NC

Bimatoprost+Timolol p-value

0.0005 0.0008 0.0012

Pre

Post

NC 0.273 NC 0.273 0.568 NC

NC 0.409 NC 0.705 0.932 NC

In the present study, conjunctival function and tear film stability were worse after treatment, indicating deterioration of the ocular surface. More recently, some authors have used the OSDI (Ocular Surface Disease Index) questionnaire, a useful tool for analyzing symptoms of dry eye, to measure symptoms in glaucoma patients; the lower the OSDI score is, the less toxic the medication is (24,26). In our study, OSDI scores also showed an increase, with most patients having mild or moderate dry eye, confirming the involvement of the lacrimal functional unit and the ocular surface. Preservative-free medications have been associated with lower scores, and improvements in scores have been reported for patients who switched to this type of medication (25,26). One of the limitations in our study was related to ethnicity. The numbers of Asian and African American individuals distributed among the groups were considerably fewer than those of Caucasian and Hispanic individuals; this could have been a source of bias. Additionally, it should be noted that, in our study, a large variation was observed in patients treated with travoprost+timolol. Although the results were considered ‘‘normal,’’ this regimen group began with somewhat worse ocular surface conditions, compared with the other groups. There was a trend that was not statistically significant toward a poorer ocular surface, irrespective of sex or age, at the beginning of the study. This finding occurred by chance and was likely related to the randomization method

Latanoprost+Timolol p-value

0.26 0.008 0.0541

Pre

Post

NC 0.159 NC 0.114 0.182 NC

NC 0.381 NC 0.545 0.545 NC

p-value

0.067 0.0022 0.0186

(permuted-block) used to ensure sample balance, but it could lead to selection bias in a non-masked study. This trend was only noticed after the investigation was completed. For this reason and because of the short study period, we excluded comparisons among the three drugs. The number of patients remaining after all of the exclusion criteria were applied was somewhat modest (n = 11 per group) for a multicentric study, but it was substantial for a two-center investigation. Thus, we assert that our results can be extrapolated and are applicable for general ophthalmic clinics, particularly for glaucoma and cornea specialists, as well as for large multicenter studies. In summary, this study demonstrated that there were significant changes in the ocular surface after exposure to FCs for a short period (three months), despite the ease of administration (once daily), and reduced exposure to preservatives (one drop versus three if the medications were administered individually). However, it cannot be concluded from the present study whether any particular drug induced greater changes in the ocular surface.

& ACKNOWLEDGMENTS This study was supported by the Federal University of Sa˜o Paulo and Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP).

Figure 3 - IL-6 expression. Top images: on the left, the bimatoprost+timolol group pre-treatment, with cells negative for IL-6. On the right: the same group after treatment, with 2006 magnification. The figures on the bottom show the same images as above, with 4006 magnification. Note the increase in positive cells after treatment (images on the right).

Figure 2 - HLA-DR expression. On the left: images of the travatan+timolol group pre-treatment, with cells negative for HLA. On the right: the same group after treatment, at 1006 (on the top) and 4006 (on the bottom) magnification, respectively.

1323


A cytopathological and immunohistochemistry study Russ HH et al.

CLINICS 2013;68(10):1318-1324

` Brien C, Hitchings RA. Adverse effects of 13. Broadway DC, Grierson I, O topical antiglaucoma medication. II. The outcome of filtration surgery. Arch Ophthalmol. 1994;112(11):1446-54, http://dx.doi.org/10.1001/ archopht.1994.01090230060021. 14. Centofanti M, Oddone F, Gandolfi S, Hommer A, Boehm A, Tanga L, et al. Comparison of Travoprost and Bimatoprost plus timolol fixed combinations in open-angle glaucoma patients previously treated with latanoprost plus timolol fixed combination. American Journal of Ophthalmology. 2010;150(4):575-80, http://dx.doi.org/10.1016/j.ajo. 2010.05.003. 15. Russ HH, Costa VP, Montiani-Ferreira F, Valgas SR, Correa-Neto MA, Strobel EVL, et al. Conjunctival changes induced by prostaglandin analogues and timolol maleate: a histomorphometric study. Arq Bras Oftalmol. 2007;70(5):910-17, http://dx.doi.org/10.1590/S0004-27492007000600005. 16. Baffa LP, Ricardo JRS, Dias AC, Modulo CM, Braz AM, Paula JS, et al. Tear film and ocular surface alterations in chronic users of antiglaucoma medications. Arq Bras Oftalmol. 2008;71(1):18-21, http://dx.doi.org/10. 1590/S0004-27492008000100004. 17. Mietz H, Esser JM, Welsandt G, Kociok N, Hueber A, Esser P, et al. Invest Ophthalmol Vis Sci. 2003;44(12):5182-8. 18. Bensoussan L, Blondin C, Baudouin C, Hamard P, Sabeh Afaki G, Creuzot-Garcher C, et al. Flow cytometric analysis of HLA-DR, IL-6 and IL-8 expression by conjunctival epithelial cells from patients with prolonged topical antiglaucoma treatments. J Fr Ophtalmol. 2003;26(8):782-9. 19. Guenoun JM, Baudouin C, Rat P, Pauly A, Warnet JM, BrignoleBaudouin F. In vitro study of inflammatory potential and toxicity profile of latanoprost, travoprost, and bimatoprost in conjunctiva 窶電erived epithelial cells. Invest Ophthalmol Vis Sci. 2005;46(7):2444-50, http://dx. doi.org/10.1167/iovs.04-1331. 20. Moreno M, Villena A, Cabarga C, Sanchez-Font E, Garcia Campos J. Impression cytology of the conjunctival epithelium after antiglaucomatous treatment with latanoprost. Eur J Ophthalmol. 2003;13(6):553-9. 21. Novaes P, Saldiva PHN, Matsuda M, Macchioni M, Rangel MP, KaraJoseツエ N, et al. Ambient Levels of Air Pollution Induce Goblet-Cell Hyperplasia in Human Conjunctival Epithelium. Environ Health Perspect. 2007;115(12):1753-6, http://dx.doi.org/10.1289/ehp.10363. 22. Baudouin C, Hamard P, Liang H, Creuzot-Garcher C, Bensoussan L, Brignole F. Conjunctival epithelial cell expression of interleukins and inflammatory markers in glaucoma patients treated over the long term. Ophthalmology. 2004;111(12):2186-92, http://dx.doi.org/10.1016/ j.ophtha.2004.06.023. 23. Cvenkel B, Ihan A. Ocular Surface Changes Induced by Topical Antiglaucoma Monotherapy. Ophthalmologica. 2002;216(3):175-9, http://dx.doi.org/10.1159/000059624. 24. Arici MK, Arici DS, Topalkara A, Guler C. Adverse effects of topical antiglaucoma drugs on the ocular surface. Clin Experiment Ophthalmol. 2000;28(2):113-7, http://dx.doi.org/10.1046/j.1442-9071.2000.00237.x. 25. Blondin C, Hamard P, Cholley B, Haeffner-Cavaillon N, Baudouin C. In vitro effects of preserved or preservative-free antiglaucoma medications on human complement system. Curr Eye Res. 2003;27(4):253-9, http:// dx.doi.org/10.1076/ceyr.27.4.253.16603. 26. Uusitalo H, Chen E, Pfeiffer N, Brignole-Baudouin F, Kaarniranta K, Leino M, et al. Switching from a preserved to a preservative-free prostaglandin preparation in topical glaucoma medication. Acta Ophthalmol. 2010;88(3):329-36.

& AUTHOR CONTRIBUTIONS Russ HH, Montiani-Ferreira F, Gomes JA and Mello PA conceived the study and participated in its design. Russ HH and Faria NL performed the data acquisition. Russ HH, Faria NL, Nogueira-Filho PA, Barros JN, Montiani-Ferreira F, Gomes JA and Mello PA participated in the analysis and interpretation of the data. Russ HH, Faria NL and Montiani-Ferreira F drafted the manuscript. Russ HH, Gomes JA and Mello PA revised the manuscript and approved its final version.

& REFERENCES 1. Gordon MO, Beiser JA, Brandt JD. The ocular hypertension treatment study: baseline factors that predict the onset of primary open-angle glaucoma. Arch Ophthalmol. 2002 Jun;120(6):714-20; discussion 829-30, http://dx.doi.org/10.1001/archopht.120.6.714. 2. Ritch R, Shields B, Krupin T. Pharmacology. In The Glaucomas, Second Edition. Mosby, St Louis, EUA. 1996;3:1375-489. 3. Stewart WC, Kolker AE, Stewart JA, Leech J, Jackson AL. Conjunctival hyperemia in healthy subjects after short-term dosing with latanoprost, bimatoprost, and travoprost. Am J Ophthalmol. 2003;135(3):314-20, http://dx.doi.org/10.1016/S0002-9394(02)01980-3. 4. Johnstone MA. Hypertrichosis and increased pigmentation of eyelashes and adjacent hair in the region of the ipsilateral eyelids of patients treated with unilateral topical latanoprost. Am J Ophthalmol. 1997;124(4):544-7. 5. Kook MS, Lee K. Increased eyelid pigmentation associated with use of latanoprost. Am J Ophhtalmol. 2000;129(6):804-6. 6. Arcieri ES, Santana A, Rocha FN, Guapo GL, Costa VP. Blood-aqueous barrier changes after the use of prostaglandin analogues in patients with pseudophakia and aphakia: a 6-month randomized trial. Arch Ophthalmol. 2005;123(2):186-92, http://dx.doi.org/10.1001/archopht. 123.2.186. 7. Herreras JM, Pastor JC, Calonge M, Asensio VM. Ocular surface alteration after long-term treatment with antiglaucomatous drug. Ophthalmology. 1992;99(7):1082-8. 8. Nuzzi R, Finazzo C, Cerruti A. Adverse effects of topical antiglaucomatous medications on the conjunctiva and the lacrymal. Int Ophthalmol. 1998;22(1):31-5, http://dx.doi.org/10.1023/A:1006051725115. ` Brien C, Hitchings RA. Adverse effects of 9. Broadway DC, Grierson I, O topical antiglaucoma medication. I- The conjunctival cell profile. Arch Ophthalmol. 1994;112(11):1437-45, http://dx.doi.org/10.1001/archopht. 1994.01090230051020. 10. Thygesen J, Aaen K, Theodorsen F, Kessing SV, Prause JU. Short-term effect of latanoprost and timolol eye drops on tear fluid and the ocular surface in patients with primary open-angle glaucoma and ocular hypertension. Acta Ophthalmol Scand. 2000;78(1):37-44, http://dx.doi. org/10.1034/j.1600-0420.2000.078001037.x. 11. Brandt JD, Wittpenn JR, Katz J, Steinmann WN, Spaeth GL. Conjunctival impression cytology in patients with glaucoma using long-term topical medication. Am J Ophthalmol. 1991;112(3):297-301. 12. Mietz H, Niesen U, Krieglstein GK. Effect of latanoprost and timolol on the histopathology of the rabbit conjunctiva. Invest Ophthalmol Vis Sci. 2001;42(3):679-87.

1324


CLINICAL SCIENCE

Myxovirus resistance, osteopontin and suppressor of cytokine signaling 3 polymorphisms predict hepatitis C virus therapy response in an admixed patient population: comparison with IL28B Ana Luiza Dias Angelo,I Lourianne Nascimento Cavalcante,II,V Kiyoko Abe-Sandes,I,III Taı´sa Bonfim Machado,I Denise Carneiro Lemaire,I,III Fernanda Malta,IV Joa˜o Renato Pinho,IV Luiz Guilherme Costa Lyra,V Andre Castro LyraII,IV I

Federal University of Bahia, Laboratory of Immunology, Salvador/BA, Brazil. II Federal University of Bahia, Division of Gastroenterology & Hepatology, Department of Medicine, Salvador/BA, Brazil. III State University of Bahia, Department of Life Sciences, Salvador/ BA, Brazil. IV Faculdade de Medicina da Universidade de Sa˜o Paulo, Laborato´rio de Gastroenterologia e Hepatologia Tropical, Sa˜o Paulo/SP, Brazil. V Hospital Sa˜o Rafael, Gastro-Hepatology Service, Salvador/BA, Brazil.

OBJECTIVES: Suppressor of cytokine signaling 3, myxovirus resistance protein and osteopontin gene polymorphisms may influence the therapeutic response in patients with chronic hepatitis C, and an association with IL28 might increase the power to predict sustained virologic response. Our aims were to evaluate the association between myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 gene polymorphisms in combination with IL28B and to assess the therapy response in hepatitis C patients treated with pegylated-interferon plus ribavirin. METHOD: Myxovirus resistance protein, osteopontin, suppressor of cytokine signaling 3 and IL28B polymorphisms were analyzed by PCR-restriction fragment length polymorphism, direct sequencing and realtime PCR. Ancestry was determined using genetic markers. RESULTS: We analyzed 181 individuals, including 52 who were sustained virologic responders. The protective genotype frequencies among the sustained virologic response group were as follows: the G/G suppressor of cytokine signaling 3 (rs4969170) (62.2%); T/T osteopontin (rs2853744) (60%); T/T osteopontin (rs11730582) (64.3%); and the G/T myxovirus resistance protein (rs2071430) genotype (54%). The patients who had $3 of the protective genotypes from the myxovirus resistance protein, the suppressor of cytokine signaling 3 and osteopontin had a greater than 90% probability of achieving a sustained response (p,0.0001). The C/C IL28B genotype was present in 58.8% of the subjects in this group. The sustained virological response rates increased to 85.7% and 91.7% by analyzing C/C IL28B with the T/T osteopontin genotype at rs11730582 and the G/G suppressor of cytokine signaling 3 genotype, respectively. Genetic ancestry analysis revealed an admixed population. CONCLUSION: Hepatitis C genotype 1 patients who were responders to interferon-based therapy had a high frequency of multiple protective polymorphisms in the myxovirus resistance protein, osteopontin and suppressor of cytokine signaling 3 genes. The combined analysis of the suppressor of cytokine signaling 3 and IL28B genotypes more effectively predicted sustained virologic response than IL28B analysis alone. KEYWORDS: Hepatitis C; IL28B; MxA; Osteopontin; SOCS3; Genetic polymorphisms. Angelo AL, Cavalcante LN, Abe-Sandes K, Machado TB, Lemaire DC, Malta F, et al. Myxovirus resistance, osteopontin and suppressor of cytokine signaling 3 polymorphisms predict hepatitis C virus therapy response in an admixed patient population: comparison with IL28B. Clinics. 2013;68(10):1325-1332. Received for publication on April 5, 2013; First review completed on April 24, 2013; Accepted for publication on May 15, 2013 E-mail: aclyra@live.com Tel.: 55 71 3281-6432

& INTRODUCTION Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Genetic and biological host factors such as the human leukocyte antigen, ancestry, cytokine polymorphisms, gender, liver fibrosis and insulin resistance are implicated in the effectiveness of interferon (IFN)-a therapy in chronic hepatitis C (1,2). The interferon system is a crucial component of the natural immune response to infectious agents. Type I

No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)06

1325


MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al.

CLINICS 2013;68(10):1325-1332

time, whereas 38 had been previously treated with a combination of standard alpha-2a or alpha-2b interferon and ribavirin.

interferon induces numerous antiviral proteins, including the myxovirus resistance (MxA) protein, 2-5 oligoadenylate synthetase 1 and double-stranded RNA-dependent protein kinase. The MxA protein has selective activity against a number of viruses, and its levels are higher in chronic hepatitis C virus (HCV) patients during interferon treatment; the single nucleotide polymorphisms (SNPs) in the promoter region of MxA appear to be associated with the response of HCV-infected patients to interferon (3,4). Osteopontin (OPN) is an extracellular matrix protein expressed in activated Kupffer and stellate cells that contributes to the migration of macrophages into the necrotic areas of the injured liver. OPN is an essential cytokine in initiating the Th1 immune response; recent research has shown that genetic polymorphisms in the OPN gene determine the magnitude of the immune reaction, and SNPs in the promoter region of human OPN may affect the necroinflammatory activity in chronic hepatitis C patients (CHC) (5). The mechanisms by which HCV interferes with IFN signaling and attenuates antiviral efficacy are not fully elucidated. HCV infection leads to endogenous IFN production and increased expression of the suppressor of cytokine signaling 3 (SOCS3) via viral core proteins or IFN inhibitory factors (6). SOCS3 can suppress JAK-STAT signaling at the level of STAT1 (Signal Transducer and Activator of Transcription 1) phosphorylation by blocking the IFNinduced formation of interferon-stimulated gene factor 3 (ISGF3) (7). Previous studies have reported that an SNP (-4874nt A.G) in the promoter region of the SOCS3 gene is associated with a poorer treatment outcome (8). IL28A, IL28B and IL29 are cytokines related to the lambda interferon family and have been structurally associated with the IL-10 family (9). SNPs located upstream of the IL28B gene are the most important genetic markers for predicting the response to combination therapy with pegylated IFN-a and ribavirin in HCV genotype 1 patients (10-12). IFN-a acts through the well-characterized JAK-STAT pathway to up- or downregulate hundreds of genes that function in the immune response pathways (13). SNPs in the interferon-a pathway genes and interferon-induced genes within the MxA and OPN (4,14-16) promoter regions are associated with therapeutic outcome. High intrahepatic expression levels of interferon-stimulated genes are associated with lower antiviral response rates to interferon plus ribavirin in chronic hepatitis C patients (17). The aim of this study was to evaluate the influence of host genetic heterogeneity mediated by SNPs in the promoter regions of MxA, OPN and SOCS3 in chronic hepatitis C patients treated with pegylated interferon (Peg-IFN) plus ribavirin combination therapy. The capacity of these protective genotypes to predict therapeutic response in HCV patients was compared with therapeutic response prediction using IL28B genotypes.

Inclusion criteria We included viral genotype 1 CHC patients who were older than 18 years old and were treated with Peg-IFN alpha-2a or alpha-2b plus ribavirin.

Exclusion criteria The exclusion criteria were hepatitis B or HIV co-infection and alcohol intake $40 g of ethanol/day or other concomitant chronic liver disease. The patients were divided into the following 2 groups: the SVR (sustained virologic response) group (individuals who had achieved SVR), and the non-response (NR) group (individuals who were non-responders or relapsers to therapy). Other data were obtained from patient interviews and chart reviews. SVR was defined as undetectable HCV RNA in serum 24 weeks after the end of therapy. Patients received 48 weeks of treatment. Non-response to therapy was defined as an HCV viral load decline of less than 2 logs at week 12 during therapy or detectable serum HCV RNA at any time during therapy up to 48 weeks. Relapse was defined as undetectable HCV RNA in serum at the end of therapy followed by detectable HCV RNA after discontinuation of therapy.

Genotyping of allelic variants Genomic DNA from the peripheral blood mononuclear cells was isolated using the DNA Blood MiniKit (Invitrogen, USA). We defined protective genotypes as those genotypes associated with a sustained virological response.

MxA The biallelic polymorphism in the promoter region of MxA rs2071430 at position -88nt (G.T) and rs17000900 at position -123nt (C.A) from the transcription start site was determined by PCR-restriction fragment length polymorphism (RFLP), as described by Hijikata et al. (4). Amplification was conducted using Taq DNA Polymerase High Fidelity (Invitrogen, USA).

OPN The SNPs in the OPN promoter region at position -616nt (rs2853744; G.T) and position -449nt (rs11730582; T.C) were analyzed by the direct sequencing of DNA fragments (5). The extracted genomic DNA was amplified using Taq DNA Polymerase High Fidelity (Invitrogen, USA). The direct sequencing was performed using BigDye Terminator v3.1 Ready Reaction Cycle Sequencing (Applied BioSystems, USA).

SOCS3 and IL28B The SOCS3 and IL28B SNPs were genotyped by real-time PCR. Thermal cycling was performed on a Step One RealTime PCR System (Applied BioSystems, USA). The fluorescence data were collected, and the genotypes were determined using Sequence Detection Systems software version 1.3.1 (Applied BioSystems). The genotyping of the SOCS3 promoter region at -4874nt (of rs4969170 A.G) was performed according to Persico et al. (8). The SNP for IL28B was rs12979860 (T.C).

& MATERIALS AND METHODS Study design and patients Between January 2010 and March 2011, 181 adult outpatient clinic patients chronically infected with HCV genotype 1 who were treated with a combination of PegIFN alpha-2a or alpha-2b and ribavirin were consecutively screened. Of these patients, 143 were treated for the first

1326


CLINICS 2013;68(10):1325-1332

MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al.

combined Peg-INF alpha-2a or alpha-2b and ribavirin therapy. The patient characteristics are described in Table 1. Severe fibrosis (Metavir F3 and F4) was observed more frequently in those patients who did not respond to the combination treatment (OR = 2.27; 95% CI: 1.11–4.65; p = 0.018) when compared to the sustained responders. Our studied population was admixed, and the genetic ancestry analysis revealed a tri-hybrid population with the following genetic ancestry contribution: African, 43.6%; European, 31.9% and Amerindian, 24.6%. We found that patients in the NR/R group had a higher contribution of African ancestry (46.6%) compared to European (27.2%) and Amerindian (26.1%) ancestries, whereas the patients in the SVR group had a greater contribution of European ancestry (40.4%) compared to African (35.6%) and Amerindian (24%) ancestries (p = 0.048).

Ancestry informative markers (AIMs) Genetic ancestries were determined by analyzing the ancestry informative markers (AIMs) for African, Amerindian and European populations. The allele*1 was defined as the presence of insertion or the lack of restriction enzyme site (18). The AIMs were selected based on previous studies that analyzed a panel of 48 ancestry markers in different populations (18-20). Seven AIMs were selected that had higher than 48% ethno-geographical differential frequencies for Amerindian/European, African/European and Amerindian/African ancestries. The evaluated AIMs were as follows: African ancestry, AT3I/D (rs3138521) and LPL (rs285); European ancestry, Sb19.3 (rs3138524), APO (rs3138522) and FY-Null (rs2814778); and Amerindian ancestry, PV92 (rs3138523) and CKMM (rs4884). Three SNPs (FY-null, LPL and CKMM) were determined using the Taqman assay (Applied BioSystems, USA); 3 Alu insertion polymorphisms (APO, Sb19.3 and PV92) and a polymorphic insertion of a 68-bp fragment at locus AT3-I/D were analyzed for specific alleles using PCR (19-21).

Polymorphisms in the MxA promoter Linkage disequilibrium was observed between the MxA SNPs rs2071430 and rs17000900 (p = 0.001). The polymorphisms in MxA at position -88 (rs2071430) were associated with patient response to Peg-INF and ribavirin therapy (Table 2). The G/G was significantly less frequent in the SVR group than in the NR/R group (11.2 vs. 88.8%, p,0.0001). G/T heterozygosis plus T/T homozygosis was present in 54% of the patients who achieved SVR and in 46% of the subjects from the NR/R group. The T allele had a significantly higher frequency in the patients with SVR (OR = 0.39; 95% CI: 0.21–0.71; p = 0.003). The SNP at position -123 (rs17000900) was associated with a therapeutic response. As shown in Table 2, non-responders/relapsers had a higher frequency of C/C homozygotes than did the sustained virological responders (82.6% vs. 17.4%, p,0.0001), which is similar to the frequency of G/G homozygotes for rs2071430.

Statistical analysis The statistical analysis was performed using the R projects software version 2.11.1 for Windows (http://www.r-project). The categorical data were analyzed using Fisher’s exact tests or the x2 test; the continuous data were analyzed using the non-parametric Mann-Whitney U test. The univariate factors with p-values less than 0.05 and confidence intervals of 95% were considered to be statistically significant. The allele frequencies were estimated by the gene counting method using the GENEPOP online version 4.0.10 (http://genepop.curtin.edu.au) (22). The admixture proportions of each population sample were estimated by the ADMIX software version 2.0 software [www.genetica. fmed.edu.uy] (23,24). The parental population allele frequencies used were described by Shriver et al. (18).

Polymorphisms in the OPN promoter The direct sequencing of the DNA fragments between nt 733 and -236 in 181 patients revealed 2 SNPs in the promoter region of OPN, located at nt -616 (rs2853744) and -443 (rs11730582). The prevalence of these 2 SNPs is shown in Table 2. The T/T genotype for the SNP at rs2853744 was associated with a sustained virological response to antiviral Peg-IFN-a therapy (60% vs. 40%, p = 0.013). The T allele occurred more frequently in the SVR group compared to the NR/R group (OR = 0.30; 95% CI: 0.12 0.73; p = 0.009). Patients with the T/T genotype for the SNP at rs11730582 (64.3%) had a significantly higher SVR rate than patients

Ethics This study was approved by the ethics committee of the institution, and all of the patients provided written informed consent. All of the procedures were in accordance with the ethical standards of the responsible committee on human experimentation and with the Helsinki Declaration of 1975 as revised in 1983.

& RESULTS Of the 181 HCV individuals in the study, 52 achieved SVR, and 129 were non-responders/relapsers to the

Table 1 - Comparison of the baseline characteristics of individuals infected with HCV by response to Peg-IFN-a/ RBV therapy.

Gender Female Male Age (years) ¡ SD Liver fibrosis stage #F2 F3/F4 ALT (U/L) Viral Load (IU/ml)

N

SVR N = 52 (%)

NR N = 129 (%)

OR (95% CI)

p-value

62 119 181

13 (21) 39 (32.8) 50¡9.6

49 (79) 80 (67.2) 53¡10.1

1.83 (0.89-3.78)

0.066

78 81 166 73

28 (63.6) 16 (36.4) 117.42 5.6

50 (43.5) 65 (56.5) 113.08 5.9

2.27 (1.11–4.65)

SD = standard deviation; OR = odds ratio; 95% CI = 95% confidence interval.

1327

0.149 0.018 0.733 0.270


MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al.

CLINICS 2013;68(10):1325-1332

Table 2 - MxA, OPN, SOCS3 and IL28B polymorphism genotype and allele frequencies by therapeutic outcome in patients with chronic hepatitis C.

MxA (rs2071430) Genotypes G/G G/T + T/T Allele frequency T G MxA (rs17000900) Genotypes C/C C/A + A/A Allele frequency A C OPN (rs2853744) Genotypes T/T G/T + G/G Allele frequency T G OPN (rs11730582) Genotypes T/T T/C + C/C Allele frequency T C SOCS3 (rs4969170) Genotypes G/G A/G + A/A Allele frequency G A IL28B (rs12979860) Genotype C/C C/T + T/T Allele frequency C T

SVR N = 52 (%)

NR N = 129 (%)

OR (95% CI)

p-value

12 (11.2) 40 (54)

95 (88.8) 34 (46)

0.10 (0.05-0.22)

,0.0001

0.471 0.529

0.258 0.742

0.39 (0.21–0.71)

0.003

20 (17.4) 32 (48.5)

95 (82.6) 34 (51.5)

0.22 (0.11-0.44)

,0.0001

0.346 0.423

0.140 0.860

0.20 (0.09–0.41)

0.001

9 (60) 43 (25.9)

6 (40) 123 (74.1)

0.23 (0.07-0.69)

0.013

0.221 0.779

0.087 0.913

0.30 (0.12-0.73)

0.009

36 (64.3) 16 (12.8)

20 (35.7) 109 (87.2)

0.08 (0.03-0.17)

,0.0001

0.750 0.250

0.417 0.583

0.23 (0.12-0.43)

,0.0001

23 (62.2) 29 (20.1)

14 (37.8) 115 (79.9)

0.15 (0.07-0.33)

,0.0001

0.577 0.423

0.443 0.557

0.56 (0.32-0.99)

0.065

20 (58.8) 24 (22.9)

14 (41.2) 81 (77.1)

0.20 (0.09–0.47)

0.0008

0.648 0.352

0.458 0.542

0.45 (0.25–0.80)

0.009

OR = odds ratio; 95% CI = 95% confidence interval.

with the T/C or C/C genotypes (12.8%). T/C + C/C was associated with non-response/relapse (12.8% vs. 87.2%, p,0.0001). The T allele had a strong association with the SVR rate (OR = 0.23; 95% CI: 0.12 - 0.43; p = 0.001). No linkage disequilibrium was noted between the SNPs.

Analysis of the combination of protective genotypes at the MxA, OPN and SOCS3 promoter regions A higher number of protective genotypes present in a patient indicated a higher probability of achieving sustained virological response (Figure 1). The patients who had 3 or more protective genotypes had a greater than 90% probability of attaining SVR (OR = 0.01; 95% CI: 0.001 - 0.10; p,0.0001). There were few patients with higher numbers of protective genotypes.

Polymorphisms in the SOCS3 promoter Our data show that the SNP located at nt -4874 (rs4969170) in the promoter region of the SOCS3 gene is associated with the antiviral treatment response. As shown in Table 2, the A/G + A/A genotype was more frequent among the subjects in the NR/R group compared to the SVR group (79.9% vs. 20.1%, p,0.0001). The G/G genotype frequency was much higher in the SVR patients than in the NR/R patients (62.2% vs. 37.8%, p,0.0001). The alleles were not associated with the antiviral therapy response (OR = 0.56; 95% CI: 0.32 – 1.00; p = 0.065).

Polymorphisms in the IL28B gene Individuals with the C allele in the IL28B polymorphism at rs12979860 had a greater probability of achieving SVR, whereas patients with the T allele had a greater probability of non-response (OR = 0.45; 95% CI: 0.25–0.80; p = 0.009). The C/C genotype was more frequent in the SVR group, whereas

1328


CLINICS 2013;68(10):1325-1332

MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al.

Figure 1 - Analysis of combinations of MxA, OPN and SOCS3 protective genotypes compared with IL28B by therapeutic response. Patients who had 3 or more protective genotypes had a greater than 90% probability of attaining SVR.

(10). In this study, we found that the combined presence of more than 3 protective genotypes from the OPN, MxA and SOCS3 genes was as effective at predicting the therapeutic response as was CC IL28B alone. We verified that grouping the SOCS3 and IL28B protective genotypes increased the capacity to predict SVR. Interferons exert their biological effects primarily through the JAK-STAT pathway, which regulates gene transcription and mediates antiproliferative, antiviral and immunomodulatory responses (25). SOCS3 interacts with the JAKs, resulting in impaired STAT1 and STAT3 phosphorylation, reduced levels of STAT1, impaired binding to the interferon-sensitive response element (ISRE) and decreased interferon-stimulated gene (ISG) expression (26). Persico et al. (8) reported that the SOCS3 rs4969170 A/A genotype was strongly associated with a failure to respond to HCV antiviral therapy. In our study, the G/G genotype was more frequently found in the sustained virological responders, whereas the A/G + A/A genotype was most frequent in NR/R subjects. Persico et al. (8) found that the A/A genotype carriers had significantly higher SOCS3 mRNA and protein expression levels, suggesting that high SOCS3 expression in the liver, as observed in the non-responders, may be associated with non-response to HCV therapy (27). The SOCS3 rs4969170 A.G polymorphism is located within the binding region for 2 transcription factors, RUNX1 and PURa. The allelic G form binds both factors, whereas the allelic A form only binds RUNX1 (28). The SOCS3 A allele could predispose patients to overproducing SOCS3 and to resistance to antiviral therapy (29). The MxA and OPN proteins could be downregulated by SOCS3 overexpression, suppressing IFN-a-induced STAT activation and the expression of antiviral proteins. The SNPs in OPN may be crucial in stimulating diverse Th1 immune responses to HCV by regulating OPN expression in the liver. The Th1 response is involved in inflammation in chronic hepatitis C; HCV-infected hepatocytes are eradicated by the Th1 response during IFN-based

the C/T and T/T genotypes were more frequent in the NR/R group (OR = 0.20; 95% CI: 0.09–0.47; p = 0.0008) (Table 2).

Polymorphisms in the MxA, OPN and SOCS3 promoter genes and prediction of therapy response when analyzed in combination with IL28B gene The comparisons of the separate analysis of each protective genotype in the OPN and SOCS3 genes to the IL28B C/C genotype (rs12979860) detected an association between SVR and those polymorphisms. The protective genotypes from MxA were not associated with SVR compared to IL28B. The combined analysis of the MxA, OPN and SOCS3 genotypes with IL28B C/C revealed that patients with 3 or more protective genotypes had a greater probability of attaining SVR compared to patients with only the IL28B C/ C genotype (OR = 0.07; 95% CI: 0.02 - 0.20; p,0.0001) (Figure 1). In this population, analysis of only the isolated protective IL28B genotype (C/C) was associated with SVR in 58.8% of patients. Analyzing the IL28B C/C with the protective OPN genotype (T/T) at rs11730582 increased the SVR proportion to 85.7% (OR = 0.23; 95% CI: 0.11-0.46; p,0.0001). The combination of the IL28B C/C with the SOCS3 protective genotype (G/G) achieved a predictive SVR rate of 91.7% (OR = 0.12; 95% CI: 0.05-0.28; p,0.0001) (Figure 2). For the 181 patients who were treated for chronic HCV, the frequencies of the protective genotypes were 30.9% for OPN T/T (rs11730582), 20.4% for SOCS3 G/G and 18.8% for IL28B C/C. The frequencies of the combinations of protective genotypes were 6.6% for the IL28B C/C plus OPN T/T and 6.07% for the IL28B C/C plus SOCS3 G/G.

& DISCUSSION SNPs may be associated with the therapeutic outcome of treatment with Peg-INF and ribavirin, and IL28B genotypes have been reported to be significant markers in recent trials

1329


MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al.

