Issuu on Google+

Volume 68 Number 4 - April/2013


CLINICS Editor Mauricio Rocha-e-Silva Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Area Editors Ana Maria de Ulhoa Escobar Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Anna Sara Shafferman Levin Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Antonio Egidio Nardi Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil Anuar Ibrahim Mitre Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ashok Agarwal The Cleveland Clinic Foundation Cleveland, Ohio, USA

Gustavo Franco Carvalhal Faculdade de Medicina da Pontifı´cia Universidade Cato´lica do Rio Grande do Sul Porto Alegre, Rio Grande do Sul, Brazil Heitor Franco de Andrade Jr. Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ivete Bedin Prado Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Joaquim Prado Moraes-Filho Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ludhmila Abrahao Hajjar Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Berenice Bilharinho Mendonc¸a Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Bruno Zilberstein Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Carlos Serrano Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Carmen Silvia Valente Barbas Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Claudia Regina Furquim de Andrade Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Edmund Chada Baracat Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Eliete Bouskela Universidade do Estado do Rio de Janeiro Rio de Janeiro, RJ, Brazil Emilia Inoue Sato Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Fulvio Alexandre Scorza Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Geraldo Busatto Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Luı´z Eugeˆnio Garcez-Leme Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Lydia Masako Ferreira Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Maria Cecı´lia Solimene Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Mauricio Etchebehere Universidade Estadual de Campinas Campinas, SP, Brazil Naomi Kondo Nakagawa Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Nelson Wolosker Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Newton Kara-Junior Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Olavo Pires de Camargo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Oswaldo Keith Okamoto Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Patricia Rieken Macedo Rocco Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil

Paulo Hoff Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Raul Coimbra University of California, San Diego La Jolla, CA, USA Renato Delascio Lopes Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Rubens Belfort Jr. Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ruth Guinsburg Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ruy Jorge Cruz Junior University of Pittsburgh Pittsburgh, PA, USA Sandro Esteves ANDROFERT - Andrology & Human Reproduction Clinic Campinas, SP, Brazil Sergio Paulo Bydlowski Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Silvia Vanessa Lourenc¸o Faculdade de Odontologia da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Simone Appenzeller Universidade Estadual de Campinas Campinas, SP, Brazil Sophie Franc¸oise Mauricette Derchain Faculdade de Cieˆncias Me´dicas, Universidade Estadual de Campinas Campinas, SP, Brazil Suely Kazue Nagahashi Marie Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Thelma Suely Okay Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Vale´ria Aoki Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Editorial Board Abhijit Chandra King George’s Medical College Lucknow, India

Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ernest Eugene Moore University of Colorado Denver Denver, CO, USA

Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Adamastor Humberto Pereira Universidade Federal do Rio Grande do Sul Porto Alegre, RS, Brazil

Artur Brum-Fernandes Universite´ de Sherbrooke Que´bec, Canada´

Euclides Ayres Castilho Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ke-Seng Zhao Southern Medical University Guangzhou, China

Adauto Castelo Universidade Federal de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Carmita Helena Najjar Abdo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Ademar Lopes Fundac¸a˜o Antoˆnio Prudente, Hospital do Caˆncer Sa˜o Paulo, SP, Brazil

Cesar Gomes Victora Faculdade de Medicina da Universidade Federal de Pelotas Pelotas, RS, Brasil

Alberto Azoubel Antunes Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Daniel Romero Mun˜oz Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Alexandre Roberto Precioso Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Edmund Neugebauer Witten/Herdecke University Witten, North Rhine - Westphalia, Germany

Andrea Schmitt University of Goettingen Goettingen, Germany Arnaldo Valdir Zumiotti

Egberto Gaspar de Moura Jr. Universidade do Estado do Rio de Janeiro Rio de Janeiro, RJ, Brazil

Fa´bio Biscegli Jatene Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Laura Cunha Rodrigues London School of Hygiene and Tropical Medicine - University of London London, UK

Francisco Laurindo Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Marcelo Zugaib Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Hiroyuki Hirasawa Chiba University School of Medicine Chiba, Japan

Marco Martins Amatuzzi Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Irismar Reis de Oliveira Faculdade de Medicina da Universidade Federal da Bahia Salvador, BA, Brasil Irshad Chaudry University of Alabama Birmingham, AL, USA Ivan Cecconello

Maria Aparecida Shikanai Yasuda Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Mauro Perretti William Harvey Research Institute London, UK


Michael Gregory Sarr Mayo Clinic Rochester, MN, USA

Pedro Puech-Lea˜o Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Milton de Arruda Martins Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Peter Libby Brigham and Women’s Hospital Boston, Boston, MA, USA

Mitchell C. Posner The University of Chicago Medical Center Chicago, IL, USA

Philip Cohen University of Houston Health Center Houston, Texas, USA

Moyses Szklo Johns Hopkins Bloomberg School of Public Health Baltimore, USA

Rafael Andrade-Alegre Santo Toma´s Hospital Republic of Panama´, Panama´

Navantino Alves Faculdade de Cieˆncias Me´dicas de Minas Gerais Belo Horizonte, MG, Brazil

Ricardo Antonio Refinetti Faculdade de Medicina da Universidade Federal do Rio de Janeiro Rio de Janeiro, RJ, Brazil

Noedir Antonio Groppo Stolf Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Roberto Chiesa San Raffaele Hospital

Milan, Italy Ronald A. Asherson Netcare Rosebank Hospital Rosebank, Johannesburg, South A´frica Samir Rasslan Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Tarcisio Eloy Pessoa de Barros Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Valentim Gentil Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Wagner Farid Gattaz Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Board of Governors Alberto Jose´ da Silva Duarte Aluisio Augusto Cotrim Segurado Ana Claudia Latronico Xavier Berenice Bilharinho de Mendonc¸a Carlos Roberto Ribeiro de Carvalho Clarice Tanaka Claudia Regina Furquim de Andrade Cyro Festa Dalton de Alencar Fischer Chamone Daniel Romero Mun˜oz Edmund Chada Baracat Eduardo Massad Eloisa Silva Dutra de Oliveira Bonfa´ Euripedes Constantino Miguel Fa´bio Biscegli Jatene Flair Jose´ Carrilho Gerson Chadi Gilberto Luis Camanho Irene de Lourdes Noronha Irineu Tadeu Velasco Ivan Cecconello

Jorge Elias Kalil Jose´ Antonio Franchini Ramires Jose´ Antonio Sanches Jose´ Eduardo Krieger Jose´ Ota´vio Costa Auler Jose´ Ricardo de Carvalho Mesquita Ayres Lenine Garcia Branda˜o Luiz Augusto Carneiro D’Albuquerque Luiz Fernando Onuchic Magda Maria Sales Carneiro-Sampaio Manoel Jacobsen Teixeira Marcelo Zugaib Marcos Boulos Marcus Castro Ferreira Maria Aparecida Shikanai Yasuda Miguel Srougi Milton de Arruda Martins Nelson de Luccia Olavo Pires de Camargo Paulo Andrade Lotufo Paulo Hila´rio Nascimento Saldiva

Editorial Director Kavita Kirankumar Patel-Rolim Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Paulo Marcelo Gehm Hoff Pedro Puech-Lea˜o Remo Susanna Ricardo Ferreira Bento Ricardo Nitrini Roberto Kalil Roberto Zatz Roger Chammas Samir Rasslan Sandra Josefina Ferraz Ellero Grisi Selma Lancman Tarcı´sio Eloy Pessoa de Barros Uenis Tannuri Umbertina Conti Reed Valentim Gentil Venaˆncio Avancini Ferreira Alves Vicente Odone Wagner Farid Gattaz Werther Brunow de Carvalho William Carlos Nahas Wilson Jacob

Editorial Assistants Nair Gomes Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Daniela Aquemi Higa Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil Ariane Maris Gomes Faculdade de Medicina da Universidade de Sa˜o Paulo Sa˜o Paulo, SP, Brazil

Editorial Office: Rua Dr. Ovı´dio Pires de Campos, 225 - 6 ˚ Andar CEP 05403-010 Sa˜o Paulo/SP Tel.: +55-11-2661-6235 Email: clinics@hc.fm.usp.br Website: www.scielo.br/clinics Submission: http://mc04.manuscriptcentral.com/clinics-scielo Indexations: LILACS; MEDLINE; PubMed; PubMed Central; SciELO; Science Citation Index Expanded (ISI Web of Knowledge); Scopus; Ulrich’s Periodical Directory; Qualis/Capes - Classified as an International Circulation Journal in Medicine. Clinics. Sa˜o Paulo: Scientific Journal of Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, 2005Monthly Periodical: January to December ISSN 1807-5932 printed version ISSN 1980-5322 online version Formerly Revista do Hospital das Clı´nicas da FMUSP, 1946–2004. 1. Medicine-scientific production. 2. Medical Sciences I. Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo. CDD 610


PUBLICATION INFORMATION AND EDITORIAL POLICIES CLINICS publishes peer-reviewed articles of interest to clinicians and researchers in the medical sciences. CLINICS is registered with PubMed Central and SciELO and complies with the policies of funding agencies, such as the Wellcome Trust, the Research Councils UK - (RCUK), the National Institutes of Health (NIH), and the German Research Foundation (DFG), which request or require deposition of the published articles that they fund into publicly available databases. CLINICS supports the position of the International Committee of Medical Journal Editors (http:// www.icmje.org/) on trial registration. All trials initiated after January 1, 2012 must be prospectively registered (before patient recruitment begins) in a publicly accessible registry. Trials initiated before January 1, 2012 must be registered before submission to our journals. See the ICMJE FAQ regarding trial registration for further details. Visit http://www.who.int/ictrp/ network/list_registers/en/index.html for the WHO’s list of approved registries. CLINICS suggests: http://www.clinicaltrials. gov as a user friendly site.

clinical, and surgical research. Original studies must conform to the following format: Title page:

N N N N

Manuscript:

N

Publication Fees CLINICS uses a business model in which expenses are recovered in part by charging a publication fee to the authors or research sponsors for each published article. Our 2013 prices are as follows: fast track: US$ 2,000.00; original articles, review articles and rapid communications: US$ 1,200.00. Invited reviews, editorials and letters to the editors: no charge. * The exchange rate for payments in Brazil-Real is the commercial exchange rate of the day the articles is accepted. Clinics uses the Banco do Brasil currency conversion tool. Manuscripts involving human subjects or the use of laboratory animals must clearly state adherence to appropriate guidelines and approval of protocols by their institutional review boards. Photographs that may identify patients or other human participants of studies shall be acceptable only when a legally valid consent form is signed by the participating patient, other human participant, or his/her legally constituted representative. Manuscripts should be digitalized using a Word *.doc-compatible software program and submitted online in English. Authors are strongly advised to submit the manuscript in its final form to a spell check for English (US). Submissions with excessive spelling or syntax mistakes as well as articles in which the meaning is not sufficiently clear shall be returned to authors for correction. Authors are also strongly advised to use abbreviations sparingly whenever possible to avoid jargon and improve the readability of the manuscript. All abbreviations must be defined the first time that they are used. Only terms or expressions that are used at least 5 times throughout the text should be abbreviated. Never use abbreviations that spell common English words, such as FUN, PIN, SCORE and SUN. Please make sure to submit your manuscript in the exact format that is described below. Failure to do so will cause the submission to be returned to you during the preliminary examination by the Editorial Office.

Manuscripts are invited in the following categories: ORIGINAL STUDY: Complete original studies should be submitted in this category. Three sections are offered: basic,

Title (up to 250 characters); Running title (up to 40 characters, letters and spaces); Full address of corresponding author only; Authors’ names (without titles or degrees). Authors should have participated sufficiently in the work to take public responsibility for appropriate portions of the content. Such participation must be declared in this section of the manuscript.

N N

N

N

N

N

N

Abstract: Abstracts are limited to 250 words and structured into objectives, method, results, and conclusions. Citations or abbreviations (except internationally recognized abbreviations, such as weights, measures, and physical or chemical abbreviations) are not permitted. Authors are strongly encouraged not to display numerical statistical information but to merely state what is significantly different (or not) between the described parameters. Keywords: For keywords, 3–6 items from the Medical Subject Headings (MeSh) should be used. Introduction: The introduction should set the purpose of the study, provide a brief summary (not a review) of previous relevant studies, and state the new advances in the current investigation. The introduction should not include data or conclusions from the work being reported. A final sentence summarizing the novel finding to be presented is permissible. Materials and Methods: This section should briefly give clear and sufficient information to permit the study to be repeated by others. Standard techniques only need to be referenced. Previously published methods may be briefly described following the reference. Ethics: When reporting experiments on human subjects, indicate whether the procedures were in accordance with the ethical standards of the responsible committee on human experimentation (institutional or regional) and with the Helsinki Declaration of 1975, which was revised in 1983. When reporting experiments on animals, indicate whether the institution’s guide, a national research council’s guide, or any national law on the care and use of laboratory animals was followed. Results: The results section should be a concise account of the new information that was discovered, with the least personal judgment. Do not repeat in text all the data in the tables and illustrations but briefly describe what these data comprise. Discussion: The discussion should include the significance of the new information and relevance of the new findings in light of existing knowledge. Only unavoidable citations should be included. Citation to review articles are not encouraged in this section. Acknowledgments: This section should be short, concise, and restricted to acknowledgments that are necessary.


N

N

N

References in text: CLINICS adopts the Vancouver format. Cite references in the text using Arabic numerals in the order of appearance, within parentheses, (1) after the previous word, with spacing as in this example: ‘‘Diabetes (2), hypertension (3,4) and alcoholism (5–9) are complex medical problems (10).’’ Under exceptional circumstances, authors’ names may appear in text: Single author: ‘‘Einstein (11) proposed a new theory …’’, Two authors: ‘‘Watson & Crick (12) reported on the structure of …’’, or Three or more authors: ‘‘Smith et al. (13) described …’’ Reference List: Only citations that appear in the text should be referenced. References must be restricted to directly relevant published works, papers, or abstracts. Unpublished papers, unless accepted for publication, should not be cited. Work that is accepted for publication should be referred to as ‘‘in press’’ and a letter of acceptance of the journal must be provided. Authors are responsible for the accuracy and completeness of their references and for correct text citation. Usually the total number of references should not exceed 35. For up to six authors, list all authors. For more than 6 authors, list first six authors followed by ‘‘et al.’’. Tables and Figures: The maximum number of tables and/or figures is six tables and/or figures. Tables: Should be constructed using the table feature in your word processor or using a spreadsheet program such as Excel. The tables should be numbered in order of appearance in the text, using Arabic numerals. Each table should have a title and an explanatory legend, if necessary. All tables must be referenced and succinctly described in the text. Under no circumstances should a table repeat data that are data presented in an illustration. Statistical measures of variation (i.e., standard deviation or standard error) should be identified, and decimal places in tabular data should be restricted to those with mathematical and statistical significance. Figures: Photographs, illustrations, charts, drawings, line graphs, etc are all defined as figures. Number figures consecutively using Arabic numerals in order of appearance. Figure legend(s) should be descriptive and should allow examination of the figure without reference to text. Images must be of professional quality and uploaded as *.tiff files. Generally, figures will be reduced to fit one column of text. The actual magnification of all photomicrographs should be provided, preferably by placing a scale bar on the print. Line graphs and charts should never be sent as *.jpeg illustrations. We recommend preparing line graphs and charts as ExcelH files and copying these files into a Word *.doc sheet.

FAST TRACK ARTICLES: Fast-track articles should follow the same format described above for original studies. The Editorial Office will produce a first-action response in the shortest possible time and will publish accepted fast track articles in the next available issue. Only one article may be submitted as fast track in any calendar year by any author or co-author. In the Comments section, the authors must explain the justification for fast-track publication. Rejection by journals with a higher impact factor than ours is an acceptable reason for requesting fast-track status. However, the reviewers’ reports from the previous submission

must be included in the current submission. Information contained in the comments is limited to the editor and shall remain confidential. No publication fee discount is allowed for accepted fast track articles. REVIEW ARTICLES: Review articles should cover themes that are relevant to medical practice. Spontaneously submitted reviews are welcome; however, potential authors should bear in mind that they are expected to have expertise in the reviewed field. The sections should be arranged as follows:

N N

Title page: As described in the Original Study section. Manuscript: Abstract, keywords and text should be arranged to cover the subject that is being reviewed. If appropriate, the method of reference collection should be described. The use of headings, subheadings, and paragraph titles is encouraged to improve clarity. Abbreviations, acknowledgments, tables and figures should be formatted as described in the Original Study section. The number of references is at the discretion of the authors. No publication fee discount is allowed for spontaneously submitted review articles that are accepted for publication.

RAPID COMMUNICATIONS:

N N

Title page: As described in the Original Study section. Manuscript: Rapid communications are limited to 1,500 words, not including the reference list, abstract and keywords. Authors should format rapid communications based on the subject at hand. Abstracts are limited to 250 words and structured into objectives, method, results, and conclusions. Citations or abbreviations (except internationally recognized abbreviations, such as weights, measures, and physical or chemical abbreviations) are not permitted. For keywords, 3-6 items from the Medical Subject Headings (MeSh) should be used.

LETTERS TO THE EDITOR: Letters to the editor expressing comments or dissenting opinions concerning articles that have been recently published in CLINICS are not submitted to peer review and are published at the discretion of the editor. A letter is a single section containing untitled text concerning the article under discussion, followed by references. No publication fee is charged for this class of manuscripts. EDITORIAL: Editorials should cover broad aspects of medical or biological sciences. Such manuscripts are not submitted to peer review and are published at the discretion of the editor. No publication fee is charged for this class of manuscripts. COMMENTARY: A commentary is an invited text with respect to an article that is being published by Clinics. No publication fee is charged for this class of manuscripts. INVITED REVIEW: These reviews are by invitation only and follow the format proposed for general reviews. No publication fee is charged for this class of manuscripts. SPECIAL ISSUE ARTICLE: Special issue articles are by invitation only and follow a specific format that is set by the editor in charge of the collection.


Currently CLINICS does not accept: case reports, technical notes, retrospective studies, translations and validations of questionnaires, and articles referring to first demonstration in Brazil. Peer Review: Manuscripts are reviewed by at least two expert consultants. Accepted manuscripts are edited to comply with the journal’s format, remove redundancies, and improve clarity and understanding without altering meaning. The edited text will be presented to authors for approval. Submission: A copyright transfer form, signed by all authors, must be submitted by fax (55-11-2661-7524) or by mail as soon as the manuscript is submitted. Any financial or other relationships that may lead to a conflict of interest must be

disclosed in the copyright transfer form. If the editor considers this conflict of interest relevant to the paper, a footnote will be added to show the equity interest in or affiliation with the identified commercial firm(s). When the authors are satisfied that the manuscript complies with the journal format, our site should be accessed using the website www.clinics.org.br. The system will guide authors through the manuscript submission process and will prompt authors to input information into specific fields as they are submitting their manuscript. The editorial office and authors will be automatically notified of the submission. Progress of the manuscript through the Editorial Office’s procedures will be available to authors at all times.


ISSN-1807-5932

CLINICS CONTENTS Clinics 2013 68(4):437–577

EDITORIAL

Is hepatic venous pressure gradient assessment required before liver resection in patients with cirrhosis and hepatocellular carcinoma? Mauricio F. Silva, Simone I. Strasser, Flair J. Carrilho . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 437

CLINICAL SCIENCES

The lung in paracoccidioidomycosis: new insights into old problems Andre Nathan Costa, Gil Benard, Andre Luis Pereira Albuquerque, Carmem Lucia Fujita, Adriana Satie Kono Magri, Joa˜o Marcos Salge, Maria Aparecida Shikanai-Yasuda, Carlos Roberto Ribeiro Carvalho . . . . . . . . . . . . . . . . . . . . 441

Cognition and biomarkers of oxidative stress in obstructive sleep apnea Leticia Viana Sales, Veralice Meireles Sales de Bruin, Vania D’Almeida, Sabine Pompe´ia, Orlando Francisco Amodeo Bueno, Se´rgio Tufik, Lia Bittencourt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 449

Crohn’s disease activity assessed by doppler sonography: the role of aortic flow parameters Thais Guarana´ Andrade, Homero Soares Fogac¸a, Celeste Carvalho Siqueira Elia, Melissa Tassano Pitrowsky, Heitor Siffert Pereira de Souza . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 457

Vibroacoustography for the assessment of total hip arthroplasty Hermes A. S. Kamimura, Liao Wang, Antonio A. O. Carneiro, Randall R. Kinnick, Kai-Nan An, Mostafa Fatemi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 463

Saint John’s wort, an herbal inducer of the cytochrome P4503A4 isoform, may alleviate symptoms of Willis-Ekbom’s disease Jose´ Carlos Pereira Jr., Ma´rcia Pradella-Hallinan, Rosana Cardoso Alves . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 469

Expression of leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) on osteoclasts and its potential role in rheumatoid arthritis Yuan Zhang, Yong Ding, Yi Huang, Chunmei Zhang, Boquan Jin, Ran Zhuang . . . . . . . . . . . . . . . . . . . . . . . . . . 475

Protective response in renal transplantation: no clinical or molecular differences between open and laparoscopic donor nephrectomy Christiano Machado, Denise Maria Avancini Costa Malheiros, Ari Adamy, Luiz Sergio Santos, Agenor Ferreira da Silva Filho, William Carlos Nahas, Francine Brambate Carvalhinho Lemos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 483

Sexual behavior among high school students in Brazil: alcohol consumption and legal and illegal drug use associated with unprotected sex Zila M. Sanchez, Solange A. Nappo, Joselaine I. Cruz, Elisaldo A. Carlini, Claudia M. Carlini, Silvia S. Martins . . . 489


Remote ischemic preconditioning in patients with intermittent claudication Glauco Fernandes Saes, Antonio Eduardo Zerati, Nelson Wolosker, Luciana Ragazzo, Ruben Miguel Ayzin Rosoky, Raphael Mendes Ritti-Dias, Gabriel Grizzo Cucato, Marcelo Chehuen, Breno Quintella Farah, Pedro Puech-Lea˜o . . . . . . . . . . .495

Effect of intraoperative HES 6% 130/0.4 on the need for blood transfusion after major oncologic surgery: a propensity-matched analysis Fernando Godinho Zampieri, Otavio T. Ranzani, Priscila Fernanda Morato, Pedro Paulo Campos, Pedro Caruso . . . .501

Cortical activity in tinnitus patients and its modification by phonostimulation Katarzyna Pawlak-Osin´ska, Wojciech Kaz´mierczak, Henryk Kaz´mierczak, Małgorzata Wierzchowska, Izabela Matuszewska . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 511

Static and dynamic postural control in low-vision and normal-vision adults Moˆnica S.V. Tomomitsu, Angelica Castilho Alonso, Eurica Morimoto, Tatiana G. Bobbio, Julia M.D. Greve. . . . . . 517

Comparing percutaneous coronary intervention and thrombolysis in patients with return of spontaneous circulation after cardiac arrest Ying-Qing Li, Shu-Jie Sun, Na Liu, Chun-Lin Hu, Hong-Yan Wei, Hui Li, Xiao-Xing Liao, Xin Li. . . . . . . . . . . . . 523

Decreased plasma ADAMTS-13 activity as a predictor of postoperative bleeding in cyanotic congenital heart disease Rosangela P.S. Soares, Se´rgio P. Bydlowski, Marcelo B. Jatene, Janete Ferreira Hironaka, Antonio Augusto Lopes. . . .531

Predictors of walking capacity in peripheral arterial disease patients Breno Quintella Farah, Joa˜o Paulo dos Anjos Souza Barbosa, Gabriel Grizzo Cucato, Marcel da Rocha Chehuen, Luis Alberto Gobbo, Nelson Wolosker, Cla´udia Lu´cia de Moraes Forjaz, Raphael Mendes Ritti-Dias . . . . . . . . . . . . . . . 537

The diagnostic significance of NT-proBNP and troponin I in emergency department patients presenting with palpitations ¨ mit Yas¸ar Tekeliog˘lu, Serkan O ¨ ztu¨rk, Suzi Selim Ayhan, Mehmet Fatih O ¨ zlu¨, Tarık Ocak, Alim Erdem, Arif Duran, U Mehmet Tosun, Hasan Koc¸og˘lu, Mehmet Yazıcı . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 543

BASIC RESEARCHES

Exercise training prior to myocardial infarction attenuates cardiac deterioration and cardiomyocyte dysfunction in rats Luiz Henrique Marchesi Bozi, Izabel Regina dos Santos Costa Maldonado, Marcelo Perim Baldo, Ma´rcia Ferreira da Silva, Jose´ Bianco Nascimento Moreira, Roˆmulo Dias Novaes, Regiane Maria Soares Ramos, Jose´ Geraldo Mill, Patricia Chakur Brum, Leonardo Bonato Felix, Thales Nicolau Prı´mola Gomes, Antoˆnio Jose´ Natali. . . . . . . . . . . . . . . . . . 549

Effectiveness and safety of iodopovidone in an experimental pleurodesis model Lisete R. Teixeira, Francisco S. Vargas, Juliana Puka, Milena M. P. Acencio, Leila Antonangelo, Ricardo M. Terra, Francisco M. Damico, Fabio G. Pitta, Evaldo Marchi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 557

Methodological quality of systematic reviews and clinical trials on women’s health published in a Brazilian evidence-based health journal Cristiane Rufino Macedo, Rachel Riera, Maria Regina Torloni . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 563

RAPID COMMUNICATION

The minimal inhibitory concentration for sulbactam was not associated with the outcome of infections caused by carbapenem-resistant Acinetobacter sp. treated with ampicillin/sulbactam Maura S. de Oliveira, Silvia Figueiredo Costa, Ewerton de Pedri, Inneke van der Heijden, Anna Sara S. Levin . . . . . 569


READERS OPINIONS

It is important to control for confounders when examining the role of diet in cardiovascular disease prevention Sevket Balta, Sait Dem覺rkol, Mustafa Cakar, Murat Unlu, Ugur Kucuk, Mustafa Dinc . . . . . . . . . . . . . . . . . . . . . . 575

Safety concerns in pregnancy Emre Yalcinkaya, Murat Celik, Baris Bugan, Uygar Cagdas Yuksel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 577


EDITORIAL

Is hepatic venous pressure gradient assessment required before liver resection in patients with cirrhosis and hepatocellular carcinoma? Mauricio F. Silva,I Simone I. Strasser,II Flair J. CarrilhoIII I Santa Casa General Hospital, Department Liver Transplantation, Porto Alegre/RS, Brazil. II Royal Prince Alfred Hospital, AW Morrow Gastroenterology and Liver Centre, Sydney/Australia. III Faculdade Medicina da Universidade de Sa˜o Paulo, Gastroenterology Department, Sa˜o Paulo/SP, Brazil.

The importance of the hepatic venous pressure gradient (HVPG) in selecting patients with hepatocellular carcinoma (HCC) for liver resection (LR) has been somewhat controversial. Recently, Boleslawski et al. prospectively evaluated a cohort of 40 patients undergoing LR for HCC; the authors aimed to identify the impact of HVPG values and clinical signs of portal hypertension (esophageal varices or splenomegaly with a platelet count ,100,000/mm3) on postoperative outcomes (1). The study showed that liver dysfunction and 90-day postoperative mortality rates were associated with high HVPG values (p = 0.017 and 0.026, respectively). In contrast, the presence of clinical features of portal hypertension was not associated with either liver dysfunction or shortterm mortality. The authors concluded that the HVPG should be measured routinely in HCC patients prior to LR. Clinical practice guidelines from the European Association for the Study of the Liver (EASL) and the American Association for the Study of Liver Diseases (AASLD) suggest that clinical parameters can be used as an alternative to HPVG in determining the presence of clinically relevant portal hypertension (2,3). Consequently, HVPG assessment may not be necessary in all LR candidates (4). Although the Boleslawski et al. study examined an important aspect of LR for HCC patients, some concerns should be addressed. There is no clear maximum tumor size that contraindicates LR in HCC patients with a single nodule (2,3). Nevertheless, in a patient with well-preserved liver function and a single tumor up to 5 cm, the presence of portal hypertension is accepted as an adverse prognostic factor that is associated with reduced and long-term patient survival (5,6). In 1996, Bruix et al. first reported the negative impact of significant portal hypertension on liver resection outcomes (5). Twenty-nine cirrhotic Child-Turcotte-Pugh (CPT) class A patients who underwent LR were evaluated to determine the role of increased portal pressure in developing postoperative hepatic decompensation. Eleven of the 29 patients

developed persistent liver decompensation within the first three months after surgery, and HVPG was the only independent factor that predicted hepatic decompensation in a multivariate analysis (p,0.001). Subsequently, the same researchers updated their results, suggesting that either HVPG or clinical signs of portal hypertension could be used to select HCC patients for resection or liver transplantation (6). Note that patients with a single tumor .5 cm do not fulfill the Milan criteria, and liver transplantation is not usually considered a treatment alternative (2,3,7). Therefore, the presence of portal hypertension as an absolute criterion for selecting patients for liver transplantation, rather than resection, is of most relevance to the subgroup of patients who could undergo either resection or transplantation. Given the limited efficacy of other treatment options for this patient subset, such as transarterial chemoembolization, patients with a single tumor .5 cm may still be best served by liver resection, even in the presence of portal hypertension. The study by Boleslawski et al. did not mention tumor number or size in the 40 enrolled patients, and this information may aid in interpreting their data and conclusions. Note that in their series, not all of the patients performed poorly (despite liver resection in the presence of a HVPG .10 mmHg), and portal hypertension clinically-based (PH-CB) was not predictive of patient outcomes. In light of the uncertainties surrounding the role of portal hypertension in selecting HCC patients for liver resection, we recently undertook a multicenter (in Australia, Spain, and Brazil), exploratory analysis of 105 CPT A HCC patients (with a single nodule #5 cm on imaging) who were treated with primary liver resection (unpublished data). After a median follow up of 51 months (range, 1–159 months), the 1-, 3-, and 5year survival rates were 97%, 83%, and 66%, respectively. As in other studies, significant portal hypertension was defined as having an HVPG $10 mmHg or the presence of gastroesophageal varices, splenomegaly (spleen length $12 cm) with a platelet count ,100,000/mm3, or the need for diuretics to control ascites. PH-CB was defined with the same criteria but without the HVPG variable. No pre-operative characteristic predicted the likelihood of survival after assessing all of the variables recommended by the Panel of Experts in HCC-Design Clinical Trials (7). In other words, our results suggest that liver resection for CPT A HCC patients with a single tumor #5 cm offers survival rates similar to liver transplantation, independent of any pre-operative characteristics (8). We have summarized the published studies evaluating liver resection for patients with cirrhosis and HCC (Table 1). It is clear that the data regarding the prognostic factors for HCC

Email: mauriciosilva11@yahoo.com.br Tel.: 55 51 9767-1801 Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)01

437


Retrospective

Prospective

Retrospective

Yamamoto et al., 2001

Poon et al., 2002

Ercolani et al., 2003 Ferrero et al., 2005 Wu et al., 2005

Pathology

Pathology

Radiology

Pathology

438

Retrospective

Retrospective

Retrospective

Retrospective

Retrospective

Margarit et al., 2005

Capussotti et al., 2006

Taura et al., 2007

Ishizawa et al., 2008

Park et al., 2009

Radiology

Pathology

Pathology

Pathology

Radiology

Pathology

Retrospective

Grazi et al., 2001

Pathology

Retrospective

Retrospective

Chiappa et al., 2000

Radiology

Pathology

Retrospective

Llovet et al., 1999

Tumor Assessment

Retrospective

Design

Author, year

CPT A, MC

Depending on ascites, BL, and ICGR15.

MC

Absence of vein invasion or extrahepatic spread CPT A, single nodule up to 5 cm, ,70 yrs, normal BL, without SPH. Not defined

Not defined

CPT A or B without ascites, HE, or esophageal varices. Without ascites or jaundice; .3 cm and .3 nodules. Neither extrahepatic spread nor macrovascular invasion. Not defined

Single nodule up to 5 cm, well-preserved liver function. Not defined

Inclusion Criteria

n = 213

n = 434

CPT A = 129 CPT B = 37

n = 217

n = 73

n = 426

n = 241

92

N/A

N/A N/A

N/A

LR = 92 LT = 78

#70 yrs = 74 .70 yrs = 81 N/A N/A

83

Group 1 = 70 Group 2 = 161

n = 206

n = 224

96

N/A

n = 264

n = 58

89

85

Comments

69

SPH = 56 No SPH = 71

54 28

SPH = 29 No SPH = 39

Patients with SPH had poor long-term survival rates (p = 0.020); however, when considering only CPT A patients, the survival rates were similar between the groups (p = 0.503). This study included a third subgroup of non-cirrhotic patients (n = 127). The presence of cirrhosis was associated with lower overall survival and a greater risk of recurrence. This study was primarily designed to compare patients with SPH (n = 136) to those without PH (n = 250). CPT B patients had a 5-year survival rate of 19%. The results shown in the table correspond to the subset of CPT A patients. Eighteen percent of the enrolled cases had no cirrhosis. Patients were followed for 34 (1–145) months. Six patients underwent salvage living donor LT. The overall survival between patients with a single nodule and 2-3 nodules separately were not shown.

Ninety-eight patients received TACE prior to LR. Patients with a single nodule had higher long-term survival in the multivariate analysis. #70 yrs = 32 This study was primarily designed to compare LR according to age (#70 yrs, n = 177) .70 yrs = 48 and (.70 yrs, n = 64). The survival rates were similar between the groups (p = 0.081). Group 1 = 61 This study was primarily designed to compare LR according to the period (1991Group 2 = 46 1996, n = 161, Group 1) and (1997 – 2002, n = 265, Group 2). The 5-yeear survival rates were higher in Group 2 (p,0.001). LR = 70 This study was primarily designed to compare LR (n = 37) to LT (n = 36). TACE LT = 65 prior to LR and LT was performed in selected cases.

42

This study was primarily designed to compare resection (n = 58) to PEI (n = 39). The survival rates were similar between the groups (p = 0.96), although the cohorts had different baseline characteristics. Group A = 33 This study was primarily designed to compare extended LR (Group 1, n = 45) to lesser Group B = 44 extent liver resection (Group 2, n = 161). Eighty-six percent of the patients had hepatitis B cirrhosis.

61

SPH and BL were the factors associated with survival. The subset of patients with neither SPH nor BL $1 mg/dL had a 5-year survival rate of 74%. This study compared the results of 2 independent arms of HCC patients undergoing LR or LT. 53 at 3 years After a median follow-up of 28 months, tumor recurrence occurred in 45% of cases. Microvascular invasion and symptomatic tumors were associated with poor longterm survival. 41 Patients who underwent resection after 1992 (n = 157) had higher 5-year survival rates than the remainder (49% versus 32%, p,0.05).

51

5-year

Survival (%) 1-year

n = 51

n = 77

Patients

Table 1 - Results of a series evaluating liver resection in patients with hepatocellular carcinoma and cirrhosis.

Resection, portal hypertension and HCC Silva MF et al. CLINICS 2013;68(4):437-440


439

Retrospective

Prospective

Retrospective

Sapisochin et al., 2012

Boleslawski et al., 2012

Silva et al., 2012

Radiology

N/A

Radiology

Pathology

CPT A, single nodule #5 cm

N/A

CPT A or B; single HCC; no extrahepatic spread nor macrovascular invasion. BL ,2 mg/dL, albumin .3 g/dL, prothrombin activity .60% without ascites, portal vein thrombosis or extrahepatic spread. CPT A or B, BL ,3 mg/dL, controllable ascites. CPT A or B, no extrahepatic spread or nodal involvement; any tumor size and number. Single nodule #5 cm; no portal hypertension and normal bilirubin

Single nodule #5 cm; CPT A; resection of ,2 segments. MC; CPT A and B.

Inclusion Criteria

n = 105

85

N/A

82

n = 95

n = 40

78

80

72

59

N/A N/A

LRFA = 88 LR = 93

This study was primarily designed to compare LR with LRFA. Patients were selected for 1 of these alternatives on the basis of tumor location. The survival rates were similar between the 2 forms of LR.

Comments

There was no restriction regarding tumor number and size. After a median follow-up of 24 months, 78 cases developed tumor recurrence.

60 This study was primarily designed to compare LR (n = 95) with LT (n = 122) on an 33 at 10 years intention-to-treat basis. The authors concluded that at 5 years survival was equivalent; nevertheless, LT achieved a better outcome at 10 years. Moreover, when they compared patients resected with early HCC (tumors #2 cm) with LT, the 10-year survival was similar. N/A This study was primarily designed to evaluate the impact of portal hypertension on short-term survival and morbidities post-LR; see text for details. 66 No pre-operative characteristics were associated with patient survival; see text for further information. This study was based on the intention-to-treat principle.

This study was primarily designed to compare LR with LT (n = 78). It was concluded that LT should be the primary option in patients within the MC, whereas LR should be the first treatment in patients beyond the MC. 56 in 3 years Eighty percent of the enrolled patients had cirrhosis caused by hepatitis B; the survival rates at 1 and 3 years were 87%, and 75%, respectively (p = 0.002) in patients with nodules smaller than 5 cm.

52

21

LR = 70% at 4 This study was primarily designed to compare LR with LT. LT had higher survival years rates than LR. However, patients with tumors with a size-plus-number of up to 4 or LT = 87% at 4 absence of microvascular invasion had similar long-term survival between the years groups. 52 This study was primarily designed to ascertain the outcome of LT due to HCC in patients who had undergone previous LR (n = 17). It was shown that patients with recurrence within the first year after LR had a poor prognosis after salvage LT.

LRFA = 41 LR = 54

5-year

Survival (%) 1-year

n = 77

n = 130

n = 175

n = 100

n = 1,018 n = 89

LRFA = 74 LR = 78

Patients

Abbreviations: SPH, significant portal hypertension; BL, serum total bilirubin; HCC, hepatocellular carcinoma; LR, liver resection; LT, liver transplantation; CPT, Child-Pugh-Turcotte; N/A, not available; HE, hepatic encephalopathy; PEI, percutaneous ethanol injection; TACE, transarterial chemoembolization; ICGR15, indocyanine green retention rate at 15 minutes; MC, Milan criteria; LRFA, laparoscopic radiofrequency ablation.

Retrospective

Huang et al., 2011

Radiology

Pathology

Abdel-Wahab Retrospective et al., 2010

Retrospective

Radiology

Retrospective

Sapisochin et al., 2010

Lee et al., 2010

Radiology

Retrospective

Zhou et al., 2010

Tumor Assessment

Radiology

Design

Santambrogio Retrospective et al., 2009

Author, year

Table 1 - Continued.

CLINICS 2013;68(4):437-440 Resection, portal hypertension and HCC Silva MF et al.


Resection, portal hypertension and HCC Silva MF et al.

CLINICS 2013;68(4):437-440

patients undergoing liver resection are scarce. Current recommendations for patient selection for liver resection versus liver transplantation for tumors #5 cm are still based on the original Barcelona group publication, which was based on a retrospective analysis of a case series from the 1990s (5). Note that given the limitations of retrospective studies, the robustness of evidence supporting this finding must be validated following evidenced-based ranking systems (9). Basing recommendations on the results of liver resection performed in the 1990s ignores recent improvements in the perioperative care of cirrhotic patients (10). These recommendations may also limit access to liver resection for patients who have no or limited access to liver transplantation. In conclusion, further well-designed trials are warranted to evaluate the role of significant portal hypertension in predicting liver resection outcomes for HCC patients. Nevertheless, until further well-designed prospective studies are undertaken, the recommendations of the EASL– HCC Clinical Practice Guidelines should remain in place.

2.

3. 4.

5.

6. 7. 8.

& AUTHOR CONTRIBUTIONS 9.

All of the authors declare that they contributed equally to the text.

& REFERENCES

10.

1. Boleslawski E, Petrovai G, Truant S, Dharancy S, Duhamel A, Salleron J, et al. Hepatic venous pressure gradient in the assessment of portal hypertension before liver resection in patients with

440

cirrhosis. Br J Surg 2012;99(6):855-63, http://dx.doi.org/10.1002/ bjs.8753. European Association For The Study Of The Liver; European Organisation For Research And Treatment Of Cancer. EASL–EORTC Clinical Practice Guidelines: Management of hepatocellular carcinoma. J Hepatol. 2012;56(4):908-43. Simpson KJ, Finlayson ND. Clinical evaluation of liver disease. Baillieres Clin Gastroenterol 1995;9(4):639-59, http://dx.doi.org/10.1016/09503528(95)90054-3. Bruix J, Castells A, Bosch J, Feu F, Garcia-Pagan JC, Visa J, et al. Surgical resection of hepatocellular carcinoma in cirrhotic patients: prognostic value of preoperative portal pressure. Gastroentrology. 1996; 111(4):1018-22, http://dx.doi.org/10.1016/S0016-5085(96)70070-7. Llovet JM, Fuster J, Bruix J. Intention-to-Treat analysis of surgical treatment for early hepatocellular carcinoma: resection versus transplantation. Hepatology. 1999;30(6):1434-40, http://dx.doi.org/10.1002/ hep.510300629. Bruix J, Sherman M. Management of hepatocellular carcinoma: an update. Hepatology. 2011;53(3):1020-2, http://dx.doi.org/10.1002/hep. 24199. Llovet JM, Di Bisceglie AM, Bruix J, Kramer BS, Lencioni R, Zhu AX, et al. Design and endpoints of clinical trials in hepatocellular carcinoma. J Natl Cancer Inst. 2008;100(10):698-711. Germani G, Gurusamy K, Garcovich M, Toso C, Fede G, Hemming A, et al. Which matters most: Number of tumors, size of the largest tumor, or total tumor volume? Liver Transpl. 2011;17(suppl 2);S58-S66, http:// dx.doi.org/10.1002/lt.22336. Guyatt GH, Oxman AD, Vist G, Kunz R, Falck-Ytter Y, Alonso-Coello P, et al. GRADE: an emerging consensus on rating quality of evidence and strength of recommendations. BMJ. 2008;336(7650):924-6, http://dx.doi. org/10.1136/bmj.39489.470347.AD. Tremosini S, Reig M, De Lope CR, Forner A, Bruix J. Treatment of early hepatocellular carcinoma: towards personalized therapy. Dig Liver Dis. 2010;42 Suppl:S242-S8, http://dx.doi.org/10.1016/S1590-8658(10)605129.


CLINICAL SCIENCE

The lung in paracoccidioidomycosis: new insights into old problems Andre Nathan Costa,I Gil Benard,II Andre Luis Pereira Albuquerque,I Carmem Lucia Fujita,III Adriana Satie Kono Magri,IV Joa˜o Marcos Salge,I Maria Aparecida Shikanai-Yasuda,IV Carlos Roberto Ribeiro CarvalhoI I Faculdade de Medicina da Universidade de Sa˜o Paulo, Heart Institute (InCor), Pulmonary Division, Sa˜o Paulo/SP, Brazil. II Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Dermatology Division, Laboratory of Dermatology and Immunodeficiencies, and Laboratory of Medical Mycology, Sa˜o Paulo/SP, Brazil. III Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Radiology, Sa˜o Paulo/SP, Brazil. IV Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Infectious and Parasitic Diseases, Sa˜o Paulo/SP, Brazil.

OBJECTIVES: Chronic paracoccidioidomycosis can diffusely affect the lungs. Even after antifungal therapy, patients may present with residual respiratory abnormalities due to fungus-induced lung fibrosis. METHODS: A cross-sectional analysis of 50 consecutive inactive, chronic paracoccidioidomycosis patients was performed using high resolution computed tomography, pulmonary function tests, ergospirometry, the sixminute walk test and health-related quality of life questionnaires. RESULTS: Radiological abnormalities were present in 98% of cases, the most frequent of which were architectural distortion (90%), reticulate and septal thickening (88%), centrilobular and paraseptal emphysema (84%) and parenchymal bands (74%). Patients typically presented with a mild obstructive disorder and a mild reduction in diffusion capacity with preserved exercise capacity, including VO2max and six-minute walking distance. Patient evaluation with the Saint-George Respiratory Questionnaire showed low impairment in the health-related quality of life, and the Medical Research Council questionnaire indicated a low dyspnea index. There were, however, patients with significant oxygen desaturation upon exercise that was associated with respiratory distress compared with the non-desaturated patients. The initial counterimmunoelectrophoresis of these patients was higher and lung emphysema was more prominent; however, there were no differences in the interstitial fibrotic tomographic abnormalities, tobacco exposure, functional responses, exercise capacity or quality of life. CONCLUSIONS: Inactive, chronic paracoccidioidomycosis patients show persistent and disseminated radiological abnormalities by high resolution computed tomography, short impairments in pulmonary function and low impacts on aerobic capacity and quality of life. However, there was a subset of individuals whose functional impairment was more severe. These patients present with higher initial serology and more severe emphysema, stressing the importance of adequate treatment associated with tobacco exposure cessation. KEYWORDS: Paracoccidioidomycosis; Lung; Pulmonary Function; Quality Of Life; Computed Tomography. Costa AN, Benard G, Albuquerque AL, Fujita CL, Magri AS, Salge JM, et al. The lung in paracoccidioidomycosis: new insights into old problems. Clinics. 2013;68(4):441-448. Received for publication on September 26, 2012; First review completed on October 30, 2012; Accepted for publication on December 3, 2012 E-mail: nathan.andre@gmail.com Tel.: 55 11 2661-5695

the most common systemic mycosis affecting non-immunocompromised hosts in South America and Brazil, which account for more than 80% of all reported cases (5-8). Additionally, cases outside these areas continue to be reported and are generally associated with long periods of latency, representing endogenous reactivation of the infectious focus that was previously acquired in endemic regions (4). PCM is subdivided into the following two groups that are differentiated by their time course and the age of the host: juvenile and chronic forms. The juvenile form has an acute or subacute clinical course with a predominantly lymphatic distribution. The chronic or reactivation form has a more insidious course in which the lung is the most frequently involved organ, with lesser involvement of the reticuloendothelial and lymphatic systems (3,4,9). The cure

& INTRODUCTION In 1908, Adolph Lutz first described the human Paracoccidioides brasiliensis infection (1). This thermally dimorphic fungus is acquired by inhalation of the infective forms of the organism and causes notable, systemic mycosis (2-4). The disease, termed paracoccidioidomycosis (PCM), is

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)02

441


The lung in residual paracoccidioidomycosis Costa AN et al.

CLINICS 2013;68(4):441-448

For the pulmonary function tests (PFT), all measurements were obtained using the recommended standards (19-22). Spirometry was performed using a calibrated pneumotachograph (Medical Graphics Corporation, MGC, St. Paul, MN, USA, 2005), whereas lung volumes and CO diffusing capacity (DLCO) were obtained with a body plethysmograph (Elite Dx, Elite SeriesTM, MGC). The following variables were considered: FVC (forced vital capacity), FEV1 (expiratory forced volume in the first second), IC (inspiratory capacity), TLC (total lung capacity), RV (residual volume), MVV (maximal voluntary ventilation) and DLCO. The predicted values were derived based on the Brazilian population (19-21). For the cardiopulmonary exercise test (CPET), a ramp symptom-limited CPET was performed on a cycle (Corival, Lode B.V. Medical Technology, Groningen, The Netherlands) consisting of a 2 min period of rest and 2 min period of warm-up, followed by an incremental work-rate period, which was increased from 10 to 20 W/min. Oxygen saturation (SpO2) by pulse oximetry (NONIN-ONYX, model 9500, Plymouth, MN, USA) and electrocardiography (Welch Allyn CardioPerfect, Inc, NY) were monitored continuously (23). The following variables were recorded (CardiO2 System, MGC): work rate, VO2, minuteventilation (VE), carbon dioxide output (VCO2), tidal volume (VT), respiratory rate (RR), respiratory exchange rate (RER) and heart rate (HR). The predicted values for CPET were calculated based on the Brazilian population (23). The six-minute walk test (6MWT) was performed according to the ATS guidelines (24), and the parameters analyzed were the distance walked (meters), SpO2 minimum maintained for at least 10 seconds and the difference between the basal saturation (at rest) and minimal saturation achieved during the test (SpO2 basal – SpO2 min). The distance was analyzed based on the predictive equations for the adult Brazilian population (25). A standard questionnaire was administered by a pulmonologist to obtain information on age, sex, body mass index, smoking habits and possible respiratory co-infections. Two specific respiratory questionnaires, the Saint George Respiratory Questionnaire (SGRQ) (26,27), and Medical Research Council (MRC) Dyspnea Questionnaire (28,29) were used. The SGRQ is a standardized airway diseasespecific questionnaire divided into three subscales: symptoms, activity and impacts. The scores were calculated using algorithms as recommended (P.W. Jones, St George’s Hospital Medical School, London, UK, personal communication). For each subscale and the overall questionnaire, scores ranged from zero, indicating no impairment, to 100, indicating maximum impairment. Values above 10 reflected an altered quality of life for that specific area (26,27). The MRC breathlessness scale is a measurement of disability in patients with chronic obstructive pulmonary disease. It comprises five statements that describe nearly the entire range of respiratory disability from none (Grade 1) to almost complete incapacity (Grade 5) (28,29). Patients were then divided into two groups based on the severity of exercise gas exchange disability by desaturation in the 6MWT. Group A demonstrated desaturation, and Group B had no desaturation. Desaturation was defined as a fall .4% of the resting SpO2 value (30). We chose the 6MWT because it is a simple, efficient and low-cost tool used to evaluate the performance of individuals during submaximal exercise and can be even more sensitive than maximal incremental cycle testing for the detection of oxygen desaturation (24,30).

rate is high when adequate treatment is readily administered, and mycological eradication can be achieved with sulfonamides, azole compounds or amphotericin (9-11). However, in pulmonary parenchyma, even after treatment, P. brasiliensis induces chronic damage that leads to the development of lung fibrosis, which is most likely due to persistent antigenic stimulus that elicits a continuous inflammatory response (12). This process can result in a severe restriction of respiratory function and a decline in work capacity, thereby affecting patient quality of life (4,13,14). In fact, in more than 50% of cases in which the patient receives an adequate course of therapy, pulmonary fibrosis is radiographically documented at the end of the treatment period (15). However, the true incidence and severity of radiographical and functional disability of the patient following treatment for this endemic mycosis remain unknown. The objective of this study was to characterize both the residual pulmonary involvement in PCM by high resolution computed tomography (HRCT) and the sequelae related to lung function, exercise capacity and quality of life in the inactive chronic form of PCM.

& PATIENTS AND METHODS From July 2008 to July 2010, all PCM patients seen in the outpatient clinic of the Pulmonary and Infectious Diseases Divisions of the Hospital das Clinicas at the University of Sao Paulo were invited to participate in the study. The patients were included if the PCM diagnosis was confirmed by the identification of P. brasiliensis yeast cells in biopsies and/or other clinical specimens and/or serological diagnosis. The patients were enrolled if they met the criteria for inactive disease as determined by a treatment length of at least 6 months, negative mycological examinations, resolution of skin and mucosal lesions, low anti-P. brasiliensis antibody titers by counterimmunoelectrophoresis (CIE) (titers ,1:4 or a fall in at least four dilutions) and a lack of radiological activity on chest radiographs (9,16,17). The exclusion criteria were pulmonary co-infections, such as tuberculosis, histoplasmosis or other chronic infections, or lung neoplasia. From a cohort of 81 PCM patients, 72 met the inclusion criteria, and 22 were excluded. Of the 22 excluded patients, 10 had the juvenile form, seven had tuberculosis co-infections, three were tracheotomized, one had microstomia and one refused. Of the 50 patients included in the study, 47 were men ranging in age from 35 to 78 years, with a mean age of 56.9 years. All were previously diagnosed based on mycological examination, including direct visualization and/or culture of smears of lesions and/or biopsies. HRCT scans were obtained using 1 or 2 mm collimation at 10 mm intervals (Multislice Philips Brilliance CT40, Cleveland, United States). Two investigators (CF and CRRC) blinded to the clinical history of the patients retrospectively read the CT scans, and when necessary, final decisions were reached by consensus. The findings were analyzed with regard to distribution in the lung parenchyma, (central, peripheral or both) and upper (above the level of the tracheal carina), middle (between the level of the carina and inferior pulmonary veins) and lower zones (below the level of the inferior pulmonary veins) or a combination of zones (2,18).

442


CLINICS 2013;68(4):441-448

The lung in residual paracoccidioidomycosis Costa AN et al.

The serum CIE titer at diagnosis was significantly higher in Group A compared with the patients without exercise desaturation in Group B. The other clinical and epidemiological parameters were not different between these two groups.

Statistical analysis was performed with GraphPad Prism Version 5.0 for Windows (GraphPad Software, San Diego CA, USA). Parametric variables are expressed as the mean and standard deviation (SD), and nonparametric variables are expressed as the median and interquartile range (IQ). Correlations were performed using either Pearson or Spearman tests, depending on the distribution of the variables. Comparisons between groups were performed with a Student’s T test or Mann-Whitney test when appropriate. A chi-squared analysis was used to examine categorical variables, and a Fisher exact test was used for small samples. Statistical significance was assumed for pvalues,0.05.

Radiological Findings Abnormal pulmonary findings on HRCT were observed in all but one patient, and multiple abnormalities were often present simultaneously (median of eight abnormalities/ patient). CT findings included architectural distortion (90%, n = 45), interlobular septal thickening and reticulate (88%, n = 44), centrilobular or paraseptal emphysema (82%, n = 41), bronchial thickening (82%, n = 41), parenchymal bands (74%, n = 37), areas of cicatricial emphysema (66%, n = 33), nodules ,3 cm (62%, n = 31) and ground glass opacities (46%, n = 23). Pleural thickening was observed in 10 (20%) patients, and mediastinal lymphadenopathy in only three cases. Thirty-eight patients presented with mosaic perfusion patterns with expiratory maneuvers. The major tomographic findings were predominantly diffuse in their distribution (84%), were most prominent in the superior and medium zones and had a combination of central and peripheral locations in 80% of cases. When predominance was apparent, these findings were most common in the upper and middle lung zones. The most frequent abnormalities are shown in Figure 1 (A-F). Notably, a comparison between Group A and B revealed no difference in the number of interstitial fibrotic CT abnormalities, which were architectural distortion, interlobular septal thickening and reticulate and parenchymal bands. However, when emphysema quantification scores were compared, they were higher (more prominent emphysema) in Group A than Group B (Figure 2, p = 0.0009).

Ethics Statement Our research was approved by our two Ethics Committees, Comissa˜o de Pesquisa do Departamento de Cardiopneumologia and Comissa˜o de E´tica para a Ana´lise de Projetos de Pesquisa – CAPPesq da Diretoria Clı´nica do Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, on June 09, 2007, under approval number 870/06. All patients in our study signed an informed consent form, and all clinical investigations were conducted in accordance with the principles expressed in the Declaration of Helsinki.

& RESULTS The clinical and epidemiological data for the patients and their serum titers on CIE at the time of diagnosis and the time of our evaluation are shown in Table 1. All but one of the patients were smokers. The antifungal drugs used by the patients were itraconazole (26%), sulfamethoxazole-trimethoprim (16%), sulfadiazine (12%) and ketoconazole (8%). The remaining 38% used two or more of these drugs for treatment. Patients were not HIV co-infected and had no autoimmune disease or referred use of immunosuppressant drugs. Twenty-seven patients remained on antifungal medications because it is a common practice in the infectious diseases outpatient unit to use low-dose sulfamethoxazoletrimetropin as a maintenance treatment to prevent relapses of the chronic forms of infections. These patients represented 40% in Group A (desaturation in 6 MWT) and 60% in Group B (p = 0.34).

Pulmonary function tests (PFT) Lung function test results are shown in Table 2. Seven patients (14%) presented with normal PFT. An obstructive defect, defined as FEV1/FVC,0.70, was observed in 70% (35) of patients (31). Of the latter, 85% (n = 30) presented with only a mild obstruction (FEV1.60%), and only one patient presented with a severe obstruction (FEV1,40%). The residual volume/total lung capacity was slightly increased, suggesting air trapping without pulmonary hyperinflation. Only one patient presented with a pure

Table 1 - Clinical and epidemiological data of Group A (desaturation .4% in 6MWT) and Group B (desaturation ,4% in 6MWT).

Age in years Gender male (%) Body mass index Tobacco exposure (%) Tobacco exposure in pack years Length of treatment in months Time between onset of treatment and evaluation (years) Initial CIE CIE at evaluation

n = 50

GROUP A n = 18

GROUP B n = 32

p (A 6 B)

56.9¡9.7 92% 24.0¡4.8 98%

59.1¡2.2 89% 24.7¡1.4 100%

55.6¡1.7 94% 23.6¡0.6 97%

0.21 0.62 0.50 1.00

35(27-50)

30(20-42)

37(30-53)

0.25

42¡34 5.9¡3.8

38.2¡37.2 5.9¡3.8

44¡31.7 5.9¡3.9

0.56 0.99

1:64 (1:16-1:256) 1:2(0-1:4)

1:128 (1:32-1:256) 1:2(0-1:5)

1:32 (1:8-1:128) 1:1.5(1-1:4)

0.01 0.62

The data are reported as either the median values (IQ) or as the mean¡SD. IQ = interquartile, SD = standard deviation, CIE = counterimmunoelectrophoresis.

443


The lung in residual paracoccidioidomycosis Costa AN et al.

CLINICS 2013;68(4):441-448

Figure 1 - The patterns of pulmonary alterations found on HRCT. (A) Upper lobes showing septal thickening and peripheral reticulate. (B) Upper lobes showing architectural distortion. (C) Lower lobes showing parenchymal bands. (D) Lower lobes showing non-calcified nodules in the left lower lobe. (E) Upper lobes showing centrilobular and paraseptal emphysema. (F) Lower lobes showing peribronchovascular thickening.

restrictive pattern, showing a TLC of 61% of the predicted value. Diffusing capacity was impaired in 43 (86%) patients (mean DLCO: 60.6% of the predicted value). Nine patients presented with a severe (DLCO,40%), 15 with a moderate (40%,DLCO,60%) and 19 with a mild reduction (DLCO.60%) in diffusion capacity. There was no bronchodilator response (data not shown). A comparison between groups showed that Group A had significantly reduced gas exchange and ventilatory strength than Group B (Table 2).

Exercise evaluation The maximal exercise performance was preserved in the PCM patients, with a VO2max value of 80.8%¡18.5 of the predicted value. At exercise cessation, there was a large

Table 2 - Lung function measurements of Group A (desaturation .4% in 6 MWT) and Group B (desaturation ,4% in 6MWT).

FVC (L) % predicted FEV1 (L) % predicted FEV1/FVC % predicted FEF 25-75% (L/s) % predicted TLC (L) % predicted RV (L) % predicted RV/TLC % predicted DLCO (mL/min/mmHg) % predicted MVV (L) % predicted

n = 50

Group A

Group B

4.00¡0.82 94.8¡12.1 2.60¡0.68 77.6¡17.0 0.65¡0.11 81.7¡13.4 1.6¡0.93 52.1¡28.4 6.80¡0.20 100.4¡12.9 2.40¡0.73 121.2¡34.5 0.38¡0.07 117.2¡23.4 20.4¡6.6 60.6¡19.9 98.7¡29 72.5¡20.2

3.75¡0.2 91.0¡3.2 2.38¡0.1 72.1¡3.9 63.3¡2.8 79.3¡3.5 1.42¡0.2 45.9¡6.2 6.14¡0.3 98.8¡3.9 2.41¡0.2 122.4¡9.9 0.38¡0.02 120.5¡7 16.7¡1.3 49.2¡3.8 86.5¡20.5 65.2¡3.9

4.13¡0.1 97.0¡1.8 2.72¡0.1 80.2¡2.9 66.16¡1.7 83.0¡2.1 1.73¡0.1 55.5¡5.1 6.47¡0.1 101.3¡1.9 2.39¡0.1 120.6¡5.6 0.37¡0.01 115.2¡3 22.5¡1.10 66.9¡3.4 105.8¡4.7 76.5¡3.9

pvalue 0.14 0.12 0.09 0.10 0.39 0.17 0.26 0.24 0.40 0.58 0.95 0.87 0.58 0.51 0.002 0.001 0.14 0.04

The data are reported as the means¡SD. SD = standard deviation, FVC = forced vital capacity, FEV1 = forced expiratory volume in 1 s, FEF2575% = forced expiratory flow from 25 to 75% of the FVC, TLC = total lung capacity, RV = residual volume, DLCO = carbon monoxide diffusing capacity, MVV = maximal voluntary ventilation.

Figure 2 - Figure showing that emphysema quantification by CT was significantly higher in the most severely impaired PCM patients compared to the least severely impaired PCM patients.

444


CLINICS 2013;68(4):441-448

The lung in residual paracoccidioidomycosis Costa AN et al.

Table 3 - Maximal cardiopulmonary and 6MWT tests for Group A (desaturation .4% in 6MWT) and Group B (desaturation ,4% in 6MWT).

Cardiopulmonary test VO2 max (% predicted) RER Ventilatory reserve (%) VE/VCO2 VO2/HR (mL.min-1) HR (% predicted) SpO2 N Initial N Final 6MWT Walked distance (meters) SpO2 N Initial N Final HR (% predicted)

n = 50

Group A

Group B

80.8¡18.5 1.18 (1.12-1.26) 40.4¡17 36.0¡8 11.0¡2.8 82.4¡13

79.5¡3.9 1.18 (1.12-1.24) 21.2¡5.2 38.3¡1.5 10.0¡0.7 86.9¡2.5

81.6¡3.6 1.18 (1.11-1.27) 39.4¡4.3 34.2¡1.2 11.3¡0.4 80.3¡2.4

97 (96-98) 94 (92-96)

96.2¡0.36 91.7¡1

97.0¡0.3 94.7¡0.4

492 (456-520)

431 (354-480)

477 (306-492)

0.11 0.04 p-value 0.71

96¡1.6 93¡4 62.8¡15

95.9¡0.3 89.1¡1.0 69.8¡2.1

95.9¡0.28 l 94.8¡0.3 63.0¡1.3

0.96 ,0.0001 0.01

p-value 0.70 0.89 0.01 0.04 0.13 0.07

The data are reported as either the median values (IQ) or the means¡SD. IQ = interquartile, ST = standard deviation, VO2 max = maximal oxygen consumption, VE/VCO2 = ventilatory equivalent ratio for carbon dioxide, VO2/FC = oxygen pulse, HR = heart rate, SpO2 = peripheral oxygen saturation.

the in HRQOL (p = 0.021, r = 0.33). However, there was no correlation between the CIE and any of the other parameters analyzed in the population under study.

ventilatory reserve that was accomplished without oxygen desaturation, showing a preserved performance of the respiratory system under effort. Cardiac behavior was characterized by a normal oxygen pulse (VO2/HR = 11.0¡2.8 mL.min-1), and the significant cardiac reserve suggested that there were no cardiac limitations. Of the 50 patients, only one had ECG abnormalities that were compatible with coronary disease, which was not confirmed by an invasive posterior coronary study. When Groups A and B were examined, no significant difference was found between the patients for either VO2max or oxygen pulse; however, Group A had a lower ventilatory reserve with higher hyperventilation (augmented VE/VCO2). In summary, Group A presented with more serious respiratory impairments during exercise compared with Group B (Table 3). In the 6MWT, patients achieved a normal distance with a median of 492 meters, which was 131% of the predicted value, without desaturation. The distance achieved was similar between groups. However, for the submaximal test (very large cardiac reserve at exercise cessation), 18 (36%) of the patients presented with a decrease .4% in SpO2, which was indicative of an abnormal arterial-alveolar gradient that was previously shown for PCM in other studies (32,33) (Table 3).

& DISCUSSION In contrast with previous investigations of treated PCM patients, we found a consistently higher incidence of radiological involvement, with 98% of patients presenting with at least one CT abnormality. The most common abnormalities were architectural distortion and interlobular septal thickening and reticulate, which were most likely related to dissemination of the fungi through the lymphatics and subsequent fibrosis formation (13). The finding of peribronchovascular interstitial thickening diffusely distributed throughout the pulmonary zones in 62% of the patients is another abnormality related to the pattern of fungal dissemination previously described in histopathology studies (2). In contrast, centrilobular and paraseptal emphysema were observed in 82% of individuals, which reflects the high tobacco exposure in our population, a feature regularly described in cohorts of chronic PCM (8). Finally, different from the pre-treatment CT scan findings (2,18,34), consolidation and cavitations were very rare, and no reversed halo sign was observed, confirming the inactivity of the mycosis.

Health-related quality of life (HRQOL) The Saint George Respiratory Questionnaire scores are presented in Table 4. Patients presented with high (worse) scores in the symptoms and activity scales but low overall impairments in health-related quality of life. For the MRC Dyspnea Questionnaire, the patients had a mean value of 1, which corresponds with ‘‘not troubled by breathlessness except on strenuous exercise’’ (28). Even in Group A, the more severe impairments did not translate into a worse quality of life, as measured by either the SGRQ or MRC Dyspnea Questionnaire. There was a strong correlation between the two scores, with p,0.0001 and r = 0.65.

Table 4 - Saint George Respiratory Questionnaire scores for Group A (desaturation .4% in 6 MWT) and Group B (desaturation ,4% in 6MWT). Symptoms % total (IQ) Activity % total (IQ) Impacts % total (IQ) Overall ¡ SD % total¡ST

Correlation studies The initial CIE titers inversely correlated with the DLCO (p = 0.001, r = -0.44) and positively correlated with impairments

n = 50 17.8 (3.7-34.9)

Group A

Group B

p (A 6 B)

18.2 (6-36) 16.9 (0.5-34.4)

0.61

29.5 (5.8-41.8) 26.4 (0-41.8) 29.5 (6.0-41.8)

0.76

3.2 (0-12.9)

3.5 (0-12.9)

3.1 (0-14.5)

1.00

16.2¡13.8

24.7¡10.4

14.5¡13.9

0.9

The data are reported as either the median values (IQ) or the means¡SD. IQ = interquartile, ST standard deviation.

445


The lung in residual paracoccidioidomycosis Costa AN et al.

CLINICS 2013;68(4):441-448

that a proportion of PCM patients will present with some degree of respiratory distress during exercise. Notably, both groups had comparable interstitial fibrotic alterations regarding lung CTs, type and length of treatments, age and tobacco exposure. Patients with exercise desaturation (Group A) presented with more severe emphysema than Group B, even though they had similar tobacco exposure. One likely explanation for this finding is the higher pretreatment serology titers in Group B, denoting a putative higher fungal burden and subsequently stronger inflammatory response. In fact, the initial serology was inversely correlated with the DLCO and positively correlated with impairment in the health-related quality of life questionnaire. This aspect warrants further evaluation. It is also conceivable that in some patients, the diagnosis was delayed; therefore, at the time treatment began, the fibrosis was already at an advanced stage. Similarly, differences in the host-parasite relationship due to distinct host immune responses and regulation among the patients could also explain the different outcomes (42,43). Finally, genetic differences in the response to tobacco exposure leading to more severe emphysema in face of comparable tobacco exposure could explain why a subgroup of patients developed higher levels of emphysema (44). Also, the influence of genetic background on emphysema severity could have been accentuated by the concomitant pulmonary insult caused by the fungi. This is of particular interest because emphysema was the major tomographic finding associated with more intense impairments in aerobic capacity and gas exchange. Our study has several limitations. We could not assess the patients at the onset of antifungal therapy, and information regarding the clinical course of the disease was retrospectively assessed. Notably, these data are particularly difficult to interpret because the CF of the mycosis has a very insidious and often subclinical course, and at the time of diagnosis, the patients usually exhibit marked clinicalradiological dissociation (4). Tobacco exposure may indeed be a confounding variable. However, obtaining a group of patients without tobacco exposure is not feasible when studying the chronic form of PCM because a smoking habit is almost universal in individuals with this form of mycosis (2,8,45). Additionally, patients used different classes of drugs for treatment, which can be a confounding factor for the final endpoints, but currently, there are no studies demonstrating the improved efficacy of one antifungal drug compared with others (9,10,46,47). In conclusion, we showed that patients with the chronic form of PCM and high exposure to tobacco displayed several residual lesions on the lung CT scans in association with emphysema. However, these residual lesions did not predict severe pulmonary functional impairments or a decreased HRQOL. A subset of patients, however, persisted with gas exchange impairments during exercise and higher respiratory distress and should be identified by the simple and inexpensive 6MWT. The main factors involved with the respiratory impairments were emphysema, as shown by the HRCT scan, and higher initial serology titer, as shown by the CIE and higher initial serology titer. This stresses the value of adequate and early specific treatments associated with tobacco cessation. The factors involved in this more severe evolution of PCM, however, remain unclear and require further investigation.

It has been shown by thoracic roentgenogram that fungus-induced lung fibrosis in the form of residual lesions occurs in up to 53% of treated patients (15), which has led to experimental studies involving pentoxifylline as a complementary treatment for pulmonary PCM due to its immunomodulatory and anti-fibrotic properties (35). However, this radiologic approach may not be beneficial for an even greater proportion of individuals with interstitial pulmonary abnormalities because thoracic roentgenogram is not sufficiently sensitive to evaluate these lesions. In addition, chest X-rays are not sufficiently sensitive to confirm the possible presence of lung emphysema (15). Indeed, HRCT is currently the standard approach to confirm lung parenchymal involvement (18,36,37). As expected, using HRCT, we found a greater proportion of lung residual abnormalities than previously reported, confirming that PCM can lead to even further radiological involvement of respiratory tissue than previously thought. Despite these findings, the pulmonary functional impairments were not that limiting. On average, the patients presented with a mild obstructive disorder associated with a mild reduction in diffusion capacity and slight reduction in the maximal voluntary ventilation. Indeed, most of the patients were classified as having mild obstructive defects, and only one patient presented with severe obstruction. This contrasts with earlier studies in which more than 50% of the patients evaluated presented with a moderate to severe obstructive defect (38), the alveolar-arterial gradient was altered in all patients (39,40), and cor pulmonale was present in almost 25% of the cases (40). This discrepancy may be related to the more restricted access to health care facilities in Brazil at the time these studies were conducted, which delayed proper diagnosis and treatment. In contrast, in our patients, the DLCO was severely impaired in only 18% of patients. A plausible explanation for these functional findings of mild obstruction with more severe DLCO impairment is the presence of interstitial fibrotic disease associated with pulmonary emphysema, as described for Combined Pulmonary Fibrosis and Emphysema (CPFE). In this condition, there are subnormal spirometry exams, despite severe impairment in DLCO, that are most likely secondary to overinflation and an increase in pulmonary compliance due to the loss of elasticity in areas with emphysema that are balanced by the loss of volume and decreased compliance caused by fibrosis (41). When our patients performed maximal and submaximal exercises, their performances were normal. Furthermore, we could not find any ventilatory or cardiac limitations. This behavior was also reflected in the quality of life measurements. On average, the patients presented with low quality of life impairments, as measured by the Saint George Respiratory Questionnaire. The mean score of 16 can be interpreted as altered because it is higher than 10 (29), but compared with the general population, it remained within the 80th percentile limit (26), indicating that the HRQOL was not impaired in a severe manner. Indeed, in the MRC questionnaire, the patients had a mean value of 1. There was, however, a substantial percentage (36%) of patients who presented with significant gas exchange dysfunction that was confirmed by desaturation (decrease $4%) in the 6MWT. This proportion of impaired patients is smaller than previously thought, but this finding suggests

446


CLINICS 2013;68(4):441-448

The lung in residual paracoccidioidomycosis Costa AN et al. 20. Neder JA, Andreoni S, Castelo-Filho A, Nery LE. Reference values for lung function tests. I. Static volumes. Braz J Med Biol Res. 1999;32(6):70317. 21. Neder JA, Andreoni S, Peres C, Nery LE. Reference values for lung function tests. III. Carbon monoxide diffusing capacity (transfer factor). Braz J Med Biol Res. 1999;32(6):729-37, http://dx.doi.org/10.1590/ S0100-879X1999000600008. 22. Miller MR, Hankinson J, Brusasco V, Burgos F, Casaburi R, Coates A, et al. Standardisation of spirometry. Eur Respir J. 2005;26(2):319-38, http://dx.doi.org/10.1183/09031936.05.00034805. 23. Neder JA, Nery LE, Castelo A, Andreoni S, Lerario MC, Sachs A, et al. Prediction of metabolic and cardiopulmonary responses to maximum cycle ergometry: a randomised study. Eur Respir J. 1999;14(6):1304-13, http://dx.doi.org/10.1183/09031936.99.14613049. 24. ATS statement: guidelines for the six-minute walk test. Am J Respir Crit Care Med. 2002;166(1):111-7. 25. Soares MR, Pereira CA. Six-minute walk test: reference values for healthy adults in Brazil. J Bras Pneumol. 2011;37(5):576-83. 26. Ferrer M, Villasante C, Alonso J, Sobradillo V, Gabriel R, Vilagut G, et al. Interpretation of quality of life scores from the St George’s Respiratory Questionnaire. Eur Respir J. 2002;19(3):405-13, http://dx.doi.org/10. 1183/09031936.02.00213202. 27. Sousa TC, Jardim JRB, Jones PW. Validac¸a˜o do Questiona´rio do Hospital Saint George na Doenc¸a Respirato´ria (SGRQ) em pacientes portadores de doenc¸a pulmonar obstrutiva croˆnica no Brasil. J Bras Pneumol. 2000;16:119-25, http://dx.doi.org/10.1590/S0102-35862000000300004. 28. Bestall JC, Paul EA, Garrod R, Garnham R, Jones PW, Wedzicha JA. Usefulness of the Medical Research Council (MRC) dyspnoea scale as a measure of disability in patients with chronic obstructive pulmonary disease. Thorax. 1999;54(7):581-6, http://dx.doi.org/10.1136/thx.54.7.581. 29. Kovelis D, Segretti NO, Probst VS, Lareau SC, Brunetto AF, Pitta F. Validation of the Modified Pulmonary Functional Status and Dyspnea Questionnaire and the Medical Research Council scale for use in Brazilian patients with chronic obstructive pulmonary disease. J Bras Pneumol. 2008;34(12):1008-18. 30. Poulain M, Durand F, Palomba B, Ceugniet F, Desplan J, Varray A, et al. 6-minute walk testing is more sensitive than maximal incremental cycle testing for detecting oxygen desaturation in patients with COPD. Chest. 2003;123(5):1401-7, http://dx.doi.org/10.1378/chest.123.5.1401. 31. Global Strategy for the Diagnosis, Management and Prevention of COPD, Global Initiative for Chronic Obstructive Lung Disease (GOLD) 2011. Available at: http://www.goldcopd.org/. Accessed 26 April 2012. Journal [serial on the Internet]. Date [cited 2011: Available from: http:// www.goldcopd.org/. 32. Lemle A, Wanke B, Mandel MB. Pulmonary localization of paracoccidioidomycosis: lung function studies before and after treatment. Rev Inst Med Trop Sao Paulo. 1983;25(12):73-8. 33. Afonso JE, Nery LE, Romaldini H, Bogossian M, Ribeiro-Ratto O. [Pulmonary function in paracoccidioidomycosis (South American blastomycosis)]. Rev Inst Med Trop Sao Paulo. 1979;21(6):269-80. 34. Marchiori E, Zanetti G, Escuissato DL, Souza AS, Jr., Meirelles Gde S, Fagundes J, et al. Reversed Halo Sign: High-Resolution CT Scan Findings in 79 Patients. Chest. 2012;141(5):1260-6, http://dx.doi.org/10.1378/ chest.11-1050. 35. Naranjo TW, Lopera DE, Diaz-Granados LR, Duque JJ, Restrepo AM, Cano LE. Combined itraconazole-pentoxifylline treatment promptly reduces lung fibrosis induced by chronic pulmonary paracoccidioidomycosis in mice. Pulm Pharmacol Ther. 2010;24(1):81-91. 36. Marchiori E, Valiante PM, Mano CM, Zanetti G, Escuissato DL, Souza AS, Jr., et al. Paracoccidioidomycosis: high-resolution computed tomography-pathologic correlation. Eur J Radiol. 2009;77(1):80-4. 37. Barreto MM, Marchiori E, Amorim VB, Zanetti G, Takayassu TC, Escuissato DL, et al. Thoracic Paracoccidioidomycosis: Radiographic and CT Findings. Radiographics. 2012;32(1):71-84, http://dx.doi.org/10. 1148/rg.321115052. 38. Lemle A, Vieira LO, Milward GA, Miranda JL. Lung function studies in pulmonary South American blastomycosis. Correlation with clinical and roentgenologic findings. Am J Med. 1970;48(4):434-42. 39. Campos EP, Cataneo AMJ. Func¸a˜o pulmonar na evoluc¸a˜o de 35 pacientes com paracoccidioidomicose. Rev Inst Med Trop Sao Paulo. 1986;28(5):330-6, http://dx.doi.org/10.1590/S0036-46651986000500008. 40. Campos EP, Padovani CR, Cataneo AMJ. Paracoccidioidomicose: estudo radiolo´gico e pulmonar de 58 casos. Rev Inst Med Trop Sao Paulo. 1991;33(4):267-76, http://dx.doi.org/10.1590/S0036-46651991000400005. 41. Jankowich MD, Rounds SI. Combined pulmonary fibrosis and emphysema syndrome: a review. Chest. 2012;141(1):222-31, http://dx.doi.org/ 10.1378/chest.11-1062. 42. Benard G. An overview of the immunopathology of human paracoccidioidomycosis. Mycopathologia. 2008;165(4-5):209-21, http://dx.doi.org/10. 1007/s11046-007-9065-0. 43. Calich VL, Vaz CA, Burger E. Immunity to Paracoccidioides brasiliensis infection. Res Immunol. 1998;149(4-5):407-17; discussion 99-500, http:// dx.doi.org/10.1016/S0923-2494(98)80764-5.

& AUTHOR CONTRIBUTIONS Costa AN performed the patient interviews, review of medical records, statistical analysis, ergospirometry and pulmonary function test analyses, health related questionnaires and manuscript preparation. Costa AN is the guarantor of the paper and takes responsibility for the integrity of the work as a whole, from inception to published article. Benard G performed the patient interviews, statistical analysis and manuscript review. Albuquerque AL and Salge JM performed the pulmonary function tests, ergospirometry analysis and manuscript review. Fujita CL performed the radiological analysis. Kono A performed the patient interviews and manuscript review. Shikanai-Yasuda MA performed the manuscript review. Carvalho CR designed the study and performed the radiological analysis and manuscript review.

& REFERENCE 1. Lutz A. Uma mycose pseudococcidica localisada na boca e observada no Brazil. Contribuicao ao conhecimento das hyphoblastomycoses americanas. Bras Med. 1908;(22):121-4. 2. Funari M, Kavakama J, Shikanai-Yasuda MA, Castro LG, Bernard G, Rocha MS, et al. Chronic pulmonary paracoccidioidomycosis (South American blastomycosis): high-resolution CT findings in 41 patients. AJR Am J Roentgenol. 1999;173(1):59-64. 3. Bethlem EP, Capone D, Maranhao B, Carvalho CR, Wanke B. Paracoccidioidomycosis. Curr Opin Pulm Med. 1999;5(5):319-25, http://dx.doi.org/10.1097/00063198-199909000-00010. 4. Queiroz-Telles F, Escuissato DL. Pulmonary paracoccidioidomycosis. Semin Respir Crit Care Med. 2011;32(6):764-74, http://dx.doi.org/10. 1055/s-0031-1295724. 5. Blotta MH, Mamoni RL, Oliveira SJ, Nouer SA, Papaiordanou PM, Goveia A, et al. Endemic regions of paracoccidioidomycosis in Brazil: a clinical and epidemiologic study of 584 cases in the southeast region. Am J Trop Med Hyg. 1999;61(3):390-4. 6. Coutinho ZF, Silva D, Laze´ra M, Petri V, Oliveira RM, Sabroza PC, et al. Paracoccidioidomycosis mortality in Brazil (1980-1995). Cad Sau´de Pu´blica. 2002;18(5):1441-54, http://dx.doi.org/10.1590/S0102-311X2002000500037. 7. Rodrigues Gda S, Severo CB, Oliveira Fde M, Moreira Jda S, Prolla JC, Severo LC. Association between paracoccidioidomycosis and cancer. J Bras Pneumol. 2010;36(3):356-62. 8. Bellissimo-Rodrigues F, Machado AA, Martinez R. Paracoccidioidomycosis epidemiological features of a 1,000-cases series from a hyperendemic area on the southeast of Brazil. Am J Trop Med Hyg. 2011;85(3):546-50, http://dx.doi. org/10.4269/ajtmh.2011.11-0084. 9. Shikanai-Yasuda MA, Telles Filho Fde Q, Mendes RP, Colombo AL, Moretti ML. [Guidelines in paracoccidioidomycosis]. Rev Soc Bras Med Trop. 2006;39(3):297-310. 10. Shikanai-Yasuda MA, Benard G, Higaki Y, Del Negro GM, Hoo S, Vaccari EH, et al. Randomized trial with itraconazole, ketoconazole and sulfadiazine in paracoccidioidomycosis. Med Mycol. 2002;40(4):411-7. 11. Tercarioli GR, Bagagli E, Reis GM, Theodoro RC, Bosco Sde M, Macoris SA, et al. Ecological study of Paracoccidioides brasiliensis in soil: growth ability, conidia production and molecular detection. BMC Microbiol. 2007;7:92, http://dx.doi.org/10.1186/1471-2180-7-92. 12. Restrepo S, Tobon A, Trujillo J, Restrepo A. Development of pulmonary fibrosis in mice during infection with Paracoccidioides brasiliensis conidia. J Med Vet Mycol. 1992;30(3):173-84, http://dx.doi.org/10. 1080/02681219280000241. 13. Tuder RM, el Ibrahim R, Godoy CE, De Brito T. Pathology of the human pulmonary paracoccidioidomycosis. Mycopathologia. 1985;92(3):179-88, http://dx.doi.org/10.1007/BF00437631. 14. Lemle A, Wanke B, Miranda JL, Kropf GL, Mandel MB, Mandel S. Pulmonary function in paracoccidioidomycosis (South American blastomycosis). An analysis of the obstructive defect. Chest. 1983;83(5):827-8, http://dx.doi.org/10.1378/chest.83.5.827. 15. Tobon AM, Agudelo CA, Osorio ML, Alvarez DL, Arango M, Cano LE, et al. Residual pulmonary abnormalities in adult patients with chronic paracoccidioidomycosis: prolonged follow-up after itraconazole therapy. Clin Infect Dis. 2003;37(7):898-904, http://dx.doi.org/10.1086/377538. 16. Del Negro GM, Pereira CN, Andrade HF, Palacios SA, Vidal MM, Charbel CE, et al. Evaluation of tests for antibody response in the followup of patients with acute and chronic forms of paracoccidioidomycosis. J Med Microbiol. 2000;49(1):37-46. 17. de Camargo ZP. Serology of paracoccidioidomycosis. Mycopathologia. 2008;165(4-5):289-302, http://dx.doi.org/10.1007/s11046-007-9060-5. 18. Souza AS, Jr., Gasparetto EL, Davaus T, Escuissato DL, Marchiori E. High-resolution CT findings of 77 patients with untreated pulmonary paracoccidioidomycosis. AJR Am J Roentgenol. 2006;187(5):1248-52, http://dx.doi.org/10.2214/AJR.05.1065. 19. Pereira CA, Sato T, Rodrigues SC. New reference values for forced spirometry in white adults in Brazil. J Bras Pneumol. 2007;33(4):397-406.

447


The lung in residual paracoccidioidomycosis Costa AN et al.

CLINICS 2013;68(4):441-448

Estado do Espı´rito Santo, Brasil. Cad Sau´de Pu´blica. 2003;19(1):245-53, http://dx.doi.org/10.1590/S0102-311X2003000100027. 46. Stamm AM, Dismukes WE. Current therapy of pulmonary and disseminated fungal diseases. Chest. 1983;83(6):911-7, http://dx.doi.org/10.1378/chest.83.6.911. 47. Menezes VM, Soares BG, Fontes CJ. Drugs for treating paracoccidioidomycosis. Cochrane Database Syst Rev. 2006;(2):CD004967.

44. Kim WJ, Hoffman E, Reilly J, Hersh C, Demeo D, Washko G, et al. Association of COPD candidate genes with computed tomography emphysema and airway phenotypes in severe COPD. Eur Respir J. 2011;37(1):39-43, http://dx.doi.org/10.1183/09031936.00173009. 45. Santos WA, Silva BM, Passos ED, Zandonade E, Falqueto A. Associac¸a˜o entre tabagismo e paracoccidioidomicose: um estudo de caso-controle no

448


CLINICAL SCIENCE

Cognition and biomarkers of oxidative stress in obstructive sleep apnea Leticia Viana Sales,I Veralice Meireles Sales de Bruin,II Vania D’Almeida,I Sabine Pompe´ia,I Orlando Francisco Amodeo Bueno,I Se´rgio Tufik,I Lia BittencourtI I Universidade Federal de Sa˜o Paulo (UNIFESP), Departamento de Psicobiologia, Sa˜o Paulo/SP, Brazil. II Universidade Federal do Ceara´ (UFC), Faculdade de Medicina, Fortaleza/CE, Brazil.