CLINICS 2013;68(10):1325-1332

Figure 2 - Prediction of therapeutic response based on the combined analysis of protective OPN (rs11730582) or SOCS3 genotypes with the protective IL28B genotype. The protective IL28B genotype (C/C) alone was associated with SVR in 58.8% of the patients. The IL28B C/C genotype combined with the protective OPN genotype (T/T) at rs11730582 increased the SVR proportion to 85.7%. The combination of IL28B C/C with the SOCS3 protective genotype (G/G) achieved a predictive SVR rate of 91.7%.

therapies. The T/T genotype in the OPN polymorphism at rs11730582 was significantly associated with SVR, whereas the T allele was less frequently found in the NR/R group; this observation is in agreement with the data from Naito et al. (16). The SVR group had a higher frequency of the T/T genotype at the OPN SNP rs2853744, although this finding was not confirmed by other authors (5,16). OPN SNPs may affect OPN expression in the liver because they are located just upstream of the cis-acting enhancing element of human OPN (29). We evaluated the MxA gene at rs17000900 and noted linkage disequilibrium with rs2071430. Therefore, only rs2071430 was analyzed. The G/T and T/T genotypes were present more frequently in the SVR patients, whereas the G/G genotype was associated with NR/R, suggesting that the T allele has a protective effect. This assertion is supported by an in vitro study that reported higher transcriptional activity when stimulated by interferon-alpha and by the fact that the T allele polymorphism at rs2071430 increases the homology of its encompassing sequence element to an ISRE (4). Patients with the G/G genotype may produce a suboptimal MxA response from treatment with interferon-alpha. Our data agree with the findings that indicated a statistical association between heterozygosis and SVR. We detected a lower frequency of the C/C genotype (18.8%) in the IL28B polymorphisms (rs12979860) than did a previous study (35%) (10), possibly because of the high African contribution in our admixed population. In separate analyses of the 143 na覺穡ve patients and the 38 previous NR/ Rs to standard interferon-based therapy patients who were retreated with Peg-INF plus ribavirin, the results remained identical for all of the analyzed SNPs (data not shown), indicating that the low frequency of C/C IL28B may be a result of the high African contribution in our population (30). In our study population, the C/C genotype frequency

was highly associated with the SVR group (58.8%), which is in agreement with the literature; Ge et al. found that the protective IL28B genotype is associated with SVR in approximately 55% of African Americans (10). The MxA, OPN and SOCS3 protective genotypes exhibited individual associations with the therapeutic response; when analyzed together, the power to predict an SVR response increased progressively. The SVR response rate was 93.3% in patients with combinations of MxA, OPN and SOCS3 protective genotypes, whereas 58.8% of patients with the C/C IL28B genotype experienced SVR. The frequency of the combined MxA, OPN and SOCS3 protective genotypes in our study population was 10%. We evaluated the combination of the MxA, OPN and SOCS3 protector genotypes with C/C IL28B to increase the probability of predicting the therapeutic response but found significant associations only with the OPN and SOCS3 genes. The frequency of SVR for the OPN and IL28B (T/T + C/C) combination of protective genotypes was 85.7%. The combined genotypes were present at a frequency of 6.6%, whereas the individual genotype frequencies were 30.9% (T/T OPN) and 18.8% (C/C IL28B). The frequency of SVR for the SOCS3 and IL28B (G/G + C/C) combination of protective genotypes was 91.7%, which is higher than the individual frequencies of G/G SOCS3 (62.2%) and C/C IL28B (58.8%). The combined genotype (G/G + C/C) frequency was 6.07%, which is lower than the individual G/G SOCS3 (20.4%) and C/C IL28B (18.8%) frequencies. Although the frequency of the combined protective genotypes is low, its predictive power is reasonably accurate and is superior to the predictive power of C/C IL28B alone. A plausible biological explanation for this finding is that a less active SOCS3 allows IFN-lambda and IFN-alpha to signal more effectively via the JAK-STAT pathway to transcribe anti-viral proteins.

1330


CLINICS 2013;68(10):1325-1332

MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al. 6. Bode JG, Ludwig S, Ehrhardt C, Albrecht U, Erhardt A, Schaper F, et al. IFN-alpha antagonistic activity of HCV core protein involves induction of suppressor of cytokine signaling-3. FASEB J. 2003; 17(3):488-90. 7. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol. 2000;18:143-64, http://dx.doi. org/10.1146/annurev.immunol.18.1.143. 8. Persico M, Capasso M, Russo R, Persico E, Croce L, Tiribelli C, et al. Elevated expression and polymorphisms of SOCS3 influence patient response to antiviral therapy in chronic hepatitis C. Gut. 2008;57(4):507-15. 9. Gad HH, Dellgren C, Hamming OJ, Vends S, Paludan SR, Hartmann R. Interferon-lambda is functionally an interferon but structurally related to the interleukin-10 family. J Biol Chem. 2009;284(31):20869-75, http://dx. doi.org/10.1074/jbc.M109.002923. 10. Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, Urban TJ, et al. Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 2009;461(7262):399-401, http://dx.doi.org/10.1038/ nature08309. 11. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, Sakamoto N, et al. Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. Nat Genet. 2009;41(10):1105-9, http://dx.doi.org/10.1038/ng.449. 12. Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, O’Huigin C, et al. Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature. 2009;461(7265):798-801, http://dx.doi.org/10.1038/nature08463. 13. David M. Signal transduction by type I interferons. Biotechniques 2002;Suppl:58-65. 14. Welzel TM, Morgan TR, Bonkovsky HL, Naishadham D, Pfeiffer RM, Wright EC, et al. Variants in interferon-alpha pathway genes and response to pegylated interferon-Alpha2a plus ribavirin for treatment of chronic hepatitis C virus infection in the hepatitis C antiviral long-term treatment against cirrhosis trial. Hepatology. 2009;49(6):1847-58, http:// dx.doi.org/10.1002/hep.22877. 15. Knapp S, Yee LJ, Frodsham AJ, Hennig BJ, Hellier S, Zhang L, et al. Polymorphisms in interferon-induced genes and the outcome of hepatitis C virus infection: roles of MxA, OAS-1 and PKR. Genes Immun. 2003;4(6):411-9, http://dx.doi.org/10.1038/sj.gene.6363984. 16. Naito M, Matsui A, Inao M, Nagoshi S, Nagano M, Ito N, et al. SNPs in the promoter region of the osteopontin gene as a marker predicting the efficacy of interferon-based therapies in patients with chronic hepatitis C. J Gastroenterol. 2005;40(4):381-8, http://dx.doi.org/10.1007/s00535-005-1558-3. 17. Abe H, Hayes CN, Ochi H, Maekawa T, Tsuge M, Miki D, et al. IL28 variation affects expression of interferon stimulated genes and peginterferon and ribavirin therapy. J Hepatol. 2011;54(6):1094-101, http:// dx.doi.org/10.1016/j.jhep.2010.09.019. 18. Shriver MD, Parra EJ, Dios S, Bonilla C, Norton H, Jovel C, et al. Skin pigmentation, biogeographical ancestry and admixture mapping. Hum Genet. 2003;112(4):387-99. 19. Parra EJ, Marcini A, Akey J, Martinson J, Batzer MA, Cooper R, et al. Estimating African American admixture proportions by use of population-specific alleles. Am J Hum Genet. 1998;63(6):1839-51. 20. Bonilla C, Parra EJ, Pfaff CL, Dios S, Marshall JA, Hamman RF, et al. Admixture in the Hispanics of the San Luis Valley, Colorado, and its implications for complex trait gene mapping. Ann Hum Genet. 2004;68(Pt 2):139-53, http://dx.doi.org/10.1046/j.1529-8817.2003.00084.x. 21. Batzer MA, Stoneking M, Alegria-Hartman M, Bazan H, Kass DH, Shaikh, et al. African origin of human-specific polymorphic Alu insertions. Proc Natl Acad Sci U S A. 1994;91(25):12288-92, http://dx. doi.org/10.1073/pnas.91.25.12288. 22. Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered. 1995;86(3):248-9. 23. Chakraborty R. Gene identity in racial hybrids and estimation of admixture rates. In: Ahuja Y, Neel JV, eds. Genetic Microdifferentiation in Human and Other Animal Populations. Delhi, India: Anthropological Association, Delhi University Anthropology Department. 1985;171-80. 24. Divers J, Vaughan LK, Padilla MA, Fernandez JR, Allison DB, Redden DT. Correcting for measurement error in individual ancestry estimates in structured association tests. Genetics. 2007;176(3):1823-33, http://dx.doi. org/10.1534/genetics.107.075408. 25. Goodbourn S, Didcock L, Randall RE. Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures. J Gen Virol. 2000;81(Pt 10):2341-64. 26. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol. 2000;18:143-64, http://dx.doi. org/10.1146/annurev.immunol.18.1.143. 27. Miyaaki H, Ichikawa T, Nakao K, Matsuzaki T, Muraoka T, Honda T, et al. Predictive value of suppressor of cytokine signal 3 (SOCS3) in the outcome of interferon therapy in chronic hepatitis C. Hepatol Res. 2009;39(9):850-5, http://dx.doi.org/10.1111/j.1872-034X.2009.00529. x. 28. Cartharius K, Frech K, Grote K, Klocke B, Haltmeier M, Klingenhoff A, et al. MatInspector and beyond: promoter analysis based on transcription

A previous study of HCV genotype 1 patients examined the effect of the IL28B genotype; ancestry analysis indicated that patients with the C/C genotype had an SVR rate of approximately 80% (10). Self-classified EuropeanAmericans had an SVR rate slightly higher than 80%. The authors explained that European ancestry is associated with a higher frequency of the IL28B C allele, which results in a greater probability of SVR. In our study, the group with a combination of the C/C IL28B and G/G SOCS3 genotypes had a greater SVR rate than the group with only the C/C IL28B genotype. Our results suggest that the association between the protective genotypes G/G SOCS3 and C/C IL28B is a more powerful predictor of SVR. Our study population was admixed; the genetic ancestry analysis revealed a tri-hybrid population. It appears that our study population is more ethnically heterogeneous than populations evaluated in European and North American studies. We found that the patients in the NR/R group had a higher contribution of African ancestry, whereas the patients in the SVR group had a greater European contribution. In conclusion, the combination of the MxA, OPN and SOCS3 protective genotypes was more frequent among the SVR patients. The combined analysis of the SOCS3 and IL28B protective genotypes (G/G + C/C) had greater power than IL28B to predict SVR. The limitations of the study must be clarified. Our study population was relatively small, and most of the combinations of SNPs that predicted treatment outcomes more effectively than did the IL28B genotype alone were present in less than 10% of the patients. New studies involving combination polymorphism analysis should be encouraged to validate our findings.

& ACKNOWLEDGMENTS This study was supported in part by the FAPESB (grant number 6081/ 2010) and by the FAPESP (grant number 2010/10549-1).

& AUTHOR CONTRIBUTIONS Angelo AL performed the majority of this work. Cavalcante LN provided the data collection. Angelo AL, Machado TB, Lemaire DC, Malta F and Pinho JR provided the DNA extraction and genotyping. Angelo AL, AbeSandes K and Cavalcante LN provided the analytical tools. Lyra AC and Lyra LG edited and wrote the manuscript. Angelo AL, Lemaire DC, Cavalcante LN, Lyra AC and Lyra LG conceived the study.

& REFERENCES 1. Thio CL. Host genetic factors and antiviral immune responses to hepatitis C virus. Clin Liver Dis. 2008;12(3):713-26, xi, http://dx.doi. org/10.1016/j.cld.2008.03.002. 2. Mabee CL, Crippin JS, Lee WM. Review article: interferon and hepatitis C--factors predicting therapeutic outcome. Aliment Pharmacol Ther. 1998;12(6):509-18, http://dx.doi.org/10.1046/j.1365-2036.1998.00328.x. 3. Fernandez M, Quiroga JA, Martin J, Herrero M, Pardo M, Horisberger MA, et al. In vivo and in vitro induction of MxA protein in peripheral blood mononuclear cells from patients chronically infected with hepatitis C virus. J Infect Dis. 1999;180(2):262-7, http://dx.doi.org/10.1086/3148 59. 4. Hijikata M, Mishiro S, Miyamoto C, Furuichi Y, Hashimoto M, Ohta Y. Genetic polymorphism of the MxA gene promoter and interferon responsiveness of hepatitis C patients: revisited by analyzing two SNP sites (-123 and -88) in vivo and in vitro. Intervirology. 2001;44(6):379-82, http://dx.doi.org/10.1159/000050075. 5. Mochida S, Hashimoto M, Matsui A, Naito M, Inao M, Nagoshi S, et al. Genetic polymorphims in promoter region of osteopontin gene may be a marker reflecting hepatitis activity in chronic hepatitis C patients. Biochem Biophys Res Commun. 2004;313(4):1079-85, http://dx.doi.org/ 10.1016/j.bbrc.2003.12.045.

1331


MxA, OPN, SOCS3 and IL28B polymorphisms in HCV Angelo AL et al.

CLINICS 2013;68(10):1325-1332

30. Cavalcante LN, Abe-Sandes K, Angelo AL, Machado TM, Lemaire DC, Mendes CM, et al. IL28B polymorphisms are markers of therapy response and are influenced by genetic ancestry in chronic hepatitis C patients from an admixed population. Liver Int. 2012;32(3):47686.

factor binding sites. Bioinformatics. 2005;21(13):2933-42, http://dx.doi. org/10.1093/bioinformatics/bti473. 29. Yamamoto S, Hijiya N, Setoguchi M, Matsuura K, Ishida T, Higuchi Y, et al. Structure of the osteopontin gene and its promoter. Ann N Y Acad Sci. 1995;760:44-58.

1332


CLINICAL SCIENCE

Early assessment of percutaneous coronary interventions for chronic total occlusions analyzed by novel echocardiographic techniques Ercan Erdogan,I Mehmet Akkaya,I Ahmet Bacaksiz,I Abdurrrahman Tasal,I Osman So¨nmez,I Mehmet Ali ¨ mer Go¨ktekinI Elbey,II Seref Kul,I Mehmet Akif Vatankulu,I Murat Turfan,I O I

Bezmialem Foundation University, Faculty of Medicine, Department of Cardiology, Istanbul/Turkey. II Dicle University, School of Medicine, Department of Cardiology, Diyarbakır/Turkey.

OBJECTIVE: Successful revascularization of chronic total occlusions has been associated with improved left ventricular systolic function, reduced anginal symptoms, increased exercise capacity, and increased survival. This study was conducted to determine the impact of revascularization in chronic total occlusion on left ventricular function using novel echocardiographic techniques. METHODS: A total of 129 patients with chronic total occlusion who underwent revascularization between April 2011 and November 2012 were included in this study. Echocardiographic assessments with two-dimensional speckle tracking echocardiography and real-time three-dimensional echocardiography were performed before the procedure and one month after the procedure. The left ventricular ejection fraction, left ventricular volumes, and three-dimensional systolic dyssynchrony index were quantified. RESULTS: An immediate procedural success was obtained in 118 patients (91.5%). There were no acute or subacute stent thromboses during follow-up. The mean left ventricular ejection fraction significantly increased (p,0.001), while the left ventricular end-diastolic and end-systolic volumes significantly decreased (p = 0.001 and p,0.001, respectively). The three-dimensional systolic dyssynchrony index also decreased significantly (p,0.001). The global longitudinal strain showed a significant increase after successful revascularization (p,0.001). An increase in the global longitudinal strain was correlated with an increase in the left ventricular ejection fraction (r = 0.27, p = 0.02). The patients with a left ventricular ejection fraction $50% displayed a greater improvement in the global longitudinal strain, and the patients with diabetes showed less improvement. CONCLUSIONS: Using novel echocardiographic techniques, our results showed that restoring the coronary blood flow in chronic total occlusion patients reduces the left ventricular volumes and improves the left ventricular ejection fraction and the global longitudinal strain of hibernating myocardium. KEYWORDS: Chronic Total Occlusions; Left Ventricular Function; Percutaneous Coronary Intervention. Erdogan E, Akkaya M, Bacaksiz A, Tasal A, So¨nmez O, Elbey MA, et al. Early assessment of percutaneous coronary interventions for chronic total occlusions analyzed by novel echocardiographic techniques. Clinics. 2013;68(10):1333-1337. Received for publication on June 14, 2013; First review completed on July 22, 2013; Accepted for publication on July 27, 2013 E-mail: drercanerdogan@gmail.com Tel.: + 90 212 453 17 00

collaterals are capable of maintaining myocardial viability at rest, they may fail to provide adequate blood flow during exercise, which can result in angina. Successful percutaneous coronary interventions (PCIs) of CTOs have been shown to improve the left ventricular (LV) systolic function, reduce angina, increase exercise capacity, and reduce the need for late bypass surgery (3-5). An accurate assessment of LV function by determining the LV volumes and the ejection fraction (EF) is important in evaluating the prognoses of patients with CAD. Twodimensional speckle tracking echocardiography (2D-STE) can assess the global LV function, and it is superior for EF measurements because it is angle-independent, less subject to artifacts, and easier to conduct than Doppler-derived tissue velocity imaging (6,7). Based on 2D-STE, automated

& INTRODUCTION Coronary artery chronic total occlusion (CTO) is one of the most challenging obstacles faced by interventional cardiologists. Approximately one-third to one-half of the patients with significant coronary artery disease (CAD) on angiography have at least one CTO (1,2). Although

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)07

1333


Echocardiographic studies in patients with CTO Erdogan E et al.

CLINICS 2013;68(10):1333-1337

who were blinded to the clinical data, with a commercially available system (Philips iE33, Bothell, WA, USA) equipped with a broadband S5-1 transducer (frequency transmitted: 1.7 MHz; received: 3.4 MHz). The parasternal long-axis views were used to derive the M-Mode measurements of the left atrial (LA) size and the LV end-diastolic (LVEDD) and end-systolic (LVESD) dimensions. The endocardial borders were traced in the end-systolic frame of the 2D images from the three apical views. Four consecutive endexpiratory cardiac cycles using high-frame-rate (50 Hz or more) harmonic imaging in each echocardiographic view were acquired. The speckles were tracked frame by-frame throughout the LV wall during the cardiac cycle, and basal, mid, and apical regions of interest were created. The operator manually adjusted the segments that failed to be tracked. All of the measurements were made blinded to the other results and the clinical details. Real-time three-dimensional echocardiography (RT3DE) images were obtained from an apical window with the patient in the same position as for 2D-STE. Full-volume images were gathered over four cardiac cycles using a matrix array transducer (64 transducer; Philips iE33, Andover, MA). Measurements of the 3D-LV volumes and the 3D-EF were performed off-line (QLAB workstation using 3D-Advanced Quantification, Philips). The systolic dyssynchrony index (SDI) was defined as the standard deviation of the time to minimum systolic volume of the 16 LV segments, expressed as a percent of the RR duration. A higher SDI indicated greater LV dyssynchrony. Intra-observer variability was determined by the observer repeating the measurement of the GLS in 20 randomly selected patients ten days after the first measurement. Interobserver variability was determined by another observer measuring these variables in the same database. The intraand inter- observer reproducibility of GLS parameter was shown acceptable. The intra- and inter- observer variations were 5.4% and 6.7% for GLS, respectively.

function imaging is used to reflect the systolic LV function by assessment of the LV global longitudinal strain (GLS). Longitudinal tissue deformation is evaluated by frameby-frame tracking of the individual speckles throughout the cardiac cycle. This imaging technique discriminates between active and passive myocardial motion and enables angle-independent quantification of myocardial deformation in two dimensions (8,9). 2D-STE is based on tracking the characteristic speckle patterns created by interference of ultrasound beams in the myocardium, and its accuracy has been confirmed using sonomicrometry and magnetic resonance imaging (MRI) as reference methods (10). The aim of this study was to investigate the changes in the LV volumes, LVEF, and GLS of patients with CTO, before and one month after PCI, using novel echocardiographic methods.

& MATERIALS AND METHODS Patient selection A total of 129 patients with CTO who had attempted PCI at Bezmialem Foundation University Hospital between April 2011 and November 2012 were screened for inclusion in this study. Eleven patients who had failed PCI were excluded, and 118 patients who had been successfully revascularized were included in the study. All of the patients underwent physical examination, chest X-ray, 12lead electrocardiography (ECG), and transthoracic echocardiographic (2DE) evaluations. Echocardiography was also repeated one month after the revascularization procedure. CTO was defined as lumen compromise resulting in either Thrombolysis In Myocardial Infarction (TIMI) flow grade 0 or 1, with a likely duration of .3 months (11). All of the patients included had a native vessel occlusion estimated to be of at least three months in duration based on a history of sudden chest pain, a previous myocardial infarction (MI) in the same target vessel territory, or the time between diagnosis made on coronary angiography and PCI. All of the patients had symptomatic angina and/or a positive functional ischemia study. PCI and stent implantation were performed in a standard manner. Drug-eluting stents (DESs) were used in all of the angioplasty procedures. Heparin was administered to maintain an activated clotting time .250 seconds. A PCI of the CTO was performed with modern techniques such as bilateral injections; specialized hydrophilic, tapered tip, and stiff wires; parallel wires; microcatheters; and a retrograde approach when possible. After the PCI, all of the patients were prescribed lifelong aspirin. Clopidogrel was prescribed for at least 12 months in all of the patients. The patients were followed prospectively by a telephone interview or an outpatient visit after 30 days. Procedural success was defined as the successful recanalization and dilation of at least one CTO per patient with or without stent implantation, a residual stenosis of ,50%, and a TIMI flow .2. The procedure time was defined as the time difference between the patient’s entry and exit from the catheterization room. The study protocol was approved by the institutional clinical research and ethics committee of Bezmialem Foundation University Hospital, and all of the patients provided written informed consent. 2DE and 2D-STE were performed on the subjects at rest in the left lateral decubitus position with synchronized electrocardiography by two professional cardiologists,

Statistical analysis The continuous variables are reported as the mean ¡ standard deviations (SD), and the categorical variables are expressed as percentages. Comparisons of the categorical and continuous variables between the two groups were performed using the x2 test and an unpaired t-test, respectively. The GLS and velocities were compared using an independent two sample t-test. The correlation between the GLS and LVEF variables was tested using a correlation analysis. The delta values are defined as the difference between the first month and the preprocedure value. A value of p,0.05 was considered statistically significant. The SPSS 15.0 for Windows statistical software package program (SPSS Inc., Chicago, IL, USA) was used for the statistical analysis.

& RESULTS Table 1 shows the baseline demographic, angiographic, and procedural characteristics of the study patients. The mean age of the patients was 58¡9 years. There were no acute or subacute stent thrombosis. There was no death, acute MI, coronary perforation, emergency re-PCI, emergency coronary artery bypass graft surgery (CABG), or acute stroke during the periprocedural period. Pericardiocentesis was required for only one patient because of tamponade. The

1334


CLINICS 2013;68(10):1333-1337

Echocardiographic studies in patients with CTO Erdogan E et al.

that the improvement in the myocardial contractile function based on strain analysis seems to be more significant in the patients with a LVEF $50% and less significant in the patients with DM. To the best of our knowledge, this is the first study showing the benefit of revascularization of CTOs on LV function using 2DSTE and RT3DE. LV systolic function is most commonly assessed by the LVEF using 2DE. The assessment of patients with CTO may be challenging with 2DE because many of these patients suffer from long-term myocardial ischemia or MI and develop aneurysmal formation or advanced ventricular remodeling. Strain and strain rate imaging using the 2DSTE method is a novel echocardiographic technique for the evaluation of regional and global myocardial function, is relatively free from angle dependency and the frame-rate limitations of tissue Doppler imaging, and enables calculations to be made more easily. The global LV contractile function, as assessed by 2D-STE, was shown to be superior to EF measurements by 2DE (6,7). RT3DE is the other new echocardiographic technique for calculating the actual LV volume based on the actual LV shape, rather than on geometrical assumptions. It has good reproducibility even in cases of heart cavity deformation or segmental wall motion abnormalities. It is more accurate than 2DE, and its accuracy approaches that of the gold standard, namely MRI (12,13). Despite the presence of coronary collaterals, the majority of patients with a CTO show various degrees of LV dysfunction. The possibility of a functional recovery and its beneficial effect on survival are the rationale for the often technically demanding attempt to recanalize a CTO (3-5,1418). Recovery of LV function in chronically ischemic myocardium depends on the presence of hibernating or stunned but viable myocardium (19). When reperfusion is acquired, the hibernating myocardium at least partially restores the contractile function, resulting in regional and global LV function recovery (20). Baks et al. showed the beneficial effect of successful CTO revascularization on the end-systolic and end-diastolic volumes. They showed that the extent of dysfunctional but viable myocardium before revascularization was related to an improvement in the endsystolic volume and LVEF (21). In the present study, we found a reduction in LV volumes; however, we used RT3DE, which is more robust than 2DE. Cheng et al. used contrast-enhanced MRI to demonstrate that successful CTOPCI results in improved LV function and attenuated LV remodeling if the vessel patency is maintained (22). The improvements in LVEF and myocardial function in our study, based on 2DSTE and RT3DE, are consistent with the results of Cheng et al. The improvements in the LVEF and GLS observed in the current study may be a result of the recovered hibernating myocardium. Multiple retrospective studies have shown the potential benefit of PCI in patients with CTO. Successful treatment improves anginal symptoms, exercise tolerance, and LV function. The prospective Total Occlusion Angioplasty Study (TOAST-GISE) showed that revascularization of a CTO is associated with relieved angina and reduces the 12month incidence of cardiac death or MI and the need for CABG (5). Joyal et al. recently identified 13 observational studies comparing the outcomes after successful versus failed CTO recanalizations, showing that successful CTO recanalization was associated with a 44% reduction in mortality, a 78% reduction in the subsequent need for CABG, and a 55% reduction in residual or recurrent angina

Table 1 - The demographic, angiographic, and procedural characteristics of the patients. Patients (n = 129) Age (years) Gender (men) (n, %) Hypertension (n, %) Diabetes mellitus (n, %) Hyperlipidemia (n, %) Smoking (n, %) $2 CCS angina (n, %) Left anterior descending artery (n, %) Left circumflex artery (n, %) Right coronary artery (n, %) Procedure time (min) Fluoroscopic time (min) Amount of contrast media (ml) Contrast nephropathy (n, %)

58¡9 106 (82) 110 (85) 47 (37) 114 (88) 39 (30) 63 (49) 35 (27) 22 (17) 72 (56) 79¡39 34¡19 492¡174 14 (11)

CCS: Canadian Cardiovascular Society.

mean procedure time was 79¡39 min, the fluoroscopy time was 34¡19 min, and the amount of contrast was 492¡174 ml. Contrast-induced nephropathy was developed in 14 (11%) patients, and one patient underwent hemodialysis. Half of the patients (63 patients, 48.8%) suffered from angina pectoris ($2 CCS) before the procedure, and the occurrence of angina pectoris decreased significantly after PCI. Compared with the measurements before the procedure, the LVEDV and LVESV decreased significantly (p = 0.001 and p,0.001, respectively) and the mean LVEF increased significantly (p,0.001) after the procedure. The SDI derived from RT3DE decreased significantly after successful revascularization (p,0.001). The GLS increased significantly one month after PCI (p,0.001) (Table 2). We found that the increase in the GLS was correlated with an improvement in the LVEF (r = 0.27, p = 0.02; Figure 1). The patients with an LVEF $50% displayed greater improvement in the GLS compared with the patients with an LVEF ,50% (1.1¡0.9 vs. 0.12¡0.3, p,0.001). The patients with diabetes mellitus (DM) showed a lower degree of GLS improvement compared with the patients without DM (1.1¡1.0 vs. 0.62¡0.6, p = 0.07).

& DISCUSSION In this study, we used 2DSTE and RT3DE to determine that successful revascularization of CTO of the coronary arteries may improve the LV contractile function. We found Table 2 - Echocardiographic measures of the successfully revascularized patients before and one month after the procedure (n = 118). Preprocedure LVEDD (mm) 52.6¡4.9 LVESD (mm) 33.5¡5.8 3D end-diastolic volume (ml) 76.22¡22.55 3D end-systolic volume (ml) 34.54¡16.49 Mean 3D-LVEF (%) 56.31¡9.81 3D-SDI (%) 4.2¡3.1 Global longitudinal strain -12.51¡1.81 (%)

One month

p-value

52.3¡5.2 33.4¡5.9 71.98¡22.64 31.63¡16.22 58.32¡10.2 3.4¡2.3 -13.23¡2.29

0.03 0.3 0.001 ,0.001 ,0.001 ,0.001 ,0.001

3D-LVEF: three-dimensional left ventricular ejection fraction, LVEDD: left ventricle end-diastolic diameter, LVESD: left ventricle end-systolic diameter, SDI: systolic dyssynchrony index.

1335


Echocardiographic studies in patients with CTO Erdogan E et al.

CLINICS 2013;68(10):1333-1337

Figure 1 - Relationship between recovery of the global longitudinal strain (DGLS) and improvement of the left ventricular ejection fraction (DLVEF) during follow-up.

(23). In accordance with the above mentioned studies, successful revascularization of CTOs in our study resulted in a significant improvement in anginal symptoms. Approximately half of the patients did suffer from angina CCS 2 or greater before the procedure, and none of them had CCS 2 or greater after the procedure. Numerous experimental studies have demonstrated that ischemia depresses the regional systolic function, resulting in severe systolic dyssynchrony, prolonged tension development in the ischemic regions, and impaired global relaxation (24,25). Bonow et al. reported that CAD was associated with dyssynchrony, which improved after mechanical revascularization (26). In the present study, the SDI derived by RT3DE, which is a marker of dyssynchrony, was improved one month after CTO revascularization. The improvement in dyssynchrony may be related to an improvement in the hibernating myocardium and in decreased LV volumes. Endothelial dysfunction, structural changes of the microcirculation, and a negative influence on the development and prognosis of CAD are well-established features of patients with DM (27-29). Patients with DM have a greater extent of CAD and are prone to impaired clinical outcomes compared with nondiabetic patients (30-32). A previous observational study about CTO PCI in diabetics was

performed by Safley et al. They reported that DM patients do not seem to have the same survival benefits from successful PCI of a CTO as patients without DM (33). In our study, we found relatively less improvement in the GLS in diabetic patients. It is still not clear why diabetics benefit less from PCI of a CTO, but we speculate that the extensive atherosclerosis and impaired microvascular circulation may explain the worse outcomes in this population.

Limitations There are several limitations to this study. The main limitation is its observational nature and the fact that it was nonrandomized. Additionally, the duration of occlusion was not known with certainty in some of the cases. A lack of follow-up data beyond the hospital stay is another limitation. Our results showed that restoring the blood flow to dysfunctional but viable myocardium led to a moderate improvement in LV function and a reduction in the adverse remodeling in the majority of patients with a CTO. Angiographical success was accompanied by anginal relief.

& AUTHOR CONTRIBUTIONS Erdogan E contributed to the study design, data collection and interpretation, statistical analysis, manuscript preparation, and literature

1336


CLINICS 2013;68(10):1333-1337

Echocardiographic studies in patients with CTO Erdogan E et al.

search. Akkaya M contributed to the study design, data collection and interpretation, and literature search. Bacaksiz A contributed to the data interpretation, manuscript preparation, and literature search. Tasal A, So¨nmez O, Elbey MA, Kul S, Turfan M, Vatankulu MA, and Go¨ktekin O contributed to the data collection and interpretation and statistical analysis.

16.

17.

& REFERENCES 1. Christofferson RD, Lehmann KG, Martin GV, Every N, Caldwell JH, Kapadia SR. Effect of chronic total occlusion on treatment strategy. Am J Cardiol. 2005;95(9):1088-91, http://dx.doi.org/10.1016/j.amjcard. 2004.12.065. 2. Srinivas VS, Brooks MM, Detre KM, King SB, Jacobs AK, Johnston J, et al. Contemporary percutaneous coronary intervention versus balloon angioplasty for multivessel coronary artery disease: a comparison of the National Heart, Lung and Blood Institute Dynamic Registry and the Bypass Angioplasty Revascularisation Investigation (BARI) study. Circulation. 2002;106(13):1627-33, http://dx.doi.org/10.1161/01.CIR. 0000031570.27023.79. 3. Melchior JP, Doriot PA, Chatelain P, Meier B, Urban P, Finci L, et al. Improvement of left ventricular contraction and relaxation synchronism after recanalization of chronic total coronary occlusion by angioplasty. J Am Coll Cardiol. 1987;9(4):763-8, http://dx.doi.org/10.1016/S07351097(87)80230-9. 4. Suero J, Marso SP, Jones PG, Laster SB, Huber KC, Giorgi LV, et al. Procedural outcomes and long term survival among patients undergoing percutaneous coronary intervention of a chronic total occlusion in native coronary arteries: a 20 year experience. J Am Coll Cardiol. 2001;38(2):40914, http://dx.doi.org/10.1016/S0735-1097(01)01349-3. 5. Olivari Z, Rubartelli P, Pisicone F, Ettori F, Fontanelli A, Salemme L, et al. On behalf of TOAST-GISE Investigators. Immediate results and one-year clinical outcome after percutaneous coronary interventions in chronic total occlusions, (TOAST-GISSE). J Am Coll Cardiol. 2003;41(10):1672-8, http://dx.doi.org/10.1016/S0735-1097(03)00312-7. 6. Marwick TH. Should we be evaluating the ventricle or the myocardium? Advances in tissue characterization. J Am Soc Echocardiogr. 2004;17(2):168-72, http://dx.doi.org/10.1016/j.echo.2003.10.021 7. Leitman M, Lysyansky P, Sidenko S, Shir V, Peleg E, Binenbaum M, et al. Two-dimensional strain-a novel software for real-time quantitative echocardiographic assessment of myocardial function. J Am Soc Echocardiogr. 2004;17(10):1021-9, http://dx.doi.org/10.1016/j.echo.2004. 06.019 8. Reisner SA, Lysyansky P, Agmon Y, Mutlak D, Lessick J, Friedman Z. Global longitudinal strain: a novel index of left ventricular systolic function. J Am Soc Echocardiogr. 2004;17(6):630-3, http://dx.doi.org/10. 1016/j.echo.2004.02.011. 9. Delgado V, Mollema SA, Ypenburg C, Tops LF, van der Wall EE, Schalij MJ, et al. Relation between global left ventricular longitudinal strain assessed with novel automated function imaging and biplane left ventricular ejection fraction in patients with coronary artery disease. J Am Soc Echocardiogr. 2008;21(11):1244-50, http://dx.doi.org/10.1016/ j.echo.2008.08.010. 10. Amundsen BH, Helle-Valle T, Edvardsen T, Torp H, Crosby J, Lyseggen E, et al. Noninvasive myocardial strain measurement by speckle tracking echocardiography: Validation against sonomicrometry and tagged magnetic resonance imaging. J Am Coll Cardiol. 2006;47(4):789-93, http://dx.doi.org/10.1016/j.jacc.2005.10.040. 11. Stone GW, Kandzari DE, Mehran R, Colombo A, Schwartz RS, Bailey S, et al. Percutaneous recanalization of chronically occluded coronary arteries: a consensus document: part I. Circulation. 2005;112(15):2364-72, http://dx.doi.org/10.1161/CIRCULATIONAHA.104.481283. 12. Bauer F, Shiota T, Qin JX, White RD, Thomas JD. Measurement of left atrial and ventricular volume in real-time 3D echocardiography: Validation by nuclear magnetic resonance. Arch Mal Coeur Vaiss. 2001;94(1):31-8. 13. Jenkins C, Bricknell K, Hanekom L, Marwick TH. Reproducibilityand accuracy of echocardiographic measurements of left ventricular parameters using real-time three-dimensional echocardiography. J Am Coll Cardiol. 2004;44(4):878-86, http://dx.doi.org/10.1016/j.jacc.2004.05.050. 14. Engelstein E, Terres W, Hofmann D, Hansen L, Hamm CW. Improved global and regional left ventricular function after angioplasty for chronic coronary occlusion. Clin Investig. 1994;72(6):442-7. 15. Danchin N, Angioi M, Cador R, Tricoche O, Dibon O, Juillie`re Y, et al. Effect of late percutaneous angioplastic recanalization of total coronary

18.

19. 20. 21.

22.

23. 24. 25.

26.

27.

28.

29.

30.

31. 32. 33.

1337

artery occlusion on left ventricular remodeling, ejection fraction, and regional wall motion. J Am Coll Cardiol. 1996;78(7):729-35. Van Belle E, Blouard P, McFadden EP, Lablanche JM, Bauters C, Bertrand ME. Effects of stenting of recent or chronic coronary occlusions on late vessel patency and left ventricular function. J Am Coll Cardiol. 1997;80(9):1150-4. Sirnes PA, Myreng Y, Molstad P, Bonarjee V, Golf S. Improvement in left ventricular ejection fraction and wall motion after successful recanalization of chronic coronary occlusions. Eur Heart J. 1998;19(2):273-81, http://dx.doi.org/10.1053/euhj.1997.0617. Dzavik V, Carere RG, Mancini GBJ, Cohen EA, Catellier D, Anderson TE, et al. Predictors of improvement in left ventricular function after percutaneous revascularization of occluded coronary arteries: a report from the Total Occlusion Study of Canada (TOSCA ). Am Heart J. 2001;142(2):301-8, http://dx.doi.org/10.1067/mhj.2001.116960. Wijns W, Vatner SF, Camici PG. Hibernating myocardium. N Engl J Med. 1998;339(3):173-81. Bax JJ, Visser FC, Poldermans D, Elhendy A, Cornel JH, Boersma E, et al. Relationship between preoperative viability and postoperative improvement in LVEF and heart failure symptoms. J Nucl Med. 2001;42(1):79-86. Baks T, van Geuns RJ, Duncker DJ, Cademartiri F, Mollet NR, Krestin GP, et al. Prediction of left ventricular function after drug-eluting stent implantation for chronic total coronary occlusions. J Am Coll Cardiol. 2006;47(4):721-5, http://dx.doi.org/10.1016/j.jacc.2005.10.042. Cheng ASH, Selvanayagam JB, Jerosch-Herold M, van Gaal WJ, Karamitsos TD, Neubauer S, et al. Percutaneous treatment of chronic total coronary occlusions improves regional hyperemic myocardial blood flow and contractility: insights from quantitative cardiovascular magnetic resonance imaging. JACC Cardiovasc Interv. 2008;1(1):44-53, http://dx.doi.org/10.1016/j.jcin.2007.11.003. Joyal D, Afilalo J, Rinfret S. Effectiveness of recanalization of chronic total occlusions: a systematic review and meta-analysis. Am Heart J. 2010;160(1):179-87, http://dx.doi.org/10.1016/j.ahj.2010.04.015. Kumada T, Karliner JS, Pouleur H, Gallagher KP, Shirato K, Ross J Jr. Effects of coronary occlusion on early ventricular diastolic events in conscious dogs. Am J Physiol. 1979;237(5):H542-9. Green MV, Jones-Collins BA, Bacharach SL, Findley SL, Patterson RE, Larson SM. Scintigraphic quantitation of asynchronous myocardial motion during the left ventricular isovolumic relaxation period: a study in the dog during acute ischemia. J Am Coll Cardiol. 1984;4(1):72-9, http://dx.doi.org/10.1016/S0735-1097(84)80321-6. Bonow RO, Vitale DF, Bacharach SL, Frederick TM, Kent KM, Green MV. Asynchronous left ventricular regional function and impaired global diastolic filling in patients with coronary artery disease: reversal after coronary angioplasty. Circulation. 1985;71(2):297-307, http://dx.doi.org/ 10.1161/01.CIR.71.2.297. Schofield I, Mlik R, Izzard A, Austin C, Heagerty A. Vascular structural and functional changes in type 2 diabetes mellitus: evidence for the roles of abnormal myogenic responsiveness and dyslipidemia. Circulation. 2002;106(24):3037-43, http://dx.doi.org/10.1161/01.CIR.0000041432.80615. A5. Watts GF, O’Brien SF, Silvester W, Millar JA. Impaired endotheliumdependent and independent dilatation of forearm resistance arteries in men with diettreated non-insulin-dependent diabetes: role of dyslipidaemia. Clin Sci (Lond). 1996;91(5):567-73. Haffner SM, Lehto S, Ro¨nnemaa T, Pyo¨ra¨la¨ K, Laakso M. Mortality from coronary heart disease in subjects with type 2 diabetes and in nondiabetic subjects with and without prior myocardial infarction. N Engl J Med. 1998;339(4):229-34. Malmberg K, Yusuf S, Gerstein HC, Brown J, Zhao F, Hunt D, et al. Impact of diabetes on long-term prognosis in patients with unstable angina and non-Q-wave myocardial infarction: results of the OASIS (Organization to Assess Strategies for Ischemic Syndromes) Registry. Circulation. 2000;102(9):1014-9, http://dx.doi.org/10.1161/01.CIR.102.9. 1014. Comparison of coronary bypass surgery with angioplasty in patients with multivessel disease. The Bypass Angioplasty Revascularization Investigation (BARI) Investigators. N Engl J Med. 1996;335(4):217-25. Gu K, Cowie CC, Harris MI. Diabetes and decline in heart disease mortality in US adults. The Journal of the American Medical Association: JAMA. 1999;281(14):1291-7, http://dx.doi.org/10.1001/jama.281.14.1291. Safley DM, House JA, Rutherford BD, Marso SP. Success rates of percutaneous coronary intervention of chronic total occlusions and longterm survival in patients with diabetes mellitus. Diab Vasc Dis Res. 2006;3(1):45-51, http://dx.doi.org/10.3132/dvdr.2006.006.


BASIC RESEARCH

Tocotrienol supplementation in postmenopausal osteoporosis: evidence from a laboratory study Norliza Muhammad,I Douglas Alwyn Luke,II Ahmad Nazrun Shuid,I Norazlina Mohamed,I Ima Nirwana SoelaimanI I Universiti Kebangsaan, UKM Medical Faculty Jalan Raja Muda Abdul Aziz, Pharmacology Department, Kuala Lumpur, Malaysia. II Universiti Kebangsaan, Dental Faculty, Department of Oral Biology, Kuala Lumpur, Malaysia.

OBJECTIVE: Accelerated bone loss that occurs in postmenopausal women has been linked to oxidative stress and increased free radicals. We propose the use of antioxidants to prevent and reverse postmenopausal osteoporosis. This study aimed to examine the effects of tocotrienol, a vitamin E analog, on bone loss due to estrogen deficiency. Our previous study showed that tocotrienol increased the trabecular bone volume and trabecular number in ovariectomized rats. In the current study, we investigated the effects of tocotrienol supplementation on various biochemical parameters in a postmenopausal osteoporosis rat model. MATERIALS AND METHODS: A total of 32 female Wistar rats were randomly divided into four groups. The baseline group was sacrificed at the start of the study, and another group was sham operated. The remaining rats were ovariectomized and either given olive oil as a vehicle or treated with tocotrienol at a dose of 60 mg/ kg body weight. After four weeks of treatment, blood was withdrawn for the measurement of interleukin-1 (IL1) and interleukin-6 (IL6) (bone resorbing cytokines), serum osteocalcin (a bone formation marker) and pyridinoline (a bone resorption marker). RESULTS: Tocotrienol supplementation in ovariectomized rats significantly reduced the levels of osteocalcin, IL1 and IL6. However, it did not alter the serum pyridinoline level. CONCLUSION: Tocotrienol prevented osteoporotic bone loss by reducing the high bone turnover rate associated with estrogen deficiency. Therefore, tocotrienol has the potential to be used as an anti-osteoporotic agent in postmenopausal women. KEYWORDS: Estrogen Deficiency; Ovariectomy; Tocotrienol. Muhammad N, Luke DA, Shuid AN, Mohamed N, Soelaiman IN. Tocotrienol supplementation in postmenopausal osteoporosis: evidence from a laboratory study. Clinics. 2013;68(10):1338-1343. Received for publication on May 2, 2013; First review completed on May 14, 2013; Accepted for publication on May 14, 2013 E-mail: imasoel@medic.ukm.my Tel.: 603 4040 5281

M-CSF and RANKL to their respective surface receptors on osteoclast precursors enables them to differentiate into mature multinucleated osteoclast cells. This process is regulated by osteoprotegerin, which competes with RANKL to inhibit osteoclast formation (1,2). Meanwhile, bone resorption causes the release of osteoclast-derived ‘coupling factors’, which are embedded in the bone matrix by osteoblasts during bone formation. These coupling factors include growth factors, such as transforming growth factor beta (TGF-beta), bone morphogenetic proteins and insulin-like growth factor (IGF), as well as factors produced and released by osteoclasts, including cardiotropin-1, which stimulate osteoblast differentiation and bone formation (2). In postmenopausal osteoporosis, estrogen deficiency leads to loss of bone, rendering it susceptible to fracture. The mechanisms for bone loss include RANKL upregulation, which leads to increased osteoclast recruitment and activation; decreased osteoclast apoptosis; reduced osteoprotegerin production by osteoblasts, causing an increase in the RANKL/osteoprotegerin ratio that favors bone resorption; increased expression of bone-resorbing cytokines, such

& INTRODUCTION To maintain its overall health and function, bone continuously undergoes a regeneration process known as bone remodeling. The process involves bone resorption by osteoclasts followed by formation of new bone by osteoblasts. Bone resorption and formation are closely coupled such that the amount of bone destroyed by osteoclasts is equal to the amount of bone formed by osteoblasts. The molecular basis of the coupling process in bone remodeling involves cytokines such as macrophage-colony stimulating factor (M-CSF), receptor activator of nuclear factor kappa b ligand (RANKL) and osteoprotegerin (OPG). The binding of

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)08

1338


CLINICS 2013;68(10):1338-1343

Tocotrienol and postmenopausal bone loss Muhammad N et al.

cardiac puncture. The serum was separated and stored in a deep freezer at a temperature of -70 ˚C.

as M-CSF, tumor necrosis factor-a (TNF-a), interleukin-1 and interleukin-6; and a direct effect on osteoclasts via the inhibition of apoptosis and an increase in the differentiation of osteoclast precursors into mature osteoclasts (3). Reactive oxygen species have widely been considered to be a causal factor in a number of pathological conditions, including osteoporosis. Studies by Bax et al. (4) and Garrett et al. (5) reported that osteoclast differentiation and functions were stimulated by reactive oxygen species. Another study showed that estrogen deficiency lowered antioxidant defenses in osteoclasts, resulting in increased osteoclastic resorption (6). Several of the intracellular signals essential for osteoclast formation, such as nuclear factor-kappa B (NF-kB), c-Jun amino-terminal kinase (JNK) and phosphatidylinositol 3-kinase (PI3K) are sensitive to reactive oxygen species (7). Previous researchers have reported that antioxidant vitamins can effectively reduce oxidative damage both in vitro and in vivo (6,8). In the present study, we determined the effects of vitamin E in the form of tocotrienol on bone metabolism in ovariectomized rats by analyzing the biomarkers of bone turnover.

Serum biochemistry Serum levels of interleukin-1, interleukin-6, osteocalcin and pyridinoline were measured at the end of the experiment using the enzyme immunoassay (EIA) technique. The results obtained with commercially produced rat enzyme immunoassay kits for interleukin-1 (Biosource International, Camarillo, California, USA), interleukin-6 (BenderMed Systems, Vienna, Austria), osteocalcin (Biomedical Technologies, Stoughton, Massachusetts, USA) and pyridinoline (Quidel Corp., San Diego, California, USA) were analyzed using an enzyme immunoassay reader (VERSAmax, ELISA Reader, Molecular Devices LLC, Sunnyvale, California, USA).

Statistical analysis The results are expressed as the mean¡SEM. Data analyses were performed using Statistical Package for Social Sciences software (SPSS, USA). Normality was tested with the Kolmogorov-Smirnov test. Data that were found to be normally distributed were subjected to ANOVA followed by Tukey’s HSD post-hoc analysis. The significance level was set at p#0.05. All the protocols used in this study were approved by the Animal Ethics Committee of the Universiti Kebangsaan Malaysia (approval number FAR/IMA/23-JULY/075).

& MATERIALS AND METHODS Animals A total of 32 female Wistar rats (three months old), weighing 160-190 g, were obtained from the Animal House of the Universiti Kebangsaan Malaysia. The rats were equally divided at random into four groups with eight rats in each group. The baseline group was sacrificed at the start of experiment, and a second group was sham operated. The remaining rats were ovariectomized and either given olive oil or treated with tocotrienol at a dose of 60 mg/kg body weight. The sham rats were also given olive oil. Treatment commenced two weeks after ovariectomy to allow the rats to recuperate. Olive oil or tocotrienol was given orally to the rats using an oral gavage needle six days per week for four weeks. The rats were housed in standard cages in groups of three at room temperature with a 12 h light-dark cycle. The animals were fed with a commercial rat chow diet (Gold Coin, Klang, Selangor, Malaysia), and tap water was provided ad libitum. Daily food intakes and weekly body weights were documented.

& RESULTS Body weights and food intake There was no significant difference in the mean body weights at the start of the experiment. All the rats gained weight throughout the six-week study. Starting from week three until the completion of the study, the ovariectomized rats showed significantly higher body weights compared with the other rats. Tocotrienol supplementation inhibited the increase in body weight observed following ovariectomy (Figure 1). The ovariectomized rats had a higher average daily food intake compared with the sham and tocotrienoltreated groups. The daily food intake of rats supplemented with tocotrienol did not differ significantly from that of the sham rats (Table 1).

Cytokines

Pure tocotrienol

As shown in Figures 2 and 3, ovariectomy caused an increase in the levels of both interleukin-1 and interleukin-6. Treatment with tocotrienol successfully prevented this rise in cytokine levels.

The tocotrienol mixture was prepared by the Palm Oil Research Institute of Malaysia (PORIM; Malaysian Palm Oil Board, Kajang, Selangor, Malaysia) and had the following composition: 37.2% alpha-tocotrienol, 39.1% gamma-tocotrienol and 22.6% delta-tocotrienol. The palm tocotrienol mixture was diluted in olive oil (Bertolli Classico, Italy) to obtain a concentration of 60 mg/kg body weight. The dose chosen was based on our previous study, which showed that at a dose of 60 mg/kg body weight, tocotrienol was able to prevent the oxidative stress-induced increase in interleukin-1, a bone resorbing cytokine, in a rat model (9). This dose is equivalent to 6 mg/kg in humans, or approximately 420 mg for a 70 kg human, after adjusting for differences in surface area (10).

Specimen collection The rats were sacrificed by cervical dislocation under anesthesia with ether. Subsequently, their abdomens were dissected to expose their hearts for blood sampling via

Osteocalcin The osteocalcin level in tocotrienol-treated rats was significantly reduced compared with the ovariectomy control group (Figure 4).

Serum pyridinoline No significant differences were noted in the levels of serum pyridinoline in any of the groups of rats (data not shown).

& DISCUSSION The purpose of this study was to evaluate the effects of pure tocotrienol on bone metabolism in ovariectomized

1339


Tocotrienol and postmenopausal bone loss Muhammad N et al.

CLINICS 2013;68(10):1338-1343

Figure 1 - Mean body weight. aIndicates a significant difference compared with the ovariectomized group (p,0.05). The data are presented as the mean¡SEM. Ovx = ovariectomy. Ovx+PTT = ovariectomy treated with pure tocotrienol.

female rats by measuring biochemical parameters including the levels of bone-resorbing cytokines (interleukin-1 and interleukin-6), a bone formation marker (osteocalcin) and a bone resorption marker (serum pyridinoline). The ovariectomized rat has become a widely accepted model of human postmenopausal osteoporosis because of the many similarities in their pathophysiological mechanisms (11,12). In both species, bone loss occurs rapidly after the onset of estrogen deficiency, resulting in a reduction in bone mineral density (13). The responses to mechanical influences (e.g., exercise) and various treatment modalities are also similar (14). Although rats are skeletally mature at 10 months old, the cheaper and more readily available three-month-old rats are generally used because their bone loss characteristics are similar to those of the aged rat model. Rats younger than 3 months old are not suitable models for studying bone loss caused by ovarian deficiency because the normal processes of bone remodeling and skeletal maturation during growth may mask the effects of ovariectomy-induced bone loss (15). In our previous study, we observed no reduction in trabecular bone volume in ovariectomized rats supplemented with pure palm tocotrienol. All the structural parameters (with the exception of trabecular thickness) were maintained at the levels of sham rats (16). The results of the structural histomorphometric analysis suggest that tocotrienols prevent bone resorption by reducing the trabecular perforation that typically occurs during estrogen deficiency. We also reported that palm tocotrienols significantly improved bone dynamic parameters in estrogen-deficient rats by increasing the mineralizing surface, the mineral

apposition rate and the bone formation rate (17). The effects of tocotrienol on dynamic parameters indicate that this form of vitamin E has anabolic properties that result in increased bone formation. This observation has been confirmed in a study performed by Shuid et al. (18). Ovarian hormone deficiency increases bone resorption, which results in bone mineral loss from the skeleton. Lack of estrogen disrupts calcium homeostasis, leading to a negative calcium balance via a combination of decreased intestinal absorption and increased renal excretion (19). In addition, reduced estrogen contributes to oxidative stress by producing excessive free radicals. This process is associated with low levels of antioxidant enzymes, such as superoxide dismutase, glutathione peroxidase and glutathione-S-transferase (20). These enzymes are responsible for metabolizing free radical molecules to non-radical products. Osteoporotic patients were found to have low levels of antioxidants (21) and high levels of free radical species (22). Although toxic to the bone-forming osteoblasts (23), free radicals activate osteoclastic bone resorption, which is responsible for bone loss (5). Bone resorption in postmenopausal osteoporosis has also been linked to the inflammatory process. Various studies have demonstrated the connection between osteoclasts, M-CSF and inflammatory cytokines such as TNF-a and interleukins 1, 6 and 7. Estrogen deficiency causes

Table 1 - Average food intake. Sham (n = 8) Average food intake, g/day

18.75¡0.35

a

Ovx (n = 8)

Ovx+PTT (n = 8)

26.75¡0.67

21.45¡0.56a

Figure 2 - IL-1 levels in the different groups of rats. * Indicates a significant difference compared with the ovariectomy (Ovx) group (p,0.05). Ovx+PTT = Ovariectomy+pure tocotrienol. The data are presented as the mean¡SEM.

a

Indicates a significant difference compared with the ovariectomized group (p,0.05). The data are presented as the mean¡SEM. Ovx = ovariectomy. Ovx+PTT = ovariectomy treated with pure tocotrienol.

1340


CLINICS 2013;68(10):1338-1343

Tocotrienol and postmenopausal bone loss Muhammad N et al.

as osteoporosis. An earlier study using palm vitamin E (which contains a higher percentage of tocotrienols than tocopherols) showed that this vitamin was effective in preventing the loss of bone mineral density in osteoporotic male rats (29). The same study also showed that palm vitamin E increased the calcium content in rats with osteoporosis induced by orchidectomy. Similarly, a study performed by Norazlina et al. (30) showed that vitamin E deficiency impaired bone calcification, whereas supplementation with palm vitamin E improved the bone calcium content in growing rats. The role of antioxidants in scavenging reactive oxygen species during oxidative stress is well established. Tocotrienol is a powerful antioxidant from the vitamin E family. This family consists of eight naturally occurring isoforms including a-, b-, c- and d-tocopherols as well as a-, b-, c- and d-tocotrienols. Significant attention has been focused on tocopherol, most likely because of its abundance. Tocotrienols are similar to tocopherols except that they possess three trans double bonds in the hydrocarbon tail instead of a saturated phytyl tail (31). This unique structure makes tocotrienol a more potent antioxidant compared with tocopherol. Recent scientific studies have shown that tocotrienol is better able to scavenge free radicals compared with tocopherol (32-34), most likely because the unsaturated side chain of tocotrienol penetrates tissues more efficiently, allowing it to be better distributed in the fatty layers of the cell membrane (35). Other beneficial effects of tocotrienols such as their anti-cancer, neuroprotective and cholesterol-lowering properties, have also been reported (36-38). We did not measure free radicals or antioxidant status in this experiment, although other studies have shown that ovariectomy caused an increase in reactive oxygen species and a decrease in the levels of thiol antioxidants, whereas administration of 17-beta-estradiol reversed these effects and prevented bone loss (6,39). We did, however, conduct a study to measure the level of thiobarbituric acid-reactive substances (TBARSs), which is an index of lipid peroxidation, and the levels of the antioxidant enzymes glutathione peroxidase and superoxide dismutase in the femurs of normal male rats (40). It was shown that rats supplemented with tocotrienol had a lower TBARS level; however, the

Figure 3 - IL-6 levels in the different groups of rats. * Indicates a significant difference compared with the ovariectomy (Ovx) group (p,0.05). Ovx+PTT = Ovariectomy+pure tocotrienol. The data are presented as the meanยกSEM.

increased production of inflammatory cytokines, which stimulate osteoclasts to resorb bone via the binding of RANKL to its receptor (RANK) (24). In our current study, ovariectomized rats had elevated levels of interleukins 1 and 6. The osteocalcin level, which is a marker of bone formation, was also increased. This is consistent with previous findings that bone loss in ovariectomy is due to a high bone turnover rate with resorption exceeding formation (11,25). The increase in the levels of cytokines and osteocalcin in ovariectomized rats was prevented by supplementation with tocotrienols. This finding is in agreement with our earlier studies, in which tocotrienols were able to reduce the interleukin-1 and interleukin-6 levels in a free radical-induced osteoporotic rat model (9). The lack of a serum pyridinoline response in this study could be due to the short duration of the study period. Most studies examining serum pyridinoline were carried out for longer durations, the average being 16 weeks (26,27). In these studies, serum pyridinolines in ovariectomized animals were higher than those in the sham group. Equivalent results were obtained in studies using urinary pyridinoline as a marker for bone resorption (28). Our histomorphometric and biochemical results strongly indicate that palm tocotrienol was able to prevent the loss of trabecular bone in accelerated bone loss conditions such

Figure 4 - Osteocalcin levels in the different groups of rats. * Indicates a significant difference compared with the ovariectomy (Ovx) group (p,0.05). Ovx+PTT = Ovariectomy+pure tocotrienol. The data are presented as the meanยกSEM.

1341


Tocotrienol and postmenopausal bone loss Muhammad N et al.

CLINICS 2013;68(10):1338-1343

13. Ima-Nirwana S, Norazlina M and Khalid BAK. Pattern of bone mineral density in growing male and female rats after gonadectomy. J Asean Fed Endoc Soc. 1998;16:21-6. 14. Frost HM, Jee WSS. On the rat model of human osteopenias and osteoporoses. J Bone Miner Res. 1992;18:227-36. 15. Kalu DN. The ovariectomized rat model of postmenopausal bone loss. Bone Miner. 1991;15(3):175-91. 16. Muhammad N, Luke DA, Shuid AN, Mohamed N, Soelaiman IN. Two Different Isomers of Vitamin E Prevent Bone Loss in Postmenopausal Osteoporosis Rat Model. Evidence-Based Complementary and Alternative Medicine. 2012. 17. Soelaiman IN, Ming W, Abu Bakar R, Hashnan NA, Mohd Ali H, Mohamed N, et al. Palm tocotrienol supplementation enhanced bone formation in oestrogen-deficient rats. Int J Endocrinol. 2012;2012:532862. 18. Shuid AN, Mehat Z, Mohamed N, Muhammad N, Soelaiman IN. Vitamin E exhibits bone anabolic actions in normal male rats. J Bone Miner Metab. 2010(2):149-56. 19. Draper CR, Dick IM, Prince RL. The effect of estrogen deficiency on calcium balance in mature rats. Calcif Tissue Int. 1999;64(4):325-8, http://dx.doi.org/10.1007/s002239900627. 20. Muthusami S, Ramachandran I, Muthusamy B, Vasudevan G, Prabhu V. Subramaniam V, et al. Ovariectomy induces oxidative stress and impairs bone antioxidant system in adult rats. Clin Chim Acta. 2005;360(1–2):816. 21. Maggio D, Barabani M, Pierandrei M, Polidori MC, Catani M, Mecocci P, et al. Marked Decrease in Plasma Antioxidants in Aged Osteoporotic Women: Results of a Cross-Sectional Study. J Clin Endocrinol Metab. 2003;88(4):1523-7, http://dx.doi.org/10.1210/jc.2002-021496. 22. Sontakke AN and Tare RS. A duality in the roles of reactive oxygen species with respect to bone metabolism. Clin Chim Acta. 2002;318(1– 2):145-8, http://dx.doi.org/10.1016/S0009-8981(01)00766-5. 23. Moreau MF, Chappard D, Lesourd M, Montheard JP, Basle MF. Free radicals and side products released during methylmethacrylate polymerization are cytotoxic for osteoblastic cells. J Biomed Mater Res. 1998;40(1):124-31, http://dx.doi.org/10.1002/(SICI)1097-4636(199804) 40:1,124::AID-JBM14.3.0.CO;2-O. 24. Mundy GR. Osteoporosis and inflammation. Nutr Rev. 2007;65(12):S14751, http://dx.doi.org/10.1301/nr.2007.dec.S147-S151. 25. Wronski T J, Cintron M, Doherty AL, Dann LM. Estrogen treatment prevents osteopenia and depresses bone turnover in ovariectomized rats. Endocrinology. 1988;123(2):681-6, http://dx.doi.org/10.1210/endo-1232-681. 26. Goss PE, Qi S, Josse RG, Pritzker KP, Mendes M, Hu H, et al. The steroidal aromatase inhibitor exemestane prevents bone loss in ovariectomized rats. Bone. 2004;34(3):384-92, http://dx.doi.org/10.1016/j. bone.2003.11.006. 27. Watkins BA, Li Y, Seifert MF. Dietary ratio of n-6/n-3 PUFAs and docosahexaenoic acid: actions on bone mineral and serum biomarkers in ovariectomized rats. J Nutr Biochem. 2006;17(4):282-9, http://dx.doi. org/10.1016/j.jnutbio.2005.05.012. 28. Stancı´kova´ M, Svı´k K, Istok R, Rovensky´ J, Velebny´ V. The effects of hyaluronan on bone resorption and bone mineral density in a rat model of estrogen deficiency-induced osteopenia. Int J Tissue React. 2004;26(1– 2):9-16. 29. Ima-Nirwana S, Kiftiah A, Zainal AG, Norazlina M, Gapor MT, Khalid BAK. Palm Vitamin E prevents osteoporosis in orchidectomized growing male rats. Nat Prod Sci. 2000;6:155-60. 30. Norazlina M, Ima-Nirwana S, Gapor MT, Khalid BAK. Tocotrienols are needed for normal bone calcification in growing female rats. Asia Pac J Clin Nutr. 2002;11(3):194-9, http://dx.doi.org/10.1046/j.1440-6047. 2002.00290.x. 31. Liebecq C. IUPAC-IUBMB Joint Commission on Biochemical Nomenclature and Nomenclature Commission of IUBMB. Portland Press; Biochemical Nomenclature and Related Documents 1992. 32. Begum A, Terao J. Protective effect of alpha-tocotrienol against free radical-induced impairment of erythrocyte deformability. Biosci Biotechnol Biochem. 2002;66(2):398-403, http://dx.doi.org/10.1271/bbb. 66.398. 33. Mutalib MSA, Khaza’ai H, Wahle KWJ. Palm-tocotrienol rich fraction (TRF) is a more effective inhibitor of LDL oxidation and endothelial cell lipid peroxidation than [alpha]-tocopherol in vitro. Food Res Int. 2003;36(5):405-13, http://dx.doi.org/10.1016/S0963-9969(02)00173-4. 34. Qureshi A, Mo H, Packer L, Peterson DM. Isolation and identification of novel tocotrienols from rice bran with hypocholesterolemic, antioxidant, and antitumor properties. J Agric Food Chem. 2000;48(8):3130-40, http://dx.doi.org/10.1021/jf000099t. 35. Suzuki YJ, Tsuchiya M, Wassall SR, Choo YM, Govil G, Kagan VE, et al. Structural and dynamic membrane properties of alpha-tocopherol and alpha-tocotrienol: implication to the molecular mechanism of their antioxidant potency. Biochemistry. 1993;32(40):10692-9, http://dx.doi. org/10.1021/bi00091a020. 36. Ngah WZ, Jarien Z, San MM, Marzuki A, Top GM, Shamaan NA, et al. Effect of tocotrienols on hepatocarcinogenesis induced by 2-acetylaminofluorene in rats. Am J Clin Nutr. 1991;53(4 Suppl):1076S-1081S.

glutathione peroxidase activity was increased. This finding indicates that tocotrienol directly enhances the antioxidant defense system in bone. Another study also showed that supplementation with tocotrienol more successfully prevented bone loss in rats exposed to nicotine compared with tocopherol (41). Therefore, modern treatments for osteoporosis should be directed toward increasing the bone antioxidant defense, and tocotrienol should be considered in the choice of therapy. In conclusion, treatment with tocotrienol at a dose of 60 mg/kg body weight prevented bone loss due to estrogen deficiency. Tocotrienol can be potentially used to prevent postmenopausal osteoporosis in women, provided that sufficient clinical studies are carried out to establish the efficacy and safety of this form of antioxidant vitamin.

& ACKNOWLEDGMENTS The authors would like to thank the Universiti Kebangsaan Malaysia for funding this project under a faculty grant. We would also like to thank Ms. Shahani Muhamad, Mr. Faisal Ariffin and Mr. Mohamad Arizi Aziz for their technical assistance. We would like to express our gratitude to Dr. Haizal M. Hussaini for allowing us to use the image analyzer, and we thank Mr. Abdul Gapor M. Top from the Malaysian Palm Oil Board for supplying the tocotrienol used in this study.

& AUTHOR CONTRIBUTIONS Muhammad N prepared the manuscript and was involved in performing the study and in data collection, analysis and interpretation. Soelaiman IN designed the study and supervised all aspects of the project. Luke DA provided conceptual advice, particularly for bone histology. Shuid AN, Mohamed N and Soelaiman IN assisted in the design of the study. All authors contributed to the interpretation of the results and the determination of the study implications. Additionally, all authors have reviewed the manuscript.

& REFERENCES 1. Martin TJ, Sims NA. Osteoclast-derived activity in the coupling of bone formation to resorption. Trends Mol Med. 2005;11(2):76-81, http://dx. doi.org/10.1016/j.molmed.2004.12.004. 2. Sims NA, Gooi JH. Bone remodeling: Multiple cellular interactions required for coupling of bone formation and resorption. Semin. Cell Dev.Biol 2008;19(5):444-51. 3. Clarke BL, Khosla S. Physiology of bone loss. Radiol. Radiol Clin North Am. 2010;48(3):483-95, http://dx.doi.org/10.1016/j.rcl.2010.02.014. 4. Bax BE, Alam ASMT, Banerji B, Bax CM, Bevis PJ, Stevens CR, et al. Stimulation of osteoclastic bone resorption by hydrogen peroxide. Biochem. Biophys. Biophys Res Commun. 1992;183(3):1153-8, http:// dx.doi.org/10.1016/S0006-291X(05)80311-0. 5. Garrett IR, Boyce BF, Oreffo ROC, Bonewald L, Poser J, Mundy GR. Oxygen-derived free radicals stimulate osteoclastic bone resorption in rodent bone in vitro and in vivo. J Clin Invest. 1990;85(3):632-9, http:// dx.doi.org/10.1172/JCI114485. 6. Lean JM, Davies JT, Fuller K, Jagger CJ, Kirstein B, Partington GA, et al. A crucial role for thiol antioxidants in estrogen-deficiency bone loss. J Clin Invest. 2003;112(6):915-23. 7. Dro¨ge W. Free radicals in the physiological control of cell function. Physiol Rev. 2002;82(1):47-95. 8. Melhus H, Michaelsson K, Holmberg L, Wolk A, Ljunghall S. Smoking, antioxidant vitamins, and the risk of hip fracture. J Bone Miner Res. 1999;14(1):129-35, http://dx.doi.org/10.1359/jbmr.1999.14.1.129. 9. Ahmad NS, Khalid BAK, Luke DA, Ima- Nirwana S. Tocotrienol offers better protection than tocopherol from free-radical induced damage of rat bone. Clin Exp Pharmacol Physiol. 2005;32(9):761-70, http://dx.doi. org/10.1111/j.1440-1681.2005.04264.x. 10. Fort FL. Drug safety evaluation. In: Swarbrick J, Boylan JC. (Eds), Encyclopedia of pharmaceutical technology. Vol 4. Marcel Dekker, New York, 1991;416-21. 11. Kalu DN. The ovariectomized rat model of postmenopausal bone loss. J. Bone Miner Res. 1991;15(3):175-91. 12. Wronski TJ, Yen CF. The ovariectomized rat as an animal model for postmenopausal bone loss. Cell Mater. 1991;S1:69-74.