OBJECTIVES: The aim of this study was to investigate neuropsychological performance and biomarkers of oxidative stress in patients with obstructive sleep apnea and the relationships between these factors. METHODS: This was an observational, cross-sectional study of 14 patients (36.0¡6.5 years old) with obstructive sleep apnea and 13 controls (37.3¡6.9 years old). All of the participants were clinically evaluated and underwent full-night polysomnography as well as neuropsychological tests. Blood samples were used to assay superoxide dismutase, catalase, glutathione and homocysteine, as well as vitamins E, C, B11 and B12. RESULTS: The patients performed poorly relative to the controls on several neuropsychological tests, such as the attention test and tests of long-term memory and working memory/executive function. They also had lower levels of vitamin E (p,0.006), superoxide dismutase (p,0.001) and vitamin B11 (p,0.001), as well as higher concentrations of homocysteine (p,0.02). Serum concentrations of vitamin C, catalase, glutathione and vitamin B12 were unaltered. Vitamin E levels were related to performance in the backward digit span task (F = 15.9; p = 0.002) and this correlation remained after controlling for age and body mass index (F = 6.3, p = 0.01). A relationship between superoxide dismutase concentrations and executive non-perseveration errors in the Wisconsin Card Sorting Test (F = 7.9; p = 0.01) was also observed. CONCLUSIONS: Decreased levels of antioxidants and lower performance on the neuropsychological tasks were observed in patients with obstructive sleep apnea. This study suggests that an imbalance between antioxidants and pro-oxidants may contribute to neuropsychological alterations in this patient population. KEYWORDS: Sleep Apnea; Neuropsychological Tests; Oxidative Stress; Vitamin E; Superoxide Dismutase. Sales LV, Bruin VM, D’Almeida V, Pompe´ia S, Bueno OF, Tufik S, et al. Cognition and biomarkers of oxidative stress in obstructive sleep apnea. Clinics. 2013;68(4):449-455. Received for publication on August 11, 2012; First review completed on September 7, 2012; Accepted for publication on December 4, 2012 E-mail: lia.rita@unifesp.br Tel.: 55 11 5539-0155

functioning (7). A decline has been reported in particular cognitive domains, such as attention, long-term episodic memory and working memory/executive function (8-11). Given the complexity of this subject and the potential interactions, a multi-compartment model of working memory has been proposed (12,13). Although intermittent hypoxemia and frequent arousals, either individually or in combination, are involved in these cognitive alterations, the pathophysiology of the neuropsychological deficits has not yet been completely determined (14,15). The relationship between cognitive dysfunction and oxidative stress has not been extensively investigated, although higher levels of oxidative stress biomarkers have been linked to increased cardiovascular morbidity in OSA individuals (16). However, controversy remains regarding the best marker of oxidative stress. High levels of certain biomarkers, including lipid peroxidation products (17), homocysteine (18), 8–hydroxy-2’-deoxyguanosine in urine (19) and interleukin 10 or TNF-alpha in exhaled air (20), have been reported. Higher-than-normal levels of plasma homocysteine, which is an indirect marker of oxidative

& INTRODUCTION Obstructive sleep apnea (OSA) is characterized by recurrent episodes of either total or partial obstruction of the upper airway during sleep, which leads to intermittent hypoxemia, transitory hypercapnia and frequent arousals (1). In addition to cardiovascular morbidity, OSA is associated with a wide spectrum of cognitive symptoms, from mild attention deficits to severe daytime sleepiness (2,3). Several studies have confirmed the presence of neuropsychological alterations in OSA patients (4-6). OSA has a profound impact on psychomotor functioning and cognitive domains, such as attention, memory and executive

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)03

449


Oxidative stress and cognition in sleep apnea Sales LV et al.

CLINICS 2013;68(4):449-455

stress, have been detected in OSA patients (21). Christou et al. provided further evidence showing that patients with severe OSA have a reduced antioxidant capacity (22). Other studies have indicated that continuous positive airway pressure (CPAP) therapy diminishes plasma oxidative stress (23,24). However, few studies have examined a wider array of antioxidant biomarkers as surrogate measures of oxidative stress in OSA patients. Preliminary evidence indicates that folic acid and vitamin B12 have anti-apoptotic efficacy and the ability to preserve mitochondrial function (25). Furthermore, vitamin B11 deficiency has been associated with elevated concentrations of homocysteine in the plasma of elderly non-demented patients (26,27). High vitamin B11 (plasma folate) concentrations have been associated with improved global cognitive function (26). However, the association between homocysteinemia and decreased cognition was only observed in participants with low folate levels (28), which suggests potential interplay between these factors. Recently, Singh et al. (2009) determined that both CPAP treatment and antioxidant treatment (oral vitamin E and C) reduced oxidative stress in OSA patients (29). Despite these findings, a relationship between antioxidant biomarkers and cognitive impairment has not been established in OSA patients. The aim of this study was to investigate neuropsychological performance and oxidative stress biomarkers in OSA patients and to evaluate the relationship between these factors.

examination; ear, nose and throat exam; electrocardiography (ECG) and polysomnography. Sleep complaints were evaluated using a questionnaire that had been adapted for local use, daytime sleepiness was evaluated using the Epworth Sleepiness Scale (ESS) (36) and depressive symptoms were evaluated using the Beck Depression Inventory (30,31). The neuropsychological test battery included measures of various different cognitive functions. Blood samples were collected to assay oxidative stress biomarkers.

Polysomnography The recorded parameters included the following: electroencephalogram, electrooculogram, electromyogram (submentonian region and tibialis anterior muscle), electrocardiogram, air flow (recorded by a nasal pressure cannula and a buccal thermistor), respiratory effort by abdominal and thoracic movement (inductance plethysmography), body position, oximetry and snoring (Sonolab MeditronH). The sleep stage scoring (32), respiratory patterns (1), arousals (33) and periodic leg movements were analyzed according to international criteria (34).

Neuropsychological Tests Classical psychometric tests adapted for local use were selected to assess attention, various subcomponents of working memory (including executive functions) and episodic memory. Testing was carried out at approximately 10:00 AM during two sessions that lasted approximately 45 minutes each. The neuropsychological measures were investigated using the Toulouse-Pie´ron Attention Test (35,36), the Wisconsin Card Sorting Test (WCST) for executive functions (37,38), the Digit Symbol Substitution Test (39) for the processing of visual figures, the forward Digit Span measuring the functioning of phonological storage within working memory and the backward Digit Span evaluating executive functions. Other tests included the Similarities Test to evaluate abstract verbal reasoning, the Logical Memory and Verbal Paired Association Tests to evaluate episodic memory (immediate recall short-term verbal memory) and long-term memory (delayed recall long-term verbal memory) (13), and the immediate and delayed recall of the Rey-Osterrieth Complex Figure Test (40,41) to evaluate short- and long-term visual non-verbal memory, respectively, as well as planning and perceptual organization.

& MATERIAL AND METHODS Study Design and Subjects All of the subjects were clinically evaluated, underwent neuropsychological tests and polysomnography and had blood samples taken in the morning. The study was approved by the Ethics Committee for Research of the Hospital Sa˜o Paulo-UNIFESP (# CEP 1266/03), and all of the participants provided written informed consent. The male patients were consecutively recruited at the Sleep Institute of Sa˜o Paulo. The inclusion criteria included an age between 25 to 65 years, a body mass index (BMI) ,40 and a minimum of 11 years of formal education. All of the cases had confirmed clinical and polysomnographic diagnoses of OSA: apnea-hypopnea index (AHI) above 10 events/h (rather than 5) and at least one symptom or AHI above 15. The exclusion criteria included previous CPAP therapy, the presence of shift work, severe depression, endocrinopathies, (including dyslipidemia, diabetes, obesity or metabolic syndrome), arterial hypertension, anemia, AIDS, current acute myocardial failure or arrhythmia, history of neoplasia, and neurologic or psychiatric disease (including substance/alcohol abuse), as well as the use of hypnotics, neuroleptics, beta-blockers, anti-epileptics, antirheumatic medication, steroids and non-steroid anti-inflammatory drugs (NSAIDs), lipid reducers and vitamins. The control group was recruited from the relatives of patients and the employees of the Sleep Institute. The control subjects were matched according to age, sex, weight, scores on the Beck Depression Inventory (30) and years of education, and they were subject to the same inclusion and exclusion criteria as patients, except that they had no sleep disorders (confirmed by polysomnography). Clinical Assessment. Examination included measurement of weight, height and blood pressure; ectoscopy; neurological

Biomarkers of Oxidative Stress For the biochemical analyses, venous blood was collected in the morning, at approximately 8:00 AM after 12 hours of fasting. The red blood cells were washed and hemolyzed to assay the antioxidant enzymes and glutathione, whereas the plasma was used for the vitamin and amino acid assays. Two enzymatic antioxidants were assayed, i.e., superoxide dismutase (SOD) (42) and catalase (43), in addition to three other non-enzymatic antioxidants, i.e., glutathione (44) and vitamins B11 and B12 (45).

Statistical Analysis Descriptive statistics are presented as the mean¡standard deviation, range and frequency (% values). Fisher exact tests for categorical variables, the Mann-Whitney U test for continuous variables and Student’s t test for normally distributed data with equal variances were performed to compare the cases and controls. Linear regression analysis

450


CLINICS 2013;68(4):449-455

Oxidative stress and cognition in sleep apnea Sales LV et al.

years of schooling (.11 years), age (p = 0.62) and BMI (p = 0.12). As expected, the OSA patients presented more sleep complaints (UNIFESP sleep questionnaire) than the controls (p,0.001) and more daytime sleepiness (ESS, p,0.001). Excessive daytime sleepiness (ESS.10) was more frequent in the OSA patients than in the controls (78.6% vs 15.4%; p = 0.001). Depressive symptoms (according to the BDI) were similar between the cases and controls (p = 0.08). By definition, the cases presented higher values of AHI than the controls (p,0.001), as well as lower minimum oxygen saturation levels (SpO2 minimum) (p = 0.003) and an increased micro arousal index (p = 0.006) (Table 1).

Table 1 - Polysomnographic results (mean¡SD) in controls and patients with obstructive sleep apnea. Controls (N = 13) Clinical data and questionnaires Age (years) 36.0¡6.1 26.9¡2.9 Body mass index 2 (Kg/m ) BDI scores 0.9¡1.7 ESS scores 1.4¡0.5 Polysomnography measures Sleep efficiency 87.3¡8.2 S1 (%TTS) 3.2¡1.6 S2 (%TTS) 59.3¡6.5 S3 (%TTS) 15.1¡4.5 REM (%TTS) 22.4¡3.3 Arousals/h 7.7¡3.4 AHI 1.9¡1.5 Minimum SpO2 (%) 88.8¡2.6 Student’s t test *p,0.05;

**

Patients (N = 14)

37.2¡6.9 28.8¡3.3 2.4¡2.5 9.6¡6.1 87.8¡8* 6.6¡5.1* 63.8¡11.3* 11.3¡7.3* 18.3¡8.6* 37.9¡36.9 ** 36.4¡28.8 ** 78.0¡11.9 **

p-value

0.61 0.13 0.08 ,0.005** 0.89

Neuropsychological Tests The patients performed worse in the classical attention test (Toulouse-Pie´ron), with significantly more errors (p,0.02). Working memory was also significantly impaired in the patients with regard to retention of the episodic buffer (Logical Memory A+B immediate recollection, p,0.04; Rey Immediate Recall, p,0.001) and executive measures (backward digit span, p = 0.006; similarities, p,0.005; perseveration errors in the WCST, p,0.04). The patients also showed worse verbal memory performance according to the Logical Memory Delayed Recollection (A+B, p,0.05) and the verbal paired associates delayed recollection (easy plus difficult, p,0.02). Furthermore, reduced values were observed on the Rey Figure Delayed Recall, which is a long-term non-verbal memory test (p,0.001) (Table 2).

,0.005**

p,0.01.

was used to examine the relationship between scores of neuropsychological tests (dependent variables) and the levels of biomarkers for oxidative stress. Posterior adjustments for age and BMI were performed. The level of significance was set at p,0.05. Analyses were conducted using the Statistical Package for Social Sciences V16.0 [SPSS Inc., Chicago, IL, USA].

& RESULTS

Antioxidant and Pro-Oxidative Stress Markers in Patients and Controls. The patients presented lower levels of vita-

In total, 32 out of 63 consecutively evaluated OSA patients from an outpatient sleep disorder clinic met the inclusion requirements. Of these 32 patients, 18 were initially recruited; the remaining 14 cases were excluded because the presence of shift work (N = 4), the use of medication (NSAIDs and vitamins, N = 1), the presence of arterial hypertension (N = 1), high scores on the Beck Depression Inventory (N = 5), refusal of neuropsychological testing (N = 3) or refusal to participate without a specific reason (N = 4). Fourteen patients who met the eligibility requirements and 13 controls were studied. Thirteen controls were included. The cases and controls were similar with regard to

min E (p,0.006), SOD (p,0.001) and vitamin B11 (p,0.001), as well as higher levels of homocysteine (p,0.02). Serum concentrations of vitamin C, catalase, glutathione and vitamin B12 were equivalent and within the normal range (Table 3). Correlations between Oxidative Stress Markers and Neuropsychological Test Scores. Comparisons between

levels of oxidative stress markers and neuropsychological results revealed a correlation between serum concentrations of vitamin E and the results of the backward digit span task (r = 0.76; p = 0.002) in the OSA patients (Figure 1); a similar

Table 2 - Neuropsychological test results (mean¡SEM) in the controls and patients with obstructive sleep apnea. Neuropsychological Tests Toulouse-Pie´ron Correct Answers Toulouse-Pie´ron Errors Digit Symbol Forward Digit Span Backward Digit Span Similarities Logical Memory–R I (A+B) Logic Memory–R T (A+B) Verbal PA–1st Trial Verbal PA–2nd Trial Verbal PA–3rd Trial Verbal Recollection P A Rey Figure–Copy Rey Figure-R I Rey Figure-R T Perseverative Errors Failure in Keeping the Set

Controls (N = 13)

Patients (N = 14)

p-value

161.6¡40.7 0.07¡0.3 55.53¡13.1 5.85¡1.1 5.15¡0.9 24.77¡1.6 32.54¡4.7 29.92¡4.2 5.07¡1.7 6.4¡1.5 7.3¡0.8 7.3¡0.8 34.4¡1.8 29.5¡2.9 29.7¡3.6 2.2¡5.1 0.41¡0.9

132.8¡29.2 0.68¡0.7 51.7¡12.7 5.8¡0.7 4.07¡1.0 21.0¡4.0 27.2¡7.1 25.0¡7.1 4.5¡1.5 6.1¡1.4 6.7¡1 5.7¡1.5 33.7¡2.6 24.0¡4.2 22.3¡5.4 6.07¡3.8 2.1¡3.3

0.05 0.01* 0.44 0.97 0.006 0.004** 0.03* 0.04* 0.36 0.56 0.12 0.001** 0.39 ,0.001** ,0.001** 0.03 0.09

PA = Paired-Associated; IR = Immediate Recall; LR = Late Recall. Mann-Whitney Test *p,0.05 **p,0.01.

451


Oxidative stress and cognition in sleep apnea Sales LV et al.

CLINICS 2013;68(4):449-455

Table 3 - Oxidative stress parameters (mean¡SD) in the controls and patients with obstructive sleep apnea. Oxidative stress parameters

Controls (N = 13)

Non-enzymatic antioxidant markers Vitamin E mmol/L 19.1¡6.7 Vitamin C mmol/L 46.7¡14.5 Glutathione mmol/g Hb 7.8¡1.7 Enzymatic antioxidant markers SOD U/mgHb 14.4¡2.3 Catalase U/mgHb 11¡40 Homocysteine and related vitamins Homocysteine u/M 10.7¡2.9 Vitamin B11 ng/ml 9.3¡2.8 480¡111

Patients (N = 14)

p-value

12.8¡3.6 49.2¡12.7 7.3¡3.8

0.005** 0.63 0.70

10¡2.9 99¡26

,0.001** 0.90

16.7¡8.0 4.8¡2.3 464¡184

0.02* ,0.001** 0.79

SOD = superoxide dismutase. Student’s t test *p#0.05 **p,0.01.

Figure 2 - Superoxide dismutase concentrations are positively correlated with nonperseverative errors in the Wisconsin Card Sorting Test in obstructive sleep apnea patients (r = 0.63, p = 0.01).

correlation was not observed in the controls (r = 0.23; p = 0.43). A correlation was observed between the SOD concentration and the executive non-perseveration errors on the WCST in the OSA patients (r = 0.63; p = 0.01) (Figure 2); a similar correlation was not observed in the controls (r = -0.44; p = 0.10). The correlation between vitamin E levels and the backward digit span task remained after controlling for age and BMI (r = 0.69; p = 0.009), as did the correlation between SOD levels and WCST scores (r = 0.63, p = 0.02). No correlations were found among the other oxidative stress parameters, the neuropsychological results and the polysomnographic variables in the OSA patients and in the controls.

cerebrovascular disease and endothelial dysfunction (7). To address this issue, this study considered matched groups of patients and controls, so that the only difference across the groups was a high or low apnea index. It should also be noted that the present study did not find a correlation between neuropsychological results and polysomnographic measures, including oxygen desaturation and/or sleep fragmentation. To date, various cognitive deficits have been identified in OSA patients. Deficits in attention, vigilance, memory and executive function have all been described. Attempts to explain these alterations have been made using both animal models and patients with OSA. Gozal et al. studied young adult rats and examined the effects of fluctuating ambient oxygenation on learning and neuronal health (46). Based on their results, a model was proposed for a conceptual framework. In this model, sleep fragmentation and/or intermittent hypoxemia and hypercarbia disrupt the restorative features of sleep and consequently disrupt cellular or chemical homeostasis (47). All of these disturbances induce cellular and biochemical stress. Oxidative stress (48), apoptosisrelated neural injury, reduced expression of brain-derived neurotrophic factor (BDNF) (49) and molecular alterations (50) have been described in association with neural injury in OSA (51). Consequently, alterations of the cerebral cortex, particularly the pre-frontal cortex, and cognitive dysfunction occur. Neuroimaging studies have confirmed the involvement of the pre-frontal cortex in OSA (52). These alterations have been shown to improve with treatment (53). In addition, recent studies showed that young children with sleep apnea may also undergo neuronal loss and cognitive impairments (54). Controversy remains regarding the role of hypoxia in cerebral changes related to OSA. For example, most animal models have used fluctuating ambient oxygen patterns to reproduce the chronic intermittent hypoxia associated with OSA. Therefore, the observed brain alterations could merely be secondary to cerebral hypoxia. In contrast to this explanation, sleep fragmentation was recently shown to have an impact on both brain-specific alterations and general metabolism (55). Furthermore, Thomas et al. examined OSA patients using functional magnetic resonance imaging and demonstrated a lower level of activation of the prefrontal

& DISCUSSION The present study, which evaluated a wide range of oxidative stress biomarkers, confirms that oxidative stress is critically elevated in OSA patients. The present study also substantiates an important role for vitamin E and SOD, as it demonstrates a relationship between these antioxidants and neuropsychological performance. It should be noted that the association between OSA and cognitive impairment is complicated by numerous comorbidities, including aging, obesity, genetic factors, hypoxemia, daytime somnolence,

Figure 1 - Serum concentrations of vitamin E are positively correlated with backward digit span task results in obstructive sleep apnea patients (r = 0.75, p = 0.002).

452


CLINICS 2013;68(4):449-455

Oxidative stress and cognition in sleep apnea Sales LV et al.

found that SOD concentrations were within normal levels in these patients (67). These discrepancies in SOD findings may be the result of methodological differences. Although the current study measured SOD values in erythrocytes, Schulz et al. (2000) analyzed neutrophils (66). Furthermore, other factors (such as age) are known to influence antioxidant measurements. In this study, we observed an increase in homocysteine and a reduction of vitamin B11 but not B12, both of which play fundamental roles in homocysteine metabolism. The vitamin B11 reduction was accompanied by augmented plasma concentrations of homocysteine, as expected (28). Our data are in agreement with another study showing increased homocysteine levels in OSA patients (68). In the present study, blood was obtained from individuals in the morning, at a time when homocysteine concentrations are usually low, and yet concentrations of homocysteine were elevated beyond the normal range. Some limitations to this study must be acknowledged. This study was an observational cross-sectional evaluation, and a cause/effect relationship among neuropsychological dysfunction, vitamin E and SOD cannot be established. The present evidence is important because it has potential implications for future therapies; however, these data only provide initial evidence, and more experiments to assess the relationship between antioxidants and neuropsychological tests in OSA patients are warranted. In this study, a wide sample of neuropsychological tests and several antioxidant biomarkers was examined. It should be noted that all of the study subjects were male, and the results may not be generalized to women. These results are unique and have not been previously shown. The evidence described here could be corroborated by prospectively studying the effects of administering vitamin E and other antioxidants on neuropsychological test scores in OSA patients. In conclusion, decreased levels of antioxidants were observed in OSA patients. This study raises the possibility that an imbalance between antioxidants and pro-oxidants may contribute to the neuropsychological alterations observed in OSA patients. To the best of our knowledge, this is the first clinical investigation to relate neuropsychological alterations to oxidative stress biomarkers in OSA.

cortex while performing a working memory task that was similar in hypoxic and nonhypoxic subjects, which indicates that hypoxia does not influence the cortical dysfunction observed in sleep apnea (56). Previous studies of the effects of vitamin E on cognition and the role of inflammation and oxidative stress in OSA are controversial. Recently, an uncontrolled study of 20 patients receiving CPAP therapy found that antioxidant intake improved the quality of sleep (29). In addition, CPAP has been reported to improve airway inflammation and oxidative stress (57). Dietary intake of v-3 PUFA has been associated with lower plasma levels of Ab42, and this pattern has also been linked with a reduced risk of incident Alzheimer’s disease and slower cognitive decline (58). In contradiction to these findings, a metanalysis has shown a lack of evidence for the efficacy of vitamin E in the prevention or treatment of dementia (59). Similar to our findings, increased oxidative stress in the hippocampus and cognitive impairment were previously associated with sleep deprivation and the Western diet (60), which indicates that oxidative stress may present an additional risk factor for the complex cognitive impairment in OSA. It should be noted that despite the obvious relationship between neuropsychological testing and cognitive function, neuropsychological evaluations describe performance that is not necessarily related to reduced cognition or dementia. In other words, neuropsychological tests should be considered to reflect a cerebral functional state rather than an established brain alteration. As an example of intermittent alterations, studies of seals have recently demonstrated increased levels of endogenous antioxidants to counteract noxious intermittent hypoxemia and chronic cycles of ischemia/reperfusion (61). OSA patients are continuously exposed to intermittent hypoxemia and chronic cycles of ischemia/reperfusion. Thus, it is possible that the adaptive mechanisms observed in seals are species-specific. Other studies may help to corroborate these findings. This study confirms previous data showing compromised performance in specific neuropsychological tests, particularly in tests measuring attention and memory. Most of previous studies did not examine a wide range of neuropsychological tests. It has recently been noted that relatively little research has specifically examined the influence of OSA on intellectual function (3). Furthermore, in the present study, subjective somnolence was observed in 85% of patients, which agrees with previous studies estimating that 80% of OSA patients present excessive daytime somnolence or some other cognitive alteration (62). Regarding simple attention, a higher number of errors was observed in the Toulouse-Pie´ron test, which supports a previous report of a significant reduction in attention on various tests (63). Detrimental effects were also observed in episodic and working memory, which corroborates previous findings that these cognitive domains are impaired in OSA patients (64). With regard to oxidative stress markers, a reduction in the blood concentration of vitamin E was observed, which agrees with the findings in a previous report (65). With regard to enzymatic antioxidants, the OSA patients exhibited a decrease in SOD, which is the first enzyme of the antioxidizing pathway and may represent an oxidant signal. A previous study showed that fMLP-stimulated superoxide release was markedly increased in OSA patients when compared to a control group (66). However, another study

& ACKNOWLEDGMENTS This work was supported in part by the AFIP, FAPESP/CEPID and MCT/CNPq.

& AUTHOR CONTRIBUTIONS Sales LV was responsible for the study design and evaluation, and the collection of clinical data. Bruin VM contributed to the data analysis, manuscript writing and critical review. D’Almeida V was responsible for the biochemical measurements and contributed to the data collection and analysis. Pompeia S contributed to the psychological test design and analysis. Bueno OF contributed to the psychological test design, analysis and critical review. Tufik S contributed to the study design, evaluation and critical review. Bittencourt LR contributed to the study design, analysis, manuscript writing and critical review.

& REFERENCES 1. Sleep-related breathing disorders in adults: recommendations for syndrome definition and measurement techniques in clinical research. The Report of an American Academy of Sleep Medicine Task Force. Sleep. 1999;22(5):667-89.

453


Oxidative stress and cognition in sleep apnea Sales LV et al.

CLINICS 2013;68(4):449-455

25. Majumdar S, Maiti A, Karmakar S, Sekhar Das A, Mukherjee S, Das D, et al. Antiapoptotic efficacy of folic acid and vitamin B(12) against arsenic-induced toxicity. Environ Toxicol. 2012;27(6):351-63, http://dx. doi.org/10.1002/tox.20648. 26. de Lau LM, Refsum H, Smith AD, Johnston C, Breteler MM. Plasma folate concentration and cognitive performance: Rotterdam Scan Study. Am J Clin Nutr. 2007;86(3):728-34. 27. Pfeiffer CM, Caudill SP, Gunter EW, Osterloh J, Sampson EJ. Biochemical indicators of B vitamin status in the US population after folic acid fortification: results from the National Health and Nutrition Examination Survey 1999-2000. Am J Clin Nutr. 2005;82(2):442-50. 28. Vidal JS, Dufouil C, Ducros V, Tzourio C. Homocysteine, folate and cognition in a large community-based sample of elderly people--the 3C Dijon Study. Neuroepidemiology. 2008;30(4):207-14, http://dx.doi.org/ 10.1159/000126914. 29. Singh TD, Patial K, Vijayan VK, Ravi K. Oxidative stress and obstructive sleep apnoea syndrome. Indian J Chest Dis Allied Sci. 2009 Oct-Dec; 51(4):217-24. 30. Beck AT, Steer RA. Internal consistencies of the original and revised Beck Depression Inventory. J Clin Psychol. 1984;40(6):1365-7, http://dx.doi. org/10.1002/1097-4679(198411)40:6,1365::AID-JCLP2270400615.3.0.CO; 2-D. 31. Gorenstein C, Pompeia S, Andrade L. Scores of Brazilian University students on the Beck Depression and the State Trait Anxiety Inventories. Psychol Rep. 1995;77(2):635-41, http://dx.doi.org/10.2466/pr0.1995.77.2. 635. 32. Rechtschaffen A, Kales A. A Manual of Standardized Terminology, Techniques and Scoring System for Sleep Stages of Human Subjects. US Department of Health, Education and Welfare Public Health Service. Health NIo, editor. Bethesda 1968. 33. EEG arousals: scoring rules and examples: a preliminary report from the Sleep Disorders Atlas Task Force of the American Sleep Disorders Association. Sleep. 1992;15(2):173-84. 34. Recording and scoring leg movements. The Atlas Task Force. Sleep. 1993;16(8):748-59. 35. Montiel J, Figueiredo E, Lustosa D, Dias N. Evideˆncia de validade para o Teste de Atenc¸a˜o Concentrada Toulouse-Pie´ron no contexto de traˆnsito. Psicologia: Pesquisa & Traˆnsito. 2006;2:19-27. 36. Lazzeroni V. [Experimental research on the application of the ToulousePieron test to the study of distributed attention]. Atti Accad Fisiocrit Siena Med Fis. 1954;1:116-31. 37. Salorio CF, White DA, Piccirillo J, Duntley SP, Uhles ML. Learning, memory, and executive control in individuals with obstructive sleep apnea syndrome. J Clin Exp Neuropsychol. 2002;24(1):93-100, http://dx. doi.org/10.1076/jcen.24.1.93.973. 38. Ingram F, Greve KW, Ingram PT, Soukup VM. Temporal stability of the Wisconsin Card Sorting Test in an untreated patient sample. Br J Clin Psychol. 1999;38 (Pt 2):209-11. 39. Wechsler D. WAlS-R: manual. San Antonio: The Psychological Corporation, 1981. 40. Poulton RG, Moffitt TE. The Rey-Osterreith Complex Figure Test: norms for young adolescents and an examination of validity. Arch Clin Neuropsychol. 1995;10(1):47-56. 41. Beebe DW, Wells CT, Jeffries J, Chini B, Kalra M, Amin R. Neuropsychological effects of pediatric obstructive sleep apnea. J Int Neuropsychol Soc. 2004;10(7):962-75. 42. McCord JM, Fridovich I. The utility of superoxide dismutase in studying free radical reactions. I. Radicals generated by the interaction of sulfite, dimethyl sulfoxide, and oxygen. J Biol Chem. 1969 25;244(22):6056-63. 43. Adamo AM, Llesuy SF, Pasquini JM, Boveris A. Brain chemiluminescence and oxidative stress in hyperthyroid rats. Biochem J. 1989; 263(1):273-7. 44. Tietze F. Enzymic method for quantitative determination of nanogram amounts of total and oxidized glutathione: applications to mammalian blood and other tissues. Anal Biochem. 1969;27(3):502-22, http://dx.doi. org/10.1016/0003-2697(69)90064-5. 45. Sharma SK, Dakshinamurti K. Determination of vitamin B6 vitamers and pyridoxic acid in biological samples. J Chromatogr. 1992;578(1):45-51, http://dx.doi.org/10.1016/0378-4347(92)80223-D. 46. Gozal D, Daniel JM, Dohanich GP. Behavioral and anatomical correlates of chronic episodic hypoxia during sleep in the rat. J Neurosci. 2001; 21(7):2442-50. 47. Beebe DW, Gozal D. Obstructive sleep apnea and the prefrontal cortex: towards a comprehensive model linking nocturnal upper airway obstruction to daytime cognitive and behavioral deficits. J Sleep Res. 2002;11(1):1-16, http://dx.doi.org/10.1046/j.1365-2869.2002.00289.x. 48. Nair D, Dayyat EA, Zhang SX, Wang Y, Gozal D. Intermittent hypoxiainduced cognitive deficits are mediated by NADPH oxidase activity in a murine model of sleep apnea. PLoS One. 2011;6(5):e19847, http://dx.doi. org/10.1371/journal.pone.0019847. 49. Xie H, Yung WH. Chronic intermittent hypoxia-induced deficits in synaptic plasticity and neurocognitive functions: a role for brain-derived neurotrophic factor. Acta Pharmacol Sin. 2012;33(1):5-10, http://dx.doi. org/10.1038/aps.2011.184.

2. Spruyt K, Gozal D. A mediation model linking body weight, cognition, and sleep-disordered breathing. Am J Respir Crit Care Med. 2012;185(2):199-205, http://dx.doi.org/10.1164/rccm.201104-0721OC. 3. Kielb SA, Ancoli-Israel S, Rebok GW, Spira AP. Cognition in Obstructive Sleep Apnea-Hypopnea Syndrome (OSAS): Current Clinical Knowledge and the Impact of Treatment. Neuromolecular Med. 2012;14(3):180-93, http://dx.doi.org/10.1007/s12017-012-8182-1. 4. Liukkonen K, Virkkula P, Haavisto A, Suomalainen A, Aronen ET, Pitkaranta A, et al. Symptoms at presentation in children with sleeprelated disorders. Int J Pediatr Otorhinolaryngol. 2012;76(3):327-33, http://dx.doi.org/10.1016/j.ijporl.2011.12.002. 5. Kim HC, Young T, Matthews CG, Weber SM, Woodward AR, Palta M. Sleep-disordered breathing and neuropsychological deficits. A population-based study. Am J Respir Crit Care Med. 1997;156(6): 1813-9. 6. Engleman HM, Kingshott RN, Martin SE, Douglas NJ. Cognitive function in the sleep apnea/hypopnea syndrome (SAHS). Sleep. 2000 15;23 Suppl 4:S102-8. 7. Lal C, Strange C, Bachman D. Neurocognitive impairment in obstructive sleep apnea. Chest. 2012;141(6):1601-10, http://dx.doi.org/10.1378/ chest.11-2214. 8. Naegele B, Launois SH, Mazza S, Feuerstein C, Pepin JL, Levy P. Which memory processes are affected in patients with obstructive sleep apnea? An evaluation of 3 types of memory. Sleep. 2006;29(4):533-44. 9. Daurat A, Foret J, Bret-Dibat JL, Fureix C, Tiberge M. Spatial and temporal memories are affected by sleep fragmentation in obstructive sleep apnea syndrome. J Clin Exp Neuropsychol. 2008;30(1):91-101, http://dx.doi.org/10.1080/13803390701236116. 10. Yaouhi K, Bertran F, Clochon P, Mezenge F, Denise P, Foret J, et al. A combined neuropsychological and brain imaging study of obstructive sleep apnea. J Sleep Res. 2009;18(1):36-48, http://dx.doi.org/10.1111/j. 1365-2869.2008.00705.x. 11. Twigg GL, Papaioannou I, Jackson M, Ghiassi R, Shaikh Z, Jaye J, et al. Obstructive sleep apnea syndrome is associated with deficits in verbal but not visual memory. Am J Respir Crit Care Med. 2010;182(1):98-103, http://dx.doi.org/10.1164/rccm.200901-0065OC. 12. Baddeley A. The episodic buffer: a new component of working memory? Trends Cogn Sci. 2000;4(11):417-23, http://dx.doi.org/10.1016/S13646613(00)01538-2. 13. Baddeley AD, Andrade J. Working memory and the vividness of imagery. J Exp Psychol Gen. 2000;129(1):126-45, http://dx.doi.org/10. 1037/0096-3445.129.1.126. 14. Canessa N, Castronovo V, Cappa SF, Aloia MS, Marelli S, Falini A, et al. Obstructive Sleep Apnea: Brain Structural Changes and Neurocognitive Function Before and After Treatment. Am J Respir Crit Care Med. 2011;183(10):1419-26, http://dx.doi.org/10.1164/rccm.201005-0693OC. 15. Torelli F, Moscufo N, Garreffa G, Placidi F, Romigi A, Zannino S, et al. Cognitive profile and brain morphological changes in obstructive sleep apnea. Neuroimage. 2011;54(2):787-93, http://dx.doi.org/10.1016/j. neuroimage.2010.09.065. 16. Feng J, Zhang D, Chen B. Endothelial mechanisms of endothelial dysfunction in patients with obstructive sleep apnea. Sleep Breath. 2012;16(2):283-94, http://dx.doi.org/10.1007/s11325-011-0519-8. 17. Franco CM, Lima AM, Ataide L, Jr., Lins OG, Castro CM, Bezerra AA, et al. Obstructive Sleep Apnea Severity Correlates with Cellular and Plasma Oxidative Stress Parameters and Affective Symptoms. 2012;47(2):300-10. 18. Monneret D, Tamisier R, Ducros V, Garrel C, Levy P, Baguet JP, et al. The impact of obstructive sleep apnea on homocysteine and carotid remodeling in metabolic syndrome. Respir Physiol Neurobiol. 2012;180(2-3):298-304, http://dx.doi.org/10.1016/j.resp.2011.12.009. 19. Yamauchi M, Nakano H, Maekawa J, Okamoto Y, Ohnishi Y, Suzuki T, et al. Oxidative stress in obstructive sleep apnea. Chest. 2005;127(5):16749, http://dx.doi.org/10.1378/chest.127.5.1674. 20. Li Y, Chongsuvivatwong V, Geater A, Liu A. Exhaled breath condensate cytokine level as a diagnostic tool for obstructive sleep apnea syndrome. Sleep Med. 2009;10(1):95-103, http://dx.doi.org/10.1016/j.sleep.2007.11. 013. 21. Jordan W, Berger C, Cohrs S, Rodenbeck A, Mayer G, Niedmann PD, et al. CPAP-therapy effectively lowers serum homocysteine in obstructive sleep apnea syndrome. J Neural Transm. 2004;111(6):683-9. 22. Christou K, Markoulis N, Moulas AN, Pastaka C, Gourgoulianis KI. Reactive oxygen metabolites (ROMs) as an index of oxidative stress in obstructive sleep apnea patients. Sleep Breath. 2003;7(3):105-10, http:// dx.doi.org/10.1007/s11325-003-0105-9. 23. Oyama J, Yamamoto H, Maeda T, Ito A, Node K, Makino N. Continuous positive airway pressure therapy improves vascular dysfunction and decreases oxidative stress in patients with the metabolic syndrome and obstructive sleep apnea syndrome. Clin Cardiol. 2012;35(4):231-6, http:// dx.doi.org/10.1002/clc.21010. 24. Celec P, Hodosy J, Behuliak M, Palffy R, Gardlik R, Halcak L, et al. Oxidative and carbonyl stress in patients with obstructive sleep apnea treated with continuous positive airway pressure. Sleep Breath. 2012;16(2):393-8, http://dx.doi.org/10.1007/s11325-011-0510-4.

454


CLINICS 2013;68(4):449-455

Oxidative stress and cognition in sleep apnea Sales LV et al.

50. Row BW. Intermittent hypoxia and cognitive function: implications from chronic animal models. Adv Exp Med Biol. 2007;618:51-67, http://dx. doi.org/10.1007/978-0-387-75434-5_5. 51. Dempsey JA, Veasey SC, Morgan BJ, O’Donnell CP. Pathophysiology of sleep apnea. Physiol Rev. 2010;90(1):47-112, http://dx.doi.org/10.1152/ physrev.00043.2008. 52. Zhang X, Ma L, Li S, Wang Y, Wang L. A functional MRI evaluation of frontal dysfunction in patients with severe obstructive sleep apnea. Sleep Med. 2011;12(4):335-40, http://dx.doi.org/10.1016/j.sleep.2010.08.015. 53. Canessa N, Castronovo V, Cappa SF, Aloia MS, Marelli S, Falini A, et al. Obstructive sleep apnea: brain structural changes and neurocognitive function before and after treatment. Am J Respir Crit Care Med. 2011; 183(10):1419-26, http://dx.doi.org/10.1164/rccm.201005-0693OC. 54. Halbower AC, Degaonkar M, Barker PB, Earley CJ, Marcus CL, Smith PL, et al. Childhood obstructive sleep apnea associates with neuropsychological deficits and neuronal brain injury. PLoS Med. 2006;3(8):e301, http://dx.doi.org/10.1371/journal.pmed.0030301. 55. Baud MO, Magistretti PJ, Petit JM. Sustained sleep fragmentation affects brain temperature, food intake and glucose tolerance in mice. J Sleep Res. 2012 26. 56. Thomas RJ, Rosen BR, Stern CE, Weiss JW, Kwong KK. Functional imaging of working memory in obstructive sleep-disordered breathing. J Appl Physiol. 2005;98(6):2226-34, http://dx.doi.org/10.1152/japplphysiol.01225. 2004. 57. Petrosyan M, Perraki E, Simoes D, Koutsourelakis I, Vagiakis E, Roussos C, et al. Exhaled breath markers in patients with obstructive sleep apnoea. Sleep Breath. 2008;12(3):207-15, http://dx.doi.org/10.1007/ s11325-007-0160-8. 58. Gu Y, Schupf N, Cosentino SA, Luchsinger JA, Scarmeas N. Nutrient intake and plasma beta-amyloid. Neurology. 2012;78(23):1832-40, http:// dx.doi.org/10.1212/WNL.0b013e318258f7c2 59. Isaac MG, Quinn R, Tabet N. Vitamin E for Alzheimer’s disease and mild cognitive impairment. Cochrane Database Syst Rev. 2008(3):CD002854. 60. Alzoubi KH, Khabour OF, Salah HA, Abu Rashid BE. The Combined Effect of Sleep Deprivation and Western Diet on Spatial Learning and

61.

62.

63.

64.

65.

66.

67.

68.

455

Memory: Role of BDNF and Oxidative Stress. J Mol Neurosci. 2012 10.1007/s12031-012-9881-7 [Epub ahead of print]. Vazquez-Medina JP, Zenteno-Savin T, Elsner R, Ortiz RM. Coping with physiological oxidative stress: a review of antioxidant strategies in seals. J Comp Physiol B. 2012;182(6):741-50. Weaver TE, Maislin G, Dinges DF, Bloxham T, George CF, Greenberg H, et al. Relationship between hours of CPAP use and achieving normal levels of sleepiness and daily functioning. Sleep. 2007;30(6):711-9. Ferini-Strambi L, Baietto C, Di Gioia MR, Castaldi P, Castronovo C, Zucconi M, et al. Cognitive dysfunction in patients with obstructive sleep apnea (OSA): partial reversibility after continuous positive airway pressure (CPAP). Brain Res Bull. 2003;61(1):87-92, http://dx.doi.org/ 10.1016/S0361-9230(03)00068-6. Naegele B, Pepin JL, Levy P, Bonnet C, Pellat J, Feuerstein C. Cognitive executive dysfunction in patients with obstructive sleep apnea syndrome (OSAS) after CPAP treatment. Sleep. 1998;21(4):392-7. Barcelo A, Barbe F, de la Pena M, Vila M, Perez G, Pierola J, et al. Antioxidant status in patients with sleep apnoea and impact of continuous positive airway pressure treatment. Eur Respir J. 2006;27(4):756-60, http://dx.doi.org/10.1183/09031936.06.00067605. Schulz R, Mahmoudi S, Hattar K, Sibelius U, Olschewski H, Mayer K, et al. Enhanced release of superoxide from polymorphonuclear neutrophils in obstructive sleep apnea. Impact of continuous positive airway pressure therapy. Am J Respir Crit Care Med. 2000;162(2 Pt 1):566-70. Alzoghaibi MA, Bahammam AS. Lipid peroxides, superoxide dismutase and circulating IL-8 and GCP-2 in patients with severe obstructive sleep apnea: a pilot study. Sleep Breath. 2005;9(3):119-26, http://dx.doi.org/ 10.1007/s11325-005-0022-1. Steiropoulos P, Tsara V, Nena E, Fitili C, Kataropoulou M, Froudarakis M, et al. Effect of continuous positive airway pressure treatment on serum cardiovascular risk factors in patients with obstructive sleep apnea-hypopnea syndrome. Chest. 2007;132(3):843-51, http://dx.doi. org/10.1378/chest.07-0074.


CLINICAL SCIENCE

Crohn’s disease activity assessed by doppler sonography: the role of aortic flow parameters Thais Guarana´ Andrade,I Homero Soares Fogac¸a,I Celeste Carvalho Siqueira Elia,I Melissa Tassano Pitrowsky,I Heitor Siffert Pereira de SouzaI,II I Universidade Federal do Rio de Janeiro, Hospital Universita´rio, Servic¸o de Gastroenterologia and Laborato´rio Multidisciplinar de Pesquisa, Rio de Janeiro/ RJ, Brazil. II Universidade Federal do Rio de Janeiro, Departamento de Clı´nica Me´dica, Rio de Janeiro/RJ, Brazil.

OBJECTIVES: Intestinal neovascularization and abnormal abdominal arterial flow rates have been reported in Crohn’s disease. The aim of this study was to evaluate Doppler sonography as a method for assessing Crohn’s disease activity based on changes in splanchnic hemodynamics. METHODS: Forty-eight patients with Crohn’s disease, 22 healthy volunteers and 12 patients with irritable bowel syndrome were evaluated by Doppler ultrasound for flow parameters of the aorta and superior mesenteric artery. This evaluation included the cross-sectional area, maximum flow volume, peak systolic velocity, end diastolic velocity, resistance and the pulsatility index. Disease activity was classified according to the Crohn’s disease activity index. RESULTS: Most measurements in the aorta and superior mesenteric artery were significantly different between Crohn’s disease patients and both control groups. Only the aortic maximum flow volume (CC = 0.37, p = 0.009) and aortic peak systolic velocity (CC = 0.30, p = 0.035) showed a significant positive correlation with the Crohn’s disease activity index. The determination of cut-off points for the aortic maximum flow volume and peak systolic velocity measurements increased the sensitivity (80 and 75% for flow volume and velocity, respectively), specificity (57 and 75%), accuracy (67 and 75%) and positive (57 and 68%) and negative (80 and 81%) predictive values. These cut-off values permitted the correct classification of most of the patients with Crohn’s disease with respect to disease activity. None of the superior mesenteric artery measurements were able to discriminate patients in relation to disease activity. CONCLUSION: The aortic maximum flow volume and peak systolic velocity levels estimated by Doppler sonography reflected disease activity in Crohn’s disease. Doppler sonography of the aorta is therefore a novel noninvasive adjunct method that may be useful in the clinical follow-up of patients with Crohn’s disease. KEYWORDS: Crohn’s disease; Doppler Sonography; Inflammatory Bowel Diseases; Splanchnic Hemodynamics. Andrade TG, Fogac¸a HS, Elia CCS, Pitrowsky MT, Souza HSP. Crohn’s disease activity assessed by doppler sonography: the role of aortic flow parameters. Clinics. 2013;68(4):457-462. Received for publication on October 10, 2012; First review completed on November 15, 2012; Accepted for publication on December 7, 2012 E-mail: hsouza@hucff.ufrj.br; heitor.souza@gmail.com Tel.: 55 21 2562-2669

therapy has become progressively more critical for individualized and optimized care, as the decision of whether and when to initiate novel therapies may alter the natural course of CD (4). Serial assessment of CD activity is regarded as a fundamental tool in the follow-up of patients and allows the identification of specific conditions that may influence clinical decisions. Several methods have been used to investigate CD activity, but there is no consensus reference method (5,6). Even the Crohn’s disease activity index (CDAI), which is the most used and cited reference method, has limitations because of the subjectivity of some of its criteria (7). Endoscopic methods are commonly used for the diagnosis and follow-up of CD patients; however, these methods are invasive, expose patients to some potential risks, usually require hospitalization, are expensive and still have some limitations depending on the disease location (8). Therefore, a new alternative method should be simple,

& INTRODUCTION Crohn’s disease (CD) is characterized by recurrent inflammation of the gastrointestinal tract with inappropriate or delayed healing, and it affects genetically susceptible individuals who are exposed to environmental risk factors (1). Although great advances have been made recently in the understanding of CD etiopathogenesis (2,3), the medical management of CD continues to be challenging. The objective assessment of disease activity and response to

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)04

457


Aortic flow parameters in Crohn’s disease Andrade TG et al.

CLINICS 2013;68(4):457-462

extensive surgery involving the small bowel or colon (extensive ileal resection with ileo-transverse-anastomosis and right hemicolectomy) were excluded from this study. The disease location was ileocolonic in 55.3% of the patients, restricted to the right colon in 27.9% and exclusively in the terminal ileum in 16.8%. Regarding disease behavior, the prevalence of predominantly penetrating, stricturing and nonpenetrating nonstricturing forms was 39.6%, 35.4% and 25.0%, respectively. Twelve patients were taking prednisone (10-40 mg/day) in combination with other medications, whereas three patients were taking prednisone only. Seventeen patients were using mesalamine (2-4 g/day) alone or in combination with another group of drugs, and ten patients were taking azathioprine (2-2.5 mg/kg/day). Among the patients with CD, a previous history of intestinal resection was present in 37.5% of the patients with active disease and in 25% of the patients in remission. The control group consisted of 22 healthy volunteers, with 15 females and 7 males and a median age of 33 years (20-55 years). An additional control group comprised patients with IBS, with 10 females and 2 males and a median age of 46 years (range: 27-65 years). All of the patients presented with chronic functional diarrhea, fulfilled the positive Rome III criteria for IBS and had normal colonoscopies and no histological abnormalities. Regarding the mean age of the study groups, no significant difference was found between CD patients and the controls (p = 0.885) or IBS (p = 0.159) patients or between the controls and IBS patients (p = 0.091).

reproducible and noninvasive to monitor disease activity and response to therapy in CD; such a new method could become an invaluable adjunct to clinical practice. Recent advances in vascular biology have defined a key role for the microcirculation in both the initiation and perpetuation of inflammatory bowel diseases (IBD), including CD. In particular, angiogenesis has been detected in surgical samples of both the small and large bowel affected by CD (9). In addition to histopathologic changes, CD is also accompanied by remarkable changes in the splanchnic circulation, as demonstrated by imaging studies (10,11). Doppler sonography allows the assessment of the splanchnic circulation and permits the measurement of various parameters in the mesenteric arterial and venous vasculature. In recent years, several studies with Doppler sonography have been conducted to evaluate splanchnic hemodynamics in CD (12-14). As an adjunct for CD evaluation, preliminary Doppler sonography studies have focused on the potential relationship between disease activity and intestinal blood flow data, typically using flow parameters of the superior mesenteric artery (SMA). However, these studies have produced conflicting results (15-21). The aim of this prospective study was to evaluate the potential application of Doppler sonography of the abdominal aorta and SMA as a method for assessing CD disease activity.

& PATIENTS AND METHODS The study protocol was approved by the Ethical Committee of the University Hospital of Federal University of Rio de Janeiro and was therefore performed in accordance with the ethical standards described in the 1964 Declaration of Helsinki. All subjects gave their informed consent prior to inclusion in the study.

Study Protocol This cross-sectional study was conducted at a tertiary care setting (University Hospital of the Federal University of Rio de Janeiro) between April 2004 and December 2009. The study population was representative of patients undergoing regular follow-up in the gastroenterology outpatient unit. All of the patients were clinically evaluated and received a CDAI score during the same week of the Doppler measurements. The extent of disease was evaluated using a barium enema and/or colonoscopy. Exclusion criteria were age over 65 years and under 18 years, tobacco smoking, and any chronic disease that could have significant hemodynamic effects, such as advanced renal disease, vascular disease, cardiac failure and cor pulmonale. None of the subjects in the study were taking any cardiovascular medications, such as alphaor beta-blocking agents, calcium-channel blockers, angiotensin-converting enzyme inhibitors, angiotensin II receptor antagonists, alpha-2 agonists, hydralazine or nitrates.

Study population Forty-eight consecutive patients with Crohn’s disease (CD) involving the ileum and/or the right colon were enrolled in this study. Clinical diagnosis of CD was confirmed by the combination of radiological, endoscopic and histological criteria. Twelve patients with irritable bowel syndrome (IBS) comprised the control group. A third group composed of 22 healthy individuals, matched for age and gender, was included for comparative analysis. The patients with CD consisted of 28 females and 20 males, with a mean age of 38 years (range: 18-57 years). According to the Montreal Classification (22), most (80.5%) CD patients are diagnosed before the age of 40 years. The classification of disease activity was determined by a combination of a history, physical examination, laboratory investigation, colonoscopy, barium study and Crohn’s disease activity index (CDAI) for each patient (23). The disease was categorized as active if the CDAI was $150 and inactive if the CDAI was ,150. The mean value observed for disease activity was 102.9 (range 16-264). Twenty-four subjects were in remission at the time of the study, whereas the other 24 had moderately to severely active CD (score of $150); none of the patients had a CDAI score above 450. To establish the most homogeneous CD group and to minimize potential confounding physical factors, only patients with ileum and/or right colon involvement were selected for analysis; patients with any history of prior

Doppler measurements Color Doppler and gray-scale sonography analyses of the aorta and the superior mesenteric artery (SMA) were performed in all participants involved in this study. Color Doppler sonography was performed using a Philips HDI3000 ultrasound system with a 3.75 MHz B-mode convex transducer (Andover, Massachusetts, USA). The color Doppler analysis was initiated 15 minutes after rest, in the supine position and following a 12 hour fast to minimize the influence of exercise, postural changes and meals on hemodynamic variables. The same investigator, who was unaware of the clinical status of the patients, examined all of the subjects in the study. The aorta and the SMA were studied in real time, and the cross-sectional area was calculated during diastole. The

458


CLINICS 2013;68(4):457-462

Aortic flow parameters in Crohn’s disease Andrade TG et al.

arteries were then examined in the long axis using an insonation angle of less than 60 degrees. For the aortic measurements, the parameters were acquired after the SMA emergence. The following parameters were measured: cross-sectional area (cm2), peak systolic velocity (cm/s), end diastolic velocity (cm/s) and resistive index. Each parameter was recorded three times from three different cardiac cycles and averaged for each patient to minimize random error. The flow volume (ml/min), pulsatility index and mean velocity (cm/s) were automatically calculated from digitized spectral velocity waveform envelopes stored on a computer and analyzed using HDI Laboratory software [ATL (Advanced Technologies Laboratories); Philips Ultrasound].

Table 2 - Doppler sonography evaluation of the abdominal aorta of patients with active and quiescent Crohn’s disease based on the CDAI.

Aortic Aortic Aortic Aortic Aortic Aortic

CSA (cm2) Q (mL/min) PSV (cm/s) EDV (cm/s) RI PI

Active CD

Quiescent CD

p valuea

1.55 (1.00-3.30) 2685 (1362-6182) 69.4 (54.2-143.4) 1.70 (0-16.1) 0.99 (0.77-1.20) 2.85 (1.60-3.00)

1.90 (0.90-3.20) 3751 (1733-9095) 90.7 (45.2-169.5) 3.95 (0-35.9) 0.90 (0.73-1.00) 2.35 (1.40-3.00)

0.166 0.010 0.036 0.394 0.155 0.314

CD, Crohn’s disease; CSA, cross-sectional area; Q, maximum flow volume; PSV, peak systolic velocity; EDV, end diastolic velocity; RI, resistive index; PI, pulsatility index. The values presented are medians with 95% confidence intervals. aMann-Whitney test.

Statistical Analysis cross-sectional area (CSA), maximum flow volume (Q), end diastolic velocity (EDV) and pulsatility index (PI) were significantly lower, whereas the resistive index (RI) was higher in the CD patients than in both control groups (Table 1). For the SMA measurements, the maximum flow volume (Q), peak systolic velocity (PSV) and the end diastolic velocity (EDV) were higher in the CD patients than in the control groups (Table 1). No significant difference was detected between healthy volunteers and IBS patients (data not shown).

Statistical analyses were performed using the statistical software SPSS for Windows (Version 10.1, SPSS Inc., 19891999, USA). Significant differences among the experimental groups were evaluated using the non-parametric KruskalWallis ANOVA ranks test, whereas the Mann-Whitney test was applied for pairwise comparisons. Correlations between sonographic measurements and the CDAI were assessed using the Spearman rank correlation coefficient. Values were expressed as medians with 95% confidence intervals. Selected sonographic parameter-related sensitivities and specificities with positive and negative predictive values and overall accuracy rates for CD activity were calculated. The level of significance was set at p,0.05.

Doppler measurements and assessment of CD activity To determine Doppler sonographic parameters for the assessment of Crohn’s disease activity, the relationship between the measurements obtained for CD patients and the CDAI scores was analyzed. Significant correlations were found between the CDAI and aortic maximum flow volume (Q) (CC = 0.374, p = 0.009) and aortic peak systolic velocity (PSV) (CC = 0.305, p = 0.035). Of all the parameters analyzed, only the aortic Q and aortic PSV were significantly different, with lower values in the active CD patients than in the inactive CD patients (Tables 2 and 3). Of note, none of the patients in the active group scored higher than 317. Next, we analyzed the two variables in the aorta to distinguish between active and inactive CD and also determined cut-off points for stratification of patients.

& RESULTS Doppler measurements and potential clinical utility for CD Doppler sonography measurements were successfully obtained from all individuals referred to the study. The sonographic parameters described were calculated for each of the 82 subjects examined. The median values (with 95% confidence intervals) for each Doppler measurement in the CD group, healthy volunteers and IBS group are summarized in Table 1. Most measurements in the aorta and in the superior mesenteric artery were significantly different among the three groups. For the aortic measurements, the

Table 1 - Doppler sonography evaluation of the abdominal aorta and superior mesenteric artery of patients with CD, healthy volunteers and IBS patients.

Abdominal aorta Aortic CSA (cm2) Aortic Q (mL/min) Aortic PSV (cm/s) Aortic EDV (cm/s) Aortic RI Aortic PI Superior m. artery SMA CSA (cm2) SMA Q (mL/min) SMA PSV (cm/s) SMA EDV (cm/s) SMA RI SMA PI

CD

Control

IBS

p valuea

1.75 (0.92-3.27) 3093 (1416-8638) 77.5 (45.3-167.4) 2.8 (0-33.6) 0.95 (0.73-1.14) 2.5 (1.4-3.0)

2.15 (1.20-5.30) 4558 (2126-11285) 79.4 (50.7-152.9) 14.2 (0-39.4) 0.80 (0.72-1.0) 1.7 (1.4-3.0)

2.62 (1.10-4.05) 4130 (2128-9125) 80.9 (38.9-104.1) 8.4 (0-26.3) 0.89 (0.72-1.0) 2.1 (1.4-3.0)

0.021 0.017 0.918 0.010 0.010 0.015

0.35 (0.17-0.73) 1905 (846-6770) 202.3 (77.4-365.6) 33.8 (9.1-97.2) 0.81 (0.67-0.94) 1.76 (1.20-2.53)

0.33 (0.20-0.67) 1334 (510-5296) 151.2 (77.3-247.2) 24.1 (11.4-55.4) 0.84 (0.67-0.94) 1.88 (1.22-2.50)

0.27 (0.14-0.55) 1166 (485-2972) 145.4 (99.7-298.4) 24.0 (15.5-64.2) 0.85 (0.78-0.89) 1.91 (1.64-2.18)

0.097 0.006 0.008 0.008 0.089 0.139

CD, Crohn’s disease; IBS, irritable bowel syndrome; SMA, superior mesenteric artery; CSA, cross-sectional area; Q, maximum flow volume; PSV, peak systolic velocity; EDV, end diastolic velocity; RI, resistive index; PI, pulsatility index. The values presented are the medians with 95% confidence intervals. a Kruskal-Wallis H test.

459


Aortic flow parameters in Crohn’s disease Andrade TG et al.

CLINICS 2013;68(4):457-462

the use of color Doppler and power Doppler (24,25) as well as pulsed Doppler spectral analysis (26,27). In this study, in addition to comparing SMA measurements with data from previous studies, we demonstrated for the first time the simultaneous acquisition of SMA and abdominal aorta measurements. We demonstrated in this study that most of the parameters analyzed by Doppler ultrasound examination were significantly different between patients with CD and control individuals. Overall, our data appear to agree with previous studies that also detected differences in splanchnic hemodynamics in CD (14,28-30). Furthermore, the opposing results for the aortic and SMA parameters in the same individuals support the presence of different levels of macrovascular control in the splanchnic circulation and possibly the existence of pathologic compensatory mechanisms in CD hemodynamics. Although Doppler sonography is not required for the diagnosis of CD and is not being proposed as a new diagnostic tool, the results presented here support the general hypothesis that vascular abnormalities are constitutive elements in the pathogenesis of CD (31,32). With regard to CD activity, prior studies on Doppler sonography have presented conflicting results. In a recent study, Doppler sonography for the evaluation of the SMA by segments in gray scale was presented as an excellent method for assessing CD activity (33). Other studies on the analysis of specific SMA measurements have suggested that either the resistance index (17,18) or the maximum flow volume (13,29) is the best parameter for differentiating CD patients. In contrast, a similar study failed to correlate the hyperdynamic mesenteric circulation detected in CD patients with the clinical or biochemical activity of the disease (14). In agreement with these results, our Doppler measurements obtained in the SMA confirmed the presence of hyperdynamic circulation in CD; however, these measurements could not distinguish disease activity among patients. In contrast, the significant differences in aortic measurements were correlated with disease activity. The most accurate Doppler parameter for the evaluation of CD activity was the estimated intensity of the maximum flow volume and peak systolic velocity; both of these parameters were shown to be lower in active CD. Previous studies questioned the reliability of results obtained by Doppler sonography of small size vessels for the evaluation of CD activity (15,17). Similarly, we present superior results from the aorta relative to the SMA; this difference is likely associated with the dimensions and particularly the diameter of the vessels involved. Previous major abdominal surgeries could also impose technical difficulties and affect the overall quality of results (28). To minimize this potentially confounding factor in our study, we only examined patients who had never been submitted to any abdominal surgery and patients who underwent only

Table 3 - Doppler sonography evaluation of the superior mesenteric artery of patients with active and quiescent Crohn’s disease based on the CDAI.

SMA SMA SMA SMA SMA SMA

CSA (cm2) Q (mL/min) PSV (cm/s) EDV (cm/s) RI PI

Active CD

Quiescent CD

p valuea

0.33 (0.20-0.61) 1620 (871-3609) 203.0 (75.1-366.3) 30.75 (7.60-94.6) 0.82 (0.67-0.95) 1.81 (1.20-2.56)

0.38 (0.16-0.74) 2093 (840-6833) 200.5 (85.7-355.7) 37.0 (14.3-98.0) 0.78 (0.67-0.93) 1.65 (1.22-2.41)

0.228 0.322 0.818 0.433 0.285 0.774

CD, Crohn’s disease; SMA, superior mesenteric artery; CSA, cross-sectional area; Q, maximum flow volume; PSV, peak systolic velocity; EDV, end diastolic velocity; RI, resistive index; PI, pulsatility index. The values presented are medians with 95% confidence intervals. aMann-Whitney test.

Arbitrary cut-off values of aortic Q,4500 mL/min and an aortic PSV,70 cm/s were chosen so that the maximum possible number of CD patients was correctly classified according to disease activity. The overall sensitivity, specificity, accuracy, positive predictive value and negative predictive value were calculated for both parameters (Table 4).

& DISCUSSION In the current study, we demonstrated the technical feasibility and potential clinical utility of Doppler sonography for patients with CD. The sonographic parameters analyzed showed that most measurements in the aorta and in the superior mesenteric artery were significantly different in the CD patients relative to either healthy subjects or patients with IBS. For assessment of disease activity, only the aortic measurements of maximum flow volume and aortic peak systolic velocity were significantly correlated with CDAI, with lower values in active CD. In addition, after selecting these two parameters, we determined cut-off points to accurately classify patients with regard to disease activity. The results indicate that the stratification of aortic maximum flow volume and peak systolic velocity values allowed a simple and accurate distinction to be made between active and inactive CD patients. Despite advances in clinical techniques, the optimal therapy for CD still depends on correct classification of disease activity. Although substantial efforts have been made to develop new methods for evaluating CD activity, the CDAI is still the most widely used method in clinical trials and in routine practice, including the analysis of the response to treatment. In the last decade, abdominal Doppler ultrasound has been presented as a potential alternative for the evaluation of CD activity and is predominantly based on measurements obtained in the SMA. In addition, neovascularization and hyperemia of inflamed areas of the gut have also been investigated with

Table 4 - Critical analysis of selected Doppler sonography parameters for detecting active Crohn’s disease based on the CDAI. Variable (s) Aortic Q , 4500 mL/min Aortic PSV , 70 cm/s

Sensitivity

Specificity

Accuracy

Positive Predictive Value

Negative Predictive Value

16 of 20 (80) 15 of 20 (75)

16 of 28 (57) 21 of 28 (75)

32 of 48 (67) 36 of 48 (75)

16 of 28 (57) 15 of 22 (68)

16 of 20 (80) 21 of 26 (81)

Q, maximum flow volume; PSV, peak systolic velocity. The values presented are the number of findings with percentages in parentheses.

460


CLINICS 2013;68(4):457-462

Aortic flow parameters in Crohn’s disease Andrade TG et al.

minor surgical procedures, such as an inguinal hernia repair, cholecystectomy or appendectomy. Of note, this study inadvertently selected consecutive CD patients with a relatively low intensity of disease based on the CDAI. In contrast to most studies where patients with a CDAI.450 have been categorized as having a high degree of activity, we only analyzed patients with a CDAI between 9 and 317. This factor may explain some differences between our results and those of other studies, especially concerning the SMA measurements. Moreover, the narrow range of disease activity may not have allowed a clear discrimination among the CD subjects enrolled in this study. Therefore, further studies with a higher number of both patients and control subjects are necessary to confirm the findings and the utility of Doppler sonography as an adjunctive tool for the evaluation of CD. In conclusion, as a feasible and accurate technique, Doppler sonography of the aorta is a novel noninvasive adjunct method that may be useful in the clinical follow-up of patients with CD.

10. 11.

12. 13. 14.

15.

16.

& ACKNOWLEDGMENTS 17.

The authors wish to thank the Brazilian research foundations CNPq and FAPERJ for financial support. The authors are grateful to the medical staff of the Gastroenterology Division of the University Hospital for their assistance with patient selection. The authors are also grateful to the D’Or Laboratory for their support and for the opportunity to use their equipment for this study.

18. 19.

& AUTHOR CONTRIBUTIONS Andrade TG was involved with the study design, patient selection and follow-up, data collection and interpretation and manuscript preparation. Fogac¸a H was involved with the study design, ultra-sonographic examinations, patient selection and critical review of the manuscript. Elia C was involved with data interpretation, obtained funding and provided a critical review of the manuscript. Pitrowsky M was involved with the patient selection and follow-up, data collection and interpretation and statistical analysis. Souza HS obtained funding and was involved with data interpretation, statistical analysis, critical review of the manuscript and manuscript writing.

20.

& REFERENCES

24.

21. 22.

23.

1. Podolsky DK. Inflammatory bowel disease. N Engl J Med. 2002;347(6):417-29. 2. Xavier RJ, Podolsky DK. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 2007;448(7152):427-34, http://dx.doi.org/10. 1038/nature06005. 3. Strober W, Fuss I, Mannon P. The fundamental basis of inflammatory bowel disease. J Clin Invest. 2007;117(3):514-21, http://dx.doi.org/10. 1172/JCI30587. 4. D’Haens GR, Fedorak R, Le´mann M, Feagan BG, Kamm MA, Cosnes J, et al. Endpoints for clinical trials evaluating disease modification and structural damage in adults with Crohn’s disease. Inflamm Bowel Dis. 2009;15(10):1599-604, http://dx.doi.org/10.1002/ibd.21034. 5. Sandborn WJ, Feagan BG, Hanauer SB, Lochs H, Lo¨fberg R, Modigliani R, et al. A review of activity indices and efficacy endpoints for clinical trials of medical therapy in adults with Crohn’s disease. Gastroenterology. 2002;122(2):512-30, http://dx.doi.org/10.1053/gast. 2002.31072. 6. Lichtenstein GR, Hanauer SB, Sandborn WJ. Practice Parameters Committee of American College of Gastroenterology (2009). Management of Crohn’s disease in adults. Am J Gastroenterol. 2009;104:465-83, http://dx.doi.org/10.1038/ajg.2008.168. 7. Freeman HJ. Use of the Crohn’s disease activity index in clinical trials of biological agents. World J Gastroenterol. 2008;14(26):4127-130. 8. Terheggen G, Lanyi B, Schanz S, Hoffmann RM, Bo¨hm SK, Leifeld L, et al. Safety, feasibility, and tolerability of ileocolonoscopy in inflammatory bowel disease. Endoscopy. 2008;40(8):656-63, http://dx.doi.org/10. 1055/s-2008-1077445. 9. Wakefield AJ, Sawyerr AM, Dhillon AP, Pittilo RM, Rowles PM, Lewis AA, Pounder RE. Pathogenesis of Crohn’s disease: multifocal gastrointestinal

25.

26. 27.

28.

29.

30. 31.

461

infarction. Lancet. 1989;2(8671):1057-62, http://dx.doi.org/10.1016/S01406736(89)91078-7. Lunderquist A, Knutsson H. Angiography in Crohn’s disease of the small bowel and colon. Am J Roentgenol Radium Ther Nucl Med. 1967;101(2):338-44, http://dx.doi.org/10.2214/ajr.101.2.338. Giaffer MH, Tindale WB, Senior S, Barber DC, Holdsworth CD. Quantification of disease activity in Crohn’s disease by computer analysis of Tc-99m hexamethyl propylene amine oxime (HMPAO) labelled leucocyte images. Gut. 1993;34(1):68-74, http://dx.doi.org/10. 1136/gut.34.1.68. Maconi G, Imbesi V, Bianchi Porro G. Doppler ultrasound measurement of intestinal blood flow inflammatory bowel disease. Scand J Gastroenterol. 1996;31(6):590-3. Erden A, Cumhur T, Olcer T. Superior mesenteric artery Doppler waveform changes in response to inflammation of the ileocecal region. Abdom Imaging. 1997;22(5):483-6, http://dx.doi.org/10.1007/s002619900243. Maconi G, Parente F, Bollani S, Imbesi V, Ardizzone S, Russo A, Bianchi Porro G. Factors affecting splanchnic haemodynamics in Crohn’s disease: a prospective controlled study using Doppler ultrasound. Gut. 1998;43(5):645-50, http://dx.doi.org/10.1136/gut.43.5.645. Byrne MF, Farrell MA, Abass S, Fitzgerald A, Varghese JC, Thornton F, et al. Assessment of Crohn’s disease activity by Doppler sonography of the superior mesenteric artery, clinical evaluation and the Crohn’s disease activity index: a prospective study. Clin Radiol. 2001;56(12):9738, http://dx.doi.org/10.1053/crad.2001.0794. van Oostayen JA, Wasser MN, Griffioen G, van Hogezand RA, Lamers CB, de Roos A. Activity of Crohn’s disease assessed by measurement of superior mesenteric artery flow with Doppler ultrasound. Neth J Med. 1998;53(6):S3-8. Bolondi L, Gaiani S, Brignola C, Campieri M, Rigamonti A, Zironi G, et al. Changes in splanchnic hemodynamics in inflammatory bowel disease. Non-invasive assessment by Doppler ultrasound flowmetry. Scand J Gastroenterol. 1992;27(6):501-7. Giovagnorio F, Diacinti D, Vernia P. Doppler sonography of the superior mesenteric artery in Crohn’s disease. AJR Am J Roentgenol. 1998;170(1):123-6, http://dx.doi.org/10.2214/ajr.170.1.9423614. Ludwig D, Wiener S, Bru¨ning A, Schwarting K, Jantschek G, Stange EF. Mesenteric blood flow is related to disease activity and risk of relapse in Crohn’s disease: a prospective follow-up study. Am J Gastroenterol. 1999;94(10):2942-50. Ludwig D, Wiener S, Bru¨ning A, Schwarting K, Jantschek G, Fellermann K, et al. Mesenteric blood flow is related to disease activity and risk of relapse in ulcerative colitis: a prospective follow up study. Gut. 1999;45(4):546-52, http://dx.doi.org/10.1136/gut.45.4.546. Dietrich CF, Jedrzejczyk M, Ignee A. Sonographic assessment of splanchnic arteries and the bowel wall. Eur J Radiol. 2007;64(2):202-12. Satsangi J, Silverberg MS, Vermeire S, Colombel JF. The Montreal classification of inflammatory bowel disease: controversies, consensus, and implications. Gut. 2006;55(6):749-53, http://dx.doi.org/10.1136/gut. 2005.082909. Best WR, Becktel JM, Singleton JW. Rederived values of the eight coefficients of the Crohn’s Disease Activity Index (CDAI). Gastroenterology. 1979;77(4 Pt 2):843-6. van Oostayen JA, Wasser MN, van Hogezand RA, Griffioen G, de Roos A. Activity of Crohn disease assessed by measurement of superior mesenteric artery flow with Doppler US. Radiology. 1994;193(2):551-4. Heyne R, Rickes S, Bock P, Schreiber S, Wermke W, Lochs H. Noninvasive evaluation of activity in inflammatory bowel disease by power Doppler sonography. Zeitschrift fur Gastroenterologie. 2002;40(3):171-5, http://dx.doi.org/10.1055/s-2002-22325. Esteban JM, Maldonado L, Sanchiz V, Minguez M, Benages A. Activity of Crohn’s disease assessed by colour Doppler ultrasound analysis of the affected loops. Eur Radiol. 2001;11(8):1423-8. Sjekavica I, Barbaric´-Babic´ V, Krznaric´ Z, Molnar M, Cukovic´-Cavka S, Stern-Padovan R. Assessment of Crohn’s disease activity by doppler ultrasound of superior mesenteric artery and mural arteries in thickened bowel wall: cross-sectional study. Croat Med J. 2007;48(6):822-30, http:// dx.doi.org/10.3325/cmj.2007.6.822. van Oostayen JA, Wasser MN, van Hogezand RA, Griffioen G, Biemond I, Lamers CB, et al. Doppler sonography evaluation of superior mesenteric artery flow to assess Crohn’s disease activity: correlation with clinical evaluation, Crohn’s disease activity index, and alpha 1antitrypsin clearance in feces. AJR Am J Roentgenol. 1997;168(2):429-33, http://dx.doi.org/10.2214/ajr.168.2.9016220. van Oostayen JA, Wasser MN, Griffioen G, van Hogezand RA, Lamers CB, de Roos A. Diagnosis of Crohn’s ileitis and monitoring of disease activity: value of Doppler ultrasound of superior mesenteric artery flow. Am J Gastroenterol. 1998;93(1):88-91. Ludwig D. Doppler sonography in inflammatory bowel disease. Z Gastroenterol. 2004;42(9):1059-65, http://dx.doi.org/10.1055/s-2004813308. Thornton M, Solomon MJ. Crohn’s disease: in defense of a microvascular aetiology. Int J Colorectal Dis. 2002;17(5):287-97, http://dx.doi.org/10. 1007/s00384-002-0408-5.


Aortic flow parameters in Crohn’s disease Andrade TG et al.

CLINICS 2013;68(4):457-462

33. Yekeler E, Danalioglu A, Movasseghi B, Yilmaz S, Karaca C, Kaymakoglu S, et al. Crohn disease activity evaluated by Doppler ultrasonography of the superior mesenteric artery and the affected smallbowel segments. J Ultrasound Med. 2005;24(1):59-65.

32. Hatoum OA, Binion DG, Otterson MF, Gutterman DD. Acquired microvascular dysfunction in inflammatory bowel disease: loss of nitric oxide-mediated vasodilation. Gastroenterol. 2003;125(1):58-69, http:// dx.doi.org/10.1016/S0016-5085(03)00699-1.

462


CLINICAL SCIENCE

Vibroacoustography for the assessment of total hip arthroplasty Hermes A. S. Kamimura,I,II Liao Wang,III,IV Antonio A. O. Carneiro,II Randall R. Kinnick,I Kai-Nan An,III Mostafa FatemiI I College of Medicine, Mayo Clinic, Department of Physiology and Biomedical Engineering, Rochester/MN, USA. II Universidade de Sa˜o Paulo, Faculdade de Filosofia, Cieˆncias e Letras de Ribeira˜o Preto, Department of Physics, Ribeira˜o Preto/SP, Brazil. III Mayo Clinic, College of Medicine, Department of Orthopedics, Rochester/MN, USA. IV Shanghai Jiao Tong University School of Medicine and Engineering Research Center of Digital Medicine, Department of Orthopedics, Shanghai, China.

OBJECTIVES: This paper proposes imaging with 3-dimensional vibroacoustography for postoperatively assessing the uncovered cup area after total hip arthroplasty as a quantitative criterion to evaluate implant fixation. METHODS: A phantom with a bone-like structure covered by a tissue-mimicking material was used to simulate a total hip arthroplasty case. Vibroacoustography images of the uncovered cup region were generated using a two-element confocal ultrasound transducer and a hydrophone inside a water tank. Topological correction based on the geometry of the implant was performed to generate a 3-dimensional representation of the vibroacoustography image and to accurately evaluate the surface. The 3-dimensional area obtained by the vibroacoustography approach was compared to the area evaluated by a 3-dimensional motion capture system. RESULTS: The vibroacoustography technique provided high-resolution, high-contrast, and speckle-free images with less sensitivity to the beam incidence. Using a 3-dimensional-topology correction of the image, we accurately estimated the uncovered area of the implant with a relative error of 8.1% in comparison with the motion capture system measurements. CONCLUSION: Measurement of the cup coverage after total hip arthroplasty has not been well established; however, the covered surface area of the acetabular component is one of the most important prognostic factors. The preliminary results of this study show that vibroacoustography is a 3-dimensional approach that can be used to postoperatively evaluate total hip arthroplasty. The favorable results also provide an impetus for exploring vibroacoustography in other bone or implant surface imaging applications. KEYWORDS: Arthroplasty; 3D Imaging; Vibroacoustography. Kamimura HA, Wang L, Carneiro AA, Kinnick RR, An KN, Fatemi M. Vibroacoustography for the assessment of total hip arthroplasty. Clinics. 2013;68(4):463-468. Received for publication on October 15, 2012; First review completed on November 13, 2012; Accepted for publication on December 6, 2012 E-mail: fatemi.mostafa@mayo.edu Tel.: 507284-0608

have varied from 60% to 80% (1-4). However, the minimum requirement of 3-dimensional (3D) cup coverage, which can be used as a criterion during cup placement, is still under investigation (5). To provide precise information on the relationship between minimum cup coverage and the cup loosening rate, a noninvasive 3D imaging technique is required to postoperatively measure cup coverage. In this paper, we describe using vibroacoustography (VA) as a noninvasive tool for 3D imaging and for evaluating the uncovered area of the cup in THA. VA is an ultrasound-based technique in which two cofocused ultrasound beams at slightly different frequencies (in the MHz range) generate low-frequency (in the kHz range) acoustic excitation caused by the radiation force of the interacting ultrasound beams (6,7) and the nonlinear mixing of the scattered waves (8). Recent studies have shown that the nonlinear acoustic scattering of waves is important for generating the low-frequency response of

& INTRODUCTION Total hip arthroplasty (THA) is a cost-effective procedure to treat patients with end-stage osteoarthritis. The acetabular component may not obtain full coverage in patients with developmental dysplasia of the hip or in patients undergoing a revision procedure. Previous studies have investigated the relationship between the loosening rate and the measured cup coverage using plain anteroposterior pelvis radiographs, and the recommendations from these studies regarding adequate cup coverage

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. DOI: 10.6061/clinics/2013(04)05

463


Vibroacoustography and total hip arthroplasty Kamimura HA et al.

CLINICS 2013;68(4):463-468

objects in VA (9-11). The different frequencies are detected by a hydrophone that is coupled to the system. The focused lowfrequency excitation provides a speckle-free image with a high (sub-mm) lateral resolution. The feasibility of VA has been demonstrated for evaluating soft tissues, such as arteries (12,13), breast tissue (14,15), and prostate tissue (16). However, the implementation of VA in a commercial machine (17) and the development of new technologies for VA beam forming (18) open a new range of clinical applications. An important property of VA is its relative insensitivity to the sound beam orientation with respect to the object, which allows VA to image specular surfaces with high local curvatures of bone and metal implants. This characteristic is an important advantage of VA over traditional B-mode ultrasound imaging, which often misses a signal if the object surface is not perpendicular to the beam. Barratt et al. (19) described a 3D system composed of a B-mode ultrasound imaging system and an optical tracking device for pelvic bone imaging. The authors reported some difficulties associated with this technique for imaging complex anatomic structures with high curvatures. A comparative study between VA and B-mode (pulse-echo) ultrasound for brachytherapy seed imaging showed that the image quality in VA was far less affected by the orientation of seeds for the range up to 80 ˚ than the images acquired in B-mode (20). Bmode ultrasound is highly affected by angle variation because the image formation in this technique is based on reflected wave intensity. At incidence angles greater than a few degrees, the reflected ultrasound beam mostly misses the transducer, which significantly decreases the reflected wave intensity that the transducer can receive. In VA, a hydrophone is used to acquire the tissue response under low-frequency excitation. The low-frequency wave is propagated in all directions, and its attenuation is much less than the attenuation at high frequencies. Therefore, the orientation of the object and the hydrophone position are not critical for VA acquisition. The low variability in the VA image in relation to the incidence angle is particularly important in this study because the bone and cup surfaces may have great variations in shape. Calle et al. (21) presented the VA technique for bone imaging and showed the trabecular structure of a cut calcaneus bone. The authors used low ultrasound frequencies that penetrate deeper the tissue to observe internal structures of the bone. Renaud et al. (22) reported preliminary results for a heel bone crack assessment using ultrasound excitation, including VA. Moreover, Alizad et al. (23) presented a frequency spectrum analysis of fractured bones. In the study presented here, we propose VA imaging with 3D correction of the topology for evaluating the uncovered cup surface area in THA. For an accurate evaluation of the surface area, an analytic correction based on the 3D geometry of the implant (cup) was made to the VA image to generate a 3D representation of it. Furthermore, an optical measurement was conducted to provide an independent measurement of the uncovered area.

Figure 1 - Total hip arthroplasty model. The metal implant was positioned inside the pelvis. The uncovered area was evaluated using vibroacoustography.

1301-1, Pacific Research Laboratories, Inc., Vashon, Washington, USA) was made of foam cortical shell material and had the dimensions of a typical adult pelvis and an elastic modulus of 210 MPa. The uncovered surface area, shown in Figure 1, was evaluated for cup fixation. A tissuemimicking material (TMM) was placed between the THA model and the ultrasound transducer to simulate muscle and fat in the buttock region. To ensure a more realistic TMM, the damping effect of the wave was considered, and the TMM was molded to conform to the shape of the bone and implant surfaces, and placed in contact with these structures. The TMM was composed of water (50% of the volume), evaporated milk (approximately 50% of the volume), porcine skin–derived gel (180 g), glycerol (180 mL), and potassium sorbate (18 g). The TMM attenuation was controlled by diluting the evaporated milk in water (24). The tissue phantom exhibited attenuation of approximately 0.5 dB?cm21, a propagation speed of 1540 m?s21, and a 5cm thickness. The empirical values for the attenuation coefficients of fat and skeletal muscles were previously reported by Mast (25). The resultant attenuation coefficient of the TMM was similar to a muscle to fat proportion of 2 to 3.

Uncovered Implant Area Estimation The boundary of the uncovered surface area was digitized using a motion capture system (OptotrakCertus; NDI, Inc. Waterloo, Ontario, Canada). The area was calculated using computer-aided design (CAD) software (SolidWorks; Dassault Syste`mes S.A., Ve´lizy, France), which provided an accuracy of 0.15 mm at 2.25 m of distance between the system and the THA model. The pelvic model was positioned on a rigid table, which was stationary in relation to the optical system. Using the marker digitizing probe, the diameter of the implant was determined by acquiring six points on the edge of the implant. Those points represented the external implant diameter and were used to build the sphere surface model with the CAD software. Next, 20 points on the border of the uncovered implant area were acquired to determine the region of interest (ROI). A 3D curve, which was defined by the ROI points, was used to define the uncovered area on the sphere surface. The uncovered area was calculated using the surface area evaluation tool of the CAD software.

& MATERIALS AND METHODS The THA Model A hemispherical acetabular implant cup with an outer diameter of 57.10¡0.05 mm was placed inside a pelvic bone model to simulate THA. The bone model (Sawbones Model

464


CLINICS 2013;68(4):463-468

Vibroacoustography and total hip arthroplasty Kamimura HA et al.

Figure 2 - Vibroacoustography image acquisition using a confocal ultrasound transducer and a tissue-mimicking gel to simulate the soft tissue around the hip. Figure 3 - Linear combination of vibroacoustography images at three different depths: (a) VA image at a depth of 6.3 cm, (b) VA image at a depth of 5.8 cm, (c) VA image at a depth of 5.3 cm, and (d) a linear combination of the images with equal weighting. The cross-hatch texture of the image is caused by tiny elevated squares on the implant surface.

VA Acquisition The VA acquisition was performed inside a tank of degassed water. A confocal ultrasound transducer with an outer diameter of 45 mm and a focal distance of approximately 7 cm was positioned with a 3-axis scanner system (0.25-mm resolution) and swept the pelvic model in a 567cm raster pattern. The implant face of the THA model was oriented parallel to the transducer scan axis (Figure 2). The focal depth of the transducer was approximately 1 cm long. With this focal depth and the amount of curvature of the implant’s surface, the uncovered area of the implant could not be covered by the focal region in only 1 scanning plane. Thus, three acquisition planes at depths of 5.3 cm, 5.8 cm, and 6.3 cm from the transducer were acquired and combined into one image to extend the focal depth coverage to the entire exposed implant area.

Topology Correction For an accurate evaluation of the uncovered area, a correction in the topology of the image was necessary because the combined VA image used here was only 2dimensional. An analytic approach for the topology correction was performed based on the implant cup dimensions. In this approach, the topology of the 3D implant surface was given by a quarter of a sphere. For the 3D visualization of the uncovered area, the VA image was applied as a texture on the 3D surface (topology). The segmented region in Figure 4(c) defined the uncovered area to be evaluated on the 3D surface.

Image Processing The VA images were combined with equal weightings using the linear combination of the images shown in Figure 3. The surface area of the VA image was automatically identified by contour segmentation on the basis of gradient-based edge detection (26). Analytic topology correction was performed to obtain 3D representations of the VA image. Finally, the uncovered area was evaluated using the 3D surface representations.

Surface Area Evaluation The total surface area of the implant was estimated by calculating the surface area of half of a sphere, equal to

Contour Segmentation The uncovered implant area was identified by analyzing the image texture using contour detection (27). The gradient magnitude of the image was computed to detect the image edges. The edges were characterized by sudden changes in the gray level, and they were defined by evaluating the partial derivative with respect to the x and y directions. The Sobel edge masks were used to calculate the horizontal and vertical gradient magnitude (the vertical gradient magnitude was calculated by transposing the filter). The square root of the sum of the squared gradients in both directions was evaluated, providing the image shown in Figure 4(b). Next, a threshold was applied to the image followed by operations to dilate and fill the holes in the ROI. The segmented area had a high brightness and is highlighted in Figure 4(d).

Figure 4 - Contour segmentation in the image acquired by the vibroacoustography technique: (a) the combined image, (b) the gradient magnitude, (c) the segmented region, and (d) the highlighted segmented area on the image.

465


Vibroacoustography and total hip arthroplasty Kamimura HA et al.

CLINICS 2013;68(4):463-468

2?p?r2, where r is the radius of the sphere. After the topology corrections were applied, the segmented area in the VA image defined the surface area to be evaluated. The surface area was numerically computed by calculating the sum of the triangular subareas formed by three neighbor pixels. The x, y, and z coordinates of the points (pixels) determined the 3D surface in space; these coordinates represented the vertices of the triangles. The subareas (of the triangles) were calculated by the cross-product of the vectors defined by the vertices (28). The accuracy of the numeric area evaluation depended on the number of pixels. The resolution in the acquisition was set to 0.25 mm/pixel, which allowed for highly accurate results. The proposed method is diagrammed in Figure 5, which shows the steps for evaluating the implant uncovered area.

between the bone and implant. In the VA modality, the lowfrequency response is less affected by changes in the incidence angle of the ultrasound beam with respect to the specular surfaces of the bone or implant. This feature of VA imaging contrasts with B-mode imaging. For B-mode imaging, the echo signal level strongly depends on the beam angle with respect to the object surface, which negatively impacts image quality. Our results showed that the good contrast of VA images facilitated the segmentation process of the uncovered region. In this study, we used an optical method to provide an independent measurement of the 3D uncovered surface area. Although this optical method offers high accuracy (0.15 mm) for point acquisition, the manual handling of the optical probe may introduce additional error into the measurements and requires care with use. In our experiments, the optical measurements of the percentage of the uncovered area were similar to those obtained by VA, and the relative error was 8.1%. The agreement between the two methods supports the validity of the VA approach for in vivo applications. Further research is necessary to make a statistical conclusion about the mean error and to demonstrate the application in humans. The calculated surface area was simplified using the priori knowledge of implant geometry. Because the implant dimensions are known in clinical THA, analytical correction of the topology can be easily applied to the VA image of the implant. Because of the spherical symmetry of the implant model, the alignment of the VA image is easily reached by aligning the midpoint on top of the implant with the equivalent point on the 3D analytic topology. Thus, even when the VA image is acquired at an arbitrary orientation with respect to the implant, angle alignment of the VA image in the xy plane (length and width plane) is not necessary to correctly evaluate the uncovered area. This property further facilitates the clinical application of this technique. Overall, the results of this study support the feasibility of VA to postoperatively evaluate THA and its potential as a noninvasive alternative to x-ray–based methods that use ionizing radiation. The quality of the images also suggests that VA may be a practical solution for evaluating implants

& RESULTS The metal implant diameter was 5.71 cm, and the total surface area was 51.2 cm2. The estimated uncovered area determined by the optical measurements was 6.64 cm2 and represented 13.0% of the implant surface area. The uncovered area in the VA image was detected by contour segmentation. The image had a high contrast between the metal and bone, which revealed considerable surface detail. Using the analytical approach to correct the surface topology, as shown in Figure 6(a), the uncovered area was found to be 6.10 cm2, which represented 11.9% of the implant surface area.

& DISCUSSION VA is an imaging technique that can be used in vivo for soft tissue evaluation. This study presented a new clinical application for VA for evaluating THA. Differences in the mechanical properties of objects, such as stiffness, density, acoustic impedance, and shape, determine the contrast and resolution of the image. In addition, low and high frequencies interact differently with metal and bone. In VA, differences in the mechanical properties of bone and metal, including absorption, scattering, and stiffness, provide high contrast

Figure 5 - Schematic showing the steps for the implant uncovered area evaluation. The VA images were acquired and combined into one image. The uncovered implant area was determined by a segmentation process. The resulting image was fitted to a priori known shape of the implant to account for the curvature of the 3D shape of the uncovered area.

466


CLINICS 2013;68(4):463-468

Vibroacoustography and total hip arthroplasty Kamimura HA et al.

Figure 6 - A 3D representation of the implant topology using the analytic approach: (a) analytic topology and (b) 3D image result. 8. Fatemi M, Greenleaf JF. Vibro-acoustography: An imaging modality based on ultrasound-stimulated acoustic emission. Proc Nat Acad Sci USA. 1999;96(12):6603-8, http://dx.doi.org/10.1073/pnas.96.12.6603. 9. Silva GT, Mitri FG. Analysis of the difference-frequency wave generated by the interaction of two axisymmetric and co-focused ultrasound beams, in: Proc. IEEE Ultrason. Symp., IEEE-UFFC, 2008.pp.1326-9. 10. Silva GT, Farid FG. Difference-frequency generation in vibro-acoustography. Phys. Med. Biol. 2011;56(18):5985-93, http://dx.doi.org/10. 1088/0031-9155/56/18/013. 11. Bandeira A, Silva GT. Difference-frequency generation in nonlinear scattering of acoustic waves by a rigid sphere. Ultrasonics. 2013;53(2):470-8. 12. Alizad A, Fatemi M, Whaley DH, Greenleaf JF. Application of vibroacoustography for detection of calcified arteries in breast tissue. J Ultrasound Med. 2004;23(2):267-73. 13. Pislaru C, Kantor B, Kinnick RR, Anderson JL, Aubry MC, Urban MW, et al. In vivo vibro-acoustography of large peripheral arteries. Invest Radiol. 2008;43(4):243-52, http://dx.doi.org/10.1097/RLI.0b013e31816085fc. 14. Fatemi M, Wold LE, Alizad A, Greenleaf JF. Vibro-acoustic tissue mammography. IEEE Trans Med Imaging. 2002;21(1):1-8, http://dx.doi. org/10.1109/42.981229. 15. Alizad A, Whaley DH, Urban MW, Carter RE, Kinnick RR, Greenleaf JF, et al. Breast vibro-acoustography: initial results show promise. Breast Cancer Research. 2012;14(5):R128, http://dx.doi.org/10.1186/bcr3323. 16. Mitri FG, Trompette P, Chapelon JY. Improving the use of vibroacoustography for brachytherapy metal seed imaging: A feasibility study. IEEE Trans Med Imaging. 2004;23(1):1-6, http://dx.doi.org/10. 1109/TMI.2003.819934. 17. Urban MW, Chalek C, Kinnick RR, Kinter TM, Haider B, Greenleaf JF, et al. Implementation of vibro-acoustography on a clinical ultrasound system. IEEE Trans Ultrason Ferroelectr Freq Control. 2011;58(6):1169-81, http://dx.doi.org/10.1109/TUFFC.2011.1927. 18. Kamimura HAS, Urban MW, Carneiro AAO, Fatemi M, Alizad A. Vibroacoustography beam formation with reconfigurable arrays. IEEE Trans Ultrason Ferroelectr Freq Control. 2012;59(7):1421-31, http://dx.doi.org/ 10.1109/TUFFC.2012.2343. 19. Barratt DC, Chan CSK, Edwards PJ, Penney GP, Slomczykowski M, Carter TJ, et al. Instantiation and registration of statistical shape models of the femur and pelvis using 3D ultrasound imaging. Medical Image Analysis. 2008;12(3):358-74, http://dx.doi.org/10.1016/j.media.2007.12.006. 20. Mitri FG, Davis BJ, Greenleaf JF, Fatemi M. In vitro comparative study of vibro-acoustography versus pulse-echo ultrasound in imaging permanent prostate brachytherapy seeds. Ultrasonics. 2009;49(1):31-38, http:// dx.doi.org/10.1016/j.ultras.2008.04.008. 21. Calle S, Remenieras JP, Matar OB, Defontaine M, Patat F. Application of nonlinear phenomena induced by focused ultrasound to bone imaging. Ultrasound Med Biol. 2003;29(3):465-72, http://dx.doi.org/10.1016/ S0301-5629(02)00729-9. 22. Renaud G, Calle S, Remenieras JP, Defontaine M. Non-linear acoustic measurements to assess crack density in trabecular bone. Int J NonLinear Mech. 2008;43(3):194-200, http://dx.doi.org/10.1016/j.ijnonlinmec. 2007.12.007. 23. Alizad A, Wallch M, Greenleaf JF, Fatemi M. Vibrational characteristics of bone fracture and fracture repair: Application to excised rat femur. J Biomech Eng. 2006;128(3):300-8, http://dx.doi.org/10.1115/1.2187037. 24. Madsen EL, Frank GR, Dong F. Liquid or solid ultrasonically tissue mimicking materials with very low scatter. Ultrasound Med Biol. 1998;24(4):535-42, http://dx.doi.org/10.1016/S0301-5629(98)00013-1. 25. Mast TD. Empirical relationships between acoustic parameters in human soft tissues. Acoustics Research Letters Online. 2000;1(2):37-42, http:// dx.doi.org/10.1121/1.1336896. 26. Burger W, Burge MJ. Digital image processing: an algorithmic introduction using Java. 1st ed. New York: Springer-Verlag New York Inc; 2008.

designed for shallower regions, such as the arms and knees. The favorable results of this study also provide the impetus for further research of other application areas, such as diagnostic bone surface imaging and in vivo imaging of metallic implants in other parts of the body. The range of applications may also be broadened by using more sophisticated methods, which would improve image resolution and contrast, and lower image distortion, to restore VA images (29). Conflicts of Interest: Mayo Clinic and one of the authors (Fatemi M) have financial interests associated with the technology used in this research, and the technology has been licensed (in part) to industry.

& ACKNOWLEDGMENTS This work was supported in part by the Brazilian agencies CNPq (process: 571801/2008-0) and FAPESP (process: 2011/10809-6). The authors thank James F. Greenleaf, PhD, Matthew W. Urban, PhD, and Thomas M. Kinter for their assistance in the technical discussions and with image processing.

& AUTHOR CONTRIBUTIONS All of the co-authors have read the manuscript and contributed substantially to it. This work was partially conducted while Kamimura HA was visiting a graduate student and Wang L was a fellow at the Mayo Clinic (2010/2011). Kamimura HA, Wang L, and Kinnick RR worked on the experiments together. Wang L and An KN designed the realistic problem to better represent the clinical problem. Kamimura HA, Fatemi M, and Carneiro AA discovered the solution to build the 3D image and worked on the image processing.

& REFERENCES 1. Anderson MJ, Harris WH. Total hip arthroplasty with insertion of the acetabular component without cement in hips with total congenital dislocation or marked congenital dysplasia. J Bone Joint Surg Am. 1999;81A(3):347-54. 2. Hartofilakidis G, Georgiades G, Babis GC, Yiannakopoulos CK. Evaluation of two surgical techniques for acetabular reconstruction in total hip replacement for congenital hip disease - Results after a minimum ten-year follow-up. J Bone Joint Surg British. 2008;90B(6): 724-30, http://dx.doi.org/10.1302/0301-620X.90B6.20490. 3. Jasty M, Anderson MJ, Harris WH. Total hip-replacement for developmental dysplasia of the hip. Clin Orthop Relat Res. 1995;311:40-5. 4. Kim YH, Seo HS, Kim JS. Outcomes after THA in patients with high hip dislocation after childhood sepsis. Clin Orthop Relat Res. 2009;467(9): 2371-8, http://dx.doi.org/10.1007/s11999-008-0654-0. 5. Sanchez-Sotelo J, Trousdale RT, Berry DJ, Cabanela ME. Surgical treatment of developmental dysplasia of the hip in adults: I. Nonarthroplasty options. J Am Acad Orthop Surg. 2002;10(5):321-33. 6. Dean LW. Interactions between sound waves. J Acoust Soc Am. 1962;34(8):1039-44, http://dx.doi.org/10.1121/1.1918241. 7. Fatemi M, Greenleaf JF. Ultrasound-stimulated vibro-acoustic spectrography. Science. 1998;280(5360):82-5, http://dx.doi.org/10.1126/science. 280.5360.82.

467


Vibroacoustography and total hip arthroplasty Kamimura HA et al.

CLINICS 2013;68(4):463-468

29. Perciano T, Urban MW, Mascarenhas NDA, Fatemi M, Frery AC, Silva GT. Deconvolution of vibroacoustic images using a simulation model based on a three dimensional point spread function. Ultrasonics. 2013;53(1):36-44, http://dx.doi.org/10.1016/j.ultras.2012.03. 011.

27. Pal NR, Pal SK. A review on image segmentation techniques. Pattern Recognition. 1993;26(9):1277-94, http://dx.doi.org/10.1016/00313203(93)90135-J. 28. Zill DG, Wright WS. Advanced engineering mathematics, 10th ed. Massachusetts: Jones and Bartlett Publishers Inc; 2006.

468


CLINICAL SCIENCE

Saint John’s wort, an herbal inducer of the cytochrome P4503A4 isoform, may alleviate symptoms of Willis-Ekbom’s disease Jose´ Carlos Pereira Jr.,I Ma´rcia Pradella-Hallinan,II Rosana Cardoso AlvesIII I

Faculdade de Medicina de Jundiaı´, Pediatria, Jundiaı´/SP, Brazil. II Universidade Federal de Sa˜o Paulo, Departamento de Psicobiologia, Sa˜o Paulo/SP, Brazil. Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Departamento de Neurologia, Sa˜o Paulo/SP, Brazil.

III

OBJECTIVE: Certain drug classes alleviate the symptoms of Willis-Ekbom’s disease, whereas others aggravate them. The pharmacological profiles of these drugs suggest that drugs that alleviate Willis-Ekbom’s disease inhibit thyroid hormone activity, whereas drugs that aggravate Willis-Ekbom’s disease increase thyroid hormone activity. These different effects may be secondary to the opposing actions that drugs have on the CYP4503A4 enzyme isoform. Drugs that worsen the symptoms of the Willis-Ekbom’s disease inhibit the CYP4503A4 isoform, and drugs that ameliorate the symptoms induce CYP4503A4. The aim of this study is to determine whether Saint John’s wort, as an inducer of the CYP4503A4 isoform, diminishes the severity of WillisEkbom’s disease symptoms by increasing the metabolism of thyroid hormone in treated patients. METHODS: In an open-label pilot trial, we treated 21 Willis-Ekbom’s disease patients with a concentrated extract of Saint John’s wort at a daily dose of 300 mg over the course of three months. RESULTS: Saint John’s wort reduced the severity of Willis-Ekbom’s disease symptoms in 17 of the 21 patients. CONCLUSION: Results of this trial suggest that Saint John’s wort may benefit some Willis-Ekbom’s disease patients. However, as this trial was not placebo-controlled, the extent to which Saint John’s wort is effective as a Willis-Ekbom’s disease treatment will depend on future, blinded placebo-controlled studies. KEYWORDS: Willis-Ekbom’s Disease; Restless Legs Syndrome Treatment; Restless Legs Syndrome; Saint John’s Wort; Thyroid Hormone; CYP4503A4. Pereira Jr JC, Pradella-Hallinan M, Alves RC. Saint John’s wort, an herbal inducer of the cytochrome P4503A4 isoform, may alleviate symptoms of Willis-Ekbom’s disease. Clinics. 2013;68(4):469-474. Received for publication on November 1, 2012; First review completed on November 22, 2012; Accepted for publication on December 6, 2012 E-mail: jcpereirajr@uol.com.br Tel.: 55 11 4586-4559

expression of cytochrome P450, which results in an increase of TH metabolism (6-11). Furthermore, DA also modulates TH by reducing the synthesis of thyroid stimulation hormone (TSH) in the hypothalamus (12). The major pathway of TH metabolism is through sequential deiodination, but TH is also conjugated with glucuronides and sulfates. Glucuronides are then excreted into bile to act as intermediates in the enterohepatic cycle and fecal excretion of thyroid hormone. Sulfation accelerates the deiodination of different iodothyronines by type I deiodinase and thus initiates the irreversible degradation of the hormone (7). This second pathway is less prevalent and represents approximately 20% of the total TH metabolism (8). TH behaves similarly to a steroid hormone, and most steroid hormones are substrates for the CYP3A4 enzyme isoform. There is strong evidence that when the CYP3A4 isoform is induced, TH glucuronidation and sulfation are also induced (8,9,13,14). Notably, many drugs that relieve or worsen WED symptoms are inducers or inhibitors, respectively, of the CYP3A4 isoform (Table 1). Pramipexole is an effective treatment for WED that is a typical DA agonist with selective affinity for the D2 receptor

& INTRODUCTION Willis-Ekbom’s disease (WED), formerly known as restless legs syndrome, is a common disorder (1-3). In Brazil, the lifetime prevalence of WED is 6.40% (4). Recently (2010), it has been suggested that the WED pathophysiology is caused by an imbalance between the activities of thyroid hormone (TH) and the dopaminergic system (IMBTH/DA (5). This concept is based on the following findings: 1) dopamine (DA) agonists reduce TH levels and alleviate WED symptoms; 2) cytochrome P450 metabolizes TH, and its inhibition (mainly of the CYP3A4 enzyme isoform) aggravates WED symptoms; 3) induction of CYP3A4 alleviates WED symptoms; and 4) DA increases the

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)06

469


St. John’s wort and Willis-Ekbom’s disease Pereira Jr JC et al.

CLINICS 2013;68(4):469-474

Table 1 - Suggested mechanisms by which some drugs aggravate WED. The drugs listed in Table 1 (substrates and/or inhibitors of CYP3A4) affect WED by interfering with CYP3A4, thereby decreasing TH metabolism. In addition, some drugs may cause a direct decline in dopaminergic signaling. Drug classes Calcium channel blockers Selective serotonin reuptake inhibitors

Neuroleptics

Anti-nausea agents Lipid lowering agents

Non-steroidal anti-inflammatory drugs Stimulants

Examples

CYP3A4 substrates

CYP3A4 inhibitors

Effects on DA system

Verapamil Diltiazem Fluoxetine Paroxetine Sertraline Citalopram Escitalopram Fluvoxamine Haloperidol Chlorpromazine Clozapine Pimozide Quetiapine Metoclopramide

Yes +++ Yes +++ Yes + No Yes + Yes +++ Yes +++ No Yes +++ Yes + Yes + Yes +++ Yes +++ No

Yes ++ Yes ++ Yes + Yes + Yes ++ No No Yes + Yes ++ No Yes + Yes + No No

No

Atorvastatin Lovastatin Simvastatin Diclofenac Caffeine

Yes +++ Yes +++ Yes +++ Yes + Yes +

Yes + Yes + No Yes ++ Yes ++

No

Yes: block DA D2 receptors

Yes: block DA D2 receptors No No No

(+ = mild, ++ = moderate, and +++ = strong), References: 9, 13, 14, and 17.

dopaminergic A11 cell group. This system sends projections to the dorsal horn at all spinal levels and to the preganglionic sympathetic neurons (28). There is evidence that this system modulates pain inputs; when dysfunctional, it also may contribute to WED symptoms (28,29). In somatosensory physiology, PSS receptors in the legs receive information from the environment and convey signals to the somatosensory cortex via the dorsal root ganglia (23), and when this signaling is not appropriately modulated, WED symptoms may ensue. Phantom WED in patients with leg amputation and in WED patients secondary to total knee arthroplasty are examples of the importance of low-threshold sensitivity to stimulation of the peripheral sensory receptors (30-32). On their way to the cortex, the sensory axons synapse in various relay nuclei, in which electrochemical signals are regulated by a number of interspersed neurons (18,23). The primary neural modulation systems are the dopaminergic, GABAergic, glycinergic, and opioidergic systems (18,23). The GABAergic system is the predominant inhibitory system in the CNS (18), and if a drug has the ability to enhance GABA signaling, it may alleviate the WED symptoms. Drugs with this profile include benzodiazepines, benzodiazepine-like drugs, and carbamazepine. Drugs that inhibit the excitability of the sensory neurons that convey messages to the cortex include many anticonvulsant drugs, such as gabapentin, which is an analogue of GABA (27). Clonidine, which is an alpha-2 adrenergic receptor agonist, is a sympatholytic agent that relieves WED symptoms in many patients (27). The beneficial effects of clonidine on RLS symptoms highlight the importance of the connection between the sympathetic system (SS) and the TH axis. The SS has nerve projections to the thyroid gland and induces TH release (33) that, when excessive, may cause IMBTH/DA. Clonidine targets the enhanced functioning of the SS, which makes it a useful drug for alleviating WED symptoms that are occasionally generated in response to an exacerbation of the SS tonus. In iron-deficient patients, WED is more common or symptoms

subfamily (15,16). Pramipexole regulates the expression of many CYP450 enzymes through the tuberoinfundibular and mesolimbic dopaminergic pathways (10,11); furthermore, pramipexole administration decreases the release of TSH (12). These two pharmacological actions of pramipexole may be why it is effective as a WED treatmen. Xenobiotic drugs may also aggravate WED symptoms through decreased dopaminergic signaling (17) (Table 1). We believe that the non-genomic actions of TH, when unmodulated, underlie WED pathophysiology. TH acts on the mitochondria (18-20), which are responsible for adenosine triphosphate (ATP) production, and it is known that TH increases the number and activity of mitochondria (18). TH has a remarkable range of action in the nervous system, and it is essential for sensory systems (18,21). By increasing the production of ATP, TH increases synaptic transmission by enhancing purinergic neurotransmission (21,22). ATP, which is also a neurotransmitter, is now recognized as having a role in a wide range of nervous system activities, including pain and mechanosensory transduction (22). ATP acts as an excitatory neurotransmitter and is also present in neurons of the dorsal root ganglia (22,23). These neurons have an axon that is connected to peripheral somatosensory receptors (PSS) (23). By enhancing ATP production, TH enhances PSS receptor signaling to the somatosensory cortex; therefore, if modulation does not occur, WED symptoms may ensue. In the so called ‘‘forbidden zone for sleep,’’ the lowest propensity for sleep occurs in the few hours before sleep onset (during the human circadian rhythm) (24,25), concomitantly with a steep increase in the activity (thyrotropin-evening-surge) of the TH axis (26) and an increase in the daily severity of WED symptoms (2,3). Many medications relieve WED symptoms (17,27), and most of them are able to correct IMBTH/DA directly by inhibiting the TH axis (via CYP450) or indirectly by enhancing dopaminergic signaling (5,17). DA agonists also increase the activity of the diencephalon-spinal DA system, which arises from the dorsal posterior hypothalamic

470


CLINICS 2013;68(4):469-474

St. John’s wort and Willis-Ekbom’s disease Pereira Jr JC et al.

antidepressant. Thirteen patients were drug-naı¨ve. Eight patients had been taking pramipexole before the trial but had stopped taking the medication for various reasons, although their typical WED paresthesias had been almost entirely alleviated by the use of pramipexole. All of the nondrug-naı¨ve patients stopped taking pramipexole at least three weeks before the SJW trial, and their WED symptoms had returned. The concentrated extract of SJW used in this trial, which was purchased from Herbarium Laborato´rios (Curitiba, Parana´), is marketed in Brazil under the brand name Hipericin (300 mg of SJW dry extract in each capsule). This experiment used only one SJW extract provider; therefore, it was possible to establish that all of the patients would receive equal amounts of the drug. SJW was tested at a daily dose of 300 mg administered two or three hours before bedtime for ten days, during which time the patients received at least three telephone calls to verify treatment compliance. The patients were rated pre- and post-treatment using the IRLSSG severity rating scale (40), which was translated and validated in the Brazilian Portuguese language (41). After ten days of drug administration, the patients were asked about the benefits of the treatment and asked to report, in a face-to-face interview, their subjective impression of the benefit as a percentage of relief in a continuous scale from 0% (no improvement) to 100% (complete improvement). To appraise the study results, SJW was considered effective only if the patient expressed at least 70% relief of their WED symptoms. It was also necessary that the patients subjectively reported an increased quality of sleep during the treatment compared to before the treatment. From the eleventh day onward, patients who were successful in the initial ten-day SJW trial were prescribed the drug at a dosage of 300 mg for three additional months, not on a daily basis but according to their need to achieve relief from their WED symptoms. The patients took the medication for four to five days and then stopped taking it for as long as it would take for the WED symptoms to recur. During the second phase of the trial, the patients received at least one telephone call each week to ascertain their adherence to the treatment. At the completion of the second phase of the trial, the patients were questioned again in a face-to-face or telephone interview regarding their impressions of the ongoing treatment and were also asked if they would be willing to continue with SJW as a treatment for their WED. At the end of the second phase of the trial, all of the patients fulfilled out the IRLSSG rating scale, and the ratings obtained were compared to those taken before the treatment. Statistical analyses were performed using the mean, standard deviation, median, or relative and absolute frequencies. The scores were normally distributed (Kolmogorov-Smirnov test). The paired t-test was used to compare the scores and values before and after the treatment. We assumed p = 0.05 to be significant and used SAS 9.2 software (SAS Institute, Cary, NC, USA) to analyze the results. All of the patients had their TSH, free T4, hemoglobin and ferritin levels determined at the beginning of the trial.

are more severe, and WED patients who receive iron treatment (34,35) often obtain symptom relief. These findings strongly suggest that iron is central to WED pathophysiology. We believe that the role of iron in WED pathophysiology may also be explained by the notion that IMBTH/DA is the main cause of WED. Iron is a component of many enzymatic systems (18); therefore, it is reasonable to assume that when it is lacking, these enzymes will experience reduced activity levels in accordance with the severity of the iron deficienc. In the chain of reactions that lead to the synthesis of DA, iron is part of the enzyme tyrosine hydroxylase that catalyzes the conversion of tyrosine into L-DOPA. This step in the synthesis of DA is rate-limiting (36); as such, it is possible to infer that iron deficiency may result in decreased production of DA. Additionally, iron is an integral part of all cytochromes (18), including CYP450, which plays a critical role in the degradation of TH. As such, it is reasonable to assume that a lack of iron will upset the balance between TH and DA in two ways: by decreasing DA synthesis and diminishing TH metabolism.

& MATERIALS AND METHODS Saint John’s wort trial Saint John’s wort (SJW) is a standardized extract of hypericum perforatum L that is used to treat mild to moderate depression in adults and children older than six years of age. The usual adult dosage is 300 mg three times daily. SJW is considered to be a fairly safe drug and is devoid of serious side effects (37). SJW is an inducer of the CYP3A4 isoform (13,14) and is also believed to be a mild reuptake inhibitor of the monoamines dopamine, norepinephrine, and serotonin (37). Of the many compounds present in the concentrated extracts of SJW, it is believed that hyperforin is responsible for the induction of the CYP3A4 isoform (37). Compounds present in the hypericum perforatum bush vary according to different circumstances, such as the age of the herb, season of the year, and the different proportions of stalk, leaves, and flowers that are used to prepare the SJW extract (37). SJW acts as a ligand for the nuclear pregnane X receptor to enhance the expression of CYP4503A4 and also stimulates the expression of P-glycoprotein (Pgp) (38), which may result in decreased uptake of many xenobiotics and compounds, including TH. It is known that CYP3A4 and Pgp are coexpressed in many tissues, mainly in the liver and intestinal wall (8). WED patients (n = 21, 16 female) were told the objective of the trial, and they agreed to volunteer and signed a formal consent for this study, which was approved by the board of ethics on experimentation at our institution, the Faculdade de Medicina de Jundiaı´ (protocol number 227-2012). All of the studied patients were descendants of Italian and/or Portuguese families. The following inclusion criteria were applied: primary WED sufferers meeting all four criteria for WED according to the IRLSSG (39); experiencing WED symptoms at least three times a week; and having an IRLSSG severity score (39) of at least 15. Additionally, the patients should not have any clinical or therapeutic conditions that may conflict with the experimental drug, such as the use of drugs that are metabolized by CYP4503A4. Exceptions to this latter criterion were three patients who received TH replacement treatment and three patients who were being treated with a low-dosage

& RESULTS The age of the patients ranged from 12 to 76 years (median 48 years), and their median WED severity score, according to the International Restless Legs Syndrome

471


St. John’s wort and Willis-Ekbom’s disease Pereira Jr JC et al.

CLINICS 2013;68(4):469-474

Table 2 - Results for 21 WED patients treated with SJW. The alleviation of WED symptoms (percentage of relief) after the first ten-day treatment and subjective impressions of sleep quality improvement. Patients 14 2 1 1 3

% of Relief

Batter Sleep

100% 80% 70% 20% 0%

Yes Yes Yes No No

Study Group (IRLSSG) (39-41), ranged from 17 to 36 (median 24). After the initial ten-day treatment, 17 patients (81%) (14 female) reported experiencing .70% improvement of their WED symptoms and also reported better sleep during the treatment compared to before the treatment (Table 2). Regarding compliance with the first treatment phase, 11 patients reported that they did not take SJW for one day during the ten day-trial, and four patients did not take SJW on two days of the trial. The age of this successful ten-day treatment group was between 12 and 76 years, with an average of 49.2¡17.7 years and a median age of 53 years. Four patients (two female) reported no improvement during the ten-day trial, all of whom were drug-naı¨ve (ages 21, 42, 45 and 56 years, median WED severity score of 24). Of these four patients, two decided to take pramipexole, after which their WED symptoms were alleviated entirely. Two patients did not return for another interview. All of the patients whose symptoms were alleviated by the ten-day SJW trial agreed to take the drug for three more additional months. All of the patients in this second phase of the trial did not take the drug daily. The patients reported that during the three-month second-phase trial, they took the drug on average for 40 days. They stopped taking the drug for a few days, and then when the WED symptoms returned, they resumed taking the drug for a few days (35 days), and so on. Following cessation of the drug, the patients reported that they remained free of WED symptoms for 2-7 days (median 3). After completing the threemonth trial, all 17 patients reported a desire to continuously take SJW as a WED treatment. At the beginning of the trial, these 17 patients scored a median of 24 (¡5.1) points in the IRLSSG rating severity scale, and after the three-month treatment, the score was 4.1 (¡1). When the paired t-test was applied to compare scores and values before and after treatment, p,0.0001 was obtained (Figure 1). The TSH and free T4 levels measured in all of the patients showed results in the normal reference range for these parameters. None of the patients was anemic, and eight had ferritin levels under 45 mg/L (after the end of the trial they received iron therapy). In this open-label trial, SJW did not cause any side effects in any of the patients.

Figure 1 - Average (with standard deviation) WED severity scores pre- and post-treatment for the 17 successful patients. Paired ttest: p,0.0001

believe that SJW alleviated WED symptoms of the patients studied because it decreased TH levels by increasing TH degradation through the CYP3A4 enzyme isoform and, perhaps, by increasing Pgp expression. The results of this trial, despite its limitations, seem to add evidence favoring the IMBTH/DA theory as being central to WED pathophysiology. Interfering with the expression of CYP3A4, and perhaps also with Pgp, may decrease the severity of WED symptoms. Four patients did not experience relief from their WED symptoms, most likely because the extent to which the SJW enhanced their CYP3A4 TH metabolism was not sufficiently high (or the SJW dose used was too small) to decrease TH to lower levels that are compatible with DA counteraction. As explained in the introductory part of this manuscript, there are four pharmacological goals for WED drugs: 1) diminishing the TSH release, 2) enhancing the CYP3A4 expression, 3) modulating the WED sensation inputs on their pathway from the peripheral sensory receptors to the sensory cortex, and 4) diminishing the TH release by the thyroid gland by decreasing the SS activity. SJW most likely relieved the symptoms of the WED patients studied only by enhancing the expression of the CYP3A4 isoform. It is also theoretically possible that SJW alleviated WED symptoms by increasing the activity of the dopaminergic system. However, this specific action of SJW is recognized as mild and therefore most likely did not affect this trial. The IMBTH/DA of the WED patients is most likely subtle. In most WED cases, hyperthyroidism is not more prevalent than it is in normal subjects; therefore, the normal TSH and TH levels observed in all of the patients were not unexpected. During the second phase of the trial, all of the patients were able to become free of WED symptoms for a few days during brief interruptions of the SJW treatment. It is common that the induction or inhibition of CYP450 by xenobiotics lasts for a variable time after exposure to the drug is stopped. Thus, the few days of relief from WED symptoms after the SJW treatment was stopped were not unexpected.

& DISCUSSION The results of this pilot trial suggest that SJW may be an effective treatment for some WED patients. However, as this trial was not placebo-controlled, the extent to which SJW is effective as a WED treatment will depend on future, blinded, placebo-controlled studies, which could minimize the placebo effect. We do not advocate that SJW should be considered as a definitive treatment for WED; however, we

Final considerations A better understanding of the mechanisms by which drugs ameliorate or worsen WED symptoms may help in the development of new strategies for WED treatment. Furthermore, WED can be considered to be a condition

472


CLINICS 2013;68(4):469-474

St. John’s wort and Willis-Ekbom’s disease Pereira Jr JC et al. 11. Wo´jcikowski J, Golembiowska K, Daniel WA. Regulation of liver cytochrome P450 by activation of brain dopaminergic system: Physiological and pharmacological implications. Biochem Pharmacol. 2008;(12)675-9. 12. Shupnik MA, Greenspan SL, and Ridgway EC. Transcriptional regulation of thyrotropin subunit by thyrotropin-releasing hormone and dopamine in pituitary cell culture. J. Biol. Chem. 1986;261(12): 675-9. 13. Thummel KE, Wilkinson GR. In Vivo and in Vitro Drug Interactions involving Human CYP3A. Ann Rev Pharmacol Toxicol. 1998;38:389-430, http://dx.doi.org/10.1146/annurev.pharmtox.38.1.389. 14. Flockhart DA. Drug Interactions: Cytochrome P450 Drug Interaction Table. Indiana University School of Medicine (2007). http://medicine. iupui.edu/clinpharm/ddis/table.aspx. Accessed: June, 30, 2012. 15. Antonini A, Calandrella D. Pharmacokinetic evaluation of pramipexole. Expert Opin Drug MetabToxicol. 2011;7(10):1307-14, http://dx.doi.org/ 10.1517/17425255.2011.614232. 16. Schilling JC, Adamus WS, and Palluk R. Neuroendocrine and side effect profile of pramipexole, a new dopamine receptor agonist, in humans. Clin Pharmacol Ther. 1992;51(5):541-8, http://dx.doi.org/10.1038/clpt. 1992.60. 17. Hening WA, Allen RP, Walters AS, and Chokroverty S. Motor Functions and Dysfunctions of Sleep; in Chokroverty S, editor. Sleep Disorders Medicine, 2009; Saunders, Elsevier. Philadelphia. Pgs 397-435. 18. Guyton AC, Hall JE. Textbook of Medical Physiology, 11th edition. Elsevier Ltd, 2006. 19. Lys CV, Verstreken P. Mitochondria at the synapse. Neuroscientist. 2006;12(4):291-9. 20. Goglia F, Moreno M, Lanni A. Action of thyroid hormones at the cellular level: the mitochondrial target. FEBS Lett. 1999;452(3):115-20, http://dx. doi.org/10.1016/S0014-5793(99)00642-0. 21. Nunez J, Celi FS, Ng L, Forrest D. Multigenic control of thyroid functions in the nervous system. Mol Cell Endocrinol. 2008;287(1-2):1-12, http:// dx.doi.org/10.1016/j.mce.2008.03.006. 22. Burnstock G, Krugel U, Abbrachio MP, Illes P. Purinergic signaling: from normal behaviour to pathological brain function. Prog Neurobiol. 2011;95(2):229-74, http://dx.doi.org/10.1016/j.pneurobio.2011.08.006. 23. Ropper AH, Samuels MA. Adams and Victor’s Principles of Neurology, 9th edition, 2009. McGraw Hill. New York. 24. Lavie P. Sleep-Wake as a biological rhythm. Annu Rev Psychol. 2001;52:277-303, http://dx.doi.org/10.1146/annurev.psych.52.1.277. 25. Pereira Jr. JC, Alves RC. The ‘‘forbidden zone for sleep’’ might be caused by the evening thyrotropin surge and its biological purpose is to enhance survival: a hypothesis. Sleep Sci. 2011;4(3):105-9. 26. Brabant G, Prank K, Ranft U, Schuermeyer TOF, Wagner H, Hauser B, et al. Physiological regulation of circadian and pulsatile thyrotropin secretion in normal man and woman. J Clin Endocrinol Metab. 1990;70(2):403-9, http://dx.doi.org/10.1210/jcem-70-2-403. 27. Trenkwalder C, Hening WA, Montagna P, Oertel WH, Allen RP, Walters AS, Costa J, Stiasny-Kolster K, and Sampaio C. Treatment of restless legs syndrome: An evidence-based review and implications for clinical practice. Mov Disord. 2008;23(16):2267-302, http://dx.doi.org/10.1002/ mds.22254. 28. Lindvall O, Bjorklund A, and Scargerberg G. Dopamine-containing neurons in the spinal cord: Anatomy and some functional aspects. Ann Neurol. 1983;14(3):255-60, http://dx.doi.org/10.1002/ana.410140302. 29. Clemens S, Rye D, and Hochman S. Restless legs syndrome. Revisiting the dopamine hypothesis from the spinal cord perspective. NEUROLOGY, 2006;67:125-30, http://dx.doi.org/10.1212/01.wnl.0000223316.53428.c9. 30. Ekbom KA. Restless Legs in Amputees. Acta Med Scand. 1961;169(4) s419-21. 31. Pereira Jr. JC, Alves RsC. The principle of labelled-lines of the somatosensory system physiology might explain the phantom limb phenomenon. Med Hypotheses. 2011;77(5):853-6, http://dx.doi.org/10. 1016/j.mehy.2011.07.054. 32. Pereira Jr. JC, Silva Neto JLP, Pradella-Hallinan M. Restless legs syndrome in subjects with knee prosthesis: Evidence that symptoms are generated in the periphery. Clinics. 2011;66(11):1955-9, http://dx.doi. org/10.1590/S1807-59322011001100017. 33. Green ST. Intrathyroidal autonomic nerves can directly influence hormone release from rat thyroid follicles: study in vitro employing electrical field stimulation and intracellular microelectrodes. Clin Sci (Lond). 1987;72(2):233-8. 34. Allen RP, Adler CH, Du W, Butcher A, Bregman DB, Earley CJ. Clinical efficacy and safety of IV ferric carboxymaltose (FCM) treatment of RLS: a multi-centred, placebo-controlled preliminary clinical trial. Sleep Med. 2011;12(9):906-13, http://dx.doi.org/10.1016/j.sleep.2011.06.009. 35. Connor JR, Ponnuru P, Wang XS, Patton SM, Allen RP, Earley CJ. Profile of altered brain iron acquisition in restless legs syndrome. Brain. 2011;134(Pt 4):959-68, http://dx.doi.org/10.1093/brain/awr012. 36. Rye DB, and Freeman AAH. Dopamine in behavioral state control, in Monti JM, Pandi-Perumal SR, and Sinton CM: Neurochemistry of Sleep and Wakefulness. Cambridge University press. Cambridge 2008. Pgs 179-223.

whose severity may be influenced by interactions between xenobiotics and endogenous compounds. For WED patients, the importance of the CYP4503A4 isoform is magnified, and some practical issues may arise. For instance, it may not be advisable for these patients to consume grapefruit juice (popular in the United States) because it is a strong inhibitor of the CYP4503A4 isoform that may thus increase the severity of WED symptoms. Caffeine is also a moderate inhibitor of CYP4503A4; thus, the recommendation of refraining from caffeine after 4 PM might not be sufficient for WED patients because it is possible that the resulting CYP3A4 inhibition will persist well beyond the average half-life of caffeine. As Pgp is able to decrease the TH content of cells, it is reasonable to infer that this protein may also be involved in the fine adjustment of TH physiology. For the treatment of any health problem other than WED, therefore, it would be best for a WED patient to choose a treatment that does not inhibit CYP4503A. In spite of the inherent limitations of this open-label trial, we hope that its rationale and results may encourage further studies, including larger blind placebo-controlled trials that could demonstrate the extent to which SJW could be used to treat WED.

& ACKNOWLEDGMENTS We are indebted to Prof Karl Ekbom Jr. from the Department of Neurology of Karolinska University, Hospital/Huddinge in Stockholm, Sweden, for his helpful critique of the manuscript and kind assistance. We are also indebted to Prof. Moˆnica Andersen from the Department of Psicobiologia of the Universidade Federal Paulista in Sa˜o Paulo, Brazil, for her assistance during the course of the writing of this manuscript.

& AUTHOR CONTRIBUTIONS Pereira Jr JC conceived and designed the study and was also responsible for writing the manuscript, researching the pertinent literature, and prescribing the drug as well as performing the face-to-face interviews. PradellaHallinan M and Alves RC were responsible for revising the manuscript and providing important notes for it.

& REFERENCES 1. Ekbom K-A. Restless legs: a clinical study. Acta Med Scand. 1945;158: 1-122. 2. Ekbom Jr. K, J Ulfberg. Restless Legs Syndrome. J Intern Med. 2009; 266(5):419-31, http://dx.doi.org/10.1111/j.1365-2796.2009.02159.x. 3. Allen R. Restless Legs Syndrome (Willis-Ekbom’s Disease); in Carney PR, Geyer JD, and Berry RB: Clinical Sleep Disorders, 2nd edition, 2012, Lippincott Williams & Wilkins. Philadelphia. Pgs 203-18. 4. Eckeli AL, Gitaı´ LL, Dach F, Ceretta H, Sander HH, Passos AD, et al. Prevalence of restless legs syndrome in the rural town of Cassia dos Coqueiros in Brazil. Sleep Med. 2011;12(8):762-7, http://dx.doi.org/10. 1016/j.sleep.2011.01.018. 5. Pereira Jr JC, Pradella-Hallinan M, and Lins Pessoa JH. Imbalance between thyroid hormones and the dopaminergic system might be central to restless legs syndrome pathophysiology: A hypothesis. Clinics. 2010;65(5):547-54, http://dx.doi.org/10.1590/S1807-59322010000500013. 6. Delitala G. Dopamine and T.S.H secretion in man. Lancet. 1977;310:760-1, http://dx.doi.org/10.1016/S0140-6736(77)90259-8. 7. Visser TJ. Pathways of thyroid hormone metabolism. Acta Med. Austriaca. 1996;23:10-6. 8. Bruntom L, Parker K, Blumenthal D, and Buxton I. Goodman & Gilman’s Manual of Pharmacology and Therapeutics. McGraw-Hill, New York, 2008. 9. Preissner S, Kroll K, Dunkel M, Senger C, Goldsobel G, Kuzman D, et al. SuperCYP: a comprehensive database on Cytochrome P450 enzymes including a tool for analysis of CYP-drug interactions. Nucleic Acids Res. 2010;38(Database issue):D237-43, http://dx.doi.org/10.1093/nar/gkp970. 10. Wo´jcikowski J, Daniel WA. The brain dopaminergic system as an important center regulating liver cytochrome P450 in the rat. Expert Opin Drug Metab Toxicol. 2009;5(6):631-45, http://dx.doi.org/10.1517/ 17425250902973703.

473


St. John’s wort and Willis-Ekbom’s disease Pereira Jr JC et al.

CLINICS 2013;68(4):469-474

syndrome diagnosis and epidemiology workshop at the National Institutes of Health. Sleep Med. 2003;4(2):101-19, http://dx.doi.org/10. 1016/S1389-9457(03)00010-8. 40. Walters AS, LeBrocq C, Dhar A, Hening W, Rosen R, Allen RP, et al. Validation of the International Restless Legs Syndrome Study Group rating scale for restless legs syndrome. Sleep Med. 2003;4(2):121-32. 41. Masuko AH, Carvalho LB, Machado MA, Morais JF, Prado LB, Prado GF. Translation and validation into the Brazilian Portuguese of the restless legs syndrome rating scale of the International Restless Legs Syndrome Study Group. Arq Neuropsiquiatr. 2008;66(4):832-6, http:// dx.doi.org/10.1590/S0004-282X2008000600011.

37. Barnes J, Anderson LA, Phillipson JD. (2001), St John’s wort (Hypericum perforatum L.): a review of its chemistry, pharmacology and clinical properties. J Pharm Pharmacol. 2001;53(5):583-600, http://dx.doi.org/10. 1211/0022357011775910. 38. Moore LB, Goodwin B, Jones SA, Wisely BG, Serebjit-Singh CJ, Willson TM, et al. John’s wort induces hepatic drug metabolism through activation of the pregnane X receptor. PNAS. 2000;97(13):7500-502, http://dx.doi.org/10.1073/pnas.130155097. 39. Allen RP, Picchietti D, Hening WA, Trenkwalder C, Walters AS, Montplaisir J. Restless legs syndrome: diagnostic criteria, special considerations, and epidemiology. A report from the restless legs

474


CLINICAL SCIENCE

Expression of leukocyte-associated immunoglobulinlike receptor-1 (LAIR-1) on osteoclasts and its potential role in rheumatoid arthritis Yuan Zhang,I Yong Ding,II Yi Huang,III Chunmei Zhang,IV Boquan JinIV*, Ran ZhuangIV* I Fourth Military Medical University, Department of Physiology, Xi’an, China. II Fourth Military Medical University, Orthopaedic Department of Tangdu Hospital, Xi’an, China. III Fourth Military Medical University, Anesthesia Department of Xijing Hospital, Xi’an, China. IV Fourth Military Medical University, Department of Immunology, Xi’an, China. *corresponding author.

OBJECTIVE: Leukocyte-associated immunoglobulin-like receptor-1 is an inhibitory receptor primarily expressed by immune cells. This study was undertaken to define the role of this molecule in osteoclast differentiation and rheumatoid arthritis. METHODS: In vitro osteoclast assays were performed to characterize the role of Leukocyte-associated immunoglobulin-like receptor-1 in murine and human osteoclastogenesis. Human Leukocyte-associated immunoglobulin-like receptor-1 expression was assessed by immunohistochemistry staining in the synovium of patients with rheumatoid arthritis. The levels of soluble Human Leukocyte-associated immunoglobulin-like receptor-1 were determined by enzyme-linked immunosorbent assay. RESULTS: We found that multinucleated osteoclast formation from mouse bone marrow cells was inhibited by treatment with a monoclonal antibody against mouse Leukocyte-associated immunoglobulin-like receptor-1 in vitro. By immunohistochemistry, we found that Leukocyte-associated immunoglobulin-like receptor-1 was mainly expressed by macrophages in the inflamed synovial tissue of rheumatoid arthritis patients. In addition, serum and synovial fluid levels of soluble Leukocyte-associated immunoglobulin-like receptor-1 were higher in rheumatoid arthritis patients compared to healthy controls or osteoarthritis patients. Moreover, overexpression of Leukocyte-associated immunoglobulin-like receptor-1 in CD14+ monocytes from healthy volunteers also inhibited human osteoclastogenesis. CONCLUSION: Collectively, these data demonstrate for the first time that Leukocyte-associated immunoglobulin-like receptor-1 inhibits osteoclastogenesis. Therefore, these results may have therapeutic implications for the treatment of rheumatoid arthritis. KEYWORDS: Leukocyte-associated immunoglobulin-like receptor-1; Inhibitory Receptor; Osteoclasts; Rheumatoid Arthritis. Zhang Y, Ding Y, Huang Y, Zhang C, Jin B, Zhuang R. Expression of leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) on osteoclasts and its potential role in rheumatoid arthritis. Clinics. 2013;68(4):475-481. Received for publication on September 24, 2012; First review completed on October 24, 2012; Accepted for publication on December 7, 2012 E-mail: fmmuzhr@fmmu.edu.cn Tel.: +86-29-84774531-807

co-stimulatory signals generated by transmembrane immunoreceptors can cooperate to induce OC differentiation. Immunoglobulin (Ig)-like receptors, initially identified and well studied in the immune system, are a novel class of receptors that are critically involved in the regulation of bone homeostasis (3,4). Several studies have specifically suggested critical roles for Ig-like receptors of the leukocyte receptor complex (LRC)-encoded family in the control of osteoclastogenesis, such as the activatory receptors OCassociated receptor (OSCAR) and paired immunoglobulinlike receptor B (PIR-B). Leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) is an LRC-encoded transmembrane glycoprotein containing two immunoreceptor tyrosine-based inhibition motifs (ITIMs) in its cytoplasmic tail. LAIR-1 is broadly expressed on cells in the immune system, including natural killer (NK) cells, T cells, B cells, monocytes, and dendritic

& INTRODUCTION Osteoclasts (OCs), the only cell type capable of resorbing bone, are derived from bone marrow (BM) precursor cells of the monocyte-macrophage lineage (1). The disruption of the dynamic balance of the osteoblasts and OCs leads to pathological bone resorption, such as that observed in rheumatoid arthritis (RA) (2). It is well known that

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)07

475


Potential Role for LAIR-1 in Rheumatoid Arthritis Zhang Y et al.

CLINICS 2013;68(4):475-481

cells, as well as CD34+ hematopoietic progenitors (5,6). This receptor can inhibit the cytotoxicity of NK cells (activated lymphocyte killer cells) as well as the differentiation of blood precursors into dendritic cells (7-9). Mouse orthologs of human LAIR-1 (hLAIR-1) share ,40% protein sequence identity and the potent inhibitory capacity of hLAIR-1 (10). Interestingly, collagens are high-affinity ligands for LAIR molecules, and the interaction between LAIR-1 and collagen directly inhibits immune cell activation in vitro and may represent a novel mechanism of peripheral immune regulation mediated by the extracellular matrix (ECM) (11). The role of the co-stimulatory pathway downstream of immunoreceptor tyrosine-based activating motif (ITAM)harboring receptors in osteoclastogenesis has been extensively studied. However, the potential implication of ITIMharboring receptors remains unclear, and the existing literature shows conflicting results. In addition, the involvement of LAIR-1 in OC formation has not yet been studied. In the pathology of RA, chronic inflammation leads to bone destruction (12), and OCs is a key player in this process. For example, in a serum transfer model of inflammatory arthritis, animals that are unable to produce OCs do not show evidence of bone resorption despite the presence of inflammation (13). Therefore, we further investigated the possibility that LAIR-1 may be involved in the pathological process of inflammatory RA by modulating osteoclastogenesis.

sex-matched healthy volunteers and osteoarthritis (OA) patients served as controls. A total of 20–30 ml of whole blood was collected by venipuncture for routine laboratory investigations. Sera were isolated from 22 healthy individuals, 18 OA patients, and 17 RA patients. Meanwhile, synovial fluids were treated with hyaluronidase type IV at 20 U/ml (Sigma-Aldrich, St. Louis, MO, USA) for 20 min at 37 ˚C to reduce viscosity. The sera and synovial fluids were stored at -20 ˚C until use. Synovial tissue samples were obtained from RA patients at the time of surgical treatment.

In vitro osteoclastogenesis and mAb stimulation The induction of murine OCs in vitro was performed as previously described (6). Briefly, total murine BM was flushed from the tibias and femurs of two- to three-weekold mice, and freshly harvested BM cells were cultured at 56105 cells/ml in minimum essential medium (a-MEM) with 10% FBS containing 10 ng/ml M-CSF. After two days, non-adherent BM cells were discarded, and adherent cells were used as BM monocyte/macrophage lineage cells (BMMs). The BMMs were further cultured for 6 days in the presence of 100 ng/ml recombinant mouse receptor activator of nuclear factor kappa-B ligand (rmRANKL) and 10 ng/ml macrophage colony-stimulating factor (MCSF) to generate mature OCs. For osteoclastogenesis after mAb stimulation, 96-well flat-bottom plates were coated overnight at 4 ˚C with commercial anti-mLAIR-1 mAbs or control Abs at a concentration of 10 mg/ml in phosphatebuffered saline (PBS). BMMs were plated at 56105 cells/ml and then cultured as previously described for six days. The medium and factors were replaced after three days. For the human OC cultures, peripheral blood CD14+ monocytes were MACS-sorted from healthy volunteers, according to the guidelines of the ethics committee at our university. TRAP+ multinuclear cells (MNCs, .3 nuclei) were counted.

& MATERIALS AND METHODS Ethics All procedures were approved by the local ethics committee, and all of the participants provided written informed consent.

Regents and mice All media components were purchased from GIBCO (Carlsbad, CA, USA). Recombinant cytokines were purchased from R&D Biosystems, Inc. Bovine collagen II and culture-cell BSA and TRAP solutions (No. 387) were purchased from Sigma (St Louis, MO, USA). The functional purified antimouse LAIR-1 monoclonal antibodies (mAbs) and isotype control Abs were purchased from eBioscience (San Diego, CA, USA). Human CD14+ monocytes from PBMC were separated using magnetic MicroBeads (Miltenyi Biotec, Bergisch Gladbach, Germany). The anti-human antibodies against CD3, CD20, and CD68 were purchased from Maxin Biotechnology (Fuzhou, Fuzhou, China). The anti-mouse LAIR-1 (mLAIR-1) polyclonal antibody, anti-hLAIR-1 antibody (9.1C3), and sandwich ELISA kit for detecting soluble hLAIR-1 were established by our laboratory (14). C57BL/6 mice were purchased from the laboratory animal center at our university. All of the mice were cared for in accordance with the institutional guidelines for animal welfare.

Flow cytometric (FCM) analysis Rabbit polyclonal antibodies against the mLAIR-1 protein were prepared by immunization with the mLAIR-1-Fc fusion protein and were purified from rabbit sera using a Sepharose4B affinity column (Pharmacia, Peapack, NJ, USA) coupled with mLAIR-1-Fc. To analyze the cell surface expression of mLAIR-1, the cells were incubated with DyLight 649conjugated anti-mLAIR-1 polyclonal antibody and appropriate isotype controls (Pierce DyLight 649 labeling kit, Thermo scientific, Rockford, IL, USA). The procedures for mouse BM cell, BM-derived macrophage (BM-MW), and BMderived OC (BM-OC) immunofluorescence staining and FCM analysis were conducted as previously described (15). The cells were examined with a flow cytometer (FACS Calibur, BD, San Jose, CA, USA) and analyzed using the WinMDI software ver.2.9 (San Diego, CA, USA).

Patients

TRAP staining

RA patients were selected at random from the Tangdu Hospital at our university. All of the patients fulfilled the American College of Rheumatology classification criteria for RA and had a disease duration of .1 year. In all the RA patients, disease activity was measured with the Disease Activity Score 28-joint assessment (DAS28) (15). None of the patients were treated with TNF-a blocker therapy. Age- and

On day six of the BMM culture, the cells were washed with PBS and fixed with 4% paraformaldehyde. The cultures were then stained for TRAP by incubating the cells in a 0.1 M sodium acetate buffer (pH 5.0) containing naphthol AS-BI phosphoric acid sodium salt and fast red ITR salt in the presence of 10 mM sodium tartrate.

476


CLINICS 2013;68(4):475-481

Potential Role for LAIR-1 in Rheumatoid Arthritis Zhang Y et al.

Hematoxylin-eosin (HE) and immunohistochemistry (IHC) staining

Effect of LAIR-1 mAb on OC formation To investigate the involvement of LAIR-1 in OC formation, we next examined whether treatment with LAIR-1 mAb or collagen in the mono-culture system would affect OC formation. Mouse BMMs were cultured with M-CSF and RANKL for six days in the presence of commercial mLAIR-1 mAb, collagen, or control reagents. Note that we chose bovine collagen II as the ligand for stimulation because the LAIR-1 molecule interacts in a cross-species manner with various collagen molecules and recognizes the conserved Gly-Pro-Hyp repeats present in all collagen trimers. Figure 2A shows representative photographs of the effects of this treatment on TRAP+ multinucleated OC formation. MNC OC formation was significantly decreased in a mono-culture system of BMMs via the cross-linking of mLAIR-1 molecules by anti-mLAIR-1 mAb. These data indicate that LAIR-1 inhibits osteoclastogenesis in vitro (Figure 2B). However, collagen II, a high-affinity ligand for LAIR-1, did not significantly inhibit OC differentiation.

The synovial tissue obtained from RA patients was fixed in 10% formalin, embedded in paraffin, and stained with HE. For IHC staining, the Immunocruz staining system (Santa Cruz) was employed according to the manufacturer’s instructions. The sections were incubated with anti-hLAIR-1 antibody (9.1C3) or other primary antibodies; negative controls were performed by replacing the primary antibody with normal mouse Ig at the same concentration.

Lentiviral transductions Lenti-X lentiviral expression systems were used to overexpress hLAIR-1 according to the manufacturer’s instructions (Clontech, Mountain View, CA, USA). Briefly, the LAIR-1 open reading frame (ORF) was inserted into the Lenti-X plasmid vector and then co-transfected into Lenti-X 293T cells, using a Lenti-X HTX Packaging Mix, to produce recombinant lentivirus for target cell infection, as previously described (16). The resulting lentivirus-containing supernatants were used to infect healthy human CD14+ monocytes for 6–8 hours. The media were then exchanged with fresh a-MEM containing 10% FBS. Infected cells were cultured with 100 ng/ml rhRANKL and 30 ng/ml M-CSF for seven days, and the cells were harvested for assays.

LAIR-1-expressing cells in the synovial tissue of RA patients Given the importance of LAIR-1 as a co-stimulatory molecule in murine OC differentiation and function, we investigated the expression pattern of human LAIR-1 in the synovial tissue (Figure 3) of five RA patients by IHC. First, HE staining of the knee joint showed abundant inflammatory cell infiltration at the subsynovial tissues (Figure 3A), whereas positive staining was not observed in sections stained with the isotype control (Figure 3B). Anti-human CD3, CD20, and CD68 antibodies were used to detect the presence of T cells, B cells, and macrophages (Figures 3C-F). At the same time, staining with the anti-hLAIR-1 antibody revealed prominent colocalization with macrophage staining, which indicated (consistent with our previous results) that hLAIR-1 is highly expressed in differentiated mature macrophages.

Statistical analysis Normally distributed data were analyzed using the Student’s t-test; otherwise, the Wilcoxon signed rank test was used. All data were expressed as the mean ¡ SEM, and p,0.05 was considered to be statistically significant. All statistical tests were performed with the GraphPad Prism software version 4.0 (GraphPad Software, San Diego, CA, USA).

& RESULTS Expression of mLAIR-1 on OCs

Determination of soluble hLAIR-1 levels in patients with OA and RA

To date, the expression of LAIR-1 in the OC system has not been reported. Therefore, we first investigated the expression of LAIR-1 on mature OCs. The rabbit antimLAIR-1 polyclonal antibody was generated in our laboratory and used for the FCM analysis. Surface mLAIR-1 expression was predominantly detected on BM-MW and was expressed at a lower level by BM-OCs (Figure 1).

Because shedding of surface molecules is a commonly observed regulatory phenomenon, we developed a sandwich ELISA to investigate the presence of soluble hLAIR-1 in the serum and synovial fluid. The characteristics of the RA patients are summarized in the supplemental material (Table 1). Of the patients examined, 13 were female and four were male, and the mean patient age was 50.9¡17.3 years. The mean age of the healthy volunteers and OA patients was 51.7¡13.7 and 58.2¡6.4 years, respectively. The mean erythrocyte sedimentation rate (ESR) of the RA patients was 59.3 mm/h, and the mean DAS28 score was 5.5, indicating active disease. Overall, 20 of the 22 healthy volunteers showed detectable levels of serum soluble hLAIR-1 (average 2.72¡1.50 ng/ml, range 0.36–6.33 ng/ml). All of the patients with OA or RA were sera-soluble hLAIR-1-positive, with average concentrations of 3.61¡1.64 ng/ml (range 0.2– 6.33 ng/ml) and 7.15¡7.65 ng/ml (range 0.36–30.65 ng/ ml), respectively (Figure 4A). To explore whether hLAIR-1 is present at sites of inflammation, we measured soluble hLAIR-1 in the synovial fluids of patients with RA (n = 13). Soluble hLAIR-1 levels were compared to those found in the synovial fluids from patients with OA (n = 14) who suffered

Figure 1 - FCM analysis of cell-surface mLAIR-1 expression in freshly isolated BM cells BM-Mw, and BM-OC. After differentiation, the cells were stained with anti-mLAIR-1 polyclonal antibody (shaded histogram) or isotype control mAb (open histogram).

477


Potential Role for LAIR-1 in Rheumatoid Arthritis Zhang Y et al.

CLINICS 2013;68(4):475-481

Figure 2 - Effect of mLAIR-1 mAb on OC formation induced by soluble RANKL. OC formation was induced by M-CSF (10 ng/ml) and soluble RANKL (100 ng/ml) in the mono-culture system of BMMs. (A) Photomicrographs taken from the cultures stained for TRAP after six days of BM cell culture (magnification, 6100) with the basal medium, normal mouse IgG (mIgG), LAIR-1 mAb, BSA, and collagen. (B) Data are expressed as the number of TRAP+ MNC cells and represent the means ¡ SEM (n = 3), *p,0.01.

from joint degeneration with no detectable or mild inflammation, and the soluble hLAIR-1 concentrations in the synovial fluids from RA patients were significantly elevated (average 45.8¡24.4 ng/ml, range 13.6–91.2 ng/ml) compared to those in OA patients (average 22.9¡13.5 ng/ml, range 9.5–57.3 ng/ml, p,0.05) (Figure 4B). Thus, the increased soluble hLAIR-1 levels in RA synovial fluid seem to reflect the local inflammation in the joints of these patients.

& DISCUSSION LAIR-1 is a receptor for ECM collagens, and the interaction between LAIR-1 and collagens is of a high affinity and is dependent on the presence of hydroxyproline in a post-translational modification uniquely present in GlyPro-Hyp collagen repeats (20,21). However, when we used collagen II to stimulate mLAIR-1, no significant reduction in the final yield of TRAP+ MNCs was observed. Collagens are the most abundant ECM proteins in most animals, and they can also interact with activatory receptors, such as OSCAR. Therefore, the integral effect of collagens in controlling osteoclastogenesis remains unclear. It is not known whether the tyrosines in the ITIMs of LAIR-1 become phosphorylated and serve as docking sites for SHP-1 and SHP-2. However, it has been reported that LAIR-1 signaling is not impaired in cells deficient for the SHP-1 and SHP-2 phosphatases; thus, the C-terminal Src Kinase (Csk) may be the key downstream effector of LAIR-1 in cells where phosphatase activity is limited (17). Because Csk has been demonstrated as playing a key role in osteoclastogenesis (although it negatively regulates the kinase activity of c-Src) we hypothesized that LAIR-1 may regulate OC formation through Csk, although this must be further evaluated in subsequent studies (18,19). Very recently, Meyaard et al. demonstrated that the synovial fluid levels of soluble hLAIR-1 were significantly increased in RA patients and that LAIR-2 (soluble, homologous to hLAIR-1) levels in the urine were significantly correlated with markers of inflammation [23]. Our research

High level of hLAIR-1 expression decreases osteoclastogenesis in healthy humans ex vivo To further evaluate the significance of these findings in a clinical setting, we also assessed whether the hLAIR-1 molecule could negatively stimulate osteoclastogenesis using monocytes from humans. After culture with 100 ng/ml rhRANKL and 30 ng/ml M-CSF, a decreased number of TRAP+ MNCs were formed when hLAIR-1 lentivirus was added to CD14+ MACS-sorted blood monocytes as compared to the control group, which was infected with a control lentivirus (Figure 5). Furthermore, we failed to detect OC formation when there was no RANKL supplement in the culture medium (vehicle control). Lentivirus infection resulted in an average 89% gene transfer rate, as assessed by PCR (data not shown). These results demonstrated that the over-expression of hLAIR-1 in an in vitro mono-culture system negatively affected osteoclastogenesis. Together, our data reveal that activation of the LAIR-1 pathway inhibits in vitro osteoclastogenesis in both mice and humans.

478


CLINICS 2013;68(4):475-481

Potential Role for LAIR-1 in Rheumatoid Arthritis Zhang Y et al.

Table 1 - Characteristics of the studied RA patients*. Patient 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 *

Age/ gender

DAS28

CRP mg/ml

ESR mm/h

RF U/ml

sCD305 (ng/ml)

66/F 55/F 71/F 67/F 48/M 53/F 36/M 72/M 43/F 54/F 42/F 36/F 35/F 55/M 55/F 47/F 30/F

5.2 4.0 4.1 3.8 7.0 5.6 6.9 4.6 6.7 7.2 4.4 7.1 3.3 7.3 4.9 6.6 4.7

14.3 4.9 13.8 11.7 27.6 67.5 ,3 9.1 ,3 5.0 4.7 66.4 ,3 2.3 4.1 4.7 ,3

75 50 75 53 96 90 19 60 73 106 26 52 17 90 20 82 24

,20.0 ,20.0 ,20.0 24.0 197.0 514.0 ,20.0 ,20.0 192.0 23.3 ,20.0 772.0 143.0 233.0 26.8 132.0 76.3

1.11 4.76 1.33 6.01 6.33 4.76 2.02 4.16 30.65 4.76 0.36 3.87 18.33 2.52 7.68 8.37 14.5

DAS28 = Disease Activity Score 28-joint assessment; CRP = C-reactive protein (normal ,5 mg/l); ESR = erythrocyte sedimentation rate (normal ,10 mm/h), RF = rheumatoid factor (normal ,60 U/ml).

etanercept. Moreover, although Meyaard concluded that LAIR-2 was a more efficient antagonist of the LAIR-collagen interaction than soluble LAIR-1, LAIR-1 may also play an important role because the levels of soluble hLAIR-1 are much higher than those of LAIR-2. It is well known that many trans-membrane receptors can be shed from the cell surface and released into the circulation in soluble form when immune cells are activated. In many cases, the levels of soluble receptors in the circulation can be used as markers of disease severity. Using a sandwich ELISA, we found that the soluble level of hLAIR-1 in sera from healthy individuals was significantly higher than that in RA and OA patients. Furthermore, the soluble hLAIR-1 level in the synovial fluids from RA patients was higher than those in OA patients. These results indicate that increased hLAIR-1 may be released or shed from the cells of RA patients, suggesting that the circulating soluble LAIR-1 may regulate the inhibitory potential of membrane-bound LAIR-1 via

Figure 3 - Human LAIR-1immunohistochemistry in knee joint sections of RA patients. (C-F) The synovial samples obtained by arthroscopic synovectomy from five RA patients were analyzed by IHC for the expression of CD3,CD20, CD68, and hLAIR-1. (A and B) HE and isotype control staining for IHC are also shown (magnification, 6100).

group is more interested in the relationship between the level of soluble LAIR-1 and inflammatory arthritis. We found that the sera levels of soluble hLAIR-1 were significantly increased in RA patients, and this result is not fully consistent with Meyaard’s work. We think that the reason for this difference may be partially due to the patient samples that we used. All of the patients who participated in this research were never treated with any corticosteroids or biological recombinant medicine, such as adalimumab or

Figure 4 - Presence of soluble hLAIR-1 in the sera and synovial fluid of patients with RA or OA. Measurements were performed by ELISA, as described in the Materials and Methods. (A) The Wilcoxon signed rank test indicated a statistically significant elevation of soluble hLAIR-1 levels in the sera of RA patients compared to healthy controls, *p,0.05. (B) The Wilcoxon signed rank test indicated a statistically significant elevation of soluble hLAIR-1 levels in the synovial fluid of RA patients compared to OA patients, *p,0.05.

479


Potential Role for LAIR-1 in Rheumatoid Arthritis Zhang Y et al.

CLINICS 2013;68(4):475-481

Figure 5 - Human LAIR-1 influences CD14+ monocyte differentiation into mature OCs. Human CD14+ monocytes isolated from healthy volunteers were plated onto a 96-well plate. (A) Preosteoclasts were incubated with M-CSF/RANKL in the absence or presence of hLAIR1 lentivirus. After cell culturing with RANKL and M-CSF for seven days, TRAP staining was performed. Representative data are shown from three separate experiments, with similar results. (B) TRAP+ MNCs having . three nuclei were counted as OCs, *p,0.05.

5. Takai T. Roles of Fc receptors in autoimmunity. Nat Rev Immunol. 2002;2(8):580-92. 6. Koga T, Inui M, Inoue K, Kim S, Suematsu A, Kobayashi E, et al. Costimulatory signals mediated by the ITAM motif cooperate with RANKL for bone homeostasis. Nature. 2004;428(6984):758-63, http://dx. doi.org/10.1038/nature02444. 7. Ouyang W, Ma D, Lin D, Sun Y, Liu X, Li Q, et al. 9.1C3 is identical to LAIR-1, which is expressed on hematopoietic progenitors. Biochem Biophys Res Commun. 2003;310(4):1236-40, http://dx.doi.org/10.1016/j. bbrc.2003.09.152. 8. Meyaard L, Adema GJ, Chang C, Woollatt E, Sutherland GR, Lanier LL, et al. LAIR-1, a novel inhibitory receptor expressed on human mononuclear leukocytes. Immunity. 1997;7(2):283-90, http://dx.doi.org/10. 1016/S1074-7613(00)80530-0. 9. Verbrugge A, de Ruiter T, Geest C, Coffer PJ, Meyaard L. Differential expression of leukocyte-associated Ig-like receptor-1 during neutrophil differentiation and activation. J Leukoc Biol. 2006;79(4):828-36, http:// dx.doi.org/10.1189/jlb.0705370. 10. Poggi A, Tomasello E, Revello V, Nanni L, Costa P, Moretta L. p40 molecule regulates NK cell activation mediated by NK receptors for HLA class I antigens and TCR-mediated triggering of T lymphocytes. Int Immunol. 1997;9(9):1271-9, http://dx.doi.org/10.1093/intimm/9.9.1271. 11. Burns GF, Triglia T, Bartlett PF, Mackay IR. Human natural killer cells, activated lymphocyte killer cells, and monocytes possess similar cytotoxic mechanisms. Proc Natl Acad Sci U S A. 1983;80(24):7606-10, http://dx.doi.org/10.1073/pnas.80.24.7606. 12. Komatsu N, Takayanagi H. Inflammation and bone destruction in arthritis: synergistic activity of immune and mesenchymal cells in joints. Front Immunol. 2012;3:77, http://dx.doi.org/10.3389/fimmu. 2012.00077. 13. Goldring SR. Bone and joint destruction in rheumatoid arthritis: what is really happening? J Rheumatol Suppl. 2002;65:44-8. 14. Ouyang W, Xue J, Liu J, Jia W, Li Z, Xie X, et al. Establishment of an ELISA system for determining soluble LAIR-1 levels in sera of patients with HFRS and kidney transplant. J Immunol Methods. 2004;292(12):109-17, http://dx.doi.org/10.1016/j.jim.2004.06.005. 15. Prevoo ML, van ’t Hof MA, Kuper HH, van Leeuwen MA, van de Putte LB, van Riel PL. Modified disease activity scores that include twentyeight-joint counts. Development and validation in a prospective longitudinal study of patients with rheumatoid arthritis. Arthritis Rheum. 1995;38(1):44-8, http://dx.doi.org/10.1002/art.1780380107. 16. Lebbink RJ, de Ruiter T, Adelmeijer J, Brenkman AB, van Helvoort JM, Koch M, et al. Collagens are functional, high affinity ligands for the inhibitory immune receptor LAIR-1. J Exp Med. 2006;203(6):1419-25, http://dx.doi.org/10.1084/jem.20052554. 17. Meyaard L. LAIR and collagens in immune regulation. Immunol Lett. 2010;128(1):26-8, http://dx.doi.org/10.1016/j.imlet.2009.09.014. 18. Lebbink RJ, van den Berg MC, de Ruiter T, Raynal N, van Roon JA, Lenting PJ, et al. The soluble leukocyte-associated Ig-like receptor (LAIR)-2 antagonizes the collagen/LAIR-1 inhibitory immune interaction. J Immunol. 2008;180(3):1662-9. 19. Olde Nordkamp MJ, van Roon JA, Douwes M, de Ruiter T, Urbanus RT, Meyaard L. Enhanced secretion of leukocyte-associated immunoglobulin-like receptor 2 (LAIR-2) and soluble LAIR-1 in rheumatoid arthritis: LAIR-2 is a more efficient antagonist of the LAIR-1-collagen inhibitory

competition for ligands. However, the OCs in RA patients may be more prone to induction or activation because of the lower expression of LAIR-1 on the membrane after shedding. In this article, we demonstrated the negative regulatory role of LAIR-1 in osteoclastogenesis both in humans and in mice. We found that hLAIR-1 is highly expressed by CD68+macrophages from RA patients and that the levels of soluble hLAIR-1 in the sera and synovial fluid from RA patients were significantly greater than those in OA patients, which was also correlated with the levels of rheumatoid factor. Collectively, these results suggest that activated OC differentiation in RA patients may either be caused by the lower expression of hLAIR-1 (shed from the cell membrane) or because of the increased expression of LAIR-1 functional blockers such as soluble hLAIR-1. These findings support evidence for the regulation of OC formation by ITIM-harboring Ig-like receptors, which may have potential clinical significance in RA therapy.

& ACKNOWLEDGMENTS This work was supported by the National Natural Science Foundation of China (No. 30901309 and 30973039).

& AUTHOR CONTRIBUTIONS Zhang Y, Ding Y and Huang Y are the co-first authors. Jin B and Zhuang R are the corresponding authors. All of the authors contributed to the study conception and design, acquisition, analysis and interpretation of the data, manuscript drafting, critical revision for important content, and approval of the final version of the manuscript.

& REFERENCES 1. Teitelbaum SL. Bone resorption by osteoclasts. Science. 2000;289(5484): 1504-8, http://dx.doi.org/10.1126/science.289.5484.1504. 2. Kong YY, Feige U, Sarosi I, Bolon B, Tafuri A, Morony S, et al. Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. Nature. 1999;402(6759):304-9. 3. Chambers TJ. Regulation of the differentiation and function of osteoclasts. J Pathol. 2000;192(1):4-13, http://dx.doi.org/10.1002/10969896(2000)9999:9999,::AID-PATH645.3.0.CO;2-Q. 4. Massey HM, Scopes J, Horton MA, Flanagan AM. Transforming growth factor-beta1 (TGF-beta) stimulates the osteoclast-forming potential of peripheral blood hematopoietic precursors in a lymphocyte-rich microenvironment. Bone. 2001;28(6):577-82, http://dx.doi.org/10.1016/S87563282(01)00432-X.

480


CLINICS 2013;68(4):475-481

Potential Role for LAIR-1 in Rheumatoid Arthritis Zhang Y et al. 21. van Boekel MA, Vossenaar ER, van den Hoogen FH, van Venrooij WJ. Autoantibody systems in rheumatoid arthritis: specificity, sensitivity and diagnostic value. Arthritis Res. 2002;4(2):87-93, http://dx.doi.org/10.1186/ar395. 22. Chew FS. Radiology of the hands: review and self-assessment module. AJR Am J Roentgenol. 2005;184(6 Suppl):S157-68, http://dx.doi.org/10. 2214/ajr.184.6_supplement.0184s157.

interaction than is soluble LAIR-1. Arthritis Rheum. 2011;63(12):3749-57, http://dx.doi.org/10.1002/art.30612. 20. Schett G, Kiechl S, Weger S, Pederiva A, Mayr A, Petrangeli M, et al. High-sensitivity C-reactive protein and risk of nontraumatic fractures in the Bruneck study. Arch Intern Med. 2006;166(22):2495-501, http://dx. doi.org/10.1001/archinte.166.22.2495.

481


CLINICAL SCIENCE

Protective response in renal transplantation: no clinical or molecular differences between open and laparoscopic donor nephrectomy Christiano Machado,I Denise Maria Avancini Costa Malheiros,II Ari Adamy,I Luiz Sergio Santos,I Agenor Ferreira da Silva Filho,I William Carlos Nahas,III Francine Brambate Carvalhinho LemosIII I

Hospital de Caridade, Irmandade Santa Casa de Miserico´rdia de Curitiba, Division of Urology, Curitiba/PR, Brazil. II Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Pathology, Sa˜o Paulo/SP, Brazil. III Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Renal Transplantation Section, Division of Urology, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: Prolonged warm ischemia time and increased intra-abdominal pressure caused by pneumoperitoneum during a laparoscopic donor nephrectomy could enhance renal ischemia reperfusion injury. For this reason, laparoscopic donor nephrectomy may be associated with a slower graft function recovery. However, an adequate protective response may balance the ischemia reperfusion damage. This study investigated whether laparoscopic donor nephrectomy modified the protective response of renal tissue during kidney transplantation. METHODS: Patients undergoing live renal transplantation were prospectively analyzed and divided into two groups based on the donor nephrectomy approach used: 1) the control group, recipients of open donor nephrectomy (n = 29), and 2) the study group, recipients of laparoscopic donor nephrectomy (n = 26). Graft biopsies were obtained at two time points: T-1 = after warm ischemia time and T+1 = 45 minutes after kidney reperfusion. The samples were analyzed by immunohistochemistry for the Bcl-2 and HO-1 proteins and by realtime polymerase chain reaction for the mRNA expression of Bcl-2, HO-1 and vascular endothelial growth factor. RESULTS: The area under the curve for creatinine and delayed graft function were similar in both the laparoscopic and open groups. There was no difference in the protective gene expression between the laparoscopic donor nephrectomy and open donor nephrectomy groups. The protein expression of HO-1 and Bcl-2 were similar between the open and laparoscopic groups. Furthermore, the gene expression of B-cell lymphoma 2 correlated with the warm ischemia time in the open group (p = 0.047) and that of vascular endothelial growth factor with the area under the curve for creatinine in the laparoscopic group (p = 0.01). CONCLUSION: The postoperative renal function and protective factor expression were similar between laparoscopic donor nephrectomy and open donor nephrectomy. These findings ensure laparoscopic donor nephrectomy utilization in renal transplantation. KEYWORDS: Apoptosis; Gene Expression; Kidney Transplantation; Laparoscopy; Reperfusion Injury. Machado C, Malheiros DM, Adamy A, Santos LS, Silva Filho AF, Nahas WC, et al. Protective response in renal transplantation: no clinical or molecular differences between open and laparoscopic donor nephrectomy. Clinics. 2013;68(4):483-488. Received for publication on October 22, 2012; First review completed on November 18, 2012; Accepted for publication on December 11, 2012 E-mail: christianombr@yahoo.com Tel.: 55 41 3252-9943

activity and improved cosmesis (1-4). However, laparoscopically harvested kidneys may regain normal function more slowly than open-recruited organs, and their long-term graft survival is debatable (5). Prolonged warm ischemia time (WIT) is usually observed after laparoscopic surgery, but its effect on graft function is not completely understood. Furthermore, experimental studies have demonstrated that laparoscopy could increase renal ischemia-reperfusion injury (IRI) after renal transplantation (6,7). Renal IRI is an inherent event in renal transplantation, and the extent of graft damage reflects the balance between deleterious events and protective factors. One protective factor is heme-oxygenase-1, a heat shock protein that participates in vascular tone control and has anti-apoptotic,

& INTRODUCTION Laparoscopic donor nephrectomy (LDN) has gained widespread acceptance because of diminished donor morbidity compared with the open approach. LDN has better pain control, shorter hospital stays, faster return to normal

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)08

483


Protective response in renal transplantation Machado C et al.

CLINICS 2013;68(4):483-488

GGTGATGGCCT. The cycle number at which the reporter fluorescence crossed the threshold (CT value) was used as a quantitative measurement of the copies of the target in any sample, and the mean of the normalization of these values (DCT = CT target gene-CT housekeeping gene) was used for a comparison between groups. We emphasize that the greater the DCT, the lower the gene expression. We compared the laparoscopic group samples at time points T-1 and T+1 with the respective open group time points.

anti-inflammatory and antioxidant functions (8). Another important factor involved in the protective response is VEGF, a potent angiogenic factor that has been shown to be crucial in preserving vascular integrity and microcirculation repair (9). Bcl-2 is an anti-apoptotic protein that may play a role in renal transplantation by preventing apoptosis during ischemia. In deceased donors, a diminished mRNA expression of HO-1, VEGF and Bcl-2 had been previously observed compared with living donors. Furthermore, a correlation between renal function and HO-1 and VEGF was noted, which reinforced their protective roles in renal transplantation (10). To our knowledge, no study has investigated IRIprotective factors during laparoscopy. Therefore, we investigated whether LDN could affect the protective response of live renal transplantation.

Immunohistochemistry The renal biopsies were immersed in Dubosq solution for 30 minutes and fixed in 10% buffered formalin, embedded in paraffin, and sectioned. The slides were processed for routine histology. The protein expressions of Bcl-2 and HO1 were determined by immunohistochemistry in the renal biopsy samples. The primary antibodies used were mouse monoclonal anti-human HO-1 (Clone GTS-1; Novus Biological, Littleton City, CO, USA) and mouse monoclonal anti-human Bcl-2 (Clone 3.1, Novocastra, Newcastle upon Tyne City, UK). Each primary antibody utilized was previously titered in human renal tissue samples. A semiquantitative analysis was performed.

& PATIENTS AND METHODS Patient population Fifty-five patients who underwent living donor transplants from October 2009 to September 2011 at our institution were included in the analysis. The patients were further divided into two groups based on the donor nephrectomy approach that was used. The control group comprised 29 recipients who received kidneys retrieved by open donor nephrectomy (ODN), and the study group included 26 recipients of kidneys retrieved by LDN. This study was approved by the local ethics committee, and each patient provided informed consent. All of the patients included in the analysis received intraoperative induction therapy with anti-thymocyte globulin or basiliximab and a maintenance immunosuppression regimen with tacrolimus, mycophenolate and prednisone. Warm ischemia time was defined as the interval between the renal artery occlusion and the kidney immersion in ice slush. Renal function was evaluated by the serum creatinine level on days one to seven, day 30 and the third and sixth months after transplantation. The area under the curve for creatinine from the first to the ninetieth postoperative days was used to observe the creatinine decline. Delayed graft function (DGF) was defined as the need for dialysis during the first week after transplantation, and functional delayed graft function (FDGF) was defined as the absence of a decrease in the serum creatinine level of at least 10% per day for three consecutive days in the first week after renal transplantation. Renal allograft biopsies were obtained at two time points: after WIT (T-1) and 45 minutes after kidney reperfusion (T+1). The biopsies were divided into two pieces, with one used for immunohistochemistry and the other for RNA extraction.

Statistical analysis We used Fisher’s exact test for the categorical variables. Continuous variables were reported as the mean¡standard deviation and compared using Student’s t-test and an analysis of variance (ANOVA). The relationships between variables were assessed with Pearson’s correlation coefficient. All of the tests were two-tailed, and p,0.05 was considered statistically significant.

& RESULTS The demographics and clinical characteristics of the recipients and donors are shown in Table 1. There were no significant differences between the two groups regarding the baseline characteristics. Multiple arteries were observed in four patients (14%) in the open group and in three patients (12%) in the laparoscopic group. The mean WIT was significantly longer in the laparoscopic group compared with the open group (194 vs. 132 seconds; p = 0.005). DGF was observed in three patients, one (3%) in the open group and two (8%) in the laparoscopic group, with no significant difference (p = 0.60). FDGF occurred in four patients in the open group and in three cases in the laparoscopic group (14% vs. 12%, p = 0.99). Renal function after transplantation, as evaluated by the serum creatinine levels and the area under the curve of serum creatinine (AUCcr), was similar between the open (mean AUCcr = 122) and laparoscopic groups (mean AUCcr = 133, p = 0.33) (Figure 1). WIT was not associated with DGF, FDGF or AUCcr.

Real-time polymerase chain reaction (PCR) The mRNA expressions of Bcl-2, VEGF and HO-1 in renal tissue were analyzed with real-time PCR using a Taqman master mix (Applied Biosystems, Foster City, CA, USA) and the 7500 Real Time PCR system (Applied Biosystems, Foster City, CA, USA). The level of the different RNA factors in the renal tissue was normalized to the housekeeping gene 18S. The primers utilized were developed by Applied Biosystems. The sequences of the 59 primers used were 18S CCATTGGAGGGCAAGTCTGGTGCCA, Bcl-2 TAACGGAGGCTGGGATGCCTTTGTG, VEGF CAAGAAAAATGTGACAAGCCGAGGC and HO-1 GACGGCTTCAAGCT-

mRNA expression by Real-time PCR Bcl-2. Thirty-nine samples from 24 patients were analyzed for the mRNA expression of Bcl-2. In the open group, 13 samples were evaluated at time point T-1 and 11 samples after reperfusion at T+1. In the laparoscopic group, nine samples were evaluated at T-1 and six samples at T+1. The comparison between the kidneys retrieved by open and laparoscopic nephrectomy showed no significant difference at time points T-1 (open, mean DCT = 10.29 and

484


CLINICS 2013;68(4):483-488

Protective response in renal transplantation Machado C et al.