1342


CLINICS 2013;68(10):1338-1343

Tocotrienol and postmenopausal bone loss Muhammad N et al. in hypercholesterolemic humans. Atherosclerosis. 2002;161(1):199-207, http://dx.doi.org/10.1016/S0021-9150(01)00619-0. 40. Maniam S, Mohamed,N, Shuid AN, Soelaiman IN. Palm Tocotrienol Exerted Better Antioxidant Activities in Bone than a-Tocopherol. Basic Clin. Pharmacol. Basic Clin Pharmacol Toxicol. 2008;103(1):55-60, http:// dx.doi.org/10.1111/j.1742-7843.2008.00241.x. 41. Hermizi H, Faizah O, Ima-Nirwana S, Ahmad NS, Norazlina M. Beneficial Effects of Tocotrienol and Tocopherol on Bone Histomorphometric Parameters in Sprague–Dawley Male Rats After Nicotine Cessation. Calcif Tissue Int. 2009;84(1):65-74, http://dx.doi. org/10.1007/s00223-008-9190-x.

37. Nesaretnam K, Ambra R, Selvaduray KR, Radhakrishnan A, Reimann K, Razak G, Virgili F. Tocotrienol-rich fraction from palm oil affects gene expression in tumors resulting from MCF-7 cell inoculation in athymic mice. Lipids. 2004;39(5):459-67, http://dx.doi.org/10.1007/s11745-004-1251-1. 38. Khanna S, Roy S, Ryu H, Bahadduri P, Swaan PW, Ratan RR, et al. Molecular basis of vitamin E action: tocotrienol modulates 12-lipoxygenase, a key mediator of glutamate-induced neurodegeneration. Journal of Biological Chemistry. 2003;278(44):43508-15, http://dx.doi. org/10.1074/jbc.M307075200. 39. Qureshi AA, Sami SA, Salser WA, Khan FA. Dose-dependent suppression of serum cholesterol by tocotrienol-rich fraction (TRF25) of rice bran

1343


BASIC RESEARCH

Periostin as a modulator of chronic cardiac remodeling after myocardial infarction Marcos F. Minicucci, Priscila P. dos Santos, Bruna P. M. Rafacho, Andre´a F. Gonc¸alves, Lidiane P. Ardisson, Diego F. Batista, Paula S. Azevedo, Bertha F. Polegato, Katashi Okoshi, Elenize J. Pereira, Sergio A. R. Paiva, Leonardo A. M. Zornoff Universidade Estadual Paulista (UNESP), Botucatu Medical School, Internal Medicine Department, Botucatu/SP, Brazil.

OBJECTIVE: After acute myocardial infarction, during the cardiac repair phase, periostin is released into the infarct and activates signaling pathways that are essential for the reparative process. However, the role of periostin in chronic cardiac remodeling after myocardial infarction remains to be elucidated. Therefore, the objective of this study was to investigate the relationship between tissue periostin and cardiac variables in the chronic cardiac remodeling induced by myocardial infarction. METHODS: Male Wistar rats were assigned to 2 groups: a simulated surgery group (SHAM; n = 8) and a myocardial infarction group (myocardial infarction; n = 13). After 3 months, morphological, functional and biochemical analyses were performed. The data are expressed as means¡SD or medians (including the lower and upper quartiles). RESULTS: Myocardial infarctions induced increased left ventricular diastolic and systolic areas associated with a decreased fractional area change and a posterior wall shortening velocity. With regard to the extracellular matrix variables, the myocardial infarction group presented with higher values of periostin and types I and III collagen and higher interstitial collagen volume fractions and myocardial hydroxyproline concentrations. In addition, periostin was positively correlated with type III collagen levels (r = 0.673, p = 0.029) and diastolic (r = 0.678, p = 0.036) and systolic (r = 0.795, p = 0.006) left ventricular areas. Considering the relationship between periostin and the cardiac function variables, periostin was inversely correlated with both the fractional area change (r = -0.783, p = 0.008) and the posterior wall shortening velocity (r = -0.767, p = 0.012). CONCLUSIONS: Periostin might be a modulator of deleterious cardiac remodeling in the chronic phase after myocardial infarction in rats. KEYWORDS: Fibrosis; Myocardial Infarction; Periostin. Minicucci MF, Santos PP, Rafacho BP, Gonc¸alves AF, Ardisson LP, Batista DF, et al. Periostin as a modulator of chronic cardiac remodeling after myocardial infarction. Clinics. 2013;68(10):1344-1349. Received for publication on March 26, 2013; First review completed on April 28, 2013; Accepted for publication on May 16, 2013 E-mail: lzornoff@fmb.unesp.br Tel.: 55 14 3822-2969

After myocardial infarction (MI), remodeling is a dynamic process that results from the activation of molecular and cellular pathways involving both myocytes and extracellular matrix components, including collagens, glycoproteins, proteoglycans, glycosaminoglycans and matricellular proteins (5,6). Matricellular proteins are a family of structurally unrelated extracellular macromolecules that play limited roles in tissue architecture but serve as links between cells and the extracellular matrix. In general, matricellular proteins are minimally expressed in normal hearts but are upregulated following cardiac injury (7). One of the most important matricellular proteins is periostin, which plays a role in the maturation and differentiation of fibroblasts in the developing neonatal heart (7). After acute MI, during the cardiac repair phase, periostin is released into the infarct and activates signaling pathways that are essential for the reparative process (8-11). However, the role of periostin in chronic cardiac remodeling

& INTRODUCTION Cardiac remodeling describes changes in the size, geometry, shape, composition and function of the heart after cardiac injury. Importantly, chronic ventricular remodeling is now recognized as an important pathological process that results in progressive ventricular dysfunction and the clinical presentation of heart failure or death (1-4). Thus, it is critical to know the pathophysiological alterations involved in these processes.

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)09

1344


CLINICS 2013;68(10):1344-1349

Periostin post-infarction Minicucci MF et al.

was maintained at a constant temperature (37 ˚C) and perfusion pressure (75 mmHg). All hearts were paced at 200 to 250 beats/min. The procedures and measurements were performed following a previously described method (17).

after MI remains to be elucidated. Therefore, the objective of this study was to investigate the relationship between periostin and cardiac variables in the chronic cardiac remodeling induced by coronary occlusion in rats.

& MATERIALS AND METHODS

Morphometric analysis

All experiments and procedures were performed in accordance with the National Institute of Health’s Guide for the Care and Use of Laboratory Animals and were approved by the Animal Ethics Committee of our institution. Male Wistar rats that weighed 200-250 g were assigned to 2 groups. One group underwent simulated surgery without the induction of an MI (SHAM group; n = 8), and the other group was subjected to an MI (MI group; n = 13). Water and diet were supplied ad libitum. The rats were observed for 3 months, after which morphological, functional and biochemical analyses were performed.

Upon the completion of the functional analyses, the right and left ventricles (including the interventricular septum) were dissected, separated and weighed. Transverse sections of the LV were fixed in 10% buffered formalin and embedded in paraffin. Five-micron-thick sections were stained with hematoxylin and eosin (HE) or the collagen-specific stain picrosirius red (Sirius red F3BA in aqueous saturated picric acid). The myocyte crosssectional area was determined for a minimum of 100 myocytes per HE-stained cross-section. Measurements were obtained from digital images (4006 magnification) that were collected with a video camera attached to a Leica microscope; the images were analyzed with the Image-Pro Plus 3.0 software program (Media Cybernetics; Silver Spring, MD). The myocyte cross-sectional area was measured with a digital pad, and the selected cells were transversely cut in such a way that the nucleus was in the center of the myocyte (18). The interstitial collagen volume fraction was determined for the entire cardiac section that was stained with picrosirius red by analyzing digital images that were captured under polarized light (2006 magnification). The cardiac tissue components were identified according to the following staining patterns: red for collagen fibers, yellow for myocytes and white for interstitial space. The collagen volume fraction was calculated as the sum of all of the connective tissue areas divided by the sum of all of the connective tissue and myocyte areas. On average, 35 microscopic fields per heart were analyzed with a 206 lens. Perivascular collagen was excluded from this analysis (19). The infarcted and viable muscle lengths for both the endocardial and epicardial circumferences were determined using planimetry. The infarct size was calculated by dividing the endocardial and epicardial circumferences of the infarcted area by the total epicardial and endocardial ventricular circumferences. The measurements on the midventricular slices (5-6 mm from the apex) were performed under the assumption that the left midventricular slice had a close linear relationship with the sum of the area measurements from all of the heart slices (20).

Coronary artery ligation When the animals achieved body weights of 200-250 g, an MI was induced as previously described (12,13). In brief, the rats were anesthetized with ketamine (70 mg/kg) and xylazine (1 mg/kg), and after a left thoracotomy, the heart was exteriorized. The left atrium was retracted to facilitate the ligation of the left coronary artery with 5-0 mononylon between the pulmonary outflow tract and the left atrium. The heart was then replaced in the thorax, and the lungs were inflated by positive pressure as the thoracotomy was closed. The rats were housed in a temperature-controlled room (24 ˚C) with a 12-h light:dark cycle.

Echocardiographic analysis After 3 months, all animals were weighed and evaluated by a transthoracic echocardiographic exam (14,15). The same observer made all measurements according to the leading-edge method recommended by the American Society of Echocardiography/European Association of Echocardiography (16). The end-systolic and end-diastolic cavity areas were calculated as the sum of the areas from both the short- and long-axis views in diastole (SumD) and systole (SumS), respectively. The fractional area change (FAC) was calculated from the composite cavity areas as follows: FAC = (SumD-SumS)/SumD. Additionally, the left ventricular mass index (LVMI) was calculated using the equation LVMI = {[(LVEDD+2*LVWT)3–(LVEDD)3 ]*1.04}/ BW. The transmitral diastolic flow velocities (E and A velocities) were obtained from the apical four-chamber view. The E/A ratio, the isovolumetric relaxation time and the isovolumetric relaxation time corrected by the heart rate (TRIV/RR0.5) were used as indices of the left ventricular (LV) diastolic function.

Myocardial hydroxyproline concentration The myocardial hydroxyproline concentration was used to estimate the extent of fibrosis. Hydroxyproline (HOP) was measured in the tissues (the septum of the LV and the mid-ventricular slice of the RV) according to the method described previously (21). Briefly, the tissues were dried for 4 h using a Speedvac Concentrator SC 100 that was attached to a refrigerated condensation trap (RVT 100) and vacuum pump (VP 100, Savant Instruments, Inc., Farmingdale, NY). The dry weights of the tissues were determined, and the samples were hydrolyzed overnight at 110 ˚C with 6 N HCl (1 ml/10 mg dry tissue). A 50-ml aliquot of the hydrolysate was transferred to an Eppendorf tube and dried in the Speedvac Concentrator. Deionized water (1 ml) was added, and the sample was transferred to a tube with a Teflon screw cap. Potassium borate buffer (1 ml, pH 8.7) was

In vitro left ventricular function analysis One day after the echocardiographic study, the rats were anesthetized with thiopental sodium (50 mg/kg, i.p.) and were administered heparin (2000 UI, i.p.). The chest was subjected to a median sternotomy under artificial ventilation. The entire heart was quickly removed from the chest and transferred to a perfusion apparatus (model 830 Hugo Sachs Eletronick-Green-stasse). The ascending aorta was isolated and cannulated for retrograde perfusion with filtered and oxygenated Krebs-Henseleit solution, which

1345


Periostin post-infarction Minicucci MF et al.

CLINICS 2013;68(10):1344-1349

added to maintain a constant pH, and the sample was oxidized with 0.3 ml of chloramine T solution at room temperature for exactly 20 min. The oxidative process was stopped by adding 1 ml of 3.6 mol/l sodium thiosulfate and mixing thoroughly for 10 s. The solution was saturated with 1.5 g of KCl. The tubes were capped and heated in boiling water for 20 min. After cooling to room temperature, the aqueous layer was extracted with 2.5 ml of toluene. Next, 1 ml of toluene extract was transferred to a 12675 mm test tube. Then, 0.4 ml of Ehrlich’s reagent was added to allow the color to develop for 30 min. The absorbances were read at 565 nm against a reagent blank. Deionized water and 20 mg/ml HOP were used as the blank and standard, respectively (22).

mouse monoclonal IgG1, Santa Cruz Biotechnology, Inc., Europe, sc 32233) was used for western blot normalization of collagen I, III and periostin.

Statistical analysis The data are expressed as means¡SD or medians (including the lower and upper quartiles). The Kolmogorov-Smirnov test was used to test for the normally distributed data. Comparisons between groups were performed using Student’s t test for parameters with normal distributions. Otherwise, comparisons between groups were performed using the Mann-Whitney U test. Correlations between continuous variables were performed with the Spearman’s test. The x2 test or Fisher Exact test was used to compare categorical variables. The data analyses were performed with SigmaStat for Windows v2.03 (SPSS Inc., Chicago, IL). The significance level was set at 5%.

Western blot analysis LV samples were extracted using Tris-Triton buffer (10 mM Tris pH 7.4, 100 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 10% glycerol, 0.1% SDS, 0.5% deoxycholate, 1 nM EDTA, 1 mM EGTA, a 1 mM mixture of protease inhibitors, 1 mM sodium orthovanadate, 1 mM sodium fluoride and 1% leupeptin, aprotinin and pepstatin) to detect collagen I, collagen III and periostin. The samples were then centrifuged at 12,000 rpm at 4 ˚C for 20 min, and the supernatant was collected. The supernatant protein content was quantified using the Bradford method. The samples were separated on a 10% SDS-polyacrylamide gel, and the separated proteins were transferred to a nitrocellulose membrane. The membrane was blocked with 5% nonfat dry milk in Tris-buffered saline containing Tris 1 M pH 8.0, NaCl 5 M and Tween-20 at room temperature for 2 h. The membrane was then incubated with the following primary antibodies: anti-collagen III, mouse monoclonal IgG1 (Abcam, Inc., Canada, ab 6310); anti-collagen I A1, rabbit polyclonal IgG (Santa Cruz Biotechnology, Inc., Europe, sc 8784R); and anti-periostin, goat polyclonal IgG (Santa Cruz Biotechnology, Inc., Europe, sc 49480). The membrane was washed with TBS and Tween-20 and was then incubated with secondary peroxidase-conjugated antibodies. A Super SignalH West Pico Chemiluminescent Substrate (Pierce Protein Research Products, Rockford, USA) was used to detect the bound antibodies. GAPDH (GAPDH [6C5],

& RESULTS The mean infarct size was 33.2¡13.4%, and the rats in the SHAM group weighed more 3 months after surgery. The echocardiographic data are listed in Table 1. The animals in the MI group had higher values of left cardiac chambers corrected by body weight, higher LVMIs and lower relative wall thicknesses (RWTs) compared with the SHAM group. In addition, there were no differences in the diastolic function variables; however, systolic function was worse in the MI group. The in vitro LV function data revealed worse systolic (+ dP/dt max: SHAM: 4375¡843, MI: 2675¡813 mmHg/s; p = 0.012) and diastolic functions (- dP/dt max: SHAM: 2125 [1969-2500], MI: 1750.0 [1219-1750] mmHg/s; p = 0.008) in the MI group (Table 2). The morphological data are listed in Table 3. The BWcorrected right ventricular weight (RVW) was elevated in the MI group. This result, which suggests cardiac hypertrophy, was in agreement with the higher values of the myocyte cross-sectional area (MCA) (SHAM: 305.7¡53.1, MI: 492.6¡65.3 mm2; p,0.001) observed in the MI group. In addition, the interstitial collagen volume fraction (SHAM: 1.85¡0.70, MI: 4.02¡0.61%; p,0.001) and HOP concentration

Table 1 - Echocardiographic data.

BW, (g) HR, (bpm) LVWT, (mm) LVEDD/BW (mm/kg) LVESD/BW (mm/kg) LA/BW, (mm/kg) RWT Mitral E wave, (cm/s) Mitral A wave, (cm/s) Mitral E/A IVRT/RR0.5, (ms) EDT, (ms) PWSV, (mm/s) FAC, (%)

SHAM (n = 8)

Myocardial infarction (n = 13)

p-value

490¡29 293 (280-307) 1.40 (1.38-1.46) 16.6 (16.0-17.9) 7.58 (6.99-8.43) 12.2 (11.8-13.2) 0.34¡0.02 75.5 (71.5-79.5) 51.0 (48.0-61.0) 1.51 (1.34-1.56) 54.7 (35.6-58.6) 38.8¡6.69 36.4¡4.0 75.3¡7.25

459¡32 315 (290-340) 1.49 (1.45-1.74) 23.1 (21.5-26.1) 16.6 (15.3-20.6) 15.5 (13.6-18.5) 0.29¡0.03 99.0 (75.5-118.3) 57.0 (13.8-61.0) 1.78 (1.28-9.11) 47.9 (44.6-49.1) 33.9¡6.01 27.7¡3.9 36.1¡7.80

0.037 0.147 0.063 ,0.001 ,0.001 0.003 ,0.001 0.096 0.799 0.405 0.885 0.094 ,0.001 ,0.001

SHAM: rats subjected to surgery but without coronary occlusion; BW: body weight; HR: heart rate; LVWT: LV posterior wall thickness; LVEDD: LV enddiastolic dimension; LVESD: LV end-systolic dimension; LA: left atrium; RWT: relative wall thickness; E wave: peak velocity of transmitral flow during early ventricular filling; A wave: peak velocity of transmitral flow during atrial contraction; IVRT/RR0.5: isovolumetric relaxation time corrected for heart rate; EDT: E wave deceleration time; PWSV: posterior wall shortening velocity; FAC: fractional area change. Data are expressed as means¡SD or medians (25%75%).

1346


CLINICS 2013;68(10):1344-1349

Periostin post-infarction Minicucci MF et al.

Table 2 - In vitro left ventricular function data. Variables + dP/dt max, (mmHg/s) - dP/dt max, (mmHg/s)

SHAM (n = 5)

Myocardial infarction (n = 5)

p-value

4375¡843 2125 (1969-2500)

2675¡813.0 1750.0 (1219-1750)

0.012 0.008

SHAM: rats subjected to surgery but without coronary occlusion; +dP/dt max: maximum rate of ventricular pressure rise; -dP/dt max: maximum rate of ventricular pressure decrease. Data are expressed as means¡SD or medians (25%-75%).

(SHAM: 3.32¡0.75, MI: 5.48¡0.73 mg/mg; p = 0.002) were higher in the MI group. Periostin (SHAM: 0.0009 [0.0007-0.0015], MI: 0.156 [0.1110.234); p = 0.016] and collagen types I (SHAM: 1.90¡1.07, MI: 4.14¡0.82; p = 0.009) and III (SHAM: 1.01 [0.91-1.13], MI: 9.26 [6.61-10.73]; p = 0.016) were higher in the MI group than in the SHAM group (Table 4). The periostin level was positively correlated with the type III collagen level (r = 0.673, p = 0.029) but not with the type I collagen level (r = 0.370, p = 0.275). Taking into account the relationship between periostin and the cardiac function variables, periostin was inversely correlated with FAC (r = -0.783, p = 0.008) and PWSV (r = -0.767, p = 0.012). Considering the association between periostin and the morphological variables, periostin was positively correlated with both the diastolic (r = 0.678, p = 0.036) and systolic (r = 0.795, p = 0.006) LV areas.

maturation phases may result in fatal complications after MI. For instance, slower healing, which results in an infarcted area more susceptible to deformations, might provoke infarct expansion, aneurysm formation, arrhythmia and cardiac rupture after infarction (1,4). Importantly, the composition of the extracellular matrix plays a key role during all of the phases of infarct healing (7). It is accepted that periostin is a critical modulator of collagen deposition, fibrosis and scar mechanics (23). Periostin expression by cardiac fibroblasts is high during early neonatal life and subsequently declines to barely detectable levels in adult life (24). However, periostin is upregulated in the injured heart and plays a critical role in the regulation of inflammatory, reparative and fibrotic pathways (24). Thus, knowledge of the effects of periostin on cardiac remodeling after MI is pivotal. The role of periostin during the infarct-healing phase has been studied. In mice, immunohistochemical analysis 1 week after MI revealed a massive accumulation of periostin within the scar. In addition, periostin-null mice had significantly increased mortality during the first 10 days after MI, which was associated with a 2-fold greater rate of ventricular rupture compared with the controls (11). Another study on periostin-null mice found that, after acute MI, cardiac healing was impaired, resulting in a cardiac rupture as a consequence of reduced myocardial stiffness caused by impaired collagen formation (10). Therefore, the data strongly suggest that periostin is essential for cardiac healing after acute MI by promoting myofibroblast migration and activation. In contrast to the function of periostin during the infarcthealing phase, the role of periostin during the chronic phase following an MI is less clear. Indeed, as mentioned previously, shortly after coronary occlusion, periostin-null mice presented with greater ventricular ruptures. However, periostin-null mice surviving the acute phase had significantly reduced fibrosis in the non-infarcted area, which was associated with the attenuation of the ventricular systolic

& DISCUSSION The objective of this study was to analyze the contribution of periostin in the chronic cardiac remodeling induced by MI. The expression of cardiac periostin increased 3 months after infarction. In addition, there were strong associations among periostin and cardiac fibrosis, ventricular enlargement and cardiac systolic dysfunction. Therefore, our data suggest that periostin might play a pathophysiological role in the detrimental chronic remodeling process following coronary occlusion in rats. Extracellular matrix components play a critical role in the cardiac remodeling process. The most dramatic changes in the cardiac extracellular matrix occur in the scenario of acute MI. Indeed, in the early period, abundant inflammatory leukocytes infiltrate the infarcted area and phagocytose dead cells and matrix debris. Then, the regression of inflammatory signals is noted, and fibroblasts produce large amounts of extracellular matrix proteins, including collagen types I and III. Finally, a mature scar is formed. Thus, alterations in the inflammatory, proliferative and

Table 3 - Morphometric data and myocardial hydroxyproline concentration.

LVW/BW, (g/kg) RVW/BW, (g/kg) Lung WC, (%) Liver WC, (%) IC*, (%) CSA*, (mm2) HOP**, (mg/mg) *

SHAM (n = 8)

Myocardial infarction (n = 13)

p-value

1.76¡0.17 0.39 (0.36-0.43) 76.2 (72.1-77.3) 68.4 (66.1-69.0) 1.85¡0.70 306¡53 3.32¡0.75

2.11¡0.57 0.54 (0.47-1.04) 75.4 (73.5-77.2) 67.7 (67.4-68.0) 4.02¡0.61 493¡65 5.48¡0.73

0.110 ,0.001 0.913 0.205 ,0.001 ,0.001 0.002

7 rats per group; ** 5 rats per group. SHAM: rats subjected to surgery but without coronary occlusion; BW: body weight; LVW: left ventricular weight; RVW: right ventricular weight; WC: water content; IC: interstitial collagen volume fraction; CSA: myocyte cross-sectional area; HOP: hydroxyproline. Data are expressed as means¡SD or medians (25%-75%).

1347


Periostin post-infarction Minicucci MF et al.

CLINICS 2013;68(10):1344-1349

performed the molecular biological analysis. Santos PP, Rafacho BP, Gonc¸alves AF, Ardisson LP, Batista DF, Polegato BF, Okoshi K and Pereira EJ were responsible for the evaluation and collection of the data. Minicucci MF, Paiva SA and Zornoff LA were responsible for the manuscript writing and critical review.

Table 4 - Levels of myocardial periostin and collagen types I and III. Variables Periostin Collagen I Collagen III

SHAM (n = 4)

Myocardial infarction (n = 5)

0.0009 (0.0007-0.0015) 0.156 (0.111-0.234) 1.90¡1.07 4.14¡0.82 1.01 (0.91-1.13) 9.26 (6.61-10.73)

p-value 0.016 0.009 0.016

& REFERENCES 1. Pfeffer JM, Finn PV, Zornoff LA, Pfeffer MA. Endothelin-A receptor antagonism during acute myocardial infarction in rats. Cardiovasc Drugs Ther. 2000;14(6):579-87, http://dx.doi.org/10.1023/A:1007890126061. 2. Cohn JN, Ferrari R, Sharpe N. Cardiac Remodeling – concepts and clinical implications: a consensus paper from an international forum on cardiac remodeling. J Am Coll Cardiol. 2000;35(3):569-82, http://dx.doi. org/10.1016/S0735-1097(99)00630-0. 3. Swynghedaunw B. Molecular mechanisms of myocardial remodeling. Physiol Rev. 1999;79(1):215-62. 4. Zornoff LAM, Paiva SAR, Duarte DR, Spadaro J. Ventricular remodeling after myocardial infarction: concepts and clinical implications. Arq Bras Cardiol. 2009;92(2):157-64. 5. Zamilpa R, Lindsey ML. Extracellular matrix turnover and signaling during cardiac remodeling following MI: causes and consequences. J Mol Cell Cardiol. 2010;48(3):558-63, http://dx.doi.org/10.1016/j.yjmcc.2009. 06.012. 6. Dobaczewski M, Gonzalez-Quesada C, Frangogiannis NG. The extracellular matrix as a modulator of the inflammatory and reparative response following myocardial infarction. J Mol Cell Cardiol. 2010;48(3):504-11, http://dx.doi.org/10.1016/j.yjmcc.2009.07.015. 7. Frangogiannis NG. Matricellular proteins in cardiac adaptation and disease. Physiol Rev. 2012;92(2):635-88, http://dx.doi.org/10.1152/ physrev.00008.2011. 8. Matsui Y, Morimoto J, Uede T. Role of matricellular proteins in cardiac tissue remodeling after myocardial infarction. World J Biol Chem. 2010;1(5):69-80. 9. Ku¨hn B, del Monte F, Hajjar RJ, Chang YS, Lebeche D, Arab S, et al. Periostin induces proliferation of differentiated cardiomyocytes and promotes cardiac repair. Nat Med. 2007;13(8):962-9, http://dx.doi.org/ 10.1038/nm1619. 10. Shimazaki M, Nakamura K, Kii I, Kashima T, Amizuka N, Li M, et al. Periostin is essential for cardiac healing after acute myocardial infarction. J Exp Med. 2008;205(2):295-303, http://dx.doi.org/10.1084/jem. 20071297. 11. Oka T, Xu J, Kaiser RA, Melendez J, Hambleton M, Sargent MA, et al. Genetic manipulation of periostin expression reveals a role in cardiac hypertrophy and ventricular remodeling. Circ Res. 101(3):313-21. 12. Minicucci MF, Azevedo PS, Martinez PF, Lima AR, Bonomo C, Guizoni DM, et al. Critical infarct size to induce ventricular remodeling, cardiac dysfunction and heart failure in rats. Int J Cardiol. 2011;151(2):242-3. 13. Duarte DR, Minicucci MF, Azevedo PS, Matsubara BB, Matsubara LS, Novelli EL, et al. The role of oxidative stress and lipid peroxidation in ventricular remodeling induced by tobacco smoke exposure after myocardial infarction. Clinics. 2009;64(7):691-7. 14. Minicucci MF, Azevedo PS, Santos DF, Polegato BF, Santos PP, Okoshi K, et al. Echocardiographic predictors of ventricular remodeling after acute myocardial infarction in rats. Arq Bras Cardiol. 2011;97(6):502-6, http:// dx.doi.org/10.1590/S0066-782X2011005000117. 15. Paiva SAR, Novo R, Matsubara BB, Matsubara LS, Azevedo PS, Minicucci MF, et al. b-carotene attenuates the paradoxical effect of tobacco smoke on the mortality of rats after experimental myocardial infarction. J Nutr. 2005;135(9):2109-13. 16. Lang RM, Bierig M, Devereux RB, Flachskampf FA, Foster E, Pellikka PA, et al. Recommendations for chamber quantification: a report from the American Society of Echocardiography’s guidelines and standards Committee and the chamber quantification writing group, developed in conjunction with the European Association of Echocardiography, a branch of the European Society of Cardiology. J Am Soc Echocardiogr. 2005;18(12):1440-63, http://dx.doi.org/10.1016/ j.echo.2005.10.005. 17. Azevedo PS, Minicucci MF, Chiuso-Minicucci F, Justulin LA Jr, Matsubara LS, Matsubara BB, et al. Ventricular remodeling induced by tissue vitamin A deficiency in rats. Cell Physiol Biochem. 2010;26(3):395402, http://dx.doi.org/10.1159/000320563. 18. Rafacho BP, Santos P, Assalin HB, Ardisson LP, Roscani MG, Polegato BF, et al. Role of vitamin D in the cardiac remodeling induced by tobacco smoke exposure. Int J Cardiol. 2012;155(3):472-3. 19. Paiva SA, Zornoff LA, Okoshi MP, Okoshi K, Matsubara LS, Matsubara BB, et al. Ventricular remodeling induced by retinoic acid supplementation in adult rats. Am J Physiol Heart Circ Physiol. 2003;284(6):H22426. 20. Zornoff LA, Paiva SA, Minicucci MF, Spadaro J. Experimental myocardium infarction in rats: analysis of the model. Arq Bras Cardiol. 2009;93(4):434-40, http://dx.doi.org/10.1590/S0066-782X2009001000018.

SHAM: rats subjected to surgery but without coronary occlusion; Data are expressed as means¡SD or medians (25%-75%).

dysfunction 8 weeks after the infarct (11). In another study, Kuhn et al. administered Gelfoam patches loaded with periostin in rats subjected to coronary occlusion. Between 1 and 12 weeks, the shortening and ejection fractions in coronary occlusion rats increased significantly in comparison to the control animals. In addition, at 1 week after MI, the treatment and control groups had the same LV dimensions. However, at 12 weeks, the end-diastolic dimension was smaller in the periostin-treated rats, suggesting improved ventricular remodeling in those rats (9). Therefore, considering the conflicting results, the role of periostin in chronic cardiac remodeling after MI remains to be elucidated. In our study, the infarcted rats presented with increased LV dimensions. LV enlargement can occur soon after MI as a result of infarct expansion, which increases the surface of the infarcted area by the stretching and thinning of the damaged region. As a result of post-infarction expansion, parietal tension is significantly increased, inducing the process of eccentric hypertrophy. Therefore, regardless of its complexity, after myocardial infarction, the remodeling process is frequently used as a synonym for ventricular dilation (1-4). Consequently, our data indicated that myocardial infarction induced remodeling. It is well accepted that collagen accumulation in non-infarcted areas is a crucial component of remodeling (5,6). In accordance with this concept, LV dilation was associated with fibrosis and was accessed using biochemical, histological and molecular methods. Importantly, we found a correlation among periostin and collagen variables, indicating that periostin might also be a relevant determinant of cardiac fibrosis in the chronic phase after MI. Although the relationship between periostin and collagen is indisputable, the association between periostin and hypertrophy is less apparent. In a model of pressure overload, periostin-null mice experienced decreased hypertrophy after 8 weeks compared with the control mice (11). However, in another study, periostin did not induce hypertrophy of differentiated cardiomyocytes (9). In our study, there was a strong correlation between the periostin level and the LV dimension associated with an inverse correlation between periostin and cardiac systolic function, suggesting that periostin can modulate the chronic remodeling process after MI. In conclusion, our results suggest that periostin might be a modulator of deleterious cardiac remodeling in the chronic phase after MI in rats.

& AUTHOR CONTRIBUTIONS Paiva SAR and Minicucci MF were responsible for the statistical analysis. Minicucci MF, Azevedo PS and Zornoff LA designed the study and

1348


CLINICS 2013;68(10):1344-1349

Periostin post-infarction Minicucci MF et al. 23. Snider P, Standley KN, Wang J, Azhar M, Doestschman T, Conway SJ. Origen of cardiac fibroblasts and the role of periostin. Circ Res. 2009;105(10):934-47, http://dx.doi.org/10.1161/CIRCRESAHA.109.201400. 24. Norris RA, Moreno-Rodrigues R, Hoffman S, Markwald RR. The many facets of the matricellular protein peristin during cardiac development, remodeling, and pathophysiology. J Cell Commun Signal. 2009;3(34):275-86, http://dx.doi.org/10.1007/s12079-009-0063-5.

21. Zornoff LAM, Matsubara BB, Matsubara LS, Paiva SAR, Spadaro J. Early rather than delayed administration of lisinopril protects the heart after myocardial infarction in rats. Basic Res Cardiol. 2000;95(3):208-14, http://dx.doi.org/10.1007/s003950050183. 22. Matsubara LS, Matsubara BB, Okoshi MP, Cicogna AC, Janicki JS. Alterations in myocardial collagen content affect rat papillary muscle function. Am J Physiol Heart Circ Physiol. 2000;279(4):H1534-9.

1349


BASIC RESEARCH

Antifibrotic effects of crocetin in scleroderma fibroblasts and in bleomycin-induced sclerotic mice Yinghua Song, Lubing Zhu, Ming Li Fudan University, Zhongshan Hospital, Department of Dermatology, Shanghai, China.

OBJECTIVE: To investigate the antifibrotic effects of crocetin in scleroderma fibroblasts and in sclerotic mice. METHODS: Skin fibroblasts that were isolated from three systemic scleroderma (SSc) patients and three healthy subjects were treated with crocetin (0.1, 1 or 10 mM). Cell proliferation was measured with an MTT assay. Alphasmooth muscle actin was detected via an immunohistochemical method. Alpha 1 (I) procollagen (COL1A1), alpha 1 (III) procollagen (COL3A1), matrix metalloproteinase (MMP)-1 and tissue inhibitor of matrix metalloproteinase (TIMP)-1 mRNA levels were measured using real-time PCR. SSc mice were established by the subcutaneous injection of bleomycin. Crocetin (50 mg/kg/d) was injected intraperitoneally for 14 days. Dermal thickness and lung fibrosis were assessed with Masson’s trichrome staining. Plasma ET-1 was detected with an enzyme-linked immunosorbent assay (ELISA). Skin and lung ET-1 and COL1A1 mRNA levels were measured via real-time PCR. RESULTS: Crocetin inhibited the proliferation of SSc and normal fibroblasts, an effect that increased with crocetin concentration and incubation time. Crocetin decreased the expression of a-SMA and the levels of mRNA for COL1A1, COL3A1 and matrix metalloproteinase-1, while crocetin increased TIMP-1 mRNA levels in both SSc and normal fibroblasts. Skin and lung fibrosis was induced, and the levels of ET-1 in the plasma, skin and lungs were elevated in bleomycin-injected mice. Crocetin alleviated the thickening of the dermis and lung fibrosis; decreased COL1A1 mRNA levels in the skin and lung; and simultaneously decreased ET-1 concentrations in the plasma and ET-1 mRNA levels in the skin and lungs of the bleomycin-induced sclerotic mice, especially during the early phase (weeks 1-3). CONCLUSION: Crocetin inhibits cell proliferation, differentiation and collagen production in SSc fibroblasts. Crocetin alleviates skin and lung fibrosis in a bleomycin-induced SSc mouse model, in part due to a reduction in ET-1. KEYWORDS: Crocetin; Fibroblasts; Systemic scleroderma; Collagen; Fibrosis. Song Y, Zhu L, Li M. Antifibrotic effects of crocetin in scleroderma fibroblasts and in bleomycin-induced sclerotic mice. Clinics. 2013;68(10):13501357. Received for publication on March 30, 2013; First review completed on April 26, 2013; Accepted for publication on May 16, 2013 E-mail: li.ming@zs-hospital.sh.cn Tel.: 86 21 64041990-3016

studies were based on the study of cultured fibroblasts. Regarding in vivo research, the bleomycin-induced experimental sclerotic mouse is a good model for studying the prevention or treatment of fibrosis and is the most frequently used model (3). However, there is currently still no cure for SSc and little possibility of modifying or reversing the fibrosis of the skin and internal organs. Saffron, a spice and food colorant present in the dry stigmas of the plant Crocus sativus L., has been used as an herbal remedy for various ailments, including cancer, in the ancient Arabian, Indian and Chinese cultures. Crocetin, an important carotenoid constituent of saffron, has shown significant potential as an anti-tumor agent in animal models and cell culture systems (4). This unique carotenoid contains a short carbon chain length (C20 apocarotenoid) and carboxyl groups at both ends of the carbon chain (5). Additionally, crocetin exhibits other pharmacological actions, including the inhibition of retinal ischemic damage in mice (6) and neuroprotection in conjunction with selenium in cognitive impairment (7). More intriguingly,

& INTRODUCTION Systemic scleroderma (SSc) is a complex, chronic connective tissue disease that has three cardinal clinical features: the excessive deposition of extracellular matrix (ECM), vascular damage and inflammation/autoimmunity (1). Despite an unclear pathogenesis, SSc is characterized by the pathologic remodeling of the connective tissues in the skin and internal organs, which is due to the overproduction of ECM, especially the production of collagen by fibroblasts (2). Therefore, many of the landmark in vitro SSc

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)10

1350


CLINICS 2013;68(10):1350-1357

Antifibrotic effects of crocetin Song Y et al.

recent research has revealed that crocetin reverses cardiac hypertrophy in vivo and inhibits the collagen synthesis that is stimulated by angiotensin (Ang) II in cardiac fibroblasts (8). Because the pathogenic processes of SSc and cardiac hypertrophy share many similar features, we became interested in whether crocetin has an effect on SSc. In this study, we investigated the possible antifibrotic effects of crocetin in vitro in fibroblasts isolated from patients with SSc and in vivo in bleomycin-induced sclerotic mice. This study contributes to the potential use of crocetin as a treatment for fibrosis in SSc patients.

slips were blocked with 5% BSA and then incubated overnight at 4 ˚C with an a-SMA mouse monoclonal antibody (Boster, China). The visualization of antibody staining was performed according to the manufacturer’s instructions for the 3,3’-Diaminobenzidine (DAB) Horseradish Peroxidase Color Development Kit (Boster, China). The staining wasrepeated for each sample at least three times, and photomicrographs were obtained with a microscope (Olympus, Japan). At minimum, 30 cells in several microscopic fields in each slide at 6400 magnification were scored by two independent examiners. The ratio of positive cells/total number of cells counted was calculated.

& MATERIALS AND METHODS Detection of COL1A1, COL3A1, MMP-1 and TIMP-1 mRNA levels by real-time PCR

Cell culture and crocetin treatment Skin biopsies were obtained from three patients who met the American College of Rheumatology criteria for SSc(9) (with a less than 1-year duration of the disease) and were not undergoing treatment and from three age- and sex-matched healthy subjects. Full-thickness 7-mm biopsies that were 50 mm2 in size were excised from the forearm lesions of the patients with SSc and from the healthy controls. Primary cultures of the skin fibroblasts were established using the method introduced by Zhu et al. (10). The fibroblasts were serially passaged in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) (PAA, Pasching, Austria) in an incubator at 37˚C with 5% CO2. The cells were used for the crocetin administration experiments at passages 3 to 6 at early confluence. The study protocol was reviewed and approved by the research ethics committee of Zhongshan Hospital, and informed consent was obtained from all of the participants. In the following assays, after reaching 90% confluency, the fibroblasts were synchronized by serum starvation for 24 h. The fibroblasts were then treated for 24 h in serum-free culture medium (except for the MTT assay) with crocetin (0.1, 1 or 10 mM, ChromaDex, USA). The crocetin was dissolved in dimethylsulfoxide (DMSO, Sigma, USA) for all of the in vitro studies. The above concentrations are commonly employed in in vitro studies (8) and caused no apparent cell toxicity in our preliminary assay. Untreated cells in the same medium were used as controls.

After incubation with crocetin (0.1, 1 or 10 mM) for 24 h, total RNA from the fibroblasts was isolated with TRIzol (Invitrogen, USA) and was reverse-transcribed to generate cDNA. COL1A1, COL3A1, MMP-1 and TIMP-1 mRNA levels in the fibroblasts were detected via real-time RT-PCR, which was performed using a SYBR Green Master Mix (TaKaRa, Japan) at 95 ˚C for 30 s, followed by 40 cycles of 95 ˚C for 5 s and 60 ˚C for 20 s. GAPDH was used as an internal control. The primers that were used are shown in Table 1. A relative quantification was performed using the 2-DDCt method (11,12). The experiments were performed in triplicate and were repeated twice.

Induction of dermal and lung sclerosis in mice and the administration of crocetin Female C3H/He mice, aged 6 weeks and weighing 20 to 25 g, were obtained from Vitalriver Laboratory Animal Center (Beijing, China) and were maintained under pathogen-free conditions. The animal protocol was approved by the Committee of Animal Care and Use of Fudan University. Bleomycin powder (Nihon Kayaku, Tokyo, Japan) was dissolved in phosphate-buffered saline (PBS; 0.01 M, pH 7.4) at a concentration of 0.2 g/L. A crocetin suspension was prepared using a 0.5% carboxymethylcellulose (CMC) solution for the animal experiments. For the SSc mouse model, 100 ml of filter-sterilized bleomycin or PBS was subcutaneously injected into the shaved backs of the mice daily for 3 weeks with a 27-gauge needle. Simultaneously, either vehicle (CMC) or crocetin (50 mg/

3-(4,5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) assay For the MTT assay, the fibroblasts were seeded into 96well microplates (26103 cells/well) in triplicate. After incubation with crocetin (0.1, 1 or 10 mM) in DMEM containing 2% FBS for 1, 3 or 6 days (with a change of the culture media on the fourth day), an MTT solution (Amresco, USA) at a final concentration of 0.5 g/L was added, and the clones were further incubated at 37 ˚C for 4 h. The cells were then solubilized in 1 ml of 10% DMSO (Sigma, USA) for 10 min. Finally, the absorbance at 570 nm was measured with a microplate reader (Bio-Rad, USA).

Table 1 - List of primers used for real-time PCR. Sample/control gene Homo MMP-1 Homo TIMP-1 Homo COL1A1 Homo COL3A1

Immunohistochemistry Homo GAPDH

To measure a-smooth muscle actin (a-SMA), sterile microscope coverslips (Fisher, USA) were placed into the individual wells of 24-well cell culture plates, and the fibroblasts from the SSc patients or the healthy controls were incubated on the coverslips at a concentration of 16105 cells/cm2. After reaching 90% cell confluency, the cells were treated with crocetin. The cell-containing cover

Mus ET-1 Mus COL1A1 Mus GAPDH

1351

Primer Sequence (5’-3’) TGAAAAGCGGAGAAATAGTGG GAGGACAAACTGAGCCACATC ATACTTCCACAGGTCCCACAAC GGATGGATAAACAGGGAAACAC CCTGGAAAGAATGGAGATGATG ATCCAAACCACTGAAACCTCTG GCTGGCTACTTCTCGCTCTG TCCGCATAGGACTGACCAAG GGTGAAGGTCGGTGTGAACG CTCGCTCCTGGAAGATGGTG GACCAGACACCGTCCTCTTC TGGAAAGTCACGAACAGCAG GGTCTTGGTGGTTTTGTATTCG AACAGTCGCTTCACCTACAGC CCCCTTCATTGACCTCAACTAC GAGTCCTTCCAGGATACCAAAG


Antifibrotic effects of crocetin Song Y et al.

CLINICS 2013;68(10):1350-1357

kg/d) was injected intraperitoneally for 14 days into the mice that were injected subcutaneously with bleomycin. The concentration of crocetin used in these experiments had previously exhibited maximal efficacy in suppressing cardiac hypertrophy without apparent cell toxicity in mice (8). At the end of week 1 (W1), W2, W3, W5 and W7 after bleomycin/PBS injection, the mice (six per group per time point) were euthanized by CO2 asphyxiation, and peripheral blood plasma samples were taken by cardiac puncture and centrifuged at 4 ˚C. The back skins and lungs were collected for histological examination or were snap-frozen in liquid nitrogen.

Effect of crocetin on COL1A1, COL3A1, MMP-1 and TIMP-1 mRNA levels in fibroblasts Compared to normal fibroblasts, the levels of COL1A1, COL3A1 and TIMP-1 mRNAs in the SSc fibroblasts increased significantly (p,0.05 or p,0.01), while there was no difference in MMP-1 mRNA levels between the SSc and normal fibroblasts (p.0.05). Crocetin decreased COL1A1 and COL3A1 mRNA levels in SSc and normal fibroblasts (p,0.05 or p,0.01) in comparison with the untreated controls (Figure 2A and 2B). Crocetin also decreased MMP-1 mRNA levels in SSc and normal fibroblasts (p,0.05 or p,0.01, Figure 2C). In contrast, crocetin increased TIMP-1 mRNA levels in the fibroblasts at concentrations of 0.1 and 10 mM (p,0.05 or p,0.01, Figure 2D) with no significant effect on TIMP-1 mRNA levels in the fibroblasts at a concentration of 1 mM. However, among the three concentrations used, crocetin at a concentration of 1 mM resulted in the most significant inhibitory effect on the expression of COL1A1, COL3A1, and MMP-1 mRNA levels.

Histological evaluation of skin and lung tissues Formalin-fixed skin and lung tissues were paraffinembedded and stained with hematoxylin and eosin and Masson’s trichrome stain. The sections were examined using a Leica DFC 280 light microscope. Five randomly selected sites in two Masson’s trichrome-stained skin or lung sections from each mouse were examined at 6100 magnification. Using a Leica Q Win Plus Image Analysis System (Leica Micros Imaging Solutions Ltd., Cambridge, UK), the dermal thickness (measured from the epidermal– dermal junction to the dermal–fat junction) was determined. The percentage of lung tissue fibrosis was evaluated by counting the number of pixels corresponding to the stained collagen areas.

Inhibitory effect of crocetin on a-SMA expression in SSc and normal fibroblasts a-SMA expression increased in SSc fibroblasts compared to normal fibroblasts (p,0.05). All tested concentrations of crocetin decreased a-SMA expression in both SSc and normal fibroblasts (p,0.05 or p,0.01, Figure 3A-3D). Crocetin at a concentration of 1 mM significantly decreased a-SMA expression in SSc and normal fibroblasts compared to the other two concentrations tested (p,0.05 or p,0.01, Figure 3E).

Plasma endothelin-1 (ET-1) concentration detected with an enzyme linked immunosorbent assay (ELISA) Peripheral blood plasma ET-1 concentrations were measured according to the manufacturer’s protocol with an ELISA kit (USCN, Wuhan, China). The absorbance at 570 nm was measured using a microplate reader (Bio-Rad, USA). The experiments were performed in triplicate and were repeated twice.

Skin and lung ET-1 and COL1A1 mRNA expression detected by real-time PCR The skin and lung ET-1 and COL1A1 mRNA levels in the mice were detected via real-time PCR as described above. The primer pairs that were used are shown in Table 1. The experiments were performed in triplicate and were repeated twice.

Statistics All of the statistical analyses were performed using SPSS 13.0 software. The quantitative data were expressed as the means ¡ SEM. The quantitative variables were compared using the two-sample Student’s t-test or a one-way ANOVA. Statistical significance was defined as p,0.05.

& RESULTS Inhibitory effect of crocetin on fibroblast proliferation On D1, D3 and D6, crocetin inhibited fibroblast proliferation derived from both SSc patients and healthy individuals compared to the untreated control fibroblasts. Moreover, this inhibitory effect increased with concentration and incubation time (Figures 1A and 1B).

Figure 1 - Inhibitory effect of crocetin on the proliferation of fibroblasts derived from SSc patients and healthy individuals. Fibroblast proliferation was detected with the MTT assay, and absorbance at 570 nm was measured. (A) Proliferation of SSc fibroblasts. (B) Proliferation of normal fibroblasts.

1352


CLINICS 2013;68(10):1350-1357

Antifibrotic effects of crocetin Song Y et al.

Figure 2 - Effect of crocetin on COL1A1, COL3A1, MMP-1 and TIMP-1 mRNA expression in SSc and normal fibroblasts. mRNA expression was detected using quantitative reverse transcription–polymerase chain reaction, and relative quantification was performed using the 2-DDCt method. The experiments were performed in triplicate and repeated twice. (A) COL1A1; (B) COL3A1; (C) MMP-1; (D) TIMP-1. * p,0.05, ** p,0.01.

Antifibrotic effect of crocetin in bleomycin-induced sclerotic mice

and the bleomycin+CMC-injected mice were significantly higher than in the PBS- and bleomycin+crocetin-injected mice, respectively (p,0.05, Figure 4B and 4C). The COL1A1 mRNA levels in the skin and lungs from the mice at different time points are shown in Figure 4D and Figure 4E. The

The histological examination of the skin and lung tissue from the mice is shown in Figure 4A. The dermal thicknesses and percentages of lung fibrosis in the bleomycin-injected

1353


Antifibrotic effects of crocetin Song Y et al.

CLINICS 2013;68(10):1350-1357

Figure 3 - Inhibitory effect of crocetin on the expression of a-smooth muscle actin (a-SMA) in SSc and normal fibroblasts. (A-D) a-SMA expression in normal fibroblasts. Original magnification 6100. (a-SMA expression in SSc fibroblasts is not shown because the appearance is similar to normal cells). (E) a-SMA positive cells/total number of cells counted (%). * p,0.05, ** p,0.01.

bleomycin-injected mice had higher skin COL1A1 mRNA levels than the PBS-injected mice, a difference that increased with time. The bleomycin+crocetin-injected mice had lower skin COL1A1 mRNA levels than the bleomycin+CMCinjected mice. The bleomycin-injected mice had higher lung COL1A1 mRNA levels than the PBS-injected mice, and the bleomycin+CMC-injected mice had higher lung COL1A1 mRNA levels than the crocetin-injected mice at the end of W1, W2 and W3. Plasma ET-1 levels and ET-1 mRNA levels in mouse skin and lungs At W1, the bleomycin-injected mice had significantly higher plasma ET-1 levels than the PBS-injected mice, and the bleomycin+crocetin-injected mice had significantly lower plasma ET-1 levels than the bleomycin+CMC-injected mice (Figure 5A). Afterward, the differences between the bleomycin- and PBS-injected mice and between the bleomycin+CMC-injected and bleomycin+crocetin-injected mice were not significant. The bleomycin-injected mice had significantly higher skin ET-1 mRNA levels than the PBSinjected mice after W1, W5 and W7. The bleomycin+crocetininjected mice had significantly lower skin ET-1 mRNA levels than the bleomycin+CMC-injected mice (Figure 5B). Afterward, the differences between the bleomycin-injected

and the PBS-injected mice and between the bleomycin+CMCinjected and the bleomycin+crocetin-injected mice were not significant. The bleomycin-injected mice had higher lung ET1 levels than the PBS-injected-mice at W1. Afterward, the difference between the bleomycin-injected and the PBSinjected mice was not significant. The bleomycin+crocetininjected mice had lower lung ET-1 levels than the bleomycin+CMC-injected mice at the end of the W1 (Figure 5C).

& DISCUSSION The most prominent clinical features of SSc are caused by the excessive deposition of ECM components, especially type I and type III collagen, in the skin and involved organs, such as the lung. Type I collagen is composed of two alpha 1 (I) chains and one alpha 2 (I) chain that are expressed coordinately in human fibroblasts (13,14). Type III collagen is composed of two alpha 1 (III) chains(13). The upregulated COL1A1 and COL3A1 genes in SSc fibroblasts play important roles in the pathogenesis of SSc. MMP-1 promotes the degradation of both type I and type III collagen, and MMP-1 activity is inhibited by TIMP-1. Therefore, the balance of MMP-1 and TIMP-1 maintains the homeostasis of tissue damage and repair (15). Another marker of the

1354


CLINICS 2013;68(10):1350-1357

Antifibrotic effects of crocetin Song Y et al.

Figure 4 - Histological evaluation of mouse skin and lung tissues. (A) Representative pathologic findings from the skin and lung tissue from the mice at W3 after beginning the bleomycin or crocetin treatment; 6100, Masson’s trichrome staining. (B) Dermal thickness (measured from the epidermal–dermal junction to the dermal–fat junction). (C) Percentage of lung fibrosis (evaluated by counting the numbers of pixels corresponding to stained collagen areas). (D) Skin COL1A1 mRNA levels; (E) Lung COL1A1 mRNA levels.

activated SSc fibroblast is the expression of a-SMA. SSc is associated with the differentiation of fibroblasts into myofibroblasts, which is characterized by the expression of a-SMA contractile filaments. Myofibroblasts present some activation features, including high levels of ECM gene expression, during normal reparative or pathological fibrotic processes (16). In vitro, we observed an inhibitory effect of crocetin on the proliferation of both the SSc and normal fibroblasts, an effect that increased with concentration and time. We also observed crocetin-induced inhibition of a-SMA expression in SSc fibroblasts. In addition, crocetin significantly decreased COL1A1 and COL3A1 mRNA levels in both SSc and normal fibroblasts. These findings indicate that crocetin inhibits overproliferation, the overproduction of collagen and the differentiation of fibroblasts, whether the fibroblasts are derived from patients with SSc or from healthy individuals. In addition, we noted that MMP-1 mRNA

levels in the fibroblasts decreased, while TIMP-1 mRNA levels increased after treatment with crocetin. This observation suggests that crocetin may have dual effects on the metabolism of collagen in fibroblasts, which involve inhibiting both the production and the degradation of collagen. Among the three concentrations of crocetin used in nearly all of the in vitro assays, crocetin at 1 mM had the most significant effect. This result indicates that 1 mM is possibly one of the most suitable concentrations for studying the effect of crocetin on cultured fibroblasts. ET-1, an important endogenous peptide hormone that potently promotes vasculopathy, inflammation and fibrosis, is one of the most important pathogenic endogenous peptide hormones in the pathogenesis of SSc(17). Furthermore, elevated levels of circulating ET-1 in patients with SSc have been observed (18,19). Therefore, elevated ET-1 may be an indicator for disease activity in SSc. Our in vivo study demonstrated that plasma ET-1 levels and ET-1 mRNA levels

1355


Antifibrotic effects of crocetin Song Y et al.

CLINICS 2013;68(10):1350-1357

Figure 5 - Plasma, skin and lung ET-1 levels in mice. (A) Plasma ET-1 levels; (B) skin ET-1 mRNA levels; (C) lung ET-1 mRNA levels. Plasma ET-1 levels were detected using an ELISA. ET-1 mRNA expression was detected via a quantitative reverse transcription-polymerase chain reaction, and relative quantification was performed using the 2-DDCt method.

1356


CLINICS 2013;68(10):1350-1357

Antifibrotic effects of crocetin Song Y et al. 3. Avouac J, Elhai M, Allanore Y. Experimental models of dermal fibrosis and systemic sclerosis. Joint Bone Spine. 2013;80(1):23-8, http://dx.doi. org/10.1016/j.jbspin.2012.06.005. 4. Gutheil WG, Reed G, Ray A, Anant S, Dhar A. Crocetin: an agent derived from saffron for prevention and therapy for cancer. Curr Pharm Biotechnol. 2012;13(1):173-9, http://dx.doi.org/10.2174/138920112798868566. 5. Xiang M, Qian ZY, Zhou CH, Liu J, Li WN. Crocetin inhibits leukocyte adherence to vascular endothelial cells induced by AGEs. J Ethnopharmacol. 2006;107(1):25-31, http://dx.doi.org/10.1016/j.jep.2006.01.022. 6. Ishizuka F, Shimazawa M, Umigai N, Ogishima H, Nakamura S, Tsuruma K, et al. Crocetin, a carotenoid derivative, inhibits retinal ischemic damage in mice. Eur J Pharmacol. 2013;703(1-3):1-10. 7. Khan MB, Hoda MN, Ishrat T, Ahmad S, Moshahid Khan M, Ahmad A, et al. Neuroprotective efficacy of Nardostachys jatamansi and crocetin in conjunction with selenium in cognitive impairment. Neurol Sci. 2012;33(5):1011-20, http://dx.doi.org/10.1007/s10072-011-0880-1. 8. Cai J, Yi FF, Bian ZY, Shen DF, Yang L, Yan L, et al. Crocetin protects against cardiac hypertrophy by blocking MEK-ERK1/2 signalling pathway. J Cell Mol Med. 2009;13(5):909-25, http://dx.doi.org/10.1111/j. 1582-4934.2008.00620.x. 9. Masi AT RG, Medsger TA Jr, et al. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Subcommittee for scleroderma criteria of the American Rheumatism Association Diagnostic and Therapeutic Criteria Committee. Arthritis Rheum. 1980; 23(5):581-90, http://dx.doi.org/10.1002/art.1780230510. 10. Zhu L, Gao D, Yang J, Li M. Characterization of the phenotype of high collagen-producing fibroblast clones in systemic sclerosis, using a new modified limiting-dilution method. Clin Exp Dermatol. 2012;37(4):395403, http://dx.doi.org/10.1111/j.1365-2230.2011.04254.x. 11. Shi R, Chiang VL. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 2005;39(4):519-25, http://dx.doi.org/10. 2144/000112010. 12. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101-8, http://dx.doi. org/10.1038/nprot.2008.73. 13. Hulmes DJ. Building collagen molecules, fibrils, and suprafibrillar structures. J Struct Biol. 2002;137(1-2):2-10, http://dx.doi.org/10.1006/ jsbi.2002.4450. 14. Hata R. Transfection of normal human skin fibroblasts with human alpha 1(I) and alpha 2(I) collagen gene constructs and evidence for their coordinate expression. Cell Biol Int. 1995;19(9):735-41, http://dx.doi. org/10.1006/cbir.1995.1124. 15. Woessner JF, Jr. Matrix metalloproteinases and their inhibitors in connective tissue remodeling. FASEB J. 1991;5(8):2145-54. 16. Desmouliere A, Chaponnier C, Gabbiani G. Tissue repair, contraction, and the myofibroblast. Wound Repair Regen. 2005;13(1):7-12, http://dx. doi.org/10.1111/j.1067-1927.2005.130102.x. 17. Leask A. The role of endothelin-1 signaling in the fibrosis observed in systemic sclerosis. Pharmacol Res. 2011;63(6):502-3, http://dx.doi.org/ 10.1016/j.phrs.2011.01.011. 18. Kuryliszyn-Moskal A, Klimiuk PA, Sierakowski S. Soluble adhesion molecules (sVCAM-1, sE-selectin), vascular endothelial growth factor (VEGF) and endothelin-1 in patients with systemic sclerosis: relationship to organ systemic involvement. Clin Rheumatol. 2005;24(2):111-6, http://dx.doi.org/10.1007/s10067-004-0987-3. 19. Peterlana D, Puccetti A, Caramaschi P, Biasi D, Beri R, Simeoni S, et al. Endothelin-1 serum levels correlate with MCP-1 but not with homocysteine plasma concentration in patients with systemic sclerosis. Scand J Rheumatol. 2006;35(2):133-7. 20. Mutsaers SE, Foster ML, Chambers RC, Laurent GJ, McAnulty RJ. Increased endothelin-1 and its localization during the development of bleomycin-induced pulmonary fibrosis in rats. Am J Respir Cell Mol Biol. 1998;18(5):611-9. 21. Onat AM, Turkbeyler IH, Pehlivan Y, Demir T, Kaplan DS, Taysi S, et al. The efficiency of a urotensin II antagonist in an experimental lung fibrosis model. Inflammation. 2012;35(3):1138-43, http://dx.doi.org/10. 1007/s10753-011-9421-6. 22. Rose NR, Leskovsek N. Scleroderma: immunopathogenesis and treatment. Immunol Today. 1998;19(11):499-501, http://dx.doi.org/10.1016/ S0167-5699(98)01322-X. 23. Yang R, Yang L, Shen X, Cheng W, Zhao B, Ali KH, et al. Suppression of NF-kappaB pathway by crocetin contributes to attenuation of lipopolysaccharide-induced acute lung injury in mice. Eur J Pharmacol. 2012;674(2-3):391-6.

in the skin and lungs of bleomycin-induced sclerotic mice were significantly higher than the levels found in the PBSinjected mice at an early phase (1-3 weeks), which is similar to previous results(20,21). Crocetin significantly reversed skin thickening, lung fibrosis and COL1A1 mRNA levels in the skin and lungs of bleomycin-induced sclerotic mice, especially within the early phase (1-3 weeks). Simultaneously, crocetin decreased plasma ET-1 levels and ET-1 mRNA levels in the skin and lungs of bleomycin-induced sclerotic mice, especially within the early phase (1-3 weeks). Therefore, we speculate that in addition to the direct antifibrotic effect, the capacity of crocetin to alleviate bleomycin-induced fibrosis may be caused, at least in part, by the reduction of ET-1 in the plasma and fibrotic tissues of these mice. Furthermore, some cytokines, such as interleukin-6 (IL-6) and transforming growth factor b (TGF-b), are highly involved in the pathogenesis of scleroderma (22). Crocetin has been found to attenuate the expression of IL-6 in mice (23), but whether this effect can be blocked by the addition of IL-6 remains unknown. Nevertheless, little is known regarding the effect of crocetin on other crucial cytokines, such as TGF-b. These observations indicate the necessity to further investigate the potential effect of crocetin on the profibrotic cytokines in cultured SSc fibroblasts in vitro or in the SSc experimental model in vivo. In conclusion, our findings provide new evidence that crocetin inhibits the overproliferation and differentiation of SSc fibroblasts. In addition, crocetin may possess the dual effects of inhibiting both the overproduction and the degradation of collagen in fibroblasts. Furthermore, crocetin reversed the skin and lung fibrosis that occurs in a bleomycin-induced SSc mouse model, which may be due, at least in part, to the reduction of ET-1 in the plasma and fibrotic tissues of these mice. This study highlights the potential use of crocetin as a new drug for the treatment of fibrosis in patients with SSc.

& ACKNOWLEDGMENTS We thank doctors Di Gao, Ji Yang and Xiaojing Xing for providing reagents and information for the immunohistochemical staining. This project was supported by the National Natural Science Foundation of China (30901291).

& AUTHOR CONTRIBUTIONS The authors have participated sufficiently in the work to take public responsibility for appropriate portions of the content. LB Zhu and M Li conceived and designed the experiments. YH Song and LB Zhu performed the experiments. LB Zhu and YH Song analyzed the data. YH Song and LB Zhu wrote the paper.

& REFERENCES 1. Varga J, Abraham D. Systemic sclerosis: a prototypic multisystem fibrotic disorder. J Clin Invest. 2007;117(3):557-67, http://dx.doi.org/10.1172/ JCI31139. 2. Bhattacharyya S, Wei J, Varga J. Understanding fibrosis in systemic sclerosis: shifting paradigms, emerging opportunities. Nat Rev Rheumatol. 2012;8:42-54, http://dx.doi.org/10.1038/nrrheum.2011.149.

1357


BASIC RESEARCH

The protective effect of aqueous extracts of roselle (Hibiscus sabdariffa L. UKMR-2) against red blood cell membrane oxidative stress in rats with streptozotocin-induced diabetes Jamaludin Mohamed, Saw Wuan Shing, Muhd Hanis Md Idris, Siti Balkis Budin, Satirah Zainalabidin Universiti Kebangsaan Malaysia, Faculty of Health Sciences, School of Diagnostic & Applied Health Sciences, Programme of Biomedical Sciences, Jalan Raja Muda Aziz, Kuala Lumpur, Malaysia.

OBJECTIVES: The aim of this study was to investigate the protective effects of aqueous extracts of roselle (Hibiscus sabdariffa L. UKMR-2) against red blood cell (RBC) membrane oxidative stress in rats with streptozotocin-induced diabetes. METHODS: Forty male Sprague-Dawley rats weighing 230-250 g were randomly divided into four groups (n = 10 rats each): control group (N), roselle-treated control group, diabetic group, and roselle-treated diabetic group. Roselle was administered by force-feeding with aqueous extracts of roselle (100 mg/kg body weight) for 28 days. RESULTS: The results demonstrated that the malondialdehyde levels of the red blood cell membranes in the diabetic group were significantly higher than the levels in the roselle-treated control and roselle-treated diabetic groups. The protein carbonyl level was significantly higher in the roselle-treated diabetic group than in the roselle-treated control group but lower than that in the diabetic group. A significant increase in the red blood cell membrane superoxide dismutase enzyme was found in roselle-treated diabetic rats compared with roselle-treated control rats and diabetic rats. The total protein level of the red blood cell membrane, osmotic fragility, and red blood cell morphology were maintained. CONCLUSION: The present study demonstrates that aqueous extracts of roselle possess a protective effect against red blood cell membrane oxidative stress in rats with streptozotocin-induced diabetes. These data suggest that roselle can be used as a natural antioxidative supplement in the prevention of oxidative damage in diabetic patients. KEYWORDS: Roselle; Red Blood Cell Membrane; Oxidative Stress; Diabetes Mellitus. Mohamed J, Shing SW, Idris MH, Budin SB, Zainalabidin S. The protective effect of aqueous extracts of roselle (Hibiscus sabdariffa L. UKMR-2) against red blood cell membrane oxidative stress in rats with streptozotocin-induced diabetes. Clinics. 2013;68(10):1358-1363. Received for publication on March 29, 2013; First review completed on April 29, 2013; Accepted for publication on May 19, 2013 E-mail: satirahukm@gmail.com Tel.: 60 392897632

protein glycation (4). Both the polyol pathway and the protein glycation process favor the generation of advanced glycation end products (AGEs), which further worsen oxidative stress (5). The process of glycolysis and the pentose phosphate pathway have also been shown to contribute to the formation of ROS in patients with diabetes (1). Red blood cells (RBCs) are susceptible to attacks by ROS because of their high polyunsaturated fatty acid (PUFA) content and their abundance of iron (Fe2+)-rich hemoglobin (5). Ionic Fe2+ acts as a catalyst in redox reactions and lipid peroxidation and forms malondialdehyde (MDA) as the end product (6). In addition, in diabetes, RBCs often undergo membrane protein oxidation or carbonylation (7). Therefore, protein carbonyls are common indicators of oxidative damage to proteins in cells (7). Diabetes mellitus also weakens the components of antioxidant defense systems,

& INTRODUCTION Diabetes mellitus is associated with oxidative stress as a result of increased free radical formation, such as the superoxide (O2N-) and hydroxyl (NOH) free radicals, and decreased activity of antioxidant defense systems (1). Hyperglycemia increases the formation of reactive oxygen species (ROS) via several pathways, such as glucose autoxidation (2), the polyol pathway (3), and non-enzymatic

Copyright Ă&#x; 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)11

1358


CLINICS 2013;68(10):1358-1363

Effect of roselle against oxidative stress Mohamed J et al.

such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) (1). As a result of the oxidative attack on RBC membrane lipids, membrane proteins, and cytoskeletal proteins, the structure and function of the membrane bilayer may change, which further damages the RBC membrane as indicated by increased osmotic fragility and alterations in RBC morphology (8). Roselle (Hibiscus sabdariffa L.) is a tropical annual herbal shrub that belongs to the Malvaceae family and is characterized by red calyces and flowers with a unique sour taste. Roselle calyces have been widely used as an edible colorant in food and drink preparations and are rich in antioxidant components, mainly anthocyanin, that counteracts oxidative damage to prevent diseases (9,10). Previous studies have shown that the free radical scavenging effect of Hibiscus sabdariffa extract is able to attenuate lipid peroxidation and protein oxidation in hepatic and renal tissues (11). Hibiscus sabdariffa L. UKMR-2 is cultivated by Universiti Kebangsaan Malaysia, Malaysia, and has been shown to possess a higher anthocyanin content than other local varieties, e.g., UKMR-1 and UKMR-3 (12). The aim of this study was to investigate the antioxidant effect of roselle aqueous extracts (Hibiscus sabdariffa L. variety UKMR-2) on cellular plasma membrane oxidative stress in rats with streptozotocin (STZ)-induced diabetes. The RBC membrane was chosen as a representative model of cell membrane function because RBCs lack membranes derived from organelles (8). STZ was used to induce type 1 diabetes mellitus because it selectively destroys pancreatic beta cells (13).

0.9% normal saline before use) at a dose of 45 mg/kg body weight into the tail vein of the rats (14). The fasting blood glucose level was measured after 3 days to assess the development of diabetes mellitus.

Treatment groups Roselle was administered to the NR and DR groups by force-feeding with aqueous extracts of roselle (100 mg/kg body weight) (15,16) for 28 days. Groups N and D were given distilled water at a dose of 1 ml/kg body weight in the same manner and for the same duration.