Table 1 - Recipient and donor characteristics at transplantation time. RECIPIENTS No. patients Mean age¡SD Gender female (%) BMI¡SD Induction suppression anti-IL2R Immunosuppression at three months Pred+Tacro+MP Prior Transfusion Prior pregnancy Re-transplant HLA Mismatches PRA ,10% 10-50% .50% DONORS Mean age ¡SD Donor type RLD URLD Age .50 y Donor gender Female (%) % Female donor/ Mean BMI¡SD

Open

Laparoscopic p-value

29 43¡12 16/29 (55%)

26 44¡14 13/26 (50%)

0.71 0.79

23.9¡4.1 23/29 (79%)

24.3¡4.3 20/26 (77%)

0.71 0.78

25/29 (86%) 0.90¡0.33 2¡2 0 (0%) 3.9¡1.9 19/27 (70%) 6/27 (22%) 1/27 (4%)

24/26 (92%) 0.93¡0.64 3¡2 2/26 (8%) 2.9¡2.1 15/23 (65%) 5/23 (22%) 3/23 (13%)

0.57 0.71 0.23 0.22 0.15 0.34

35¡10 24/29 (83%) 5/29 (17%) 2/29 (7%) 20/29 (69%)

36¡10 20/26 (77%) 6/26 (23%) 2/29 (8%) 21/26 (81%)

0.74 0.74

12/29 (41%) 24.5¡4

12/26 (46%) 26.2¡3

0.39 0.12

Figure 1 - Curve for the serum creatinine level decrease during the first days after transplantation.

Histological analysis and protein expression by immunohistochemistry During the preliminary histological analysis, we found the histological characteristics of acute tubular necrosis in 44% of samples in the open group and in 45% in the laparoscopic group. Only one patient in the open group had severe acute tubular necrosis. In the remaining samples, the changes were mild. A total of 86 samples were evaluated by immunohistochemistry for the protein expression of Bcl-2 and Heme oxygenase-1. Bcl-2 protein expression. Bcl-2 was expressed mainly at the tubular epithelial cells (Figure 2). Eighty-six biopsy specimens were available from forty-four patients for the evaluation of Bcl-2 protein expression. Compared with the open nephrectomy, the Bcl-2 protein expression in the laparoscopic group appeared to be increased. However, the difference was not significant. At the reperfusion time point T+1, there was a decrease in the mean expression of Bcl-2 in both groups, but the differences were not significant (Figure 3). Heme oxygenase-1 (HO-1) protein expression. Thirtyeight samples from twenty patients were evaluated at two time points. At T-1, 11 samples from the open group were evaluated, and 7 (63.6%) were positive for HO-1. In the laparoscopic group, seven samples were analyzed with one positive case (14.3%) (p = 0.07). After reperfusion (T+1), 11 samples were analyzed in the open group, with 5 (45.5%) positive for HO-1. In the 9 laparoscopic samples, 6 (66.7%) expressed the HO-1 protein (p = 0.41). The HO-1 protein expression at T+1 (after reperfusion) tended to increase compared with T-1 in the laparoscopic group (p = 0.06). No significant difference in HO-1 expression was observed between the two time points in the open group (p = 0.67) (Table 2).

0.99 0.37

BMI = body mass index; anti-IL2R = anti-interleucin-2 receptor (daclizumab/basiliximab); Pred = prednisone, Tacro = tacrolimus, MPS = mycophenolate sodium; PRA = panel-reactive antibody RLD = related living-donor URLD = unrelated living-donor.

laparoscopic, mean DCT = 9.98, p = 0.75) and T+1 (open, mean DCT = 10.94 and laparoscopic, mean DCT = 11.25, p = 0.82). To investigate any kinetic change in the mRNA during the nephrectomy procedure, we compared the Bcl-2 mRNA expression at T-1 and T+1 for each type of procedure. The comparison showed no differences between T-1 and T+1 for both the open (p = 0.77) and laparoscopic (p = 0.09) procedures. Vascular endothelial growth factor (VEGF). Thirty-five samples from 24 patients were analyzed for the mRNA expression. In the open group, 11 samples were evaluated at T1 and nine samples after reperfusion at T+1. In the laparoscopic group, eight samples were analyzed at T-1 and seven samples at T+1. There were no significant differences between the open and laparoscopic groups at T-1 (open, mean DCT = 10.66, and laparoscopic, mean DCT = 10.38, p = 0.64) and T+1 (open, mean DCT = 11.11 and laparoscopic, mean DCT = 11.71, p = 0.52). When the two time points (T-1 and T+1) were compared in each group, no differences were observed (open, p = 0.70 and laparoscopic, p = 0.26). Heme-oxygenase 1 (HO-1). From 24 patients, 39 samples were quantified for the mRNA expression levels of HO-1. In the open group, 13 samples were evaluated at T-1, and 10 samples at T+1. In the laparoscopic group, 9 samples were evaluated at T-1, and 7 samples after reperfusion (T+1). No difference was observed for the comparison of the two groups at T-1 (open: mean DCT = 10.86 and laparoscopic: mean DCT = 10.11; p = 0.57) and T+1 (open: mean DCT = 10.42 and laparoscopic: mean DCT = 10.90; p = 0.76). No differences were observed for the comparison of the two time points (p = 0.45 and p = 0.40 for the open and laparoscopic groups, respectively).

Relationship between mRNA and protein expression and the clinical parameters When we analyzed the mRNA expression findings and their correlation with the clinical and surgical features, we noticed a correlation between WIT and DCT Bcl-2 in the open group at the moment of kidney retrieval (T-1) (Pearson r = 0.582, p = 0.047). This correlation indicated that in open nephrectomy, a longer warm ischemia time was associated

485


Protective response in renal transplantation Machado C et al.

CLINICS 2013;68(4):483-488

Figure 2 - Immunohistochemical staining for Bcl-2 (A) and HO-1 (B), expressed predominantly in the renal tubule cells.

with a lower expression level of the Bcl-2 mRNA. The AUCcr was negatively correlated with the DCT of VEGF in the laparoscopic group after reperfusion (Pearson r = -0.919, p = 0.01), i.e., a slower decline of creatinine correlated with a higher expression level of the VEGF mRNA in the laparoscopic group (Figure 4).

nephrectomy on renal function, such as the decline in creatinine for three consecutive days after the transplantation and the area under the curve for creatinine. This last parameter could be useful for identifying any mild changes in the serum creatinine decline during the first weeks after transplantation. Analyzing all of these parameters, we observed no differences in the allograft renal functions of laparoscopic and open nephrectomy recipients. Similarly, a systematic review of the literature revealed a comparable recovery of renal function and DGF incidence between open and laparoscopic renal transplantations (14). The loss of tubular epithelial cells is the main histological finding of the tissue damage caused by renal ischemiareperfusion injury. In our study, acute tubular necrosis was observed in 44% of the patients in the open nephrectomy group and in 45% in the laparoscopic group. The pathological analysis showed a mild lesion, with only one patient having a severe lesion that developed into DGF. A histopathological evaluation of the donor kidneys procured by laparoscopic nephrectomy was previously performed by Shimizu et al. (15). The authors found that 54% of the specimens had subcapsular cortical damage, which was much more intense in the hand-assisted laparoscopy group; this damage was most likely caused by pneumoperitoneum and mechanical injury during surgical manipulation. In the Shimizu et al. study, the description of acute tubular necrosis was analyzed together with the congestion of glomerular and peritubular capillaries. We did not find these vascular lesions in our groups, but the high percentage of acute tubular necrosis appeared to be a relevant finding even without significant renal function changes. The inflammatory response during ischemia-reperfusion was mediated by different mechanisms and molecules. In our samples, we analyzed the gene expression levels of INFc, TNFa and IL-6, and we did not observe any differences between open and laparoscopic nephrectomy

& DISCUSSION In the present study, the protective response of the renal tissue was investigated in the context of ischemia reperfusion injury during a laparoscopic kidney nephrectomy. Compared with conventional open nephrectomy, the patients transplanted with kidneys retrieved by a laparoscopic procedure had similar renal functions after transplantation, and differences were not observed in the protective response. The most evident clinical manifestation of tissue damage caused by renal ischemia reperfusion injury is the occurrence of delayed graft function (DGF), which impacts both short and long-term graft survival (11,12). In several centers, the DGF in living donor transplantation is approximately 5%, which is similar to our findings (13). In our study, the incidence of DGF was 3% in the open nephrectomy group and 8% in the laparoscopic group; these rates were not significantly different. In addition to the DGF criteria, we used other parameters to better evaluate any impact from

Table 2 - Comparison of the HO-1 protein expression between the LDN and ODN groups at two time points. Groups ODN LDN

Figure 3 - Comparison of the mean protein expression of Bcl-2 ยก 1 standard deviation. Open group: T-1 = 13ยก10 and T+1 = 11ยก11; Laparoscopic group: T-1 = 20ยก19 and T+1 = 17ยก17 (p = NS, ANOVA).

p-value

T-1

T+1

p-value

7/11 (63.6%) 1/7 (14.3%) n = 18 0.07

5/11 (45.5%) 6/9 (66.7%) n = 20 0.41

0.67 0.06

LDN = laparoscopic donor nephrectomy. ODN = open donor nephrectomy.

486


CLINICS 2013;68(4):483-488

Protective response in renal transplantation Machado C et al.

decrement of serum creatinine after transplantation, which suggested that in situations with more intense injury, an increase in VEGF may represent an attempt to repair damaged tissue and that this protective gene was not inhibited during the laparoscopic surgery. Concerns about a prolonged warm ischemia time (WIT) and its effect on renal allograft function always existed in the laparoscopic era. Nogueira et al. (23) found a prolonged WIT as a risk factor for delayed graft function in the grafts of laparoscopic donors. In contrast, Buzdon et al. (24) and Simforoosh et al. (25) did not find decreased renal function as a consequence of longer WIT. In our series, the laparoscopic group had a longer WIT than the open group but did not have higher rates of DGF or functional DGF. Furthermore, no association between the WIT and serum creatinine decline was observed. However, the WIT was weakly associated with diminished Bcl-2 gene expression after kidney open retrieval, which could reflect a decreased protective response in open surgery when the kidney is exposed to periods of prolonged oxygen deprivation. In the laparoscopic group, this association was not observed and may reflect ischemic preconditioning, as the kidney is continuously exposed to parenchyma compression caused by pneumoperitoneum pressure. In animals, it has been demonstrated that hypoxic preconditioning might activate HIF-1a, leading to an increase in the Bcl-2 protein expression (26). In laparoscopy, apoptosis has been shown to increase in rats that are submitted to different pneumoperitoneum gradients of pressure, which suggests that an elevation of intra-abdominal pressure could increase the ischemiareperfusion injury and cause apoptosis (27). However, in our study, we found no differences in the gene and protein expression of Bcl-2 in the laparoscopic and open groups. Therefore, a negative effect of the pneumoperitoneum, with respect to renal apoptosis, was not observed. Although our study analyzed a limited sample size, we were careful to evaluate different moments of tissue injury during the nephrectomy and to also analyze expression at both the gene and protein levels. The immunohistochemistry analysis revealed Bcl-2 and HO-1 protein expression in the tubular epithelial cells with no differences between the open and laparoscopic groups. However, there were decreases in the mean Bcl-2 protein and gene expressions after reperfusion; these decreases were not significantly different. During the first time-point biopsy, we observed a trend towards lower protein expression for the HO-1 protein expression in the laparoscopic group, whereas after reperfusion, there was a trend towards increased HO-1 protein expression. Interestingly, other authors have reported similar results. Ollinger et al. (28) observed a quantitative increase in the HO-1 expression after reperfusion in deceased renal transplantation biopsies; this increase was associated with delayed graft function and higher increases in the HO-1 protein levels from pre- to postreperfusion. Finally, this investigation analyzed aspects of renal IRI in LDN that have not been previously studied. The renal function of the recipients of LDN and ODN and protective factors of renal ischemia reperfusion injury in the renal tissue of LDN and ODN were similar. Therefore, these findings are important for reinforcing laparoscopic nephrectomy utilization in live renal transplantation.

Figure 4 - A) Correlation between the Bcl-2 mRNA expression levels after kidney retrieval and the warm ischemia time in open surgery. B) Correlation between the VEGF mRNA expression levels after reperfusion and the area under the curve of the serum creatinine level in the laparoscopic surgery group.

(data not shown). Based on previous reports highlighting the importance of the protective response to counterbalance the injury during ischemia-reperfusion, we investigated this adaptive response during the laparoscopic nephrectomy (16-18). We investigated the protective molecules HO-1 and VEGF. Heme oxygenase-1, which is induced by hypoxia, plays a critical role in the renal protective response because of its anti-apoptotic, anti-inflammatory and antioxidant properties and its vascular tone regulation (19). As an important angiogenic factor, VEGF is essential for maintaining peritubular capillaries, which maintain adequate renal tubule and interstitium blood supplies (20). Experimental studies have observed VEGF reduction after ischemia reperfusion injury, particularly when the kidney was submitted to a prolonged period of ischemia (21,22). In our study, we did not find any difference in the HO-1 and VEGF gene transcript levels between the open and laparoscopic groups after the warm ischemia time or after 45 minutes of reperfusion. Note that a further change in the mRNA expression cannot be excluded and that the duration of 45 minutes could be still too early to identify any different patterns between the groups. In this regard, we observed that a higher VEGF mRNA expression in the laparoscopic group after reperfusion was associated with a slower

487


Protective response in renal transplantation Machado C et al.

CLINICS 2013;68(4):483-488

11. Siedlecki A, Irish W, Brennan DC. Delayed graft function in the kidney transplant. Am J Transplant. 2011;11(11):2279-96. 12. Yarlagadda SG, Coca SG, Formica RN Jr, Poggio ED, Parikh CR. Association between delayed graft function and allograft and patient survival: a systematic review and meta-analysis. Nephrol Dial Transplant. 2009;24(3):1039-47. 13. Perico N, Cattaneo D, Sayegh MH, Remuzzi G. Delayed graft function in kidney transplantation. The Lancet. 2004;364(9447):1814-27, http://dx. doi.org/10.1016/S0140-6736(04)17406-0. 14. Greco F, Hoda MR, Alcaraz A, Bachmann A, Hakenberg OW, Fornara P. Laparoscopic living-donor nephrectomy: analysis of the existing literature. Eur Urol. 2010;58(4):498-509, http://dx.doi.org/10.1016/j.eururo. 2010.04.003. 15. Shimizu T, Tanabe K, Ishida H, Toma H, Yamagushi Y. Histopathological evaluation of 0-h biopsy specimens of donor kidney procured by laparoscopic donor nephrectomy. Clin Transplant. 2004;18(Suppl.11):24-8, http://dx.doi.org/10.1111/j.1399-0012.2004.002 43.x. 16. Exner M, Bo¨hmig GA, Schillinger M, Regele H, Watschinger B, Ho¨rl WH, et al. Donor heme oxygenase-1 genotype is associated with renal allograft function1. Transplantation. 2004;77(4):538-42, http://dx.doi. org/10.1097/01.TP.0000113467.36269.F8. 17. Faleo G, Neto JS, Kohmoto J, Tomiyama K, Shimizu H, Takahashi T, et al. Carbon monoxide ameliorates renal cold ischemia-reperfusion injury with an upregulation of vascular endothelial growth factor by activation of hypoxia-inducible factor. Transplantation. 2008;85(12):1833-40, http:// dx.doi.org/10.1097/TP.0b013e31817c6f63. 18. Ferenbach DA, Kluth DC, Hughes J. Hemeoxygenase-1 and renal ischaemia-reperfusion injury. Nephron Exp Nephrol. 2010;115(3):e33-7, http://dx.doi.org/10.1159/000313828. 19. Abraham NG,Cao J, Sacerdoti D, Li X, Drummomd G. Heme oxygenase: the key to renal function regulation. Am J Physiol Renal Physiol. 2009;297:F1137-52, http://dx.doi.org/10.1152/ajprenal.90449.2008. 20. Ferrara N. The Biology of Vascular Endothelial Growth Factor. Endocr Rev. 1997;18(1):4-25, http://dx.doi.org/10.1210/er.18.1.4. 21. Basile DP, Fredrich K, Chelladurai B, Leonard EC, Parrish AR. Renal ischemia reperfusion inhibits VEGF expression and induces ADAMTS-1, a novel VEGF inhibitor. Am J Physiol Renal Physiol. 2008;294:F928-F36, http://dx.doi.org/10.1152/ajprenal.00596.2007. 22. Constantinides CA, Tyritzis SI, Evangelou C, Kyroudi A, Liatsikos E, Karamessinis P, et al. Vascular endothelial growth factor protein expression in a renal ablation rabbit model under prolonged warm and cold ischemia. Am J Nephrol. 2008;28(3):438-45. 23. Nogueira JM, Haririan A, Jacobs SC, Weir MR, Hurley HA, Al-Qudah HS, et al. The detrimental effect of poor early graft function after laparoscopic live donor nephrectomy on graft outcomes. Am J Transplant. 2009;9(2):337-47. 24. Buzdon MM, Cho E, Jacobs SC, Jarrell B, Flowers JL. Warm ischemia time does not correlate with recipient graft function in laparoscopic donor nephrectomy. Surg Endosc. 2003;17(5):746-9, http://dx.doi.org/ 10.1007/s00464-002-8860-4. 25. Simforoosh N, Basiri A, Shakhssalim N, Ziaee SAM, Tabibi A, Moghaddam SMMH. Effect of warm ishemia on graft outcome in laparoscopic donor nephrectomy. J Endourol. 2006;20(11):895-8, http:// dx.doi.org/10.1089/end.2006.20.895. 26. Yang CC, Lin LC, Wu MS, Chien CT, Lai MK. Repetitive hypoxic preconditioning attenuates renal ischemia/reperfusion induced oxidative injury via upregulating HIF-1 alpha-dependent bcl-2 signaling. Transplantation. 2009;88(11):1251-60, http://dx.doi.org/10.1097/TP. 0b013e3181bb4a07. 27. Khoury W, Jakowlev K, Fein A, Orenstein H, Nakache R, Weinbroum AA. Renal apoptosis following carbon dioxide pneumoperitoneum in a rat model. J Urology. 2008;180(4):1554-8. 28. Ollinger R, Kogler P, Biebl M, Sieb M, Sucher R, Bosmuller C, et al. Protein levels of heme oxygenase-1 during reperfusion in human kidney transplants with delayed graft function. Clin Transplant. 2008;22(4):41823, http://dx.doi.org/10.1111/j.1399-0012.2008.00800.x.

& ACKNOWLEDGMENTS Funding for this study was provided by Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP).

& AUTHOR CONTRIBUTIONS Machado C contributed to the conception and design, data acquisition, analysis and interpretation, drafting of the manuscript and statistical analysis. Malheiros DM contributed to the data acquisition and technical support. Adamy A contributed to the data interpretation, drafting of the manuscript, critical revision of the manuscript for important intellectual content and statistical analysis. Santos LS and Silva Filho AF contributed to the data acquisition and critical revision of the manuscript for important intellectual content. Nahas WC contributed to the conception and design, data acquisition, analysis and interpretation and obtained funding. Lemos FB contributed to the conception and design, data acquisition, analysis and interpretation, drafting of the manuscript, statistical analysis and technical support.

& REFERENCES 1. Ratner LE, Kavoussi LR, Schulam PG, Bender JS, Magnuson TH, Montgomery R. Comparison of laparoscopic live donor nephrectomy versus the standard open approach. Transplant proc. 1997;29(1-2):138-9, http://dx.doi.org/10.1016/S0041-1345(96)00037-1. 2. Andersen MH, Mathisen L, Oyen O, Edwin B, Digernes R, Kvarstein G, et al. Postoperative pain and convalescence in living kidney donorslaparoscopic versus open donor nephrectomy: a randomized study. Am J Transplant. 2006;6(6):1438-43. 3. Kim FJ, Ratner LE, Kavoussi LR. Renal Transplantation: Laparoscopic Live Donor Nephrectomy. Urol Clin North Am. 2000;27(4):777-85, http://dx.doi.org/10.1016/S0094-0143(05)70125-7. 4. Khauli RB E-HY, Hussein M, Dagher FJ, Medawar W, Houjaij A, et al. A controlled sequential evaluation of open donor nephrectomy versus classical and modified laparoscopic donor nephrectomy: an update. Transplant Proc. 2005;37(7):2944-6, http://dx.doi.org/10.1016/j.transproceed. 2005.08.016. 5. Troppmann C, Ormond DB, Perez RV. Laparoscopic (vs. Open) Live Donor Nephrectomy: A UNOS Database Analysis of Early Graft Function and Survival. Am J Transplant. 2003;3(10):1295-301. 6. Burgos F, Pascual J, Briones G, Cuevas B, Villafruela J, Correa C, et al. Influence of laparoscopic live donor nephrectomy in ischemia–reperfusion syndrome and renal function after kidney transplantation: an experimental study. Transplant Proc. 2003;35(5):1664-5, http://dx.doi. org/10.1016/S0041-1345(03)00622-5. 7. Kurian SM, Flechner SM, Kaouk J, Modlin C, Goldfarb D, Cook DJ, et al. Laparoscopic Donor Nephrectomy Gene Expression Profiling Reveals Upregulation of Stress and Ischemia Associated Genes Compared to Control Kidneys. Transplantation. 2005;80(8):1067-71, http://dx.doi. org/10.1097/01.tp.0000176485.85088.f7. 8. Holzen JP, August C, Bahde R, Minin E, Lang D, Heidenreich S, et al. Influence of heme oxygenase-1 on microcirculation after kidney transplantation. J Surg Res. 2008;148(2):126-35, http://dx.doi.org/10. 1016/j.jss.2007.10.007. 9. Masuda Y, Shimizu A, Mori T, Ishiwata T, Kitamura H, Ohashi R, et al. Vascular Endothelial Growth Factor Enhances Glomerular Capillary Repair and Accelerates Resolution of Experimentally Induced Glomerulonephritis. Am J Pathol. 2001;159(2):599-608. 10. Lemos FBC, Ijzermans JN, Zondervan P, Peeters AMA, Van Den Engel S, Mol WM, et al. Differential expression of heme oxygenase-1 and vascular endothelial growth factor in cadaveric and living donor kidneys after ischemia-reperfusion. J Am Soc Nephrol. 2003;14(12):3278-87, http://dx. doi.org/10.1097/01.ASN.0000098683.92538.66.

488


CLINICAL SCIENCE

Sexual behavior among high school students in Brazil: alcohol consumption and legal and illegal drug use associated with unprotected sex Zila M. Sanchez,I Solange A. Nappo,I Joselaine I. Cruz,I Elisaldo A. Carlini,I Claudia M. Carlini,I Silvia S. MartinsII I

Escola Paulista de Medicina da Universidade Federal de Sa˜o Paulo, Brazilian Center of Information of Psychotropic Drugs, Department of Preventive Medicine, Sa˜o Paulo/SP, Brazil. II Columbia University, Department of Epidemiology, New York/NY, USA.

OBJECTIVE: Alcohol and other drug use appears to reduce decision-making ability and increase the risk of unsafe sex, leading to possible unplanned pregnancies, sexually transmitted diseases/human immunodeficiency virus/HIV transmission, and multiple sexual partners. This study aimed to test the hypothesis that risky sexual behaviors among adolescents are associated with legal and illegal drug use. METHODS: A national cross-sectional survey of 17,371 high-school students was conducted in 2010. Students were selected from 789 public and private schools in each of the 27 Brazilian state capitals by a multistage probabilistic sampling method and answered a self-report questionnaire. Weighted data were analyzed through basic contingency tables and logistic regressions testing for differences in condom use among adolescents who were sexually active during the past month. RESULTS: Approximately one third of the high school students had engaged in sexual intercourse in the month prior to the survey, and nearly half of these respondents had not used a condom. While overall sexual intercourse was more prevalent among boys, unsafe sexual intercourse was more prevalent among girls. Furthermore, a lower socioeconomic status was directly associated with non-condom use, while binge drinking and illegal drug use were independently associated with unsafe sexual intercourse. CONCLUSION: Adolescent alcohol and drug use were associated with unsafe sexual practices. School prevention programs must include drug use and sexuality topics simultaneously because both risk-taking behaviors occur simultaneously. KEYWORDS: Sexual Risky Behavior; Binge Drinking; Illegal Drug Use; School Survey; Adolescents. Sanchez ZM, Nappo SA, Cruz JI, Carlini EA, Carlini CM, Martins SS. Sexual behavior among high school students in Brazil: alcohol consumption and legal and illegal drug use associated with unprotected sex. Clinics. 2013;68(4):489-494. Received for publication on August 20, 2012; First review completed on October 22, 2012; Accepted for publication on December 19, 2012 E-mail: zila.sanchez@gmail.com Tel.: 55 11 5576-4997

drinking behavior pattern is often carried out by these teenagers at parties and nightclubs, despite the sale of alcoholic beverages and entry into nightlife environments being prohibited to adolescents younger than 18 years of age in this country (2). Particularly in the nightlife environment, youth may associate alcohol consumption with sexual practices, believing that alcohol may act as a facilitator for sexual encounters. After drinking, young individuals feel more confident to attempt a sexual approach (3). Moreover, there is a belief that alcohol consumption can help improve sexual performance and increase sexual pleasure (4). However, alcohol and other psychotropic drugs appear to be associated with unsafe sex. English young adults who drank and used illegal drugs had more sexual partners and had engaged in more episodes of unsafe sex compared with the abstainers from alcohol or drugs (5). In Africa, binge drinking episodes were causally associated with unsafe sex and sexual violence among adults (6).

& INTRODUCTION Adolescence is characterized by emotional, social and physical transformations that can expose young people to emotional and health vulnerabilities. In this period of development, young people begin to engage in risky behaviors, such as alcohol/drug use and unsafe sex (1). In Brazil, the onset of alcohol use occurs on average during adolescence, and approximately 35% of high school students tend to engage in binge drinking (defined as drinking five or more doses of alcohol on one occasion). This

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)09

489


Drug use and unprotected sex among adolescents Sanchez ZM et al.

CLINICS 2013;68(4):489-494

Alcohol use reduces decision-making ability and decreases the chances of rejection of an unwanted sexual act, leading to possible pregnancy, STD/HIV transmission and multiple sexual partners (7). Some authors have emphasized the ‘‘Alcohol Myopia Theory’’ to explain risk behaviors associated with the pharmacological effects of alcohol. This theory suggests that when a person consumes alcohol, his cognitive abilities to process and discriminate between stimuli or cues to behavior begin to decrease. This cognitive impairment causes the person to focus on the most important cues and ignore others, making them ‘‘myopic’’ (8-10). The same has been shown for other psychotropic drugs that impair cognition (10). In Latin America, approximately 1.4 million people are infected with HIV; more than half of the cases are in Brazil (11) and due to sexual intercourse (12). Among youth (between 13 and 19 years old), the number of AIDS cases is higher among females than males in Brazil, which is different from the gender ratio in other age groups. Governmental data suggest that despite having high knowledge about STD/HIV, youth are the only age group that shows a trend toward increased HIV infection. Among girls, almost the totality of infections were due to heterosexual intercourse (13). Because most current studies were derived from data collected among adults and young adults in developed countries, there is an interest in studying the level of exposure to sexually transmitted diseases in adolescence and its association with patterns of alcohol/other drug use in a middle-income country, such as Brazil (14). This study tested the hypothesis that risky sexual behaviors among adolescents are associated with alcohol and other drug use and therefore, aimed to describe the socio-demographic characteristics of unsafe sex among high school students in Brazil.

Assessment Plan Anonymous standardized paper and pencil questionnaire data were gathered by a trained team of interviewers who worked in the classroom without a teacher present. A questionnaire with closed-form questions adapted from standardized World Health Organization items (15) and the European School Survey Project on Alcohol and Other Drugs (ESPAD) questionnaire (16) was used. On average, it took 40 minutes for the students to complete the questionnaire. The protocol was reviewed and approved by the UNIFESP Research Ethics Committee (Protocol #0348/08), with provisions for participants to participate anonymously, to decline to participate, to leave questions unanswered, or to interrupt their participation at any time.

Measures Key Response Variables. The key response variables in this study were as follows: 1) sexual intercourse during the past month (past 30 days) and 2) sexual intercourse without condom use during the past month (past 30 days). The students answered if they had sexual intercourse in the month prior to the survey and if they had sexual intercourse without condom use in the month prior to the survey (yes or no answer). Questions about risk behavior were based on the CDC-YRBSS (Centers for Disease Control [CDC] and Prevention Youth Risk Behavior Surveillance System).

Covariates under study The covariates of central interest were drug use in the same period of time (past 30 days) as the sexual intercourse. Questions about alcohol use, tobacco smoking, and illegal drug use were based on the World Health Organization drug use survey for students and had the following structure: ‘‘During the previous month, that is, in the last 30 days, did you drink any alcoholic beverage?’’ For the illegal drug variable, we considered at least one use in the past month of at least one of the following drugs: cocaine, crack, marijuana, inhalants, ecstasy, or LSD. Binge drinking (BD) in the past month was defined as at least one episode of consumption of five or more servings of alcoholic beverages on the same occasion, as used in the ESPAD survey (16). A serving was defined as a 5 oz glass of wine, a 12 oz can of beer, or a 1.5 oz shot of liquor, and the equivalence examples were drawn on the questionnaire to facilitate student understanding. Socio-demographic variables included gender, age, type of school (public or private), and socioeconomic status (SES). SES was evaluated in relation to a highly standardized survey assessment of socio-economic status known as the ABEP index (Associac¸a˜o Brasileira de Empresas de Pesquisa or the Brazilian Association of Research Agencies). The ABEP index (17) is based on the educational level of the head of the household, possession of various types of household goods (e.g., television sets), and the number of housekeepers. This scale was used to sort participants into standardized subgroups labeled from A to E (in which A was the highest economic group). Strata D and E were grouped for analysis due to the low prevalence of SES E students.

& METHODS Study design and sample selection The data were from a cross-sectional survey of schoolattending youths in all 27 Brazilian state capitals; the classroom survey data were collected in 2010 from a sample of the cities’ private and public schools. The study’s target population was designed as a representative multistage probabilistic sample of high school students (10th to 12th grade) in these schools, with a two-step random selection process. A total of 789 schools participated in this study, with a school response rate of 86%. The sample size considered a maximum relative error of 10% and a 95% confidence interval for a variation of 50%. The student response rate was 79.2% (20.5% were absent on the day of the survey, and 0.3% refused to participate). Ninety-eight questionnaires were excluded from the analysis for having a positive answer for a fictitious drug. The present study was limited to high school students between 13 and 18 years of age (n = 17,371). Approximately 2% of the participants had missing or invalid responses to the key study variable (sexual intercourse), resulting in a total sample of 16,998 subjects for the bivariate analysis (Table 1). Considering the missing data for the independent variables (6%), the effective sample size with useable data for logistic regressions was 16,202 participants (Table 2). Logistic regressions for non-condom use sexual intercourse considered only those who had sex during the month prior to the survey (n = 3,551).

Statistical analysis Analyses were conducted on data weighted to correct for unequal probabilities of selection into the sample. The

490


CLINICS 2013;68(4):489-494

Drug use and unprotected sex among adolescents Sanchez ZM et al.

Table 1 - Sociodemographic characteristics and drug use characteristics according to sexual intercourse status during the month prior to the survey among high school students in Brazil. Among those who had engaged in sexual intercourse in the month prior to the survey, the same variables are described for the group that used a condom and the group that had unsafe sex. Recent sexual intercourse and condom usea (N = 4,483)

Recent sexual intercourse (N = 16,998) No

Gender

female male Age 13 to 15 16 to 18 Socioeconomic Status (SES) A B C D/E Brazilian Region North Northeast Southeast South Middle West Type of School private public Recent Tobaccob yes no yes Recent Bingeb no Recent Alcoholb yes no yes Recent Illegal Drug Useb no Total a

Yes

With Condom

Non-Condom

N

%

SE

N

%

SE

p-value

N

%

SE

N

%

SE

p-value

7330 5144 5425 7072 2209 4873 3307 428 2649 4819 1943 1082 2004 5651 6846 566 11889 1697 10525 3346 8993 571 11925 12497

58.4 41.6 43.7 56.3 13.3 43.7 38.6 4.4 11.1 28.3 41.4 7.2 12.0 24.5 75.5 4.8 95.2 13.4 86.6 26.4 73.6 4.2 95.8 70.6

0.7 0.7 1.7 1.7 1.4 1.1 1.2 0.3 1.1 1.7 2.1 0.9 1.0 1.7 1.7 0.3 0.3 0.7 0.7 0.9 0.9 0.3 0.3 0.7

2112 2377 985 3515 719 1650 1271 163 1003 1568 790 465 675 1532 2969 724 3748 1581 2634 2344 2035 653 3848 4501

49.7 50.3 20.9 79.1 12.2 44.2 39.1 4.5 10.3 25.1 46.3 7.9 10.4 17.5 82.5 16.5 83.5 37.2 62.8 53.6 46.4 14.5 85.5 29.4

0.1 0.1 1.3 1.3 1.1 1.5 1.1 0.3 0.8 1.5 2.2 0.9 0.9 1.5 1.5 1.1 1.1 1.4 1.4 1.3 1.3 0.8 0.8 0.7

,0.0001

1007 1616 640 1988 461 970 702 82 635 890 437 270 396 941 1687 368 2245 884 1581 1319 1240 342 2286 2628

42.1 57.9 22.9 77.1 13.4 46.7 36.2 3.6 11.4 23.9 46.2 8.2 10.4 18.0 82.0 14.3 85.7 34.6 65.4 51.2 48.8 12.8 87.2 57.6

1.6 1.6 1.5 1.5 1.4 2.1 1.9 0.5 0.9 1.6 2.3 1.0 1.0 1.6 1.6 1.0 1.0 1.6 1.6 1.5 1.5 0.9 0.9 1.3

1095 753 341 1513 255 673 565 81 363 673 348 193 278 585 1270 354 1487 696 1036 1022 780 308 1547 1855

60.2 39.8 18.3 81.7 10.7 40.5 43.1 5.7 8.9 26.8 46.4 7.6 10.3 16.9 83.1 19.3 80.7 40.9 59.1 57.1 42.9 16.8 83.2 42.4

1.5 1.5 1.6 1.6 1.2 1.9 1.9 7.8 1.0 2.0 2.8 1.0 0.9 1.9 1.9 1.7 1.7 1.8 1.8 1.9 1.9 1.2 1.2 1.3

,0.0001

only among those who had sex during the past month;

b

,0.0001 0.75

0.01

,0.0001 ,0.0001 ,0.0001 ,0.0001 ,0.0001

0.011 0.001

0.21

0.51 0.001 0.002 0.002 0.004

recent use refers to use during the 30 days prior to the survey.

Among the adolescents who had sex during the past 30 days, 43% (SE 1.3%) had not used a condom. This unsafe behavior was more prevalent among girls (60.2%, SE 1.5%), participants aged 16 to 18 years old (81.7%, SE 1.6%), and the students studying in public schools (83.1%, SE 1.9%). Bivariate analyses showed that recent binge drinking and alcohol, tobacco, and illegal drug use were more prevalent among those participants who had recent sexual intercourse without a condom compared with those who had used a condom. Binge drinking was reported by 40.9% of the group who had unsafe sex and by 34.6% of the group who used a condom (p = 0.002). Sexual intercourse was more prevalent among boys (aOR = 1.32, 95% CI 1.18-1.48), but unsafe sexual intercourse (non-condom use) was more prevalent among girls (aOR = 2.21, 95% CI 1.79-2.73). Older age and lower socioeconomic status were directly associated with non-condom use. An increase of one year of age increased the odds of engaging in unsafe sex by 17%. A decrease of one level of SES (considering the four SES groups) increased the odds of engaging in a sexual intercourse with a condom by 21%. Binge drinking and illegal drug use were independently associated with unsafe sex, even when controlling for obvious confounders (age, gender, and SES). Adolescents who had non-condom sex were 32% and 43% more likely to engage in binge drinking and illegal drug use, respectively, in the same period of time (past 30 days) (Table 2). Any recent sexual intercourse was associated with any drug use, age, and gender (p,0.0001) but was not associated

complex survey design took into account the city and type of school, the school as the primary sampling unit, the expansion weight, and the final probability of drawing the student who answered the questionnaire. The outcome variable of interest was unsafe sexual intercourse during the past month. The independent variables included SES, type of school, age, gender, and drug use in the same period of the past month (binge drinking, tobacco use, alcohol use, and illegal drug use). We described sexually active students’ characteristics and the characteristics of those reporting sexual intercourse without condom use by weighted proportions and crude odds ratios from logistic regressions. All analyses were controlled for age, sex, and type of school. Analyses were performed using Stata Version 11 (Stata Statistical Software Release 11, StataCorp. 2009, College Station, Texas, USA) with svyset procedures to determine variance estimation under the complex sample survey mode in these regression models and estimate 95% confidence intervals (CI). The results are presented as weighted proportions (wgt%), crude odds ratios (cORs), adjusted odds ratios (aORs), and 95% CIs.

& RESULTS Approximately one third of the high school students reported having sex in the month prior to the survey, and 79% (SE 1.3%) of them were 16 to 18 years old (Table 1). Approximately one third of adolescents who had recent sexual intercourse also had recently used drugs (37.2% engaged in binge drinking, 16.5% had smoked tobacco, and 14.5% had used illegal drugs).

491


Drug use and unprotected sex among adolescents Sanchez ZM et al.

CLINICS 2013;68(4):489-494

Table 2 - Logistic regression estimates for sexual intercourse during the month prior to the survey and sexual intercourse during the month prior to the survey without condom use among high school students in Brazil according to sociodemographic characteristics and drug use (crude and adjusted odds ratios). Sexual intercourse without condom useb (N = 3,551)

Recent sexual intercourse (N = 16,202)

Male Age SESa Brazilian region Public school Recent tobacco Recent binge Recent alcohol Recent illegal drug a

cOR

IC

p-value

aOR

IC

p-value

cOR

IC

p-value

aOR

IC

p-value

1.42 1.65 1.03 1.01 1.52 3.88 3.82 3.22 3.89

1.27;1.58 1.55;1.74 0.95;1.11 0.97;1.06 1.30;1.78 3.27;4.61 3.29;4.43 2.88;3.61 3.31;4.56

,0.0001 ,0.0001 0.40 0.43 ,0.0001 ,0.0001 ,0.0001 ,0.0001 ,0.0001

1.32 1.52 . . 1.59 1.69 1.73 1.72 2.02

1.18;1.48 1.43;1.61 . . 1.36;1.87 1.33;2.13 1.39;2.14 1.46;2.03 1.69;2.03

,0.0001 ,0.0001 . . ,0.0001 ,0.0001 ,0.0001 ,0.0001 ,0.0001

0.48 1.12 1.28 1.01 1.07 1.43 1.31 1.27 1.37

0.40;0.57 1.04;1.21 1.12;1.44 0.95;1.07 0.86;1.34 1.15;1.77 1.10;1.55 1.08;1.48 1.10;1.70

,0.0001 0.002 ,0.0001 0.69 0.51 0.001 0.002 0.003 0.004

0.45 1.17 1.21 . . . 1.32 . 1.43

0.36;0.55 1.07;1.28 1.05;1.39 . . . 1.07;1.63 . 1.03;1.90

,0.0001 0.001 0.006 . . . 0.008 . 0.012

reference group for socioeconomic status was the highest level (A).

b

reference group was participants who reported sex with condom use.

sexual intercourse during the 12 months prior to the survey, 81% had used a condom, but only 43% said they had always used a condom. No data on drug use were available. In Brazil, among high school students in Minas Gerais, girls were less likely than boys to use condoms consistently, regardless of the nature of their relationships. Non-condom use and illegal drug use were only significantly associated among boys who had recently used illegal drugs (21). Dahl (22) noted that during puberty, changes occur in the neuronal system responsible for emotions and motivations, which facilitates the emergence of risk taking behaviors. At this stage, adolescents seek new experiences that generate pleasure, but the feeling of omnipotence can trigger a lack of awareness of the consequences of their actions. The association between drug use and sexual intercourse might also be a strategy for the facilitation of the sexual act. For example, a study among British young adults showed that alcohol, marijuana, ecstasy, and cocaine were used to stimulate arousal during sexual intercourse. Moreover, in this British study, early alcohol use was associated with early sexual activity onset, primarily among girls (5). Thus, the fact that adolescents who use alcohol/drugs are more likely to engage in unsafe sex can be explained by both pharmacological and behavioral issues. The Alcohol Myopia Theory (8) appears to be appropriate and to explain the unsafe sex that occurs after the use of psychotropic drugs taken to facilitate a sexual encounter. In contrast, the risktaking behavior theory might explain why the same group of youth expose themselves to different risks. In our study, we found that girls were more exposed to unprotected sex than boys, and this result could explain why there is a larger proportion of adolescent girls in Brazil infected with HIV than boys in the same age group (13). Gender differences in the prevalence of unsafe sex have been described before in studies focusing on US high school students. According to Johnston et al. (23), girls are more engaged in monogamous dating and felt more secure about STD/AIDS. However, another hypothesis suggests that being in love and using alcohol/drugs blinded these girls to the risk of unprotected sex, even when they knew of the possibility of contracting HIV (24). Bralock and Koniak (25) point to the fact that female adolescents were willing to concede to unprotected sexual intercourse with a boy they loved, showing that being in love was a risk factor for STD transmission.

with SES (p = 0.40) or the five Brazilian geo-economic regions (p = 0.43). Adjusted logistic regression for recent sexual intercourse showed that adolescents who had sex in the month prior to the survey were twice as likely to also have used illegal drugs in the same period and were approximately 70% more likely to have used alcohol (any alcohol use and binge drinking) and tobacco (see Table 2).

& DISCUSSION The main findings of this study showed that most students who had sexual intercourse in the 30 days prior to the survey also used legal or illegal drugs in the same period, and nearly half of these students had not used a condom. Most of the students who engaged in unsafe sex were older girls from lower SES families. Adolescents who used any illegal drugs or engaged in binge drinking during the past month were less likely to use a condom during sexual intercourse in the same period prior to the survey. Although our study did not evaluate the concomitant use of alcohol and other drugs at the time of the unprotected sex, these behaviors were associated and reported by the same subjects during the same time period. Unprotected sex is not a problem only among Brazilian adolescents. Recent data from a biennial National Survey on Youth Risk Behavior in the US showed less alarming but not harmless numbers. Data for the period of 1991 to 2011 indicated that recent condom use among students currently having sexual intercourse increased from 46.2% in 1991 to 60.2% in 2011 for both genders. However, 40% of the adolescents (both boys and girls) were still engaging in recent sexual intercourse without using condoms (18). In Spain, contrary to what we found in our study, boys were more likely not to use condoms than girls; 82% of the adolescent boys who had ever had sexual intercourse reported recent risky sexual behavior (multiple partners or non-condom use) compared with 62% of the girls. The two strongest predictors for risky sexual behaviors were country of origin (not Spain) and recent alcohol use among boys or recent use of cannabis among girls (19). However, it is important to note that studies about condom use and its association with drug use among adolescents in Latin America are not common. A national survey among high school students in Argentina showed a less worrisome situation than observed in the present study. According to Linetzky et al. (20), among students who had

492


CLINICS 2013;68(4):489-494

Drug use and unprotected sex among adolescents Sanchez ZM et al.

shown biased information. Some degree of non-participation (especially because of absence on the day of the survey) and missing data excluded some students from the analysis. However, the levels of participation were larger than those obtained in the US Monitoring the Future study (32), considering that almost all of the students that were invited to participate agreed to participate. Because this study did not collect information on variables such as school policies against alcohol consumption, other drug use, and sexual behaviors, it is not possible to control the analysis for the influence of school prevention programs on binge drinking, other drug use, and unsafe sex. Furthermore, this was a cross-sectional survey; therefore, while the variables analyzed were associated with the practice of unsafe sex, it was not possible for us to establish causal relationships. In addition, we did not measure the propensity of the students for risk-taking behaviors (such as impulsivity; for example, highly impulsive youth might bond and mingle with other highly impulsive youth and thus engage more frequently in alcohol and other drug use and in unsafe sex practices). Moreover, we did not investigate sexual preferences that could lead to different urges or reasons for condom use. Nearly half of the sexually active high school students in Brazil had not used a condom during recent sexual intercourse. While the overall prevalence of sexual intercourse was higher among boys, unsafe sexual intercourse was more prevalent among girls. A lower socioeconomic status was directly associated with non-condom use. This study offers directions for prevention programs by suggesting that recent unsafe sexual behavior (non-condom use) is associated with recent binge drinking and illegal drug use. The authors suggest that school prevention programs must include drug use and sexuality topics simultaneously, as both risk-taking behaviors are prevalent among high school students and occurred during the same month.

It is important to note that these girls may have been having unprotected sex with older boys/men who were no longer in high school and therefore were not detected by our study (which would explain the gender differences found among high school students). Late-adolescent girls usually engage in sex with older boys/men (26). Another possible explanation for this behavior being more prevalent among women may be the use of contraceptives. These girls may believe that once protected against unwanted pregnancy, there is no need to use a condom, culminating in the practice of unsafe sex and increasing the risk for STDs/HIV. This method can be very useful for preventing pregnancy during adolescence; however, contraception does not prevent STDs (27). In our national sample, low SES increased the risk for unsafe sex but was not associated with sexual activity. Conversely, (28) among Canadian high school students, a lower SES was associated with sexual activity but not risky sexual behaviors. SES may also play a role as a moderator for condom use. In a survey of adolescents from low-income areas in Mexico, the odds of adolescent condom use were higher in larger urban areas only among adolescents in the lowest SES levels. The results suggest that condom use is related to urbanicity but moderated by SES (29). The spread of HIV has become a serious public health concern and must be considered among adolescents, as adolescence is the stage of life when risky sexual behaviors start (13,23). According to Catalano et al. (30), alcohol, tobacco, and illegal drug use and unsafe sex were responsible for the burden of adolescent mortality and morbidity worldwide. However, these risky behaviors are preventable, and it is time for the policy makers from low and middle income countries to incorporate youth intervention strategies into public policy. School-age youth need education and prevention programs that are incorporated into the larger context of school health education curricula. Specific interventions should focus on improving the decision-making skills of adolescents, including techniques to negotiate safer sex behaviors among girls. However, according to a recent systematic review on interventions to prevent substance use and risky sexual behavior in young people (31), the interventions that addressed multiple domains of risk (individual and peer, family, school, and community) and protective factors against risky behavior were more promising than programs that addressed just one domain (school, individual, or family). However, there are relatively few studies on interventions to reduce the association between substance use and sexual risk. The interventions described in this review showed mixed results, with programs impacting some measures but not others or having an inconsistent effect across genders and no long-term effects. These findings suggest that there is an urgent need for developing culturally tailored intervention programs aimed at reducing the risk behaviors identified in this study. Despite the relevance of our findings and the implications for prevention among adolescents, some limitations must be mentioned. Because a self-report questionnaire was used, the questions were subject to interpretation by the participants and to a possible information bias. However, the anonymous nature of the survey and the absence of the teacher in the classroom should have helped promote response validity. Additionally, the question about a fictitious drug allowed us to drop the questionnaires with

& ACKNOWLEDGMENTS Funding for this study was provided by the SENAD (National Secretariat for Drug Policies) of the Brazilian Federal Government. Dr. Martins received research support from the US NIH NIDA grant DA023434 and NICHD grant HD060072.

& AUTHOR CONTRIBUTIONS Sanchez ZM wrote the first draft of the manuscript and performed the statistical analyses. Cruz JI performed the literature search and wrote the first draft of the discussion. Nappo SA critically revised the manuscript for important intellectual content. Carlini EA and Carlini CM substantially contributed to the conception, design, and acquisition of the student survey data. Martins SS supervised the statistical analyses and writing process. All of the authors approved the final version of the manuscript.

& REFERENCES 1. Pharo H, Sim C, Graham M, Gross J, Hayne H. Risky business: executive function, personality, and reckless behavior during adolescence and emerging adulthood. Behav Neurosci. 2011;125(6):970-8, http://dx.doi. org/10.1037/a0025768. 2. Sanchez ZM, Martins SS, Opaleye ES, Moura YG, Locatelli DP, Noto AR. Social factors associated to binge drinking: a cross-sectional survey among Brazilian students in private high schools. BMC Public Health. 2011;11:201, http://dx.doi.org/10.1186/1471-2458-11-201. 3. Lomba L, Apo´stolo J, Mendes F. Drugs and alcohol consumption and sexual behaviours in night recreational settings in Portugal. Adicciones. 2009;21(4):309-25. 4. Stoner SA, George WH, Peters LM, Norris J. Liquid courage: alcohol fosters risky sexual decision-making in individuals with sexual fears. AIDS Behav. 2007;11(2):227-37, http://dx.doi.org/10.1007/s10461-0069137-z.

493


Drug use and unprotected sex among adolescents Sanchez ZM et al.

CLINICS 2013;68(4):489-494

5. Bellis M, Hughes K, Calafat A, Juan M, Ramon A, Rodriguez J, et al. Sexual uses of alcohol and drugs and the associated health risks: A cross sectional study of young people in nine European cities. BMC Public Health. 2008;8:155, http://dx.doi.org/10.1186/1471-2458-8-155. 6. Chersich MF, Luchters SM, Malonza IM, Mwarogo P, King’ola N, Temmerman M. Heavy episodic drinking among Kenyan female sex workers is associated with unsafe sex, sexual violence and sexually transmitted infections. Int J STD AIDS. 2007;18(18):764-9. 7. Griffin KW, Scheier LM, Acevedo B, Grenard JL, Botvin GJ. Long-term effects of self-control on alcohol use and sexual behavior among urban minority young women. Int J Environ Res Public Health. 2012;9(1):1-23. 8. Griffin JA, Umstattd MR, Usdan SL. Alcohol use and high-risk sexual behavior among collegiate women: a review of research on alcohol myopia theory. J Am Coll Health. 2010;58(6):523-32, http://dx.doi.org/ 10.1080/07448481003621718. 9. Giancola PR, Duke AA, Ritz KZ. Alcohol, violence, and the Alcohol Myopia Model: preliminary findings and implications for prevention. Addict Behav. 2011;36(10):1019-22, http://dx.doi.org/10.1016/j.addbeh. 2011.05.006. 10. Davis KC, Hendershot CS, George WH, Norris J, Heiman JR. Alcohol’s effects on sexual decision making: an integration of alcohol myopia and individual differences. J Stud Alcohol Drugs. 2007;68(6):843-51. 11. Teva I, Bermu´dez M, Ramiro M, Buela-Casal G. Current epidemiological situation of HIV/AIDS in Latin America: Analysis of differences among countries]. Rev Med Chil. 2012;140(1):50-8, http://dx.doi.org/10.4067/ S0034-98872012000100007. 12. Dourado I, Veras MASM, Barreira D, Brito AM. AIDS epidemic trends after the introduction of antiretroviral therapy in Brazil. Rev Sau´de Pu´blica. 2006;40:Suppl:9-17, http://dx.doi.org/10.1590/S0034-89102006000800003. 13. MS BMoH. Boletim Epidemiolo´gico do AIDS/DST [Epidemiological Bulletin on AIDS/STD]. 1 ed. Brasilia: Ministe´rio da Sau´de; 2011.p.159. 14. Cooper ML. Alcohol use and risky sexual behavior among college students and youth: evaluating the evidence. J Stud Alcohol Suppl. 2002;14:101-17. 15. Smart RG, Hughes DPH, Johnston LD. Methodology for students druguse surveys. Geneva: World Health Organization; 1980. 16. Hibell B, Guttormsson U, Ahlstro¨m S, Balakireva O, Bjarnason T, Kokkevi A, et al. The 2007 ESPAD Report - Substance Use Among Students in 35 European Countries. Stockholm: The Swedish Council for Information on Alcohol and Other Drugs. 2009. p. 408 pages. 17. ABEP. Crite´rio de Classificac¸a˜o Econoˆmica Brasil [Internet]. Available from: www.abeporg/codigosguias/Criterio_Brasil_2008.pdf Associac¸a˜o Brasileira de Empresas de Pesquisa 2008. 18. CDC. Trends in HIV-related risk behaviors among high school students-United States, 1991-2011. MMWR Morb Mortal Wkly Rep. 2012;61(29):556-60.

19. Puente D, Zabaleta E, Rodriguez-Blanco T, Cabanas M, Monteagudo M, Pueyo MJ, et al. Gender differences in sexual risk behaviour among adolescents in Catalonia, Spain. Gac Sanit. 2011;25(1):13-9, http://dx.doi. org/10.1016/j.gaceta.2010.07.012. 20. Linetzky B, Morello P, Virgolini M, Ferrante D. [Results from the First National School Health Survey: Argentina, 2007]. Arch Argent Pediatr. 2011;109(2):111-6. 21. Bertoni N, Bastos FI, Mello MB, Makuch MY, Sousa MH, Osis MJ, et al. [Alcohol and illicit drug use and its influence on the sexual behavior of teenagers from Minas Gerais State, Brazil]. Cad Saude Publica. 2009; 25(6):1350-60, http://dx.doi.org/10.1590/S0102-311X2009000600017. 22. Dahl RE. Adolescent brain development: a period of vulnerabilities and opportunities. Keynote address. Ann N Y Acad Sci. 2004;1021:1-22. 23. Johnston LD, O’Malley PM, Bachman JG, Schulenberg JE. HIV/AIDS: Risk & Protective Behaviors among American Young Adults, 2004–2008. Bethesda, MD: National Institute on Drug Abuse; 2010. 24. Christianson M, Lalos A, Westman G, Johansson EE. "Eyes Wide Shut"-sexuality and risk in HIV-positive youth in Sweden: a qualitative study.Scand J Public Health. 2007;35(1):55-61. 25. Bralock A, Koniak-Griffin D. What do sexually active adolescent females say about relationship issues? J Pediatr Nurs. 2009;24(2):131-40, http:// dx.doi.org/10.1016/j.pedn.2008.02.036. 26. Wood EB. HIV-related sexual risk behaviours among late-adolescent Jamaican girls with older male partners. West Indian Med J. 2010;59(4): 403-8. 27. Ornstein RM, Fisher MM. Hormonal contraception in adolescents: special considerations. Paediatr Drugs. 2006;8(1):25-45. 28. Langille DB, Hughes J, Murphy GT, Rigby JA. Socio-economic factors and adolescent sexual activity and behaviour in Nova Scotia. Can J Public Health. 2005;96(4):313-8. 29. Gutie´rrez JP, Atienzo EE. Socioeconomic status, urbanicity and risk behaviors in Mexican youth: an analysis of three cross-sectional surveys. BMC Public Health. 2011;11:900, http://dx.doi.org/10.1186/1471-245811-900. 30. Catalano RF, Fagan AA, Gavin LE, Greenberg MT, Irwin CE, Jr., Ross DA, et al. Worldwide application of prevention science in adolescent health. Lancet. 2012;379(9826):1653-64, http://dx.doi.org/10.1016/S0140-6736(12) 60238-4. 31. Jackson C, Geddes R, Haw S, Frank J. Interventions to prevent substance use and risky sexual behaviour in young people: asystematic review. Addiction. 2012;107(4):733-47, http://dx.doi.org/10.1111/j.1360-0443. 2011.03751.x. 32. Johnston LD, O’Malley PM, Bachman JG, Schulenberg JE. Monitoring the Future National Survey Results on Drug Use, 1975-2008. Volume I: Secondary School Students. Bethesda, MD: National Institute on Drug Abuse; 2009.

494


CLINICAL SCIENCE

Remote ischemic preconditioning in patients with intermittent claudication Glauco Fernandes Saes, Antonio Eduardo Zerati, Nelson Wolosker, Luciana Ragazzo, Ruben Miguel Ayzin Rosoky, Raphael Mendes Ritti-Dias, Gabriel Grizzo Cucato, Marcelo Chehuen, Breno Quintella Farah, Pedro Puech-Lea˜o Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Disciplina de Cirurgia Vascular, Ambulato´rio de Claudicac¸a˜o, Sa˜o Paulo/SP, Brasil.

OBJECTIVE: Remote ischemic preconditioning (RIPC) is a phenomenon in which a short period of sub-lethal ischemia in one organ protects against subsequent bouts of ischemia in another organ. We hypothesized that RIPC in patients with intermittent claudication would increase muscle tissue resistance to ischemia, thereby resulting in an increased ability to walk. METHODS: In a claudication clinic, 52 ambulatory patients who presented with complaints of intermittent claudication in the lower limbs associated with an absent or reduced arterial pulse in the symptomatic limb and/ or an ankle-brachial index ,0.90 were recruited for this study. The patients were randomly divided into three groups (A, B and C). All of the patients underwent two tests on a treadmill according to the Gardener protocol. Group A was tested first without RIPC. Group A was subjected to RIPC prior to the second treadmill test. Group B was subjected to RIPC prior to the first treadmill test and then was subjected to a treadmill test without RIPC. In Group C (control group), both treadmill tests were performed without RIPC. The first and second tests were conducted seven days apart. Brazilian Clinical Trials: RBR-7TF6TM. RESULTS: Group A showed a significant increase in the initial claudication distance in the second test compared to the first test. CONCLUSION: RIPC increased the initial claudication distance in patients with intermittent claudication; however, RIPC did not affect the total walking distance of the patients. KEYWORDS: Intermittent Claudication; Ischemic Preconditioning; Peripheral Arterial Disease. Saes GF, Zerati AE, Wolosker N, Ragazzo L, Rosoky RM, Ritti-Dias RM, et al. Remote ischemic preconditioning in patients with intermittent claudication. Clinics. 2013;68(4):495-499. Received for publication on October 25, 2012; First review completed on November 21, 2012; Accepted for publication on December 19, 2012 E-mail: glauco.saes@terra.com.br Tel.: 55 11 98111-2860

effects on myocardial cells after transient ischemia is encountered by other tissue (20-22). Cells in organs other than the heart are sensitive to the protective effects that follow ischemia-reperfusion injury of the myocardial tissue or other distant tissues (23-26). Based on evidence of RIPC occurring in other tissues, we predicted that RIPC could occur in patients with intermittent claudication (IC), thereby making the muscles more resistant to ischemia and increasing the ability of these individuals to walk. To test this hypothesis, we performed gait tests in patients with claudication with and without prior RIPC and then compared the initial claudication distance (ICD) and the total walking distance (TWD).

& INTRODUCTION Ischemic preconditioning (IPC) was first described in 1986 by Murry et al. (1) as an increase in cellular resistance to myocardial ischemia when the heart is exposed to periods of brief non-lethal ischemia interspersed with reperfusion. In 1993, Pryzklenk et al. (2) demonstrated that an increase in cell resistance to ischemia also occurred in other tissues that were not directly subjected to ischemia. This phenomenon was named remote ischemic preconditioning (RIPC) (3-18). Although some authors question whether RIPC actually occurs (19), many studies have demonstrated the beneficial

& METHODS

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

This study was performed at the Intermittent Claudication Clinic of the Hospital das Clı´nicas, Faculdade de Medicina at the Universidade de Sa˜o Paulo after receiving approval from the local ethics committee. All of the participants signed informed consent forms prior to

No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)10

495


Ischemic preconditioning in claudication Saes GF et al.

CLINICS 2013;68(4):495-499

their enrollment. This study was registered as a clinical trial in the Brazilian Clinical Trials Registry (trial RBR-7TF6TM). Between January 2009 and May 2011, 52 consecutive ambulatory patients complaining of typical intermittent claudication (IC) in one or both lower limbs that was associated with an absent or reduced arterial pulse in the symptomatic limb and/or an ankle-brachial index ,0.90 were recruited for this study. Physical examinations of the upper limbs revealed normal physiology in all the study participants. The patients were randomly divided into three groups (A, B and C) and underwent two treadmill tests according to the Gardener protocol. Group A was first tested on a treadmill without undergoing RIPC, and then Group A was tested on a treadmill after undergoing RIPC. Group B was first tested on a treadmill after receiving RIPC, and then Group B was tested on a treadmill without receiving RIPC. In Group C (control group), both treadmill tests were conducted without the patient receiving RIPC. The treadmill tests were conducted seven days apart. The tests were conducted on a treadmill running at a fixed speed of 3.2 km/h, and the required effort was progressively increased (2% increase in the incline every 2 minutes). The initial claudication distance (ICD), which describes the maximum distance a patient can walk without experiencing leg pain, and the total walking distance (TWD), which refers to the distance walked before the patient could not continue walking, were recorded in each test. RIPC was implemented according to a previously described protocol (22), which is detailed below. Ninety minutes before exercising on the treadmill, an inflated cuff was positioned on the non-dominant upper limb of the participant three times for five minutes each time. Between each period of inflation, the cuff was deflated for five minutes. The participants were advised to avoid consuming the following substances, which have been suggested to interfere with the process of ischemic preconditioning (RIPC), within two hours of the test: cilostazol, sildenafil, dipyridamole, glibenclamide, aminophylline, nicorandil, phenylephrine, angiotensin-converting enzyme inhibitors, angiotensin receptor blocker II, statins and steroids, caffeine and alcohol. Considering the experimental nature of this study, the number of subjects included in each group was calculated based on sample power, as proposed by J. Eng (41).

first tested for normality and homogeneity of variance using the Shapiro-Wilk and Levene tests, respectively. To compare the general characteristics of the three experimental groups, we used an analysis of variance (ANOVA) of one factor for continuous variables and the chi-squared or Fisher’s exact test for categorical variables. To compare ICD and TWD between the three experimental groups, a two factorial ANOVA for repeated measurements was used considering the group (A, B and C) as an independent factor and the time (first or second test) as the repeated factor. When significant effects were observed, the post-hoc Duncan’s test was used to verify differences. Data are presented as relative frequencies, means and standard deviations. For all of the analyses, a significance level of p,0.05 was assumed.

& RESULTS A total of 52 patients were analyzed in this study, which included 38 males and 14 females. General patient characteristics are shown in Table 1. No differences were observed between the groups regarding age, race, gender, diabetes prevalence, hypertension prevalence and smoking history. However, Group C had a higher prevalence of dyslipidemia relative to the other groups (p = 0.017). Table 2 shows the effect of RIPC on the walking capacity of the IC patients. Group A and Group C patients had higher initial claudication distances (ICDs) in the second test relative to the first test. However, no differences were found in Group B. Furthermore, the ICD was greater in Group A patients when compared with the other groups. Table 2 also shows that the total walking distance (TWD) was lower in the first test than in the second test for Group A and Group B. However, there were no significant differences between the groups (see Figures 1 and 2).

& DISCUSSION Initial studies analyzing RIPC used animal models in an attempt to show the effects of RIPC by comparing the area of injury in tissues exposed and not exposed to periods of ischemia-reperfusion induced by ligating the arterial feeder vessel. Pryzklenk et al. were the first to demonstrate that small cycles of coronary artery occlusions in dogs protected the myocardial cells from longer periods of ischemia (2). Later, the protective effect induced by ischemia could be transferred to non-preconditioned rabbits that received whole blood transfusions from rabbits that were subjected to RIPC (29). Other studies have shown reductions in the area of myocardial infarction in animals subjected to RIPC induced by the intermittent occlusion of the femoral, renal

Statistical analysis The statistical analyses were conducted using the Statistic 5.1 software (StatSoft, Inc., Tulsa, OK, USA). The data were

Table 1 - General characteristics of patients with intermittent claudication. Variables Age (years) Gender (% males) Skin color (% whites) Risk factors Diabetes mellitus (%) Hypertension (%) Dyslipidemia (%) History of smoking

Group A (n = 18)

Group B (n = 16)

Group C (n = 18)

p-value

65.8¡7.9 72.2 72.2

60.5¡9.5 69.8 75.0

64.0¡9.9 77.8 77.8

0.145 0.835 0.929

23.5 77.8 38.9 94.4

37.5 62.5 25.0 93.8

44.4 94.4 72.2 83.3

0.422 0.074 0.017 0.456

Values are expressed as the mean ¡ standard deviation.

496


CLINICS 2013;68(4):495-499

Ischemic preconditioning in claudication Saes GF et al.

Table 2 - Effect of remote ischemic preconditioning (RIPC) on initial claudication distance (ICD) and total walking distance (TWD) in the three experimental groups.

ICD (m) Group A (n = 18) Group B (n = 16) Group C (n = 18) TWD (m) Group A (n = 18) Group B (n = 16) Group C (n = 18)

First test

Second test

Group effect

Moment effect

Interaction effect

164¡79 147¡112 143¡114

197¡85* 134¡91{ 173 ¡ 135*{

0.518

0.039

0.045

352¡173 309¡168 308¡214

435 ¡ 182* 364 ¡ 218* 421 ¡ 279*

0.692

,0.001

0.595

Values are expressed as the mean ¡ standard deviation. *Significant difference compared with the first test; {Different from Group A (p,0.05). Group effect indicates whether a statistically significant difference exists between the groups (A, B and C). Moment effect indicates whether a statistically significant intra-patient difference exists between the results from the first and second treadmill tests (days 1 and 7). The interaction effect indicates whether a statistically significant difference exists in both the group and moment effects.

and mesenteric arteries (30-32). In addition to the cardiac muscle, other organs and tissues have been shown to respond to the protective effect of RIPC, including the lungs, kidneys, liver and skeletal muscle (23,33-35). Of the few RIPC studies that have been conducted in human subjects, some have shown that RIPC protects endothelial function after ischemia-reperfusion injury (22,36,37), and other studies have shown the protection of myocardial cells in patients undergoing cardiac operations (38,39). For patients undergoing segmental hepatectomy, RIPC before the operation led to reduced liver enzymes during the immediate postoperative period compared with patients in whom RIPC was not performed, but no differences in mortality and morbidity were observed (40). RIPC may be mediated by humoral factors and/or through the neurogenic pathway consisting of an early phase that begins after the completion of preconditioning and persists for upwards of 4 hours, and a late phase that begins approximately 24 hours after RIPC and persists for nearly 48 hours. Several humoral factors appear to be involved in mediating RIPC, including opioids, nitric oxide, adenosine, catecholamines, bradykinin, heat shock proteins, heme oxygenase, tumor necrosis factor-alpha, free radicals, prostaglandins and angiotensin. Organs subjected to ischemia have been shown to activate the protein kinase C

intracellular pathway resulting in the nuclear translocation of nuclear factor kappa beta and the subsequent activation of nitric oxide synthesis. Common mechanisms involved in target organs in the early and late stages of RIPC remain unclear; however, some studies have suggested roles for mitochondrial KATP channels and neutrophils. RIPC is of particular interest with respect to peripheral arterial disease such as intermittent claudication (IC). RIPC could explain, at least partially, the success of physical training in treating patients with IC. The mechanism by which exercise improves the symptoms of vascularmediated IC remains poorly understood. Furthermore, the initial concept that physical activity promotes increased collateral circulation by stimulating neoangiogenesis lacks definitive evidence (27). Current theories have sought to associate the improvement in walking distance to changes in muscle metabolism induced by exercise (28). Repeated ischemia-reperfusion events caused by physical training could be the stimulus for intracellular biochemical changes leading to a more effective use of oxygen by the muscle and an improvement in endothelial function. This theory is based on the concept of RIPC. In patients with claudication, a major goal of treatment is to improve the quality of life by increasing the ICD and TWD. Therefore, these parameters were used in our study

Figure 1 - Effect of remote ischemic preconditioning (RIPC) on the initial claudication distance (ICD).

Figure 2 - Effect of remote ischemic preconditioning (RIPC) on the total walking distance (TWD).

497


Ischemic preconditioning in claudication Saes GF et al.

CLINICS 2013;68(4):495-499

that are not directly subjected to ischemia benefit upon subsequent ischemic insults. RIPC increases the initial claudication distance in patients with intermittent claudication. However, RIC does not affect the total walking distance of claudication patients.

to evaluate patient responses to RIPC treatment using each patient as his/her own control. We compared the distances walked in each treadmill test with and without RIPC. Because many patients were not used to walking on a treadmill, some patients may have been able to walk a greater distance in the second test after becoming more familiar with walking on the treadmill relative to the first test. Therefore, we divided the patients into two groups that differed in RIPC administration and a control group. In this study, a significant increase in the ICD was observed in the second treadmill test for Group A and Group C, and this increase was greater in Group A compared to Group C. All of the groups showed a statistically significant increase in the second treadmill test for the TWD regardless of RIPC treatment. These findings suggested that two factors contributed to an increase in walking distance: RIPC and an increase in patient familiarity with treadmill use. Thus, Group A averaged a significantly higher ICD in the second week when compared to the first week. However, in Group B, the factors responsible for increasing the distance walked (RIPC and treadmill familiarization) appeared to antagonize the effect of each other because of the timing of the treadmill test. If RIPC had no beneficial effect on treadmill performance, then the distance walked in the second test should increase regardless of whether RIPC was administered prior to the first test or the second test; however, this was not the case in our study. The fact that the TWD did not change upon RIPC treatment is most likely caused by ischemic conditioning, which is expected in claudication patients, as ischemia is the cause of the symptoms of claudication. However, as RIPC activates several signaling pathways, we believe that pathways that are not activated or that are partially activated may become fully activated after RIPC, such as the opioid pathway. We suspect that the activation of other signaling pathways by RIPC could explain why the ICD increased, as opioids may increase tolerance to pain. Future studies should attempt to identify the biochemical agents responsible for the benefits of RIPC in claudication patients, which could allow for the exogenous administration of these factors to claudication patients bringing relief of symptoms. However, prior to the developing therapeutics for claudication patients, evidence confirming the benefits of RIPC in these individuals is necessary, which was the main objective of our study. Because RIPC did not change the TWD, RIPC did not appear to be useful for claudication treatment, and conventional treatments involving exercise training (walking and/ or exercise with load), risk factor control, smoking cessation and drug therapy with aspirin and simvastatin remain the best therapeutic option. However, as patients with claudication are constantly exposed to ischemic conditioning in the lower limbs and because the lower limbs account for a large proportion of the skeletal muscle, claudication patients are an ideal model to research signaling pathways involved with the RIPC effect as well as the triggers of RIPC. RIPC research can lead to the development of therapeutics that could increase cellular resistance to ischemia in patients subjected to acute ischemia, such as trauma patients or major surgery patients. Additional studies are needed to clarify the effects of RIPC and the mechanism of action through which tissues

& ACKNOWLEDGMENTS Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (Fapesp); grant numbers: 2008/03203-1.

& AUTHOR CONTRIBUTIONS Saes GF and Zerati AE were responsible for the study concept and design, patient recruitment, data collection and manuscript writing. Wolosker N was responsible for the study concept and design, patient recruitment and writing of the manuscript. Ragazzo L was responsible for patient recruitment, data collection and final approval. Rosoky RM was responsible for the study concept and design, and manuscript writing. Ritti-Dias RM, Cucato GG and Chehuen M were responsible for cardiovascular screening and final approval. Farah B was responsible for statistical expertise and final approval. Puech-Lea˜o P provided medical support during the study and approved the final version of the manuscript.

& REFERENCES 1. Murry CE, Jennings RB, Reimer KA. Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation. 1986;74(5):1124-36, http://dx.doi.org/10.1161/01.CIR.74.5.1124. 2. Przyklenk K, Bauer B, Ovize M, Kloner RA, Whittaker P. Regional ischemic ‘preconditioning’ protects remote virgin myocardium from subsequent sustained coronary occlusion. Circulation. 1993;87(3):893-9, http://dx.doi.org/10.1161/01.CIR.87.3.893. 3. Przyklenk K. Efficacy of cardioprotective ‘conditioning’ strategies in aging and diabetic cohorts: the co-morbidity conundrum. Drugs Aging. 2011;28(5):331-43, http://dx.doi.org/10.2165/11587190-000000000-00000. 4. Przyklenk K, Darling CE, Dickson EW, Whittaker P. Cardioprotection ‘outside the box’--the evolving paradigm of remote preconditioning. Basic Res Cardiol. 2003;98(3):149-57. 5. Przyklenk K, Frelinger AL 3rd, Linden MD, Whittaker P, Li Y, Barnard MR, Adams J, Morgan M, Al-Shamma H, Michelson AD. Targeted inhibition of the serotonin 5HT2A receptor improves coronary patency in an in vivo model of recurrent thrombosis. J Thromb Haemost. 2010;8(2):331-40, http://dx.doi.org/10.1111/j.1538-7836.2009.03693.x. 6. Przyklenk K, Heusch G. Late preconditioning against myocardial stunning. Does aspirin close the ‘‘second window’’ of endogenous cardioprotection? J Am Coll Cardiol. 2003;41(7):1195-7, http://dx.doi. org/10.1016/S0735-1097(03)00087-1. 7. Przyklenk K, Li G, Simkhovich BZ, Kloner RA. Mechanisms of myocardial ischemic preconditioning are age related: PKC-epsilon does not play a requisite role in old rabbits. J Appl Physiol. 2003;95(6):2563-9. 8. Przyklenk K, Li G, Whittaker P. No loss in the in vivo efficacy of ischemic preconditioning in middle-aged and old rabbits. J Am Coll Cardiol. 2001;38(6):1741-7, http://dx.doi.org/10.1016/S0735-1097(01)01603-5. 9. Przyklenk K, Maynard M, Darling CE, Whittaker P. Pretreatment with D-myo-inositol trisphosphate reduces infarct size in rabbit hearts: role of inositol trisphosphate receptors and gap junctions in triggering protection. J Pharmacol Exp Ther. 2005;314(3):1386-92, http://dx.doi.org/10. 1124/jpet.105.087742. 10. Przyklenk K, Maynard M, Darling CE, Whittaker P. Aging mouse hearts are refractory to infarct size reduction with post-conditioning. J Am Coll Cardiol. 2008;51(14):1393-8, http://dx.doi.org/10.1016/j.jacc.2007.11.070. 11. Przyklenk K, Maynard M, Greiner DL, Whittaker P. Cardioprotection with postconditioning: loss of efficacy in murine models of type-2 and type-1 diabetes. Antioxid Redox Signal. 2011;14(5):781-90, http://dx.doi. org/10.1089/ars.2010.3343. 12. Przyklenk K, Maynard M, Whittaker P. First molecular evidence that inositol trisphosphate signaling contributes to infarct size reduction with preconditioning. Am J Physiol Heart Circ Physiol. 2006;291(4):H2008-12, http://dx.doi.org/10.1152/ajpheart.00313.2006. 13. Przyklenk K, Maynard M, Whittaker P. Reduction of infarct size with Dmyo-inositol trisphosphate: role of PI3-kinase and mitochondrial K(ATP) channels. Am J Physiol Heart Circ Physiol. 2006;290(2):H830-6. 14. Przyklenk K, Undyala VV, Wider J, Sala-Mercado JA, Gottlieb RA, Mentzer RM Jr. Acute induction of autophagy as a novel strategy for cardioprotection: getting to the heart of the matter. Autophagy. 2011;7(4):432-3, http://dx.doi.org/10.4161/auto.7.4.14395.

498


CLINICS 2013;68(4):495-499

Ischemic preconditioning in claudication Saes GF et al.

15. Przyklenk K, Whittaker P. In vitro platelet responsiveness to adenosinemediated ‘‘preconditioning’’ is age-dependent. J Thromb Thrombolysis. 2005;19(1):5-10. 16. Przyklenk K, Whittaker P. Cardioprotection with adenosine: ‘a riddle wrapped in a mystery’. Br J Pharmacol. 2005;145(6):699-700. 17. Przyklenk K, Whittaker P. Adaptation of a photochemical method to initiate recurrent platelet-mediated thrombosis in small animals. Lasers Med Sci. 2007;22(1):42-5, http://dx.doi.org/10.1007/s10103-006-0410-1. 18. Przyklenk K, Whittaker P. Cardioprotection via adaptation to hypoxia: expanding the timeline and targets? Basic Res Cardiol. 2011;106(3):325-8, http://dx.doi.org/10.1007/s00395-011-0169-9. 19. Nakano A, Heusch G, Cohen MV, Downey JM. Preconditioning one myocardial region does not necessarily precondition the whole rabbit heart. Basic Res Cardiol. 2002;97(1):35-9, http://dx.doi.org/10.1007/ s395-002-8385-3. 20. McClanahan TB, Nao BS, Wolke LJ, Martin BJ, Mezt TE. Brief renal occlusion and reperfusion reduces myocardial infart size in rabbits. FASEB J. 1993;7:A18. 21. Gho BC, Schoemaker RG, van den Doel MA, Duncker DJ, Verdouw PD. Myocardial protection by brief ischemiain noncardiac tissue. Circulation. 1996;94(9):2193-200, http://dx.doi.org/10.1161/01.CIR.94.9.2193. 22. Kharbanda RK, Mortensen UM, White PA, Kristiansen SB, Schmidt MR, Hoschtitzky JA, et al. Transient limb ischemia induces remote ischemic preconditioning in vivo. Circulation. 2002;106(23):2881-3, http://dx.doi. org/10.1161/01.CIR.0000043806.51912.9B. 23. Ates¸ E, Genc¸ E, Erkasap N, Erkasap S, Akman S, Firat P, et al. Renal protection by brief liver ischemia in rats. Transplantation. 2002;74(9):124751, http://dx.doi.org/10.1097/00007890-200211150-00009. 24. Mallick IH, Yang W, Winslet MC, Seifalian AM. Ischaemic preconditioning improves microvascular perfusion and oxygenation following reperfusion injury of the intestine. Br J Surg. 2005;92(9):1169-76. 25. Gurusamy KS, Gonzalez HD, Davidson BR. Current protective strategies in liver surgery. World J Gastroenterol. 2010;16(48):6098-6103. 26. Tapuria N, Kumar Y, Habib MM, Abu Amara M, Seifalian AM, Davidson BR. Remote ischemic preconditioning: a novel protective method from ischemia reperfusion injury--a review. J Surg Res. 2008;150(2):304-30, http://dx.doi.org/10.1016/j.jss.2007.12.747. 27. Stewart KJ, Hiatt WR, Regensteiner JG, Hirsch AT. Exercise training for claudication. N Engl J Med. 2002;347(24):1941-51. 28. Wolosker N, Nakano L, Rosoky RA, Puech-Leao P. Evaluation of walking capacity over time in 500 patients with intermittent claudication who underwent clinical treatment. Arch Intern Med. 2003;163(19):2296300, http://dx.doi.org/10.1001/archinte.163.19.2296. 29. Dickson EW, Reinhardt CP, Renzi FP, Becker RC, Porcaro WA, Heard SO. Ischemic preconditioning may be transferable via whole blood transfusion: preliminary evidence. J Thromb Thrombolysis. 1999; 8(2):123-9, http://dx.doi.org/10.1023/A:1008911101951. 30. Birnbaum Y, Hale SL, Kloner RA. Ischemic preconditioning at a distance: reduction of myocardial infarct size by partial reduction of blood supply combined with rapid stimulation of the gastrocnemius muscle in the

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

499

rabbit. Circulation. 1997;96(5):1641-6, http://dx.doi.org/10.1161/01.CIR. 96.5.1641. Takaoka A, Nakae I, Mitsunami K, Yabe T, Morikawa S, Inubushi T, et al. Renal ischemia/reperfusion remotely improves myocardial energy metabolism during myocardial ischemia via adenosine receptors in rabbits: effects of ‘‘remote preconditioning’’. J Am Coll Cardiol. 1999;33(2):556-64, http://dx.doi.org/10.1016/S0735-1097(98)00559-2. Patel HH, Moore J, Hsu AK, Gross GJ. Cardioprotection at a distance: mesenteric artery occlusion protects the myocardium via an opioid sensitive mechanism. J Mol Cell Cardiol. 2002;34(10):1317-23, http://dx. doi.org/10.1006/jmcc.2002.2072. Harkin DW, Barros D’Sa AA, McCallion K, Hoper M, Campbell FC. Ischemic preconditioning before lower limb ischemia–reperfusion protects against acute lung injury. J Vasc Surg. 2002;35(6):1264-73, http://dx.doi.org/10.1067/mva.2002.121981. Lai IR, Chang KJ, Chen CF, Tsai HW. Transient limb ischemia induces remote preconditioning in liver among rats: the protective role of heme oxygenase-1. Transplantation. 2006;81(9):1311-7, http://dx.doi.org/10. 1097/01.tp.0000203555.14546.63. Addison PD, Neligan PC, Ashrafpour H, Khan A, Zhong A, Moses M, et al. Noninvasive remote ischemic preconditioning for global protection of skeletal muscle against infarction. Am J Physiol Heart Circ Physiol. 2003;285(4):H1435-43. Loukogeorgakis SP, Panagiotidou AT, Broadhead MW, Donald A, Deanfield JE, MacAllister RJ. Remote ischemic preconditioning provides early and late protection against endothelial ischemia-reperfusion injury in humans: role of the autonomic nervous system. J Am Coll Cardiol. 2005;46(3):450-6, http://dx.doi.org/10.1016/j.jacc.2005.04.044. Loukogeorgakis SP, Williams R, Panagiotidou AT, Kolvekar SK, Donald A, Cole TJ, et al. Transient limb ischemia induces remote preconditioning and remote postconditioning in humans by a K(ATP)-channel dependent mechanism. Circulation. 2007;116(12):1386-95, http://dx.doi.org/10. 1161/CIRCULATIONAHA.106.653782. Venugopal V, Hausenloy DJ, Ludman A, Di Salvo C, Kolvekar S, Yap J, et al. Remote ischaemic preconditioning reduces myocardial injury in patients undergoing cardiac surgery with cold-blood cardioplegia: a randomised controlled trial. Heart. 2009;95(19):1567-71, http://dx.doi. org/10.1136/hrt.2008.155770. Thielmann M, Kottenberg E, Boengler K, Raffelsieper C, Neuhaeuser M, Peters J, et al. Remote ischemic preconditioning reduces myocardial injury after coronary artery bypass surgery with crystalloid cardioplegic arrest. Basic Res Cardiol. 2010;105(5):657-64, http://dx.doi.org/10.1007/s00395010-0104-5. Gurusamy KS, Kumar Y, Pamecha V, Sharma D, Davidson BR. Ischaemic pre-conditioning for elective liver resections performed under vascular occlusion. Cochrane Database Syst Rev. 2009;(1):CD007629. Eng J. Sample size estimation: how many individuals should be studied? Radiology. 2003;227(2):309-13, http://dx.doi.org/10.1148/radiol.227201 2051.


CLINICAL SCIENCE

Effect of intraoperative HES 6% 130/0.4 on the need for blood transfusion after major oncologic surgery: a propensity-matched analysis Fernando Godinho Zampieri,I,II,III Otavio T. Ranzani,II Priscila Fernanda Morato,I Pedro Paulo Campos,I Pedro CarusoI,IV I

Hospital do Caˆncer AC Camargo, Intensive Care Unit, Sa˜o Paulo/SP, Brazil. II Faculdade de Medicina da Universidade de Sa˜o Paulo, Emergency Medicine Discipline, Intensive Care Unit, Sa˜o Paulo/SP, Brazil. III Hospital Alema˜o Oswaldo Cruz, Intensive Care Unit, Sa˜o Paulo/SP, Brazil. IV Faculdade de Medicina da Universidade de Sa˜o Paulo, Respiratory Intensive Care Unit, Sa˜o Paulo/SP, Brazil.

OBJECTIVES: To evaluate the effect of the intraoperative use of hydroxyethyl starch on the need for blood products in the perioperative period of oncologic surgery. The secondary end-points included the need for other blood products, the clotting profile, the intensive care unit mortality and length of stay. METHODS: Retrospective observational analysis in a tertiary oncologic ICU in Brazil including 894 patients submitted to oncologic surgery for a two-year period from September 2007. Patients were grouped according to whether hydroxyethyl starch was used during surgery (hydroxyethyl starch and No-hydroxyethyl starch groups) and compared using a propensity score analysis. A total of 385 propensity-matched patients remained in the analysis (97 in the No-hydroxyethyl starch group and 288 in the hydroxyethyl starch group). RESULTS: A higher percentage of patients in the hydroxyethyl starch group required red blood cell transfusion during surgery (26% vs. 14%; p = 0.016) and in the first 24 hours after surgery (5% vs. 0%; p = 0.015) but not in the 24- to 48-hour period after the procedure. There was no difference regarding the transfusion of other blood products, intensive care unit mortality or length of stay. CONCLUSION: Hydroxyethyl starch use in the intraoperative period of major oncologic surgery is associated with an increase in red blood cell transfusions. There are no differences in the need for other blood products, intensive care unit length of stay or mortality. KEYWORDS: Tetrastarch; Adverse Events; Blood Transfusion; Surgical Blood Loss; Surgery; Cancer. Zampieri FG, Ranzani OT, Morato PF, Campos PP, Caruso P. Effect of intraoperative HES 6% 130/0.4 on the need for blood transfusion after major oncologic surgery: a propensity-matched analysis. Clinics. 2013;68(4):501-509. Received for publication on October 14, 2012; First review completed on November 12, 2012; Accepted completed on December 21, 2012 E-mail: fgzampieri@gmail.com Tel.: 55 11 2661-6457

(third generation, low molecular weight, low degree of substitution) is less prone to cause blood coagulation disorders than the old compounds (11), but this issue remains controversial (7,12,13) primarily because few studies evaluated the issue (4). In the perioperative period, even the new generation starches inspire concerns about their safety, especially in terms of coagulation disorders (1,7,13-15). Patients submitted to oncologic surgery are subjected to long surgery procedures, with a great need of fluid resuscitation and blood products transfusion. It has been suggested that surgical cancer patients are more prone to being transfused with blood products than non-cancer patients (16). No study has evaluated the effects of the intraoperative use of a new generation HES on the intraoperative and postoperative red blood cells and other blood products transfusion in patients submitted to elective major oncologic surgery. We hypothesized that patients submitted to oncologic surgery that received a new generation HES during surgery

& INTRODUCTION Fluid expansion is critical during surgery and in postoperative care. The ideal fluid type (crystalloids or colloids) and the optimum dosage of fluids are much debated issues (1-4). Hydroxyethyl starches (4) are widely used as fluid expanders in the perioperative period and are the preferred colloids in many intensive care units (ICU) (5,6). Hydroxyethyl starch (HES) may impair blood coagulation by reducing the levels of von Willebrand factor and factor VIII and by decreasing the platelet count and function (710). It has been suggested that the new generation HES

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)11

501


HES in oncologic surgery Zampieri FG et al.