Blood sample collection Following the experimental period (28 days), rats were again fasted overnight and blood was then drawn under light ether anesthesia from the sinus orbital or by cardiac puncture. To conduct the osmotic fragility test, blood smear preparation, and ghost membrane preparation, fresh blood was collected in EDTA tubes and placed in an ice bath. The blood was centrifuged (3,500 rpm, 5 minutes, 4 ˚C) to separate the packed RBCs from the plasma and buffy coat. The packed RBCs were then washed three times in 0.9% normal saline. Afterward, the packed RBCs were suspended in 0.9% normal saline (ratio 1:1). Then, 50% of the RBC suspensions were aliquoted and stored at -40˚C for future use.

RBC ghost membrane preparation RBC ghost membranes were prepared according to the method described by Dodge et al. (17). A volume of 50% RBC suspension was added to 10 ml of cold isotonic phosphatebuffered saline (PBS) at a pH of 7.4 and left for 30 minutes at 4 ˚C. The suspension was then centrifuged (4,000 x g, 20 minutes, 4 ˚C), and the supernatant was decanted. Sedimented cells were then resuspended in cold 1.25 mM PBS at a pH of 7.4 (ratio 1:15) and left for 30 minutes at 4 ˚C. The suspension was then centrifuged four times (20,000 x g, 40 minutes) (Eppendorf AG, Hamburg, Germany), and the supernatant was decanted. RBC ghosts were then resuspended in an equal volume of cold PBS and kept at -40 ˚C before use.

& MATERIALS AND METHODS Preparation of roselle aqueous extracts Roselle (H. sabdariffa L. UKMR-2) calyces were obtained from the Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Malaysia. Calyces were added to distilled water in a 1:2 ratio and ground in a blender (Cornell, Petaling Jaya, Malaysia) for 10 minutes. Next, the roselle extract was boiled until air bubbles appeared. The boiled extract was then cooled and filtered. The roselle extract was stored in an aluminum-covered bottle at 4 ˚C. Extracts that needed to be stored for a longer period were freeze-dried (Labconco Co., Missouri, USA) and could be used for approximately 6 months.

Determination of total RBC membrane protein The total RBC membrane protein was determined using 100-ml suspensions of RBC ghosts according to the method described by Bradford (1976), using Coomassie Brilliant Blue G-250 (Acros Organics, New Jersey, USA) at 595 nm (SI Analytics GmbH, Hattenbergstrabe 10, Mainz, Germany) (18). The results are expressed as mg/ml.

Experimental animals Forty male Sprague-Dawley rats weighing 230-250 g were obtained from the animal facility of the Institute of Medical Research, Kuala Lumpur, Malaysia. All animal experimental protocols were performed in accordance with the guidelines issued by the Universiti Kebangsaan Malaysia Animal Ethics Committee (FSK/BIOMED/2011/SATIR AH/30-NOVEMBER/407-NOVEMBER-2011-MAY-2012). Rats were housed in clean cages and fed with rat chow and water throughout the experimental period (28 days). Rats were randomly divided into 4 groups of 10 rats each: control (N), roselle-treated control (NR), diabetic (D), and roselle-treated diabetic (DR) rats.

Determination of RBC membrane malondialdehyde (MDA) RBC membrane MDA was determined as a measure of lipid peroxidation in 0.1 ml of RBC ghosts according to the method described by Stocks and Dormandy (19), using the thiobarbituric acid reagent (ICN Biomedicals, Irvin, California, USA) at 100 ˚C. The pink adducts that formed were extracted in butanol (Fisher Scientific, Massachusettes, USA) and measured spectrophotometrically at 532 nm (19). The results were expressed as nmol/g of protein.

Determination of RBC membrane protein carbonyl (PC)

Induction of diabetes Following an overnight fast, diabetes was induced in groups D and DR by intravenous injection of STZ (Sigma Chemicals, St. Louis, Missouri, USA) (freshly dissolved in

According to the method described by Levine et al. (20), RBC membrane PC was measured spectrophotometrically at

1359


Effect of roselle against oxidative stress Mohamed J et al.

CLINICS 2013;68(10):1358-1363

Table 1 - Body weight, blood glucose, and food and water intake. Group N Body weight (g) Blood glucose (mmol/L) Food intake (g) Water intake (mL)

318.63ยก10.40 6.8ยก0.80 4.07ยก0.15 8.73ยก2.09

Group NR

Group D

328.88ยก10.42 6.1ยก0.60 6.14ยก0.75 8.95ยก0.90

Group DR ab

233.44ยก15.28 26.85ยก1.33ab 14.73ยก0.40ab 44.52ยก2.55ab

206.40ยก14.58ab 19.32ยก1.48abc 13.45ยก0.60ab 43.21ยก2.35ab

Values are expressed as the meanยกSEM (n = 8 per group). a indicates a significant difference compared with group N (p,0.05). b indicates a significant difference compared with group NR (p,0.05). c indicates a significant difference compared with group D (p,0.05).

360 nm as an index of protein oxidation in 50 ml of ghosts, using the 2,4-dinitrophenylhydrazine reagent (Sigma Chemicals, St Louis, Missouri, USA) to form protein-conjugated hydrazones (20). The results were expressed as nmol/mg of protein.

significant at p,0.05. The results are expressed as the meanยกstandard error of the mean (SEM).

& RESULTS Animals

Assay of RBC membrane superoxide dismutase (SOD) enzyme activity

The mean body weights of all four groups were similar at the beginning of the study (246.25ยก7.43 g). After the induction of diabetes, all 20 rats were used for the following 28-day period. Body weight, blood glucose, and food and water intake were monitored in all of the studied animals (Table 1). At the end of the experiment, both diabetic groups demonstrated weight loss and a significant increase in their blood glucose levels (p,0.05). However, roselle treatment in the DR group resulted in a significant decrease in the blood glucose level compared with the DA group (p,0.05). Food and water intake were significantly increased in both diabetic groups compared with the non-diabetic controls (p,0.05). Overall, roselle treatment did not affect any of the above parameters. The RBC membrane malondialdehyde (MDA) level (11.51ยก0.45 nmol/g) and protein carbonyl (PC) level (1.27ยก0.08 nmol/g) were significantly increased (p,0.05) compared with group N (MDA = 9.06ยก0.07 and PC = 0.73ยก0.09 nmol/g) and group NR (MDA = 6.41ยก0.30 and PC = 0.44ยก0.05 nmol/g) (Figures 1 and 2). Both the RBC membrane MDA (Figure 1) and the PC (Figure 2) levels (MDA and PC levels for group DR were 9.35ยก0.29 and

The RBC membrane SOD enzyme activity was determined according to the method described by Beyer and Fridovich (21) with slight modifications. The following reaction mixture was made in the dark: 20 ml of ghosts, 27 ml of phosphate buffer at a pH of 7.8, 1.5 ml of 30 mg/ml L-methionine (Acros Organics, New Jersey, USA), 1 ml of 1.41 mg/ml nitro blue tetrazolium chloride (Acros Organics, New Jersey, USA), and 0.75 ml of 1% Triton X100 (Fisher Scientific, Massachusettes, USA). The mixture was added to 10 ml of riboflavin (Acros Organics, New Jersey, USA). The reaction mixture was then exposed to Sylvania arolux fluorescent light (18 W) for 7 minutes and measured spectrophotometrically at 560 nm. The results were expressed as U/mg of protein.

Determination of osmotic fragility RBC osmotic fragility was determined according to the method described by Dacie and Lewis (22). A total of 0.05 ml of fresh blood was added to increasing concentrations of a sodium chloride (NaCl) solution (0, 0.30, 0.45, 0.55, and 0.85%), gently mixed, and incubated at room temperature (25 หšC) for 30 minutes. The mixtures were then centrifuged (2,000 x g, 5 minutes) and measured spectrophotometrically at 540 nm. The results were expressed as the percentage (%) of hemolysis.

RBC morphology Blood smears were prepared according to the method described by Dacie and Lewis (22), and staining was performed according to the method described by Wright (23), with slight modifications. The blood smears were prepared with one drop of fresh blood followed by Wrightโ€™s staining (Sigma Chemicals, St Louis, Missouri, USA). The stained blood smears were visualized using a light microscope.

Statistical analysis All data were tested for normality using the Shapiro-Wilk test (p.0.05), and Leveneโ€™s test was used to assess homogeneity (p.0.05). Using SPSS Version 18 (Armonk, New York, USA), four groups were compared using oneway analysis of variance (ANOVA) followed by the Bonferroni (post hoc) test. Differences were statistically

Figure 1 - RBC membrane MDA level among control group (N), roselle-treated control group (NR), diabetic group (D), and roselle-treated diabetic group (DR). Data values are expressed as meanยกSEM.

1360


CLINICS 2013;68(10):1358-1363

Effect of roselle against oxidative stress Mohamed J et al.

Table 2 - Values of osmotic fragility for the control group (N) and the STZ-induced diabetes group (D) following 28 days of treatment with aqueous extracts of roselle. NaCl (%) 0.85 0.55 0.45 0.30 0.00

Group N

Group NR

Group D

Group DR

0 1.41¡0.33 22.91¡6.88 92.51¡1.84 100

0 1.31¡0.34 37.55¡6.66 82.75¡3.05a 100

0 3.96¡2.44 37.65¡7.44 94.44¡0.98 100

0 1.20¡0.34 40.05¡7.03 89.53¡1.98 100

Values are expressed as the mean¡SEM. a indicates a significant difference compared with group N (p,0.05).

of the diabetic rats compared with the RBCs of the control rats. However, there was the presence of a small number of abnormal (A) or hemolyzed (H) RBCs in the blood smears of diabetic rats (Figure 4C). Figure 2 - RBC membrane PC level among control group (N), roselle-treated control group (NR), diabetic group (D), and roselle-treated diabetic group (DR). Data values are expressed as mean¡SEM.

& DISCUSSION The aim of the present study was to evaluate the protective effects of a newly mutated variety of H. sabdariffa L. UKMR-2 on RBC oxidative stress in diabetic rats. UKMR2 was chosen because it has the most potential for commercialization and contains the highest anthocyanin content among the three H. sabdariffa variants (12). In the present study, we observed significant decreases in the RBC membrane MDA and PC levels, as well as a significant increase in the RBC membrane SOD enzyme activity. In the present study, the total RBC membrane protein level in diabetic rats was not significantly different from that of the other groups, which was consistent with the results found in previous studies (24,25). The total protein level is not a specific marker of protein damage; however, PCs play a role as essential oxidative markers of RBC membrane proteins (7).

0.95¡0.03 nmol/g, respectively) were found to be significantly decreased in the two roselle-treated groups compared with groups N and D (p,0.05). There was no significant difference (p.0.05) in the total protein level between the groups (N: 49.33¡1.78 mg/ml; NR: 48.60¡3.11 mg/ml; D: 44.38¡3.82 mg/ml; DR: 44.70¡2.72 mg/ml). The RBC membrane SOD enzyme activity was significantly higher (p,0.05) in the roselle-treated groups (NR = 0.52¡0.01 and DR = 0.54¡0.01) than in the groups that were not treated with roselle (Figure 3). The RBC osmotic fragility in group D was slightly higher than that in group N but was not significantly different (Table 2). The RBC morphology of both roselle-treated groups (Figure 4B and Figure 4D) was normal (Figure 4A). There were also no significant morphological changes in the RBCs

Figure 3 - RBC membrane SOD enzyme activity among control group (N), roselle-treated control group (NR), diabetic group (D), and roselle-treated diabetic group (DR). Data values are expressed as mean¡SEM.

Figure 4 - RBC morphology of (A) control rat, (B) roselle-treated control rat, (C) diabetic rat, and (D) roselle-treated diabetic rat under magnification of 1000x with a light microscope. Data values are expressed as mean¡SEM.

1361


Effect of roselle against oxidative stress Mohamed J et al.

The significant increase in the RBC membrane PC level in diabetic rats observed in this study suggests that diabetes induces an increased level of free oxygen radicals and resultant oxidative protein damage, which is supported by the observation that increased blood glucose levels were associated with a high RBC membrane PC content in diabetic patients (26). A possible mechanism of PC production during oxidative stress is the direct oxidation of proline, arginine, and lysine residues (27). In addition to RBC membrane protein damage, free radicals also attack RBC membrane lipids, especially PUFAs, leading to lipid peroxidation. MDAs were significantly increased in the RBC membranes of diabetic rats, which is consistent with the results of previous studies (28,29). In contrast, SOD activity in RBC membranes was higher in diabetic rats than in control rats (30), which could be due to the activation of an antioxidant defense system to suppress the formation of free radicals (25). Both RBC membrane MDA and PC levels were significantly reduced in the two roselle-treated groups (NR and DR). A previous study showed that roselle extracts significantly decreased MDA formation in the hepatic tissue of diabetic rats and in the linoleic acid oxidation system (11). In control rats treated with roselle extracts, a reduced MDA level was also observed in the renal tissue (35). It has also been demonstrated that roselle extracts effectively reduce protein oxidation in the hepatic and renal tissues of diabetic rats. Furthermore, a tendency toward decreased PC levels was observed in the hepatic and renal tissues of control rats treated with roselle extracts (11). However, the slight increase in SOD enzyme activity could not compensate for the increase in free radicals, as demonstrated by the increase in PC and MDA levels. These changes may cause damage to the membrane protein structure and lipid (PUFA) content. As a result, the intrinsic membrane mechanical properties are altered, resulting in reduced deformability and reduced fluidity or altered permeability of the phospholipid bilayer, which, in turn, reduces the ability of the membrane to withstand osmotic changes (32). The present study also demonstrated that there were no significant changes in osmotic fragility or RBC morphology in roselle-treated rats (NR and DR). The roselle extract had a similar effect on the osmotic fragility of human RBCs (31). The results of the present study suggest that the roselle extract has a protective effect on the RBC membrane against free radical attacks that allows the RBCs to maintain normal morphology in diabetes. In addition, it has also been found that anthocyanins are able to localize to the plasma membrane (36); therefore, they can further protect the membrane from the oxidative attacks of free radicals. The structure of anthocyanins consists of an o-diphenol structure in ring-B and a conjugated double bond system. This structure gives the molecule the ability to scavenge radicals by hydrogen donation, to assist in radical stabilization, (33) to protect RBCs against ROS attacks, and to increase RBC integrity and function (34). In conclusion, the aqueous extract of roselle (Hibiscus sabdariffa L. UKMR-2) possesses antioxidant properties, as demonstrated by its protective effect against RBC membrane oxidative stress in rats with STZ-induced diabetes.

CLINICS 2013;68(10):1358-1363

& AUTHOR CONTRIBUTIONS Mohamed J was the supervisor. Shing SW and Idris MH performed the experiments. Budin SB was the co-supervisor. Zainalabidin S wrote the manuscript.

& REFERENCES 1. Martı´n-Galla´n P, Carrascosa A, Gussinye´ M, Domı´nguez C. Biomarkers of diabetes-associated oxidative stress and antioxidant status in young diabetic patients with or without subclinical complications. Free Radic Biol Med. 2003;34(12):1563-74, http://dx.doi.org/10.1016/S0891-5849(03) 00185-0. 2. Wolff SP and Dean RT. Glucose autoxidation and protein modification. The potential role of ‘autoxidative glycosylation’ in diabetes. Biochem J. 1987;245:243-50. 3. Chung SSM, Ho ECM, Lam KSL, Chung SK. Contribution of polyol pathway to diabetes-induced oxidative stress. J Am Soc Nephrol. 2003;14(Suppl. 3):S233-6, http://dx.doi.org/10.1097/01.ASN.0000077408. 15865.06. 4. Wolff SP, Jiang ZY, Hunt JV. Protein glycation and oxidative stress in diabetes mellitus and ageing. Free Radic Biol Med. 1991;10(5):339-52, http://dx.doi.org/10.1016/0891-5849(91)90040-A. 5. Rizvi SI, Zaid MA, Anis R, Mishra N. Protective role of tea catechins against oxidation-induced damage of type 2 diabetic erythrocytes. Clin Exp Pharmacol Physiol. 2005;32(1-2):70-5, http://dx.doi.org/10.1111/j. 1440-1681.2005.04160.x. 6. Draper HH and Hadley M: Malondialdehyde determination as index of lipid peroxidation. Methods in Enzymology, Vol. 186. Edited by Packer L and Glazer AN. San Diego: Academic Press, 1990,pp421-30. 7. Dalle-Donne I, Rossi R, Giustarini D, Milzani A, Colombo R. Protein carbonyl groups as biomarkers of oxidative stress. Clin Chim Acta. 2003;329(1-2):23-38, http://dx.doi.org/10.1016/S0009-8981(03)00003-2. 8. Jain SK. Hyperglycemia can cause membrane lipid peroxidation and osmotic fragility in human red blood cells. J Biol Chem. 1989; 264(35):21340-5. 9. Ali BH, Wabel NA, Blunden G. Phytochemical, pharmacological and toxicological aspects of Hibiscus sabdariffa L.: A review. Phytother Res. 2005;19(5):369-75, http://dx.doi.org/10.1002/ptr.1628. 10. Tsai P-J, McIntosh J, Pearce P, Camden B, Jordan BR. Anthocyanin and antioxidant capacity in Roselle (Hibiscus sabdariffa L.) extract. Food Res Int. 2002;35(4):351-6, http://dx.doi.org/10.1016/S0963-9969(01)00129-6. 11. Farombi EO, Ige OO. Hypolipidemic and antioxidant effects of ethanolic extract from dried calyx of Hibiscus sabdariffa in alloxan-induced diabetic rats. Fundam Clin Pharmacol. 2007;21:601-9, http://dx.doi.org/10.1111/ j.1472-8206.2007.00525.x. 12. Osman M, Golam F, Saberi S, Majid NA, Nagoor NH, Zulqarnain M. Morpho-agronomic analysis of three roselle (Hibiscus sabdariffa L.) mutants in tropical Malaysia. Aust J Crop Sci. 2011;5(10):1150-6. 13. Wu KK, Huan Y. Streptozotocin-induced diabetic models in mice and rats. Current Protocols in Pharmacology. Edited by Enna SJ, Williams M, Frechette R, Kenakin T, McGonigle P, Ruggeri B. Hoboken: John Wiley & Sons, 2008,pp5.47.1-5.47.14. 14. Jung CH, Zhou S, Ding GX, Kim JH, Hong MH, Shin Y-Cet al. Antihyperglycemic activity of herb extracts on streptozotocin-induced diabetic rats. Biosci Biotechnol Biochem. 2006;70(10):2556-9, http://dx. doi.org/10.1271/bbb.60238. 15. Idris MHM, Budin SB, Osman M, Mohamed J. Protective role of Hibiscus sabdariffa calyx extract against streptozotocin induced sperm damage in diabetic rats. EXCLI Journal. 2012;11:659-69. 16. Olaleye MT, Rocha BTJ. Acetaminophen-induced liver damage in mice: Effects of some medicinal plants on the oxidative defense system. Exp Toxicol Pathol. 2008;59(5):319-27, http://dx.doi.org/10.1016/j.etp.2007. 10.003. 17. Dodge JT, Mitchell C, Hanahan DJ. The preparation and chemical characteristics of hemoglobin-free ghosts of human erythrocytes. Arch Biochem Biophys. 1963;100:119-30, http://dx.doi.org/10.1016/00039861(63)90042-0. 18. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72(1-2):248-54, http://dx.doi.org/10.1016/ 0003-2697(76)90527-3. 19. Stocks J and Dormandy TL. The autoxidation of human red cell lipid induced by hydrogen peroxide. Br J Haematol. 1971;20(1):95-111, http:// dx.doi.org/10.1111/j.1365-2141.1971.tb00790.x. 20. Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz A-G, Ahn BW, Shaltiel S, Stadtman ER. Determination of carbonyl content in oxidatively modified proteins. Methods in Enzymology, Vol. 186. Edited by Packer L and Glazer AN. San Diego: Academic Press, 1990,pp464-78. 21. Beyer WF, Fridovich I. Assaying for superoxide dismutase activity: Some large consequences of minor changes in conditions. Anal Biochem. 1987;161(2):559-66, http://dx.doi.org/10.1016/0003-2697(87)90489-1.

& ACKNOWLEDGMENTS We thank Sabarina Ismail for her assistance in the preparation of the biochemical tests. This study was supported by a grant from Universiti Kebangsaan Malaysia (UKM-GUP-2011-124).

1362


CLINICS 2013;68(10):1358-1363

Effect of roselle against oxidative stress Mohamed J et al. 31. Singh N, Rajini PS. Antioxidant-mediated protective effect of potato peel extract in erythrocytes against oxidative damage. Chem Biol Interact. 2008;173(2):97-104, http://dx.doi.org/10.1016/j.cbi.2008.03.008. 32. Suhail M, Patil S, Khan S, Siddiqui S. Antioxidant vitamins and lipoperoxidation in non-pregnant, pregnant, and gestational diabetic woman: Erythrocyte osmotic fragility profiles. J Clin Med Res. 2010;2(6):266-73. 33. Gracia MTS, Heinonen M, Frankel EN. Anthocyanins as antioxidants on human low-density lipoprotein and lecithin-liposome systems. J Agric Food Chem. 1997;45:3362-7, http://dx.doi.org/10.1021/jf970234a. 34. Youdim KA, Shukitt-Hale B, MacKinnon S, Kalt W, Joseph JA. Polyphenolics enhance red blood cell resistance to oxidative stress: In vitro and in vivo. Biochim Biophys Acta. 2000;1523(1):117-22, http://dx. doi.org/10.1016/S0304-4165(00)00109-4. 35. Mossalam HH, Aty OAA-E, Morgan EN, Youssaf SMS, Mackawy AMH. Biochemical and ultra structure studies of the antioxidant effect of aqueous extract of Hibiscus sabdariffa on the nephrotoxicity induced by organophosphorus pesticide (Malathion) on the adult albino rats. Life Science J. 2011;8(X):561-74. 36. Youdim KA, Martin A, Joseph JA. Incorporation of the elderberry anthocyanins by endothelial cells increases protection against oxidative stress. Free Radic Biol Med. 2000;29(1):51-60, http://dx.doi.org/10.1016/ S0891-5849(00)00329-4.

22. Practical Haematology, 8th Ed. Edited by Dacie SJ and Lewis SM. Edinburgh: Churchill Livingstone, 1995. 23. Wright JH. A rapid method for the differential staining of blood films and malarial parasites. J Med Res. 1902;7(1):138-44. 24. Kumar R, Kumar AN, Ahmed S. Changes in erythrocyte membrane in type-2 diabetes mellitus with and without dyslipidemia. J Diabetes Metab. 2011;2:141. 25. Usoh IF, Akpan EJ, Etim EO, Farombi EO. Antioxidant actions of dried flower extracts of Hibiscus sabdariffa L. on sodium arsenite-induced oxidative stress in rats. Pakistan J Nutr. 2005;4(3):135-41. 26. Pandey KB and Rizvi SI. Age-dependent oxidative stress biomarkers in type 2 diabetic patients. J Hum Dis. 2011;1(1):1-9. 27. Berlett BS and Stadtman ER. Protein oxidation in aging, disease, and oxidative stress. J Biol Chem. 1997;272(33):20313-6, http://dx.doi.org/10. 1074/jbc.272.33.20313. 28. Hussein J, Mostafa E, El-Waseef M, El-Khayat Z, Badawy E, Medhat D. Effect of omega-3 fatty acids on erythrocyte membrane in diabetic rats. Maced J Med Sci. 2011;4(3):234-9. 29. Ahmed FN, Naqvi FN, Shafiq F. Lipid peroxidation and serum antioxidant enzymes in patients with type 2 diabetes mellitus. Ann N Y Acad Sci. 2006;1084(1):481-9. 30. Sivakumar V, Rajan MSD. Antioxidant effect of Tinospora cordifolia extract in alloxan-induced diabetic rats. Indian J Pharm Sci. 2010;72(6):795-8.

1363


REVIEW

Effects of different types of auditory temporal training on language skills: a systematic review Cristina Ferraz Borges Murphy, Eliane Schochat Faculdade de Medicina da Universidade de Sa˜o Paulo, Sa˜o Paulo/SP, Brazil.

Previous studies have investigated the effects of auditory temporal training on language disorders. Recently, the effects of new approaches, such as musical training and the use of software, have also been considered. To investigate the effects of different auditory temporal training approaches on language skills, we reviewed the available literature on musical training, the use of software and formal auditory training by searching the SciELO, MEDLINE, LILACS-BIREME and EMBASE databases. Study Design: Systematic review. Results: Using evidence levels I and II as the criteria, 29 of the 523 papers found were deemed relevant to one of the topics (use of software – 13 papers; formal auditory training – six papers; and musical training – 10 papers). Of the three approaches, studies that investigated the use of software and musical training had the highest levels of evidence; however, these studies also raised concerns about the hypothesized relationship between auditory temporal processing and language. Future studies are necessary to investigate the actual contribution of these three types of auditory temporal training to language skills. KEYWORDS: Training; Hearing; Language, Music; Software. Murphy CF, Schochat E. Effects of different types of auditory temporal training on language skills: a systematic review. Clinics. 2013;68(10):1364-1370. Received for publication on April 16, 2013; First review completed on May 9, 2013; Accepted for publication on May 9, 2013 E-mail: crist78@yahoo.com Tel.: 55 11 3091-8410

types of auditory training (18-23) that take place in acoustic cabins (‘‘formal auditory training’’). Currently, no consensus has been reached regarding the most effective approach to improving language skills such as phonological awareness, reading and speech discrimination. The purpose of this paper is to perform a systematic review of the effects of different types of auditory temporal training on language skills; we focus on three main approaches: the use of software, formal auditory training and musical training.

& INTRODUCTION Since the 1990s, research has supported the hypothesis, initially proposed by Tallal & Piercy (1), that language disorders are related to a deficit in auditory temporal processing (2-4). According to Habib (4), difficulties are observed in the processing of the temporal characteristics of different types of sensory stimuli, including auditory, visual and sensory-motor stimuli, when the stimuli are presented in rapid succession. More specifically, difficulty involving auditory temporal processing is expressed as a limited capacity to process ‘‘short acoustical elements’’, such as consonants, that comprise the rapid transition of formants. Limitations in this capacity can lead to difficulties, such as associating letters with their specific sounds, which can potentially result in dyslexia. Based on this hypothesis, a large number of studies have investigated the effects of auditory temporal training on language skills (5-23). One topic that is still being actively debated concerns the effectiveness of new approaches to auditory training, such as the use of software (5-17) and musical training (24-33), compared with more traditional

& METHOD For this systematic review, a search was performed between March and April 2013 for papers published in Portuguese, English and Spanish. The following databases were searched: MEDLINE, SciELO, EMBASE and LILACSBIREME. The keywords used in the search included ‘‘dyslexia’’, ‘‘language skills’’, ‘‘poor readers’’, ‘‘literacy’’, ‘‘learning’’, ‘‘learning impairment’’, language impairment’’, ‘‘music education’’, ‘‘computer-based auditory training’’, ‘‘auditory intervention’’, ‘‘auditory temporal processing’’, ‘‘musical training’’, ‘‘language’’ and the corresponding words in Portuguese and Spanish. In addition to the keywords listed above, ‘‘auditory perceptual disorders’’ and ‘‘language development disorders’’ were also included in a search of MeSH (Medical Subject Headings). There were no date restrictions, and the keywords were always combined. For selection from the search results, papers had to: include a main goal of investigating the effects of

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)12

1364


CLINICS 2013;68(10):1364-1370

Auditory temporal training and language Murphy CF and Schochat E

Table 1 - Levels of evidence of the treatment efficacy studies (ASHA, 2004). Level Ia Ib IIa IIb III IV

DESCRIPTION Well-designed meta-analysis of randomized controlled trials Well-designed randomized controlled trials Well-designed controlled studies without randomization Well-designed quasi-experimental studies Well-designed non-experimental studies, i.e., correlational and case studies Expert committee reports, consensus conferences and clinical experiences of respected authorities

alternative intervention (language training). The other three studies reached varying conclusions: in the Gillan et al. study (7), auditory and language skill improvement occurred for all of the trained groups of children with language disorders (i.e., the study group and the alternative groups) demonstrating that the auditory temporal training was as effective as language training; in the Halliday et al. study (11), although the trained group (children with typical development) exhibited improvements in auditory temporal processing after training, this learning did not generalize to the language skills, which casts doubt on the use of auditory training to improve language; in the Gaab et al. study (14), although there was no gain in auditory skills after training, the language skills of the children with dyslexia improved. Therefore, the authors discussed whether the improvement in language after training might have been related to the improvement of indirectly trained skills, such as cognitive skills, rather than sensory capacity, such as auditory temporal processing. The other three studies only investigated language skills after auditory temporal training (6,8,9). Cohen et al. (6) reported improvements in language skills for all groups (including a non-trained group), which may indicate the presence of a test-retest effect; Given et al. (8) corroborated the results of Gillan et al. (7) by reporting improvements following all types of training, which indicates that the success of training in terms of improving language skills is not necessarily related to a specific focus on temporal aspects; Pinheiro & Capellini (9) reported an improvement in the trained group only, although there was no alternatively trained group for comparison in this study.

training on auditory and/or language skills, contain a description of the type of intervention and the post-training implications and be classifiable as level I or II in the evidence hierarchy proposed by American Speech-Language-Hearing Association (34), which is presented in Table 1.

& RESULTS From a sample of 523 papers, 29 original papers classified as evidence levels I and II were included. The results will be discussed within the context of the type of training employed. We found papers related to the use of software (13 papers), formal auditory training (six papers) and musical training (10 papers).

Use of software Table 2 shows the 13 papers that investigated auditory temporal training using different types of software (5-17). All of the papers included were randomized and/or controlled trials; therefore, these papers belonged to evidence levels I and II. Differences in the study groups (typically developing children, children with dyslexia, children with language impairment and learning impairment and adults with schizophrenia), types of software used (Fast ForWord, Earobics, AudioTraining, Treinamento Temporal Auditivo com estĹ´mulos naËœo-verbais e verbais com fala expandida, STAR and others based on the Fast ForWord) and study designs, such as the inclusion of a comparison training group and the types of pre- and post-assessments, are systematized in the table. Of these 13 papers, 10 included auditory temporal processing and language assessment before and after training (5,7,10-17). Of these 10 papers, 7 indicated learning gains in auditory and language skills only in the study group after training based on behavioral (5,10,13,16) and electrophysiological measures (12,15,17). Therefore, these findings support the hypothesized relationship between auditory temporal processing and language skills (5,10,12,13,15-17). However, relevant methodological concerns are present in some of these studies. Tallal et al. (5), Fisher et al. (13) and Strehlow et al. (16) did not investigate the presence of a test-retest effect by including a non-trained group (control group). Additionally, Heim et al. (12), Russo et al. (15) and Hayes et al. (17) did not include an alternative training group to investigate whether the improvement after training was specifically related to the type of training, for example, auditory temporal training. Murphy and Schochat (10) investigated the influence of non-verbal auditory training on language skills in two experiments. In the first experiment, only the group of children with dyslexia that underwent auditory temporal training exhibited improvement in language skills compared to an untrained control group; in the second experiment, a group of children with dyslexia exhibited improvement in language skills following auditory training, but not after a period with an

Formal auditory temporal training Table 3 shows the six papers that investigated the effectiveness of formal auditory temporal training (using an acoustic cabin) (18-23). The samples were diverse and included children with language disorders, children with auditory processing disorders and adult and elderly hearing aid users. All papers were controlled, with high levels of evidence (I or II) according to the ASHA criteria (34). Of the six papers, only one analyzed auditory temporal processing and language following auditory temporal training (19). The researchers applied the auditory training to a group of adult hearing aid users. Compared to the untrained group, the results showed that the trained group exhibited improvements in temporal processing after training that were verified by electrophysiological measures of auditory function (reduced of P3 latencies). The trained group also exhibited improvements in language that were verified by the application of a self-assessment questionnaire that quantified auditory difficulties experienced in daily situations involving communication in quiet, noisy and reverberant environments.

1365


1366

II II

II

II

Gaab et al. (14) Russo et al. (15)

Strehlow et al. (16)

Hayes et al. (17)

27 Learn. D (Earobics)

15 D (sound processing training and reading)

22 D (FFW) 9 Lear. D. (Earobics)

21 Lang D (FFW) 29 schizophrenia (based on the FFW)

10 Learn. D (AudioTraining) e 10 TD (AudioTraining) Study 1-12 D (Software ATP) Study 2-18 D (Software ATP) 22 TD (non-verbal discrimination/Software STAR)

12 Lang. D (FFW)

54 Lang. D (FFW)

23 Lang.D (FFW)

11 Lang D (FFW)

SG

______

14 D (phoneme processing and reading) and 15 D (reading)

2 groups of 22 TD (verbal discrimination) and 20 TD (visual discrimination) ______ 1 group of 26 schizophrenia (visualspacial game, pinball-style game) ______ _______

Study 2-18D (language training)

11 Lang. D (software with natural speech) 1 group of 27 Lang. D (another software) 3 groups of 54 Lang. D each (another software) 3 groups of 14, 15 e 11 Lang. D each (another software) _____

AG

Participants

15 learn. D. and 7 TD

1 group of 23 TD 1 group of 10 TD and Lear. D. ____

1 group of 12 TD ________

1 group of 22 TD

Study 1-28 D

10 Learn. D e 10 TD

1 group of 13 Lang. D

_______

1 group of 27 Lang. D

______

CG

Yes, only for SG Yes, only for SG

Study 1 – Yes, only for SG Study 2 – Yes, only for SG Yes, only for SG and one of the AG

Not tested

Not tested

Yes, for all trained groups

Not tested

Yes, higher for SG

Improvement of ATP after training?

8 to 12

7 to 8

SG

trained

trained

trained

Yes, only for SG Yes, only for SG

Yes, only for SG Yes, only for SG

Study 1 – Yes, only for SG Estudo 2 – Yes, only for SG No improvement

Yes, for all 3 groups Yes, for all 4 groups Yes, for all 4 groups Yes, only for

Yes, higher for SG

Improvement of language skills after training?

Yes, for all but higher for Yes, for all groups after 12 months later sound processing group after 6 or 12 months later Yes, higher for SD Yes, for some measures in SG

10 (mean age) No 8 to 12 Yes, only for SG

8 (mean age) 45 (SG) and 48 (AG)

8 to 10

7 to 14

8 to 14

12

6 to 8

6 to 10

5 to 10

Age

SG: study group; AG: alternative group; CG: control group; Lang. D: language disorder; Learn. D: Learning disorder; D: dyslexia; ATP: auditory temporal processing; FFW: Fast Forword Training; TD: typically development; Software ATT: software auditory temporal processing.

II II

Heim et al. (12) Fisher et al. (13)

II

Pinheiro & Capellini (9)

II

Ib

Given et al. (8)

Halliday et al. (11)

Ib

Gillam et al. (7)

II

Ib

Cohen et al. (6)

Murphy & Schochat (10)

II

Evidence Level

Tallal et al. (5)

Study

Table 2 - Auditory temporal training using different types of software.

Auditory temporal training and language Murphy CF and Schochat E CLINICS 2013;68(10):1364-1370


II Ib

II II

Filippini et al. (20) Vilela et al. (21)

Miranda et al. (22) Schochat et al. (23)

_____ _____

AG

6 HAU 30 APD

______

9 APD and 6 Lang. D _____ 5 PD 5 PD (informal training)

16 HAU 7 HAU

SG

Participants

7 HAU 23 TD

7 TD and 8 Lang. D. 5 PD

13 HAU 7 HAU

CG

60 to 74 8 to 14

7 to 12 7 to 10

60 to 90 16 to 60

Age

Not tested Yes, reduction of P3 latency only for SG Yes, only for trained groups no significant differences before and after training for all groups Yes, for SG Yes, for SG

Improvement of ATP after training?

Not tested Not tested

Not tested Not tested

Yes, qualitative improvement only for SG Yes, qualitative improvement only for SG

Improvement of language skills after training?

1367

II

Ib

II

II II II II

II II

Dege´ & Schwarzer (25)

Gerry et al. (26)

Moreno & Besson (27)

Yucel et al. (28) Moreno et al. (29) Chobert et al. (30) Bolduc (31)

Fujioka et al. (32) Gromko (33)

________

AG

14 (phonological training) e 14 (sports training) 20 TD active musical 14 TD (passive training musical training) 10 TD 10 TD (training in painting) 9 CI _______ 16 TD (musical training) 16 TD (painting training) 12 TD (musical training) 12 TD (painting training) 51 TD (Standley and Hughes 53 TD (government music music training programme) program) 6 TD (Suzuki music school) ______ 43 TD (music education) ________

13 TD

9D

SG

Participants

6 TD 60 TD

9 CI _____ ______ _______

8 TD

26 TD

15 weeks of SG before musical training _____

CG

4 to 6 kindergarten

8 months to 8 years 8,4 (average) 8 (average) 5 (average)

8y (average)

6 months (average)

5 to 6

8,8 (average)

Age

SG: study group; AG: alternative group; D: dyslexia; ATP: auditory temporal processing; TD: typically development; CI: cochlear implant.

II

Evidence Level

Overy et al. (24)

Study

Table 4 - Musical training.

Yes, for SG Not tested

Improvement of musical discrimination Yes, electrophysiological tests Yes, greater for SG Yes, for SD Yes, for SG Yes, for both groups

Not tested

Yes, after training

Improvement of ATP after training?

Not tested Yes, higher for SG

Yes (greater for SG) Yes, for SD Not tested Yes, higher for SG

Not tested

Yes (phonological skills only after training) Yes (phonological awareness in SG and phonological AG) Yes (gestures in SG)

Improvement of language skills after training?

SG: study group; AG: alternative group; CG: control group; ATP: auditory temporal processing; HAU: hearing aid users; Lang. D.: language disorder; APD: auditory processing disorder; PD: phonological disorder; TD: typically development.

II II

Evidence Level

Megale et al. (18) Gil & Io´rio (19)

Study

Table 3 - Formal auditory temporal training.

CLINICS 2013;68(10):1364-1370 Auditory temporal training and language Murphy CF and Schochat E


Auditory temporal training and language Murphy CF and Schochat E

CLINICS 2013;68(10):1364-1370

pitch discrimination after active training. In the Moreno et al. (29) and Bolduc (31) studies, music training was applied to groups of children who were compared to alternative groups that received either painting training (29) or alternative musical training (31). Moreno’s study reported that, after musical training, the study group showed enhanced reading and pitch discrimination skills in speech as indicated by the amplitudes of specific event-related potential components elicited in music and speech tasks. The authors concluded that the results indicated brain plasticity by showing that relatively short periods of training (24 weeks) had strong effects on the functional organization of the children’s brains. In the Bolduc study (31), after a specific music training program (Standley and Hughes music training), the study group exhibited gains in tonal and rhythmic perceptive skills and phonological awareness skills. The positive effects of music training on language and auditory skills have also been demonstrated in infants and children with specific impairments, such as children with dyslexia (24) and profoundly deaf infants with cochlear implants (28). Overy et al. (24) analyzed the effect of musical training on children with dyslexia and reported a significant improvement in auditory temporal skills after training that was verified with tasks involving rapid auditory processing and phonological skills. The authors suggested that timing skills might play a key role in the transfer of musical abilities to language abilities. Yucel et al. (28) applied musical training to infants and children with cochlear implants. To investigate the effects of the training, language and auditory temporal processing assessments were performed before and after training and were compared between the trained group and an untrained control group. The researchers that the music group showed greater improvements in the discrimination of pairs of notes and greater improvements on tests that examined different levels of speech perception. Of the other five studies, three only investigated auditory skills after training (27,30,32), and the other two only investigated language skills (25,33). All of the studies of auditory skills indicated gains in these skills after training. For example, in Moreno & Besson’s study (27), the effect of musical training on typically developing children was compared with the effects of an alternative type of training (training in painting) and no training (i.e., an untrained control group). Electrophysiological measures of auditory function were assessed before and after training in all groups, and the results indicated that the amplitude of a late positive component was largest in response to strong incongruities; however, this amplitude was reduced after training only in the music group. Chobert et al. (30) applied active musical training in to children with typical development, and the mismatch negativities (MMNs) assessed before and after training were compared to a control group. While no between-group differences were identified before training, enhanced pre-attentive processing of syllabic duration and voice onset time, as reflected by greater MMN amplitudes, was noted after 12 months of training only in the music group. Fujioka et al. (32) also investigated auditory cortical responses (auditory evoked potentials) before and after one year of musical lessons. According to these authors, a clear musical training effect was expressed as a larger and earlier N250m peak in the left hemisphere in response to the sound of a violin in the musically trained children compared to the untrained children. The other two

Of the other five papers, one investigated the effects of formal auditory training on language skills (18), and the other four investigated the effects on auditory skills (20-23). Megale and Schochat (18) investigated the effectiveness of formal auditory training in elderly hearing aid users and reported effects similar to those of the Gil & Iorio study (19). Using the Abbreviated Profile of Hearing Aid Benefit (APHAB) self-report scale, these researchers also demonstrated qualitative improvements in language skills after training. Auditory temporal skills were not investigated, but auditory closure and auditory figure-ground skills improved after training. Of the other four papers, three reported gains in auditory temporal processing after training using electrophysiological (20,23) and behavioral measures (20,22). Filippini et al. (20) applied formal auditory training to groups of children with both language and auditory processing disorders; in contrast to the untrained group, both of the trained groups showed improvements in auditory temporal skills after training, as demonstrated by improved performance in behavioral measures of auditory processing and a reduction of the latency of the auditory brainstem response to complex sounds in background noise (c-ABR). Like Gil & Iorio (19) and Megale et al. (18), Miranda et al. (22) applied formal auditory training to a group of elderly hearing aid users and compared that group to a non-trained group (control group) of elderly hearing aid users. The results of this study also indicated greater gains in auditory skills in the trained group compared to the control group. In contrast, Villela et al. (21) compared children with phonological disorders who received formal auditory training to children who received alternative training (informal training) and an untrained group. Neither of the trained groups exhibited any significant differences in auditory temporal skills before and after training, a result that was likely related to the small sample of participants in the study. All studies applied formal auditory training using similar materials (compact discs with tasks involving auditory closure, temporal ordering, figure to ground for digits, sentences and non-verbal sounds) and the procedures employed by Musiek and Schochat (35).

Musical training Table 4 lists 10 papers that investigated musical training and that were classified as evidence level I or II (24-33). Infants, typically developing children, children with dyslexia and children with cochlear implants were included. Of the ten papers selected, five investigated auditory temporal skills and language skills before and after music training (24,26,28,29,31), and all of these papers reported gains in both skills. Three of these studies investigated the effect of music training on infants and children with typical development (26,29,31). For example, Gerry et al. (26) compared the effects of passive musical experiences (just listening to music) and active musical experiences (singing lessons, practice with percussion instruments and rhythm classes) in six-month-old-infants. Both groups were compared to an untrained group. The results demonstrated that, compared to infants assigned to the passive musical experience, the active group showed superior development of prelinguistic communication gestures and social behavior after training. Additionally, the active training group exhibited accelerated acquisition of knowledge about Western musical tonality and exhibited improvements in

1368


CLINICS 2013;68(10):1364-1370

Auditory temporal training and language Murphy CF and Schochat E

exercises were designed to also include specific components of linguistic processing and attention and memory skills. Therefore, results based on these interventions reveal whether the combination of all of the training tasks contributed to the improvements observed after training or whether the same results would have been obtained after training only a single skill. Further studies should include broader top-down skill assessments that incorporate, for example, attention and working memory tasks, before and after training. Only then will it be possible to investigate the extent to which auditory training influences other skills that are also related to language development. When comparing the three approaches, it should be noted that the studies involving software and musical training had higher levels of evidence (level I) because some of these studies included alternative trainings and larger samples. Nevertheless, the software approach remains the most controversial because since the majority of the studies of this approach called into question the hypothesized relationship between auditory temporal processing and language; for example, research has demonstrated that not only auditory temporal training but also alternative types of training that are not related to auditory temporal processing lead to improvements in language skills. These results also address the influences of other top-down skills, as discussed previously. Because all types of perceptual training are likely to lead to gains in memory and attention capacity, language skills seem to improve regardless the type of training applied. It is also notable that there were no blind studies in any of the approaches, which indicates the need for more studies with higher levels of evidence. In conclusion, based on our review of the current literature, the studies that investigated the use of software and musical training had the highest levels of evidence and, consequently, the most reliable data regarding the auditory temporal processing hypothesis. Each of the approaches requires additional studies that employ alternative training groups and blind designs to investigate the actual contribution of auditory temporal training to language skills.

studies on the effects of music training on language skills also indicated gains after training (25,33). Dege and Schwarzer (25) studied the effects of musical training and the effects of two alternative types of training (phonological awareness and sports) on language skills in typically developing children. The results indicated improvements in phonological awareness after training in both the study group and the phonological awareness group. In the Gromko study (33), kindergarten children who received four months of music instruction showed significantly greater gains in the development of their phoneme segmentation fluency compared to children who did not receive music instruction.

& DISCUSSION Most of the papers that investigated the use of software demonstrated that this approach can be an effective form of training for improving auditory temporal processing (5,7,1013,15-17). However, whether this learning generalizes to language skills remains controversial (5-10,12-17). For example, in some studies, the language improvements observed after training related to test-retest effects (6), but in other studies, these improvements seemed to result from any type of training and were not specific to auditory temporal training (7,8). Additionally, variables such as the duration of the training, the characteristics of the software, the type of the training and the assessment measures applied before and after training are likely important and intensify concerns regarding the genuine influence of auditory temporal training on language skills. Few studies were found that employed formal auditory training using an acoustic cabin (18-23). Of these few papers, only one investigated performance on both auditory and language tests after training, but only in a qualitative manner (19). A few other limitations were also noted. First, although the studies had non-trained control groups, most of the studies did not have alternative groups, which are essential for comparing the influence of the main training with the influences of other types of training. Second, the small numbers of participants call into question the statistical power of the results. Therefore, our review of the current literature indicates that few definitive conclusions can be drawn about the effects of this approach on language skills. Regarding musical training, of the ten studies that investigated language performance after training, most described improvements in language skills in the individuals who underwent musical training (24-26,28,29,31,33). Nevertheless, of these seven studies, only five investigated whether the improvements also occurred after auditory temporal training (24,26,28,29,31), and only one included an alternative type of training and a non-trained group (26). Therefore, although all of the studies reported positive effects of training on language skills, additional studies are needed that include alternative training groups, large samples and standardized musical training to replicate the current findings. Another topical issue regarding auditory training is the fact that, in general, perceptual training methods of this type include simultaneous training of several perceptual, cognitive and linguistic skills. For example, in interventions intended to improve spectro-temporal auditory processing deficits in individuals with dyslexia (5), the training

& ACKNOWLEDGMENTS The authors would like to thank Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP) for funding support.

& AUTHOR CONTRIBUTIONS Murphy CF and Schochat E collected the data and wrote the manuscript.

& REFERENCES 1. Tallal P, Piercy M. Developmental aphasia: impaired rate of non-verbal processing as a function of sensory modality. Neuropsychol. 1973;11(4):38998. 2. Tallal P. Auditory temporal perception, phonics and reading disabilities in children. Brain Lang. 1980;9(2):182-98. 3. Fitch RH, Miller S, Tallal P. Neurobiology of speech perception. Annu Rev Neurosci. 1997;20:331-53. 4. Habib M. The neurological basis of developmental dyslexia. An overview and working hypothesis. Brain. 2000;123 Pt 12:2373-99. 5. Tallal P, Miller SL, Bedi G, Byma G, Wang X, Nagarajan SS, et al. Language comprehension in language-learning impaired children improved with acoustically modified speech. Science. 1996;271(5245):81-4. 6. Cohen W, Hodson A, O’Hare A, Boyle J, Durrani T, McCartney E, et al. Effects of computer-based intervention through acoustically modified speech (Fast ForWord) in severe mixed receptive-expres-sive language impairment: outcomes from a randomized controlled trial. J Speech Lang Hear Res. 2005;48(3):715-29. 7. Gillam RB, Loeb DF, Hoffman LM, Bohman T, Champlin CA, Thibodeau L, et al. The efficacy of Fast ForWord Language intervention in

1369


Auditory temporal training and language Murphy CF and Schochat E

8.

9. 10. 11.

12.

13.

14.

15.

16.

17.

18. 19. 20.

CLINICS 2013;68(10):1364-1370

school-age children with language impairment: a randomized controlled trial. J Speech Lang Hear Res. 2008;51(1):97-119. Given BK, Wasserman JD, Chari SA, Beattie K, Eden GF. A randomized, controlled study of computer-based intervention in middle school struggling readers. Brain Lang. 2008;106(2):83-97. Pinheiro FH, Capellini SA. Auditory training in students with learning disabilities. Pro Fono. 2010;22(1):49-54. Murphy CFB, Schochat E. Effect of non-linguistic auditory training on phonological and reading skills. Folia Phoniatr Logop. 2011;63(3):147-53. Halliday LF, Taylor JL, Millward KE, Moore DR. Lack of generalization of auditory learning in typically developing children. J Speech Lang Hear Res. 2012;55(1):168-81. Heim S, Keil A, Choudhury N, Thomas Friedman J, Benasich AA. Early gamma oscillations during rapid auditory processing in children with a language-learning impairment: Changes in neural mass activity after training. Neuropsychol. 2013;24;51(5):990-1001. Fisher M, Holland C, Merzenich MM, Vinogradov S. Using neuroplasticity-based auditory training to improve verbal memory in schizophrenia. Am J Psychiatry. 2009;166(7):805-11. Gaab N, Gabrieli JD, Deutsch GK, Tallal P, Temple E. Neural correlates of rapid auditory processing are disrupted in children with developmental dyslexia and ameliorated with training: an fMRI study. Restor Neurol Neurosci. 2007;25(3-4):295-310. Russo NM, Nicol TG, Zecker SG, Hayes EA, Kraus N. Auditory training improves neural timing in the human brainstem. Behav Brain Res. 2005; 156(1):95-103. Strehlow U, Haffner J, Bischof J, Gratzka V, Parzer P, Resch F. Does successful training of temporal processing of sound and phoneme stimuli improve reading and spelling? Eur Child Adolesc Psychiatry. 2006;15(1):19-29. Hayes EA, Warrier CM, Nicol TG, Zecker SG, Kraus N. Neural plasticity following auditory training in children with learning problems. Clin Neurophysiol. 2003;114(4):673-84. Megale RL, Iorio MC, Schochat E. Auditory training: assessment of the benefit of hearing aid in elderly individuals. Pro Fono. 2010;22(2):101-6. Gil D, Iorio MC. Formal auditory training in adult hearing aid users. Clinics. 2010;65(2):165-74. Filippini R, Beffi-Lopes DM, Schochat E. Efficacy of auditory training using the ABR to complex sounds: Auditory Processing Disorder and Specific Language Impairment. Folia Phoniatr Logop. 2012;64(5):217-26.

21. Vilela N, Wertzner HF, Sanches SGG, Neves-Lobo IF, Carvallo RMM. Processamento temporal de crianc¸as com transtorno fonolo´gico submetidas ao treino auditivo: estudo piloto. J. Soc. Bras. Fonoaudiol. 2012;24(1):42-8. 22. Miranda EC, Gil D, Io´rio MC. Formal auditory training in elderly hearing aid users. Braz J Otorhinolaryngol. 2008;74(6):919-25. 23. Schochat E, Musiek FE, Alonso R, Ogata J. Effect of auditory training on the middle latency response in children with (central) auditory processing disorder. Braz J Med Biol Res. 2010;43(8):777-85. 24. Overy K. Dyslexia and music. From timing deficits to musical intervention. Ann NY Acad Sci. 2003;999:497-505. 25. Dege F, Schwarzer G. The effect of a music program on phonological awareness in preschoolers. Front Psychol. 2011;2:124. 26. Gerry D, Unrau A, Trainor LJ. Active music in infancy enhance musical, communicative and social development. Dev Sci. 2012;15(3):398-407. 27. Moreno S, Besson M. Musical training and language-related brain electrical activity in children. Psychophysiol. 2006;43:287-291. 28. Yucel E, Sennaroglu G, Belgin E. The family oriented musical training for children with cochlear implants: speech and musical perception results of two year follow-up. Int J Pediatr Otorhinolaryngol. 2009;73(7):1043-52. 29. Moreno S, Marques C, Santos A, Santos M, Castro SL, Besson M. Musical training influences linguistic abilities in 8-year-old children: more evidence for brain plasticity. Cereb Cortex. 2009;19(3):712-23. 30. Chobert J, Franc¸ois C, Velay JL, Besson M. Twelve Months of Active Musical Training in 8- to 10-Year-Old Children Enhances the Preattentive Processing of Syllabic Duration and Voice Onset Time. Cereb Cortex. 2012 Dec 12. [Epub ahead of print]. 31. Bolduc J. Effect of a music programme on kindergartners’s phonological awareness skills 1. International Journal of Music Education. 2009;27(1):3747. 32. Fujioka T, Ross B, Kakigi R, Pantev C, Trainor LJ. One year of musical training affects development of auditory cortical-evoked fields in young children. Brain. 2006;129(Pt 10):2593-608. 33. Gromko J. The effect of music instruction on phonemic awareness in beginning readers. Journal of Research in Music Education. 2005; 53(3):199. 34. American Speech–Language Hearing Association. Evidence-based practice in communication disorders: an introduction (technical report). 2004, http://www.asha.org/docs/html/TR2004-00001.html. 35. Musiek FE, Schochat E. Auditory training and central auditory processing disorders. Semin Hear. 1998;19(4):357-66.

1370


RAPID COMMUNICATION

PTK2 and PTPN11 expression in myelodysplastic syndromes Mariana Lazarini,I* Joa˜o Agostinho Machado-Neto,I* Leticia Fro¨hlich Archangelo,I Bruna Fernandes Mendes-Silva,I Carolina Louza˜o Bigarella,I,II Fabiola Traina,I,III Sara Teresinha Olalla SaadI I Hematology and Hemotherapy Center-University of Campinas/Hemocentro-Unicamp, Instituto Nacional de Cieˆncia e Tecnologia do Sangue, Campinas/ SP, Brazil. II Mount Sinai School of Medicine, Department of Developmental and Regenerative Biology, New York, NY, USA. III University of Sa˜o Paulo, Ribeira˜o Preto Medical School, Department of Internal Medicine, Ribeira˜o Preto/SP, Brazil.

OBJECTIVE: The aim of this study was to evaluate the expression of protein tyrosine kinase 2 and protein tyrosine phosphatase non-receptor type 11, which respectively encode focal adhesion kinase protein and src homology 2 domain-containing protein-tyrosine phosphatase 2, in hematopoietic cells from patients with myelodysplastic syndromes. METHODS: Protein tyrosine kinase 2 and tyrosine phosphatase non-receptor type 11 expressions were analyzed by quantitative polymerase chain reaction in bone marrow cells from patients with myelodysplastic syndromes and healthy donors. RESULTS: Protein tyrosine kinase 2 and tyrosine phosphatase non-receptor type 11 expressions did not significantly differ between normal cells and myelodysplastic cells. CONCLUSIONS: Our data suggest that despite the relevance of focal adhesion kinase and src homology 2 domaincontaining protein-tyrosine phosphatase 2 in hematopoietic disorders, their mRNA expression do not significantly differ between total bone marrow cells from patients with myelodysplastic syndromes and healthy donors. KEYWORDS: Myelodysplastic Syndromes; PTPN11; PTK2; FAK; SHP2. Lazarini M, Machado-Neto JA, Archangelo LF, Mendes-Silva BF, Bigarella CL, Traina F, et al. PTK2 and PTPN11 expression in myelodysplastic syndromes. Clinics. 2013;68(10):1371-1375. Received for publication on April 6, 2013; First review completed on June 11, 2013; Accepted for publication on June 25, 2013 E-mail: sara@unicamp.br * contributed equally to this work Tel.: 55 19 3521-8734

encodes focal adhesion kinase (FAK), a tyrosine kinase involved in cell proliferation, adhesion and migration (3). FAK is overexpressed in several cancers and its expression usually correlates with a poor prognosis (3). Recent evidences indicate that FAK plays a role in hematopoietic disorders. FAK is upregulated in AML and enhances the migration of leukemic cells from the marrow to circulation, confers drug resistance, and negatively influences the clinical outcome (4). FAK splice variants are abnormally expressed in the primary leukemic cells of AML patients with poor prognosis and induced an increase in the clonogenicity of normal human hematopoietic progenitor cells (5). Moreover, the silencing of this protein in erythroid and myeloid progenitors resulted in a reduced cell growth and survival in response to cytokines, and in a defective activation and expression of antiapoptotic proteins (6). PTPN11 encodes src homology 2 domain-containing protein-tyrosine phosphatase 2 (SHP2), a tyrosine phosphatase with critical cell properties, including the regulation of proliferation, apoptosis, and differentiation (7). SHP2 expression levels are elevated in AML and are related to the hyperproliferative capacity and the degree of differentiation of primary leukemia cells (8). Animal models lacking SHP2 expression in hematopoietic tissues presented peripheral blood

& INTRODUCTION Myelodysplastic syndromes (MDS) encompass a group of hematological disorders characterized by impaired hematopoiesis and a risk of progression to acute myeloid leukemia (AML). Low-risk MDS patients present high levels of intramedullar apoptosis, whereas high-risk MDS patients have impaired cell differentiation and increased cell proliferation (1). Aberrant gene expression is involved in the pathogenesis of MDS and the progression to AML (2). Therefore, studies on the expression of genes involved in cell proliferation, survival and differentiation are important to help elucidate this disease. Two genes that participate in fundamental cellular processes are protein tyrosine kinase 2 (PTK2) and protein tyrosine phosphatase non-receptor type 11 (PTPN11). PTK2

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)13

1371


PTK2 and PTPN11 in Myelodysplastic Syndromes Lazarini M et al.

CLINICS 2013;68(10):1371-1375

patients were grouped into low- and high-risk MDS according to the World Health Organization (WHO) (12,13) and French American British (FAB) (14) classifications, and the International Prognostic Score System (IPSS) (15).

and bone marrow cytopenia (9,10), in addition to increased apoptosis and a reduced quiescence and repopulation capacity of hematopoietic stem cells (10). SHP2 knockdown in normal human cord blood CD34+ cells strongly inhibited cell survival, proliferation, and differentiation in response to growth factor stimuli (11). Despite the fact that both FAK and SHP2 are upregulated in AML, there are few studies in MDS. Therefore, we aimed to evaluate FAK and SHP2 mRNA expression in bone marrow cells from healthy donors and MDS patients.

Quantitative polymerase chain reaction (qPCR) Bone marrow samples were submitted to RNA extraction using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) after removal of erythrocytes by hemolysis. The reverse transcription reaction was performed using the RevertAidTM First Strand cDNA Synthesis Kit (MBI Fermentas, St. Leon-Rot, Germany). Gene expression was evaluated by qPCR in an ABI 7500 Sequence Detector System (Applied Biosystems, Foster City, CA, USA), using specific primers for amplification of PTK2 and PTPN11 and the suitable housekeeping gene HPRT. Primer sequences are described in Table 2. The relative quantification value of gene expression was calculated using the equation 2-DDCT (16).

& MATERIALS AND METHODS Bone marrow samples Bone marrow aspirates were obtained from 43 patients diagnosed with MDS (median age: 66 years, range: 16-85 years) before treatment, and from 13 healthy donors (median age: 31 years, range: 18-56 years). This study was approved by the National Ethical Committee Board. Patients’ characteristics are described in Table 1. The

Statistical analysis Statistical analyses were performed using GraphPad Instat 5 (GraphPad Software, Inc., San Diego, CA, USA). The Mann-Whitney test was used for comparisons between groups. The level of significance was set at p,0.05.

Table 1 - Patient characteristics. Patient characteristics MDS patients Gender Male/Female Age (years), median (range) WHO Low-risk group: RCUD/RCMD/RARS High-risk group: RAEB-1/RAEB-2 AML with myelodysplasia-related changes* IPSS Low-risk group: Low-risk/INT-1 High-risk group: INT-2/High-risk Not available FAB Low-risk group: RA/RARS High-risk group: RAEB/RAEBt Cytogenetic risk Low risk Intermediate risk High risk Not available Karyotype Normal karyotype -Y Monosomy 7 Trisomy 8 Not available Number of cytopenic cell 0/1 2/3 BM blast (%) ,5% $5 and ,10% $10 and ,20% $20 and ,30%

Number 43 29/14 66 (16-85)

& RESULTS We observed no differences in PTK2 expression between normal and MDS bone marrow cells (median [range]: 1.00 [0.01-3.39] vs. 1.30 [0.01-8.10]; Figure 1A). PTK2 expression did not differ between low- and high-risk MDS patients according to WHO classification (1.29 [0.01-8.10] vs. 0.60 [0.04-2.20]), IPSS (1.15 [0.01-4.95] vs. 1.79 [0.55-8.10]), or FAB classification (1.26 [0.01-4.95] vs. 1.40 [0.04-8.10]) (Figure 1BD) and cytogenetic risk (low-risk: 1.09 [0.01-4.95] vs. intermediate/high-risk: 1.40 [0.55-8.10]); all p.0.05. Interestingly, the MDS patient who had presented the highest percentage of bone marrow blasts (23%) also presented the highest levels of PTK2 (6.2-fold above the median of the MDS group). Regarding the analysis of PTPN11 gene, we observed a heterogeneous expression and no significant differences between normal and MDS bone marrow cells (1.00 [0.1117.39] vs. 0.58 [0.01-7.36]; Figure 2A). The comparison between low- and high-risk MDS patients demonstrated a non-significant increase in PTPN11 expression in the highrisk group according to the WHO classification (0.54 [0.047.36] vs. 1.02 [0.05-4.24]), IPSS (0.54 [0.01-7.36] vs. 1.71 [0.102.80]) and FAB classification (0.54 [0.01-17.36] vs. 1.08 [0.054.24]) (Figure 2B-D). In addition, there was no significant difference in the cytogenetic risk between low- and intermediate/high-risk patients (low risk: 0.54 [0.01-7.36] vs. intermediate/high-risk: 2.52 [0.10-2.80]; all p.0.05).

4/20/7 6/3 3 17/19 5/1 1 24/7 8/4 36/1 3 2 1 36 1 2 3 1 5/12 19/7 31 6 3 3

Table 2 - Primer sequences and concentrations.

WHO: World Health Organization; RCUD: Refractory Cytopenia with Unilineage Dysplasia; RCMD: Refractory Cytopenia with Multilineage Dysplasia; RAEB-1: Refractory Anemia with Excess Blasts-1; RAEB-2: Refractory Anemia with Excess Blasts-2; AML: Acute Myeloid Leukemia; IPSS: International Prognostic Score System; INT-1: Intermediate-1; INT-2: Intermediate-2; FAB: French American British; RA: Refractory Anemia; RARS: Refractory Anemia with Ringed Sideroblasts; RAEB: Refractory Anemia with Excess Blasts; RAEBt: Refractory Anemia with Excess Blasts in Transformation; BM: bone marrow; *Excluded from the WHO classification analysis.

Gene

Sequence

Concentration

PTK2

FW: 59- GCGTCTAATCCGACAGCAACA -39 RV: 59- CTCGAGAGAGTCTCACATCAGGTT -39 FW: 59- CCGCTCATGACTATACGCTAAG -39 RV: 59-AGACCGTTCTCTCCGTATTCC -39 FW: 59- GAACGTCTTGCTCGAGATGTG -39 RV: 59- TCCAGCAGGTCAGCAAAGAAT -39

300 nM

PTPN11 HPRT

1372

400 nM 150 nM


CLINICS 2013;68(10):1371-1375

PTK2 and PTPN11 in Myelodysplastic Syndromes Lazarini M et al.

Figure 1 - PTK2 expression in normal and MDS bone marrow cells. (A) PTK2 mRNA expression in total bone marrow cells from healthy donors and MDS patients evaluated by qPCR. (B) PTK2 mRNA expression in low-risk and high-risk MDS patients according to the World Health Organization (WHO) classification, (C) the International Prognostic Score System (IPSS) and (D) the French American British (FAB) classification. Horizontal lines represent median values.

impacted the clonogenicity of progenitor cells (19). In our study, despite the role of FAK protein expression and activity in MDS cells, we observed no differences in FAK mRNA expression between total bone marrow samples from MDS patients and healthy donors. FAK expression varies according to the hematopoietic cell lineage, and different FAK signaling pathways seem to be triggered according to cell type (3), regulating different aspects of cell behavior, such as proliferation, survival, motility, and interactions between progenitor cells and the bone marrow microenvironment (17). Moreover, FAK phosphorylation is known to play important roles, activating intracellular signaling pathways downstream of integrins and growth factors (17). Therefore, we anticipate that FAK mRNA expression is not abnormal in MDS total bone marrow cells. Furthermore, studies regarding FAK protein

& DISCUSSION Several studies have reported that FAK and SHP2 are involved in hematopoietic disorders (7,17), which reinforces the need to assess these proteins in MDS. A recent study showed that the increased expression of heat shock protein 90 (HSP90) in mononuclear and CD34+ cells from MDS patients was associated with increased FAK expression and phosphorylation. Moreover, the expression of HSP90, FAK, and pFAK increased after transformation and was related with a poor prognosis or adverse cytogenetics (18). Mesenchymal stromal cells from high-risk MDS patients also presented increased expression and nuclear co-localization of paxillin, pFAK, and HSP90, which correlated with a proliferative advantage of these cells and negatively

1373


PTK2 and PTPN11 in Myelodysplastic Syndromes Lazarini M et al.

CLINICS 2013;68(10):1371-1375

Figure 2 - PTPN11 expression in normal and MDS bone marrow cells. (A) PTPN11 mRNA expression in total bone marrow cells from healthy donors and MDS patients evaluated by qPCR. (B) PTPN11 mRNA expression in low-risk and high-risk MDS patients according to the World Health Organization (WHO) classification, (C) the International Prognostic Score System (IPSS) and (D) the French American British (FAB) classification. Horizontal lines represent median values.

expression and activation in isolated hematopoietic cell lineages may help to explain the possible role of this protein in MDS. PTPN11 expression did not differ between normal and MDS bone marrow cells. We observed an increased PTPN11 expression in high-risk MDS patients compared with lowrisk patients; however, the difference was not significant. The small number of high-risk MDS patients may have affected the results; therefore, it is possible that a higher expression of SHP2 is implicated in some cases of MDS, reflecting the heterogeneity of the disease. In addition to gene expression, mutations and phosphorylation are important SHP2 regulatory events. PTPN11 mutations are associated with hematological disorders. PTPN11

mutations are present in more than 30% of patients with juvenile myelomonocytic leukemia and result in constitutive activation of the Ras signaling pathway and other effectors, deregulating myeloid growth (20). However, PTPN11 mutations do not represent a major molecular event in de novo MDS (21). Phosphorylation of SHP2 follows growth factor or cytokine stimulation and leads to the activation of the PI3K/ Akt and RAS/MAPK signaling pathways, which are related to apoptosis and cell proliferation (3,7). SHP2 was found to be constitutively phosphorylated in leukemic cells and in normal hematopoietic cells after mitogenic stimulation, suggesting a correlation between its expression/activation and the hyperproliferative phenotype of leukemia (8). Therefore, as with

1374


CLINICS 2013;68(10):1371-1375

PTK2 and PTPN11 in Myelodysplastic Syndromes Lazarini M et al. 8. Xu R, Yu Y, Zheng S, Zhao X, Dong Q, He Z, et al. Overexpression of Shp2 tyrosine phosphatase is implicated in leukemogenesis in adult human leukemia. Blood. 2005;106(9):3142-9, http://dx.doi.org/10.1182/ blood-2004-10-4057. 9. Chan G, Cheung LS, Yang W, Milyavsky M, Sanders AD, Gu S, et al. Essential role for Ptpn11 in survival of hematopoietic stem and progenitor cells. Blood. 2011;117(16):4253-61, http://dx.doi.org/10. 1182/blood-2010-11-319517. 10. Zhu HH, Ji K, Alderson N, He Z, Li S, Liu W, et al. Kit-Shp2-Kit signaling acts to maintain a functional hematopoietic stem and progenitor cell pool. Blood. 2011;117(20):5350-61, http://dx.doi.org/10.1182/blood2011-01-333476. 11. Li L, Modi H, McDonald T, Rossi J, Yee JK and Bhatia R. A critical role for SHP2 in STAT5 activation and growth factor-mediated proliferation, survival, and differentiation of human CD34+ cells. Blood. 2011;118(6):1504-15, http://dx.doi.org/10.1182/blood-2010-06-288910. 12. Swerdlow S, Campo E, Lee Harris N, Jaffe E, Pileri S, Stein H, et al. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon, France: IARC; 2008. 13. Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood. 2009;114(5):937-51, http://dx.doi.org/10. 1182/blood-2009-03-209262. 14. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, et al. Proposals for the classification of the myelodysplastic syndromes. Br J Haematol. 1982;51(2):189-99. 15. Greenberg P, Cox C, LeBeau MM, Fenaux P, Morel P, Sanz G, et al. International scoring system for evaluating prognosis in myelodysplastic syndromes. Blood. 1997;89(6):2079-88. 16. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta C(T)) Method. Methods. 2001;25(4):402-8, http://dx.doi.org/10.1006/meth.2001.1262. 17. Lu J, Sun Y, Nombela-Arrieta C, Du KP, Park SY, Chai L, et al. Fak depletion in both hematopoietic and nonhematopoietic niche cells leads to hematopoietic stem cell expansion. Exp Hematol. 2012;40(4):307-17 e3, http://dx.doi.org/10.1016/j.exphem.2011.11.010. 18. Flandrin-Gresta P, Solly F, Aanei CM, Cornillon J, Tavernier E, Nadal N, et al. Heat Shock Protein 90 is overexpressed in high-risk myelodysplastic syndromes and associated with higher expression and activation of Focal Adhesion Kinase. Oncotarget. 2012;3(10):1158-68. 19. Aanei CM, Eloae FZ, Flandrin-Gresta P, Tavernier E, Carasevici E, Guyotat D, et al. Focal adhesion protein abnormalities in myelodysplastic mesenchymal stromal cells. Exp Cell Res. 2011;317(18):2616-29, http://dx.doi.org/10.1016/j.yexcr.2011.08.007. 20. Loh ML, Vattikuti S, Schubbert S, Reynolds MG, Carlson E, Lieuw KH, et al. Mutations in PTPN11 implicate the SHP-2 phosphatase in leukemogenesis. Blood. 2004;103(6):2325-31, http://dx.doi.org/10.1182/ blood-2003-09-3287. 21. Tartaglia M, Niemeyer CM, Fragale A, Song X, Buechner J, Jung A, et al. Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet. 2003;34(2):148-50, http://dx.doi.org/10.1038/ng1156.