CLINICS 2013;68(4):501-509

would require more red blood cells transfusions during and after the surgery than patients that did not receive HES. To test our hypothesis, we evaluated whether a new generation HES led to more red blood cell transfusions during the first 48 hours after major elective oncologic surgery than patients that received only crystalloids using a propensity-matched approach. Secondary objectives included clotting profile, use of blood products other than red cells, ICU length of stay and mortality between the two groups.

each specific site is usually performed by a very restricted number of surgeons. The ICU policy for transfusion suggests that red blood cell packs should be transfused if the hemoglobin level is below 7 g/dL or below 8 g/dL with signs of active bleeding and/or impaired tissue perfusion (delayed capillary refill time, elevated lactate levels and nonchloremic metabolic acidosis) (17). Transfusion with hemoglobin levels above 9 g/dL was not encouraged and was performed only at the discretion of the intensivist if massive blood lost was detected (high output in the drain with hemodynamic instability). Platelets were transfused if the total count was less than 50 6 103 units/mL with active bleeding or after neurosurgery. Cryoprecipitate transfusion was indicated in patients with fibrinogen levels less than 100 mg/dL. Fresh frozen plasma was administered if the coagulation times were two-fold higher the normal value range in patients with active bleeding or after neurosurgery. Colloid use policy: At the time of the study, the only synthetic colloid available at our institution was a new generation 6% HES 130/0.4 (VoluvenH). HES was administered at the discretion of the anesthesiologist during surgery. HES use on the ICU postoperative period is not part of our postoperative resuscitation protocol and is discouraged. Albumin was not used during the postoperative period of elective oncologic surgery. Statistical analysis: Categorical and continuous data are presented as percentages and the mean ¡ SD (or median and 25%-75% interquartile range [IQR]), respectively. Categorical variables were compared using the Chi-square or Fisher exact test, as appropriate. Quantitative continuous variables were compared using an unpaired t test or MannWhitney test for parametric or nonparametric variables, respectively. Patients were clustered according to the administration of HES during surgery. Because the use of colloids was not randomized, there were two unbalanced groups (Table 1). Because this was a retrospective analysis (patients were not randomized), the creation of a propensity score is an effective method to reduce bias. Propensity-matched analyses are increasingly being used in research due to its ability to improve the power of retrospective and prospective non-randomized analysis (18,19). Propensity score has been defined as the ‘‘condition probability of being treated given the covariates’’ (20). Propensity-matched analyses are able to take into account as many variables related to the outcome evaluated as needed, which reduces bias (20). To construct the propensity score, a logistic regression was fitted, and variables were chosen for inclusion according to the methods of Brookhart et al. (18). We included variables that could be related to the study outcomes based on the propensity score. To identify the variables potentially associated with the outcome, a univariate analysis was performed to evaluate potential variables related to blood transfusion during the entire perioperative period (from the surgical procedure to up to 48 hours after surgery). The variables included on the propensity score were as follows: age, gender, body-mass index, metastatic disease, surgery length, volume of crystalloid infused and surgical sites. Although age and body mass index were not associated with the outcome, we believed that they were important variables that could alter the fluid dynamics during the surgical procedures and included them in the model (21). The best caliper was 0.05, which was obtained by the Austin method (22). After the propensity score was created, the

& PATIENTS AND METHODS Study design: Retrospective analysis of medical records. Patients: The Ethics Committee of the Hospital AC Camargo approved this study and waived patient consent due to its retrospective observational nature. From September 2007 to September 2009, all patients admitted to the hospital ICU (three units with a total of 33 beds) of our teaching hospital after an elective major oncologic surgery (head and neck, neurological, thoracic, abdominal and other sites) were included in the study. Data collection: In the hospital, all data are recorded in a computerized physician order entry and an electronic medical record system. We collected the data recorded during the surgery and the following 48 hours. During the intraoperative period, we collected the number of packs of blood products transfused (red blood cells, fresh frozen plasma, platelets and cryoprecipitate), the surgery length and the volume of crystalloids and colloids infused. During ICU admission, we collected the simplified acute physiology score 3 (SAPS 3) and performed laboratory exams that included creatinine levels and clotting profile (composed of the platelets count and prothrombin time (PT)). During the 48-hour period after the surgery, we collected the number of packages of blood products transfused and performed laboratory exams, including serum creatinine. We divided the 48-hour period after the surgery into two periods of 24 hours because the hypothetical HES side effect could be evanescent. The data were analyzed for three consecutive periods: the intraoperative period, the period from the end of the surgery to the first 24 hours after post-surgery (24hour period) and the period between from 24 to 48 hours after the surgery (24- to 48-hour period). The patients were categorized in two groups according to the use of HES during the intraoperative period (HES and No-HES group). The patients in the HES group received at least 500 mL of new generation HES (VoluvenH - 6% 130/0.4, Fresenius, Germany). Perioperative transfusion policy: The hospital transfusion policy recommends that patients should be admitted to the operating room with a hemoglobin level greater than 10 mg/dL and platelet count above 50 6 103 units/mL. Coagulation disorders, as assessed by aPTT and PT, were treated with preoperative fresh frozen plasma transfusion until both values were within the normal range (international normalized ratio and aPTT ratio less or equal to 1.5). Other causes of coagulopathy, such as vitamin K deficiency, were assessed as appropriate. Blood transfusion during surgery is left to the discretion of the anesthesiologist and surgeon. All anesthesiologists in the hospital are part of a small team that follows protocols for surgery resuscitation and blood transfusion. There are five major surgical teams in the hospital (thoracic, abdominal, pelvic, neurological and soft tissue) and each has a closed staff, i.e., surgery at

502


CLINICS 2013;68(4):501-509

HES in oncologic surgery Zampieri FG et al.

Table 1 - Baseline characteristics of the patients that received hydroxyethyl starch (HES group) and crystalloid during major oncologic surgery. Overall data

Age, years Male, n (%) SAPS 3 BMI, kg/m2 Metastatic disease, n (%) Any chronic comorbidity, n (%) Total operative time, hours Crystalloid volume received, L HES volume received, L Site of surgery Abdominal Head and neck Central nervous system Thoracic Soft tissue Other

Propensity-matched

No-HES (n = 280)

HES (n = 614)

p-value

No-HES (n = 97)

HES (n = 288)

p-value

61¡16 136 (49) 46¡13 26¡6 85 (31) 242 (86) 3 (2-5) 2.0 [1.0-2.5] 0

57¡16 316 (52) 47¡11 26¡5 187 (31) 475 (77) 6.2 [5-8.5] 4.5 [3.0-6.5] 1 [0.5-1.1]

,0.001 0.42 0.43 0.94 0.98 0.002 ,0.001 ,0.001

59¡17 48 (50) 46¡14 27¡5 31 (32) 79 (81) 5 (3-6) 3 [2.0-4.5] 0

58¡16 143 (50) 46¡12 26¡5 85 (30) 227 (79) 5 [4-6.2] 3.5 [2.0-4.5] 1 [0.5-1.0]

0.54 0.98 0.97 0.66 0.65 0.58 0.14 0.18

128 50 49 27 21 5

(46) (18) (17) (10) (7) (2)

458 73 45 30 6 2

,0.001 ,0.001 0.016 ,0.001 0.007 ,0.001 0.034

(74) (12) (7) (5) (1) (1)

57 8 14 12 4 2

(59) (8) (14) (12) (4) (2)

195 29 37 20 5 2

(68) (10) (13) (7) (2) (1)

0.23 0.11 0.60 0.69 0.09 0.24 0.26

BMI = body mass index; HES = hydroxyethyl starch; SAPS 3 = simplified acute physiology score 3.

patients were matched according to their respective propensity scores. As reported in the current literature, matching on the propensity score has now been clearly demonstrated to be the best method to attempt to provide an unbiased estimation of the treatment effect (19). First, based on the crude analysis, we pre-defined a match considering one patient without HES use to a maximum of three patients with HES use. The match procedure was performed with an optimal matching method, and to avoid overinflation, we did not permit replacement of matched patients. The number of patients analyzed using the propensity score was smaller than the total number of patients studied because matching was not possible for all patients. Our analysis was performed with fewer patients than the original study population. Even with fewer patients, an analysis using the propensity score is more reliable than traditional statistical methods because imbalance between groups is reduced (18,23). The correct construction of the propensity score was performed with the box-plot method. After the propensity score matches were performed, we performed a diagnostic to ensure good balance in the matched population through the bias reduction method and the stabilized standardized difference (because we were using 1:N matching instead of 1:1 matching) (19,22). After matching, the groups were compared using conventional statistical tests. We performed an additional analysis using ‘‘corrected total volume’’ (CTV) instead of crystalloid volume as a variable in the propensity score (see Appendix). CTV was defined as total crystalloid volume 6 0.3 plus 1.4 6 infused colloid volume (21,24,25). This alternative analysis was conducted to balance the effective volume used for expansion in both groups (see Appendix for details). All the statistical analysis were performed in SPSS 19.0, and a pvalue of 0.05 for was considered significant for all comparisons.

the propensity score, the patients in the HES group had longer surgical times, had received more crystalloids, were younger and were less likely to have any comorbidity compared with the No-HES group (Table 1). There were also differences regarding the surgery site between groups. After the creation of the matched groups, 385 propensitymatched patients (97 in the crystalloids group and 288 in the HES group) were analyzed. Patients in the paired groups had similar baseline characteristics (Table 1). The median volume of infused HES was 1 L [0.5-1.0]. No patient received less than 0.5 L. Creatinine values were similar for both groups in all the observation periods. The incidence of acute kidney injury (AKI) (defined according to the RIFLE criteria of risk, i.e., an increase of serum creatinine of 50% or more over the baseline) (26,27) was similar between the groups (7% versus 7%, p.0.99). More detailed results regarding the other propensity matched analysis (using CTV), standard logistic regression and non-propensity matched results analysis can be found in the Appendix. Red blood cells and other blood products transfusions: The variables related to transfusion of red blood cell pack transfusion for all the perioperative transfusions are shown in Table 2. Most patients in both groups did not require blood products transfusion. In the HES group, a higher percentage of patients received red blood cell transfusion in the intraoperative and 24-hour postoperative period, but the percentage was similar for the 24- to 48-hour postoperative period (Figure 1). For the patients in both groups that received red blood cell transfusions, the number of packs per patient was higher in the HES group during the intraoperative period (0.55 versus 0.39; p = 0.028). No patient in the No-HES group received a blood transfusion after surgery. There was no difference regarding the use of fresh frozen plasma, cryoprecipitate and platelets concentrate in any period. The patients that received HES had a small but statistically significant lower hemoglobin level at ICU admission (11.2¡1.9 versus 12.0¡1.7; p,0.001) but not at the 24-hour (11.1¡1.8 versus 11.3¡1.6; p = 0.11) and 48-hour (10.2¡1.7 versus 10.2¡1.5; p = 0.20) postoperative periods.

& RESULTS We included 894 patients; 614 received HES, and 280 received only crystalloids during surgery. Before the use of

503


HES in oncologic surgery Zampieri FG et al.

CLINICS 2013;68(4):501-509

The INR was higher in transfused No-HES patients than in non-transfused No-HES patients. The INR was also higher in the transfused HES patients than the non-transfused HES patients at ICU admission. There were no differences between transfused patients in the HES and No-HES groups regarding platelet count or INR at any period studied. Nontransfused HES patients also had a higher INR than nontransfused No-HES patients. ICU mortality and length of stay were similar between HES and No-HES groups (Table 3).

Table 2 - Univariate analysis of factors related to red blood cell transfusion. Perioperative RBC transfusion No (n = 624) $

Age, years Male, n (%)$ SAPS 3 BMI, kg/m2 $ Metastatic disease, n (%)$ Any chronic comorbidity, n (%) Total operative time, hours$ Crystalloid volume received, L$ HES volume received, L Site of surgery$ Abdominal Head and neck Central nervous system Thoracic Soft tissue Other

Yes (n = 270) p-value

58¡16 329 (53) 45¡12 27¡6 168 (27) 505 (81) 5 (3-7) 3.0 [1.6-4.5] 0.5 [0.0-1.0]

58¡15 123 (46) 49¡11 26¡5 106 (39) 212 (79) 7 (5-9) 5.5 [4.0-7.1] 1.0 [0.5-1.5]

379 (60) 96 (15) 75 (12) 50 (8) 20 (3) 4 (1)

207 (77) 27 (10) 19 (7) 7 (3) 7 (3) 3 (1)

0.73 0.049 ,0.001 0.069 ,0.001 0.41 ,0.001 ,0.001 ,0.001 ,0.001

& DISCUSSION In this retrospective analysis using a propensity-matched cohort of surgical patients, HES use was associated with more frequent red blood cells transfusions during major oncologic surgery and in the first 24 hours after the procedure. ICU length of stay and mortality were the same for both groups. There is an intense debate involving HES use in critically ill patients. HES are considered more efficient volume expanders than crystalloids; i.e., less volume is needed to obtain the same hemodynamic effect (28,29). A recent randomized controlled trial suggested that patients with penetrating trauma required less total volume when resuscitated by HES compared with saline; there was no difference, however, in patients with blunt trauma (30). A recently published trial in septic patients suggested that less fluid was needed to reach hemodynamic stability in patients resuscitated with HES (31). A larger multicenter randomized trial has shown no difference regarding the total fluid need in septic patients (24). The need for less fluid to obtain the same hemodynamic effect would be particularly interesting during the intraoperative period, when hemodynamic optimization associated with less total fluid volume may be beneficial (32). HES and other colloids are not related to any robust positive clinical outcome, such as mortality or reduced ICU length of stay (33). In the recently published 6S Trial, septic patients that were randomized to fluid resuscitation with HES had higher mortality, suggesting that at least in this specific population, HES use should be strongly discouraged (24). The doubtful greater efficiency of HES may be counteracted by significant side effects, including coagulation abnormalities and AKI (13). The impact of these side effects on outcome, especially for HES 6% 130/0.4, is largely unknown (4). Oncologic patients may have coagulation abnormalities related to their illness and chemotherapy side effects (34). We aimed to evaluate the effects of HES on the perioperative need for blood transfusion in this specific population. This outcome is important because blood transfusion may be associated with worse outcome after oncologic surgery, including long-term survival (35-38). Blood transfusion is not harmless and has been associated with several clinical side effects, including transfusion related acute lung injury and fluid overload (39). In critically ill patients, blood transfusion is associated with poorer outcomes (39). Our propensity-matched data showed that HES use is independently related to a greater need for red blood cell transfusion in the perioperative period. As previously reported, even low doses of HES could result in coagulation abnormalities (14). In addition to requiring more red blood cell transfusions, HES patients also had lower hemoglobin levels at ICU admission, suggesting that the difference was not only due to over transfusion of the HES group.

BMI = body mass index; HES = hydroxyethyl starch; SAPS 3 = simplified acute physiology score 3; $ = variables included in the propensity-score.

The transfusion rate was similar between the groups when we employed the propensity analysis that included CTV (Additional Table 2). The results of the non-propensity analysis (see Appendix, Additional Table 3 and 4) showed that red blood cell transfusion was more frequent in the HES patients. The multivariate analysis showed that the factors associated with red blood cell transfusion in the perioperative period included age, metastatic disease, total operative time, crystalloid volume used and colloid use (any dose). Thoracic and head and neck surgery were protective factors against transfusion (see Additional Table 5). Secondary objectives: Patients in the HES group showed lower levels of platelets at ICU admission compared to the No-HES group (Table 3). The international normalized ratio (INR) was also higher in the HES patients at ICU admission and in the first 24 hours after surgery (Table 3). Table 4 shows the coagulation values for transfused and nontransfused patients in both groups (No-HES and HES).

Figure 1 - Percentage of patients that received red blood cell transfusion on each studied period.

504


CLINICS 2013;68(4):501-509

HES in oncologic surgery Zampieri FG et al.

Table 3 - Secondary objectives.

ICU mortality and LOS ICU mortality, n (%) ICU LOS, days [IQ] Clotting profile Platelet count at ICU admission Platelet count at the 24-hour postoperative period Platelet count during the 24- to 48-hour postoperative period PT (INR) at ICU admission PT (INR) at the 24-hour postoperative period PT (INR) during the 24- to 48-hour postoperative period

No-HES n = 97

HES n = 288

p-value

1 (1) 1 (1-2)

6 (2) 1 (1-2)

0.69 0.48

219 [165-293] 6 103 200 [153–262] 6 103 190 [143–302] 6 103 1.12 [1.06-1.21] 1.16 [1.07-1.25] 1.29 [1.17-1.37]

191 [141-239] 6 103 193 [142–250] 6 103 188 [135–235] 6 103 1.19 [1.10-1.29] 1.19 [1.10-1.31] 1.27 [1.14-1.41]

0.003 0.22 0.24 ,0.001 0.027 0.94

PT = prothrombin time; INR = international normalized ratio; ICU = intensive care unit; LOS = length of stay.

appears to be reduced after major injury (42) and that our patients also used a small volume of starch that was below the suggested maximum daily dose of 50 mL/kg. There were small differences in the coagulation profile between the HES and No-HES groups. Those differences are likely without clinical significance because the values were very similar between the groups (Table 3). There were no differences in the coagulation profile (including the INR and platelet count) between the transfused patients in both groups (Table 4). The higher need for transfusions cannot be explained by the differences in coagulation features after surgery. In our multivariate analysis, thoracic surgery was a protector factor against transfusion. It may be speculated that because restrictive fluid therapy is frequently used in thoracic surgery (43), patients received less fluid, with less hemodilution and bleeding related to dilutional coagulopathy, and therefore required less red blood cell transfusion. The ICU length of stay and mortality were similar between groups, but our analysis was likely underpowered to detect a significant difference in a population with low mortality (below 2%) and short ICU length of stay (one day of median ICU stay). In the univariate analysis, ICU length of stay was higher in the HES group than in the No-HES group (Additional Table 6). There are several limitations in our analysis. First, this study has a single-center retrospective analysis design.

Corroborating with our results, other studies have shown a higher need for blood products in critically ill patients who received HES (24,40). Patients with blunt trauma resuscitated with HES required more blood transfusions than patients who received saline, although this conclusion is likely confounded by a higher injury severity in the HESresuscitated patients (30). Our standard multivariate analysis showed that colloid use was a risk factor for the perioperative need for red blood cell transfusion. When we performed the CTV analysis, both groups had similar transfusion rates. Nevertheless, because this analysis included fewer patients (with only 41 patients in the NoHES group – see Appendix), it is possible that the smaller sample reduced the power of the study to detect any difference. It can be argued that because the use of HES is associated with a greater degree of plasma volume expansion, and considering that the two groups were paired to the crystalloid volume infused, our findings may be related only to the increased hemodilution caused by HES use (41). The increase in the frequency of red blood cell pack transfusions in the HES group in the main propensity analysis might to some degree be related to the expansion effect of HES and not to its impact on blood coagulation. The lack of difference in the CTV analysis corroborates this hypothesis. It should be stated that the effectiveness of HES as a dilutional agent

Table 4 - Characteristics of the transfused and non-transfused patients in the HES and No-HES groups. No-HES

Age, years Male, n (%) SAPS 3 Metastatic disease, n (%) Platelets count at ICU admission Platelet count at the 24-hour postoperative period Platelet count during the 24- to 48-hour postoperative period PT (INR) at ICU admission PT (INR) at the 24-hour postoperative period PT (INR) during the 24- to 48-hour postoperative period

Comparison between No-HES and HES

HES

No-Tx (n = 85)

Tx (n = 12)

p

59 ¡ 17 43 (51) 45 ¡ 14 22 (26) 215 [170-285] 6103 201 [155–265] 6103 182 [143–314] 6103 1.11 [1.06-1.18] 1.15 [1.06-1.23]

65 ¡ 12 5 (42) 54 ¡ 11 9 (75) 207 [129-289] 6103 188 [122–250] 6103 191 [100–232] 6103 1.18 [1.15-1.25] 1.18 [1.13-1.45]

0.22 0.27 0.040 0.011 0.56

No-Tx

Tx

0.87 0.44 0.81 0.96 0.034

0.17 0.65 0.13 0.047 0.42

0.60

0.91

0.68

0.81

0.007 0.15

58 ¡ 16 58 ¡ 16 0.94 108 (52) 35 (43) 0.11 45 ¡ 11 48 ¡ 11 0.040 55 (26) 30 (37) 0.12 200 [149-251] 173 [124-245] 6103 0.12 3 610 200 [155–258] 180 [112–266] 0.17 6103 6103 190 [155–258] 158 [109–239] 6103 0.021 6103 1.15 [1.08-1.25] 1.24 [1.14-1.40] ,0.001 1.18 [1.09-1.27] 1.20 [1.11-1.33] 0.18

0.003 0.11

0.31 0.95

1.24 [1.06-1.36]

1.30 [1.27-1.32]

0.69

1.28 [1.14-1.42]

0.44

0.76

0.38 0.39

No-Tx (n = 207)

Tx (n = 81)

1.27 [1.15-1.39]

p

0.60

TX = red blood cell pack transfusion; BMI = body mass index; HES = hydroxyethyl starch; SAPS 3 = simplified acute physiology score 3.

505


HES in oncologic surgery Zampieri FG et al.

CLINICS 2013;68(4):501-509

Second, the propensity score analysis was unable to match for unmeasured variables. Third, due to its retrospective nature, we were unable to control for personal preferences variables regarding red blood cell transfusion and specific tumor staging (which could be related to technical difficulties during the surgical procedure), although we included metastatic disease in the propensity score. Fourth, although our hospital has strict policies for transfusion and perioperative fluid therapy, we cannot guarantee that these protocols were followed in all of the patients analyzed. Triggers for transfusion were also unavailable for analysis. Fifth, our study was underpowered to evaluate the ICU length of stay and mortality. Our finding that HES use is associated with a greater need for blood transfusion is biologically plausible and has been reported in other clinical scenarios (24,40). If these findings are confirmed in large, prospective studies, HES use should be questioned in the subjects undergoing elective oncologic surgery due to its unproven clinically efficacy over crystalloids (4,13). The surgical procedures on oncologic patients have specific aspects that need further study. The intraoperative use of HES 6% 130/0.4 during major elective oncologic surgery is associated with an increase in red blood cell transfusions in the perioperative period of major oncologic surgery. There were no differences in ICU length of stay and mortality. Further randomized clinical trials in this specific population are urgently needed.

11.

12.

13.

14.

15.

16.

17.

18. 19.

& AUTHOR CONTRIBUTIONS 20.

Zampieri FG designed the study, collected the data and wrote the manuscript. Ranzani OT performed the statistical analysis and reviewed the manuscript. Morato PF, Campos PP helped in the data collection and reviewed the manuscript. Caruzo P helped in the data collection, performed the statistical analysis, and reviewed the manuscript.

21. 22.

& REFERENCES 1. Westphal M, James MF, Kozek-Langenecker S, Stocker R, Guidet B, Van Aken H. Hydroxyethyl starches: different products–different effects. Anesthesiology. 2009;111(1):187-202, http://dx.doi.org/10.1097/ALN. 0b013e3181a7ec82. 2. Singer M. Management of fluid balance: a European perspective. Curr Opin Anaesthesiol. 2012;25(1):96-101, http://dx.doi.org/10.1097/ACO. 0b013e32834e8150. 3. Corcoran T, Emma Joy Rhodes J, Clarke S, Myles PS, Ho KM. Perioperative fluid management strategies in major surgery: a stratified meta-analysis. Anesth Analg. 2012;114(3):640-51, http://dx.doi.org/10. 1213/ANE.0b013e318240d6eb. 4. Gattas DJ, Dan A, Myburgh J, Billot L, Lo S, Finfer S, et al. Fluid resuscitation with 6% hydroxyethyl starch (130/0.4) in acutely ill patients: an updated systematic review and meta-analysis. Anesth Analg. 2012;114(1):159-69, http://dx.doi.org/10.1213/ANE.0b013e3182 36b4d6. 5. Schortgen F, Deye N, Brochard L, Group CS. Preferred plasma volume expanders for critically ill patients: results of an international survey. Intensive Care Med. 2004;30(12):2222-9, http://dx.doi.org/10.1007/ s00134-004-2415-1. 6. Miletin MS, Stewart TE, Norton PG. Influences on physicians’ choices of intravenous colloids. Intensive Care Med. 2002;28(7):917-24, http://dx. doi.org/10.1007/s00134-002-1337-z. 7. Sossdorf M, Marx S, Schaarschmidt B, Otto GP, Claus RA, Reinhart K, et al. HES 130/0.4 impairs haemostasis and stimulates pro-inflammatory blood platelet function. Crit Care. 2009;13(6):R208, http://dx.doi.org/10. 1186/cc8223. 8. Kozek-Langenecker SA. Effects of hydroxyethyl starch solutions on hemostasis. Anesthesiology. 2005;103(3):654-60, http://dx.doi.org/10. 1097/00000542-200509000-00031. 9. de Jonge E, Levi M. Effects of different plasma substitutes on blood coagulation: a comparative review. Crit Care Med. 2001;29(6):1261-7, http://dx.doi.org/10.1097/00003246-200106000-00038. 10. Franz A, Braunlich P, Gamsjager T, Felfernig M, Gustorff B, KozekLangenecker SA. The effects of hydroxyethyl starches of varying

23.

24. 25.

26.

27. 28.

29.

30.

31.

506

molecular weights on platelet function. Anesth Analg. 2001;92(6):14027, http://dx.doi.org/10.1097/00000539-200106000-00008. Langeron O, Doelberg M, Ang ET, Bonnet F, Capdevila X, Coriat P. Voluven, a lower substituted novel hydroxyethyl starch (HES 130/0.4), causes fewer effects on coagulation in major orthopedic surgery than HES 200/0.5. Anesth Analg. 2001;92(4):855-62, http://dx.doi.org/10. 1097/00000539-200104000-00011. Kozek-Langenecker SA, Jungheinrich C, Sauermann W, Van der Linden P. The effects of hydroxyethyl starch 130/0.4 (6%) on blood loss and use of blood products in major surgery: a pooled analysis of randomized clinical trials. Anesth Analg. 2008;107(2):382-90, http://dx.doi.org/10. 1213/ane.0b013e31817e6eac. Hartog CS, Kohl M, Reinhart K. A systematic review of third-generation hydroxyethyl starch (HES 130/0.4) in resuscitation: safety not adequately addressed. Anesth Analg. 2011;112(3):635-45, http://dx.doi.org/10. 1213/ANE.0b013e31820ad607. Schramko A, Suojaranta-Ylinen R, Kuitunen A, Raivio P, Kukkonen S, Niemi T. Hydroxyethylstarch and gelatin solutions impair blood coagulation after cardiac surgery: a prospective randomized trial. Br J Anaesth. 2010;104(6):691-7. Hartog CS, Reuter D, Loesche W, Hofmann M, Reinhart K. Influence of hydroxyethyl starch (HES) 130/0.4 on hemostasis as measured by viscoelastic device analysis: a systematic review. Intensive Care Med. 2011;37(11):1725-37, http://dx.doi.org/10.1007/s00134-011-2385-z. Amar D, Grant FM, Zhang H, Boland PJ, Leung DH, Healey JA. Antifibrinolytic therapy and perioperative blood loss in cancer patients undergoing major orthopedic surgery. Anesthesiology. 2003;98(2):337-42, http://dx.doi.org/10.1097/00000542-200302000-00011. Drews RE. Critical issues in hematology: anemia, thrombocytopenia, coagulopathy, and blood product transfusions in critically ill patients. Clin Chest Med. 2003;24(4):607-22, http://dx.doi.org/10.1016/S02725231(03)00100-X. Brookhart MA, Schneeweiss S, Rothman KJ, Glynn RJ, Avorn J, Sturmer T. Variable selection for propensity score models. Am J Epidemiol. 2006;163(12):1149-56. Gayat E, Pirracchio R, Resche-Rigon M, Mebazaa A, Mary JY, Porcher R. Propensity scores in intensive care and anaesthesiology literature: a systematic review. Intensive Care Med. 2010;36(12):1993-2003, http://dx. doi.org/10.1007/s00134-010-1991-5. D’Agostino RB, Jr. Propensity score methods for bias reduction in the comparison of a treatment to a non-randomized control group. Stat Med. 1998;17(19):2265-81, http://dx.doi.org/10.1002/(SICI)1097-0258(199810 15)17:19,2265::AID-SIM918.3.0.CO;2-B. Hahn RG. Volume kinetics for infusion fluids. Anesthesiology. 2010;113(2):470-81, http://dx.doi.org/10.1097/ALN.0b013e3181dcd88f. Austin PC. An Introduction to Propensity Score Methods for Reducing the Effects of Confounding in Observational Studies. Multivariate Behav Res. 2011;46(3):399-424, http://dx.doi.org/10.1080/00273171.2011.5687 86. Brookhart MA, Wang PS, Solomon DH, Schneeweiss S. Instrumental variable analysis of secondary pharmacoepidemiologic data. Epidemiology. 2006;17(4):373-4, http://dx.doi.org/10.1097/01.ede.0000 222026.42077.ee. Perner A, Haase N, Guttormsen AB, Tenhunen J, Klemenzson G, Aneman A, et al. Hydroxyethyl starch 130/0.42 versus Ringer’s acetate in severe sepsis. N Engl J Med. 2012;367(2):124-34. Bellmann R, Feistritzer C, Wiedermann CJ. Effect of molecular weight and substitution on tissue uptake of hydroxyethyl starch: a meta-analysis of clinical studies. Clin Pharmacokinet. 2012;51(4):225-36, http://dx.doi. org/10.2165/11594700-000000000-00000. Abosaif NY, Tolba YA, Heap M, Russell J, El Nahas AM. The outcome of acute renal failure in the intensive care unit according to RIFLE: model application, sensitivity, and predictability. Am J Kidney Dis. 2005;46(6):1038-48, http://dx.doi.org/10.1053/j.ajkd.2005.08.033. Prowle JR, Liu YL, Licari E, Bagshaw SM, Egi M, Haase M, et al. Oliguria as predictive biomarker of acute kidney injury in critically ill patients. Crit Care. 2011;15(4):R172, http://dx.doi.org/10.1186/cc10318. Verheij J, van Lingen A, Beishuizen A, Christiaans HM, de Jong JR, Girbes AR, et al. Cardiac response is greater for colloid than saline fluid loading after cardiac or vascular surgery. Intensive Care Med. 2006;32(7):1030-8, http://dx.doi.org/10.1007/s00134-006-0195-5. Trof RJ, Sukul SP, Twisk JW, Girbes AR, Groeneveld AB. Greater cardiac response of colloid than saline fluid loading in septic and non-septic critically ill patients with clinical hypovolaemia. Intensive Care Med. 2010;36(4):697-701, http://dx.doi.org/10.1007/s00134-010-1776-x. James MF, Michell WL, Joubert IA, Nicol AJ, Navsaria PH, Gillespie RS. Resuscitation with hydroxyethyl starch improves renal function and lactate clearance in penetrating trauma in a randomized controlled study: the FIRST trial (Fluids in Resuscitation of Severe Trauma). Br J Anaesth. 2011;107(5):693-702. Guidet B, Martinet O, Boulain T, Philippart F, Poussel JF, Maizel J, et al. Assessment of hemodynamic efficacy and safety of 6% hydroxyethylstarch 130/0.4 vs. 0.9% NaCl fluid replacement in patients with severe sepsis: The CRYSTMAS study. Crit Care. 2012 24;16(3):R94.


CLINICS 2013;68(4):501-509

HES in oncologic surgery Zampieri FG et al.

32. Lobo SM, Ronchi LS, Oliveira NE, Brandao PG, Froes A, Cunrath GS, et al. Restrictive strategy of intraoperative fluid maintenance during optimization of oxygen delivery decreases major complications after high-risk surgery. Crit Care. 2011;15(5):R226, http://dx.doi.org/10. 1186/cc10466. 33. Perel P, Roberts I. Colloids versus crystalloids for fluid resuscitation in critically ill patients. Cochrane Database Syst Rev. 2011(3):CD000567. 34. Kvolik S, Jukic M, Matijevic M, Marjanovic K, Glavas-Obrovac L. An overview of coagulation disorders in cancer patients. Surg Oncol. 2010;19(1):e33-46, http://dx.doi.org/10.1016/j.suronc.2009.03.008. 35. Perisanidis C, Dettke M, Papadogeorgakis N, Schoppmann A, Mittlbock M, Kyzas PA, et al. Transfusion of allogenic leukocyte-depleted packed red blood cells is associated with postoperative morbidity in patients undergoing oral and oropharyngeal cancer surgery. Oral Oncol. 2012;48(4):372-8, http://dx.doi.org/10.1016/j.oraloncology.2011.11.020. 36. Komatsu Y, Orita H, Sakurada M, Maekawa H, Hoppo T, Sato K. Intraoperative blood transfusion contributes to decreased long-term survival of patients with esophageal cancer. World J Surg. 2012;36(4):84450. 37. Ng T, Ryder BA, Chern H, Sellke FW, Machan JT, Harrington DT, et al. Leukocyte-depleted blood transfusion is associated with decreased survival in resected early-stage lung cancer. J Thorac Cardiovasc Surg. 2012;143(4):815-9, http://dx.doi.org/10.1016/j.jtcvs.2011.12.031. 38. Rzyman W, Dziadziuszko R, Skokowski J, Wilimski R, Raiter A, Szymanowska A, et al. The influence of blood transfusion on survival in operated non-small cell lung cancer patients. J Thorac Cardiovasc Surg. 2003;126(3):755-60, http://dx.doi.org/10.1016/S0022-5223(03)002 17-4. 39. Hayden SJ, Albert TJ, Watkins TR, Swenson ER. Anemia in Critical Illness: Insights into Etiology, Consequences and Management. Am J Respir Crit Care Med. 2012;185(10):1049-57, http://dx.doi.org/10. 1164/rccm.201110-1915CI. 40. Brunkhorst FM, Engel C, Bloos F, Meier-Hellmann A, Ragaller M, Weiler N, et al. Intensive insulin therapy and pentastarch resuscitation in severe sepsis. N Engl J Med. 2008;358(2):125-39. 41. Dubniks M, Persson J, Grande PO. Plasma volume expansion of 5% albumin, 4% gelatin, 6% HES 130/0.4, and normal saline under increased microvascular permeability in the rat. Intensive Care Med. 2007;33(2):293-9, http://dx.doi.org/10.1007/s00134-006-0454-5. 42. Persson J, Grande PO. Plasma volume expansion and transcapillary fluid exchange in skeletal muscle of albumin, dextran, gelatin, hydroxyethyl starch, and saline after trauma in the cat. Crit Care Med. 2006;34(9):245662, http://dx.doi.org/10.1097/01.CCM.0000233876.87978.AB. 43. Doherty M, Buggy DJ. Intraoperative fluids: how much is too much? Br J Anaesth. 2012;109(1):69-79.

Corrected total volume (CTV) analysis: Our propensity score analysis using CTV instead of infused crystalloid volume resulted in 97 patients in the No-HES group and 162 patients in the HES group. The major difference between this analysis and the previous analysis was the use of the corrected total volume (CTV) as a variable instead of the volume of infused crystalloid. We sought to minimize the role of hemodilution as a trigger to transfusion; i.e., the propensity-matched patients in this analysis would have received the same amount of plasma expansion. Because the expansion effects of colloids are different from crystalloids, we created a variable that would account for the corrected amount of fluid expansion received (CTV). We defined the CTV in patients in the No-HES group as equivalent to the crystalloid volume infused multiplied by 0.3 (1). The CTV in the HES group was defined as the sum of the crystalloid volume multiplied by 0.3 plus the volume of HES multiplied by 1.4 (CTV = [crystalloid volume 6 0.3] + [1.4 6 colloid volume]). The use of the 1.4 ratio aimed at accounting for the theoretical greater expansion effects of the colloids (2,3). This alternative propensity analysis included 41 patients in the No-HES group and 118 patients in the HES group (Additional Table 1). There was no difference in the need for red blood cell transfusion between the groups when this analysis was performed (Additional Table 2). The international normalized ration (INR) was higher at ICU admission in the HES group, but the other coagulation variables were similar (Additional Table 3). Study results of standard analysis: The second approach was a standard multivariate logistic regression. The stepwise backward method was used to determine the factors associated with red blood cell transfusion in the perioperative time. The initial model consisted of all of the independent variables that had a p value of less than 0.25 in the bivariate analysis associated with red cell blood transfusion or between the HES and non-HES groups in the 894 patients (the Hosmer-Lemeshow logistic regression). The variables were removed one at a time if they did not contribute to the model assessed according to a likelihood ratio test (p , 0.050). The continuous variables were checked for the assumption of linearity in the logit. Single colinearity was evaluated with Pearson’s correlation between the independent variables, and multi-colinearity was evaluated with the variance inflation factor. The odds-ratios and

& APPENDIX Results of propensity score using corrected total volume and the results of standard multivariate analysis Impact of intraoperative HES 6% 130/0.4 on the need for blood transfusion after major oncologic surgery: A propensity-matched analysis Additional Table 1 - CTV propensity score analysis.

Age, years Male, n (%) SAPS 3 BMI, kg/m2 Metastatic disease, n (%) Any chronic comorbidity, n (%) Total operative time, hours CTV, L Site of surgery Abdominal Head and neck Central nervous system Thoracic Soft tissue Other

No-HES (n = 41)

HES (n = 118)

p-value

61¡14 18 (44) 49¡19 27¡4 13 (32) 33 (81) 5.0 [3.8-6] 1.4 [1.1-1.8]

57¡17 66 (56) 47¡13 26¡5 39 (33) 91 (77) 6.0 [4.0-7.0] 1.9 [1.3-3.2]

0.19 0.18 0.52 0.22 0.87 0.65 0.10 0.51 0.69

26 (63) 3 (7) 4 (10) 6 (15) 2 (5) 0

82 (70) 13 (11) 10 (9) 9 (8) 3 (3) 1 (1)

Legend: BMI = body mass index; HES = hydroxyethyl starch; SAPS 3 = simplified acute physiology score 3; CTV = corrected total volume.

507


HES in oncologic surgery Zampieri FG et al.

CLINICS 2013;68(4):501-509

Additional Table 2 - Main study outcomes of the CTV propensity analysis. No-HES (n = 41)

HES (n = 118)

p-value

10 (24) 4 (10) 0 0

32 (27) 1 (1) 0 2 (2)

0.73 0.016 .0.99

0 0 0 0

5 (4) 0 1 (1) 3 (2)

0.33 .0.99 0.55

0 0 0 0

1 (1) 0 0 0

.0.99 -

10 (24) 10 (24)

35 (30) 36 (31)

0.52 0.46

Intraoperative period Patients that received red blood cells, (%) Patients that received fresh frozen plasma, (%) Patients that received platelets, (%) Patients that received cryoprecipitate, (%) 24 h postoperative period Patients that received red blood cells, (%) Patients that received fresh frozen plasma, (%) Patients that received platelets, (%) Patients that received cryoprecipitate, (%) 24-48 h postoperative period Patients that received red blood cells, (%) Patients that received fresh frozen plasma, (%) Patients that received platelets, (%) Patients that received cryoprecipitate, (%) Combined intraoperative and postoperative periods Patients that received red blood cells in the intraoperative and first 24 hours, (%) Patients that received red blood cells in the intraoperative and first 48 hours, (%) HES = hydroxyethyl starch.

also more frequent in the HES patients in the first 24 hours after the procedure. A multivariate analysis was performed to evaluate the risk factors for red blood cell transfusion from the intraoperative period up to 48 hours after the procedure (Additional Table 5). The factors associated with the red blood cell transfusions included age, metastatic disease, volume of crystalloid used, total operative time and use of any dose of HES. These factors may only highlight that patients that received blood transfusion were subject to more aggressive and/or technically difficult surgeries. Head and neck and thoracic surgery were protectors against transfusion. The ICU length of stay was higher in the HES group (Additional Table 6).

corresponding 95% confidence intervals for each variable were computed. The discriminative ability of the model to predict the outcome of patients was assessed by the area under the receiver operating characteristic (AUC) curve. The calibration ability for the model was evaluated with Hosmer-Lemeshow goodness-of-fit statistics. The major outcomes regarding the need for blood transfusion on crude analysis are displayed in Additional Table 4. The major difference between propensity-matched versus standard analysis was that before matching, the need for blood products other than red blood cell packs was more common in the HES patients. The HES patients in the unmatched analysis received fresh frozen plasma during surgery more frequently than the No-HES patients. The need for cryoprecipitate was

Additional Table 3 - Secondary objectives of the CTV propensity analysis.

ICU mortality and LOS ICU mortality, n (%) ICU LOS, days [IQ] Clotting profile Platelet count at ICU admission Platelet count at the 24-hour postoperative period Platelet count during the 24- to 48-hour postoperative period PT (INR) at ICU admission PT (INR) at the 24-hour postoperative period PT (INR) during the 24- to 48-hour postoperative period

No-HES n = 41

HES n = 118

p-value

0 2 (1-3)

2 (2) 1 (1-2)

.0.99 0.89

207 [154-285] 6 103 202 [156–256] 6 103 163 [141–233] 6 103 1.16 [1.10-1.24] 1.15 [1.11-1.23] 1.30 [1.24-1.38]

203 [141-2253] 6 103 212 [156–266] 6 103 192 [136–242] 6 103 1.17 [1.09-1.31] 1.22 [1.13-1.31] 1.32 [1.19-1.46]

0.22 0.85 0.76 0.36 0.04 0.97

PT = prothrombin time; INR = international normalized ratio; ICU = intensive care unit; LOS = length of stay.

508


CLINICS 2013;68(4):501-509

HES in oncologic surgery Zampieri FG et al.

Additional Table 4 - Transfusion outcomes according to standard univariate analysis. Transfusion outcomes

No-HES (n = 280) HES (n = 614)

Intraoperative period, patients that received blood fraction, n (%) Red blood cells 24 (9) Fresh frozen plasma 7 (3) Platelets 0 Cryoprecipitate 0 24-hour postoperative period, patients that received blood fraction, n (%) Red blood cells 7 (3) Fresh frozen plasma 6 (2) Platelets 2 (1) Cryoprecipitate 0 24- to 48-hour postoperative period, patients that received blood fraction, n (%) Red blood cells 4 (1) Fresh frozen plasma 2 (1) Platelets 0 Cryoprecipitate 0 Combined intraoperative and postoperative periods Intraoperative period and up to 24 hours after the procedure, patients that received blood fraction, n (%) Red blood cells 28 (10) Fresh frozen plasma 11 (4) Platelets 2 (1) Cryoprecipitate Intraoperative period and up to 48 hours after the procedure, patients that received blood fraction, n (%) Red blood cells 31 (11) Fresh frozen plasma 12 (4) Platelets 2 (1) Cryoprecipitate -

Additional Table 5 - Multivariate model to predict red blood cell package transfusion on intraoperative and perioperative times (up to 48 hours). Betta Agea Metastatic cancer Thoracic surgery Head and neck surgery Total operative timec, hours Crystalloid volume receivedc, l Colloid

0.012 0.633 -1.296 -0.627 0.811 0.652 0.857

OR (95% CI) 1.129 1.883 0.274 0.534 2.250 1.919 2.355

216 (35) 38 (6) 0 0

p-value

,0.001 0.019 1 1

46 24 7 16

(8) (4) (1) (3)

0.003 0.174 0.73 0.004

24 2 2 1

(4) (1) (1) (1)

0.061 0.59 1.00 1.00

231 53 7 16

(38) (9) (1) (3)

,0.001 0.011 0.73 0.004

239 53 9 17

(39) (9) (2) (3)

,0.001 0.020 0.52 0.002

Additional Table 6 - Outcomes in the standard univariate analysis. Outcome

p-value

ICU mortality, n(%) ICU LOS, days [IQ]

(1.018-1.252) 0.021 (1.350-2.625) ,0.001 (0.118-0.637) 0.003 (0.319-0.895) 0.017 (1.459-3.470) ,0.001 (1.079-3.413) 0.026 (1.471-3.772) ,0.001

a

per 10 units increase; compared with other sites of surgery; c per 01 log increase. Model performance: Hosmer-Lemeshow goodness of fitness test: Chi-square 11.664; p = 0.167. AUC: 0.752 (95% CI: 0.717-0.786); p,0.001. b

509

Non-HES (n = 280)

HES (n = 614)

p-value

4 (1) 1 (1-2)

13 (2) 2 (1-3)

0.60 ,0.001


CLINICAL SCIENCE

Cortical activity in tinnitus patients and its modification by phonostimulation Katarzyna Pawlak-Osin´ska,I Wojciech Kaz´mierczak,I Henryk Kaz´mierczak,II Małgorzata Wierzchowska,II Izabela MatuszewskaIII I Balance System Collegium Medicum Nicolaus Copernicus University, Department of Pathophysiology of Hearing, Bydgoszcz/Poland. II Collegium Medicum Nicolaus Copernicus University, Department of Otolaryngology and Laryngological Oncology, Bydgoszcz/Poland. III Jurasz University Hospital in Bydgoszcz, Poland.

OBJECTIVE: The goal of this study was to observe spontaneous cortical activity and cortical activity modulated by tinnitus-matched sound in tinnitus patients and healthy subjects with no otoneurologic symptoms. METHOD: Data were prospectively collected from 50 tinnitus patients and 25 healthy subjects. Cortical activity was recorded in all subjects with eyes closed and open and during photostimulation, hyperventilation and acoustic stimulation using 19-channel quantitative electroencephalography. The sound applied in the tinnitus patients was individually matched with the ability to mask or equal the tinnitus. The maximal and mean amplitude of the delta, theta, alpha and beta waves and the type and amount of the pathologic EEG patterns were noted during each recording. Differences in cortical localization and the influence of sound stimuli on spontaneous cortical activity were evaluated between the groups. RESULTS: The tinnitus group exhibited decreased delta activity and increased alpha and beta activity. Hyperventilation increased the intensity of the differences. The tinnitus patients had more sharp-slow waves and increased slow wave amplitude. Sound stimuli modified the EEG recordings; the delta and beta wave amplitudes were increased, whereas the alpha-1 wave amplitude was decreased. Acoustic stimulation only slightly affected the temporal region. CONCLUSION: Cortical activity in the tinnitus patients clearly differed from that in healthy subjects, i.e., tinnitus is not a ‘‘phantom’’ sign. The changes in cortical activity included decreased delta wave amplitudes, increased alpha-1, beta-1 and beta-h wave amplitudes and pathologic patterns. Cortical activity modifications occurred predominantly in the temporal region. Acoustic stimulation affected spontaneous cortical activity only in tinnitus patients, and although the applied sound was individually matched, the pathologic changes were only slightly improved. KEYWORDS: Tinnitus; Cortical Activity; Neurotology. Pawlak-Osin´ska K, Kaz´mierczak W, Kaz´mierczak H, Wierzchowska M, Matuszewska I. Cortical activity in tinnitus patients and its modification by phonostimulation. Clinics. 2013;68(4):511-515. Received for publication on September 19, 2012; First review completed on October 20, 2012; Accepted for publication on December 23, 2012 E-mail: osinskak1@wp.pl Tel.: +48 501 022 043

to increased theta and gamma activity could be responsible for tinnitus (3). When coexisting with hearing loss, tinnitus might be the result of neuronal hyperactivity provoked by reduced peripheral input (4). This hyperexcitability is suspected to be located in parts of the auditory cortex that represent intact hearing frequencies (5). The left temporal gyrus is overactivated, independent of tinnitus laterality (6). Suppression of tinnitus was positively correlated with activation of the left and right temporal gyrus and the parahippocampal-hippocampal interface (6). In addition, increased spontaneous alpha power in the auditory cortex occurred in suppressed states. (7). Sound stimuli are believed to modulate the centrally generated sensations that result in tinnitus inhibition (2). Where tinnitus and sound interact, however, is not known. The effects of sound might be psychogenic, and long-term sound application could be harmful.

& INTRODUCTION Tinnitus can originate anywhere along the audiologic pathway. In some cases, the source has remained unknown, which has led to the hypothesis that tinnitus is a phantom perception that is analogous to phantom pain (1,2). The role of cortical control is interesting from both scientific and therapeutic points of view. Changes in cortical activity can both elicit and suppress tinnitus. Thalamocortical dysrhythmia due

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)12

511


Cortical Activity in Tinnitus Pawlak-Osin´ska K et al.

CLINICS 2013;68(4):511-515

b) nuisance (minimal = 1, serious daily trouble = 10): 1-4 = 11 cases; 5-8 = 24 cases; 9-10 = 15 cases; c) effect of masking: present = 6 cases; lacking = 44 cases; d) time result: permanent tinnitus = 35 cases; interrupted tinnitus = 15 cases; and e) psychological effect: disturbed concentration = 32 cases; disturbed sleeping = 7 cases; nervousness = 11 cases.

Table 1 - Global differences in EEGs between the healthy subjects and tinnitus patients. Condition

Number of tests Number of performed significant tests

Basic recording Eyes open Acoustic stimulation Photostimulation Hyperventilation Pathologic patterns

228 228 228 228 228 152

6 3 10 7 34 26

Significance 0.9734 0.9969 0.5910 0.8870 0.0000 0.0000

The tonal audiometry results from tinnitus patients revealed the mean hearing losses as follows (with standard deviation (SD) in dB): 500 Hz = 33 (18.1) right ear, 30 (16.8) left ear; 1000 Hz = 28 (21.6) right ear, 25 (22.1) left ear; 2000 Hz = 30 (23.9) right ear, 20 (24.6) left ear; and 4000 Hz = 38 (25.3) right ear, 25 (27.3) left ear. None of the patients had received previous therapy for tinnitus. In every patient, monopolar 19-channel EEG recordings (Neuron-Spectrum 4/P, Neurosoft Company) were obtained under the following conditions: with eyes closed and open and with hyperventilation, photostimulation and acoustic stimulation. The EEGs were recorded and digitized with sampling at 500 Hz, with a high-pass filter of 0.50 Hz and low-pass filter of 35.0 Hz. In every patient, tinnitus was measured before EEG was obtained to estimate the pitch and intensity. In the entire group, the tinnitus intensity and pitch ranged from 10 to 85 dB (mean 43.8 dB, SD 19.91) and from 125 to 8000 Hz (mean 2052.5 Hz, SD 1697.1), respectively. A sound that matched the frequency and intensity of the tinnitus and that varied for each individual patient was presented through air conduction, with earphones applied to the ear that experienced the tinnitus or binaurally when the tinnitus was located in the head. Acoustic stimulation was performed in a silent room for 2 minutes. Hyperventilation was induced by taking 40 deep breaths per minute for 3 minutes. Photostimulation was applied using stroboscopic flashes lasting 7 seconds, with a 5-second pause, at frequencies in the following sequence: 1, 3, 7, 10, 15, 20, 25, 30 and 50 Hz. The control group consisted of 25 healthy subjects (12 women, 13 men) aged 18-61 (mean: 40.4) years old with no otoneurologic symptoms. Hearing based on tonal audiometry was normal (not more than a 15-dB loss) in both ears. EEG recordings were obtained in the same manner as in the tinnitus group; acoustic stimulation was the same in every case, and a 1000-Hz, 40-dB stimulus was presented.

Number of tests performed: measurements of mean and maximal amplitudes of cortical activity gathered from each EEG electrode (together = 228 results to compare); number of significant tests: number of tests showing a significant difference (p,0.05) between the healthy and tinnitus groups based on Student’s t-test; significance: results of Student’s t-test for the whole analyzed condition. Significant differences between groups with regard to hyperventilation are explained in the Discussion (line 11).

In the present study, we compared spontaneous and sound-modulated electroencephalography (EEG) recordings between tinnitus patients and healthy controls.

& MATERIALS AND METHODS The tinnitus patient group consisted of 50 individuals (24 women and 26 men) aged 20 to 63 (mean: 42.5) years with tinnitus who were not selected according to any tinnitus factors. The subjects’ tinnitus was subjective, located in the outside ear and the VIII-th nerve, according to the exclusion criteria. The exclusion criteria included suffer from external, middle or internal ear diseases or malfunction of the VIII-th cranial nerve; additionally, subjects with focal signs of central nervous system disturbances, head and neck injuries and epilepsy were excluded. Additional diagnoses accompanying tinnitus were as follows: cervical spondylosis (35 patients), hyperlipidemia (21 patients), arterial hypertension (16 patients), atheromatosis (11 patients), hormonal disturbances (thyroid = 9 patients; sexual = 9 patients), hyperglycemia (7 patients), arrhythmia (5 patients), allergy (4 patients), depression (3 patients), occupational exposure to noise (2 patients), nicotinism and coronary disease (1 patient each). The features and outcomes of tinnitus were as follows:

Ethics

a) localization: right ear = 11 cases; left ear = 15 cases; bilateral = 24 cases;

The procedures were conducted in accordance with the ethical standards of the responsible committee on human

Table 2 - Basic recording with eyes closed: differences in cortical activity between the healthy subjects and tinnitus patients. Tinnitus group Control Group Variable

Mean

SD

Mean

SD

Aav (D) for F3Fpz Aav (Bl) for F4Fpz Aav (D) for T3Fpz Aav (Bl) for T4Fpz Amax (Bh) for T4Fpz Aav (Al) for T6Fpz

13.8 4.16 15.74 6.44 23.3 18.2

5.7 1.30 6.07 2.37 11.5 8.4

17.8 3.56 18.80 5.20 19.3 13.7

11.8 1.04 5.54 1.55 5.1 9.0

Significance of a Levene’s test

Variance in 2 groups

0.051 0.192 0.986 0.028 0.009 0.815

Equal Equal Equal Different Different Equal

statistics t

-2.00 2.01 -2.12 2.71 2.08 2.16

Df

73 73 73 67.46 72.41 73

Significance of t test (2-tail)

0.050 0.049 0.038 0.008 0.041 0.034

95%

CI

min

max

-8.0 0.00 -5.94 0.33 0.2 0.3

0.0 1.20 -0.18 2.15 7.8 8.7

Abbreviations: Aav: average amplitude; Amax: maximal amplitude; 95% CI: 95% confidence interval; SD: standard deviation. Rhythms: A = alpha, B = beta, D = delta. Cortical regions: T = temporal, P = parietal, F = frontal, O = occipital, C = central.

512


CLINICS 2013;68(4):511-515

Cortical Activity in Tinnitus Pawlak-Osin´ska K et al.

Table 3 - Differences in cortical activity during acoustic stimulation between the healthy subjects and tinnitus patients. Tinnitus Group

Control Group

Variable

Mean

SD

Mean

SD

Amax for O1Fpz Am (Al) for O1Fpz Aav (Al) for O1Fpz Am (Al) for F8Fpz Aav (Bl) for F8Fpz Amax for T6Fpz Average for T6Fpz Am (Al) for T6Fpz Aav (Al) for T6Fpz Am (Bl) for T6Fpz

115.9 74.7 24.7 26.7 4.54 103.8 22.0 57.9 18.6 25.8

44.0 33.8 13.0 12.2 1.64 44.7 8.2 24.1 8.9 9.8

93.7 56.3 18.4 18.8 3.76 79.7 17.6 41.1 13.6 20.9

34.1 32.5 12.0 12.7 0.97 39.8 9.1 27.4 9.7 9.7

Significance of Levene’s test

0.158 0.624 0.365 0.529 0.053 0.421 0.806 0.813 0.909 0.981

Variance in 2 groups statistics t

Equal Equal Equal Equal Equal Equal Equal Equal Equal Equal

2.21 2.26 2.00 2.59 2.19 2.28 2.12 2.72 2.24 2.04

df

73 73 73 73 73 73 73 73 73 73

Significance of t test (2-tail)

0.030 0.027 0.049 0.011 0.032 0.026 0.037 0.008 0.028 0.045

95%

CI

min

max

2.2 2.2 0.0 1.8 0.07 3.0 0.3 4.5 0.6 0.1

42.2 34.8 12.4 13.9 1.49 45.1 8.6 29.1 9.5 9.6

Abbreviations: Aav: average amplitude; Amax: maximal amplitude; 95% CI: 95% confidence interval; SD: standard deviation. Rhythms: A = alpha, B = beta, D = delta. Cortical regions: T = temporal, P = parietal, F = frontal, O = occipital, C = central.

When acoustic stimulation matched the pitch and intensity of the tinnitus in tinnitus patients, the total maximal power of the cortical activity increased in the frontal, central, parietal and temporal regions but only bilaterally in the central cortex (Table 6). Changes were detected in the mean amplitude of beta-1, beta-h, alpha-1 and delta waves and in the maximal amplitude of delta waves (Table 6).

experimentation (institutional or regional) and with the Helsinki Declaration of 1975, which was revised in 1983.

& RESULTS Global differences were observed in the EEG recordings between the healthy subjects and tinnitus patients (Table 1). The responses to hyperventilation were significantly different. Therefore, we analyzed the type and localization of the significant changes. Spontaneous cortical activity with eyes closed revealed differences predominantly in the mean amplitude of the beta and delta waves between the groups. In the tinnitus patients, the power of the delta activity was decreased, whereas the power of the beta activity was increased (Table 2). Changes in the cortical activity under both the eyes-open and eyes-closed conditions were located strictly in the temporal regions. Tinnitus patients under acoustic stimulation showed amplitude changes in both the alpha and beta waves in the right temporal and frontal regions and the left occipital cortex (Table 3). Acoustic stimulation was followed by a decline in the beta power in the parietal region and an increase in the alpha power in the occipital and temporal regions. The mean and maximal amplitudes of the beta and alpha waves changed, and there were no regions in which the cortical activity remained the same (Table 4). Pathologic patterns were observed in the EEG recordings from tinnitus patients. Both the number and amplitude of the patterns described above were greater in the tinnitus patients than the healthy subjects (Tables 1 and 5).

& DISCUSSION EEG activity differed significantly between the healthy subjects and tinnitus patients. Changes in cortical activity were most frequently observed in the bilateral temporal lobes. Because these areas are involved in normal hearing, the pathology in tinnitus cases was suspected to be localized only in this region. This finding supports the hypothesis that tinnitus is not a ‘‘phantom’’ phenomenon but rather results from inappropriate cortical auditory perception, usually hyperactivity or activity, without any auditory input (8,9). The migration of tinnitus cortical generators over time is possibly represented by changes in activity in the auditory cortex, motor area, insula and prefrontal lobes (10). The changes in cortical activity in the tinnitus patients included decreased delta wave amplitudes and increased beta-1, beta-h, and alpha-1 wave amplitudes. According to Vanneste (10), high-frequency waves are associated with Table 5 - Significant differences in pathological EEG patterns and their localization in the tinnitus patients compared with the healthy subjects.

Table 4 - Type and localization of significant differences during acoustic stimulation between the healthy subjects and tinnitus patients. Variable

Regions

Aav Bh Amax Bh AavB1 AmaxB1 AavA1

Fp2Fpz, F4Fpz, F7Fpz, T6Fpz T6Fpz Fp2Fpz, F4Fpz, C4Fpz, F7Fpz, T6Fpz, F8Fpz, T6Fpz F4Fpz, P3Fpz, O1Fpz, O2Fpz, F7Fpz, F8Fpz, T3Fpz, F4Fpz, T5Fpz, T6Fpz P3Fpz, O1Fpz, O2Fpz, F8Fpz, T5Fpz, T6Fpz

AmaxA1

Variable A peak Amount sharp w-slow w A slow wave A sharp w-slow w Amount peak-slow w Amount slow w A peak-slow w Legend: A: amplitude; w: wave (s)

Abbreviations: Aav: average amplitude; Amax: maximal amplitude; 95% CI: 95% confidence interval; SD: standard deviation. Rhythms: A = alpha, B = beta, D = delta. Cortical regions: T = temporal, P = parietal, F = frontal, O = occipital, C = central.

Regions Fp1Fpz, P4Fpz, T4Fpz, T5Fpz, Fp2Fpz, CzFpz, P3Fpz, P4Fpz, O1Fpz, T6Fpz C3Fpz, CzFpz, P3Fpz, O1Fpz, F8Fpz, T3Fpz, T4Tpz, T5Fpz C3Fpz, C4Fpz, P3Fpz, T6Fpz T3Fpz, T6Fpz T6Fpz T6Fpz

Abbreviations: Aav: average amplitude; Amax: maximal amplitude; 95% CI: 95% confidence interval; SD: standard deviation. Rhythms: A = alpha, B = beta, D = delta. Cortical regions: T = temporal, P = parietal, F = frontal, O = occipital, C = central. W = wave.

513


Cortical Activity in Tinnitus Pawlak-Osin´ska K et al.

CLINICS 2013;68(4):511-515

Table 6 - Significant differences between EEG recordings with eyes closed and EEG recordings during phonostimulation in the tinnitus patients.

Group Tinnitus group

Significance of Levene’s test

Variance in 2 groups

Significance of t test (2 tail)

Eyes closed

Phonostimul.

Variable

Mean

SD

Mean

SD

Amax for Fp1Fpz

47.6

20.7

68.0

57.5

0.002

Different

-2.37

61.51

0.021

-37.7

-3.2

Amax for FzFpz Amax for C3Fpz Amax for C4Fpz Amax for CzFpz Amax for PzFpz Amax for T6Fpz Average for Fp2Fpz Amax (D) for P3Fpz Amax (D) for T6Fpz Aav (D) for Fp2Fpz Aav (Al) for F3Fpz Aav (Bl) for F4Fpz Aav (Bh) for C3Fpz Aav (Bh) for O1Fpz

5.1 1.54 6.0 2.24 15.1 7.5 11.26 16.9 11.38 12.94 18.12 21.9 21.7 30.6

12.3 3.74 9.6 3.48 7.4 10.1 4.12 7.5 4.25 5.31 6.22 10.4 6.4 18.8

17.3 3.42 15.1 4.16 21.5 13.3 13.86 21.0 13.52 15.84 15.96 26.7 25.3 39.7

27.2 4.36 19.8 3.87 15.6 14.2 6.99 11.8 6.26 8.19 3.65 12.2 9.2 19.2

0.000 0.001 0.026 0.047 0.004 0.053 0.063 0.156 0.024 0.039 0.009 0.648 0.245 0.737

Different Different Different Different Different Equal Equal Equal Different Different Different Equal Equal Equal

-2.89 -2.31 -2.92 -2.61 -2.63 -2.36 -2.27 -2.08 -2.00 -2.10 2.12 -2.12 -2.24 -2.38

68.33 95.82 70.93 96.90 69.98 98 98 98 86.22 84.02 79.17 98 98 98

0.005 0.023 0.005 0.011 0.010 0.020 0.026 0.040 0.049 0,039 0.037 0.036 0.027 0.019

-20.6 -3.49 -15.3 -3.38 -11.3 -10.7 -4.88 -8.0 -4.27 -5.64 0.13 -9.3 -6.7 -16.6

-3.8 -0.27 -2.9 -0.46 -1.6 -0.9 -0.32 -0.2 -0.01 -0.16 4.19 -0.3 -0.4 -1.5

Statistics t

Df

95%

CI

min

max

Abbreviations: Aav: average amplitude; Amax: maximal amplitude; 95% CI: 95% confidence interval; SD: standard deviation. Rhythms: A = alpha, B = beta, D = delta. Cortical regions: T = temporal, P = parietal, F = frontal, O = occipital, C = central.

tinnitus volume. Cortical changes were noted predominantly during hyperventilation, suggesting that physical activity with increased breathing could intensify tinnitus. The altered cortical activity during hyperventilation spread to other brain lobes, including the bilateral frontal and occipital, right prefrontal and central and left parietal regions. The ‘‘epileptic theory’’ of tinnitus was supported by the pathologic EEG patterns. These abnormal patterns were present in the tinnitus patients significantly more frequently than in the healthy subjects. First, these patterns were located in the temporal lobe at point T6 on the 10 to 20 EEG montage system. From this site, they spread to the central and parietal regions bilaterally. The number of ‘‘sharp wave-slow wave’’ patterns and the amplitudes of the slow waves, peaks and ‘‘sharp wave-slow wave’’ increased. An important finding of the present study was the influence of sound on cortical activity. The masking of tinnitus is a popular treatment method. Therefore, during audiometry, a sound that matched and therefore masked an individual’s tinnitus was used as the acoustic stimulation for EEG. In the tinnitus patients, sound application changed spontaneous activity in the prefrontal, frontal, parietal, temporal, central and occipital cortices on the left or right, depending on the region. The amplitude of the beta-1, betah and delta waves was increased, and the amplitude of the alpha-1 wave was decreased; sound stimulation emphasized this pathology in the tinnitus patients. Two other observations regarding the alpha-1 and delta waves indicated a tendency to return to normal after acoustic stimulation. Sound stimulation, however, inconsistently affected cortical activity; it did not appear to modify the same waves that were observed to be abnormal in a particular lobe. Moreover, the temporal region, which is considered a potential origin of tinnitus, was modified only very slightly. Zeng (7) observed the intensification of alpha power, followed by tinnitus suppression, when external stimulation was applied via a cochlear implant to the apical part of the

cochlea. The sound delivered was specific, i.e., a low rate less than 100 Hz and softer than the tinnitus, unlike in the present study, in which the acoustic stimulation was individually selected according to the subject’s tinnitus. Weisz (11) reported desynchronization of the rhythm between 6 and 12 Hz (theta, alpha) after sound stimulation and discussed the inhibitory effect of alpha activity on tinnitus sensation. Thus, the usefulness of sound therapy for tinnitus patients is not clear. Additionally, the healthy subjects, in contrast with the tinnitus patients, did not demonstrate any changes in spontaneous cortical activity during acoustic stimulation. Thus, while the dyssynchrony-synchrony theory of tinnitus is supported by cortical activity, concomitant sensory, biophysiologic, metabolic-electrophysiologic and neurochemical aspects are also involved (12). EEG is an effective method for evaluating cortical modification after sound stimulation, but there are some limitations to this method. Changes in the power of cortical rhythms can be influenced by the psychologic state, e.g., meditation can enhance the process of habituation to background stimuli (also acoustic, with no task imposed), and depression can reduce perception accuracy (13,14). Furthermore, we do not know what happens to cortical activity after the cessation of acoustic stimulation, e.g., EEG changes after conventional laser stimulation last for 15 minutes (15). To further investigate the usefulness of sound therapy for tinnitus, studies should be undertaken to observe neural activity on EEG and positron emission tomography simultaneously. In summary, the present study demonstrated the following findings: 1. Cortical activity in tinnitus patients is different from that in healthy subjects, and it is not a ‘‘phantom’’ sign; 2. The alterations in cortical activity in the patients with tinnitus, which were observed predominantly in the temporal regions, include decreased delta wave amplitudes

514


CLINICS 2013;68(4):511-515

Cortical Activity in Tinnitus Pawlak-Osin´ska K et al.

and increased alpha-1, beta-1 and beta-h wave amplitudes demonstrate a pathologic pattern; 3. Significant alterations in spontaneous cortical activity induced by acoustic stimulation were only observed in the tinnitus patients, and despite individual matching of the applied sound, the pathologic changes only slightly improved; 4. The usefulness of sound therapy for tinnitus should be considered together with the results of other objective studies, e.g., positron emission tomography; and 5. EEG is an effective method for evaluating cortical modification after sound stimulation, but some psychological limitations to this method should be taken into consideration.

4. 5. 6. 7.

8.

9.

& AUTHOR CONTRIBUTIONS Pawlak-Osin´ska K conceived the idea and wrote the manuscript. Kaz´mierczak W prepared the manuscript for publication. Kaz´mierczak H conducted the literature review. Wierzchowska M collected and prepared the data. Matuszewska I obtained the EEG recordings.

10.

& REFERENCES

12.

11.

1. De Ridder D, Elgoyhen A, Romo R, Langguth B. Phantom percepts: tinnitus and pain as persisting aversive memory networks. Proc Natl Acad Sci USA. 2011;(20);108:8075-80, http://dx.doi.org/10.1073/pnas. 1018466108. 2. Walton KD, Llinas RR. Central pain as thalamocortical dysrhythmia: a thalamic efference disconnection? In: Kruger L, Light AR, editors. Translational pain research. From mouse to man. Boca Raton, FL: CRC Press; 2010. Chapter 13. 3. Vanneste S, Heyning PV, De Ridder DD. Contralateral parahippocampal gamma-band activity determines noise-like tinnitus laterality: a region of

13. 14. 15.

515

interest analysis. Neuroscience. 2011;199:481-90, http://dx.doi.org/10. 1016/j.neuroscience.2011.07.067. Zhou X, Henin S, Long GR, Parra LC. Impaired cochlear function correlates with the presence of tinnitus and its estimated spectral profile. Hear Res. 2011;277(1-2):107-16, http://dx.doi.org/10.1016/j.heares.2011.02.006. Weisz N, Wienbruch C, Dohrmann K, Elbert T. Neuromagnetic indicators of auditory cortical reorganization of tinnitus. Brain. 2005;128(11):2722-31, http://dx.doi.org/10.1093/brain/awh588. Schecklmann M, Landgrebe M, Poeppl TB, Kreuzer P, Manner P, Marienhagen J et al. Neural correlates of tinnitus duration and distress: a positron emission tomography study. Hum Brain Mapp. 2011; forthcoming. Zeng FG, Tang Q, Dimitrijevic A, Starr A, Larky J, Blevins NH. Tinnitus suppression by low-rate electric stimulation and its electrophysiological mechanisms. Hear Res. 2011;277(1-2):61-6, http://dx.doi.org/10.1016/j. heares.2011.03.010. De Ridder D, van der Loo E, Vanneste S, Gaiss S, Plazier M, Kovacs S et al. Theta-gamma dysrhythmia and auditory phantom perception. J Neurosurg. 2011;114(4):912-21, http://dx.doi.org/10.3171/2010.11. JNS10335. Bartels H, Staal MJ, Albers FW. Tinnitus and neural plasticity of the brain. Otol Neurotol. 2007;28(2):178-84, http://dx.doi.org/10.1097/ MAO.0b013e31802b3248. Vanneste S, van de Heyning M, De Ridder D. The neural network of phantom sound changes over time: a comparison between recent-onset and chronic tinnitus patients. Eur J Neurosci. 2011;34(5):718-31. Weisz N, Hartmann T, Muller N, Lorenz J, Obleser J. Alpha rhythms in audition: cognitive and clinical perspectives. Front Psychol. 2011;2:73, http://dx.doi.org/10.3389/fpsyg.2011.00073. Shulman A, Goldstein B, Strashun AM. Final common pathway for tinnitus: theoretical and clinical implications of neuroanatomical substrates. Int Tinnitus J. 2009;15(1):5-50. Cahn BR, Delorme A, Polich J. Event-related delta, theta, alpha and gamma correlates to auditory oddball processing during Vipassana meditation. Soc Cogn Affect Neurosci. 2012;8(1):100-11. Terhaar J, Viola FC, Bar KJ, Debener S. Heartbeat evoked potentails mirror altered body perception in depressed patients. Clin Neurophysiol. 2012; 123(10):1950-7, http://dx.doi.org/10.1016/j.clinph.2012.02.086. Wu JH, Chang WD, Hsieh CW, Jiang JA, Fang W, Shan YC et al. Effect of law-level laser stimulation on EEG. Evid Based Complement Alternat Med. 2012;2012:951272.


CLINICAL SCIENCE

Static and dynamic postural control in low-vision and normal-vision adults Moˆnica S.V. Tomomitsu, Angelica Castilho Alonso, Eurica Morimoto, Tatiana G. Bobbio, Julia M.D. Greve Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Institute of Orthopedics and Traumatology, Movement Study Laboratory, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: This study aimed to evaluate the influence of reduced visual information on postural control by comparing low-vision and normal-vision adults in static and dynamic conditions. METHODS: Twenty-five low-vision subjects and twenty-five normal sighted adults were evaluated for static and dynamic balance using four protocols: 1) the Modified Clinical Test of Sensory Interaction on Balance on firm and foam surfaces with eyes opened and closed; 2) Unilateral Stance with eyes opened and closed; 3) Tandem Walk; and 4) Step Up/Over. RESULTS: The results showed that the low-vision group presented greater body sway compared with the normal vision during balance on a foam surface (p#0.001), the Unilateral Stance test for both limbs (p#0.001), and the Tandem Walk test. The low-vision group showed greater step width (p#0.001) and slower gait speed (p#0.004). In the Step Up/Over task, low-vision participants were more cautious in stepping up (right p#0.005 and left p#0.009) and in executing the movement (p#0.001). CONCLUSION: These findings suggest that visual feedback is crucial for determining balance, especially for dynamic tasks and on foam surfaces. Low-vision individuals had worse postural stability than normal-vision adults in terms of dynamic tests and balance on foam surfaces. KEYWORDS: Low Vision; Postural Balance; Motor Control. Tomomitsu MS, Alonso AC, Morimoto E, Bobbio TG, Greve JM. Static and dynamic postural control in low-vision and normal-vision adults. Clinics. 2013;68(4):517-521. Received for publication on October 7, 2012; First review completed on November 4, 2012; Accepted for publication on December 23, 2012 E-mail: angelicacastilho@msn.com Tel.: 55 11 2661-6041

somatosensory and vestibular information to maintain postural stability, establish and connect movement patterns and adjust to positions in space to compensate for lowfunctioning visual systems (10,12-14). Studies comparing blind and seeing individuals in static and dynamic balance tasks confirmed that approximately 80% of an individual’s sensory perception is gathered by the visual system (14), which processes and integrates other sensory inputs to select a balancing strategy (15). Currently, only a few studies have examined postural stability by comparing low-vision and normal-vision adults (3,15,16). It has been previously demonstrated that restricted vision could increase body sway and postural instability (16). Although balance appears to be affected in individuals with low vision, this relationship has not been fully explored in the literature, particularly regarding unstable surfaces, single-leg stances, dynamic tasks and tasks with eyes opened compared with eyes closed. We hypothesized that adults with sub-normal vision have an affected postural balance due to the decreased efficiency of the vision systems compared with individuals with normal vision. To further understand the balance of low-vision individuals and provide evidence for future interventions focused on reducing falls in this population, the objective of this

& INTRODUCTION The visual system plays a major role in postural control, and postural sway increases in the absence of vision (1-3). Visual impairment is associated with a reduction in postural control (4) and is an important factor in falls and related injuries (5-7). Low vision is considered a condition with an impairment of visual function, despite treatment and correction of ordinary refractive errors, and is defined as a visual acuity reduced to 20/60 visual fields or less than ten degrees from the fixation point. Patients with low vision use or have the ability to use vision for planning or executing tasks (8). The influence of the visual system on postural control (8) has been documented in several studies (9,10), especially its influence in individuals with low vision (10). Patients with visual dysfunction must place a greater demand on

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)13

517


Control postural low vision Tomomitsu MS et al.

CLINICS 2013;68(4):517-521

study was to test whether low-vision adults are able to maintain postural control and to compare these subjects with normal-vision adults during stable surface tasks and more challenging tasks. To this end, we compared the postural control of low-vision and normal-vision adults in static and dynamic conditions using posturography. Additionally, we investigated the influence of reduced visual information on the postural control systems in both groups.

Procedures Participants were required to complete a structured, selfadministered questionnaire written for this study concerning a history of falls, fractures, stumbling, dizziness and the perception of disequilibrium. The subjects were then tested using the NeuroCom Balance Master H force platform system (NeuroCom International, Inc., Clackamas, OR, USA). which includes a computer with a force plate that records data with the aid of piezoelectric crystal transducers. Force-plate data included the X (¡0.08 cm) and Y (¡0.25 cm) positions of the center of vertical force and total vertical force (¡0.1 N) at a sampling rate of 100 Hz. With this system, the transducers transmit pressure to the computer every 10 ms; then, the dynamic center of gravity of the subject is calculated, and the sway velocity during a certain period is obtained. Sway velocity (degrees/second) measures the angular change of the center of gravity per unit of time. The sway velocity is an appropriate dependent measure for determining postural stability (16). All tests were performed by the same evaluator and standardized in terms of positioning and testing. The NeuroCom Balance Master System has multiple testing protocols designed to examine balance. This study used the Modified Clinical Test of Sensory Interaction on Balance, Unilateral Stance, Tandem Walk and Step Up/ Over protocols. The equipment has been demonstrated to have good reliability and reproducibility (ICC 0.53 to 0.81) (17).

& METHODS This was a descriptive, cross-sectional, observational study conducted without intervention. Written consent was mandatory for study participation. The study was performed with approval granted by the Ethics Committee number 550/06.

Participants Twenty-five low-vision and twenty-five normal-vision individuals participated in the study. The low-vision group was composed of eleven males and fourteen females with a mean age of 28.6¡6 years (range 20-37 years), mean height of 164¡7 cm (range 151-179 cm), mean body mass of 65.5¡14.2 kg (range 48-104.2 kg) and mean body mass index (BMI) of 24.2¡4.4 (range 19.1-34.6). The participants were recruited from vision impairment centers. The etiology of low vision in the low-vision group was either congenital (twelve participants) or acquired (thirteen participants). The participants had a visual acuity of less than 6/18 but equal to or better than 3/60 or had a corresponding visual field loss of less than twenty degrees in the better eye with the best possible correction, in accordance with the International Statistical Classification of Diseases, Injuries and Causes of Death, 10th Revision (ICD10). The causes of visual impairment of the participants included optic nerve abnormalities, disorders of the retina, glaucoma, Stargardt’s disease, standard macular degeneration, retinitis pigmentosa and congenital toxoplasmosis. All participants underwent a low-vision screening test, which included a medical history, optimal visual acuity measurement and ophthalmoscopic ocular screening. The normal-vision group was a convenience sample selected from the community after an assessment using Snellen’s optometric scale. This group included seven males and eighteen females. The mean age was 26.1¡4 years (range 20-37 years). The mean height was 162¡9 cm (range 147-183 cm), and the mean body mass was 60.6¡11.3 kg (range 44.5-92.9 kg). The mean BMI was 22.7¡2.5 (range 17.3-27.7). No significant differences between the groups were found. The following criteria were used to select study participants: no current or past medical diagnosis of injury affecting balance within the last three years; no medications affecting the central nervous system or known to affect balance or coordination; no current symptoms of dizziness or light-headedness; no orthopedic or neurologic diagnoses or symptoms suggestive of vestibular or neurologic disorders; and no symptoms requiring the participant to be sedentary. Participants in the low-vision group were defined as independent if they were able to move by themselves within all environments.

Static balance protocol Modified Clinical Test of Sensory Interaction on Balance. This test quantifies sway velocity in degrees per

second ( ˚/s) with the subject standing in four test conditions: 1) a firm surface with the eyes open; 2) a firm surface with the eyes closed; 3) a foam surface with eyes open; and 4) a foam surface with eyes closed. Three tensecond trials were recorded for each of the test conditions, with a ten-second rest between each trial. The average sway velocity of the subject’s center of gravity was calculated for each trial and averaged for each test condition. Unilateral Stance. The Unilateral Stance test quantifies sway velocity in degrees per second ( ˚/s), with the subject standing on one leg in the following four conditions: 1) on the right leg with eyes open; 2) on the right leg with eyes closed; 3) on the left leg with eyes open; and 4) on the left leg with eyes closed. The subject was instructed to keep the non-test leg in a position of 0 ˚ of hip flexion and 90 ˚ of knee flexion. Three ten-second trials were recorded for each leg, with a ten-second rest between each trial. The trials were performed on a firm surface, and testing was terminated if the subject experienced a loss of balance. Mistrials were not scored. The center of gravity sway velocity was recorded for each leg.

Dynamic balance protocols Tandem Walk. This test quantifies characteristics of gait while the subject walks the length of a force platform in a heel-to-toe manner. The measured parameters include step width, speed and end sway velocity. Subjects were instructed to stand heel-to-toe steadily at the starting position, look straight ahead and tandem walk at the sound of ‘‘Go’’ along a 153 cm straight line on the force plates. Participants were told to walk as quickly as possible, stop at the end of the force plates and hold that position as

518


CLINICS 2013;68(4):517-521

Control postural low vision Tomomitsu MS et al.

steadily as possible until the command ‘‘Stop’’ was announced. The test consisted of three trials that each lasted ten seconds, with a ten-second rest between each trial. End sway velocity (degrees/second) was measured when the forward movement stopped. Step Up/Over. Three variables were analyzed in the Step Up/Over test: lift-up index, movement time and impact index. Each subject’s movement time was recorded in seconds from the initiation of the step up to contact of the first leg (the non-test leg) with the platform. The lift-up index was recorded by the percentage of body weight exerted to lift the leading leg to the wooden step. The impact index was expressed as the percentage of body weight used to step down onto the force plate. The Step Up/Over test was performed using a twenty-centimeter wooden step placed in the center of the platform. Subjects stood a comfortable distance behind the step, which was determined during a practice trial. The subjects were told to look straight ahead and at the sound of ‘‘Go’’, to step up with the test leg, swing the other leg up and over the step and then step down with the test leg. Participants were asked to hold that position as steadily as possible until they heard the command ‘‘Stop’’. Subjects held their positions for five seconds after the test leg descended to the step. The test consisted of three trials that each lasted ten seconds, with a ten-second rest between each trial.

Table 1 - Comparison between the low-vision and normal-vision groups through anamnesis. Variables Lifetime falls Balance difficulty Easily losing balance Recent falls Stumbling Dizziness Fractures Other injuries

Low-vision N (%) 23 9 8 2 9 0 2 3

(92) (36) (32) (8) (36) (0) (8%) (12%)

Normal-vision N (%) p-value 12 0 0 3 5 0 2 2

(48) (0) (0) (12) (20) (0) (8) (8)

0.006 0.002 0.009 0.63 0.20 1.00 1.00 0.63

Static balance Table 2 shows the mean values for the Modified Clinical Test of Sensory Interaction on Balance according to surface type and eye conditions and for the Unilateral Stance according to the test leg and eye condition across groups. Comparisons between groups showed significant differences regarding foam surface. For the Modified Clinical Test of Sensory Interaction on Balance on a firm surface, a significant effect of group (F(1.48) = 0.43, p,0.05, g2 = 0.13) but not eye condition (F(1.48) = 0.047, p.0.05, g2 = 0.001) was observed, but no significant interaction between eye condition and group (F(1.40) = 1.3, p.0.05, g2 = 0.027) was observed. On the foam surface, significant effects of eye condition (F(1.48) = 69.10, p,0.05, g2 = 0.59) and group (F(1.48) = 69.10, p,0.05, g2 = 0.59) were observed, as well as a significant interaction between eye condition and group (F (1.48) = 61.18, p,0.05, g2 = 0.56). The analysis revealed a difference between eye condition on the foam surface for the normal-vision group, as tasks were more difficult for these participants on the foam surface with eyes closed (M = 1.41, SD = 0.30) compared with tasks on the foam surface with eyes open (M = 0.62, SD = 0.12) (Table 2). For the Unilateral Stance on the left leg, a significant effect of the eye condition (F(1.48) = 39.26, p,0.05, g2 = 0.45) and a significant interaction between group and eye condition (F(1.48) = 20.29, p,0.05, g2 = 0.05) were observed, but no group effect (F(1.48) = 2.70, p.0.05, g2 = 0.05) was found. For the right leg, an effect of the eye condition (F(1.48) = 54.46, p,0.05, g2 = 0.53) and a significant interaction

Data analysis For the sample size calculation, we assumed the following parameters for the two-tailed hypothesis: alpha value (type 1 error probability) of 5%; beta value (type 2 error probability) of 10%; a test power of 90%; and a difference between the groups regarding the main outcome of 5%. To meet these conditions, at least seventeen subjects were necessary. Static balance protocol. Modified Clinical Test of Sensory Interaction on Balance - The data were analyzed using a 2 (group) 6 2 (eye condition) for firm and foam surface ANOVA separately. Unilateral Stance protocol - The data were analyzed using a 2 (group) 62 (eye condition) ANOVA for the right and left sides separately. An exploratory data analysis method was used in both tests when necessary. Dynamic balance protocol. Tandem Walk - To determine differences between the low-vision and normal-vision groups, the data were analyzed using one-way ANOVA. Step Up/Over - The data were analyzed using a 2 (group) 6 2 (right leg, left leg) ANOVA for lift-up index, impact index and movement time separately. The Chi-Square test was used to determine differences between the normal-vision and low-vision groups with regard to the self-reported variables. Data analysis was performed using SPSS version 17.0 for Windows. Statistical significance was set at p,0.05. Approval was granted by the Ethics Committee of the Faculdade de Medicina da Universidade de Sa˜o Paulo (number 933/06).