FAK, it would be interesting to investigate whether the activation of SHP2, rather than mRNA expression, participates in the pathophysiology of MDS.

& ACKNOWLEDGMENTS The authors would like to thank Raquel S Foglio for the English review of this manuscript. This work received financial support from Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) and Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP).

& AUTHOR CONTRIBUTIONS Lazarini M and Machado-Neto JA contributed equally to the selection of patients, performed all experiments, analyzed the results, and wrote the manuscript. Archangelo LF, Bigarella CL, and Mendes-Silva BF aided in the quantitative PCR analysis and participated in the writing of the manuscript. Traina F contributed to the selection of patients, clinical follow-up of the patients, analysis of the results, and writing of the manuscript. Ollala Saad ST was the principal investigator.

& REFERENCES 1. Davids MS and Steensma DP. The molecular pathogenesis of myelodysplastic syndromes. Cancer Biol Ther. 2010;10(4):309-19. 2. Bar M, Stirewalt D, Pogosova-Agadjanyan E, Wagner V, Gooley T, Abbasi N, et al. Gene Expression Patterns in Myelodyplasia Underline the Role of Apoptosis and Differentiation in Disease Initiation and Progression. Transl Oncogenomics. 2008;3:137-49. 3. Siesser PM and Hanks SK. The signaling and biological implications of FAK overexpression in cancer. Clin Cancer Res. 2006;12(11 Pt 1):3233-7, http://dx.doi.org/10.1158/1078-0432.CCR-06-0456. 4. Recher C, Ysebaert L, Beyne-Rauzy O, Mansat-De Mas V, Ruidavets JB, Cariven P, et al. Expression of focal adhesion kinase in acute myeloid leukemia is associated with enhanced blast migration, increased cellularity, and poor prognosis. Cancer Res. 2004;64(9):3191-7, http:// dx.doi.org/10.1158/0008-5472.CAN-03-3005. 5. Despeaux M, Chicanne G, Rouer E, De Toni-Costes F, Bertrand J, Mansat-De Mas V, et al. Focal adhesion kinase splice variants maintain primitive acute myeloid leukemia cells through altered Wnt signaling. Stem Cells. 2012;30(8):1597-610, http://dx.doi.org/10.1002/stem.1157. 6. Vemula S, Ramdas B, Hanneman P, Martin J, Beggs HE and Kapur R. Essential role for focal adhesion kinase in regulating stress hematopoiesis. Blood. 2010;116(20):4103-15, http://dx.doi.org/10.1182/blood-201001-262790. 7. Nabinger SC and Chan RJ. Shp2 function in hematopoietic stem cell biology and leukemogenesis. Curr Opin Hematol. 2012;19(4):273-9, http://dx.doi.org/10.1097/MOH.0b013e328353c6bf.

1375


RAPID COMMUNICATION

Early transconjunctival needling revision with 5fluorouracil versus medical treatment in encapsulated blebs: a 12-month prospective study Ricardo Suzuki, Remo Susanna-Jr Faculdade de Medicina da Universidade de Sa˜o Paulo, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: To compare the efficacy of transconjunctival needling revision with 5-fluorouracil versus medical treatment in glaucomatous eyes with uncontrolled intraocular pressure due to encapsulated bleb after trabeculectomy. METHODS: Prospective, randomized, interventional study. A total of 40 eyes in 39 patients with elevated intraocular pressure and encapsulated blebs diagnosed at a maximum five months after primary trabeculectomy with mitomycin C were included. The eyes were randomized to either transconjunctival needling revision with 5- fluorouracil or medical treatment (hypotensive eyedrops). A maximum of two transconjunctival needling revisions per patient was allowed in the needling arm. All patients underwent follow-up for 12 months. Successful treatment was defined as an intraocular pressure # 18 mmHg and a 20% reduction from baseline at the final follow-up. Clinicaltrial.gov: NCT01887223. RESULTS: Mean intraocular pressure at the final 12-month follow-up was lower in the transconjunctival needling revision group compared to the medical treatment group. Similar numbers of eyes reached the criteria for treatment success in both the transconjunctival needling revision group and the medical treatment group. CONCLUSIONS: Despite similar success rates in eyes randomized to transconjunctival needling revision with 5fluorouracil compared to eyes receiving medical treatment, there was a significantly lower mean intraocular pressure at 12 months after transconjunctival needling revision. KEYWORDS: Needling; Medical Treatment; Glaucoma; Encapsulated bleb; Revision; 5-Fluorouracil. Suzuki R, Susanna-Jr R. Early transconjunctival needling revision with 5-fluorouracil versus medical treatment in encapsulated blebs: a 12month prospective study. Clinics. 2013;68(10):1376-1379. Received for publication on April 26, 2013; First review completed on April 26, 2013; Accepted for publication on July 10, 2013 E-mail: risuzukioft@hotmail.com Tel.: 55 11 5181-1730

Scarring under or over the scleral flap in the subconjunctival space appears to be the most common event leading to filtering failure (7,8). Scar tissue formation over the scleral flap in the subconjunctival space or encapsulated bleb (Tenon’s capsule cyst) formation may occur at any point after the initial surgery. Some authors have suggested encapsulation rates ranging from 13.7% to 29% after trabeculectomy (9-11). Transconjunctival needling revision (TNR), which removes part of the fibroses with a minimally invasive technique and restores filtration, is one treatment option (6,12). The use of antifibrotic agents, such as 5fluorouracil (5-FU) (1,5,6,12) or mitomycin C (MMC) (5), as adjunctives is suggested to increase the procedural success rate. Conversely, several authors have proposed MT with topical hypotensive medication as a successful treatment in patients with encapsulated blebs (13-15). Several studies (1,5,12,16-18) have reported different success rates and some mixed criteria regarding successful target pressure, bleb morphological features, time of needling procedure, whether single or multiple procedures were performed and whether antifibrotic agents were used.

& INTRODUCTION To avoid the initiation or progression of visual field defects, the reduction of intraocular pressure (IOP) is the aim of treatment for all glaucoma patients. Surgical treatment is the next step after initial medical treatment (MT) failure. Trabeculectomy is still the gold standard surgery for many specialists (1-5), and proper postoperative management is essential for the achievement of success during the follow-up period. The identification and prompt management of the early aspects of bleb failure are paramount for reducing the rate of ultimate failure of the filtering procedure (6).

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)14

1376


CLINICS 2013;68(10):1376-1379

Needling revision versus medical treatment Suzuki R and Susanna-Jr R

The purpose of this study was to evaluate the short-term efficacy of early TNR with 5-FU and to compare its outcomes to MT in eyes with encapsulated blebs and uncontrolled IOP after trabeculectomy.

& MATERIALS AND METHODS We conducted a prospective, randomized interventional study on 40 eyes in 39 patients with encapsulated blebs developed within five months or less after primary trabeculectomy with MMC and IOP $ 20 mmHg at the Hospital das Clı´nicas of the University of Sa˜o Paulo, Brazil. Data were collected from May 2010 to June 2011. None of the eyes examined in this study received ocular hypotensive agents after the first surgery. An encapsulated bleb was defined as a localized, dome-shaped bleb surrounded by a fibrous tissue called the ‘‘ring of steel’’ (figure 1). Patients were randomized in two groups: TNR with 5-FU and MT. Only one surgeon (RS) performed TNRs. A maximum of two TNRs were allowed. The study protocol was approved by the Ethics Committee of the Hospital das Clı´nicas of the University of Sa˜o Paulo, Brazil. After written informed consent was given and signed, the TNR was performed. Topical anesthetic (tetracaine 0.5%), antibiotic (Ofloxacin 2%) and 5% povidone-iodine solutions were instilled into the eye. A lid speculum was inserted. At the slit lamp, a 27-gauge needle attached to a 1-ml syringe was passed into the subconjunctival space on the opposite site of the scleral flap (figure 2). After that, 0.1 ml of 2% lidocaine with epinephrine was injected. The needle was advanced into a long track towards the cyst to minimize the chance of leakage. Using up-and-down and back-and-forth sweeping movements, the scar tissue was ruptured underneath the conjunctiva, always taking care not to perforate the bleb wall. Then, aqueous flow was reestablished, increasing the bleb size. The needle was removed, and, with a 25-gauge needle attached to an insulin syringe, 5 mg (0.2 ml of 25 mg/ ml solution) of 5-FU was subconjunctivally injected superior to the bleb (figure 2). A topical antibiotic (ofloxacin 2%) was given four times a day for two weeks, and a steroid (prednisolone 1%) was given four times a day and was tapered as clinically indicated. The intraocular pressure was measured immediately after; one day after; and one, three, six, and twelve months after the

Figure 2 - A) Encapsulated bleb. B) Needle insertion site. C) Subconjunctival 5-FU injection site.

procedure. Only the twelve-month IOP was analyzed in this study. All patients were evaluated at the same time (10 am ¡ one hour) to minimize fluctuation issues. According to Shin et al. (16), the target intraocular pressure was set for each patient based on the disease progression severity and clinical history. Success was considered as achieving the target pressure, # 18 mmHg, and a 20% reduction from baseline at last follow-up (without any hypotensive agents in the TNR group). The exclusion criterion was the requirement of any further treatments, including medical or surgical procedures. In the MT group, topical hypotensive treatment was initialized with a nonspecific beta-blocker and/or prostaglandin, followed by carbonic anhydrase inhibitors and/or selective alpha agonists, as necessary. Systemic medication was not used. The exclusion criterion was the requirement of any further surgical procedures. The demographic data and characteristics of the study population were collected. Statistical analyses between variables were performed using the Student’s t-test for parametric data and chi-square and Mann-Whitney U tests for non-parametric data. Two tailed p values ,0.05 were taken to indicate significance. The SPSS software version 15.0 (SPSS Inc., Chicago, IL) was used for statistical analyses.

& RESULTS Among the 40 eyes analyzed during a 12-month time period, 20 were randomized to TNR, and 20 were randomized to MT. In the TNR group, the mean age was 57.30¡15.21 years (range 27-83 years). Fifty-five percent of the subjects were female, and 65% were white. In the MT group, the mean age was 63.30¡12.01 years (range 27-79 years), 60% were female, and 30% were white (Table 1). The types of glaucoma are also shown in Table 1. The mean times between the filtering surgery and initial treatment after randomization were 43.15¡28.71 days

Figure 1 - Encapsulated bleb – localized, dome-shaped bleb (arrows).

1377


Needling revision versus medical treatment Suzuki R and Susanna-Jr R

CLINICS 2013;68(10):1376-1379

Table 1 - Demographic data and characteristics of the study population.

Age (mean ¡ SD – range) Gender Female Male Race White Black Asian Glaucoma Type Primary open angle Congenital Inflammatory Pseudoexfoliative Neovascular Time from last surgery to treatment (days) – range

Transconjunctival needling revision (TNR)

Medical treatment (MT)

p value

57.30¡15.21 (27-83)

63.30¡12.01 (27-79)

0.17

11 (55%) 9 (45%)

12 (60%) 8 (40%)

0.75

13 (65%) 7 (35%)

6 (30%) 13 (65%) 1 (5%)

0.07

17 (85%) 1 (5%) 1 (5%) 1 (5%) 43.15¡28.71 (17-153)

18 (90%) 1 (5%) 1 (5%) 51.60¡30.61 (23-139)

0.55 0.34

than flat blebs if needling was performed within three months after trabeculectomy. Iwach et al. (20) reported a lower failure rate after the needling procedure in encapsulated blebs (19%) in comparison to diffuse blebs (53%). Interestingly, Broadway et al. (1) reported success rates of 47% for encapsulated blebs and 55% for flat blebs when considering an IOP reduction to less than 22 mmHg as success. To minimize the influence of bleb morphology, we have only considered encapsulated blebs in this study. The success rate of MT in eyes with encapsulated blebs has been reported to range from 71 to 100% (23-25). Comparisons between MT and surgical revision have been previously reported. Costa et al. (13) compared eyes with encapsulated blebs that were randomized to MT or the needling procedure; at the last follow-up, they reported a mean IOP of 16.09¡6.92 mmHg in the eyes receiving MT in comparison to a mean IOP of 18.92¡6.39 mmHg in the eyes submitted to the needling procedure in addition to MT. In our study, we reported significantly better results after TNR alone (without medication) in comparison to MT (12.14¡2.80 mmHg and 15.13¡2.07 mmHg, respectively). The use of adjunctive 5-FU may explain our better results in eyes submitted to TNR. Several studies have shown that the use of adjunctive antifibrotic agents seems to increase the success rates of both MMC and 5-FU (1,3,17,20,26). Although the time between the trabeculectomy and the needling procedure does not seem to be a determinant of success, (1) Rotchford & King (12) reported better results when performing needling revisions within a three-month period after trabeculectomy in elevated blebs. We also performed revisions in elevated blebs (encapsulated) a short period of time after trabeculectomy (51.60¡30.61 days). Complications of the needling procedure after trabeculectomy have been previously reported, but most were considered minor and were resolved spontaneously (18,27). Temporary conjunctival leakage, small hyphemas and temporary shallowing of the anterior chamber have been

(range 17-153 days) in the TNR group and 51.60¡30.61 days (range 23-139 days) in the MT group (p = 0.34). The mean IOPs before the initial treatment were 25.15¡5.25 mmHg in the TNR group and 25.10¡4.36 mmHg in the MT group (p = 0.58). The mean IOPs at the 12 month follow-up were 12.14¡2.80 mmHg in the TNR group and 15.13¡2.07 mmHg in the MT group (p = 0.004) (Table 2). Fourteen eyes (70%) in the TNR group and 15 eyes (75%) in the MT group were considered successes (p = 0.89). Six eyes (30%) were excluded in the TNR group (five required MT and one further surgery), and five eyes (25%) were excluded in the MT group (four required further filtering surgery and one was submitted to the needling procedure) (p = 0.79). The comparison of the IOP distribution before and after the treatment in both groups is shown in Figure 3 (boxplot). The mean number of needling procedures in the TNR group was 1.35¡0.49, and the mean number of medications in the MT group was 2.15¡0.74 at the last follow-up. Complications after the needling procedure were observed in three eyes (15%). One eye had a flat anterior chamber and hyphema, and one eye had a small choroidal effusion. Both were resolved with conservative treatment. One eye had a flat anterior chamber and a choroidal effusion that required surgical treatment.

& DISCUSSION Several studies have demonstrated the efficacy of needling revision in failing filtering blebs after filtration surgery (1-4,6,12,13,16-21). However, as bleb morphology, time of needling, follow-up period and successful criteria are different in each study, comparisons of these studies would not be meaningful. Multiple bleb morphologies have been present in the majority of studies; encapsulated blebs appear to have better results in comparison to flat blebs (22). Rotchford & King (12) suggested that high blebs were more likely to survive

Table 2 - Average intraocular pressure before and after randomization (at the 12-month follow-up) in the TNR and MT groups.

IOP pre-treatment (mmHg) IOP post-treatment at 12-months follow up (mmHg)

Transcojunctival needling revision (TNR)

Medical Treatment (MT)

P value

25.15 ¡ 5.25 12.14 ¡ 2.80

25.10 ¡ 4.36 15.13 ¡ 2.07

0.58 0.004

1378


CLINICS 2013;68(10):1376-1379

Needling revision versus medical treatment Suzuki R and Susanna-Jr R 2. Maestrini HA, Cronemberger S, Matoso HD, Reis JR, Merula RV, Filho AD, et al. Late needling of flat filtering blebs with adjunctive mitomycin C: efficacy and safety for the corneal endothelium. Ophthalmology. 2011;118(4):755-62. 3. Kapasi MS, Birt CM. The efficacy of 5-fluorouracil bleb needling performed 1 year or more posttrabeculectomy: a retrospective study. J Glaucoma. 2009;18(2):144-8. 4. Paris G, Zhao M, Sponsel WE. Operative revision of non-functioning filtering blebs with 5-fluorouracil to regain intraocular pressure control. Clin Experiment Ophthalmol. 2004;32(4):378-82. 5. Fagerli M, Lofors KT, Elsas T. Needling revision of failed filtering blebs after trabeculectomy: a retrospective study. Acta Ophthalmol Scand. 2003;81(6):577-82. 6. King AJ, Rotchford AP, Alwitry A, Moodie J. Frequency of bleb manipulations after trabeculectomy surgery. Br J Ophthalmol. 2007;91(7):873-7. 7. Skuta GL, Parrish RK, 2nd. Wound healing in glaucoma filtering surgery. Surv Ophthalmol. 1987;32(3):149-70. 8. Addicks EM, Quigley HA, Green WR, Robin AL. Histologic characteristics of filtering blebs in glaucomatous eyes. Arch Ophthalmol. 1983;101(5):795-8. 9. Schwartz AL, Van Veldhuisen PC, Gaasterland DE, Ederer F, Sullivan EK, Cyrlin MN. The Advanced Glaucoma Intervention Study (AGIS): 5. Encapsulated bleb after initial trabeculectomy. Am J Ophthalmol. 1999;127(1):8-19. 10. Richter CU, Shingleton BJ, Bellows AR, Hutchinson BT, O’Connor T, Brill I. The development of encapsulated filtering blebs. Ophthalmology. 1988;95(9):1163-8. 11. Campagna JA, Munden PM, Alward WL. Tenon’s cyst formation after trabeculectomy with mitomycin C. Ophthalmic Surg. 1995;26(1):57-60. 12. Rotchford AP, King AJ. Needling revision of trabeculectomies bleb morphology and long-term survival. Ophthalmology. 2008;115(7):114853 e4. 13. Costa VP, Correa MM, Kara-Jose N. Needling versus medical treatment in encapsulated blebs. A randomized, prospective study. Ophthalmology. 1997;104(8):1215-20. 14. Pederson JE, Smith SG. Surgical management of encapsulated filtering blebs. Ophthalmology. 1985;92(7):955-8. 15. Hodge W, Saheb N, Balazsi G, Kasner O. Treatment of encapsulated blebs with 30-gauge needling and injection of low-dose 5-fluorouracil. Can J Ophthalmol. 1992;27(5):233-6. 16. Shin DH, Kim YY, Ginde SY, Kim PH, Eliassi-Rad B, Khatana AK, et al. Risk factors for failure of 5-fluorouracil needling revision for failed conjunctival filtration blebs. Am J Ophthalmol. 2001;132(6):875-80. 17. Gutierrez-Ortiz C, Cabarga C, Teus MA. Prospective evaluation of preoperative factors associated with successful mitomycin C needling of failed filtration blebs. J Glaucoma. 2006;15(2):98-102. 18. Allen LE, Manuchehri K, Corridan PG. The treatment of encapsulated trabeculectomy blebs in an out-patient setting using a needling technique and subconjunctival 5-fluorouracil injection. Eye (Lond). 1998;12(Pt 1):119-23. 19. Shetty RK, Wartluft L, Moster MR. Slit-lamp needle revision of failed filtering blebs using high-dose mitomycin C. J Glaucoma. 2005;14(1):52-6. 20. Iwach AG, Delgado MF, Novack GD, Nguyen N, Wong PC. Transconjunctival mitomycin-C in needle revisions of failing filtering blebs. Ophthalmology. 2003;110(4):734-42. 21. Perucho-Martinez S, Gutierrez-Diaz E, Montero-Rodriguez M, MenciaGutierrez E, Lago-Llinas MD. [Needle revision of late failing filtering blebs after glaucoma surgery]. Arch Soc Esp Oftalmol. 2006;81(9):517-22. 22. Kapetansky FM, Kapetansky SD. Antimetabolite use in revising failing filtering blebs. Semin Ophthalmol. 1999;14(3):144-51. 23. Scott DR, Quigley HA. Medical management of a high bleb phase after trabeculectomies. Ophthalmology. 1988;95(9):1169-73. 24. Sherwood MB, Spaeth GL, Simmons ST, Nichols DA, Walsh AM, Steinmann WC, et al. Cysts of Tenon’s capsule following filtration surgery. Medical management. Arch Ophthalmol. 1987;105(11):1517-21. 25. Shingleton BJ, Richter CU, Bellows AR, Hutchinson BT. Management of encapsulated filtration blebs. Ophthalmology. 1990;97(1):63-8. 26. Anand N, Khan A. Long-term outcomes of needle revision of trabeculectomy blebs with mitomycin C and 5-fluorouracil: a comparative safety and efficacy report. J Glaucoma. 2009;18(7):513-20. 27. Greenfield DS, Miller MP, Suner IJ, Palmberg PF. Needle elevation of the scleral flap for failing filtration blebs after trabeculectomy with mitomycin C. Am J Ophthalmol. 1996;122(2):195-204. 28. Mathur R, Gazzard G, Oen F. Malignant glaucoma following needling of a trabeculectomy bleb. Eye (Lond). 2002;16(5):667-8. 29. Maestrini HA, Fernandes TA, Matoso HD, Amaral WO, Maestrini AA. [Scleral injure caused by needling revision with adjunctive mytomicin-C: case report]. Arq Bras Oftalmol. 2011;74(2):134-5.

Figure 3 - Boxplot showing a comparison of IOP profiles before and after randomization at the 12-month follow-up.

reported (18,27). However, some reports have suggested more severe complications when performing needling in flat and scarred blebs (28,29). In our study, we observed complications in three eyes (15%); only one eye required further surgical treatment. In this study, we achieved similar success rates in eyes randomized to MT in comparison to TNR with 5-FU (75% versus 70%, respectively). However, a significantly lower mean IOP after TNR was observed. By including only encapsulated blebs in this study, the accuracy of measuring successful treatment was increased through the elimination of variations in morphological characteristics. We suggest that TNR with adjunctive 5-FU without further medical therapy is very effective at maintaining a successful IOP for 12 months. The limitations of this prospective study include the small sample size and the short follow-up period. In conclusion, over a 12-month follow-up, this study showed that TNR with adjunctive 5-FU is as effective as MT. However, TNR has the advantage of being compliance-free and of recovering previously failed trabeculectomies in eyes with encapsulated blebs.

& AUTHOR CONTRIBUTIONS All authors have contributed to the data collection and analysis and to the writing of this paper.

& REFERENCES 1. Broadway DC, Bloom PA, Bunce C, Thiagarajan M, Khaw PT. Needle revision of failing and failed trabeculectomy blebs with adjunctive 5fluorouracil: survival analysis. Ophthalmology. 2004;111(4):665-73.

1379


READERS OPINION

Electrocardiographic data should be coupled with tissue-Doppler imaging and clinical follow-up evaluation to determine cardiac involvement in lichen planus ¨ zcan, Dursun Aras, Sinan Aydog˘du Ug˘ur Canpolat, Osman Turak, Fırat O Tu¨rkiye Yu¨ksek Ihtisas Training and Research Hospital, Cardiology Clinic, 06100, Ankara/Turkey. Email: dru_canpolat@yahoo.com Tel.: +90 542 843 07 71

which are known as significant risk factors for chronic inflammation and AF development (10,11). Moreover, despite the volume of studies on this topic, pwave index reference values and measurement techniques have not been standardized. Therefore, echocardiographic and clinical follow-up data could assist with determining the impact of both cardiac and non-cardiac diseases on pwave indices. Other studies have suggested that intra- and/ or inter-atrial electromechanical delays measured by tissueDoppler imaging could be useful markers for the prediction of paroxysmal AF along with PWd (12-14). In addition to the non-invasive measurements, clinical follow-up data are essential to predict several parameters of AF development accurately. In conclusion, S¸ahin et al. highlighted LP as a chronic inflammatory condition and described the impact of this condition on atrial conduction using p-wave indices. However, tissue-Doppler imaging with echocardiography and the collection of clinical follow-up data related to AF development should be considered in future studies in addition to electrocardiographic evaluation.

To the Editor, In the recent issue of your journal, we were pleased to read an interesting article by S¸ahin et al. (1) evaluating p-wave dispersion (PWd) in 58 patients with lichen planus (LP) compared to 37 age- and gender-matched healthy controls. The authors showed that PWd was higher in LP patients compared to healthy controls (39.9¡12.9 msec vs. 32.4¡ 11.8 msec, p = 0.005). Additionally, high-sensitivity C-reactive protein (hsCRP), low-density lipoprotein (LDL)-cholesterol and triglyceride levels were significantly higher in the LP group compared to the healthy controls. Furthermore, hsCRP levels were positively correlated with PWd. Atrial fibrillation (AF) is the most common clinical arrhythmia and presents as heterogeneous and discontinuous intra- and/or inter-atrial conduction due to several insults (e.g., inflammatory status) that promote atrial structural remodeling and provide a substrate for AF (2). In previous studies, Dilaveris et al. (3) described a new ECG index (PWd) and demonstrated that a p maximum .110 msec and a PWd .40 msec were simple and noninvasive parameters for the prediction of paroxysmal lone AF; Aytemir et al. (4) reported similar findings at a p maximum .106 msec and a PWd .36 msec. Thereafter, pwave indices have been applied in a wide range of clinical contexts (5-9). The study by S¸ahin et al. (1) was the first in the literature to evaluate this marker in LP patients. However, mean p-wave indices in the study by S¸ahin et al. (1) were lower than described by Dilaveris et al. (3) and Aytemir et al. (4) in the prediction of paroxysmal lone AF. This result may be due to several differences among those studies, including different patient populations and risk factors and relatively short disease durations for the LP patients. Additionally, the study results should be interpreted in the context of the effects of LP on serum lipid levels (i.e., higher LDL-cholesterol and triglyceride levels),

& REFERENCES 1. Sahin M, Bilgili SG, Simsek H, Akdag S, Akyol A, Gumrukcuoglu HA, et al. Increased P-wave dispersion in patients with newly diagnosed lichen planus. Clinics. 2013;68(6):846-50, http://dx.doi.org/10.6061/ clinics/2013(06)20. 2. Dilaveris PE, Gialafos JE. P-wave dispersion: a novel predictor of paroxysmal atrial fibrillation. Ann Noninvasive Electrocardiol. 2001;6(2):159-65, http://dx.doi.org/10.1111/j.1542-474X.2001.tb00101.x. 3. Dilaveris PE, Gialafos EJ, Sideris SK, Theopistou AM, Andrikopoulos GK, Kyriakidis M, et al. Simple electrocardiographic markers for the prediction of paroxysmal idiopathic atrial fibrillation. Am Heart J. 1998;135(5 Pt 1):733-8, http://dx.doi.org/10.1016/S0002-8703(98)700304. 4. Aytemir K, Ozer N, Atalar E, Sade E, Akso¨yek S, Ovu¨nc¸ K, et al. P wave dispersion on 12-lead electrocardiography in patients with paroxysmal atrial fibrillation. Pacing Clin Electrophysiol. 2000;23(7):1109-12, http:// dx.doi.org/10.1111/j.1540-8159.2000.tb00910.x. 5. Ozer N, Aytemir K, Atalar E Sade E, Akso¨yek S, Ovu¨nc¸ K, et al. P wave dispersion in hypertensive patients with paroxysmal atrial fibrillation. Pacing Clin Electrophysiol. 2000;23(11 Pt 2):1859-62. 6. Aytemir K, Amasyali B, Abali G, Kose S, Kilic A, Onalan O, et al. The signal-averaged P-wave duration is longer in hypertensive patients with history of paroxysmal atrial fibrillation as compared to those without. Int J Cardiol. 2005;103(1):37-40. 7. Duru M, Seyfeli E, Kuvandik G, Kaya H, Yalcin F. Effect of weight loss on P wave dispersion in obese subjects. Obesity (Silver Spring). 2006;14(80):1378-82, http://dx.doi.org/10.1038/oby.2006.156. 8. T Tu¨kek T, Yildiz P, Akkaya V, Karan MA, Atilgan D, Yilmaz V, et al. Factors associated with the development of atrial fibrillation in COPD

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)15

1380


CLINICS 2013;68(10):1380-1381

Lichen Planus and PWd Canpolat U et al. 12. Deniz A, Yavuz B, Aytemir K, Hayran M, Kose S, Okutucu S, et al. Intraleft atrial mechanical delay detected by tissue Doppler echocardiography can be a useful marker for paroxysmal atrial fibrillation. Echocardiography. 2009;26(7):779-84, http://dx.doi.org/10.1111/j.1540-8175. 2008.00881.x. 13. Deniz A, Sahin DY, Kanadasi M, Demir M, Berk IG, Akkus O, et al. Conduction characteristics in atrial fibrillation: Predictive value of tissue Doppler echocardiography. Herz. 2013 Apr 17. [Epub ahead of print]. 14. Weijs B, de Vos CB, Limantoro I, Cheriex EC, Tieleman RG, Crijns HJ. The presence of an atrial electromechanical delay in idiopathic atrial fibrillation as determined by tissue Doppler imaging. Int J Cardiol. 2012;156(1):121-2.

patients: the role of P-wave dispersion. Ann Noninvasive Electrocardiol. 2002;7(3):222-7, http://dx.doi.org/10.1111/j.1542-474X.2002.tb00167.x. 9. Simsek H, Gunes Y, Demir C, Sahin M, Gumrukcuoglu HA, Tuncer M. The effects of iron deficiency anemia on p wave duration and dispersion. Clinics. 2010;65(11):1067-71, http://dx.doi.org/10.1590/S1807-59322010001100001. 10. Lee KT, Hsieh CC, Tsai WC, Tang PW, Liu IH, Chai CY, et al. Characteristics of atrial substrates for atrial tachyarrhythmias induced in aged and hypercholesterolemic rabbits. Pacing Clin Electrophysiol. 2012;35(5):544-52, http://dx.doi.org/10.1111/j.1540-8159.2012.03355.x. 11. Tadic M, Ivanovic B, Cuspidi C. What Do We Currently Know About Metabolic Syndrome and Atrial Fibrillation? Clin Cardiol. 2013 Jun 20. http://dx.doi.org/10.1002/clc.22163. [Epub ahead of print].

1381


RETRACTION

& RETRACTION The article specified below is retracted. It is an inadequate review of recently published articles that appeared in Brazilian scientific publications, contains no original results, and was written for the information of readers of Clinics. The authors have been notified and agree with the retraction. Silva MR, Gomes A. An overview of recently published medical papers in Brazilian scientific journals. Clinics. 2011;66(11):1975–82.

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)16

1382


RETRACTION

& RETRACTION The article specified below is retracted. It is an inadequate review of recently published articles that appeared in Brazilian scientific publications, contains no original results, and was written for the information of readers of Clinics. The authors have been notified and agree with the retraction. Patel K, Caramelli B, Gomes A. A survey of recently published cardiovascular, hematological and pneumological original articles in the Brazilian scientific press. Clinics. 2011;66(12):2159–68.

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(10)17

1383


No Rebouças, pequenos eventos

tornam-se grandes.

Seja pequeno, médio ou grande, o Rebouças tem o espaço ideal para todo o tipo de evento. A melhor logística e infraestrutura de apoio maximizam os recursos operacionais e potencializam os encontros científicos, promocionais, institucionais ou culturais. O Centro de Convenções Rebouças é isso: um dos mais bem planejados e tradicionais espaços receptivos do País, dimensionado para sediar congressos, convenções, exposições, seminários, simpósios, cursos, lançamento de produtos, entre outros, bem no coração da cidade de São Paulo.

Atualmente possui 8 ambientes climatizados e modernizados que atendem até 1.200 participantes, além de uma equipe preparada e empenhada em acompanhar cerca de 280 eventos por ano. EM BREVE, estará ampliando suas instalações, que permitirá o dobro da capacidade de público.

Av. Rebouças, 600 - 05402-000 - São Paulo - Brasil - Tel.: 55 11 3898-7850 / Fax: 55 11 3898-7878 - reboucas@hcnet.usp.br

www.convencoesreboucas.com.br

CLINICS October 2013