Table 2 - Comparison between the low-vision and normal-vision groups according to eyes, surface and side leg stance in terms of the static balance protocol. Eyes open

mCTSIB (degrees/sec) Firm surface Low vision Normal vision Foam Surface Low vision Normal vision US (degrees/sec) Right leg stance Low vision Normal vision Left leg stance Low vision Normal vision

& RESULTS The low-vision group had a significantly greater lifetime number of falls and perception of disequilibrium compared with the normal-vision group (Table 1).

519

Eyes closed

p-value

M (SD)

M (SD)

0.24 (0.08) 0.23 (0.11)

0.21 (0.09) 0.27 (0.27)

0.17 0.47

1.25 (0.31) 0.62 (0.12)

1.27 (0.32) 1.41 (0.30)

0.77 ,0.001*

1.80 (0.20) 0.08 (0.20)

2.58 (0.97) 2.98 (1.73)

0.001* ,0.001*

2.07 (0.95) 0.80 (0.18)

2.93 (1.73) 2.42 (1.73)

0.09 ,0.001


Control postural low vision Tomomitsu MS et al.

CLINICS 2013;68(4):517-521

between group and eye condition (F(1.48) = 11.75, p,0.05, g2 = 0.19) was also observed, but no group effect (F(1.48) = 1.60, p.0.05, g2 = 0.03) was found. The exploratory analysis demonstrated that there was a difference between the eye conditions in both single-leg stances in the normalvision group; that is, tasks were more difficult with eyes closed than eyes open condition for both legs. In the lowvision group, a difference between the eye conditions was only observed in the left leg test, with tasks being more difficult with eyes closed than eyes open. (Table 2).

smaller lift-up). Duarte and Zatsiorsky (18) reported that the dependence of visual information on balance control is greater when the individual is in unipodal support or on an incline than in a normal or neutral position. According to those authors, the proprioceptive information from mechanoreceptors on the soles of feet would likely be reduced during the most challenging tasks, and the postural control system would need to rely more on visual and vestibular information to control balance in an inclined position and on vestibular information only in conditions of low-vision or non-vision. In agreement with the literature, the low-vision individuals demonstrated less postural stability than those with normal vision (16). Several studies have suggested that vision impairment can increase postural instability (5,20,21) and that the interaction between the central nervous, muscle and peripheral sensory systems is fundamental for calibrating sensory maps and adjusting balance (3,15,23). The results revealed an interaction between the test’s surface type and eye condition for the normal-vision group. This group was less stable on a foam surface and in the unilateral stance tests when the subjects’ eyes were closed. This finding has been corroborated by previous studies in healthy individuals (3,4,14,15,24). Other studies have demonstrated that standing on a single limb is more difficult without vision, indicating that the more challenging the task, the more the balance control mechanisms rely on vision (25). No interaction was observed between the surface type and the eye condition in the low-vision group, except for with tasks involving the left leg. This finding may indicate that visual proprioceptive information would be more sensitive than mechanical proprioceptive information from the vestibular system and somatosensory systems (15), and in the low-vision group, these systems had physiologic habituation and an adaptation response to maintain postural control (14). In relation to the left leg test, the low-vision group had greater difficulty performing the test with eyes closed compared with open. Very few studies have examined the postural control of low-vision subjects in a single-leg stance under different eye conditions. The proprioception inputs could be overloading the left leg, as previous studies have suggested that unilateral stance tasks might depend on some neuromuscular requirement (25) and muscular strength (3,12,13). The ability of the postural control system to select a higher joint configuration variance (2,28) can contribute to the maintenance of postural stability by correcting lower extremity movements in individuals with vision impairments. In the Tandem Walk protocol, the low-vision group showed slower speed and greater step width compared with the normal-vision group. These results are in accordance with previous studies (29). This finding suggests that in walking, visual proprioception normally plays a lead role in the postural control system and can be partially compensated for by improving somatosensory and peripheral vestibular processing (14,21,30). In the Step Up/Over task, the low-vision group was more cautious when stepping up and executing the movement than the normal-vision group, as observed in previous studies. This result verified that these adaptations occur to increase kinesthetic information and compensate for unreliable/incomplete visual information (31). These adaptations

Dynamic balance For Tandem Walk task, the ANOVA results indicated that the step width and speed of the normal-vision and lowvision groups were significantly different. The normalvision and low-vision groups did not differ in sway velocity (Table 3). For the Step Up/Over task, the ANOVA results indicated significant effects for leg side (F(1.48) = 24.50, p,0.05, g2 = 0.33) and group (F(1.48) = 8.86, p,0.05, g2 = 0.15), but the results indicated no significant interaction effects. The time results for the Step Up/Over task indicated an effect for group (F(1.48) = 26.08, p,0.05, g2 = 0.97) but not for the right or left leg (F(1.48) = 2.14, p.0.05, g2 = 0.04), and no interactions were observed. For Step Up/Over impact, the ANOVA results indicated no effect for leg side or group (F(1.48) = 1.17, p.0.05, g2 = 0.02 and F(1.48) = 0.56, p.0.05, g2 = 0.01, respectively). An exploratory analysis demonstrated that there was a difference between the low-vision and normal-vision groups for lift up and time in both leg sides; that is, tasks were more difficult for the normal-vision group than the low-vision group (Table 3).

& DISCUSSION In our study, the reduced visual information influenced postural stability on a foam surface and in dynamic conditions for the low-vision group. The eyes open condition was easier (a smaller sway was observed) for the normal-vision group than the low-vision group for tasks performed on the foam surface. The low-vision group was more cautious compared with the normal-vision group when performing the Tandem Walk and Step Up/Over tasks (slower walking velocity, increased step width and Table 3 - Comparison between the low-vision and normal-vision groups in terms of the dynamic balance protocol. Low-vision

Tandem Walk Step width (cm) Speed (cm/sec) End SV (degrees/sec) Step up/over Lift-up index (% weight) Right leg Left leg Movement time (sec) Right leg Left leg Impact index (% weight) Right leg Left leg

Normal-vision

p-value

M (SD)

M (SD)

11.0 (3.75) 12.2 (3.33) 4.5 (1.45)

7.36 (1.18) 16.45 (4.21) 3.86 (3.21)

#0.001 #0.004 0.23

37.40 (12.48) 34.05 (11.72)

46.32 (8.33) 41.12 (5.67)

0.005 0.009

1.89 (0.33) 2.01 (0.47)

1.49 (0.18) 1.51 (0.35)

,0.001 ,0.001

42.34 (17.22) 42.63 (20.76)

44.68 (18.61) 44.68 (18.61)

0.64 0.71

520


CLINICS 2013;68(4):517-521

Control postural low vision Tomomitsu MS et al. 13. Shumway-Cook A, Woollacott MH. Motor Control: Theory and praticalaplications. 2a ed. Sa˜o Paulo: Manole; 2003. p.153-78. 14. Friedrich M, Grein HJ, Wicher C, Schuetze J, Mueller A, Lauenroth A, et al. Influence of pathologic and simulated visual dysfunctions on the postural system. Exp Brain Res. 2008;186(2):305-14, http://dx.doi.org/ 10.1007/s00221-007-1233-4. 15. Schmid M, Nardone A, De Nunzio AM, Schmid M, Schieppati M. Equilibrium during static and dynamic tasks in blind subjects: no evidence of cross-modal plasticity. Brain. 2007;130(Pt 8):2097-107, http:// dx.doi.org/10.1093/brain/awm157. 16. Loughran S, Tennant N, Kishore A, Swan IR. Interobserver reliability in evaluating postural stability between clinicians and posturography. Clin Otolaryngol. 2005;30(3):255-7, http://dx.doi.org/10.1111/j.1365-2273. 2005.00988.x. 17. Duarte M e Zatsiorsky VM. Effects of body lean and visual information on the equilibrium maintenance during stance. Exp Brain Res. 2002;146(1):60-9, http://dx.doi.org/10.1007/s00221-002-1154-1. 18. Ray CT, Horvat M, Croce R, Mason RC, Wolf SL. The impact of vision loss on postural stability and balance strategies in individuals with profound vision loss. Gait Posture. 2008;28(1):58-61, http://dx.doi.org/ 10.1016/j.gaitpost.2007.09.010. 19. Wade LR, Weimar WH, Davis J. Effect of personal protective eyewear on postural stability. Ergonomics. 2004;47(15):1614-23, http://dx.doi.org/ 10.1080/00140130410001724246. 20. Choy NL, Brauer S, Nitz J. Changes in postural stability in women aged 20 to 80 years. J Gerontol A Biol Sci Med Sci. 2003;58(6):525-30, http:// dx.doi.org/10.1093/gerona/58.6.M525. 21. Hafstro¨m A, Fransson PA, Karlberg M, Ledin T, Magnusson M. Visual influence on postural control, with and without visual motion feedback. Acta Otolaryngol. 2002;122(4):392-7, http://dx.doi.org/10.1080/ 00016480260000076. 22. Nakata H, Yabe K. Automatic postural response systems in individuals with congenital total blindness. Gait Posture. 2001;14(1):36-43, http://dx. doi.org/10.1016/S0966-6362(00)00100-4. 23. Stones MJ, Kozma A. Balance and age in the sighted and blind. Arch Phys Med Rehabil. 1987;68(2):85-9. 24. Rougier P. Visual feedback induces opposite effects on elementary centre of gravity and centre of pressure minus centre of gravity motions in undisturbed upright stance. Clin Biomech (Bristol, Avon). 2003;18(4):3419, http://dx.doi.org/10.1016/S0268-0033(03)00003-2. 25. Hazime FA, Allard P, Ide MR, Siqueira CM, Amorim CF, Tanaka C. Postural control under visual and proprioceptive perturbations during double and single limb stance. J Bodyw Mov Ther. 2012;16(2):224-9, http://dx.doi.org/10.1016/j.jbmt.2011.02.003. 26. Alonso AC, Brech GC, Bourquin AM, Greve JM. The influence of lowerlimb dominance on postural balance. Sa˜o Paulo Med. J. 2011;129:410-3. 27. Hertel J, Gay MR, Denegar CR. Differences in Postural Control During Single-Leg Stance Among Healthy Individuals With Different Foot Types. J Athl Train. 2002;37(2):129-32. 28. Krishnamoorthy V, Yang JF, Scholz JP. Joint coordination during quiet stance: effects of vision. Exp Brain Res. 2005;164(1):1-17, http://dx.doi. org/10.1007/s00221-004-2205-6. 29. Speers RA, Ashton-Miller JA, Schultz AB, Alexandre NB. Age differences in abilities to perform tandem stand and walk tasks of graded difficulty. Gait Posture. 1998;7(3):207-13, http://dx.doi.org/10. 1016/S0966-6362(98)00006-X. 30. Kiemel T, Oie KS, Jeka JJ. Slow dynamics of postural sway are in the feedback loop. J Neurophysiol. 2006;95(3):1410-8, http://dx.doi.org/10. 1152/jn.01144.2004. 31. Buckley JG, Heasley KJ, Twigg P, Elliott DB. The effects of blurred vision on the mechanics of landing during stepping down by the elderly. Gait Posture. 2005;21(1):65-71, http://dx.doi.org/10.1016/j.gaitpost.2003.12. 001. 32. Soong GP, Lovie-Kitchin JE, Brown B. Does mobility performance of visually impaired adults improve immediately after orientation and mobility training? Optom Vis Sci. 2001;78(9):657-66. 33. Hassan SE, Lovie-Kitchin JE, Woods RL. Vision and mobility performance of subjects with age-related macular degeneration. Optom Vision Sci. 2002;79(11):697-707, http://dx.doi.org/10.1097/00006324-20021100000007. 34. Berencsi A, Ishihara M, Imanaka K. The functional role of central and peripheral vision in the control of posture. Human MovSci. 2005;24(56):689-709, http://dx.doi.org/10.1016/j.humov.2005.10.014.

may be associated with the risk or fear of falls (32). The dynamic balance can be greatly impaired by the loss of afferent visual information (33). The results provide evidence for the need for interventions focused on reducing falls in this population. Methodological limitations arise regarding the effect of central and peripheral vision in postural balance. According Berencsi et al. (34), central vision and peripheral vision contribute differently to upright posture control, and peripheral vision results in less postural sway than central vision, but both types of vision are essential for the maintenance of postural control. Future studies should analyze the postural balance in subjects with different losses in either central or peripheral fields of vision. This study suggests that visual feedback could influence balance during challenging tasks, even during periods of prolonged vision impairment. Individuals with low vision had worse postural stability than normal-vision adults in dynamic tests and tests on foam surfaces.

& AUTHOR CONTRIBUTIONS Tomomitsu MS, Alonso AC and Morimoto E were responsible for data collection and manuscript writing. Bobbio TG was responsible for data analysis and the final correction of the manuscript. D’Andre´a Greve JM oriented the work.

& REFERENCES 1. Blomqvist S, Rehn B. Validity and reliability of the Dynamic One Leg Stance (DOLS) in people with vision loss. Advances in Physiotherapy. 2007;9(3):129-35, http://dx.doi.org/10.1080/14038190701395671. 2. Hsu WL, Scholz JP, Scho¨ner G, Jeka JJ, Kiemel T. Control and estimation of posture during quiet stance depends on multijoint coordination. J Neurophysiol. 2007;97(4):3024-35, http://dx.doi.org/10.1152/jn.01142.2006. 3. Giagazoglou P, Amiridis IG, Zafeiridis A, Thimara M, Kouvelioti V, Kellis E. Static balance control and lower limb strength in blind and sighted women. Eur J Appl Physiol. 2009;107(5):571-9. 4. Sforza C, Eid L, Ferrario VF. Sensorial afferents and center of foot pressure in blind and sighted adults. J Vis Impair Blind. 2000;94(2):97– 107. 5. Lord SR, Menz HB. Visual contributions to postural stability in older adults. Gerontology. 2000;46:306-10, http://dx.doi.org/10.1159/ 000022182. 6. Anand V, Buckley FG, Scally A, Elliott DB. Postural stability in the elderly during sensory pertubations and dual tasking: the influence of refractive blur. Invest Ophthalmol Vis Sci. 2003;44:2885-91, http://dx. doi.org/10.1167/iovs.02-1031. 7. Aydog˘ E, Aydog˘ ST, Cakci A, Doral MN. Dynamic postural stability in blind athletes using the biodex stability system. Int J Sports Med. 2006;27(5):415-8. 8. Organizac¸a˜o Mundial da Sau´de (OMS) disponı´vel em ,google - world healthorganization – vision 2020 priorityeyediseases.. acesso em: 23 mar. 2011. 9. Paulus WM, Straube A, Brandt T. Visual stabilization of posture. Physiological stimulus characteristics and clinical aspects. Brain 1984;107(pt 4):1143-63. 10. Anand V, Buckley JG, Scally A, Elliott DB. Postural stability changes in the elderly with cataract simulation and refractive blur. Invest Ophthalmol Vis Sci. 2003;44(11):4670-5, http://dx.doi.org/10.1167/ iovs.03-0455. 11. Black AA, Wood JM, Lovie-Kitchin JE, Newman BM. Visual impairment and postural sway among older adults with glaucoma. Optom Vis Sci. 2008;85(6):489-97, http://dx.doi.org/10.1097/OPX.0b013e31817882db. 12. Horvat M, Ray C, Ramsey V, Miszko T, Keeney R, Blasch B. Compensatory analysis and strategies for balance in individuals with visual impairments. J Vis Impair Blind. 2003;97:695-703.

521


CLINICAL SCIENCE

Comparing percutaneous coronary intervention and thrombolysis in patients with return of spontaneous circulation after cardiac arrest Ying-Qing Li,I Shu-Jie Sun,II Na Liu,III Chun-Lin Hu,I Hong-Yan Wei,I Hui Li,I Xiao-Xing Liao,I Xin LiI* I The First Affiliated Hospital of Sun Yat-sen University, Emergency Department, Guangzhou, People’s Republic of China. II East Hospital of TongJi University, Emergency Department, Shanghai, People’s Republic of China. III University Cancer Center, Sun Yat-sen, Guangzhou, People’s Republic of China.

OBJECTIVE: To evaluate the effects of percutaneous coronary intervention and thrombolysis after restoration of spontaneous circulation in cardiac arrest patients with ST-elevation myocardial infarction using meta-analysis. METHODS: We performed a meta-analysis of clinical studies indexed in the PUBMED, MEDLINE and EMBASE databases and published between January 1995 and October 2012. In addition, we compared the hospital discharge and neurological recovery rates between the patients who received percutaneous coronary intervention and those who received thrombolysis. RESULTS: Twenty-four studies evaluating the effects of percutaneous coronary intervention or thrombolysis after restoration of spontaneous circulation in cardiac arrest patients with ST-elevation myocardial infarction were included. Seventeen of the 24 studies were used in this meta-analysis. All studies were used to compare percutaneous coronary intervention and thrombolysis. The meta-analysis showed that the rate of hospital discharge improved with both percutaneous coronary intervention (p,0.001) and thrombolysis (p,0.001). We also found that cardiac arrest patients with ST-elevation myocardial infarction who received thrombolysis after restoration of spontaneous circulation did not have decreased hospital discharge (p = 0.543) or neurological recovery rates (p = 0.165) compared with those who received percutaneous coronary intervention. CONCLUSION: In cardiac arrest patients with ST-elevation myocardial infarction who achieved restoration of spontaneous circulation, both percutaneous coronary intervention and thrombolysis improved the hospital discharge rate. Furthermore, there were no significant differences in the hospital discharge and neurological recovery rates between the percutaneous coronary intervention-treated group and the thrombolysis-treated group. KEYWORDS: Meta-analysis; Cardiac Arrest; Return of Spontaneous Circulation; St-Elevation Myocardial Infarction; Percutaneous Coronary Intervention; Thrombolysis. Li YQ, Sun SJ, Liu N, Hu CL, Wei HY, Li H, et al. Comparing percutaneous coronary intervention and thrombolysis in patients with return of spontaneous circulation after cardiac arrest. Clinics. 2013;68(4):523-529. Received for publication on November 10, 2012; First review completed on December 5, 2012; Accepted for publication on December 26, 2012 E-mail: xlidoct@qq.com *corresponding author Tel.: 86 20 28823350

However, the hospital discharge rates following in-hospital CPR remain as low as they were 50 years ago, at 15-20% (2). Epidemiological studies have shown that coronary artery disease is the primary cause of CA, resulting in arrest within a short time due to acute myocardial infarction (AMI) or ischemia-related arrhythmias in 56-88% of clinical cases with CA (3,4). Autopsy studies have demonstrated that coronary arteries occluded by thrombi or ruptured atherosclerotic plaques have been identified in up to 95% of patients who die from sudden cardiac death (SCD) (5,6). Clinical studies have shown that reperfusion therapy reduces the high mortality rate, particularly in patients with ST-elevation myocardial infarction (STEMI) (7). Some studies have demonstrated that percutaneous coronary intervention (PCI) is beneficial in patients with STEMI (810). Meanwhile, a meta-analysis also indicated that thrombolysis is an effective treatment for STEMI patients (11).

& INTRODUCTION Cardiac arrest (CA) is a major cause of death in adults both in and out of the hospital. The percentage of patients who survive to hospital discharge is approximately 5-10% at best (1). Cardiopulmonary resuscitation (CPR) is essential to prevent death and provide neuroprotection after CA.

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)14

523


PCI and Thrombolysis in CA patients Li YQ et al.

CLINICS 2013;68(4):523-529

However, a large-scale multicenter prospective study (TROICA) indicated that thrombolysis is ineffective in patients with CA after STEMI, and that study was stopped prematurely because of the convincing early-stage data (12). Therefore, the controversy still exists regarding the efficacies of PCI and thrombolysis in patients with CA after STEMI (12-17). Both PCI and thrombolysis are efficacious in patients with STEMI. However, there is a significant difference between the efficacies of PCI and thrombolysis in patients with CA after STEMI. We assumed that most studies did not distinguish the condition of patients with STEMI. Thrombolysis may be used to treat patients without return of spontaneous circulation (ROSC) after CA. Therefore, the high mortality rate of patients with CA masked the benefit of thrombolysis. However, PCI can be used to treat patients with ROSC after CA. Herein, we assessed the efficacies of PCI and thrombolysis in patients with ROSC after CA in the presence of STEMI.

Statistical analysis We performed a meta-analysis using Review Manager 5.1 (The Cochrane Collaboration, Oxford, England). Odds ratios (ORs) and 95% confidence intervals (95%CIs) were calculated for each article using either the fixed-effects or the random-effects model. We used Cochran’s x2 test and the I2 test for heterogeneity to test the between-study heterogeneity, and a p,0.10 and an I2.50% were considered indicative of statistically significant heterogeneity. Between-group comparisons were performed using Pearson’s x2 test for categorical variables. All of the analyses were performed using the SPSS 17.0 software package (SPSS, Inc., Chicago, IL, USA). P-values ,0.05 were considered statistically significant.

& RESULTS Eligibility of articles In total, 127 articles were found by searching using the keywords mentioned in the methods section. Twenty-four of these articles were cohort studies and involved CA patients with STEMI who were treated with or without PCI or thrombolysis after ROSC. One hundred three articles they were reviews, case reports, were excluded because: they reported findings for CA patients with or letters; pulmonary embolisms (PEs) or for CA patients who had received reperfusion therapy during CPR without ROSC; or the authors of the study did not present the details regarding the hospital discharge and neurological recovery rates. Because controlled studies are necessary for metaanalyses, the 17 cohort-controlled studies (8-10,18-31) were included our the meta-analysis to assess the efficacies of PCI and thrombolysis in patients with ROSC after CA. Fifteen studies (8-10,18-29) out of the total were used to analyze the efficacy of PCI. Four studies (26,27,30,31) were used to analyze the efficacy of thrombolysis. After the metaanalysis, we used all 24 studies (8-10,18-38) to compare the hospital discharge and neurological recovery rates between the PCI and thrombolysis groups among patients with ROSC after CA. The main features of these selected cohort studies are listed in Table 1.

& METHODS Study identification strategy We searched for research papers indexed in the PUBMED, MEDLINE and EMBASE databases that were published from January 1995 to October 2012. The keywords used in the search were as follows: cardiac arrest or cardiopulmonary resuscitation or cardiopulmonary-cerebral resuscitation and thrombolysis or percutaneous coronary intervention and acute myocardial infarction. Furthermore, we manually reviewed the references for each article. The search was limited using the search terms ‘‘.19 years’’, ‘‘Publication Date from 1995/01/01 to 2012/10/01’’, ‘‘English’’, ‘‘Human’’, ‘‘PUBMED’’, ‘‘MEDLINE’’ and ‘‘EMBASE’’. We excluded research papers with the following keywords: ‘‘review’’, ‘‘review literature’’, ‘‘review of reported cases’’, ‘‘review, academic’’, ‘‘review, multicase’’, ‘‘review, tutorial’’, ‘‘case reports’’, ‘‘congresses’’, ‘‘interview’’, ‘‘overall’’, ‘‘comment’’, ‘‘letter’’, ‘‘practice guideline’’, ‘‘scientific integrity review’’, ‘‘news’’, ‘‘newspaper article’’ and ‘‘address’’. Some papers not included in the PUBMED, MEDLINE and EMBASE databases were also used in this meta-analysis.

Comparison of the hospital discharge rate between with- and without-PCI patients with ROSC after CA We first compared the rate of hospital discharge between the with- and without-PCI patient groups using data from 15 articles (8-10,18-29). Overall, 1320 patients had ROSC after CA and then received PCI treatment. A total of 860 (65.15%, 95%CI, 62.58-67.72) of these patients survived to hospital discharge. In addition, 2152 patients with ROSC after CA did not receive PCI, and 1017 (47.26%, 95%CI, 45.15-49.37) of these patients were discharged from the hospital. In this meta-analysis, we used a random-effects model to take into account the effect of heterogeneity among studies (Tau2 = 0.33; x2 = 54.25; p,0.00001; I2 = 74%). This meta-analysis indicated that PCI significantly improved the rate of hospital discharge in patients with ROSC after CA (OR, 1.92; 95% CI, 1.32-2.78, p,0.001) (Figure 1).

Inclusion criteria Eligible patients had experienced CA due to STEMI and achieved ROSC after CPR. The diagnosis of CA and whether CPR was used were determined based on the records in the respective studies. The diagnostic and management process that was followed was in accordance with the Utstein model. All the included articles were non-randomized comparative studies. Patients with ROSC after CA who then received PCI or thrombolysis treatment constituted the treatment groups. The types of PCI and the doses of thrombolytic agents used were not restricted. Patients in the control groups were those who underwent CA and achieved ROSC and who could be treated by CPR without PCI or thrombolysis. We compared the efficacies of PCI and thrombolysis between the treatment and control groups. We also compared the efficacies of PCI and thrombolysis in patients with ROSC after CA. The primary study endpoints were the rates of hospital discharge and neurological recovery.

Comparison of neurological recovery between with- and without-PCI patients with ROSC after CA We also compared the neurological recovery rate between the with- and without-PCI groups using data from 12

524


CLINICS 2013;68(4):523-529

PCI and Thrombolysis in CA patients Li YQ et al.

Table 1 - Characteristics of the studies included in the comparative analysis. Author

Study Design

Type of reperfusion

Participants

Anyfantakis et al.* Cronier et al.* Dumas et al.* Garot et al.* Hosmane et al.* Kahn JK et al.* Koetha et al.* Lettieri et al.* Merchant et al.* Miloslav et al.* N.Nielsen et al.* T mte et al.* V.Gorjup et al.* B.Bendz et al Knafelj et al Mager et al Markusohn et al Valente et al Keelan et al Richling et al.* S.Bulut et al.* Total

Prosp Retro Retro Retro Retro Prosp Retro Prosp Prosp Prosp Retro Prosp Retro Retro Retro Retro Retro Retro Retro Retro Retro

PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI PCI

72 111 435 186 98 11 736 99 110 26 986 248 135 40 72 21 25 31 15 147 72 3676

Richling et al.{ S.Bulut et al. { M.Ruiz-Baile´n et al. { W.Schreiber et al. { H.-R.Arntz et al Total

Retro Retro Retro Retro Retro

thrombolysis thrombolysis thrombolysis thrombolysis thrombolysis

147 72 303 157 50 729

Hospital discharge

CPC 1/2

with PCI

without PCI

with PCI

without PCI

10/24 29/46 90/177 92/161 49/62 3/7 114/143 72/90 13/17 13/19 197/299 71/111 79/108 29/40 44/72 18/21 19/25 23/31 11/15 24/46 4/10 1004/1524 with thrombolysis 69/101 3/7 55/67 31/42 23/50 181/267

25/48 31/65 81/258 11/25 14/36 3/4 248/593 5/9 54/93 2/7 358/687 80/137 13/27

10/10 29/29 90/90 92/92 47/49 2/3 103/114 69/72

23/25 25/31 70/81 7/11 7/14 2/3 208/248 0/5

11/13 180/197 71/71

2/2 254/358 69/80

69/101 23/62 1017/2152 without thrombolysis 24/46 24/65 127/236 63/115

22/24

57/69

726/764

724/927

57/69

22/24

29/31

57/63

86/100

79/87

238/462

Retro: retrospective study; Prosp: prospective study; PCI: percutaneous coronary intervention; STEMI: ST-elevation myocardial infarction. CPC: Cerebral Performance Categories; *Included in the meta-analysis for PCI; {Included in the meta-analysis for thrombolysis.

articles (8-10,18-23,25,26,28). Neurological recovery was described and recorded using the Cerebral Performance Categories (CPC) scale. Neurological recovery was

considered good for patients who could perform their normal activities independently (CPC 1 or 2). Neurological recovery was considered bad, poor or unfavorable for

Figure 1 - Forest plot of the hospital discharge rates between the with- and without-PCI patients for the meta-analysis.

525


PCI and Thrombolysis in CA patients Li YQ et al.

CLINICS 2013;68(4):523-529

Figure 2 - Forest plot of the neurological recovery rates between the with- and without-PCI patients for the meta-analysis.

95%CI, 49.96-56.08) of these patients survived to hospital discharge. A fixed-effects model was used in this metaanalysis to account for the lack of heterogeneity among the included studies (x2 = 2.87, p = 0.41, I2 = 0%), and the analysis indicated that thrombolysis could also significantly improve the rate of hospital discharge in patients with ROSC after CA (OR, 2.63, 95%CI, 1.77-3.90, p,0.001) (Figure 3).

patients who were dependent on others, who were vegetative or who had died (CPC 3, 4 or 5). The authors assessed the CPC score at the time of hospital discharge. The rates of good neurological recovery were 95.03% (726 of 764 patients; 95%CI, 93.49-96.57) and 78.10% (724 of 927 patients; 95%CI, 75.44-80.76) for the with- or without-PCI patient groups, respectively. To reduce the heterogeneity among these studies (Tau2 = 0.86; x2 = 26.40; p = 0.006; I2 = 58%), we used a random-effects model. PCI treatment significantly improved the rate of neurological recovery at the time of hospital discharge in patients with ROSC after CA (OR, 6.71; 95% CI, 2.97-15.15, p,0.001) (Figure 2).

Comparison of neurological recovery between with- and without-thrombolysis patients with ROSC after CA To compare the neurological recovery between the withand without-thrombolysis patient groups, data from two articles were analyzed (26,31). The CPC scale was used. The homogeneity of the two studies was good (x2 = 1.17, p = 0.28, I2 = 15%). Therefore, we used a fix-effects model for this meta-analysis. Overall, 86.00% (86 of 100 patients; 95% CI, 82.53-89.47) and 90.80% (79 of 87 patients; 95% CI, 84.7396.87) of patients had a good neurological recovery in the patient groups with and without thrombolysis, respectively. Thrombolysis did not improve the neurological recovery status at the time of hospital discharge in patients with ROSC after CA (OR, 0.76, 95%CI, 0.27-2.17, p = 0.309) (Figure 4).

Comparison of the hospital discharge rate between with- and without-thrombolysis patients with ROSC after CA We also compared the rate of hospital discharge between the with- and without-thrombolysis patient groups using data from four articles (26,27,30,31). Thrombolysis was performed in 217 patients with ROSC after CA, and 158 (72.81%, 95%CI, 66.89-78.73) of these patients survived to hospital discharge. In addition, 462 patients with ROSC after CA were not treated with thrombolysis, and 238 (51.52%,

Figure 3 - Forest plot of the hospital discharge rates between the with- and without-thrombolysis patients for the meta-analysis.

526


CLINICS 2013;68(4):523-529

PCI and Thrombolysis in CA patients Li YQ et al.

Figure 4 - Forest plot of the neurological recovery rates between the with- and without-thrombolysis patients for the meta-analysis.

with thrombolysis and survived to hospital discharge, and 109 (88.62%, 95%CI, 83.01-94.23) patients had good neurological recovery. We noted that the PCI treatment group did not have a significantly better neurological recovery rate than the thrombolysis treatment group among patients with ROSC after CA (p = 0.165, Figure 5).

Comparison of the hospital discharge rate between the PCI and thrombolysis groups among patients with ROSC after CA There were 24 articles included in this comparison of the PCI and thrombolysis treatment groups. There were 21 articles (8-10,18-29,33-38) on PCI and 5 articles (26,27,30-32) on thrombolysis. Among the patients included in this analysis, 65.88% (1004 of 1524 patients, 95%CI, 63.50-68.26) survived to hospital discharge in the PCI treatment group. Similarly, 67.79% (181 of 267 patients, 95%CI, 62.18-73.40) of patients in the thrombolysis treatment group survived to hospital discharge. We found that the prognosis of patients treated with PCI was no better than that of patients treated with thrombolysis with respect to the hospital discharge rates (p = 0.543, Figure 5).

Comparison of the hospital discharge and neurological recovery rates in patients with ROSC after in-hospital CA (IHCA) or out-of-hospital CA (OHCA)

Comparison of neurological recovery between the PCI and thrombolysis groups among patients with ROSC after CA

& DISCUSSION

Even after excluding studies involving IHCA (20,21,24,29,30,36), results similar to those described above were obtained. Thus, PCI and thrombolysis had the same level of efficacy in patients with ROSC whether they experienced IHCA or OHCA.

Based on the 17 included studies (8-10,18-31), the metaanalysis indicated that both PCI and thrombolysis could improve the hospital discharge rate for patients with ROSC after CA, but only PCI could improve the neurological recovery rate. However, further analysis using a total of 24 studies (8-10,18-38) indicated that there were not significant differences in the hospital discharge and neurological recovery rates between the PCI and thrombolysis treatment groups. PCI and thrombolysis are the two main reperfusion strategies currently in use. According to the recent AHA guidelines concerning CPR for ACS (acute coronary syndrome) patients (39), PCI may be considered for patients with ROSC after CA. Our data indicate that such a strategy improved the rate of hospital discharge and enhanced neurological recovery in patients with ROSC following CA. However, the efficacy of thrombolysis has been rarely mentioned in regard to CA patients. A recent randomized study (TROICA) reported that thrombolysis did not improve the hospital discharge and neurological recovery rates in patients with CA. The TROICA researchers reported that one possible reason might be the administration of antithrombin and antiplatelet agents during CPR. Another important reason might be the restriction of the perfusion of vital organs during CPR by blood clots in the coronary arteries, limiting the perfusion pressure and hindering the delivery of the thrombolytic agents to the location where they were to play their thrombolytic role (12). We concluded that one main possible reason for the lack of efficacy for thrombolysis might have been the lack of distinguishing patients with ROSC after CA from those without ROSC; when CA patients achieve ROSC, there may be suitable perfusion pressure in the coronary arteries, allowing

This comparison between the PCI and thrombolysis groups was performed using 18 articles. There were 16 articles (8-10,18-23,25,26,28,34-37) on PCI and 3 articles (26,31,32) on thrombolysis. Among the patients included in this analysis, 856 patients with ROSC after CA who received PCI survived to hospital discharge, and 790 (92.29%, 95%CI, 90.50-94.08) patients had a good neurological recovery. In addition, 123 patients with ROSC after CA were treated

Figure 5 - Comparison of the hospital discharge and neurological recovery rates between the PCI and thrombolysis groups Left: Comparison of the hospital discharge rates between the PCI and thrombolysis groups (p = 0.543) Right: Comparison of the neurological recovery rates between the PCI and thrombolysis groups (p = 0.165).

527


PCI and Thrombolysis in CA patients Li YQ et al.

CLINICS 2013;68(4):523-529

thrombolysis could function effectively. In this study, we studied the efficacies of thrombolysis and PCI in patients with ROSC after CA, and we identified no differences in the hospital discharge and neurological recovery rates. Plaque rupture, thrombus collapse and embolisms play key roles in the pathogenesis of SCD (5,6). Clinical studies have already identified disrupted atherosclerotic plaques or occlusive thrombi in CA survivors using coronary angiography (4). Therefore, early reperfusion therapy in patients with STEMI is an important cornerstone of the recommended therapy and is also recommended by the European Society of Cardiology (ESC) (40). Reperfusion treatment has been used to treat AMI patients for the past 20 years. As the two main reperfusion approaches for AMI, PCI and thrombolysis can recanalize the occluded artery, reduce the infarct size, minimize myocardial damage, enhanced left ventricular recovery, reduce the incidence of arrhythmias and decrease mortality (13). Because AMI is the main underlying cause of CA (3,4), therapeutic strategies for coronary reperfusion should be equally appropriate for CA patients. However, in clinical practice, there is still some controversy concerning the roles and efficacies of PCI and thrombolysis for the treatment of patients with CA caused by AMI (4,12,17,20,22). PCI can directly open the occluded coronary artery and stabilize hemodynamics. Many clinical studies on reperfusion therapy have indicated that immediate PCI after CA is a safe procedure and is associated with a good prognosis (4,8,20,22,27,29,33,37). A series of large-scale clinical studies demonstrated that PCI has pronounced efficacy for treating CA patients with STEMI (8-10), a result that was confirmed by our meta-analysis. We know that thrombolysis is able to improve the prognosis of STEMI patients and has an efficacy comparable to that of PCI. However, it is not clear why there is such a large difference between these treatments in CA patients. After carefully analyzing the relevant articles (4,12,17,20,22), we found that this difference may be the result of the selection of the study populations. PCI was used to treat patients with STEMI without CA. In contrast, thrombolysis was most often used to treat patients with STEMI with CA because of its convenience and rapid action. The high mortality rate of CA patients masked the benefit of thrombolysis for the treatment of AMI (41-43). With the development of CPR, medical scientists have realized the importance of neuroprotection after CPR, especially in patients with ROSC after CA. Our metaanalysis and comparative analysis aimed to evaluate the benefits of PCI and thrombolysis for patients with ROSC after CA. In this study, we found that both PCI and thrombolysis improved the hospital discharge rates of patients with ROSC after CA. There were no significant differences in the hospital discharge and neurological recovery rates of CA patients. We also found that thrombolysis could improve the hospital discharge rate, but it could not improve the neurological recovery rate. However, several studies have demonstrated that thrombolysis also results in good neurological recovery in CA patients. Hemodynamic studies indicate that thrombolysis can decrease microthrombosis, improve microcirculation metabolism and further promote neurological recovery (30,31). Therefore, we concluded that the previous studies are insufficient to demonstrate the benefit of thrombolysis in neurological recovery.

Reperfusion therapy can open the occluded artery and rescue dying myocardium in patients with ROSC after CA. PCI is used to treat patients with STEMI but without CA, preventing many deaths. Thrombolysis is used to treat patients with STEMI during CPR. However, patient hemodynamics are unstable during that time. This instability may be the reason why the results were so dismal. Our results indicate that the first step should be the selection of patients with ROSC after CA; then, the decision between PCI and thrombolysis can be made. In developing countries, the mortality rate for ischemic heart disease is expected to increase by almost 120-137%, compared with 29-48% in developed countries, between 1990 and 2020; however, developing countries cannot afford the widely used expensive PCI techniques (44,45). Compared with PCI, thrombolysis is convenient and rapid, has a similar efficacy and is relatively simple, making it especially suited for use in clinics that cannot perform PCI. Our findings provide information to guide the resuscitation of patients with ROSC after CA. Of course, these results require validation by additional randomized control trials. In conclusion, our comparative analysis demonstrated that thrombolysis had an efficacy similar to that of PCI in patients with ROSC after CA. Our results indicate that there is still a need to conduct large-scale randomized clinical trials to confirm the benefits of thrombolysis in patients with ROSC after CA and in the presence of STEMI.

& ACKNOWLEDGMENTS This study was supported by funding from the National Natural Science Foundation of China (NSFC) (81272062, 81071030), the Science and Technology Foundation of Guangdong Province, China (2010B031600089, 2011B080701006) and the Training Foundation for the Youth Scholars of Sun Yat-sen University (09ykpy31). The funders had no role in the study design, data collection, analysis, decision to publish or preparation of the manuscript.

& AUTHOR CONTRIBUTIONS Li YQ, Sun SJ and Liu N contributed equally to this study. Li X conceived the study, designed the trial and obtained the research funding. Li YQ, Sun SJ, Liu N and Hu CL collected the data. Wei HY and Li H collected the data. Liao XX analyzed the output data with advice from Li X. Li YQ and Liu N drafted the manuscript. Li YQ, Liao XX, Liu N and Li X discussed the results and implications and commented on the manuscript at all stages.

& REFERENCES 1. 2005 international consensus on cardiopulmonary resuscitation and emergency cardiovascular care science with treatment recommendations. Part 2: Adult basic life support. Resuscitation. 2005;67(2-3):187-201. 2. Ehlenbach WJ, Barnato AE, Curtis JR, Kreuter W, Koepsell TD, Deyo RA, et al. Epidemiologic study of in-hospital cardiopulmonary resuscitation in the elderly. N Engl J Med. 2009;361(1):22-31. 3. Zipes DP, Wellens HJ. Sudden cardiac death. Circulation. 1998;98(21):2334-51, http://dx.doi.org/10.1161/01.CIR.98.21.2334. 4. Spaulding CM, Joly LM, Rosenberg A, Monchi M, Weber SN, Dhainaut JF, et al. Immediate coronary angiography in survivors of out-of-hospital cardiac arrest. N Engl J Med. 1997;336(23):1629-33. 5. Davies MJ, Thomas A. Thrombosis and acute coronary-artery lesions in sudden cardiac ischemic death. N Engl J Med. 1984;310(1):1137-40. 6. Myerburg RJ, Kessler KM, Estes D, Conde CA, Luceri RM, Zaman L, et al. Long-term survival after prehospital cardiac arrest: Analysis of outcome during an 8 year study. Circulation. 1984;70(4):538-46, http://dx.doi. org/10.1161/01.CIR.70.4.538. 7. Antman EM, Hand M, Armstrong PW, Bates ER, Green LA, Halasyamani LK, et al. 2007 focused update of the acc/aha 2004 guidelines for the management of patients with st-elevation myocardial infarction: A report of the american college of cardiology/american heart

528


CLINICS 2013;68(4):523-529

8.

9.

10.

11.

12. 13.

14.

15.

16.

17. 18.

19.

20.

21.

22.

23.

24.

25.

26.

PCI and Thrombolysis in CA patients Li YQ et al.

association task force on practice guidelines. J Am Coll Cardiol. 2008;51(2):210-47, http://dx.doi.org/10.1016/j.jacc.2007.10.001. Dumas F, Cariou A, Manzo-Silberman S, Grimaldi D, Vivien B, Rosencher J, et al. Immediate percutaneous coronary intervention is associated with better survival after out-of-hospital cardiac arrest: Insights from the procat (parisian region out of hospital cardiac arrest) registry. Circ Cardiovasc Interv. 2010;3(3):200-7, http://dx.doi.org/10. 1161/CIRCINTERVENTIONS.109.913665. Koeth O, Zahn R, Bauer T, Juenger C, Gitt AK, Senges J, et al. Primary percutaneous coronary intervention and thrombolysis improve survival in patients with st-elevation myocardial infarction and pre-hospital resuscitation. Resuscitation. 2010;81(11):1505-8, http://dx.doi.org/10. 1016/j.resuscitation.2010.06.018. Nielsen N, Hovdenes J, Nilsson F, Rubertsson S, Stammet P, Sunde K, et al. Outcome, timing and adverse events in therapeutic hypothermia after out-of-hospital cardiac arrest. Acta Anaesthesiol Scand 2009; 53(7):926-34. Li X, Fu QL, Jing XL, Li YJ, Zhan H, Ma ZF, et al. A meta-analysis of cardiopulmonary resuscitation with and without the administration of thrombolytic agents. Resuscitation. 2006;70(1):31-6, http://dx.doi.org/ 10.1016/j.resuscitation.2005.11.016. Bottiger BW, Arntz HR, Chamberlain DA, Bluhmki E, Belmans A, Danays T, et al. Thrombolysis during resuscitation for out-of-hospital cardiac arrest. N Engl J Med. 2008;359(25:2651-62. Keeley EC, Boura JA, Grines CL. Primary angioplasty versus intravenous thrombolytic therapy for acute myocardial infarction: A quantitative review of 23 randomised trials. Lancet. 2003;361(9351):13-20, http://dx. doi.org/10.1016/S0140-6736(03)12113-7. Grines CL, Browne KF, Marco J, Rothbaum D, Stone GW, O’Keefe J, et al. A comparison of immediate angioplasty with thrombolytic therapy for acute myocardial infarction. The primary angioplasty in myocardial infarction study group. N Engl J Med. 1993;328(10):673-9. Widimsky P, Bilkova D, Penicka M, Novak M, Lanikova M, Porizka V, et al. Long-term outcomes of patients with acute myocardial infarction presenting to hospitals without catheterization laboratory and randomized to immediate thrombolysis or interhospital transport for primary percutaneous coronary intervention. Five years’ follow-up of the prague2 trial. Eur Heart J. 2007;28(6):679-84. Zijlstra F, Hoorntje JC, de Boer MJ, Reiffers S, Miedema K, Ottervanger JP, et al. Long-term benefit of primary angioplasty as compared with thrombolytic therapy for acute myocardial infarction. N Engl J Med. 1999;341(19):1413-9. Abu-Laban RB, Christenson JM, Innes GD, van Beek CA, Wanger KP, McKnight RD, et al. Tissue plasminogen activator in cardiac arrest with pulseless electrical activity. N Engl J Med. 2002;346(20):1522-8. Anyfantakis ZA, Baron G, Aubry P, Himbert D, Feldman LJ, Juliard JM, et al. Acute coronary angiographic findings in survivors of out-ofhospital cardiac arrest. Am Heart J. 2009;157(2):312-8, http://dx.doi.org/ 10.1016/j.ahj.2008.09.016. Cronier P, Vignon P, Bouferrache K, Aegerter P, Charron C, Templier F, et al. Impact of routine percutaneous coronary intervention after out-ofhospital cardiac arrest due to ventricular fibrillation. Crit Care. 2011;15(3):R122, http://dx.doi.org/10.1186/cc10227. Garot P, Lefevre T, Eltchaninoff H, Morice MC, Tamion F, Abry B, et al. Six-month outcome of emergency percutaneous coronary intervention in resuscitated patients after cardiac arrest complicating st-elevation myocardial infarction. Circulation. 2007;115(11):1354-62, http://dx.doi. org/10.1161/CIRCULATIONAHA.106.657619. Hosmane VR, Mustafa NG, Reddy VK, Reese CLt, DiSabatino A, Kolm P, et al. Survival and neurologic recovery in patients with st-segment elevation myocardial infarction resuscitated from cardiac arrest. J Am Coll Cardiol. 2009;53(5):409-15, http://dx.doi.org/10.1016/j.jacc.2008.08. 076. Kahn JK, Glazier S, Swor R, Savas V, O’Neill WW. Primary coronary angioplasty for acute myocardial infarction complicated by out-ofhospital cardiac arrest. Am J Cardiol. 1995;75(15):1069-70, http://dx.doi. org/10.1016/S0002-9149(99)80727-9. Lettieri C, Savonitto S, De Servi S, Guagliumi G, Belli G, Repetto A, et al. Emergency percutaneous coronary intervention in patients with stelevation myocardial infarction complicated by out-of-hospital cardiac arrest: Early and medium-term outcome. Am Heart J. 2009;157(3):569-75, http://dx.doi.org/10.1016/j.ahj.2008.10.018. Merchant RM, Abella BS, Khan M, Huang KN, Beiser DG, Neumar RW, et al. Cardiac catheterization is underutilized after in-hospital cardiac arrest. Resuscitation. 2008;79(3):398-403, http://dx.doi.org/10.1016/j. resuscitation.2008.07.015. Pleskot M, Babu A, Hazukova R, Stritecky J, Bis J, Matejka J, et al. Out-ofhospital cardiac arrests in patients with acute st elevation myocardial infarctions in the east bohemian region over the period 2002-2004. Cardiology.2008;109(1):41-51, http://dx.doi.org/10.1159/000105325. Richling N, Herkner H, Holzer M, Riedmueller E, Sterz F, Schreiber W. Thrombolytic therapy vs primary percutaneous intervention after

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37. 38.

39.

40.

41.

42. 43. 44.

45.

529

ventricular fibrillation cardiac arrest due to acute st-segment elevation myocardial infarction and its effect on outcome. Am J Emerg Med. 2007;25(5):545-50. Bulut S, Aengevaeren WR, Luijten HJ, Verheugt FW. Successful out-ofhospital cardiopulmonary resuscitation: What is the optimal in-hospital treatment strategy? Resuscitation. 2000;47(2):155-61, http://dx.doi.org/ 10.1016/S0300-9572(00)00217-3. Tomte O, Andersen GO, Jacobsen D, Draegni T, Auestad B, Sunde K. Strong and weak aspects of an established post-resuscitation treatment protocol-a five-year observational study. Resuscitation. 2011;82(9):118693, http://dx.doi.org/10.1016/j.resuscitation.2011.05.003. Gorjup V, Radsel P, Kocjancic ST, Erzen D, Noc M. Acute st-elevation myocardial infarction after successful cardiopulmonary resuscitation. Resuscitation. 2007;72(3):379-85, http://dx.doi.org/10.1016/j.resuscitation. 2006.07.013. Ruiz-Bailen M, Aguayo de Hoyos E, Serrano-Corcoles MC, DiazCastellanos MA, Ramos-Cuadra JA, Reina-Toral A. Efficacy of thrombolysis in patients with acute myocardial infarction requiring cardiopulmonary resuscitation. Intensive Care Med. 2001;27(6):1050-7. Schreiber W, Gabriel D, Sterz F, Muellner M, Kuerkciyan I, Holzer M, et al. Thrombolytic therapy after cardiac arrest and its effect on neurological outcome. Resuscitation. 2002;52(1):63-9, http://dx.doi. org/10.1016/S0300-9572(01)00432-4. Arntz HR, Wenzel V, Dissmann R, Marschalk A, Breckwoldt J, Muller D. Out-of-hospital thrombolysis during cardiopulmonary resuscitation in patients with high likelihood of st-elevation myocardial infarction. Resuscitation. 2008;76(2):180-4, http://dx.doi.org/10.1016/j.resuscitation. 2007.07.012. Bendz B, Eritsland J, Nakstad AR, Brekke M, Klow NE, Steen PA, et al. Long-term prognosis after out-of-hospital cardiac arrest and primary percutaneous coronary intervention. Resuscitation. 2004;63(1):49-53, http://dx.doi.org/10.1016/j.resuscitation.2004.04.006. Keelan PC, Bunch TJ, White RD, Packer DL, Holmes DR, Jr. Early direct coronary angioplasty in survivors of out-of-hospital cardiac arrest. Am J Cardiol. 2003;91(12):1461-3, http://dx.doi.org/10.1016/S00029149(03)00398-9. Knafelj R, Radsel P, Ploj T, Noc M. Primary percutaneous coronary intervention and mild induced hypothermia in comatose survivors of ventricular fibrillation with st-elevation acute myocardial infarction. Resuscitation. 2007;74(2):227-34, http://dx.doi.org/10.1016/j.resuscitation. 2007.01.016. Mager A, Kornowski R, Murninkas D, Vaknin-Assa H, Ukabi S, Brosh D, et al. Outcome of emergency percutaneous coronary intervention for acute st-elevation myocardial infarction complicated by cardiac arrest. Coron Artery Dis. 2008;19(8):615-8, http://dx.doi.org/10.1097/MCA. 0b013e32831381b4. Marcusohn E, Roguin A, Sebbag A, Aronson D, Dragu R, Amikam S, et al. Primary percutaneous coronary intervention after out-of-hospital cardiac arrest: Patients and outcomes. Isr Med Assoc J. 2007;9(4):257-9. Valente S, Lazzeri C, Saletti E, Chiostri M, Gensini GF. Primary percutaneous coronary intervention in comatose survivors of cardiac arrest with st-elevation acute myocardial infarction: A single-center experience in florence. J Cardiovasc Med (Hagerstown). 2008;9(11):10837, http://dx.doi.org/10.2459/JCM.0b013e3282ff82d4. O’Connor RE, Bossaert L, Arntz HR, Brooks SC, Diercks D, Feitosa-Filho G, et al. Acute Coronary Syndrome Chapter Collaborators. Circulation. 2010;122(16 Suppl 2):S422-65, http://dx.doi.org/10.1161/CIRCULA TIONAHA.110.985549. Van de Werf F, Bax J, Betriu A, Blomstrom-Lundqvist C, Crea F, Falk V, et al. Management of acute myocardial infarction in patients presenting with persistent st-segment elevation: The task force on the management of st-segment elevation acute myocardial infarction of the european society of cardiology. Eur Heart J. 2008;29(23):2909-45. Sasson C, Hegg AJ, Macy M, Park A, Kellermann A, McNally B. Prehospital termination of resuscitation in cases of refractory out-ofhospital cardiac arrest. JAMA. 2008;300(12):1432-8, http://dx.doi.org/10. 1001/jama.300.12.1432. Stiell IG, Wells GA, Field B, Spaite DW, Nesbitt LP, De Maio VJ, et al. Advanced cardiac life support in out-of-hospital cardiac arrest. N Engl J Med 2004;351(7):647-56. Gueugniaud PY, David JS, Chanzy E, Hubert H, Dubien PY, Mauriaucourt P, et al. Vasopressin and epinephrine vs. Epinephrine alone in cardiopulmonary resuscitation. N Engl J Med. 2008;359(1):21-30. Yusuf S, Reddy S, Ounpuu S, Anand S. Global Burden of Cardiovascular DiseasesPart I: General Considerations, the Epidemiologic Transition, Risk Factors, and Impact of Urbanization. Circulation. 2001;104(22):274653, http://dx.doi.org/10.1161/hc4601.099487. Jafary FH, Ahmed H, Kiani J. Outcomes of primary percutaneous coronary intervention at a joint commission international accredited hospital in a developing country -- can good results, possibly similar to the west, be achieved? J Invasive Cardiol. 2007;19(10):417-23.


CLINICAL SCIENCE

Decreased plasma ADAMTS-13 activity as a predictor of postoperative bleeding in cyanotic congenital heart disease Rosangela P.S. Soares,I Se´ rgio P. Bydlowski,II Marcelo B. Jatene,III Janete Ferreira Hironaka,III Antonio Augusto LopesIII I

Fundac¸a˜o Pro´-Sangue Hemocentro de Sa˜o Paulo, Sa˜o Paulo/SP, Brazil. II Faculdade de Medicina da Universidade de Sa˜o Paulo, Laboratory of Medical Investigation-31, Sa˜o Paulo/SP, Brazil. III Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Heart Institute (InCor), Department of Pediatric Cardiology and Adult Congenital Heart Disease, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: To analyze the preoperative plasma antigenic concentration and activity of von Willebrand factor and its main cleaving protease ADAMTS-13 in pediatric patients with cyanotic congenital heart disease undergoing surgical treatment and investigate possible correlations with postoperative bleeding. METHODS: Plasma antigenic concentrations (von Willebrand factor:Ag and ADAMTS-13:Ag) were measured using enzyme-linked immunoassays. Collagen-binding assays were developed to measure biological activities (von Willebrand factor:collagen binding and ADAMTS-13 activity). The multimeric structure of von Willebrand factor was analyzed using Western immunoblotting. Demographic, diagnostic, and general and specific laboratory data and surgery-related variables were subjected to univariate, bivariate, and multivariate analysis for the prediction of postoperative bleeding. RESULTS: Forty-eight patients were enrolled, with ages ranging from 9 months to 7.6 years (median 2.5 years). The plasma concentrations of von Willebrand factor:Ag and ADAMTS-13:Ag were decreased by 65 and 82%, respectively, in the patients compared with the controls (p,0.001). An increased density of low-molecular-weight fractions of von Willebrand factor, which are suggestive of proteolytic degradation (p = 0.0081), was associated with decreased ADAMTS-13 activity, which was likely due to ADAMTS-13 consumption (71% of controls, p = 0.0029) and decreased von Willebrand factor:collagen binding (76% of controls, p = 0.0004). Significant postoperative bleeding occurred in 13 patients. The preoperative ADAMTS-13 activity of ,64.6% (mean level for the group), preoperative activated partial thromboplastin time, and the need for cardiopulmonary bypass were characterized as independent risk factors for postoperative bleeding, with respective hazard ratios of 22.35 (95% CI 1.69 to 294.79), 1.096 (95% CI 1.016 to 1.183), and 37.43 (95% CI 1.79 to 782.73). CONCLUSION: Low plasma ADAMTS-13 activity is a risk factor for postoperative bleeding in children with cyanotic congenital heart disease, particularly in children undergoing cardiopulmonary bypass. KEYWORDS: Congenital Heart Disease; Pediatric Cardiac Surgery; Bleeding Tendency; ADAMTS-13; von Willebrand factor (Cleaving Protease); Hemostasis. Soares RP, Bydlowski SP, Jatene MB, Hironaka JF, Lopes AA. Decreased plasma ADAMTS-13 activity as a predictor of postoperative bleeding in cyanotic congenital heart disease. Clinics. 2013;68(4):531-536. Received for publication on November 13, 2012; First review completed on December 27, 2012; Accepted for publication on December 27, 2012 E-mail: aablopes@usp.br Tel.: 55 11 2661-5350

metalloproteases and is primarily synthesized in hepatic stellate cells (1), although other sources have been identified. The principal function of ADAMTS-13 is the physiological (limited) cleavage of von Willebrand factor (VWF). Mutations of the ADAMTS-13 gene are associated with the presence of extra-large VWF multimers in plasma, which is the molecular basis of congenital thrombotic thrombocytopenic purpura (2). Abnormal circulating levels of VWF and ADAMTS-13 have been reported in numerous acquired disorders, including cardiovascular diseases (3,4). Increased plasma VWF antigen (VWF:Ag) and/or decreased ADAMTS-13 activity are generally associated with poor outcomes in these conditions (5,6).

& INTRODUCTION ADAMTS-13 (a desintegrin and metalloprotease with thrombospondin type 1 motif) is a member of a family of zinc

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)15

531


ADAMTS-13 in Congenital Heart Disease Soares RP et al.

CLINICS 2013;68(4):531-536

dialysis. The results were expressed as percent activity. Proteolysis of VWF multimers was analyzed using Western immunoblotting as previously described (11). The results were expressed as the density of VWF low-molecular-weight fractions relative to the density of all the fractions (laser densitometry). In all the determinations, the results were compared with a control group of nine healthy children within the same age range.

Changes in ADAMTS-13 activity and VWF have been reported in patients undergoing cardiac surgery (7) but have not been investigated in the pediatric population. In patients with cyanotic congenital heart disease (CCHD), abnormalities in coagulation parameters and platelet function are common. These abnormalities tend to be more pronounced in the perioperative period, particularly in subjects undergoing cardiopulmonary bypass (8-10). We designed the present study to investigate preoperative abnormalities in circulating ADAMTS-13 and VWF in children with CCHD and possible correlations with postoperative bleeding.

Statistical analysis The results are presented as the mean and standard deviation or median and range. Comparisons between groups were performed using the Student’s t-test, MannWhitney test, or Kruskal-Wallis test. The association between numeric variables was tested using linear regression and correlation. Logistic regression models were constructed to investigate possible predictors of postoperative bleeding. Once a variable was selected as a potential candidate based on univariate analysis, bivariate analysis was used to test for possible confounders. A confounder was defined as a second variable causing a significant reduction in the hazard ratio associated with the variable under investigation. Multivariate analysis was conducted by including all the variables with a p-value of ,0.10 in the univariate and bivariate analyses. A reduced multivariate model was developed using only the variables with a pvalue of ,0.10 in the first step of the multivariate analysis. In the final analyses, 0.05 was adopted as the significance level.

& METHODS Patients and general data recorded Pediatric patients with CCHD from the Department of Pediatric Cardiology and Adult Congenital Heart Disease, Heart Institute, Faculdade Medicina da Universidade de Sa˜o Paulo, Sa˜o Paulo, Brazil, were evaluated preoperatively on a hospital basis and consecutively included in the study (first operation or reoperation). Neonates, patients under intensive care, and patients undergoing emergency cardiac surgery were not included. Recorded parameters included demographics and general laboratory data, the principal diagnosis (as established by Doppler-echocardiography and, in some cases, angiography), the type of surgery, the need for cardiopulmonary bypass and its duration, and relevant postoperative events (e.g., infection, sepsis, bleeding, and death). Relevant postoperative bleeding was defined as 10 mL/Kg/hour during the first hour and 5 mL/Kg/hour after the first hour, requiring a blood transfusion. The study protocol was approved by the Scientific and Ethics Committee of the Heart Institute and the Hospital das Clinicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, CAPPESq #7106. Written informed consent was required for patient inclusion.

& RESULTS Demographics, diagnosis, and general laboratory data The study group consisted of 48 pediatric patients (24 males, aged 9 months to 7.6 years, median age 2.5 years, body weight 11.9¡3.7 Kg) with tetralogy of Fallot (N = 11), pulmonary atresia with a ventricular septal defect (N = 14), or a univentricular heart (N = 23). Patients exhibited decreased systemic oxygen saturation compared with the controls (median 80% (range: 53 to 91%) and median 98% (range: 95 to 99%), respectively, p,0.0001), increased hematocrit levels (47¡7 and 37¡3%, respectively, p,0.0001), increased hemoglobin levels (15.9¡2.3 and 12.7¡1.2 g/dL, respectively, p,0.0001), and normal platelet counts (313¡1146109 and 301¡566109 platelets/L, respectively, p = NS). Blood coagulation test results were within the normal range (activated partial thromboplastin time (APTT) normalized ratio of 1.11¡0.13 and prothrombin time international normalized ratio of 1.12¡0.11).

Biochemical determinations One day before the surgery, peripheral venous blood was collected in 1:10 volumes 3.2% sodium citrate for analysis of plasma VWF:Ag, VWF biological activity (VWF:CB), ADAMTS-13 antigenic concentration (ADAMTS-13:Ag), and ADAMTS-13 activity. Protease inhibitors were added to analyze the VWF multimeric composition (11). Plasma VWF:Ag and ADAMTS-13:Ag were determined using enzyme-linked immunosorbent assays (Diagnostica Stago, Asnie`res, France, and Technoclone, Vienna, Austria, respectively). The results were expressed as U/dL and mg/mL, respectively. Plasma VWF:CB was interpreted as the ability of VWF to bind to collagen (12). An in-house enzyme immunoassay was developed using a peroxidase-conjugated rabbit antihuman VWF polyclonal antibody (Dako Corporation, Carpinteria, CA, USA). The results were expressed as percent activity. The ADAMTS-13 activity was determined using a previously described collagen-binding assay (13). Briefly, diluted plasma samples were added to plate wells precoated with collagen (Vitrogen, Cohesion Corp., Palo Alto, CA, USA) with or without previous dialysis against 1.5 M urea. The binding of VWF to collagen was measured using a peroxidase-labeled rabbit antihuman VWF antibody (Dako Corporation). The ADAMTS-13 activity calculation compared the VWF binding after dialysis (residual) with the binding in the sample not subjected to

Specific laboratory determinations The preoperative VWF:Ag levels were decreased in the patients (Table 1) compared with the controls; the lowest levels were observed in subjects with pulmonary atresia, followed by those with tetralogy of Fallot and a univentricular heart (69, 73, and 85 U/dL, respectively, p = 0.0072). A proteolytic pattern of VWF protein (multimers) was observed (Table 1 and Figure 1), which was associated with decreased VWF:CB and decreased ADAMTS-13 (both antigen and activity, which was likely due to enzyme consumption) (Table 1). The lowest levels of VWF:CB were observed in subjects with the lowest levels of ADAMTS-13 activity (r = 0.60, p,0.0001, Figure 2). The ratio of VWF:Ag/

532


CLINICS 2013;68(4):531-536

ADAMTS-13 in Congenital Heart Disease Soares RP et al.

Table 1 - Preoperative plasma von Willebrand factor and ADAMTS-13.

VWF:Ag (U/dL) VWF:CB (%) ADAMTS-13:Ag (mg/mL) ADAMTS-13 activity (%) VWF:Ag/ADAMTS-13 activity VWF multimers

Patients

Controls

p-value

73 (51-159) 48¡21 0.91¡0.29 65¡24 1.17 (0.62-4.84) 0.44 (0.11-0.56)

113 (105-129) 63¡9 1.11¡0.09 91¡24 1.13 (1.1-1.69) 0.36 (0.25-0.55)

,0.0001 0.0004 0.0002 0.0029 0.7427 0.0081

ADAMTS-13:Ag, plasma ADAMTS-13 antigenic concentration; VWF:Ag, plasma von Willebrand factor antigenic concentration; VWF:Ag/ADAMTS-13 activity, ratio of von Willebrand factor antigenic concentration to ADAMTS-13 activity; VWF:CB, plasma von Willebrand factor activity expressed as collagen-binding capacity; VWF multimers, ratio of low-molecular-weight multimer density to total multimer density of von Willebrand factor.

ADAMTS-13 activity did not change because both values were reduced. Except for VWF:Ag, no differences were detected between the diagnostic groups. The only association with general laboratory parameters was a positive correlation between the ADAMTS-13:Ag and the systemic oxygen saturation (r = 0.44, p = 0.002).

postoperative bleeding, as previously defined, occurred in 13 patients. Systemic infection or sepsis did not occur in any of the patients.

Predictors of postoperative bleeding Preoperative clinical and laboratory parameters, including VWF and ADAMTS-13 determinations, were tested for possible relationships with postoperative bleeding. Of the specific biochemical markers, low ADAMTS-13 activity was the only parameter exhibiting a significant association in the univariate analysis. An activity of ,64.6% (mean (default) level in the patient group) was associated with a hazard ratio of 11.33 (95% CI 1.33 to 96.81). The bivariate analysis results presented in Table 2 showed that the only potential confounder was VWF:Ag. However, a specific association of VWF:Ag with bleeding could not be demonstrated (univariate and bivariate analyses). Of the other clinical and laboratory parameters, preoperative APTT and cardiopulmonary bypass were also associated with postoperative bleeding, with p,0.05 in the univariate analysis (Table 2, variables tested individually). According to previously established criteria, eight variables were tested using multivariate analysis (Table 2). The final reduced multivariate model included three predictors

Surgery and immediate outcomes The patients were subjected to total repair of tetralogy of Fallot (N = 11) or pulmonary atresia (N = 7), Glenn- (N = 14) or Fontan-type (N = 9) cavopulmonary connection, modified Blalock-Taussig anastomosis (N = 6), or pulmonary artery banding (N = 1). Cardiopulmonary bypass was required in 31 instances (duration of 38 to 250 minutes). Three immediate postoperative deaths associated with low cardiac output and circulatory collapse occurred. Significant

Figure 1 - Western immunoblotting of the plasma von Willebrand factor multimeric structure. Compared with the controls, children with cyanotic congenital heart diseases exhibited decreased densities of high-molecular-weight (HMW) multimers and increased concentrations of low-molecularweight (LMW) fractions (5 bands migrating above the IgM position, 950 kDa), which indicates abnormal proteolytic degradation. This pattern was observed in 36 of the 48 patients (p = 0.0081, densitometric analysis shown in Table 1).

Figure 2 - Correlation of von Willebrand factor biological activity (VWF:CB) with ADAMTS-13 activity in children with cyanotic congenital heart disease. The dashed lines correspond to mean values in the controls. The lowest levels of ADAMTS-13 activity correlated with the lowest levels of VWF:CB, which indicates the involvement of enzyme consumption in the degradation of biologically active (high-molecular-weight) von Willebrand factor multimers.

533


ADAMTS-13 in Congenital Heart Disease Soares RP et al.

CLINICS 2013;68(4):531-536

Table 2 - Bivariate analysis of preoperative ADAMTS-13 activity as a predictor of postoperative bleeding.

Unadjusted (univariate analysis) Adjusted (bivariate analysis) Patient age Body weight Type of anomaly Oxygen saturation Hemoglobin Platelet count Leukocyte count PT (INR) APTT VWF:Ag VWF:CB VWF multimers ADAMTS-13:Ag VWF:Ag/ADAMTS-13 activity CBP CPB time Reoperation ({)

95% CI for the hazard ratio

ADAMTS-13 Activity

Number of patients

Hazard ratio (*)

Lower

Upper

48

11.33

1.33

96.81

0.0265

48 48 48 48 48 48 48 48 48 48 48 48 48 48 48 31 48

12.38 12.77 12.08 11.90 15.27 14.85 18.72 11.64 10.06 7.73 9.96 11.41 15.58 13.85 13.15 11.84 12.73

1.38 1.44 1.38 1.38 1.58 1.59 1.88 1.32 1.11 0.85 1.08 1.31 1.63 1.50 1.44 1.23 1.44

111.14 113.63 105.96 102.82 147.35 138.77 186.79 102.27 91.25 70.63 91.68 99.43 148.90 128.16 119.86 114.40 112.64

0.0246 0.0223 0.0245 0.0244 0.0184 0.0180 0.0126 0.0269 0.0402 0.0701 0.0424 0.0275 0.0171 0.0206 0.0223 0.0326 0.0222

p-value

Second variable In the model p-value

Singly p-value ({)

0.0616 0.0717 0.6762 0.4810 0.2017 0.0627 0.0342 0.0895 0.0526 0.3115 0.6873 0.3280 0.0814 0.5048 0.0289 0.3727 0.0963

0.0587 0.0818 0.9195 0.6124 0.5086 0.0963 0.0588 0.0745 0.0228 0.0748 0.1818 0.3000 0.1733 0.8113 0.0346 0.2658 0.1231

({) ({)

({) ({) ({) ({)

({)

ADAMTS-13:Ag, plasma ADAMTS-13 antigenic concentration; APTT, activated partial thromboplastin time expressed as a normalized ratio; CPB, cardiopulmonary bypass; PT, prothrombin time expressed as the international normalized ratio (INR); VWF:Ag, plasma von Willebrand factor antigenic concentration; VWF:Ag/ADAMTS-13 activity, ratio of von Willebrand factor antigenic concentration to ADAMTS-13 activity; VWF:CB, plasma von Willebrand factor activity expressed as collagen-binding capacity; VWF multimers, ratio of low-molecular-weight multimer density to total multimer density of von Willebrand factor (*) Associated with a preoperative ADAMTS-13 activity below the default (mean) level of 64.6%. ({) Existing cardiac surgery prior to the current surgery. ({) All variables with a p-value of ,0.10 are indicated on the right in both univariate and bivariate analyses; these variables were tested using the multivariate model.

of postoperative bleeding, including low preoperative ADAMTS-13 activity (hazard ratio of 22.35 in the final model, 95% CI 1.69 to 294.79), preoperative APTT (hazard ratio associated with an increase of 0.01 in the normalized ratio of 1.096, 95% CI 1.016 to 1.183), and the need for cardiopulmonary bypass (hazard ratio 37.43, 95% CI 1.79 to 782.73). There were no significant associations among the three variables. Significant postoperative bleeding occurred in 40% of the patients with low preoperative ADAMTS-13 activity (versus 6% in the subjects with an ADAMTS-13 activity above the mean/default level, p,0.02), 39% of the patients undergoing ON-pump surgery (versus 6% of the patients who were operated on OFF-pump, p,0.02), and 55% of the patients with both risk factors (versus 7% of the patients with one or no risk factors, p,0.002). The proposed model was used to estimate the likelihood of bleeding: P~

EXPð{16:67z3:62x1 z3:11x2 z9:15x3 Þ 1zEXPð{16:67z3:62x1 z3:11x2 z9:15x3 Þ

& DISCUSSION The response of endothelial cells to injury involves the release of numerous substances, including VWF. Increased circulating levels of VWF are observed, particularly in acute disorders (5,6), and VWF is considered to be an acute-phase reactant. Several stimuli and conditions have been shown to induce the release of VWF from endothelial Weibel-Palade bodies, including hypoxia, epinephrine, thrombin, fibrin, cytokines, endotoxin, components of the complement system, and reactive oxygen intermediates (14-18). ADAMTS-13 activity should theoretically increase in response to the evaluation of plasma VWF, but in practice, the enzyme activity varies considerably (19). In conditions associated with a marked elevation of plasma VWF:Ag (for example, generalized systemic inflammation), the ADAMTS-13 activity decreases. The decreased activity is likely due to consumption of the enzyme, which is associated with an increase in the VWF:Ag/ADAMTS-13 activity ratio and is a risk factor for complications. In these instances (enzyme depletion), extra-large VWF multimers are detected in circulation (6), which may be associated with a generalized tendency toward thrombosis and coagulopathy. Overt endothelial cell activation was not likely in our relatively stable patients with chronic CCHD, and the plasma VWF:Ag ratio was not elevated. However, an ongoing process of abnormal VWF proteolytic degradation may have been associated with the increased density of lowmolecular-weight VWF species (multimeric analysis) and decreased VWF antigen and activity. Decreased ADAMTS13 activity could be explained by consumption, although

where:

P = probability of postoperative bleeding x1 = 0 or 1 for the absence or presence, respectively, of cardiopulmonary bypass x2 = 0 or 1 for the absence or presence, respectively, of ADAMTS-13 activity ,64.6% x3 = activated partial thromboplastin time (normalized ratio) In the three patients who died postoperatively, the preoperative biochemical parameters were within the range of those in the remaining patients, and the structure of the VWF protein was similar to the structure shown in Figure 1.

534


CLINICS 2013;68(4):531-536

ADAMTS-13 in Congenital Heart Disease Soares RP et al.

altered enzyme synthesis and/or abnormal degradation cannot be excluded. ADAMTS-13:Ag values correlated directly with systemic oxygen saturation in the study. The hypothesis that chronic proteolysis of VWF accounts for ADAMTS-13 consumption in children with CCHD is plausible because altered flow conditions (present in nearly all of the included anomalies) have been shown to facilitate the binding of VWF to platelet membrane glycoproteins (particularly glycoprotein Ib), followed by enzymatic degradation (20,21). This mechanism has been proposed to explain the abnormalities in circulating VWF observed in patients with aortic stenosis associated with an increased risk of postoperative bleeding (22,23). We speculate that in children with CCHD, abnormal interactions of VWF with membranes may occur at sites of altered flow conditions (for example, either normal or surgically created systemic-topulmonary connections). The lowest VWF:Ag levels in the study were observed in the pulmonary atresia subgroup, in which such connections are generally present. Thus, the link between decreased preoperative ADAMTS-13 activity and postoperative bleeding likely resulted from an ongoing process of pathological VWF cleavage with loss of the largest (high-molecular-weight) multimers, which are the most active multimers in promoting platelet adhesion and aggregation. ADAMTS-13 consumption was suggested by the association of low ADAMTS-13 activity with low VWF biological activity (Table 1 and Figure 2) in the presence of defective VWF multimeric structures (Figure 1). For extralarge VWF multimers to be observed in plasma (not the case in this study), a more dramatic reduction of the ADAMTS13 activity would likely be necessary (6). The lack of a direct correlation between VWF multimeric abnormalities and postoperative bleeding in our patients is not surprising. Other authors have suggested that the ADAMTS-13 activity and the VWF antigen level are more useful for diagnosing complications than analyzing the VWF multimer alone (6). After a careful analysis of factors potentially associated with postoperative bleeding, we identified three apparently independent predictors: ADAMTS-13 activity, APTT, and the need for cardiopulmonary bypass. We did not evaluate other abnormalities in coagulation factors and platelet function that may be involved in cardiopulmonary bypass with postoperative bleeding, which may be a limitation of the study. ADAMTS-13 cleaves VWF physiologically, but other enzymes are also involved under pathological conditions. Several enzymes promote VWF proteolysis, including elastase and plasmin (24,25). The activity of these enzymes may be enhanced following cardiopulmonary bypass. Further complementary studies are required to evaluate other enzymes. In conclusion, we demonstrated that preoperative abnormalities in circulating VWF and ADAMTS-13 may be associated with an increased risk of postoperative bleeding in children with CCHD. Low preoperative ADAMTS-13 activity (e.g., below the mean level for the group) appears to be predictive of significant bleeding. Preoperative APTT and the need for cardiopulmonary bypass were also identified as risk factors. To our knowledge, this is the first study to reveal an association between the activity of the VWF-cleaving protease and the risk of bleeding in patients with CCHD undergoing surgery. Further studies are required to provide a better understanding of the complex nature of perioperative coagulation abnormalities.

& ACKNOWLEDGMENTS This work was supported by the Foundation for Research Support of the State of SaËœo Paulo (FAPESP, grant # 0559890-9), SaËœo Paulo, Brazil, and was performed on a strictly academic basis.

& AUTHOR CONTRIBUTIONS Soares RP was responsible for the initial intellectual issues, construction of the study protocol, work plan, grant submission, data collection and analysis, blood sampling, laboratory routine, and preparation, review and approval of the manuscript final version. Bydlowski SP was responsible for the initial intellectual issues, construction of the study protocol, work plan, review and approval of the manuscript final version. Jatene MB was responsible for the initial intellectual issues, general patient care, review and approval of the manuscript final verion. Hironaka JF was responsible for the general patient care, data collection, blood sampling and laboratory routine, review and approval of the manuscript final version. Lopes AA is the corresponding author who was responsible for the initial intellectual issues, construction of the study protocol, work plan, grant submission, data analysis, and preparation, review, approval and submission of the manuscript final version.

& REFERENCES 1. Uemura M, Tatsumi K, Matsumoto M, Fujimoto M, Matsuyama T, Ishikawa M, et al. Localization of ADAMTS-13 to the stellate cells of human liver. Blood. 2005;106(3):922-4, http://dx.doi.org/10.1182/blood2005-01-0152. 2. Tsai HM. Von Willebrand factor, ADAMTS-13, and thrombotic thrombocytopenic purpura. J Mol Med. 2002;80(10):639-47, http://dx.doi.org/ 10.1007/s00109-002-0369-8. 3. Crawley JTB, Lane DA, Woodward M, Rumley A, Lowe GDO. Evidence that high von Willebrand factor and low ADAMTS-13 levels independently increase the risk of a non-fatal heart attack. J Thromb Haemost. 2008;6(4):583-8, http://dx.doi.org/10.1111/j.1538-7836.2008.02902.x. 4. Bongers TN, de Bruijne EL, Dippel DW, de Jong AJ, Deckers JW, Poldermans D, et al. Lower levels of ADAMTS-13 are associated with cardiovascular disease in young patients. Atherosclerosis. 2009;207(1):250-4, http://dx.doi.org/10.1016/j.atherosclerosis.2009.04.013. 5. Hyun J, Kim HK, Kim JE, Lim MG, Jung JS, Park S, et al. Correlation between plasma activity of ADAMTS-13 and coagulopathy, and prognosis in disseminated intravascular coagulation. Thromb Res. 2009;124(1):75-9, http://dx.doi.org/10.1016/j.thromres.2008.11.020. 6. Claus RA, Bockmeyer CL, Budde U, Kentouche K, Sossdorf M, Hilberg T, et al. Variations in the ratio between von Willebrand factor and its cleaving protease during systemic inflammation and association with severity and prognosis of organ failure. Thromb Haemost. 2009;101(2):239-47. 7. Mannucci PM, Parolari A, Canciani MT, Alemanni F, Camera M. Opposite changes of ADAMTS-13 and von Willebrand factor after cardiac surgery. J Thromb Haemost. 2005;3(2):397-9, http://dx.doi.org/ 10.1111/j.1538-7836.2005.01115.x. 8. Zonis Z, Seear M, Reichert C, Sett S, Allen C. The effect of preoperative tranexamic acid on blood loss after cardiac operations in children. J Thorac Cardiovasc Surg. 1996;111(5):982-7, http://dx.doi.org/10.1016/ S0022-5223(96)70374-4. 9. Levin E, Wu J, Devine DV, Alexander J, Reichart C, Sett S, et al. Hemostatic parameters and platelet activation marker expression in cyanotic and acyanotic pediatric patients undergoing cardiac surgery in the presence of tranexamic acid. Thromb Haemost. 2000;83(1):54-9. 10. Lill MC, Perloff JK, Child JS. Pathogenesis of thrombocytopenia in cyanotic congenital heart disease. Am J Cardiol. 2006;98(2):254-8, http:// dx.doi.org/10.1016/j.amjcard.2006.01.083. 11. Lopes AA, Soares RP, Maeda NY. A mathematical framework for group analysis of von Willebrand factor multimeric composition following luminography. Braz J Med Biol Res. 2002;35(11):1259-63, http://dx.doi. org/10.1590/S0100-879X2002001100002. 12. Siekmann J, Turecek PL, Schwarz HP. The determination of von Willebrand factor activity by collagen binding assay. Haemophilia. 1998;4 Suppl 3:1524, http://dx.doi.org/10.1046/j.1365-2516.1998.0040s3015.x. 13. Rick ME, Moll S, Taylor MA, Krizek DM, White GC 2nd, Aronson DL. Clinical use of a rapid collagen binding assay for von Willebrand factor cleaving protease in patients with thrombotic thrombocytopenic purpura. Thromb Haemost. 2002;88(4):598-604. 14. Pinsky DJ, Naka Y, Liao H, Oz MC, Wagner DD, Mayadas TN, et al. Hypoxia-induced exocytosis of endothelial cell Weibel-Palade bodies. A mechanism for rapid neutrophil recruitment after cardiac preservation. J Clin Invest. 1996;97(2):493-500, http://dx.doi.org/10.1172/ JCI118440.

535


ADAMTS-13 in Congenital Heart Disease Soares RP et al.

CLINICS 2013;68(4):531-536

20. Siedlecki CA, Lestini BJ, Kottke-Marchant KK, Eppell SJ, Wilson DL, Marchant RE. Shear-dependent changes in the three-dimensional structure of human von Willebrand factor. Blood. 1996;88(8):2939-50. 21. Goto S, Salomon DR, Ikeda Y, Ruggeri ZM. Characterization of the unique mechanism mediating the shear-dependent binding of soluble von Willebrand factor to platelets. J Biol Chem. 1995;270(40):23352-61. 22. Panzer S, Badr Eslam R, Schneller A, Kaider A, Koren D, Eichelberger B, et al. Loss of high-molecular-weight von Willebrand factor multimers mainly affects platelet aggregation in patients with aortic stenosis. Thromb Haemost. 2010;103(2):408-14. 23. Pareti FI, Lattuada A, Bressi C, Zanobini M, Sala A, Steffan A, et al. Proteolysis of von Willebrand factor and shear stress-induced platelet aggregation in patients with aortic valve stenosis. Circulation. 2000;102(11):1290-5, http://dx.doi.org/10.1161/01.CIR.102.11.1290. 24. Federici AB, Berkowitz SD, Lattuada A, Mannucci PM. Degradation of von Willebrand factor in patients with acquired clinical conditions in which there is heightened proteolysis. Blood. 1993;81(3):720-5. 25. Federici AB, Berkowitz SD, Zimmerman TS, Mannucci PM. Proteolysis of von Willebrand factor after thrombolytic therapy in patients with acute myocardial infarction. Blood. 1992;79(1):38-44.

15. Zavoico GB, Ewenstein BM, Schafer AI, Pober JS. IL-1 and related cytokines enhance thrombin-stimulated PGI2 production in cultured endothelial cells without affecting thrombin-stimulated von Willebrand factor secretion or platelet-activating factor biosynthesis. J Immunol. 1989;142(11):3993-9. 16. Ribes JA, Francis CW, Wagner DD. Fibrin induces release of von Willebrand factor from endothelial cells. J Clin Invest. 1987;79(1):117-23, http://dx.doi.org/10.1172/JCI112771. 17. Schorer AE, Moldow CF, Rick ME. Interleukin 1 or endotoxin increases the release of von Willebrand factor from human endothelial cells. Br J Haematol. 1987;67(2):193-7, http://dx.doi.org/10.1111/j.1365-2141. 1987.tb02326.x. 18. Hattori R, Hamilton KK, McEver RP, Sims PJ. Complement C5b-9 stimulates von Willebrand factor secretion from human endothelium. Circulation. 1988;78:II-117. 19. Molvarec A, Rigo´ J Jr, Bo˜ze T, Derzsy Z, Cervenak L, Mako´ V, et al. Increased plasma von Willebrand factor antigen levels but normal von Willebrand factor cleaving protease (ADAMTS-13) activity in preeclampsia. Thromb Haemost. 2009;101(2):305-11.

536


CLINICAL SCIENCE

Predictors of walking capacity in peripheral arterial disease patients Breno Quintella Farah,I Joa˜o Paulo dos Anjos Souza Barbosa,II Gabriel Grizzo Cucato,II Marcel da Rocha Chehuen,II Luis Alberto Gobbo,III Nelson Wolosker,IV Cla´udia Lu´cia de Moraes Forjaz,II Raphael Mendes Ritti-DiasI I

University of Pernambuco, School of Physical Education, Pernambuco/PE, Brazil. II University of Sa˜o Paulo, School of Physical Education and Sport, Exercise Hemodynamic Laboratory, Sa˜o Paulo/SP, Brazil. III University of Sa˜o Paulo, Faculty of Public Health, Sa˜o Paulo/SP, Brazil. IV University of Sa˜o Paulo, Faculty of Medicine, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: To estimate walking capacity in intermittent claudication patients through a prediction model based on clinical characteristics and the walking impairment questionnaire. METHODS: The sample included 133 intermittent claudication patients of both genders aged between 30 and 80 years. Data regarding clinical characteristics, the walking impairment questionnaire and treadmill walking test performance were obtained. Multiple regression modeling was conducted to predict claudication onset distance and total walking distance using clinical characteristics (age, height, mass, body mass index, ankle brachial index lower, gender, history of smoking and co-morbid conditions) and walking impairment questionnaire responses. Comparisons of claudication onset distance and total walking distance measured during treadmill tests and estimated by a regression equation were performed using paired t-tests. RESULTS: Co-morbid conditions (diabetes and coronary artery disease) and questions related to difficulty in walking short distances (walking indoors – such as around your house and walking 5 blocks) and at low speed (walking 1 block at average speed – usual pace) resulted in the development of new prediction models high significant for claudication onset distance and total walking distance (p,0.001). In addition, non-significant differences from the results obtained by the treadmill test and estimated by the current model (p.0.05) were observed. CONCLUSION: The current study demonstrated that walking capacity can be adequately estimated based on comorbid conditions and responses to the walking impairment questionnaire. KEYWORDS: Intermittent Claudication; Peripheral Arterial Disease; Walking Prediction; Comorbidities. Farah BQ, Souza-Barbosa JP, Cucato GG, Chehuen MR, Gobbo LA, Wolosker N, et al. Predictors of walking capacity in peripheral arterial disease patients. Clinics. 2013;68(4):537-541. Received for publication on December 7, 2012; First review completed on December 20, 2012; Accepted for publication on December 28, 2012 E-mail: raphaelritti@gmail.com Tel.: 55 81 3183-3379

Walking capacity in intermittent claudication patients has been assessed in research settings with the standardized treadmill test, which provides the claudication onset distance and total walking distance (6). On the other hand, in clinical settings, the treadmill test is not feasible (7), and other tools to predict walking capacity have been used. Previous studies have proposed specific equations to predict walking capacity in intermittent claudication patients. Gardner et al. (8), validated an equation to predict walking capacity based on ankle-brachial index, body mass index and current smoking status. Recently, Leitch et al. (9), predicted walking capacity with better accuracy using general questions regarding quality of life in the equation. The walking impairment questionnaire is a specific questionnaire for patients with intermittent claudication which has been used as an alternative tool to assess walking capacity (10,11). Previous studies have shown that the walking impairment questionnaire is more strongly correlated with

& INTRODUCTION Peripheral artery disease affects lower extremity arteries and reduces oxygen supply to peripheral tissues (1). Intermittent claudication, the most prevalent symptom of peripheral artery disease, leads to reduced walking capacity, which has been associated with all-cause and cardiovascular mortality (2,3), mobility loss (4) and lower extremity strength (5).

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)16

537


Predictors of walking capacity in PAD Farah BQ et al.

CLINICS 2013;68(4):537-541

walking capacity than the quality of life questionnaire (12,13). However, whether the walking impairment questionnaire accurately predicts claudication onset distance and total walking distance has not been not previously described. Our hypothesis is that clinical status and walking impairment questionnaire responses are significant predictors of walking capacity. Therefore, the aim of this study was to estimate the walking capacity in intermittent claudication patients through a prediction model based on clinical characteristics and the walking impairment questionnaire.

speeds: slowly, average speed, quickly and jogging or running. Stair use ability is assessed by the difficulty of climbing up one, two or three flights of stair. We analyzed the reliability of each question after seven days in a subsample of 25 patients, and the interclass correlation coefficient ranged from 0.76 to 0.98.

Statistical Analysis Data were analyzed using the Statistical Package for the Social Sciences (SPSS version 10, SPSS Inc., Chicago, Illinois, USA). Normality was verified by the Kolgomorov-Sminorv test. Multiple regression modeling was conducted to predict claudication onset distance and total walking distance from the independent variables: age, height, mass, body mass index, the ankle-brachial index of the lower extremities, gender (male = 1, female = 0), smoking history (yes = 1, no = 0), co-morbid conditions (hypertension, diabetes, dyslipidemia and coronary artery disease; yes = 1, no = 0) and walking impairment questionnaire responses (0 to 4). The claudication onset distance and total walking distance measured during the treadmill test were compared to the estimated values of claudication onset distance and total walking distance obtained by the regression model using paired t-tests. The accuracy of the regression model was further examined by the absolute error [(absolute difference between predicted and actual value)/actual value x 100] and the proportion of predicted values within 10%, 10-25% and .25% of the treadmill result (16). The significance level was set at p,0.05 for all analyses.

& MATERIAL AND METHODS Patients Four hundred forty consecutive patients were recruited at a tertiary care center that specializes in vascular disease. Patients with peripheral artery disease and claudication symptoms were included in this study if they had an anklebrachial index #0.90 at rest, no pain at rest, and no evidence of mental disability identified by the Mini-Mental State Examination Questionnaire (14) and were willing to volunteer to participate in the study. A total of 133 intermittent claudication patients were deemed eligible for the study.

Assessments Demographic information, height, weight, smoking history and comorbid conditions (hypertension, dyslipidemia, diabetes and coronary artery disease) were obtained through medical history and physical examination. Ankle and arm blood pressures were assessed, and the anklebrachial index was calculated by the quotient of ankle systolic blood pressure over brachial systolic blood pressure (15).

Ethics The procedures used in this study were approved by the Institutional Review Board of the University of Pernambuco and by the Institutional Review Board of the Hospital of Clinics of University of Saหœo Paulo. Written informed consent was obtained from each patient prior to investigation.

Walking capacity on treadmill The patients performed a graded maximal treadmill test (model 2200.1 Trimline; Hebb Industries Inc., Whitehouse, Texas) using a specific protocol for patients with IC as previously described (6). Briefly, the treadmill speed was maintained at 2.0 mph, and the treadmill grade was increased 2% every 2 minutes until the patients could no longer continue because of claudication symptoms. The claudication onset distance and the total walking distance were defined, respectively, as the distance walked when the patient first reported pain in the leg and the distance at which the patient was unable to continue to exercise due to leg pain.

& RESULTS The characteristics of the sample are shown in Table 1. Most of the patients were male (64.7%) and non-obese. The prevalence of co-morbid conditions ranged from 38.6% (diabetes) to 76.7% (hypertension). Table 2 displays the responses for each question of the walking impairment questionnaire: 27.9% of patients reported being unable to walk 5 blocks, 85.7% reported that they are not able to jog or run, and 20.3% reported that they are not able to climb three flights of stairs.

Walking Impairment Questionnaire

Table 1 - General characteristics of intermittent claudication patients (n = 133).

The walking impairment questionnaire is composed of 14 items distributed in 4 domains, one including general information and three regarding walking capacity (distance, speed and using stairs). Each item is ranked from 0 to 4 on a Likert scale, in which 0 represents unable to perform and 4 represents no difficulty. These data were obtained through personal interviews. The Brazilian Portuguese version of the walking impairment questionnaire has previously been validated (11). The distances that are assessed by the walking impairment questionnaire range from walking indoors around the home to walking 5 blocks outside. The speeds are assessed as the difficulty of walking 1 block at each of the following

Variables Age (years) Body mass index (kg.m-2) Ankle-brachial index Gender (% men) Smoking history (% yes) Hypertension (% yes) Dyslipidemia (% yes) Diabetes (% yes) Coronary artery disease (% yes)

Values 63.2ยก8.8 26.4ยก4.6 0.59ยก0.15 64.7 84.2 76.7 70.7 38.3 56.4

Values are presented in mean ยก standard-deviation or frequency.

538


CLINICS 2013;68(4):537-541

Predictors of walking capacity in PAD Farah BQ et al.

Table 2 - Frequency of responses on the Walking Impairment Questionnaire in intermittent claudication patients. Degree of Difficulty

Questions

Distance Q1. Walk indoors (such as around your house) Q2. Walk 5 meters Q3. Walk 45 meters Q4. Walk 90 meters Q5. Walk 180 meters Q6. Walk 270 meters Q7. Walk 450 meters Speed Q8. Walk 1 block slowly (slower than usual) Q9. Walk 1 block at average speed (usual pace) Q10. Walk 1 block quickly (faster than usual) Q11. Jog or run 1 block Stairs Q12. Walk up one flights of stairs Q13. Walk up two flights of stairs Q14. Walk up three flights of stairs

No (%)

Slight (%)

Some (%)

Much (%)

Unable (%)

62.4 71.3 35.3 22.6 16.5 9.8 6.0

16.5 12.8 21.1 15.8 7.5 10.5 4.5

14.3 9.8 21.8 18.0 18.1 10.5 12.0

6.0 5.3 19.5 36.8 45.1 53.4 49.6

0.8 0.8 2.3 6.8 12.8 15.8 27.9

38.4 11.3 4.5 1.5

36.8 32.3 7.5 1.5

13.5 16.5 11.3 1.5

10.5 33.1 40.6 9.8

0.8 6.8 36.1 85.7

38.3 23.3 12.0

24.8 12.0 12.0

9.8 18.8 11.3

25.6 37.6 44.4

1.5 8.3 20.3

Regression analyses indicated that Q1 (walking indoors – such as around your house), Q4 (walking 1 block) and Q9 (walking 1 block at average speed – usual pace) of the walking impairment questionnaire, as well as diabetes and coronary artery disease, were independent predictors of claudication onset distance and total walking distance (Table 3). Prediction models resulted in moderate correlation coefficients (claudication onset distance: r = 0.52; total walking distance: r = 0.58) and non-significant differences from the results obtained in treadmill test (Estimated by current model: claudication onset distance 2 175¡81 m and total walking distance 2 408¡173 m; Measured by the treadmill test: claudication onset distance 2 175¡155 m and total walking distance 2 408¡295 m; p.0.05). In addition, absolute errors less than 25% were found for claudication onset distance (21%) and total walking distance (32%) (Figure 1).

attributed to respiratory, metabolic and vascular dysfunction (21,22). In addition, diabetes has been associated with endothelial dysfunction and increased oxidative stress, proinflammatory status and mitochondrial dysfunction (23). Coronary artery disease patients also have endothelial dysfunction and experience reduced cardiorespiratory fitness compared to non-coronary artery disease patients (21). Although the walking impairment questionnaire has been widely used to assess walking impairment in intermittent claudication patients (13,24,25), whether this questionnaire is able to predict walking capacity has not been previously analyzed. The results of the present study indicate that the walking impairment questionnaire predicts walking capacity in intermittent claudication patients. Questions related to difficulty in walking short distances and walking at low speeds were significantly correlated to claudication onset distance and total walking distance. Thus, it seems that the best questions to predict walking capacity are those indicative of major limitations of the patient. Interestingly, in the present study, walking impairment questionnaire questions regarding climbing stairs were not predictors of walking capacity in peripheral artery disease patients. Previous studies have observed that the climbing stairs domain of the walking impairment questionnaire was correlated with walking capacity (11-13). However, these studies were performed using bivariate analysis, which does not control for the relationships between the climbing stairs domain and walking capacity to potential confounders, such as clinical characteristics or other walking impairment questionnaire domains. Poor walking capacity has been associated with increased risk for all-cause and cardiovascular mortality (2,3), mobility

& DISCUSSION The current study demonstrated that walking capacity may be adequately estimated based on co-morbid conditions and walking impairment questionnaire questions. Inclusion of comorbid conditions, such as diabetes and coronary artery disease, as well as questions related to difficulty in walking short distances and at low speeds resulted in the development of new prediction models for walking capacity that are more accurate than previously published models for patients with intermittent claudication (8,9). In the present study, diabetes and coronary artery disease were independent predictors of walking capacity. Previous studies have shown that diabetes and coronary artery disease are related to walking impairment in intermittent claudication patients (17-20), which has previously been

Table 3 - Prediction model for claudication distance and total walking distance in intermittent claudication patients. Variables

Prediction model

r (r2)

SEE

CD (m) TWD (m)

= 221.535 + (Q4625.351) + (Q1631.484) + (Q9627.146) - (diabetes presence x 47.909)a = 109.251 + (Q4678.825) + (Q1669.756) - (diabetes presence x 116.255) - (coronary artery disease presence x 98.725)b

0.52 (0.27) 0.58 (0.34)

134 242

CD – claudication distance; TWD – total walking distance; a F4 = 16.66, p,0.001; b F4 = 12.07, p,0.001; r - multiple correlation coefficient, r2 - variance; SEE standard estimate of the error; Q – question of Walking Impairment Questionnaire.

539


Predictors of walking capacity in PAD Farah BQ et al.

CLINICS 2013;68(4):537-541

Figure 1 - Distribution of absolute error of the current prediction model for estimating claudication distance (Panel A) and total walking distance (Panel B).

loss (4) and reduced strength in the lower extremities (5). Thus, the assessment of walking capacity is clinically relevant. The results of this study showed that walking capacity is adequately estimated based on clinical characteristics and walking impairment questionnaire questions; this is useful for clinicians to quantify the walking capacity of intermittent claudication patients easily. The present study has some limitations. Walking capacity was assessed in the graded treadmill test. Therefore, other ways of assessing walking capacity (e.g., the 6-minute test) cannot be predicted using the regression models proposed in this study. The equations for predicting the claudication onset distance and total walking distance were not crossvalidated in an independent group of similar peripheral arterial disease patients. This study included only peripheral artery disease patients with claudication symptoms, and the predictive models cannot be extrapolated for patients with peripheral arterial disease in other stages. In conclusion, the model based on walking impairment questionnaire and co-morbid conditions adequately predicted the walking capacity in intermittent claudication patients. This information is useful for clinicians to easily quantify the walking capacity of intermittent claudication patients.

2.

3.

4.

5.

6.

7.

8.

& ACKNOWLEDGMENTS This study was founded by grants of ‘‘Coordenac¸a˜o de Aperfeic¸oamento de Pessoal de Nı´vel Superior (CAPES)’’ and research scholarship (RMR and CLF) from Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq).

9.

10.

& AUTHOR CONTRIBUTIONS Farah BQ conceptualized and designed the study, carried out the analyses, drafted the initial manuscript, and approved the manuscript final version for submission. Gobbo LA carried out the analyses and approved the manuscript final version for submission. Barbosa JP, Cucato GG and Chehuen MR performed the data collection, and approved the manuscript final version for submission. Wolosker N and Forjaz CL coordinated and supervised data collection, critical evaluation of the manuscript, and approved the manuscript final version for submission. Ritti-Dias RM conceptualized and designed the study, coordinated and supervised data collection, reviewed the manuscript, and approved the manuscript final version for submission.

11.

12.

13.

& REFERENCES 14.

1. Hirsch AT, Haskal ZJ, Hertzer NR, Bakal CW, Creager MA, Halperin JL, et al. ACC/AHA 2005 Practice Guidelines for the management of patients with peripheral arterial disease (lower extremity, renal, mesenteric, and abdominal aortic): a collaborative report from the American Association for Vascular Surgery/Society for Vascular

540

Surgery, Society for Cardiovascular Angiography and Interventions, Society for Vascular Medicine and Biology, Society of Interventional Radiology, and the ACC/AHA Task Force on Practice Guidelines (Writing Committee to Develop Guidelines for the Management of Patients With Peripheral Arterial Disease): endorsed by the American Association of Cardiovascular and Pulmonary Rehabilitation; National Heart, Lung, and Blood Institute; Society for Vascular Nursing; TransAtlantic Inter-Society Consensus; and Vascular Disease Foundation. Circulation. 2006;113:e463-654, http://dx.doi.org/10.1161/ CIRCULATIONAHA.106.174526. McDermott MM, Tian L, Liu K, Guralnik JM, Ferrucci L, Tan J, et al. Prognostic value of functional performance for mortality in patients with peripheral artery disease. J Am Coll Cardiol. 2008;51(15):1482-9, http:// dx.doi.org/10.1016/j.jacc.2007.12.034. Leeper NJ, Myers J, Zhou M, Nead KT, Syed A, Kojima Y, et al. Exercise capacity is the strongest predictor of mortality in patients with peripheral arterial disease. J Vasc Surg. 2012;57(3):728-33. McDermott MM, Guralnik JM, Tian L, Ferrucci L, Liu K, Liao Y, et al. Baseline functional performance predicts the rate of mobility loss in persons with peripheral arterial disease. J Am Coll Cardiol. 2007;50(10):974-82, http://dx.doi.org/10.1016/j.jacc.2007.05.030. Ayzin Rosoky RM, Wolosker N, Muraco-Netto B, Puech-Leao P. Ground reaction force pattern in limbs with intermittent claudication. Eur J Vasc Endovasc Surg. 2000;20(3):254-9, http://dx.doi.org/10.1053/ejvs.2000.1146. Gardner AW, Skinner JS, Cantwell BW, Smith LK. Progressive vs singlestage treadmill tests for evaluation of claudication. Med Sci Sports Exerc. 1991;23(4):402-8. Wolosker N, Ritti-Dias RM, Camara LC, Garcia YM, Jacob-Filho W, Puech-Leao P. Treadmill test is limited in elderly patients with peripheral arterial disease. Vasa. 2010;39(3):237-41, http://dx.doi.org/ 10.1024/0301-1526/a000035. Gardner AW, Ricci MA, Case TD, Pilcher DB. Practical equations to predict claudication pain distances from a graded treadmill test. Vasc Med. 1996;1(2):91-6. Leicht AS, Crowther RG, Muller R, Golledge J. The effects of including quality of life responses in models to predict walking performance of patients with intermittent claudication. Eur J Vasc Endovasc Surg. 2011;41(4):511-7, http://dx.doi.org/10.1016/j.ejvs.2010.12.018. Regensteiner JG, Steiner JF, Panzer J, WR H. Evaluation of walking impairment by questionnaire in patients with peripheral arterial disease. J Vasc Med Biol. 1990;2:142-52. Ritti-Dias RM, Gobbo LA, Cucato GG, Wolosker N, Jacob Filho W, Santarem JM, et al. Translation and validation of the walking impairment questionnaire in Brazilian subjects with intermittent claudication. Arq Bras Cardiol. 2009;92(2):136-49. Izquierdo-Porrera AM, Gardner AW, Bradham DD, Montgomery PS, Sorkin JD, Powell CC, et al. Relationship between objective measures of peripheral arterial disease severity to self-reported quality of life in older adults with intermittent claudication. J Vasc Surg. 2005;41(4):625-30, http://dx.doi.org/10.1016/j.jvs.2005.01.012. Myers SA, Johanning JM, Stergiou N, Lynch TG, Longo GM, Pipinos II. Claudication distances and the Walking Impairment Questionnaire best describe the ambulatory limitations in patients with symptomatic peripheral arterial disease. J Vasc Surg. 2008;47(3):550-5, http://dx.doi. org/10.1016/j.jvs.2007.10.052. Sheehan DV, Lecrubier Y, Sheehan KH, Amorim P, Janavs J, Weiller E, et al. The Mini-International Neuropsychiatric Interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10. J Clin Psychiatry. 1998;59 Suppl 20:22-33;quiz 34-57.


CLINICS 2013;68(4):537-541

Predictors of walking capacity in PAD Farah BQ et al. 21. Brevetti G, Piscione F, Cirillo P, Galasso G, Schiano V, Barbato E, et al. In concomitant coronary and peripheral arterial disease, inflammation of the affected limbs predicts coronary artery endothelial dysfunction. Atherosclerosis. 2008;201:440-6, http://dx.doi.org/10.1016/j.atherosclerosis. 2008.01.014. 22. Bruno RM, Penno G, Daniele G, Pucci L, Lucchesi D, Stea F, et al. Type 2 diabetes mellitus worsens arterial stiffness in hypertensive patients through endothelial dysfunction. Diabetologia. 2012;55:1847-55, http:// dx.doi.org/10.1007/s00125-012-2517-1. 23. Tabit CE, Chung WB, Hamburg NM, Vita JA. Endothelial dysfunction in diabetes mellitus: molecular mechanisms and clinical implications. Rev Endocr Metab Disord. 2010;11:61-74, http://dx.doi.org/10.1007/s11154010-9134-4. 24. Jain A, Liu K, Ferrucci L, Criqui MH, Tian L, Guralnik JM, et al. The Walking Impairment Questionnaire stair-climbing score predicts mortality in men and women with peripheral arterial disease. J Vasc Surg. 2012;55:1662-73 e2, http://dx.doi.org/10.1016/j.jvs.2011.12.010. 25. Gardner AW, Parker DE, Montgomery PS, Khurana A, Ritti-Dias RM, Blevins SM. Gender differences in daily ambulatory activity patterns in patients with intermittent claudication. J Vasc Surg. 2010;52:1204-10, http://dx.doi.org/10.1016/j.jvs.2010.05.115.

15. Wolosker N, Rosoky RA, Nakano L, Basyches M, Puech-Leao P. Predictive value of the ankle-brachial index in the evaluation of intermittent claudication. Rev Hosp Clin Fac Med Sao Paulo. 2000;55(2):61-4. 16. Leicht AS, Crowther RG. Pedometer accuracy during walking over different surfaces. Med Sci Sports Exerc. 2007;39(10):1847-50. 17. Anderson JD, Epstein FH, Meyer CH, Hagspiel KD, Wang H, Berr SS, et al. Multifactorial determinants of functional capacity in peripheral arterial disease: uncoupling of calf muscle perfusion and metabolism. J Am Coll Cardiol. 2009;54:628-35, http://dx.doi.org/10.1016/j.jacc.2009. 01.080. 18. Brevetti G, Giugliano G, Brevetti L, Hiatt WR. Inflammation in peripheral artery disease. Circulation. 2010;122:1862-75, http://dx.doi. org/10.1161/CIRCULATIONAHA.109.918417. 19. Brevetti G, Schiano V, Chiariello M. Endothelial dysfunction: a key to the pathophysiology and natural history of peripheral arterial disease? Atherosclerosis. 2008;197:1-11, http://dx.doi.org/10.1016/j.atherosclerosis. 2007.11.002. 20. Nasser M, Wolosker N, Uint L, Rosoky RA, Lobato M, Wajngarten M, et al. Relationship between soluble thrombomodulin in patients with intermittent claudication and critical ischemia. Thromb Res. 2006;117:271-7, http://dx.doi.org/10.1016/j.thromres.2005.03.010.

541


CLINICAL SCIENCE

The diagnostic significance of NT-proBNP and troponin I in emergency department patients presenting with palpitations ¨ mit Yas¸ar Tekeliog˘lu,III Serkan O ¨ ztu¨rk,II Suzi Selim Ayhan,II Mehmet Tarık Ocak,I Alim Erdem,II Arif Duran,I U ¨ zlu¨,II Mehmet Tosun,IV Hasan Koc¸og˘lu,III Mehmet YazıcıII Fatih O I

Abant Izzet Baysal University School of Medicine, Department of Emergency Medicine, Bolu, Turkey. II Abant Izzet Baysal University School of Medicine, Department of Cardiology, Bolu, Turkey. III Abant Izzet Baysal University School of Medicine, Department of Anesthesiology and Reanimation, Bolu, Turkey. IV Abant Izzet Baysal University School of Medicine, Department of Biochemistry, Bolu, Turkey.

OBJECTIVE: This prospective study investigated the diagnostic significance of the N-terminal pro-brain natriuretic (NT-proBNP) and troponin I peptides in emergency department patients presenting with palpitations. METHODS: Two groups of patients with palpitations but without documented supraventricular tachycardia were compared: a group with supraventricular tachycardia (n = 49) and a control group (n = 47). Both groups were diagnosed using electrophysiological studies during the study period. Blood samples were obtained from all of the patients to determine the NT-proBNP and troponin I levels within the first hour following arrival in the emergency department. RESULT: The mean NT-proBNP levels were 207.74¡197.11 in supraventricular tachyarrhythmia group and 39.99¡32.83 pg/mL in control group (p,0.001). To predict supraventricular tachycardia, the optimum NT-proBNP threshold was 61.15 pg/mL, as defined by the receiver operating characteristic (ROC) curve, with a non-significant area under the ROC curve of 0.920 (95% CI, 0.86-0.97, p,0.001). The NT-proBNP cut-off for diagnosing supraventricular tachycardia had 81.6% sensitivity and 91.5% specificity. Supraventricular tachycardia was significantly more frequent in the patients with NT-proBNP levels $61.15 pg/mL (n = 44, 90.9%, p.0.001). The mean troponin I levels were 0.17¡0.56 and 0.01¡0.06 pg/mL for the patients with and without supraventricular tachycardia, respectively (p,0.05). Of the 96 patients, 21 (21.87%) had troponin I levels $0.01: 2 (4.25%) in the control group and 19 (38.77%) in the supraventricular tachycardia group (p,0.001). CONCLUSION: Troponin I and, in particular, NT-proBNP peptide were helpful for differentiating supraventricular tachycardia from non- supraventricular tachycardia palpitations. Further randomized, large, multicenter trials are needed to define the benefit and diagnostic role of NT-proBNP and troponin I in the management algorithm of patients presenting with palpitations in emergency departments. KEYWORDS: N-terminal of Brain Natriuretic Peptide; Troponin I; Palpitations; Supraventricular Tachycardia. ¨ ztu¨rk S, Ayhan SS, et al. The diagnostic significance of NT-proBNP and troponin I in emergency department Ocak T, Erdem A, Duran A, Tekeliog˘lu UY, O patients presenting with palpitations. Clinics. 2013;68(4):543-547. Received for publication on December 31, 2012; First review completed on February 14, 2013; Accepted for publication on March 8, 2013 E-mail: cardiology14@gmail.com Tel.: +90-374 2534656-3291

without documented supraventricular tachyarrhythmia (SVT). Diagnosing palpitations can be difficult in the emergency department, and the waiting period for a first appointment with an arrhythmia clinic can be long. A detailed history, physical examination, and electrocardiograph are of limited value in the differential diagnosis because most rhythm disturbances are paroxysmal in nature; therefore, in many cases, the etiology of palpitations remains unclear in the emergency department. The majority of these patients have anxiety or panic disorders (2,3). The most important problem faced by emergency department physicians is determining which patients to send to arrhythmia clinics. The literature contains only limited data from small-scale studies assessing the diagnostic values of N-terminal of

& INTRODUCTION Palpitations, a common symptom of patients presenting to the emergency department, can be linked to serious (but treatable) cardiac arrhythmias (1). Many patients with this symptom arrive at the emergency department with or

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)17

543


NT-proBNP and troponin I for palpitations Ocak T et al.

CLINICS 2013;68(4):543-547

brain natriuretic peptide (NT-proBNP) and troponin I in patients presenting to the emergency department with palpitations (4-6). Consequently, this prospective study investigated the diagnostic significance of the NT-proBNP and troponin I peptides in emergency department patients presenting with palpitations.

patients met the inclusion criteria and were included in the study. Two patient groups were compared: an SVT group (n = 49) and a control group (n = 47). During the study period, both groups were diagnosed using electrophysiology studies. The recruitment, exclusion, and subsequent grouping of all patients are also shown in the flowchart (Figure 1). We used blood samples from the SVT and control groups to determine the NT-proBNP and troponin I levels. Data on baseline demographic characteristics, clinical history, and clinical signs were gathered by trained research personnel in the emergency department. Electrocardiographs were obtained and interpreted by the attending physician in the emergency department. The exclusion criteria were age ,16 years, a history of renal insufficiency, trauma, severe coronary artery disease, right and/or left systolic dysfunction, pneumonia, pulmonary embolism, carcinoma, pneumothorax, pleural effusion, intoxication (drugs), anaphylactic reactions, asthma exacerbation, chronic renal failure requiring hemodialysis, diabetes mellitus, hypertension, atrial fibrillation (paroxysmal or sustained in both conditions), ventricular tachycardia (paroxysmal or sustained in both conditions), and other causes of elevated NT-proBNP and troponin I levels. Patients with a myocardial infarction or acute renal failure were also excluded, as these conditions are known to increase NT-proBNP and troponin I levels.

& SUBJECTS AND METHODS Study Design and Patients This prospective cohort study was performed in the ED of Abant I˙zzet Baysal University, School of Medicine Hospital, between 2011 and 2012. The study was approved by the local ethics committee. During the study period, 326 consecutive patients with palpitations were treated in the emergency department. All of the patients’ baseline electrocardiograms (ECGs) were normal. Blood samples were obtained from all of the patients within the first hour following arrival in the emergency department. After providing pre-hospital care, we excluded 175 patients who met the exclusion criteria described below. A total of 151 patients were directed to the Cardiology Arrhythmia Clinic to undergo an electrophysiological study. Some of these 151 patients underwent this study based on their 12-lead ECGs, but some patients were diagnosed based on their histories, symptoms, and physical examinations. In addition, 55 patients were excluded from the study for other reasons, including failing to provide informed consent forms (n = 38), presenting with atrial fibrillation (n = 7), and failing to undergo an electrophysiological study (n = 10). Ninety-six

Measurement of NT-proBNP and Troponin I Levels Blood samples were obtained from all of the patients to determine the NT-proBNP and troponin I levels within the

Figure 1 - Recruitment, exclusion, and subsequent grouping of all patients.

544


CLINICS 2013;68(4):543-547

NT-proBNP and troponin I for palpitations Ocak T et al.

first hour after arriving in the emergency department. During the initial evaluations, a 5-mL blood sample was collected in tubes containing potassium ethylenediaminetetraacetic acid (1 mg/mL blood). The samples were centrifuged at 4 ˚C, and the plasma was then separated and frozen at 280 ˚C before analysis. Samples were analyzed using the Roche NT-proBNP electrochemiluminescent assay, and testing was performed on an Elecsys 1010 analyzer (Roche Diagnostics, Mannheim, Germany). The assay precision, analytical sensitivity, interferences, and stability have all been described previously (6). The troponin I level was analyzed in samples using ELISA kits (Roche Diagnostics), and the results were evaluated according to the manufacturer’s instructions (with a 99th percentile cutoff point of 0.1 pg/mL).

Electrophysiological Study Protocol The patients selected to undergo an electrophysiological study had already undergone extensive negative workups, including risk factor analysis, patient history, physical examination, elimination of postural hypotension or hypoglycemia, baseline ECG, carotid sinus massage, 24-h ambulatory monitoring, and echocardiogram. The electrophysiological study was performed in the case of either an absent evident etiology or a clinically suspected cardiac cause. An echocardiogram and a complete electrophysiological study were performed. The electrophysiological study included measuring the sinus node recovery time, HV interval at baseline and under stress by incremental pacing, inducibility of ventricular arrhythmia by programmed ventricular pacing (with three cycles and three extra stimuli), and inducibility of supraventricular arrhythmia using an atrial pacing protocol. The electrophysiological study results were considered positive with the induction of a rapid supraventricular arrhythmia with symptoms similar to the patient-reported symptoms.

Figure 2 - The mean NT-proBNP levels of the two groups (SVT and control).

evaluated for interactions, and none were found. p-values ,0.05 were considered statistically significant. The SPSS ver. 15.0 (SPSS, Chicago, IL) statistical software was used.

& RESULTS The majority of the patients were female, less than 35 years of age, and presented with a history of more than five palpitation episodes. The mean patient age was 34¡21 years (71% females, 29% males). The baseline and clinical characteristics are shown in Table 1. The mean ¡ SD NT-proBNP levels were 207.74¡197.11 and 39.99¡32.83 pg/mL for the patients with and without SVT, respectively (p,0.001; Figure 2). To predict SVT, the optimum NT-proBNP threshold was 61.15 pg/mL, as defined by the ROC curve, with a significant area under the ROC curve of 0.920 (95% CI 0.86-0.97, p,0.001; Figure 3). An NT-proBNP cut-off level $61.15 pg/mL for diagnosing SVT had 81.6% sensitivity and 91.5% specificity. SVT was significantly more frequent in the patients with NT-proBNP levels $61.15 pg/mL (n = 44; 90.9%, p,0.001). The mean ¡ SD troponin I values were 0.17¡0.56 and 0.01¡0.06 pg/mL for the patients with and without SVT, respectively (p = 0.018). Of these 96 patients, 21 (4.25%) had troponin I levels #0.001 pg/mL. Two of these 21 patients (4.25%) were in the control group, and 19 (38.77%) were in the SVT group (p,0.001). To predict SVT, the optimum threshold of

Statistical Analysis The baseline characteristics were reported as counts and proportions or means ¡ standard deviations, as appropriate. Continuous variables were compared between the groups using nonparametric rank tests (Mann-Whitney Utest and Kruskal-Wallis test), and qualitative variables were compared using Pearson’s chi-square test. The diagnostic value of NT-proBNP was assessed using receiver operating characteristic (ROC) curve analysis. Logistic regression models were fitted to calculate the risk (odds ratio [OR] and 95% confidence interval [CI]) for SVT. All models were Table 1 - Baseline patient characteristics.

Gender (female) Age (years)* Smoking First episode Systolic blood pressure * (mm Hg) Diastolic blood pressure * (mm Hg) Heart rate * (beats per minute) Left ventricular ejection fraction * (%) Left atrial diameter* (mm) NT-proBNP (pg/mL) Troponin I *

SVT group (n = 49)

Control group (n = 47)

p-value

71.4% 34 (17/54) 36.1% 24.5% 118 (107/127) 75 (67/86) 88 (64/92) 62 (58/72) 3.0 (2.4/3.3) 207.74¡197.11 0.17¡0.56

65.9% 33 (18/57) 41.2% 34.9% 116 (109/129) 73 (66/89) 84 (61/95) 60 (59/70) 2.8 (2.4/3.1) 39.99¡32.83 0.01¡0.06

0.102 0.138 0.192 0.041 0.651 0.721 0.292 0.271 0.108 , 0.001 0.018

(median - min/max).

545


NT-proBNP and troponin I for palpitations Ocak T et al.

CLINICS 2013;68(4):543-547

we showed that a NT-proBNP level .61.15 pg/mL was an independent predictor of SVT. Palpitations are defined as sensations of a rapid or irregular heartbeat (7). Many patients with palpitations have anxiety or panic disorders. Studies have shown that the prevalence of panic disorder in patients with palpitations is 15-31% (8,9). However, palpitations can also be linked to serious, although treatable, cardiac arrhythmias (1). In previous studies, 50% of palpitation cases were traced to cardiac causes (10,11). Diagnosing palpitations can be difficult in the emergency department, and the wait time for a first appointment at an arrhythmia clinic can be long. An important problem faced by emergency department physicians involves determining which patients to refer to arrhythmia clinics. If a cause can be determined in the initial clinical assessment, management decisions are relatively straightforward. In addition, another important problem is that palpitation symptoms recur frequently. A detailed history, physical examination, and ECG can aid the differential diagnosis because most rhythm disturbances are paroxysmal in nature. An ECG obtained during a palpitation episode is the reference standard, but obtaining a valuable ECG is usually impossible (12). Consequently, in many cases, the etiology of palpitations remains unclear in the emergency department. We found that NT-proBNP and troponin I provided important diagnostic information that is useful in the early evaluation of palpitations in emergency departments. Natriuretic peptides (BNP and NT-pro-BNP) are markers of myocardial wall stress and have been used as markers for some types of heart disease (13). Previous studies have concluded that a rapid heart rate resulted from stimulation by natriuretic peptides. Schiebinger et al. showed that increased atrial stimulation from 120-240 beats per minute led to a significant increase in atrial natriuretic peptide secretion in isolated rat hearts (14). Qi et al. observed a significant increase in BNP associated with various tachycardias in an experimental animal study (15). Some studies have shown that natriuretic peptide is increased in plasma during acute attacks of paroxysmal supraventricular tachycardia and falls rapidly after reversion to sinus rhythm (16,17). These studies concluded that stimulation of natriuretic peptide secretion may be responsible for the polyuria and natriuresis associated with SVT. Pecini et al. found a significant increase in atrial and brain natriuretic peptides during atrioventricular nodal reentry tachycardia in peripheral venous blood (18). In another interesting study, Brueckmann et al. determined the time course of NTproANP levels in patients undergoing radiofrequency catheter ablation for paroxysmal supraventricular tachycardias (19). They observed that NT-proANP levels increased in patients presenting with paroxysmal supraventricular tachycardias and decreased shortly after RF catheter ablation, possibly reflecting a transient reduction in ANP secretion from injured myocardial cells. They concluded that lower NT-proANP levels may serve as a useful laboratory marker with which to determine the long-term success of radiofrequency ablation. Previous studies have shown that NT-proBNP was more sensitive compared with BNP and had an advantage in detecting patients with mild or asymptomatic heart disease because of its longer half-life (20,21). Consistent with these studies, we also preferred NT-proBNP over troponin I as a diagnostic marker. Additionally, we observed that NT-proBNP could be used

Figure 3 - ROC curve analysis of NT-proBNP and troponin I.

troponin I was $0.005, as defined by the ROC curve, with a significant area under the ROC curve of 0.670 (95% CI, 0.560.78, p = 0.004; Figure 2). A troponin I cut-off value $0.005, which was necessary to diagnose SVT, achieved 38.8% sensitivity and 95.7% specificity. A Cox proportional logistic regression hazards analysis, which was performed to determine the predictive value of the evaluated parameters (e.g., age, gender, heart rate, mean diastolic pressure, NT-proBNP level, and troponin level), showed that NT-proBNP, but not troponin I, was an independent predictor of SVT (OR 1.130, 95% CI, 0.0011596.251, p = 0.000; OR 0.968, 95% CI, 0.951-0.988, p = 0.974, respectively). The addition of echocardiographic parameters to the model did not change the results. In patients with SVT, the NT-proBNP levels were positively correlated with the heart rate at admission (r = 0.532, p,0.001), systolic (r = 0.322, p = 0.024) and diastolic (r = 0.320, p = 0.031) blood pressures, and white blood cell (WBC) count (r = 0.318, p = 0.019). There was no significant correlation between the NT-proBNP levels and other laboratory findings (p.0.05). In addition, in patients with SVT, the troponin I levels were positively correlated only with the heart rate at admission (r = 0.418, p = 0.021) and WBC count (r = 0.323, p = 0.031). There was no significant correlation of the NT-proBNP and troponin I levels with left atrium size in either group (r = 0.213, r = 0.245, respectively, p.0.05).

& DISCUSSION Our study demonstrated that both NT-proBNP and troponin I assessments can potentially improve the sensitivity of the clinician’s evaluation of patients presenting to the emergency department with palpitations. In addition,

546


CLINICS 2013;68(4):543-547

NT-proBNP and troponin I for palpitations Ocak T et al.

as a diagnostic marker with which to identify supraventricular tachycardia patients in the emergency department. A NT-proBNP cut-off $61.15 pg/mL to diagnose SVT achieved 81.6% sensitivity and 91.5% specificity. In addition, only NT-proBNP was an independent predictor of SVT in this study. Similar to our results, there have been a few reports of troponin elevation in patients with various tachyarrhythmias (5,6,22). Kanjwal et al. identified patients with supraventricular tachycardia who had elevated troponin levels without evidence of coronary artery disease (23). All of these patients had elevated troponin I levels and underwent coronary angiography that revealed normal epicardial coronary arteries. In the present study, we observed that the mean troponin I values were significantly higher in the SVT patients compared with the controls. In addition, we excluded patients with coronary artery disease or acute renal failure, as these conditions are known to increase NT-proBNP and troponin I levels (22,23). Our study showed the significant prognostic value of NTproBNP and troponin I for diagnosing palpitations in the emergency department. We believe that the exact mechanism for these elevations may be the shortening of diastole with subsequent subendocardial ischemia. Coronary perfusion, particularly to the subendocardium, occurs predominantly during the diastole phase (21). In SVT, the increase in heart rate causes diastole to shorten, with a significant decrease in subendocardial perfusion. Some limitations of this study should be discussed. First, the main limitation of our study was its relatively small population. This study was performed over a one-year period. Because a small sample size results in low statistical power for equivalency testing, negative results may be simply due to chance. Second, our study had a single-center prospective design. Future prospective studies at larger multicenters are required to confirm our results. The other limitation is that we cannot apply our results to the general population because of the broad exclusion criteria. To our knowledge, this is the first report of a marker (NTproBNP and troponin I) strategy aimed at diagnosing SVT based on common palpitations. We have shown that the routine evaluation of NT-proBNP and troponin I may be used to identify supraventricular tachycardia patients in the ED. The results of this study require validation in large, multicenter studies prior to the incorporation of NT-proBNP and troponin I as diagnostic markers in the clinical arena.

& REFERENCES 1. Brugada P, Gu¨rsoy S, Brugada J, Andries E. Investigation of palpitations. Lancet. 1993;341(8855):1254-8. 2. Barsky AJ, Cleary PD, Coeytaux RR, Ruskin JN.Psychiatric disorders in medical outpatients complaining of palpitations. J Gen Intern Med. 1994;9(6):306-13. 3. Barsky AJ, Cleary PD, Sarnie MK, Ruskin JN. Panic disorder, palpitations, and the awareness of cardiac activity. J Nerv Ment Dis. 1994;182(2):63-71. 4. Nilsson G, Pettersson A, Hedner J, Hedner T. Increased plasma levels of atrial natriuretic peptide (ANP) in patients with paroxysmal supraventricular tachyarrhythmias. Acta Med Scand. 1987;221(1):15-21. 5. Zellweger MJ, Schaer BA, Cron TA, Pfisterer ME, Osswald S. Elevated troponin levels in absence of coronary artery disease after supraventricular tachycardia. Swiss Med Wkly. 2003;133(31-32):439-41. 6. Redfearn DP, Ratib K, Marshall HJ, Griffith MJ. Supraventricular tachycardia promotes release of troponin I in patients with normal coronary arteries. Int J Cardiol. 2005;102(3):521-2. 7. Zimetbaum P, Josephson ME. Evaluation of patients with palpitations. N Engl J Med. 1998;338(19):1369-73. 8. Chignon JM, Lepine JP, Ades J. Panic disorder in cardiac outpatients. Am J Psychiatry. 1993;150(5):780-5. 9. Jeejeebhoy FM, Dorian P, Newman DM. Panic disorder and the heart: a cardiology perspective. J Psychosom Res. 2000;48(4-5):393-403, http:// dx.doi.org/10.1016/S0022-3999(99)00103-8. 10. Kinlay S, Leitch JW, Neil A, Chapman BL, Hardy DB, Fletcher PJ. Cardiac event recorders yield more diagnoses and are more costeffective than 48-hour Holter monitoring in patients with palpitations. A controlled clinical trial. Ann Intern Med. 1996;124(1 Pt 1):16-20. 11. Zimetbaum PJ, Kim KY, Josephson ME, Goldberger AL, Cohen DJ. Diagnostic yield and optimal duration of continuous-loop event monitoring for the diagnosis of palpitations. A cost-effectiveness analysis. Ann Intern Med. 1998;128(11):890-5. 12. Zwietering PJ, Knottnerus JA, Rinkens PE, Kleijne MA, Gorgels AP. Arrhythmias in general practice: diagnostic value of patient characteristics, medical history and symptoms. Fam Pract. 1998;15(4):343-53, http://dx.doi.org/10.1093/fampra/15.4.343. 13. Schiebinger RJ, Linden J. Effect of atrial contraction frequency on atrial natriuretic peptide secretion. Am J Physiol. 1986 Nov;251(5 Pt 2):H10959. 14. Qi W, Kjekshus H, Klinge R, Kjekshus JK, Hall C. Cardiac natriuretic peptides and continuously monitored atrial pressures during chronic rapid pacing in pigs. Acta Physiol Scand. 2000;169(2):95-102, http://dx. doi.org/10.1046/j.1365-201x.2000.00724.x. 15. Tsai RC, Yamaji T, Ishibashi M, Takaku F, Yeh SJ, Lee YS, et al. Mechanism of polyuria and natriuresis associated with paroxysmal supraventricular tachycardia. Jpn Heart J. 1987;28(2):203-9, http://dx. doi.org/10.1536/ihj.28.203. 16. Fox KM, Rowland E, Krikler DM, Bentall HH, Goodwin JF. Plasma atrial natriuretic polypeptide concentrations during and after reversion of paroxysmal supraventricular tachycardias. Br Heart J. 1988;59(4):458-62. 17. Pecini R, Pehrson S, Chen X. Neuro-hormonal activation during tachycardia in patients with atrioventricular nodal reentry tachycardias. Europace J. 2009;11:S6, Abstract 970. 18. Brueckmann M, Bertsch T, Hoffmann U, Lang S, Kaden JJ, Wolpert C, et al. N-terminal pro-atrial natriuretic peptide as a biochemical marker of long-term interventional success after radiofrequency catheter ablation of paroxysmal supraventricular tachyarrhythmias. Clin Chem Lab Med. 2004;42(8):896-902. 19. Rajan GP, Zellweger R. Cardiac troponin I as a predictor of arrhythmia and ventricular dysfunction in trauma patients with myocardial contusion. J Trauma. 2004;57(4):801-8. 20. Kanjwal K, Imran N, Grubb B, Kanjwal Y. Troponin elevation in patients with various tachycardias and normal epicardial coronaries. Indian Pacing Electrophysiol J. 2008;8(3):172-4. 21. Gallagher S, Jones DA, Anand V, Mohiddin S. Diagnosis and management of patients with acute cardiac symptoms, troponin elevation and culprit-free angiograms. Heart. 2012;98(13):974-81, http://dx.doi.org/10. 1136/heartjnl-2011-301121. 22. Palazzuoli A, Caputo M, Calabro A, Nuti R. Clinical impact of BNP and other emerging biomarkers in heart failure evaluation and management. Minerva Cardioangiol. 2012;60(2):183-94. 23. Jeremias Allen, Gibson Michael. Narrative review: alternative causes for elevated cardiac troponin levels when acute coronary syndromes are excluded. Ann Intern Med. 2005;142(9):786-91.

& AUTHOR CONTRIBUTIONS Ocak T conceived and designed the study and was responsible for the acquisition of data. Erdem A conceived and designed the study and was responsible for the analysis and interpretation of data, manuscript draft and critical revision of the manuscript. Duran A and Ozlu MF were responsible for the acquisition of data. Tekelioglu UY conceived and designed the study and was responsible for the acquisition of data. Ozturk S conceived and designed the study and was responsible for the analysis and interpretation of data and critical revision of the manuscript. Ayhan SS and Tosun M were responsible for data analysis and interpretation. Koc¸oglu H was responsible for data acquisition and manuscript draft. Yazici M was responsible for manuscript draft and critical revision of the manuscript.

547


BASIC RESEARCH

Exercise training prior to myocardial infarction attenuates cardiac deterioration and cardiomyocyte dysfunction in rats Luiz Henrique Marchesi Bozi,I,II Izabel Regina dos Santos Costa Maldonado,I Marcelo Perim Baldo,III Ma´rcia Ferreira da Silva,V Jose´ Bianco Nascimento Moreira,II Roˆmulo Dias Novaes,I Regiane Maria Soares Ramos,V Jose´ Geraldo Mill,III Patricia Chakur Brum,II Leonardo Bonato Felix,IV Thales Nicolau Prı´mola Gomes, V Antoˆ nio Jose´ NataliV I

Federal University of Vic¸osa, Department of General Biology, Vic¸osa/MG, Brazil. II Universidade de Sa˜o Paulo, School of Physical Education and Sport, Sa˜o Paulo/SP, Brazil. III Federal University of Espı´rito Santo, Department of Physiological Sciences, Vito´ria/ES, Brazil. IV Federal University of Vic¸osa, Department of Electrical Engineering, Vic¸osa/MG, Brazil. V Federal University of Vic¸osa, Department of Physical Education, Vic¸osa/MG, Brazil.

OBJECTIVES: The present study was performed to investigate 1) whether aerobic exercise training prior to myocardial infarction would prevent cardiac dysfunction and structural deterioration and 2) whether the potential cardiac benefits of aerobic exercise training would be associated with preserved morphological and contractile properties of cardiomyocytes in post-infarct remodeled myocardium. METHODS: Male Wistar rats underwent an aerobic exercise training protocol for eight weeks. The rats were then assigned to sham surgery (SHAM), sedentary lifestyle and myocardial infarction or exercise training and myocardial infarction groups and were evaluated 15 days after the surgery. Left ventricular tissue was analyzed histologically, and the contractile function of isolated myocytes was measured. Student’s t-test was used to analyze infarct size and ventricular wall thickness, and the other parameters were analyzed by the KruskalWallis test followed by Dunn’s test or a one-way analysis of variance followed by Tukey’s test (p,0.05). RESULTS: Myocardial infarctions in exercise-trained animals resulted in a smaller myocardial infarction extension, a thicker infarcted wall and less collagen accumulation as compared to myocardial infarctions in sedentary animals. Myocardial infarction-induced left ventricular dilation and cardiac dysfunction, as evaluated by +dP/dt and -dP/dt, were both prevented by previous aerobic exercise training. Moreover, aerobic exercise training preserved cardiac myocyte shortening, improved the maximum shortening and relengthening velocities in infarcted hearts and enhanced responsiveness to calcium. CONCLUSION: Previous aerobic exercise training attenuated the cardiac dysfunction and structural deterioration promoted by myocardial infarction, and such benefits were associated with preserved cardiomyocyte morphological and contractile properties. KEYWORDS: Cardiac Function; Cardiac Myocyte; Cardiac Remodeling; Physical Activity, Myocardial Infarction; Cardioprotection. Bozi LH, Maldonado IR, Baldo MP, Silva MF, Moreira JB, Novaes RD, et al. Exercise training prior to myocardial infarction attenuates cardiac deterioration and cardiomyocyte dysfunction in rats. Clinics. 2013;68(4):549-556. Received for publication on August 29, 2012; First review completed on October 15, 2012; Accepted for publication on December 5, 2012 E-mail: luizbozi@usp.br Tel.: 55 11 7950-5509

such as myocardial infarction (MI) (1), which is the most common etiology of heart failure (HF). In recent years, studies have provided strong evidence for the benefits of aerobic exercise training (AET) in cardiac rehabilitation, which highlights its use as an adjuvant therapy for a variety of cardiovascular diseases (2-4). Despite the well-known benefits of AET in terms of the clinical outcomes of cardiac patients, the potential protective effect of AET performed prior to cardiac insult remains incompletely understood and is poorly addressed in the literature. A small number of studies have evaluated how increasing physical activity prior to MI affects hemodynamic parameters and cardiac function and structure. However,

& INTRODUCTION A sedentary lifestyle is known to be a major cardiovascular risk factor predisposing individuals to cardiac events

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)18

549


Cardioprotection by exercise prior to MI Bozi LH et al.

CLINICS 2013;68(4):549-556

underwent graded treadmill running tests at a 10 ˚ grade until exhaustion to measure the maximum running workload. Treadmill running tests performed until exhaustion in a separate batch of age-matched rats revealed that 18 m.min-1 corresponded to 55-70% of the maximal running speed in all animals; therefore, the AET protocol was performed at a moderate intensity. SHAM and SED-MI groups were placed on the treadmill twice a week and walked for 10 min at 20% of the speed of the exercise-trained group to mimic the running stress associated with the experimental protocol and maintenance of exercise skills. Forty-eight hours after the last training session (ET-MI) or adaptation (SHAM and SED-MI), all animals underwent a graded treadmill exercise test until exhaustion, as described by Koch and Britton (19). Briefly, the initial treadmill speed was 10 m.min-1, which was increased by 1 m.min-1 every 2 min until the rats were no longer able to run. The tests were carried out by experienced observers (LHMB and MFS) over the course of three days.

despite distinct experimental designs and exercise regimens, results from different studies seem to be fairly convergent and suggest that exercise training protects against the maladaptive remodeling and global function induced by MI in rodents (5-8). Nevertheless, the mechanisms underlying these morphological and functional benefits of prior AET in post-remodeled myocardium are poorly understood and may be related to the morphological and contractile properties of cardiomyocytes. The role played by cardiomyocyte contractile function in reducing blood pumping capacity after MI is controversial. Some authors have reported cardiac dysfunction paralleled by impaired cardiomyocyte contractility (9-12), while others have observed preserved cardiomyocyte contractility in infarcted ventricles (13-15). Based on these findings, left ventricular (LV) remodeling (e.g., increased collagen content, pathological cardiac hypertrophy and LV dilation) has been proposed as the main determinant of cardiac dysfunction after MI; however, further studies are needed to obtain a more thorough understanding of such a relationship. As AET improves cardiomyocyte fractional shortening as well as maximal shortening and relengthening velocities (1618), it is possible that improving cardiomyocyte contractile function by AET could provide protection against MI-induced cardiac dysfunction. Therefore, the present study was undertaken to investigate 1) whether AET prior to MI prevents cardiac dysfunction and structural deterioration and 2) whether the potential cardiac benefits of AET would be associated with preserved morphological and contractile properties of cardiomyocytes in post-infarct remodeled myocardium.

Myocardial infarction Coronary artery occlusion was performed in the MI groups 48 hours after the last graded treadmill running test. Rats were deeply anesthetized with ketamine (50 mg/kg, ip) and xylazine (10 mg/kg, ip), and a left thoracotomy was then performed. The mediastinum was accessed by incising the intercostal muscles between the 3rd and 4th ribs, the heart was carefully exteriorized, and then the left anterior descending (LAD) coronary artery was occluded with a 6-0 thread. After LAD ligation, the thorax was closed, and lung collapse was prevented by rapid withdrawal of air from the pleural cavity using a syringe. Sham-operated animals underwent a similar left thoracotomy and cardiac exteriorization but did not undergo LAD ligation. The perioperative mortality was 30% in sedentary and 15% in exercise-trained animals. After MI induction, the animals were kept sedentary, and all measurements were performed 15 days after the surgical procedures. A similar number of animals from each of the three groups was allocated for either (1) the in vivo assessment of hemodynamic parameters and cardiac structure or (2) isolated cardiomyocyte structure and function evaluation.

& MATERIALS AND METHODS Study population Experiments were performed according to the principles of laboratory animal care (NIH publication No. 86-23, revised 1985) and the Brazilian College of Animal Experimentation and were approved by the Institutional Animal Care Committee (protocol 55/2009). Male Wistar rats (100-120 g) provided by the animal facilities at the Federal University of Vic¸osa, Brazil were randomly assigned to the following groups: control (SHAM; n = 15); sedentary lifestyle and MI (SED-MI; n = 20); and exercise training and MI (ET-MI; n = 20). The large initial number of animals was chosen to provide at least six rats per group for each of the measurements, as a high mortality rate is expected for rats subjected to MI (30-40%). The animals were kept under a 12:12 hour light-dark cycle in a temperature-controlled (22˚C) room with free access to standard laboratory chow (Nuvital, Colombo, Parana´, Brazil) and tap water.

In vivo hemodynamic measurements

and

cardiac

function

Fifteen days after the surgical procedures, the animals were deeply anesthetized with ketamine (70 mg.kg-1, ip) and xylazine (10 mg.kg-1, ip) for LV catheterization. The right common carotid artery was separated from its connective tissue and catheterized with a fluid-filled polyethylene catheter (P50). The catheter was connected to a pressure transducer (TRI 21, Letica Scientific Instruments, Hospitalet, Barcelona, Spain) and to a digitalizing unit (Powerlab/4SP ML750, ADInstrument, Sidney, New South Wales, Australia) for data recording. After acquiring arterial systolic (SBP) and diastolic blood pressure (DBP) values, the catheter was moved to the left ventricle to obtain the following parameters: heart rate (HR); left ventricular systolic (LVSP) and enddiastolic pressures (LVEDP); and the maximum rates of pressure rise (+dP/dt) and fall (-dP/dt).

Aerobic Exercise Training and test protocols The ET-MI group underwent AET on a motor-driven treadmill (Insight Scientific Equipments, Ribeira˜o Preto, Sa˜o Paulo, Brazil) five days per week for eight weeks prior to MI surgery. The running speed, treadmill inclination and session duration were progressively increased throughout the protocol in such a way that by the 6th week, the rats were running continuously for 60 min at 18 m.min-1 and a 10 ˚ grade, which was maintained until the end of the protocol. The running speed of 18 m.min-1 was chosen because a pilot study in our lab failed to verify cardiomyocyte adaptations after AET at lower intensities. To verify the relative intensity of the training protocol, a subset of five sedentary rats

In situ LV pressure-volume relationship After hemodynamic measurements were collected, each heart was arrested with 3 M KCl (0.2 mL, iv), and a double

550


CLINICS 2013;68(4):549-556

Cardioprotection by exercise prior to MI Bozi LH et al.

lumen catheter (P50 inserted into P200) was inserted into the left ventricle through the aorta to determine the in situ left ventricle diastolic pressure-volume relationship, as previously described (20). Briefly, the atrio-ventricular groove was occluded, and a small incision was made in the right ventricular free wall to hinder any compression effect. Then, 0.9% NaCl was infused with an infusion pump (Insight Scientific Equipments, Ribeira˜o Preto, Sa˜o Paulo, Brazil) at a constant rate of 0.68 mL.min-1 into the P200, and pressure was continuously monitored through the P50. The pressure followed a linear pattern during volume infusion from 0 to 5 mmHg, indicating the passive distention of ventricular wall; therefore, the slope was used to estimate LV dilatation because no stiffness was observed up to 5 mmHg (20).

frequency of 3 Hz (20 V, 5 ms-long square pulses) at room temperature (25 - 30˚C). Cells were imaged using a digital video camera in partial scanning mode, and these images were used to measure cell shortening (our index of contractility) in response to electrical stimulation using a video-edge detection system (Milton, Massachusetts, Ionoptix, USA). Cell images were sampled at a frame rate of 240 Hz. Cell shortening (expressed as a percentage of resting cell length), shortening velocity and relengthening velocity were calculated as previously described (22). Only Ca2+-tolerant, quiescent and rod-shaped myocytes showing clear cross striations were studied. The same images were also used to determine cell length and width, which were used to estimate myocyte volume (23) (130-180 cells per experimental group).

Histological evaluation

Statistics

After in vivo hemodynamic measurements, the heart was removed, mounted for routine histological procedures, transversely sectioned in 5 mm-thick sections and stained with picrosirius red for analysis of infarct size and collagen content. Endocardial and epicardial circumferences of the infarcted tissue and left ventricle were determined using Image J software (NIH, Bethesda, Maryland, USA). Infarct size was calculated as (endocardial + epicardial circumference of infarcted tissue)/(endocardial + epicardial circumference of the left ventricle) and was expressed as a percentage. The infarcted wall thickness was measured at the medial point of the scar area. The stereological parameter of collagen volume density (Vv) was estimated from the remote region by point counting for collagen according to the following formula: Vv[collagen] = PP[collagen]/72; where PP is the number of points that hit the structure and 72 is the total number of test points. A points test system was used for analysis in a standard test area of 0.15 mm2 (21).

The data are presented as the mean ¡ SEM. The Student’s t-test was used to analyze infarct size and ventricular wall thickness. The other parameters were analyzed using the Kruskal-Wallis test followed by Dunn’s test (nonparametric data) or a one-way analysis of variance (ANOVA) followed by Tukey’s test (parametric data). Statistical significance was defined as a p value below 0.05.

& RESULTS Running performance To verify the AET efficacy, all animals underwent graded treadmill running tests until exhaustion at the end of the training period prior to MI induction. As expected, the time until exhaustion, i.e., the running capacity, was substantially increased in exercise-trained rats (Table 1). Importantly, prior to the surgical procedure, the running capacity of the SHAM and SED-MI groups was similar, demonstrating homogeneity between these two groups at that time point.

Cardiomyocyte isolation Cardiac myocytes from a region adjacent to the MI were enzymatically isolated as previously described (22). Briefly, after euthanasia, the heart was removed rapidly, and extraneous tissue was dissected away. The heat was then flushed with a modified Hepes-Tyrode solution at room temperature containing the following ingredients: 130 mM Na+, 5.4 mM K+, 1.4 mM Mg2+, 140 mM Cl-, 0.75 mM Ca2+, 5 mM Hepes, 10 mM glucose, 20 mM taurine and 10 mM creatine, pH 7.3. The heart was then blotted dry and weighed before being mounted on a custom-designed Langendorff apparatus. After perfusion for 3 min with a 750 mM CaCl2 solution, the heart was perfused for 3-5 min with a Ca2+-free solution containing EGTA (0.1 mM). Afterwards, the heart was perfused for 15-20 min with a solution containing 1 mg.mL-1 collagenase type II (Worthington, Lakewood, New Jersey, USA). After tissue digestion, fragments of the MI-adjacent region were obtained, and single cells were isolated by mechanical dispersion and stored at 5 ˚C until use.

Cardiomyocyte morphology

contractile

function

Physiological parameters Fifteen days after infarction, significant LV remodeling had occurred. MI-induced cardiac macroscopic alterations were verified by increased heart weights (HW) and heart weight to body weight ratios (HW/BW) in both MI groups as compared to the SHAM animals (Table 1). No significant effect of prior AET was found for HW or the HW/BW ratio (Table 1). Pulmonary congestion, estimated according to the lung wet-to-dry ratio, was detected in both MI groups, Table 1 - Physiological parameters. SHAM BW, g Running time, min HW, mg HW/BW, mg/g Lung wet/dry ratio HR, bpm SBP, mmHg DBP, mmHg

and

Cellular contractility was measured as previously described (22). Briefly, isolated cardiomyocytes were placed in an experimental chamber with a glass coverslip base mounted on the stage of an inverted microscope. The chamber was perfused with HEPES Tyrode’s solution containing 0.6, 1 or 5 mM CaCl2 and field-stimulated at a

SED-MI

377¡6 8.7¡0.8

360¡12 9.0¡1.3

1.9¡0.1 5.0¡0.2 4.9¡0.09

2.4¡0.1* 6.6¡0.4* 5.2¡0.05*

246¡7 116 ¡2 73¡2

269¡8 108¡3 74¡3

ET-MI 345¡12 19.4¡0.6*{ 2.5¡0.1* 7.5¡0.4* 5.2¡0.07* 251¡7 110¡3 75¡2

Data are presented as the mean¡SEM. SHAM, control. SED-MI, sedentary and given a MI. ET-MI, exercise-trained and given a MI. HW: heart weight. HW/BW: heart weight to body weight ratio. HR: heart rate. SBP: systolic blood pressure. DBP: diastolic blood pressure. *p,0.05 vs. SHAM; {p,0.05 vs. SED-MI (ANOVA followed by Tukey’s test).

551


Cardioprotection by exercise prior to MI Bozi LH et al.

CLINICS 2013;68(4):549-556

significantly attenuated inotropic dysfunction in MI rats (Fig. 2C). Accordingly, prior AET partially restrained the effects of MI on lusitropic function (-dP/dt) (Fig. 2D).

without a significant difference between the SED-MI and ET-MI groups (Table 1). Histological analysis revealed that MI extension was greater in SED-MI than ET-MI animals (Fig. 1A and B), and infarcted wall thickness was also greater in ET-MI as compared to SED-MI animals (Fig. 1A and C). MI also increased cardiac collagen content in both groups, although this occurred to a lesser extent in rats that had undergone AET (Fig. 1D).

In situ LV pressure-volume relationship The linear rise in LV pressure up to 5 mmHg in response to fluid infusion indicates passive chamber filling. Thus, the LV volume at 5 mmHg was compared among groups and provided an estimate of LV dilation (20). As shown in Figure 3, SED-MI animals displayed LV dilation as compared to SHAM animals, which was prevented by prior AET.

Hemodynamic parameters HR, SBP and DBP under anesthesia were similar among groups (Table 1). MI decreased LVSP in the SED-MI group, which was not observed in the ET-MI group (Fig. 2A). However, AET did not prevent the elevation of LVEDP by MI (Fig. 2B). Inotropic function, evaluated according to +dP/dt, was reduced in SED-MI animals, and prior AET

Cardiomyocyte function

morphology

and

contractile

As illustrated in Figure 4, increased myocyte length without any change in cell width was observed in the SEDMI group. In contrast, the ET-MI group displayed myocyte length and width values greater than those observed in the SED-MI and SHAM groups (Fig. 4A and B). Estimated cardiomyocyte volume was increased only in ET-MI animals (Fig. 4C). Interestingly, increased cardiomyocyte dimensions in the ET-MI group were paralleled by preserved cell shortening at 1 mM and 5 mM concentrations of extracellular Ca2+ ([Ca2+]e), whereas SED-MI animals demonstrated reduced cell shortening. No difference in cell shortening was observed among groups at 0.6 mM of [Ca2+]e (Fig. 5A), and MI did not impair maximal cell shortening and relengthening velocities at any [Ca2+]e. In contrast, prior AET significantly increased both parameters in MI rats (Fig. 5B and C).

& DISCUSSION AET is used as an adjuvant therapy in preventive cardiology. In addition, cardiovascular risk factors are known to arise in rats artificially selected for inborn low aerobic capacity, suggesting that there are cardioprotective effects of increased aerobic capacity (24). The present study provides strong evidence for the attenuation of MI-induced cardiac dysfunction by prior moderate-intensity AET, and this effect was accompanied by diminished deleterious remodeling and improved cardiomyocyte morphological and contractile properties. The cardioprotective effect of prior AET was also confirmed by the reduced peri-operative mortality observed in exercise-trained animals. The efficacy of AET is typically demonstrated by increased exercise performance and resting bradycardia (25,26). In this context, the AET employed in the present study was efficient in improving the running performance of MI rats in a graded treadmill test. Although HR was unchanged between the treatment groups, it must be considered that it was assessed under deep anesthesia. We demonstrated that rats given AET had a smaller infarct extension compared to SED-MI animals, and this may reflect exercise-associated improvements in cardiac vascularity or activation of cardioprotective signaling pathways. Improved myocardial capillarization, intracellular redox balance, increased levels of anti-apoptotic proteins and downregulation of the MI-induced renin angiotensin system and sympathetic nervous activity by prior AET may also have accounted for this observation. Such parameters are directly involved in MI expansion and the progression of HF (27-32) and are improved by AET (32-37).

Figure 1 - A Representative photomicrography of cardiac tissue. B Myocardial infarct extension. C Infarcted wall thickness. D Cardiac collagen content. SHAM, control. SED-MI, sedentary and given a MI. ET-MI, exercise trained and given a MI. Vv, volume density. Data are presented as the mean¥SEM. *p,0.05 vs. SHAM; #p,0.05 vs. SED-MI (ANOVA followed by Tukey’s test).

552


CLINICS 2013;68(4):549-556

Cardioprotection by exercise prior to MI Bozi LH et al.

Figure 2 - A Left ventricular systolic pressure (LVSP). B Left ventricular end-diastolic pressure (LVEDP). C Inotropic function (+ dP/dt). D Lusitropic function (- dP/dt). SHAM, control. SED-MI, sedentary and given a MI. ET-MI, exercise trained and given a MI. *p,0.05 vs. SHAM; #p,0.05 vs. SED-MI (ANOVA followed by Tukey’s test).

Additionally, cardiomyocyte sliding occurs after MI and the thinning and elongation of the infarcted area, which accelerates MI expansion and leads to LV dilation (38). Therefore, the thicker infarcted areas observed in ET-MI animals as compared to SED-MI animals may also have

contributed to the smaller MI extension and prevented LV dilation in rats receiving both exercise training and MI. In fact, a reduction in infarct area thickness is directly associated with MI expansion (38). Moreover, the attenuation of LV collagen accumulation in the ET-MI group confirms the reduced deleterious effects of cardiac remodeling promoted by AET (39). Attenuated cardiac deterioration by AET was paralleled by reduced cardiac dysfunction in the ET-MI group when compared to SED-MI group. Moreover, blunting of inotropic (+dP/dt) and lusitropic (-dP/dt) dysfunction by prior AET can be explained, at least in part, by the lesser degree of cardiac tissue deterioration during remodeling observed in the ET-MI group. Although other studies corroborate our hypothesis (5,6), Veiga et al. (40) did not observe any cardioprotective effects following the administration of a different AET protocol. These divergent findings might be explained by the fact that animals in this previous study underwent swimming training in the absence of an external load, which may not have provided enough AET intensity to promote cardioprotection. In fact, it has been shown that exercise-induced cardioprotection is intensity-dependent, such that lowintensity exercise does not provide significant protection against cardiac damage (41). Moreover, further differences in experimental conditions, such as resting time after MI and animal gender, may also be responsible for the distinct findings between our study and that of Veiga et al. (40).

Figure 3 - In situ LV pressure-volume relationship. SHAM, control. SED-MI, sedentary and given a MI. ET-MI, exercise trained and given a MI. Data are presented as the mean¡SEM. *p,0.05 vs. SHAM; #p,0.05 vs. SED-MI (ANOVA followed by Tukey’s test).

553


Cardioprotection by exercise prior to MI Bozi LH et al.

CLINICS 2013;68(4):549-556

Figure 4 - Cardiomyocyte morphology. A Cell length. B Cell width. C Cell volume. SHAM, control. SED-MI, sedentary and given a MI. ET-MI, exercise trained and given a MI. Data are presented as the mean¡SEM. *p,0.05 vs. SHAM; #p,0.05 vs. SED-MI (Kruskal-Wallis followed by Dunn’s test).

Figure 5 - Cardiomyocyte contractile function. A Cell shortening (% of resting cell length). B Shortening velocity. C Relengthening velocity. SHAM, control. SED-MI, sedentary and given MI. ET-MI, exercise trained and given MI. Data are presented as the mean¡SEM. *p,0.05 vs. SHAM; #p,0.05 vs. SED-MI. +p,0.05 vs. lower [Ca+2] (Kruskal-Wallis followed by Dunn’s test).

LV remodeling following MI involves structural rearrangement of the remaining cardiomyocytes in an attempt to evenly distribute the increased wall stress (42,43). In fact, we observed increased cardiomyocyte length in the SED-MI group as compared to the ET-MI group. It could be argued that AET aggravated MI-induced myocyte remodeling; however, several lines of evidence have demonstrated that physiological cardiomyocyte enlargement associated with a gain of function occurs after AET (16,18,44). Despite structural similarities, studies have confirmed that distinct molecular pathways separate pathological from physiological myocyte hypertrophy. While activation of the calcineurin-NFAT-GATA4 pathway resulting from MI normally results in cardiomyocyte dysfunction (45,46), activation of the cardiac PI3k-Akt-mTOR cascade by AET promotes

cellular hypertrophy associated with functional gains (47,48). Therefore, despite not measuring hypertrophy markers, the notion of physiological hypertrophy associated with a gain of function is supported by our data showing preserved cell shortening in the ET-MI group, whereas SEDMI cell shortening was depressed under physiological (1 mM [Ca2+]e) and stimulated (5 mM [Ca2+]e) conditions. Extending our findings on cellular function, we also evaluated cardiomyocyte shortening and relengthening velocities in response to increasing inotropic stimuli (i.e., [Ca2+]e). Of interest, AET prior to MI not only improved

554


CLINICS 2013;68(4):549-556

Cardioprotection by exercise prior to MI Bozi LH et al.

both parameters but also promoted enhanced responsiveness to increasing [Ca2+]e. Studies reporting impaired Ca2+ handling and decreased myofilament sensitivity to Ca2+ in post-infarction HF in rats (10-12) support our findings of reduced responsiveness to increasing [Ca2+]e in the SED-MI group. For the first time, we demonstrated that AET performed prior to MI preserved cardiomyocyte shortening, as well as the shortening and relengthening velocities. The mechanisms underlying such findings could be explained, at least partly, by preserved or increased myofilament Ca+2 sensitivity (17,49). The reduction in myofilament Ca+2 sensitivity in infarcted hearts may result from increased reactive oxidative species (ROS) production, which upregulates kinases involved in the phosphorylation of troponin T and I, and culminates in disrupted actin–myosin interactions (50). In this regard, it has also been shown that AET improves antioxidant defenses as well as, and also reduces ROS release by the heart’s major source of ROS, the mitochondria (51). Therefore, it is reasonable to suggest that previous AET improved the mitochondrial profile after MI, which could have reduced ROS release and thereby preserved myofilament Ca+2 sensitivity. In fact, studies in healthy and post-MI rats have demonstrated that AET improves myofilament Ca+2 sensitivity, which was also associated with improved cardiomyocyte function (17,49). It is also possible that prior AET promotes a shift in myosin heavy chain composition (i.e., towards the fast V1 isoform) in the cardiac muscle (52), which may explain the changes in the contraction and relaxation velocities. Furthermore, increases in transient intracellular Ca+2 through increased SERCA2a expression and activity, as well as NCX activity, have been shown to be modulated by AET in healthy animals [16-18,26,53]. Altogether, such exercise-induced cardiac adaptations may have provided protection against MI-induced cardiomyocyte dysfunction. In conclusion, AET performed prior to MI effectively attenuated LV dysfunction and cardiac remodeling, which were associated with preserved cardiomyocyte fractional shortening, improved shortening and relengthening velocities and physiological cellular hypertrophy. Taken together, our data support the notion that AET provides considerable cardioprotection against the deleterious effects of MI, which reinforces the importance of maintaining a physically active lifestyle.

& ACKNOWLEDGMENTS This study received financial support from the Fundo de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG – PRONEX) and Coordenac¸a˜o de Aperfeic¸oamento de Pessoal de Nı´vel Superior (CAPES). LHMB held a master degree scholarship from CAPES/REUNI-Federal University of Vic¸osa (# 164584). AJN is a CNPq fellow.

& AUTHOR CONTRIBUTIONS Bozi LH was responsible for the study conception and design, acquisition of data, analysis and interpretation of the data and drafting of the manuscript. Maldonado IR contributed to the study supervision and the analysis and interpretation of the data. Baldo MP contributed to the acquisition of the data and analysis and interpretation of the data. Silva MF assisted with the animal exercise protocols and acquisition of the data. Moreira JB was responsible for the statistical analysis and manuscript drafting. Brum PC critically reviewed the manuscript for important intellectual content. Novaes RD assisted with the animal exercise protocols and acquisition of the data. Ramos RM contributed to the animal exercise protocols and acquisition of the data. Mill JG critically reviewed the manuscript for important intellectual content. Felix LB was responsible for the analysis and interpretation of the data. Gomes TN critically reviewed the manuscript for important intellectual content. Natali AJ was responsible for the study conception and design, obtained funding, provided supervision and helped drafting the manuscript.

& REFERENCES 1. Booth FW, Roberts CK. Linking performance and chronic disease risk: indices of physical performance are surrogates for health. Br J Sports Med. Circulation. 2008;42(12):950-2. 2. Wisloff U, Stoylen A, Loennechen JP, Bruvold M, Rognmo O, Haram PM, et al. Superior cardiovascular effect of aerobic interval training versus moderate continuous training in heart failure patients: a randomized study. Circulation. 2007;115(24):3086-94. 3. Fraga R, Franco FG, Roveda F, de Matos LN, Braga AM, Rondon MU, et al. Exercise training reduces sympathetic nerve activity in heart failure patients treated with carvedilol. Eur J Heart Fail. 2007;9(6-7):630-6, http://dx.doi.org/10.1016/j.ejheart.2007.03.003. 4. Rognmo O, Hetland E, Helgerud J, Hoff J, Slordahl SA. High intensity aerobic interval exercise is superior to moderate intensity exercise for increasing aerobic capacity in patients with coronary artery disease. Eur J Cardiovasc Prev Rehabil. 2004;11(3):216-22, http://dx.doi.org/10. 1097/01.hjr.0000131677.96762.0c. 5. Dayan A, Feinberg MS, Holbova R, Deshet N, Scheinowitz M. Swimming exercise training prior to acute myocardial infarction attenuates left ventricular remodeling and improves left ventricular function in rats. Annals of clinical and laboratory science. 2005;35(1):73-8. 6. Freimann S, Scheinowitz M, Yekutieli D, Feinberg MS, Eldar M, KesslerIcekson G. Prior exercise training improves the outcome of acute myocardial infarction in the rat. Heart structure, function, and gene expression. J Am Coll Cardiol. 2005;45(6):931-8, http://dx.doi.org/10. 1016/j.jacc.2004.11.052. 7. de Waard MC, Duncker DJ. Prior exercise improves survival, infarct healing, and left ventricular function after myocardial infarction. J Appl Physiol. 2009;107(3):928-36, http://dx.doi.org/10.1152/japplphysiol. 91281.2008. 8. Galvao TF, Matos KC, Brum PC, Negrao CE, Luz PL, Chagas AC. Cardioprotection conferred by exercise training is blunted by blockade of the opioid system. Clinics (Sao Paulo). 2011;66(1):151-7, http://dx.doi. org/10.1590/S1807-59322011000100026. 9. Li P, Park C, Micheletti R, Li B, Cheng W, Sonnenblick EH, et al. Myocyte performance during evolution of myocardial infarction in rats: effects of propionyl-L-carnitine. Am J Physiol. 1995;268(4 Pt 2):H1702-13. 10. Holt E, Tonnessen T, Lunde PK, Semb SO, Wasserstrom JA, Sejersted OM, et al. Mechanisms of cardiomyocyte dysfunction in heart failure following myocardial infarction in rats. J Mol Cell Cardiol. 1998;30(8):1581-93, http://dx.doi.org/10.1006/jmcc.1998.0724. 11. Loennechen JP, Wisloff U, Falck G, Ellingsen O. Cardiomyocyte contractility and calcium handling partially recover after early deterioration during post-infarction failure in rat. Acta Physiol Scand. 2002;176(1):17-26, http://dx.doi.org/10.1046/j.1365-201X.2002.01011.x. 12. Kim YK, Kim SJ, Kramer CM, Yatani A, Takagi G, Mankad S, et al. Altered excitation-contraction coupling in myocytes from remodeled myocardium after chronic myocardial infarction. J Mol Cell Cardiol. 2002;34(1):63-73, http://dx.doi.org/10.1006/jmcc.2001.1490. 13. Gupta S, Prahash AJ, Anand IS. Myocyte contractile function is intact in the post-infarct remodeled rat heart despite molecular alterations.

Study limitations We cannot exclude the possibility of variations in the ischemic region between SED-MI and ET-MI animals. To minimize this potential effect, the surgeries were performed by an experienced surgeon (MPB) who was blinded to the animal groupings. Correlations between in vivo global cardiac function and cardiomyocyte parameters from the same rats were not possible because such experiments were performed in distinct subsets of animals; however, our findings of improved cardiac function and cardiomyocyte contractility in trained animals suggest an association between these variables. Although the absence of an exercise-trained SHAM group did not allow us to directly confirm that exacerbated cellular hypertrophy in the ET-MI group was due to physiological cardiac remodeling promoted by AET, this hypothesis is supported by several previous publications (16,18,44) as well as our data on cardiac and myocyte function.

555


Cardioprotection by exercise prior to MI Bozi LH et al.

14.

15.

16.

17.

18.

19. 20.

21.

22.

23.

24.

25. 26.

27.

28. 29.

30.

31.

32.

33.

CLINICS 2013;68(4):549-556

Cardiovasc Res. 2000;48(1):77-88, http://dx.doi.org/10.1016/S00086363(00)00160-7. Song J, Zhang XQ, Wang J, Carl LL, Ahlers BA, Rothblum LI, et al. Sprint training improves contractility in postinfarction rat myocytes: role of Na+/Ca2+ exchange. J Appl Physiol. 2004;97(2):484-90, http://dx.doi. org/10.1152/japplphysiol.00061.2004. Ahlers BA, Song J, Wang J, Zhang XQ, Carl LL, Tadros GM, et al. Effects of sarcoplasmic reticulum Ca2+-ATPase overexpression in postinfarction rat myocytes. J Appl Physiol. 2005;98(6):2169-76, http://dx.doi.org/10. 1152/japplphysiol.00013.2005. Natali AJ, Wilson LA, Peckham M, Turner DL, Harrison SM, White E. Different regional effects of voluntary exercise on the mechanical and electrical properties of rat ventricular myocytes. J Physiol. 2002;541(Pt 3):863-75, http://dx.doi.org/10.1113/jphysiol.2001.013415. Wisloff U, Loennechen JP, Falck G, Beisvag V, Currie S, Smith G, et al. Increased contractility and calcium sensitivity in cardiac myocytes isolated from endurance trained rats. Cardiovasc Res. 2001;50(3):495508, http://dx.doi.org/10.1016/S0008-6363(01)00210-3. Kemi OJ, Ellingsen O, Ceci M, Grimaldi S, Smith GL, Condorelli G, et al. Aerobic interval training enhances cardiomyocyte contractility and Ca2+ cycling by phosphorylation of CaMKII and Thr-17 of phospholamban. J Mol Cell Cardiol. 2007;43(3):354-61, http://dx.doi.org/10.1016/j.yjmcc. 2007.06.013. Koch LG, Britton SL. Artificial selection for intrinsic aerobic endurance running capacity in rats. Physiological genomics. 2001;5(1):45-52. Baldo MP, Zaniqueli D, Forechi L, Machado RC, Rodrigues SL, Mill JG. Effects of spironolactone in spontaneously hypertensive adult rats subjected to high salt intake. Clinics. 2011;66(3):477-82, http://dx.doi. org/10.1590/S1807-59322011000300020. Bezerra DG, Lacerda Andrade LM, Pinto da Cruz FO, Mandarim-deLacerda CA. Atorvastatin attenuates cardiomyocyte loss in adult rats from protein-restricted dams. J Card Fail. 2008;14(2):151-60, http://dx. doi.org/10.1016/j.cardfail.2007.10.015. Roman-Campos D, Duarte HL, Sales PA, Jr., Natali AJ, Ropert C, Gazzinelli RT, et al. Changes in cellular contractility and cytokines profile during Trypanosoma cruzi infection in mice. Basic Res Cardiol. 2009;104(3):238-46, http://dx.doi.org/10.1007/s00395-009-0776-x. Satoh H, Delbridge LM, Blatter LA, Bers DM. Surface: volume relationship in cardiac myocytes studied with confocal microscopy and membrane capacitance measurements: species-dependence and developmental effects. Biophys J. 1996;70(3):1494-504, http://dx.doi.org/10. 1016/S0006-3495(96)79711-4. Wisloff U, Najjar SM, Ellingsen O, Haram PM, Swoap S, Al-Share Q, et al. Cardiovascular risk factors emerge after artificial selection for low aerobic capacity. Science. 2005;307(5708):418-20, http://dx.doi.org/10. 1126/science.1108177. Rolim NP, Medeiros A, Rosa KT, Mattos KC, Irigoyen MC, Krieger EM, et al. Exercise training improves the net balance of cardiac Ca2+ handling protein expression in heart failure. Physiol Genomics. 2007;29(3):246-52. Medeiros A, Rolim NP, Oliveira RS, Rosa KT, Mattos KC, Casarini DE, et al. Exercise training delays cardiac dysfunction and prevents calcium handling abnormalities in sympathetic hyperactivity-induced heart failure mice. J Appl Physiol. 2008;104(1):103-9. Di Filippo C, Cuzzocrea S, Rossi F, Marfella R, D’Amico M. Oxidative stress as the leading cause of acute myocardial infarction in diabetics. Cardiovasc Drug Rev. 2006;24(2):77-87, http://dx.doi.org/10.1111/j. 1527-3466.2006.00077.x. Hori M, Nishida K. Oxidative stress and left ventricular remodelling after myocardial infarction. Cardiovasc Res. 2009;81(3):457-64. Lepore DA, Knight KR, Anderson RL, Morrison WA. Role of priming stresses and Hsp70 in protection from ischemia-reperfusion injury in cardiac and skeletal muscle. Cell Stress Chaperones. 2001;6(2):93-6, http://dx.doi.org/10.1379/1466-1268(2001)006,0093:ROPSAH.2.0.CO; 2. Chen EP, Bittner HB, Davis RD, Folz RJ, Van Trigt P. Extracellular superoxide dismutase transgene overexpression preserves postischemic myocardial function in isolated murine hearts. Circulation. 1996;94(9 Suppl):II412-7. Hayakawa K, Takemura G, Kanoh M, Li Y, Koda M, Kawase Y, et al. Inhibition of granulation tissue cell apoptosis during the subacute stage of myocardial infarction improves cardiac remodeling and dysfunction at the chronic stage. Circulation. 2003;108(1):104-9, http://dx.doi.org/10. 1161/01.CIR.0000074225.62168.68. Liu JL, Irvine S, Reid IA, Patel KP, Zucker IH. Chronic exercise reduces sympathetic nerve activity in rabbits with pacing-induced heart failure: A role for angiotensin II. Circulation. 2000;102(15):1854-62, http://dx. doi.org/10.1161/01.CIR.102.15.1854. Melling CW, Thorp DB, Milne KJ, Krause MP, Noble EG. Exercisemediated regulation of Hsp70 expression following aerobic exercise

34.

35.

36. 37.

38.

39.

40.

41. 42. 43. 44.

45.

46. 47.

48.

49.

50.

51. 52.

53.

556

training. Am J Physiol Heart Circ Physiol. 2007;293(6):H3692-8, http:// dx.doi.org/10.1152/ajpheart.00827.2007. Gao L, Wang W, Liu D, Zucker IH. Exercise training normalizes sympathetic outflow by central antioxidant mechanisms in rabbits with pacing-induced chronic heart failure. Circulation. 2007;115(24):3095-102, http://dx.doi.org/10.1161/CIRCULATIONAHA.106.677989. Xu X, Zhao W, Wan W, Ji LL, Powers AS, Erikson JM, et al. Exercise training combined with angiotensin II receptor blockade reduces oxidative stress after myocardial infarction in rats. Exp Physiol. 2010;95(10):1008-15, http://dx.doi.org/10.1113/expphysiol.2010.054221. Soufi FG, Farajnia S, Aslanabadi N, Ahmadiasl N, Alipour M, Doustar Y, et al. Long-term exercise training affects age-induced changes in HSP70 and apoptosis in rat heart. Gen Physiol Biophys. 2008;27(4):263-70. Ziada AM, Hassan MO, Tahlilkar KI, Inuwa IM. Long-term exercise training and angiotensin-converting enzyme inhibition differentially enhance myocardial capillarization in the spontaneously hypertensive rat. J Hypertens. 2005;23(6):1233-40, http://dx.doi.org/10.1097/01.hjh. 0000170387.61579.ab. Pfeffer MA, Braunwald E. Ventricular remodeling after myocardial infarction. Experimental observations and clinical implications. Circulation. 1990;81(4):1161-72, http://dx.doi.org/10.1161/01.CIR.81.4. 1161. Oliveira RS, Ferreira JC, Gomes ER, Paixao NA, Rolim NP, Medeiros A, et al. Cardiac anti-remodelling effect of aerobic training is associated with a reduction in the calcineurin/NFAT signalling pathway in heart failure mice. J Physiol. 2009;587(Pt 15):3899-910, http://dx.doi.org/10. 1113/jphysiol.2009.173948. Veiga EC, Antonio EL, Bocalini DS, Murad N, Abreu LC, Tucci PJ, et al. Prior exercise training does not prevent acute cardiac alterations after myocardial infarction in female rats. Clinics. 2011;66(5):889-93, http:// dx.doi.org/10.1590/S1807-59322011000500028. Starnes JW, Taylor RP, Ciccolo JT. Habitual low-intensity exercise does not protect against myocardial dysfunction after ischemia in rats. Eur J Cardiovasc Prev Rehabil. 2005;12(2):169-74. Sutton MG, Sharpe N. Left ventricular remodeling after myocardial infarction: pathophysiology and therapy. Circulation. 2000;101(25):29818, http://dx.doi.org/10.1161/01.CIR.101.25.2981. Swynghedauw B. Molecular mechanisms of myocardial remodeling. Physiol Rev. 1999;79(1):215-62. Kemi OJ, Haram PM, Wisloff U, Ellingsen O. Aerobic fitness is associated with cardiomyocyte contractile capacity and endothelial function in exercise training and detraining. Circulation. 2004;109(23):2897-904, http://dx.doi.org/10.1161/01.CIR.0000129308.04757.72. Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, et al. Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004;94(1):110-8, http:// dx.doi.org/10.1161/01.RES.0000109415.17511.18. Heineke J, Molkentin JD. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat Rev Mol Cell Biol. 2006;7(8):589600, http://dx.doi.org/10.1038/nrm1983. DeBosch B, Treskov I, Lupu TS, Weinheimer C, Kovacs A, Courtois M, et al. Akt1 is required for physiological cardiac growth. Circulation. 2006;113(17):2097-104, http://dx.doi.org/10.1161/CIRCULATIONAHA. 105.595231. Kemi OJ, Ceci M, Wisloff U, Grimaldi S, Gallo P, Smith GL, et al. Activation or inactivation of cardiac Akt/mTOR signaling diverges physiological from pathological hypertrophy. Journal of cellular physiology. 2008;214(2):316-21, http://dx.doi.org/10.1002/jcp.21197. Wisloff U, Loennechen JP, Currie S, Smith GL, Ellingsen O. Aerobic exercise reduces cardiomyocyte hypertrophy and increases contractility, Ca2+ sensitivity and SERCA-2 in rat after myocardial infarction. Cardiovasc Res. 2002;54(1):162-74, http://dx.doi.org/10.1016/S00086363(01)00565-X. He X, Liu Y, Sharma V, Dirksen RT, Waugh R, Sheu SS, et al. ASK1 associates with troponin T and induces troponin T phosphorylation and contractile dysfunction in cardiomyocytes. The American journal of pathology. 2003;163(1):243-51, http://dx.doi.org/10.1016/S00029440(10)63647-4. Lee Y, Min K, Talbert EE, Kavazis AN, Smuder AJ, Willis WT, et al. Exercise protects cardiac mitochondria against ischemia-reperfusion injury. Med Sci Sports Exerc. 2012;44(3):397-405. Orenstein TL, Parker TG, Butany JW, Goodman JM, Dawood F, Wen WH, et al. Favorable left ventricular remodeling following large myocardial infarction by exercise training. Effect on ventricular morphology and gene expression. The Journal of clinical investigation. 1995;96(2):858-66, http://dx.doi.org/10.1172/JCI118132. Diffee GM, Nagle DF. Regional differences in effects of exercise training on contractile and biochemical properties of rat cardiac myocytes. J Appl Physiol. 2003;95(1):35-42.


BASIC RESEARCH

Effectiveness and safety of iodopovidone in an experimental pleurodesis model Lisete R. Teixeira,I Francisco S. Vargas,I Juliana Puka,I Milena M. P. Acencio,I Leila Antonangelo,I Ricardo M. Terra,II Francisco M. Damico,III Fabio G. Pitta,I Evaldo MarchiI,III I Faculdade de Medicina da Universidade de Sa˜o Paulo, Heart Institute (InCor), Pulmonary Division and Thoracic Surgery, Pleura Laboratory, Sa˜o Paulo/SP, Brazil. II Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Ophthalmology, Sa˜o Paulo/SP, Brazil. III Medical College of Jundiaı´ - Thoracic Surgery, Jundiaı´/SP, Brazil.

OBJECTIVES: Chemical pleurodesis is an important therapeutic tool to control recurrent malignant pleural effusion. Among the various sclerosing agents, iodopovidone is considered effective and safe. However, in a recent study, ocular changes were described after iodopovidone was used in recurrent pneumothorax. The aim of the study was to evaluate the efficacy and morbidity of iodopovidone pleurodesis in an experimental model. METHODS: New Zealand rabbits were submitted to intrapleural injection of iodopovidone at concentrations of 2%, 4% and 10%. Biochemical (lactic dehydrogenase, proteins, triiodothyronine, free thyroxine, urea and creatinine) and immunological (Interleukin-8 [IL-8], VEGF and TGFb) parameters were measured in the pleural fluid and blood. After 1, 3, 7, 14 and 28 days, groups of animals were euthanized, and macro- (pleura) and microscopic (pleura and retina) analyses were performed. RESULTS: An early pleural inflammatory response with low systemic repercussion was observed without corresponding changes in thyroid or renal function. The higher concentrations (4% and 10%) correlated with greater initial exudation, and maximum pleural thickening was observed after 28 days. No changes were observed in the retinal pigment epithelium of the rabbits. CONCLUSION: Iodopovidone is considered to be an effective and safe sclerosing agent in this animal model. However, its efficacy, tolerance and safety in humans should be further evaluated. KEYWORDS: Iodopovidone; Pleural Effusion; Pleural Inflammation; Pleurodesis; Pleural Diseases. Teixeira LR, Vargas FS, Puka J, Acencio MM, Antonangelo L, Terra RM, et al. Effectiveness and safety of iodopovidone in an experimental pleurodesis model. Clinics. 2013;68(4):557-562. Received for publication on September 13, 2012; First review completed on October 8, 2012; Accepted for publication on December 5, 2012 E-mail: lisetepneumo@yahoo.com.br Tel.: 55 11 98782-9068

These facts have stimulated clinical and experimental studies to reevaluate the effectiveness and safety of previously used sclerosing agents, such as iodopovidone, a topical antiseptic that is recognized as a safe (minimal side effects) and effective (.90%) (5), although visual loss has been reported by Wagenfeld et al. (6). It should be highlighted that the dose reported in this study was higher than the standard dose that has been used in other clinical studies (7-9). The purpose of this study was to evaluate pleurodesis development in an animal model and to analyze the possible systemic effects after intrapleurally injecting iodopovidone.

& INTRODUCTION Despite the preferential use of long-term catheters to control recurrent malignant pleural effusions, chemical pleurodesis persists as an important therapeutic tool. The ideal sclerosing agent should be inexpensive, widely available and easily managed, in addition to low morbidity and the absence of mortality. Although pleurodesis was first performed at the beginning of the 20th century using silver nitrate, talc progressively gained wide preference (1,2). Nevertheless, despite impressive results, the heterogeneity of talc particles has been implicated in causing undesirable side effects, sometimes culminating in respiratory failure and death (3,4).

& MATERIALS AND METHODS This project was developed at the Pleura Laboratory of the Pulmonary Division of the Heart Institute (HC-FMUSP) after approval by the Ethics Committee Board. New Zealand rabbits (2.0-3.0 kg) were randomized and subdivided into groups (five animals each) according to the time of euthanasia (1, 3, 7, 14 or 28 days). As previously described, the animals were submitted to sedation and analgesia (35 mg/kg of ketamine hydrochloride

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)19

557


Pleurodesis induced by iodopovidone Teixeira LR et al.

CLINICS 2013;68(4):557-562

pleural exudation was observed, with maximum fluid drainage at seven days (2%, 23 mL [11-46 mL], p = 0.035; 4%, 34 mL [32-44 mL], p = 0.003 and 10%, 43 mL [29-49 mL], p = 0.004). On the first (p,0.001) and third (p = 0.045) days following the pleural injection, the fluid produced with 4% and 10% iodine was superior to that produced with 2% iodine. After the seventh day, the pleural fluid markedly diminished in the majority of the animals, regardless of the concentration; this result precluded the statistical analyses in the groups. There were no differences in the protein levels among the groups. Regardless of the injected concentration, a marked elevation of lactic dehydrogenase was evident only in the pleural fluid. Twenty-four hours following the instillation, the levels were significantly greater than those obtained after three days (2%, p,0.001; 4%, p = 0.003 and 10%, p = 0.002) or seven days (2%, p,0.001; 4%, p = 0.003 and 10%, p = 0.002). Cytokine behavior is shown in Table 1. When the cytokine levels in the pleural fluid and blood were compared on the first day after injection, the IL-8 pleural was greater (2%, p = 0.003; 4%, p = 0.015 and 10%, p,0.001). After this initial increment, the pleural levels decreased beginning with the third day and stabilized until the seventh day. At this time, the IL-8 values were lower than those obtained in the blood (4%, p,0.001 and 10%, p = 0.049). In all of the evaluated periods, the serum levels were significantly greater than the baseline level of 26 pg/mL (16-55). In relation to VEGF (Table 1), the pleural values exceeded the serum value of 31 (31-34) during the entire study period. This cytokine was differentially expressed compared to IL-8, with the maximum expression reached on day seven (2%, p = 0.017; 4%, p = 0.003 and 10%, p = 0.004). The pleural levels of TGF-b1 were significantly greater than those obtained in the serum at 4% or 10% concentrations on the third (4%, p = 0.022 and 10%, p,0.001) and seventh days (4%, p = 0.041 and 10%, p,0.001). The temporal analysis of the pleural fluid revealed stable values for the 2% concentration. At higher concentrations, we observed a progressive increase of the fluid levels (p,0.001). The serum values were also significantly greater than the baseline level of 286 (244-313) in all of the evaluated periods (Table 1). Analysis of thyroid hormones and renal function markers (Figure 2) showed no significant differences among the groups during the study period. Furthermore, the results did not differ from the baseline values. Analysis of macroscopic pleural adhesions demonstrated a progressive increase over time and was more pronounced in the animals injected with 4% or 10% iodine. Analogous behavior was observed for visceral pleural thickening, which was more pronounced at increased concentrations of the sclerosing agent (Figure 3). Finally, the morphological analysis of the retina showed no changes related to time or iodine concentration. We did not observe any edemas or alterations in retinal pigment epithelium (atrophy or hypertrophy) or in photoreceptors. Cells from the intermediate and internal retina were also within the normal limits. No macro or microscopic changes were observed in the left hemithorax (not injected, used as control).

[Cristalia, Brazil] and 5 mg/kg of xylazine hydrochloride [Bayer, Brazil]) (10-12). Next, trichotomy of the right hemithorax and antisepsis were performed; a 0.5 cm incision (hemiclavicular line) was then made over the projection of the sixth rib. A catheter (8 Fr) was then tunneled into the subcutaneous tissue, and after exposing the parietal pleura, it was inserted into the cavity and attached to the skin. Through the catheter, 2 mL of iodopovidone (Rioquimica, Brazil) was injected at 2%, 4% or 10% concentrations. The left hemithorax (not injected) was used as a control. Every 24 hours, the drain was aspirated, and the pleural fluid was quantified and stored with concurrently collected blood samples. The drain was removed after the seventh day, when the fluid drainage was ,1 mL/day. At the predetermined times, the animals were euthanized; the thorax was removed en bloc, and the lungs were expanded and maintained submersed (10% formalin) for 48 hours. Next, the pleural cavity was exposed for macroscopic evaluation (10-12). For histological analysis of the retina, the rabbit eyes were enucleated and fixed (10% formalin) for slide preparation and Hematoxylin & Eosin (H&E) staining. Lactic dehydrogenase (kinetic UV method), total protein (Biuret method), and the Interleukin-8 (IL-8), VEGF and TGFb1 (ELISA method) cytokines were quantified in the blood and pleural fluid. Thyroid hormone levels (triiodothyronine and free thyroxine) in the blood was detected using chemiluminescence (ImmuLITE 2000, Siemens, Erlangen, Germany), and the levels of renal function markers (urea and creatinine) were determined with the kinetic UV method. Baseline serum levels were obtained from the rabbits prior to iodopovidone treatment and were used as the control. Macroscopic and microscopic evaluations were performed according to previously described methodology (10-12). A consensus grading of the macroscopic adhesions was reached by two investigators (LRT and JP) who were blinded with respect to the treatment group using the semi-quantitative scheme: (0) normal pleural space, (1) 1-3 small adherences, (2) over 3 adherences in which the lung can easily be separated from the thorax, (3) generalized adhesions (containing areas where the lung could only be separated from the thoracic wall with difficulty) and (4) complete obliteration of the pleural space by adhesions. The pleura visceral fragments were processed, stained (hematoxylin–eosin), and evaluated for the presence of thickening using grades from 0-4: 0 = none, 1 = equivocal, 2 = mild, 3 = moderate and 4 = marked changes. The microscopic analysis was performed by two examiners (LA and MMPA) who were blinded to the treatment. Retina fragments were also H&E stained and analyzed with light microscopy by two independent investigators (LRT and FMD).

Statistical Analysis The results are presented as median and interquartile range (25%-75%). Comparisons among the three groups were performed using non-parametric tests (the MannWhitney rank sum test or Kruskal-Wallis analysis of variance on ranks). A value of p,0.05 was considered significant. The SigmaStat 3.1 (Systat, CA, USA) program was used for the analyses.

& DISCUSSION & RESULTS

This study shows that the intrapleural injection of iodopovidone causes an early pleural inflammatory response with low systemic repercussion and no detectable

Figure 1 shows the characteristics of the inflammatory response after the iodopovidone instillation. Progressive

558


CLINICS 2013;68(4):557-562

Pleurodesis induced by iodopovidone Teixeira LR et al.

Figure 1 - Results (median and interquartile range 25%-75%) of the pleural fluid volume and biochemical analyses during the acute phase of the iodopovidone intrapleural injection (1, 3 and 7 days). (a) The volume of pleural fluid collected. (b) The total protein levels in the pleural fluid. (c) Lactic dehydrogenase in the pleural fluid. (d) Lactic dehydrogenase levels in the blood.

Table 1 - The median and interquartile (25%-75%) f cytokine levels in the pleural fluid and blood during the acute phase of iodopovidone intrapleural injection (1, 3 and 7 days), p,0.05 (*vs. day 1; # vs. day3; 1 vs. 2%). Pleural Fluid 2% IL-8 (pg/mL) Basal Day 1 2866 (2779-3459) Day 3 1083 (874-1107)* Day 7 776 (535-953)* p 0.007 VEGF (pg/mL) Basal Day 1 332 (233-583) Day 3 602 (516-656) Day 7 1483 (610-1545)* p 0.017 TGF-b1 (pg/mL) Basal Day 1 774 (701-872) Day 3 1164 (506-1443) Day 7 989 (448-1585) p 0.794

4%

Blood 10%

p

2%

4253 (3292-4443) 1189 (617-1551)* 761 (662-1475)* ,0.001

0.587 0.733 0.455

626 (527-763) 462 (428-950) 1882 (1783-2959)* 0.003

525 (470-889) 1192 (793-1304) 2627 (1717-3420)* 0.004

0.117 0.069 0.064

34 (30-37) 45 (31-45) 31 (31-41)* 0.833

0.217 0.031 0.020

444 (31-523) 736 (526-818) 786 (633-959) 0.067

559

10%

26 (16-55) 1362 (1083-1703) 1344 (1022-1531) 1664 (1557-2115) 875 (556-1684) 1395 (978-1695) 1981 (1796-2062) 1121 (402-1973) 1270 (988-1343) 2321 (1173-2642) 0.849 0.913 0.802

3961 (2044-4273) 921 (883-990)* 747 (630-818)* 0.003

862 (601-965) 972 (764-1354) 1315 (1234-1406)* 1726 (1624-2028)*1 2128 (2104-2196)*#1 2439 (2064-2530)*#1 ,0.001 ,0.001

4%

31 53 49 44

286 382 580 710

(31-34) (39-56) (36-84) (37-45) 0.846 (244-313) (346-512) (493-1021) (636-841) 0.027

p

0.121 0.101 0.289

33 (22-54) 85 (53-94) 67 (49-110) 0.323

0.629 0.328 0.264

875 (826-927) 853 (674-902) 851 (533-1005) 0.066

0.009 0.837 0.912


Pleurodesis induced by iodopovidone Teixeira LR et al.

CLINICS 2013;68(4):557-562

Figure 2 - The median and interquartile range (25%-75%) of renal function markers and thyroid hormones in the blood during the study period (1-28 days). (a) The blood levels of urea, (b) creatinine, (c) Triiodothyronine and (d) free thyroxine.

Figure 3 - The median and interquartile range (25%-75%) of the evaluation of macroscopic pleural adhesions and microscopic thickening after intrapleural iodopovidone during the study period (1 to –28 days). (a) Macroscopic adhesions evaluated using a 0-4 score. (b) Microscopic pleural thickness using a 0-4 score.

560


CLINICS 2013;68(4):557-562

Pleurodesis induced by iodopovidone Teixeira LR et al.

a framework of adhesions with temporal progression and complete disappearance of the pleural cavity after 28 days. In terms of the eventual side effects caused by iodopovidone, we did not observe any severe damage. Corroborating our findings, in a meta-analysis of observational studies, Agarwal et al. (5) demonstrated the efficacy and safety of iodopovidone pleurodesis reporting an absence of deaths. The most significant complication reported was varying degrees of chest pain. Systemic hypotension was reported in one study. Although this review supports the safety and efficacy of iodopovidone as an agent for chemical pleurodesis, no comments regarding dosage or concentration have been mentioned. However, in 2000, Singalavanija et al. (20) described five patients who presented higher serum creatinine levels and retinal damage with visual impairment after mistakenly ingesting potassium iodine orally at high concentrations. The authors concluded that potassium iodine is a chemical substance that in high doses can induce toxic effects on the retina, thereby damaging the retinal epithelium and photoreceptors cells. Recently, Wagenfeld et al. (6) described visual loss resulting from the breakdown of the diffusion barrier of the retinal pigment epithelium in three patients who received a 10% iodopovidone solution during thoracoscopic surgery. Note that the dose and the volume of iodopovidone used in this procedure were much greater than that normally recommended. Although our study has been conducted on a small number of animals, we did not find changes or damage in the retinal pigment epithelium of any rabbit, even at the highest concentration (10%) of iodopovidone. Another side effect that should be considered is a possible thyroid blockage. Kovacikova et al. (21) reported that iodopovidone, either in topical use or as contrast in image procedures, may cause transient thyroid dysfunction, mainly in children. High concentrations of exogenous iodine are capable of diminishing thyroid hormone synthesis or induce thyrotoxicosis in susceptible individuals (22). However, Yeginsu et al. (23) reported that the intrapleural administration of 100 mL of 2% iodopovidone did not affect thyroid hormone levels in humans. Although our study was conducted in an animal model, we did not find abnormal results in thyroid hormone levels, even in high concentrations. In conclusion, our findings suggest that iodopovidone is an effective and safe sclerosing agent. Further studies in humans should be conducted to determine the ideal dose and concentration.

side effects in our animal model. The higher iodine concentrations (4% and 10%) resulted in an early increase in pleural fluid production and more pronounced pleural adhesions and thickening. Finally, iodopovidone, in the studied concentrations, did not induce thyroid or renal function changes or anatomical changes in the retinal structure. The mechanisms involved in pleural symphysis are not completely known. Introducing a sclerosing agent into the pleural space is known to damage the mesothelial cell monolayer and trigger an inflammatory response that is characterized by a neutrophilic exudate (13-15). The subsequent events culminate with fibrotic adhesion development between the pleural surfaces and the consequent obliteration of the cavity. Among the factors involved in the inflammatory response, we highlight mesothelial cell injury, the collagen-secreting capacity of these cells and the fibroblasts, the equilibrium between metalloproteinases and plasminogen activators and the relationship between cytokines and fibrinolysis (16). Iodopovidone should be considered in addition to other sclerosing agents used in clinical practice, as it is universally found, easily manipulated and low cost (approximately $8 USD per 500 mL). Iodopovidone was introduced in the 1990s (17) and has an approximately 90% effectiveness (7-9). Similar to other agents, the produced pleural symphysis is most likely related to the injury of the mesothelial cells, which are initially exteriorized by a progressive production of pleural fluid with inflammatory characteristics. During the first 24 hours after the iodine injection, an expressive elevation of intrapleural lactic dehydrogenase, which has a tendency to decrease over time, was identified; the systemic repercussions were minimal. Guo et al. (18) reported similar results after intrapleurally injecting iodine at 2% or 4% concentrations, and Marchi et al. (19), who induced experimental pleurodesis with talc or silver nitrate, also obtained an early decrease in serum lactic dehydrogenase, which reflected a local inflammatory response. IL-8, an important mediator of the inflammatory process, shows similar behavior to lactic dehydrogenase. Regardless of the iodine concentration, pleural fluid IL-8 levels increased early during the first 24 hours and progressively decreased over time. In the serum, the IL-8 levels were stable but greater than the basal values. VEGF carries out multiple functions. In addition to participating in the initial inflammatory process in which VEGF stimulates the activation of mediators and facilitates the migration of inflammatory cells, it has an important role in vascular permeability, and, therefore, in pleural effusion production (12). In this study, we observed a progressive and accentuated elevation in pleural fluid, with minimal serum increase. Note the correspondence between VEGF and the intrapleural accumulation of fluid, which reinforces the role of VEGF in pleural effusion formation. Finally, TGF-b is also recognized for its multiple roles, mainly in collagen deposition and fibrosis formation (16). Although TGF-b expression largely paralleled VEGF expression in the pleural cavity, the TGF-b serum levels throughout the study period were greater compared to the values obtained before treatment. This behavior allowed us to consider its participation in pleurodesis formation. The result of this complex inflammatory process is pleural symphysis. We have demonstrated that the intrapleural injection of iodopovidone promotes, from the first 24 hours,

& ACKNOWLEDGMENTS We thank biologists Carlos SR Silva and Vanessa Alvarenga and physicians Vivian Ribeiro, Flavio Zelada, Natalia Novaes and Renato AEK Matsumoto for their assistance with animal care and sample preparation and storage. Financial support: Research Support Foundation of the State of SaËœo Paulo (FAPESP) and the National Research Council (CNPq), Brazil.

& AUTHOR CONTRIBUTIONS Teixeira LR conceived and designed the study, participated in all of the experimental stages, composition of the manuscript. Vargas SF prepared the figures, statistical analysis and final composition of the manuscript. Puka J, Pitta FG participated in all of the experimental stages. D’Amico FM was responsible for the retinal tissue analysis. Acencio MM was responsible for the laboratorial support and orientation of the statistical study. Antonangelo L was responsible for the laboratorial support,

561


Pleurodesis induced by iodopovidone Teixeira LR et al.

CLINICS 2013;68(4):557-562

12. Ribeiro SC, Vargas FS, Antonangelo L, Marchi E, Genofre EH, Acencio MM, et al. Monoclonal anti-vascular endothelial growth factor antibody reduces fluid volume in an experimental model of inflammatory pleural effusion. Respirology. 2009;14(8):1188-93, http://dx.doi.org/10.1111/j. 1440-1843.2009.01628.x. 13. Kennedy L, Harley RA, Sahn SA, Strange C. Talc slurry pleurodesis. Pleural fluid and histologic analysis. Chest. 1995;107(6):1707-12, http:// dx.doi.org/10.1378/chest.107.6.1707. 14. Xie C, Teixeira LR, McGovern JP, Light RW. Systemic corticosteroids decrease the effectiveness of talc pleurodesis. Am J Respir Crit Care Med. 1998;157(5 Pt 1):1441-4. 15. Sahn SA, Good JT. The effect of common sclerosing agents on the rabbit pleura space. Am Rev Respir Dis. 1981;124(1):65-7. 16. Lee YCG, Devin CJ, Teixeira LR, Rogers JT, Thompson PJ, Lane KB, et al. Transforming growth factor 2 induced pleurodesis is not inhibited by corticosteroids. Thorax. 2001;56(8):643-8, http://dx.doi.org/10.1136/ thorax.56.8.643. 17. Echavarrı´a A, Pinzo´n V, Bare´s JP, Ferna´ndez E. Intracavitary treatment of malignant pleural effusion with iodine-povidone. Rev Med Panama. 1991;16(1):69-74. 18. Guo Y, Tang K, Bilaceroglu S, Kalomenidis I, Salleng KJ, Lane KB, et al. Iodopovidone is as effective as doxycycline in producing pleurodesis in rabbits. Respirology. 2010;15(1):119-25, http://dx.doi.org/10.1111/j. 1440-1843.2009.01671.x. 19. Marchi E, Vargas FS, Acencio MM, Antonangelo L, Teixeira LR, Genofre EH, et al. Talc and silver nitrate induce systemic inflammatory effects during the acute phase of experimental pleurodesis in rabbits. Chest. 2004;125(6):2268-77, http://dx.doi.org/10.1378/chest.125.6.2268. 20. Singalavanija A, Ruangvaravate N, Dulayajinda D. Potassium Iodate toxic retinopathy. A report of five cases. Retina. 2000;20(4):378-83. 21. Kovacikova L, Kunovsky P, Lakomy M, Skrak P, Misikova Z, Siman J, et al. Thyroid hormone status after cardiac surgery in infants with delayed sternal closure and continued use of cutaneous povidone-iodine. Endocr Regul. 2003;37(1):3-9. 22. Bryant WP, Zimmerman D. Iodine-induced hyperthyroidism in a newborn. Pediatrics. 1995;95(1):434-36. 23. Yeginsu A, Karamustafaoglu A, Ozugurlu F, Etikan I. Iodopovidone pleurodesis does not effect thyroid function in normal adults. Interact Cardiovasc Thorac Surg. 2007;6(4):563-6, http://dx.doi.org/10.1510/ icvts.2007.154914.

interpretation of the results. Terra RM, Macchi E designed the study and were responsible for the data analysis.

& REFERENCES 1. Brock RC. The use of silver nitrate in the production of aseptic obliterative pleuritis. Guys Hosp Rep. 1942;91:99-103. 2. Milanez RC, Vargas FS, Filomeno LB, Teixeira LR, Fernandez A, Jatene F, et al. Intrapleural talc for the treatment of malignant pleural effusions secondary to breast cancer. Cancer. 1995;75(1):2688-92, http://dx.doi. org/10.1002/1097-0142(19950601)75:11,2688::AID-CNCR2820751108.3. 0.CO;2-3. 3. Brant A, Eaton T. Serious complications with talc slurry pleurodesis. Respirology. 2001;6(3):181-5, http://dx.doi.org/10.1046/j.1440-1843. 2001.00327.x. 4. Genofre EH, Marchi E, Vargas FS. Inflammation and clinical repercussions of pleurodesis induced by intrapleural talc administration. Clinics. 2007;62(5):627-34, http://dx.doi.org/10.1590/S1807-59322007000500015. 5. Agarwal R, Aggarwal AN, Gupta D, Jindal SK. Efficacy and safety of iodopovidone in chemical pleurodesis: A meta-analysis of observational studies . Respir Med. 2006;100(11):2043-7, http://dx.doi.org/10.1016/j. rmed.2006.02.009. 6. Wagenfeld L, Zeitz O, Richard G. Visual loss after povidone-iodine pleurodesis. N Engl J Med. 2007;357(12):1264-5. 7. Olivares-Torres CA, Laniado-Laborin R, Chavez-Garcia C, Light RW. Iodopovidone pleurodesis for recurrent pleural effusions. Chest. 2002;122(2):581-3, http://dx.doi.org/10.1378/chest.122.2.581. 8. Agarwal R, Aggarwal AN, Gupta D. Efficacy and safety of iodopovidone pleurodesis through tube thoracostomy. Respirology. 2006;11(1):105-08, http://dx.doi.org/10.1111/j.1440-1843.2006.00792.x. 9. Neto JDA, Oliveira SFQ, Vianna SP, Terra RM. Efficacy and safety of iodopovidone pleurodesis in malignant pleural effusions. Respirology. 2010;15(1):115-8, http://dx.doi.org/10.1111/j.1440-1843.2009.01663.x. 10. Teixeira LR, Vargas FS, Acencio MM, Ribeiro SC, Sales RK, Antonangelo L, et al. Blockage of vascular endothelial growth factor (VEGF) reduces experimental pleurodesis. Lung Cancer. 2011;74(3):392-5, http://dx.doi. org/10.1016/j.lungcan.2011.04.015. 11. Teixeira LR, Vargas FS, Acencio MM, Bumlai RU, Antonangelo L, Marchi E. Experimental pleurodesis induced by antibiotics (macrolides or quinolones). Clinics. 2006;61(6):559-64.

562


BASIC RESEARCH

Methodological quality of systematic reviews and clinical trials on women’s health published in a Brazilian evidence-based health journal Cristiane Rufino Macedo, Rachel Riera, Maria Regina Torloni Brazilian Cochrane Center, Sa˜o Paulo/SP, Brazil.

OBJECTIVES: To assess the quality of systematic reviews and clinical trials on women’s health recently published in a Brazilian evidence-based health journal. METHOD: All systematic reviews and clinical trials on women’s health published in the last five years in the Brazilian Journal of Evidence-based Health were retrieved. Two independent reviewers critically assessed the methodological quality of reviews and trials using AMSTAR and the Cochrane Risk of Bias Table, respectively. RESULTS: Systematic reviews and clinical trials accounted for less than 10% of the 61 original studies on women’s health published in the Sa˜o Paulo Medical Journal over the last five years. All five reviews were considered to be of moderate quality; the worst domains were publication bias and the appropriate use of study quality in formulating conclusions. All three clinical trials were judged to have a high risk of bias. The participant blinding, personnel and outcome assessors and allocation concealment domains had the worst scores. CONCLUSIONS: Most of the systematic reviews and clinical trials on women’s health recently published in a Brazilian evidence-based journal are of low to moderate quality. The quality of these types of studies needs improvement. KEYWORDS: Evidence-Based Medicine; Women’s Health; Review; Clinical Trial; Research Design. Macedo CR, Riera R, Torloni MR. Methodological quality of systematic reviews and clinical trials on women’s health published in a Brazilian evidence-based health journal. Clinics. 2013;68(4):563-567. Received for publication on December 4, 2012; First review completed on December 5, 2012; Accepted for publication on December 23, 2012 E-mail: rachelriera@hotmail.com Tel.: 55 11 5575-2970

are considered the highest level of evidence (3), the quality of their methodology is not homogeneous, and these publications should be as rigorously evaluated as other types of studies (4). Thus, readers and users of SRs and CTs should maintain a critical perspective and look carefully at the methodological quality of the existing publications. SRs involve an exhaustive review of the literature to answer a clearly defined clinical question using a systematic, transparent and explicit methodology to identify, select, critically appraise and synthesize all of the existing evidence (4). Conducting an SR is a complex task, and flaws are possible in this process; these factors lead to variations in the quality of published SRs. A CT is a difficult study and frequently involves a considerable number of researchers and patients to answer a question on treatment or prevention. In an attempt to avoid or minimize bias, a rigorous methodology must be used. However, despite this rigor, bias can compromise findings, and readers must keep this in mind. There is scarce literature on the quality of Brazilian SRs and CTs in general and, to the best of our knowledge, there have been no previous studies that analyzed the methodological quality of these types of studies on women’s health.

& INTRODUCTION According to official data from a survey conducted in 2011 by the Brazilian Federal Medical Council, there are 204,563 practicing physicians in the country, 167,225 of whom are specialists. Obstetricians-gynecologists (OBGYN) account for approximately 12% (22,815) of these specialists, second only to pediatricians (27,232) (1). OBGYNs are directly responsible for over 5 million pregnancies that occur each year in the country, in addition to the care of over 97 million women in Brazil (2). The importance of the continued medical education of these physicians and of ensuring their access to the best possible evidence is unquestionable. Articles published in medical journals are important sources of information and medical education for OB-GYNs and clinicians in general. Although systematic reviews (SRs) and clinical trials (CTs)

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. DOI: 10.6061/clinics/2013(04)20

563


Methodological quality of women’s health articles Macedo CR et al.

CLINICS 2013;68(4):563-567

Therefore, we set out to critically assess the quality of SRs and CTs on women’s health recently published in a Brazilian medical journal.

including five SRs and three CTs. All SRs were on gynecological topics: teriparatide for osteoporosis in postmenopausal women (10), lapatinib for advanced or metastasized breast cancer (11), comparative evaluation of digital mammography and film mammography (12), colposcopic triage methods for grade 3 cervical intraepithelial neoplasia (CIN3) after a cytopathological diagnosis of a low-grade squamous intraepithelial lesion (13) and risk of persistent high-grade squamous intraepithelial lesion after an electrosurgical excision with positive margins (14). Three of the reviews focused on treatment (10,11,14), and two focused on diagnosis (12,13). Three of these SRs presented metaanalyses of their results (10,13,14). The CTs were on ropivacaine plus clonidine for labor analgesia (15), upper limb rehabilitation after breast cancer mastectomy with preservation of the medial pectoral nerve (16) and pelvic floor muscle training versus hypopressive exercises for pelvic organ prolapse (17).

& MATERIALS AND METHODS This observational study was performed by researchers of the Brazilian Cochrane Center. Two independent investigators manually reviewed all electronic issues of the Sa˜o Paulo Medical Journal (SPMJ-Brazilian Journal of Evidence-based Health) published between 2008 and 2012 and available through the SciELO database. All SRs and CTs focused on women’s health were eligible for inclusion. The methodological quality and risk of bias of these articles were assessed independently by each of the investigators. The results were compared, and differences in ratings were discussed until a consensus was reached. In the case of disagreement, a third investigator was consulted. To assess the quality of SRs, the authors used the AMSTAR tool, which consists of 11 items that are rated as 0 or 1 (5). This tool has good face and content validity for measuring the methodological quality of SRs and requires approximately 10–15 minutes for completion (6). AMSTAR has an acceptable inter-rater agreement of the individual items, with a mean kappa of 0.70 (95% confidence interval: 0.57, 0.83). The intraclass correlation coefficient is 0.84 (95% confidence interval: 0.65, 0.92) (7). Using this tool, we classified the following 11 items for each SR: 1. a priori design; 2. duplicate study selection and data extraction; 3. comprehensive literature search; 4. inclusive publication status; 5. included/excluded studies provided; 6. characteristics of included studies provided; 7. quality assessment of studies; 8. study quality used appropriately in formulating conclusions; 9. appropriate methods used to combine studies; 10. publication bias assessed; and 11. conflict of interest stated. Each of these items was classified as ‘‘Yes,’’ ‘‘No,’’ ‘‘Can’t answer’’ or ‘‘Not applicable’’. We calculated the AMSTAR final score by adding one point for each ‘‘Yes’’ answer and no points for all other answers resulting in summary scores ranging from 0 to 11. For rating the overall quality of the SR, the following categories were used: 0–4 = low-quality SR, 5–8 = moderatequality SR and 9–11 = high-quality SR (8). To assess the quality of CTs, the authors used the Risk of Bias Table, which was developed by the Cochrane Collaboration and is available in the Cochrane Handbook (9). This tool consists of seven domains: i) sequence generation, ii) allocation concealment, iii) blinding of participants and personnel, iv) blinding of outcome assessors, v) incomplete outcome data, vi) selective reporting and vii) other sources of bias. These domains are classified as ‘‘Yes’’ (i.e., low risk of bias), ‘‘Unclear’’ (i.e., uncertain risk of bias) or ‘‘No’’ (i.e., high risk of bias). As recommended by the Cochrane Handbook, the overall classification of each CT was based on the rating of the first four domains (9). A study was classified as having a high risk of bias when at least one of the answers to these four items was ‘‘No.’’ When at least one of the answers to these four items was ‘‘Unclear,’’ the trial was classified as being at an unclear or moderate risk of bias.

Description of the evidence presented in systematic reviews Teriparatide in postmenopausal women with osteoporosis. The authors analyzed five randomized trials

involving 3,504 women and concluded that compared to placebo, the intermittent administration of 20 or 40 mg of teriparatide reduced new vertebral and non-vertebral fractures and improved whole-body and lumbar bone mineral density without serious adverse effects. Teriparatide (40 mg) was more effective than alendronate (10 mg/day) in increasing whole-body, femoral and lumbar bone mineral density but was similar to alendronate regarding the occurrence of new fractures (10). Lapatinib for the treatment of advanced or metastasized breast cancer. The authors identified only one trial that

fulfilled the selection criteria, which included 324 women. The review concluded that the combination of lapatinib plus capecitabine was more effective than capecitabine monotherapy for reducing the risk of cancer progression. However, the authors emphasized the need for more randomized clinical trials to assess the effectiveness of lapatinib alone or in association with other drugs as first- or second-line treatments for advanced breast cancer (11).

Comparative evaluation of digital versus film mammography This review included 11 studies and involved 190,322 digital and 638,348 film mammographies. The authors concluded that digital mammography was slightly more effective than film mammography in terms of cancer detection rates. There were no significant differences in recall rates between the two diagnostic methods, and the characteristics of the tumors were similar in patients screened by either type of mammography (12). Colposcopic triage methods for detecting CIN3 after a cytopathological diagnosis of low-grade squamous intraepithelial lesions. Three studies involving a total of

1,766 women fulfilled the selection criteria and were included in the review. The authors concluded that there is currently no scientific evidence to support the hypothesis that colposcopic triage using oncogenic human papilloma virus (HPV)-DNA testing to detect CIN3 is better than repeated cytological tests for women with low-grade squamous intraepithelial lesions aged 35 years and older (13).

& RESULTS The SPMJ publishes six editions per year, with an average of 11 articles per edition. Between the beginning of 2008 and the third edition of 2012, a total of 196 articles were published, of which 61 were related to women’s health,

564


CLINICS 2013;68(4):563-567

Methodological quality of women’s health articles Macedo CR et al.

Risk of persistent high-grade squamous intraepithelial lesions after electrosurgical excisional treatment with positive margins. This review included four studies with

Table 1 - Methodological quality of systematic reviews focusing on women’s health published in the Sa˜o Paulo Medical Journal between the beginning of 2008 and 2012.

a total of 1,209 women. The authors concluded that the risk of residual disease one year after electrosurgical excisional treatment was approximately 11-fold higher in cases with positive margins compared with cases with negative margins. Patients with positive margins had a 29.4% absolute risk of residual lesions during the first year and a 6% risk during the second year after the procedure. The authors emphasized that to reduce the risks of residual disease, attention should be given to correct indications, appropriate surgical procedures, correct processing of the excised specimen and appropriate choice of treatment. This treatment choice should be individualized for each case. The authors also recommended that additional studies were needed to determine the best strategy for following up these patients, particularly during the first year after excision (14).

AMSTAR item*

Systematic review 1 2 3 4 5 6 7 8 9 10 11 Total Trevisani et al. (10) Riera et al. (11) Iared et al. (12) Correa et al. (13) Oliveira et al. (14)

1 1 1 1 1

1 0 1 0 0

1 1 1 1 1

1 1 1 1 1

1 0 1 0 0

1 1 1 1 1

0 1 0 1 0

0 0 0 0 0

0 0 1 0 1

0 0 0 0 0

1 1 1 1 1

7 6 8 6 6

Overall Quality Moderate Moderate Moderate Moderate Moderate

*

AMSTAR (a measurement tool to assess systematic reviews) items are: 1. a priori design; 2. duplicate study selection and data extraction; 3. comprehensive literature search; 4. inclusive publication status; 5. list of included/excluded studies provided; 6. characteristics of included studies provided; 7. quality assessment of studies; 8. study quality used appropriately in formulating conclusions; 9. appropriate methods used to combine studies; 10. publication bias assessed; and 11. conflict of interest stated. Scale for item score: 1 = ‘‘Yes,’’ 0 = ‘‘No,’’ ‘‘Can’t answer’’ or ‘‘Not applicable.’’ The following categories were used to rate the overall quality of the reviews: score of 0–4 = low quality; 5–8 = moderate quality; and 9–11 = high quality (8).

Description of evidence from clinical trials Labor analgesia with ropivacaine added to clonidine. The authors randomized 32 women in labor to epidural analgesia with either 15 ml of ropivacaine 0.125% or 15 ml of ropivacaine 0.0625% plus 75 mg clonidine. The authors then assessed maternal pain and neonatal effects. They concluded that the pain score, sensory block level, duration of epidural analgesia and Apgar scores did not differ significantly between the two groups. However, infants of mothers who received only ropivacaine had better neurological and adaptative capacity scores (15).

and clearly stated that duplicate study selection and data extraction had been performed. Only two SRs assessed the quality of included CTs: Riera et al. (11) used the Cochrane risk of bias table (9), and Iared et al. (12) used the Quality Assessment of Diagnostic Accuracy Studies (QUADAS) tool (18). Finally, only two SRs used an appropriate method to combine studies (12,14). As presented in Table 2 and summarized in Figure 1, three CTs were classified as having a high risk of bias. One CT (15) did not provide information on sequence generation (selection bias), and two (16,17) did not report outcome assessors (detection bias) or blind the participants and personnel (performance bias).

Preservation of the medial pectoral nerve following mastectomy due to breast cancer: impact on upper limb rehabilitation. The authors of this study randomized 30

women with breast cancer to undergo modified mastectomy with either preservation or sectioning of the medial pectoral nerve. They assessed pectoral muscle strength and mass after day 43. The women who underwent nerve preservation had significantly higher muscle strength than those who underwent nerve sectioning. No differences in muscle mass or in abduction and flexion capacities of the homolateral shoulder were identified between the groups (16).

& DISCUSSION

Pelvic floor muscle training and hypopressive exercises for treating pelvic organ prolapse in women. The authors

One of the most frequent methodological flaws of the SRs was the failure to assess the quality of the studies. Authors of SRs should grade the quality of their recommendations and the strength of the evidence presented, which inevitably depend on the quality of the original studies included in the review. Out of the five published reviews, only two (11,13) provided quality assessments of the primary studies, and none mentioned this assessment in their conclusions. Another frequent flaw was the failure to assess publication bias, which was not investigated by any of the five reviews. However, it should be noted that all of the reviews that received a ‘‘zero’’ on the publication bias AMSTAR item received this score because it was impossible to assess their publication bias. Several SRs had no meta-analyses, and in those studies where meta-analyses were performed, the graphics included less than ten CTs. In this case, funnel plot analyses to investigate publication bias are not recommended by the Cochrane Handbook instructions (9). Authoritative sources such as the Cochrane Handbook (9) and PRISMA (19) guidelines emphasize that duplicate study selection and data extraction are important for minimizing the risk of bias in the selection of studies and the risk of errors while transcribing data from the original studies.

randomized 58 women with grade II pelvic prolapse to either pelvic floor muscle training, hypopressive exercise or a control group. At baseline and at 12 weeks after the intervention, the authors used ultrasound to assess the cross-sectional area of the levator ani muscle. They reported a significant increase in this measurement in both intervention groups but not in the control group. The authors concluded that physiotherapy is effective in increasing the cross-sectional area of the levator ani muscle in women with pelvic organ prolapse and that both modalities of physiotherapy are equally effective (17).

Critical appraisal of included studies As depicted in Table 1, all five SRs mentioned an a priori design, a comprehensive literature search and an inclusive publication status and provided characteristics of included studies and declared whether conflicts of interest were present. On the other hand, none of the reviews considered or mentioned the quality of included trials at formulating their conclusions nor did they assess publication bias. Only two SRs (10,12) provided a list of included/excluded studies

565


Methodological quality of women’s health articles Macedo CR et al.

CLINICS 2013;68(4):563-567

Table 2 - Risk of bias of clinical trials on women’s health published in the Sa˜o Paulo Medical Journal between 2008 and 2012. Bias/Study Was the allocation sequence adequately generated? Was allocation adequately concealed? Was knowledge of the allocated intervention adequately prevented during the study? (patients and personnel) Was knowledge of the allocated intervention adequately prevented during the study? (outcome assessors) Were incomplete outcome data adequately addressed? Are reports of the study free of suggestions of selective outcome reporting? Was the study free of other problems that could put it at a high risk of bias?

Nakamura 2008 et al. (15)

Gonc¸alves 2009 et al. (16)

Bernardes 2012 et al. (17)

No Unclear Unclear

Yes Yes Yes

Yes Unclear No

Unclear

No

No

Yes Yes Yes

Yes Yes Yes

Yes Yes Yes

‘‘Yes’’ = low risk of bias; ‘‘Unclear’’ = unclear risk of bias (moderate risk); ‘‘No’’ = high risk of bias. According to the Cochrane recommendations (9), the answers to the first four items should be analyzed when performing the final classification of the study. When at least one of the answers to these items is ‘‘No,’’ the study is classified as having a ‘‘High Risk of Bias’’; when at least one of the answers to these items is ‘‘Unclear,’’ the study is classified as having a ‘‘Moderate or Unclear Risk of Bias.’’

However, only two of the SRs published in the SPMJ (10,12) followed this recommendation. The lack of a list with excluded studies could be due in part to editorial policies and the need to limit the number of words per article. Only two SRs used appropriate methods to combine studies (12,14). However, it should be noted that the other three SRs were graded as ‘‘zero’’ because it was impossible to perform meta-analyses due to a lack of similar studies. This conservative approach to assessing the quality of published SRs has been used by other investigators performing similar evaluations (20).

The most frequent methodological flaws of the three CTs on women’s health were a lack of sequence generation information, allocation concealment and patient blinding and personnel and/or outcomes assessors, all of which are considered critical bias risk domains. Although there are several tools to assess the risk of bias of CTs, including the Jadad scale (21) and the Delphi list (22), we opted for the Cochrane tool, which is widely used and internationally validated (9). An implicit limitation of our study is that it assessed the reporting quality of the SRs and CTs published in a Brazilian evidence-based health journal and not necessarily the actual methodological quality of these studies. If we had contacted the original authors and asked for missing or unclear methodological details, it is possible that their studies could have been upgraded. Similarly, if the peer reviewers and editors of the journal had asked the researchers to address missing information before publishing their manuscripts, the final reporting quality of these eight studies would have likely been higher. Due to the conclusions of this study, the ‘‘Instructions to Authors’’ section of the SPMJ has been modified and improved. Future authors who submit manuscripts for potential publication in the SPMJ are now required to follow internationally accepted guidelines, such as the PRISMA (19), CONSORT (23), STARD (24), MOOSE (25) or STROBE (26) recommendations, depending on the design of their study. In summary, our findings indicate that most of the SRs and CTs on women’s health recently published in a Brazilian evidence-based health journal are of low to moderate quality. As a result of this study, changes in the ‘‘Instructions to Authors’’ section have been made, and higher standards have been adopted for future volumes of this journal. To help improve the standards of our journals and to ensure that our readers are consulting studies of high methodological quality, we encourage other Brazilian scientific journals to perform a similar critical appraisal of the quality of the studies that they publish. Conflicts of Interest: Torloni MR and Riera R are authors of two studies evaluated in this manuscript.

& AUTHOR CONTRIBUTIONS Figure 1 - Summary of the risk of bias for clinical trials on women’s health published in the Sa˜o Paulo Medical Journal between 2008 and 2012.

Macedo CR was responsible for evaluating the quality of the included studies and reviewing the manuscript. Riera R was responsible for the selection and evaluation of the included studies and for reviewing the

566


CLINICS 2013;68(4):563-567

Methodological quality of women’s health articles Macedo CR et al.

manuscript. Torloni MR was responsible for the selection of studies and drafting the manuscript. All authors declare that they have participated sufficiently in the work to take public responsibility for appropriate portions of the content.

14.

& REFERENCES

15.

1. Scheffer M, Biancarelli A, Cassenote A. Demografia Me´dica no Brasil: dados gerais e descric¸o˜es de desigualdades. Conselho Regional de Medicina do Estado de Sa˜o Paulo e Conselho Federal de Medicina, 2011. 117p. Available from: http://portal.cfm.org.br/images/stories/pdf/ demografiamedicanobrasil.pdf. 2. IBGE. Censo demogra´fico 2010. Available from: http://seriesestatisticas. ibge.gov.br/series.aspx?vcodigo = POP101&sv = 32&t = populacao-sexopopulacao-presente-residente. 3. Centre for Evidence Based Medicine. Oxford Centre for Evidence-based Medicine - Level of Evidence. Available from: http://www.cebm.net/ index.aspx?o = 1025. 4. Torloni MR, Riera R. Design and level of evidence of studies published in two Brazilian medical journals recently indexed in the ISI Web of Science database. Sao Paulo Med J. 2010;128(4):202-5, http://dx.doi.org/10. 1590/S1516-31802010000400005. 5. Shea BJ, Grimshaw JM, Wells GA, Boers M, Andersson N, Hamel C et al. Development of AMSTAR: a measurement tool to assess the methodological quality of systematic reviews. BMC Med Res Methodol. 2007;7:10, http://dx.doi.org/10.1186/1471-2288-7-10. 6. Shea BJ, Hamel C, Wells GA, Bouter LM, Kristjansson E, Grimshaw J, et al. AMSTAR is a reliable and valid measurement tool to assess the methodological quality of systematic review. J Clin Epidemiol. 2009, 62(10):1013–20. 7. Shea BJ, Bouter LM, Peterson J, Boers M, Andersson N, Ortiz Z, et al. External validation of a measurement tool to assess systematic reviews (AMSTAR). PLoS One. 2007;2(12):e1350, http://dx.doi.org/10.1371/ journal.pone.0001350. 8. Mikton C, Butchart A. Child maltreatment prevention: a systematic review of reviews. Bull World Health Organ. 2009;87(5):353-61, http:// dx.doi.org/10.2471/BLT.08.057075. 9. Higgins JPT, Green S (editors). Cochrane Handbook for Systematic Reviews of Interventions Version 5.1.0 [updated March 2011]. The Cochrane Collaboration, 2011. Available from www.cochrane-handbook.org. 10. Trevisani VFM, Riera R, Imoto AM, Saconato H, Atallah AN. Teriparatide (recombinant human parathyroid hormone 1-34) in postmenopausal women with osteoporosis: systematic review. Sao Paulo Med. J. 2008;126(5):279-84. 11. Riera R, de Soa´rez PC, Puga MES, Ferraz MB. Lapatinib for treatment of advanced or metastasized breast cancer: systematic review. Sao Paulo Med J. 2009;127(5):295-301, http://dx.doi.org/10.1590/S1516-31802009000500009. 12. Iared W, Shigueoka DC, Torloni MR, Velloni FG, Ajzen SA, Atallah AN, et al. Comparative evaluation of digital mammography and film mammography: systematic review and meta-analysis. Sao Paulo Med J. 2011;129(4):250-60, http://dx.doi.org/10.1590/S1516-31802011000400009. 13. Correˆa FM, Russomano FB, Oliveira CA. Colposcopic triage methods for detecting cervical intraepithelial neoplasia grade 3 after cytopathological

16.

17.

18.

19.

20.

21.

22.

23. 24. 25.

26.

567

diagnosis of low-grade squamous intraepithelial lesion: a systematic review on diagnostic tests. Sao Paulo Med J. 2012;130(1):44-52, http://dx. doi.org/10.1590/S1516-31802012000100008. Oliveira CA, Russomano FB, Ju´nior SCG, Correˆa FM. Risk of persistent high-grade squamous intraepithelial lesion after electrosurgical excisional treatment with positive margins: a meta-analysis. Sao Paulo Med J. 2012;13(2):119-25, http://dx.doi.org/10.1590/S1516-31802012000200009. Nakamura G, Ganem EM, Mo´dolo NSP, Rugolo LMSS, Castiglia YMM. Labor analgesia with ropivacaine added to clonidine: a randomized clinical trial. Sao Paulo Med J. 2008;126(2):102-6. Gonc¸alves AV, Teixeira LC, Torresan R, Alvarenga C, Cabello C. Randomized clinical trial on the preservation of the medial pectoral nerve following mastectomy due to breast cancer: impact on upper limb rehabilitation. Sao Paulo Med J. 2009;127(3):117-21. Bernardes BT, Resende APM, Stu¨pp L, Oliveira E, Castro RA, di Bella ZIKJ, et al. Efficacy of pelvic floor muscle training and hypopressive exercises for treating pelvic organ prolapse in women: randomized controlled trial. Sao Paulo Med J. 2012;130(1): 5-9, http://dx.doi.org/10. 1590/S1516-31802012000100002. Whiting P, Rutjes AW, Reitsma JB, Bossuyt PM, Kleijnen J. The development of QUADAS: a tool for the quality assessment of studies of diagnostic accuracy included in systematic reviews. BMC Med Res Methodol. 2003;3:25, http://dx.doi.org/10.1186/1471-2288-3-25. Liberati A, Altman DG, Tetzlaff J, Mulrow C, Gøtzsche PC, Ioannidis JPA, et al. The PRISMA statement for reporting systematic reviews and meta-analyses of studies that evaluate healthcare interventions: explanation and elaboration. BMJ. 2009;339:b2700, http://dx.doi.org/10.1136/ bmj.b2700. Seo HJ, Kim KU. Quality assessment of systematic reviews or metaanalyses of nursing interventions conducted by Korean reviewers. BMC Medical Research Methodology. 2012;12(1):129, http://dx.doi.org/ 10.1186/1471-2288-12-129. Jadad AR, Moore RA, Carroll D, Jenkinson C, Reynolds DJ, Gavaghan DJ, et al. Assessing the quality of reports of randomized clinical trials: is blinding necessary? Control Clin Trials. 1996;17(1):1-12, http://dx.doi. org/10.1016/0197-2456(95)00134-4. Verhagen AP, de Vet HC, de Bie RA, Kessels AG, Boers M, Bouter LM, et al. The Delphi list: a criteria list for quality assessment of randomized clinical trials for conducting systematic reviews developed by Delphi consensus. J Clin Epidemiol. 1998;51(12):1235–41, http://dx.doi.org/10. 1016/S0895-4356(98)00131-0. Schulz KF, Altman DG, , Moher D; CONSORT Group. CONSORT 2010 statement: updated guidelines for reporting parallel group randomised trials. BMJ. 2010;340:c332, http://dx.doi.org/10.1136/bmj.c332. Rennie D. Improving reports of studies of diagnostic tests: the STARD initiative. JAMA. 2003;289(1):89-90, http://dx.doi.org/10.1001/jama.289. 1.89. Stroup DF, Berlin JA, Morton SC, Olkin I, Williamson GD, Rennie D, et al. Meta-analysis of observational studies in epidemiology: a proposal for reporting. Meta-analysis Of Observational Studies in Epidemiology (MOOSE) group. JAMA. 2000;283(15):2008-12. STROBE Statement. Strengthening the reporting of observational studies in epidemiology. What is strobe? Available from: http://www.strobestatement.org/. Accessed in 2012 (Oct 15).


RAPID COMMUNICATION

The minimal inhibitory concentration for sulbactam was not associated with the outcome of infections caused by carbapenem-resistant Acinetobacter sp. treated with ampicillin/sulbactam Maura S. de Oliveira,I Silvia Figueiredo Costa,II Ewerton de Pedri,II Inneke van der Heijden,II Anna Sara S. LevinI,II I

Hospital das Clı´nicas da Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Infection Control, Sa˜o Paulo/SP, Brazil. II Faculdade de Medicina da Universidade de Sa˜o Paulo, Department of Infectious Diseases and LIM-54, Sa˜o Paulo/SP, Brazil.

OBJECTIVE: The objective of this study was to evaluate whether the outcomes of carbapenem-resistant Acinetobacter infections treated with ampicillin/sulbactam were associated with the in vitro susceptibility profiles. METHODS: Twenty-two infections were treated with ampicillin/sulbactam. The median treatment duration was 14 days (range: 3-19 days), and the median daily dose was 9 g (range: 1.5-12 g). The median time between Acinetobacter isolation and treatment was 4 days (range: 0-11 days). RESULTS: The sulbactam minimal inhibitory concentration (MIC) ranged from 2.0 to 32.0 mg/L, and the MIC was not associated with patient outcome, as 4 of 5 (80%) patients with a resistant infection (MIC$16), 5 of 10 (50%) patients with intermediate isolates (MIC of 8) and only 1 of 7 (14%) patients with susceptible isolates (MIC #4) survived hospitalization. CONCLUSION: These findings highlight the need to improve the correlation between in vitro susceptibility tests and clinical outcome. KEYWORDS: Antimicrobial Susceptibility; Resistance; Treatment. Oliveira MS, Costa SF, de Pedri E, van der Heijden I, Levin AS. The minimal inhibitory concentration for sulbactam was not associated with the outcome of infections caused by carbapenem-resistant Acinetobacter sp. treated with ampicillin/sulbactam. Clinics. 2013;68(4):569-573. Received for publication on November 5, 2012; First review completed on December 2, 2012; Accepted for publication December 2, 2012 E-mail: mauraoliveira@yahoo.com.br Tel.: 55 11 2661-7066

disk diffusion method have been published. In one study, 196 clinical isolates of Acinetobacter spp. were tested using disk diffusion and broth microdilution, and unacceptably high proportions of errors occurred for ampicillin/sulbactam (A/ S) (very major: 9.8%; minor: 16.1%) (3) Third, the MIC breakpoints used to interpret results are not well studied and may not predict clinical outcomes. The objective of this study was to evaluate whether the outcomes of patients with carbapenem-resistant Acinetobacter infections treated with A/S were associated with the in vitro susceptibility profiles.

& INTRODUCTION Infections caused by carbapenem-resistant Acinetobacter spp. are therapeutically challenging because treatment options are limited. The most studied of these options include polymyxins and sulbactam. Sulbactam, a synthetic betalactam, is mainly used as a beta-lactamase inhibitor, but it exhibits in vitro activity against Acinetobacter spp. (1) and has been used to treat infections caused by this organism. In vitro susceptibility testing for sulbactam and Acinetobacter spp. are problematic for multiple reasons. First, the minimal inhibitory concentration (MIC) breakpoint for sulbactam has not been determined. As a result, the criterion for an ampicillin/ sulbactam combination is typically used instead (2). Second, unacceptably high proportions of errors associated with the

& METHODS This study was conducted at Hospital das Clı´nicas, a 1,988-bed, tertiary-care teaching hospital affiliated with the University of Sa˜o Paulo. We performed a retrospective review of all patients who visited the hospital from 2000 through 2004 for carbapenem-resistant Acinetobacter baumannii (CRAB) bacteremia and were treated with at least 4 doses of A/S. Information was collected from the patients’ medical records. Infection diagnoses were based on CDC criteria (4) and were obtained from the infection-control

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)21

569


Treatment of Acinetobacter and the sulbactam MIC Oliveira MS et al.

CLINICS 2013;68(4):569-573

hospitalization. The outcomes stratified by the sulbactam MICs are depicted in Figure 1. Bivariate analyses showed that male sex and ICU admission were risk factors for inhospital mortality (Table 2). Multivariate analysis revealed that male sex (OR 15.16; 95% CI: 1.15-200.41) and admission to the ICU (OR: 15.20; 95% CI: 1.15-200.40) were associated with in-hospital mortality. The MICs for sulbactam and simultaneous treatment with carbapenems were not associated with patient outcome.

database. Patients were excluded if they had received polymyxin simultaneously. Isolates were phenotypically identified using an automated method (Vitek; bioMerieux; Hazelwood; MO; USA) and confirmed using classical microbiological techniques. The antimicrobial activities of sulbactam were evaluated against carbapenem-resistant Acinetobacter sp. isolates. Carbapenem resistance was defined as resistance to imipenem by broth microdilution susceptibility testing using the Clinical and Laboratory Standards Institute (CLSI) criteria (MIC$16 mg/L). Imipenem powder was obtained from Merck & Co., Inc. (EUA). The sulbactam MIC was determined using the broth microdilution method according to the CLSI guidelines (5). Sulbactam powder was obtained from European Pharmacopoeia Reference Standards CRS & BRP (EDQM European for the Quality of Medicines and Healthcare; Council of Europe; Catalogue code Y0000528). The culture medium consisted of cation-adjusted Mueller-Hinton broth (BBLTM Becton Dickinson). A standardized inoculum was prepared using the direct colony suspension method. Each bacterial suspension was adjusted to the 0.5 McFarland turbidity standard (1 to 2 6108 CFU/mL) using a photometric device (colorimeter VitekH1, BioMe´rieux, Etoile, France). The adjusted inoculum suspension was diluted in broth to achieve each an approximate final concentration of 5 6105 CFU/mL in each well. The sulbactam final concentrations were 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64 and 128 mg/L. Escherichia coli ATCC 25922 and Pseudomonas aeruginosa ATCC 27853 were used as quality control (QC) strains. The MIC results were evaluated by at least 3 observers. We described the characteristics of the patients, infections, treatments, mortality outcomes during treatment, inhospital mortality and clinical failure (defined as death or persistent signs and symptoms of infection, persistent isolation of Acinetobacter or a change in the antibiotic between day 3 and 7 of A/S treatment). Bivariate analysis was performed for 2 outcomes (mortality during treatment and in-hospital mortality). Multivariate analysis using logistic regression was performed for in-hospital mortality. Data were analyzed using EpiInfo 3.5.2 (CDC, Atlanta, GA).

& DISCUSSION Sulbactam, a beta-lactamase inhibitor, also exhibits intrinsic activity against Acinetobacter spp., including carbapenem-resistant strains, and therefore represents an alternative to treatment with polymyxins (6). However, the optimal treatment for multidrug-resistant Acinetobacter infections has not been established (7). Our case series involved 22 patients with mainly catheterassociated bloodstream infections. Surprisingly, patients infected with Acinetobacter who demonstrated higher MICs were more severely ill but had lower in-hospital mortality rates. Correlating in vitro antimicrobial susceptibility profiles with in vivo clinical outcomes can be difficult. First, appropriate breakpoints should be set. Breakpoints may originally be defined as the concentrations that distinguish subpopulations based on the MIC distribution, although these determinations are also used to guide therapy. Therefore, the use of breakpoints originally created to distinguish microbiological subpopulations to predict clinical success may be problematic. The EUCAST defined the latter breakpoint as a ‘‘clinical breakpoint’’ and the former as a ‘‘microbiological or epidemiological breakpoint’’. However, this terminology is not universal, and several current guidelines do not make these distinctions (8). To our knowledge, these differences have not been evaluated for A/S, and in our case-series, it appeared that the breakpoints did not adequately predict patient outcomes. It is always difficult to define the exact cause of death in patients with multi-resistant infections because they often exhibit several underlying diseases, receive invasive procedures and have been hospitalized for long periods (9). In our study, only admission to the ICU and sex were independently associated with in-hospital mortality. Admission to the ICU reflects the severity of the patient’s condition, but we cannot explain the influence of gender on mortality. Clinical efficacy is also influenced by the pharmacokinetics/pharmacodynamics of antimicrobials, which may be altered in critically ill patients. A recent study in an ex vivo human model showed that doses of 0.5 and 1 g of sulbactam infused over 30 minutes resulted in bactericidal serum levels at 2 hours after treatment. However, net regrowth and a trend to regrowth occurred, which suggests that a desirable length of time above a MIC.50% would not be achieved with the common dosage regime (1 g every 6 hours) (10). In addition, in vitro susceptibility tests for sulbactam against Acinetobacter spp. may not be reliable. In one study, 196 clinical isolates of Acinetobacter spp. were tested by disk diffusion and broth microdilution, and unacceptably high proportions of errors occurred for A/S (very major: 9.8%; minor: 16.1%) (3). Another study evaluated the activity of sulbactam-containing combinations by broth microdilution against 469 Acinetobacter isolates and concluded that testing

& RESULTS Sixty-three CRAB infections occurred in 58 patients; of these, 20 received no treatment, 22 received A/S, 10 received colistin, 4 received colistin + A/S, and records were not available for 2 patients. The mean age of the studied patients was 48 years (SD: 23.3). Of the total patients, 64% were male, 21 (96%) used central venous catheters, 16 (73%) used urinary catheters, and 12 (55%) required mechanical ventilation. The median treatment duration was 14 days (range: 3-19 days), and the median daily dose was 9 g (range: 1.5-12 g). The median time between Acinetobacter isolation and treatment was 4 days (range: 0-11 days). Eight patients (36%) received simultaneous carbapenems, and 13 (59%) received vancomycin. A description of the studied cases is shown in Table 1. The sulbactam MICs ranged from 2.0 to 32.0 mg/L. Five (23%) patients were classified as resistant, 7 (32%) were susceptible, and 10 (45%) were intermediate. Clinical failure occurred in 7 (33%) patients. Seven (33%) patients died during treatment, and 12 patients (55%) died during

570


571

81 23

33

67 61

M F

F

M F

22 17

13

15 18

19 11 7 NA 11 10 9

18 19

22

Heart failure Systemic erythematous lupus Kidney and pancreas transplant Multiple myeloma Leukemia

Cirrhosis and dialytic renal failure Trauma Chronic obstructive pulmonary disease Burn Leukemia Breast cancer Acute abdomen Hemangioblastoma Stomach cancer Heart failure

Renal transplant Cancer of the larynx Stroke Burn Acute abdomen Endometrial cancer Lymphoma

Underlying diseases

No No

No

No Yes

Yes No No No Yes No Yes

Yes Yes

Yes

No Yes Yes Yes Yes Yes No

Mechanical ventilation

No Yes

Yes

No Yes

Yes No No No Yes Yes Yes

Yes Yes

Yes

No Yes Yes Yes Yes Yes Yes

Urinary catheter

Yes Yes

Yes

Yes Yes

Yes No Yes Yes Yes Yes Yes

Yes Yes

Yes

Yes Yes Yes Yes Yes Yes Yes

Central venous catheter

BSI BSI

Surgical site

BSI BSI

BSI BSI BSI BSI Pneumonia BSI BSI

BSI BSI

BSI

BSI BSI Pneumonia Pneumonia BSI BSI BSI

Acinetobacter infection

M: male, F: female, BSI: blood stream infection, NA: not available; MIC: minimal inhibitory concentration.

7 24 54 56 36 60 7

M M F M F M F

M

23 70

58

M M M M F F M

M M

55 59 84 46 16 74 63

Gender

19 9 23 13 14 15 13

Apache II Age score (y) (points)

12 9

3

12 3

4 12 12 6 12 12 1.5

12 3

6

6 3 NA 12 9 9 6

Daily ampicillinsulbactam dose (g)

NA 1.6

2.5

2.5 4.4

0.7 3.3 NA 4.3 0.6 NA 0.9 0.8

0.7 3.8

3.6

2.5 5.3 1.6 0.6 1.1 2.7 2,2

Highest creatinine level during treatment (mg/dl)

10 15

14

19 16

9 8 13 11 15 3 3

11 14

10

14 15 15 14 16 14 3

Treatment duration (days)

1 1

5

0 11

3 3 36 4 5 4 3

6 2

4

9 4 7 5 4 3 3

Days to initiate treatment

Failure Success

Success

Success Success

Failure Failure Success Failure Sucess Success Failure

Success Success

Failure

Success Success Success Success Success Success Failure

Clinical outcome

Yes No

No

No No

Yes Yes No Yes No No Yes

No Yes

Yes

No Yes Yes Yes No Yes Yes

In- hospital death

16 16

16

16 16

8 8 8 8 8 8 8

8 8

8

2 2 2 4 4 4 4

Sulbactam MIC (mg/L)

Table 1 - Summary of clinical characteristics and outcome of 22 patients with carbapenem-resistant Acinetobacter spp. infections treated with ampicillin-sulbactam. Hospital das Clı´nicas, University of Sa˜o Paulo, Brazil.

CLINICS 2013;68(4):569-573 Treatment of Acinetobacter and the sulbactam MIC Oliveira MS et al.


Treatment of Acinetobacter and the sulbactam MIC Oliveira MS et al.

CLINICS 2013;68(4):569-573

Table 2 - Bivariate analysis of factors associated with in-hospital mortality and mortality during treatment in patients with carbapenem-resistant Acinetobacter spp. infections treated with ampicillin-sulbactam. Hospital das Clı´nicas, University of Sa˜o Paulo, Brazil. In-hospital mortality Non-survivors (n = 12) Age (years) Mean (SD) 56.3 (21.6) Median (range) 61 (7-84) Male gender (%) 10 APACHE II score (points) Mean (SD) 15.9 (5.3) Median (range) 15 (9-23) Admission to ICU (%) 10 Acinetobacter infection site (n) Bloodstream infection 10 Pneumonia 2 Surgical site infection 0 Time between isolation and beginning of treatment (days) Mean (SD) 3.5 (1.5) Median (range) 3 (1-7) Daily Dose (grams) Mean (SD) 6.7 (3.9) Median (range) 6 (1.5-12) Simultaneous use of 6 carbapenem(n) MIC (mg/L) #4 5 8 6 $16 1

Survivors (n = 10)

Mortality during treatment

RR (95% CI)

44.2 (21) 45 (16-81) 4 2.86 (0.82-9.92) 14.2 (4.0) 14.5 (7-19) 4

2.86 (0.82-9.92)

p

0.11 0.04 0.44

0.04 0.50

8 1 1

Death during Survivors until the end treatment (n = 7) of treatment (n = 15)

48.9 (23.7) 58 (7-67) 6 16(5.7) 16 (9-22) 5 7 0 0

RR (95% CI)

51.7 (21.6) 55 (16-84) 8

0.97 3.42 (0.49-23.6)

0.15 0.64

14.7 (4.4) 15 (7-23) 9

1.43(0.35- 5.74)

0.61

11 3 1

0.32

0.10

5.1 (3.2) 5 (0-11) 9.0 (3.7) 10.5 (3-12) 2

p

0.06

3.0 (1.0) 3 (1-4) 6.8 (3.9)

4.8 (2.9) 5 (0-11) 9.6 (3.7)

0.21

0.21 1.75(0.85-3.61)

0.15

6 (1.5-12) 3

10.5 (3-12) 5

0.19 2 4 4

1.31(0.39-4.44)

0.66 0.24

1 5 1

6 5 4

SD: standard deviation, MIC: minimum inhibitory concentration.

Figure 1 - Clinical outcome, mortality during treatment, in-hospital mortality and median APACHE II score of patients with infections caused by Acinetobacter spp. stratified by the minimum inhibitory concentration (MIC) ampicillin/sulbactam. Hospital das Clı´nicas, University of Sa˜o Paulo, Brazil.

572


CLINICS 2013;68(4):569-573

Treatment of Acinetobacter and the sulbactam MIC Oliveira MS et al.

with the inhibitor at a fixed ratio resulted in more reliable results compared to a fixed concentration (11). Our study was limited by the small number of patients and its retrospective design. To balance these limitations, we used strict diagnostic criteria for infections, included only blood isolates and used mortality as the main endpoint. Unfortunately, we did not have data concerning catheter removal. In summary, in this cases series, the MIC was not associated with patient outcome, as 4 of 5 (80%) patients with a MIC$16 mg/mL (considered resistant), 5 of 10 (50%) patients with a MIC of 8 mg/mL (considered intermediate), and 1 of 7 (29%) patients with a MIC#4 mg/mL (considered susceptible) survived hospitalization. Although we sought to determine alternative sulbactam breakpoints for Acinetobacter infections, this was not possible, which highlights the need for additional studies to improve the correlation between in vitro susceptibility tests and clinical outcome.

2.

3.

4.

5.

6.

7.

8.

& AUTHOR CONTRIBUTIONS Oliveira MS reviewed the medical records, helped writing the manuscript and performed the data analysis. Costa SF performed the data analysis, supervised the experiments and helped writing the manuscript. De Pedri EH performed the experiments. van der Heijden IM performed the experiments and helped writing the manuscript. Levin AS analyzed the data, contributed to the study design and helped writing the manuscript.

9.

10.

11.

& REFERENCES 1. Joly-Guillou ML, Herrman JL, Bourdelier E, Bergongne-Be´re´zin E. Bactericidal in-vitro activity of ß-lactams and ß-lactamase inhibitors, alone or associated, against clinical strains of Acinetobacter baumannii:

573

effect of combination with aminoglycosides. J Antimicrob Chemother. 1995;36(4):619-29, http://dx.doi.org/10.1093/jac/36.4.619. Jones RN, Dudley MN. Microbiologic and pharmacodynamic principals applied to the antimicrobial susceptibility testing of ampicillin/sulbactam: analysis of the correlations between in vitro test results and clinical response. Diagn Microbiol Infect Dis. 1997;28(1):5-18, http://dx.doi.org/ 10.1016/S0732-8893(97)00013-8. Swenson JM, Killgore GE, Tenover FC. Antimicrobial susceptibility testing of Acinetobacter spp. by NCCLS broth microdilution and disk diffusion methods. J Clin Microbiol. 2004;42(11):5102-8. Horan TC, Andrus M, Dudeck MA. CDC/NHSN surveillance definition of health care-associated infection and criteria for specific types of infections in the acute care setting. Am J Infect Control. 2008;36(5):309-32, http://dx.doi.org/10.1016/j.ajic.2008.03.002. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: 21st informational supplement (M100-S21), CLSI, Wayne, PA, USA, 2011. Levin AS, Oliveira MS. The challenge of multidrug resistance: the treatment of gram-negative rod infections. Shock. 2008;30 Suppl 1:30-3, http://dx.doi.org/10.1097/SHK.0b013e3181819cb8. Garnacho-Montero J, Amaya-Villar R. Multiresistant Acinetobacter baumannii infections: epidemiology and management. Curr Opin Infect Dis. 2010;23(4):332-9, http://dx.doi.org/10.1097/QCO.0b013e328 33ae38b. Mouton JW. Breakpoints: current practice and future perspectives. Int J Antimicrob Agent. 2002;19(4):323-31, http://dx.doi.org/10.1016/ S0924-8579(02)00028-6. Stratton CW. In vitro susceptibility testing versus in vivo effectiveness. Med Clin North Am. 2006;90(6):1077-88, http://dx.doi.org/10.1016/j. mcna.2006.07.003. Bantar C, Canigia LF, Berger MA, Soutric JL, Arenoso HJ. Pharmacodynamic assessment of Amoxicillin-Sulbactam against Acinetobacter baumannii: searching the optimal dose and infusion time through a human ex-vivo model. Braz J Infec Dis. 2009;13(5):348-52. Brauers J, Frank U, Kresken M, Rodloff AC, Seifert H. Activities of various beta-lactams and beta-lactam/beta-lactamase inhibitor combinations against Acinetobacter baumannii and Acinetobacter DNA group 3 strains. Clin Microbiol Infect. 2005;11(1):24-30, http://dx.doi.org/10. 1111/j.1469-0691.2004.01015.x.


READERS OPINION

It is important to control for confounders when examining the role of diet in cardiovascular disease prevention Sevket Balta,I Sait Demırkol,I Mustafa Cakar,II Murat Unlu,I Ugur Kucuk,II Mustafa DincIII I

Gulhane Medical Academy, Department of Cardiology, Ankara, Turkey. II Gulhane Medical Academy, Department of Internal Medicine, Ankara, Turkey. Beytepe Hospital, Department of Internal Medicine, Ankara, Turkey.

III

Email: drsevketb@gmail.com Tel.: 90 312-3044281

To the Editor,

excess salt intake, major depression, and gastrointestinal disease (5). Several of these possible contributing factors were not mentioned in the present study. It would be better if the authors provided data concerning these factors. Finally, cardiovascular risk factors may be influenced by weight loss medications, aspirin, a history of drug addiction (6), and some antihypertensive therapies, such as angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, and beta-blockers. It would be better if the authors performed a subgroup analysis, dividing the three patient groups on the basis of the administration of antihypertensive therapy. We believe that these data would provide a more complete basis for future research concerning the clinical effects of diet on cardiovascular risk factors.

We read the article ‘‘Effects of Brazilian Cardioprotective Diet Program on risk factors in patients with coronary heart disease: a Brazilian Cardioprotective Diet randomized pilot trial’’ by Bernardete Weber et al. with a great interest (1). The authors evaluated the ability of the Brazilian Cardioprotective Diet Program to reduce blood pressure, fasting glucose levels, and body mass indices (BMIs) among patients with established atherothrombotic disease. They concluded that patients participating in the Brazilian Cardioprotective Diet Program showed greater decreases in these factors than patients who received the dietary therapy proposed by the Brazilian guidelines for cardiovascular disease (CVD). We thank the authors for their study, which was well designed and thoroughly documented. Cardiovascular disease is the most important cause of mortality and morbidity in developed countries worldwide. Secondary prevention is important to combat the further progression of atherosclerotic disease and to reduce mortality from coronary artery disease. Although there is an established association between regular physical activity and cardiac risk factors in the secondary prevention of coronary artery disease (2), the authors did not mention the relationships between physical activity and reductions in blood pressure, fasting glucose levels, and BMI. We think that the results of the study would be stronger if the authors addressed the issue of physical activity in their patient cohort. Cardiovascular risk modifications can also be affected by atherosclerotic risk factors, such as alcohol consumption, hypothyroidism, impaired glucose tolerance (3), and the elevated inflammatory status associated with inflammatory diseases, cardiac syndrome X, and infection (4). These risk modifications can also be affected by eating disorders,

& REFERENCES 1. Weber B, Galante A, Bersch-Ferreira A, Torreglosa C, Carvalho V, Victor E, et al. Effects of Brazilian Cardioprotective Diet Program on risk factors in patients with coronary heart disease: a Brazilian Cardioprotective Diet randomized pilot trial. Clinics. 2012;67(12):1407-14, http://dx.doi.org/ 10.6061/clinics/2012(12)10. 2. Demirkol S, Cakar M, Balta S, Unlu M, Ay SA, Karaman M. To maintain a proper follow-up of the patients with coronary artery disease is as nearly important as medications. Int J Cardiol. 2012;pii: S01675273(12)01589-6. 3. Solimene MC. Coronary heart disease in women: a challenge for the 21st century. Clinics. 2010;65(1):99-106, http://dx.doi.org/10.1590/S180759322010000100015. 4. Demirkol S, Balta S, Unlu M, Yuksel UC, Celik T, Arslan Z, et al. Evaluation of the mean platelet volume in patients with cardiac syndrome X. Clinics. 2012;67(9):1019-22. 5. Torres MRSG, Ferreira T da S, Nogueira L de P, Do Nascimento DCS, Sanjuliani AF. Dietary counseling on long-term weight loss in overweight hypertensive patients. Clinics. 2011;66(10):1779-85. 6. Torres MRSG, Ferreira T da S, Nogueira L de P, Do Nascimento DCS, Sanjuliani AF. Dietary counseling on long-term weight loss in overweight hypertensive patients. Clinics. 2011;66(10):1779-85.

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)22

575


READERS OPINION

Safety concerns in pregnancy Emre Yalcinkaya,I Murat Celik,I Baris Bugan,II Uygar Cagdas YukselI I Gulhane Military Medical Faculty, Department of Cardiology, 06018, Ankara, Turkey. Turkey.

II

Malatya Army Hospital, Department of Cardiology, Malatya,

Email: dremreyalcinkaya@gmail.com Tel.: 905336577191

To the Editor,

both mother and fetus. MRI should be considered for cases in which the results of echocardiography are inconclusive and patient management mainly depends on results from further imaging modalities (2). Contrast media should only be given intravenously when a compulsive clinical indication exists and the potential benefit to the mother overbalances the potential risk to the fetus (5). In the abovementioned case report, the authors did not report any potential benefits of cardiac catheterization to detect an asymptomatic coronary fistula in a pregnant woman. Therefore, we strongly believe the use of cardiac catheterization should have been postponed until delivery because the patient was asymptomatic and did not have any signs of cardiac failure. Aspirin and endocarditis prophylaxis could have been considered, especially if the level of clinical suspicion in the case was high.

We greatly enjoyed reading the article by Roscani et al. (1) titled ‘‘Congenital aneurysmal circumflex coronary artery fistula in a pregnant woman.’’ In the article, the authors presented a case report of a congenital aneurysmal coronary artery fistula to the right ventricle in a pregnant woman and discussed the appropriate management. We have some concerns about the article. During pregnancy, immediate invasive cardiac procedures have highly time-responsive benefits, and these benefits might be lost due to unnecessary delays. Thus, these procedures should not be completely denied; rather, whether they are performed should depend on the state of the pregnancy. Concerns related to the safety of these invasive tests must be balanced against the importance of accurate diagnosis and proper assessment of the pathologic state (2). Additionally, cardiologists must consider the clear indications and limitations of each type of diagnostic imaging test and avoid potentially harmful effects to protect the fetus. Potential adverse outcomes due to radiation exposure during pregnancy include teratogenicity, genetic damage, intrauterine death and increased risk of malignancy, especially increased risk to the fetal thyroid from radioiodine exposure after 12 weeks of gestation (3). The need for invasive radiological procedures in the diagnosis of cardiac diseases has been markedly reduced due to developments in imaging technologies that use non-ionizing energies. Nonetheless, imaging modalities that do not use ionizing radiation, such as magnetic resonance imaging (MRI), are preferred for pregnant women (4). The benefit-risk balance assessment for cardiac catheterization during pregnancy should be performed properly for

& REFERENCES 1. Roscani MG, Zanati SG, Salmazo PS, Carvalho FC, Magalha˜es CG, Borges VT, et al. Congenital aneurysmal circumflex coronary artery fistula in a pregnant woman. Clinics. 2012;67(12):1523-5, http://dx.doi. org/10.6061/clinics/2012(12)30. 2. Pradhan AD, Visweswaran GK, Gilchrist IC. Coronary angiography and percutaneous interventions in pregnancy. Minerva Ginecol. 2012;64(5): 345-59. 3. Lowe SA. Diagnostic radiography in pregnancy: risks and reality. Aust N Z J Obstet Gynaecol. 2004;44(3):191-6. 4. Patel SJ, Reede DL, Katz DS, Subramaniam R, Amorosa JK. Imaging the pregnant patient for nonobstetric conditions: algorithms and radiation dose considerations. Radiographics. 2007;27(6):1705-22, http://dx.doi. org/10.1148/rg.276075002. 5. Siegmann KC, Heuschmid M, Claussen CD. Diagnostic imaging during pregnancy. Dtsch Med Wochenschr. 2009;134(14):686-9, http://dx.doi. org/10.1055/s-0029-1208106.

Copyright ß 2013 CLINICS – This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http:// creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited. No potential conflict of interest was reported. DOI: 10.6061/clinics/2013(04)23

577


No Rebouças, pequenos eventos

tornam-se grandes.

Seja pequeno, médio ou grande, o Rebouças tem o espaço ideal para todo o tipo de evento. A melhor logística e infraestrutura de apoio maximizam os recursos operacionais e potencializam os encontros científicos, promocionais, institucionais ou culturais. O Centro de Convenções Rebouças é isso: um dos mais bem planejados e tradicionais espaços receptivos do País, dimensionado para sediar congressos, convenções, exposições, seminários, simpósios, cursos, lançamento de produtos, entre outros, bem no coração da cidade de São Paulo.

Atualmente possui 8 ambientes climatizados e modernizados que atendem até 1.200 participantes, além de uma equipe preparada e empenhada em acompanhar cerca de 280 eventos por ano. EM BREVE, estará ampliando suas instalações, que permitirá o dobro da capacidade de público.

Av. Rebouças, 600 - 05402-000 - São Paulo - Brasil - Tel.: 55 11 3898-7850 / Fax: 55 11 3898-7878 - reboucas@hcnet.usp.br

www.convencoesreboucas.com.br


Clinics April 2013