Page 1

Sumári

Linguagens, códigos e suas tecnologias

Ciências humanas e suas tecnologias

Ciências da natureza e suas tecnologias

Matemática e suas tecnologias


Ficha Técnica Autoria História e Filosofia André Marcos de Paula e Silva Edson Bispo Geografia e Sociologia Arno Boing Luciano Stangue Biologia Heraldo Taborda Damas Luiz Borges Neto Física Daniel Tadanori Oshima Inglês Carlos Eduardo Baldoino Maria Ascension Jimenez Martin Química Sidnei Christoff Matemática, Álgebra e Geometria Adriano Carlos Leal José Carlos Bus Luiz Carlos Domenico Literatura Elio Antunes Língua Portuguesa Elio Antunes Wallace Stocco Martinez Espanhol Maria Ascension Jimenez Martin Arte Juliano de Paula Antoceveiz Viviane Paduim

Gerência CEEE Sandra Poli Coordenação de Desenvolvimento de Material Didático Elisabete Piscke Edição de Texto Adriano Sachweh Ivan Justen Santana Kelly Lima Roberta Costa Gonçalves de Almeida Vera Lúcia Bueno Weidlich Revisão Cláudia Stadler Mikoski Martins Daniela Lemos da Cruz Gabriela Sbeghen Patrícia Hostilio Iconografia Ana Lúcia Pereira da Silva Fujihara Gerência de Produção Antônio Paulo Both Pré-Impressão Alexandre Straube Projeto Gráfico Mariana Augusta de Souza Diagramação e Arte-Final Ivan Alexander Mizanzuk Jailson Madureira Roberto Mariana Augusta de Souza Ilustração Ademar dos Santos Eliane Cassia Ramos Relty Sacha Jung Tratamento de Imagem Jandir Romano


Prepare–se! Em suas mãos está um material único, criado especialmente para prepará-lo para o Exame Nacional do Ensino Médio (Enem). O ExpoEnem apresenta 747 questões de múltipla escolha, 80% das quais são inéditas. As demais 20% são questões de edições anteriores do Enem e dos principais vestibulares do país. Fotos, charges, tabelas e notícias complementam e contextualizam as questões, preparadas por uma equipe de professores do Ensino Médio, Pré-Vestibular, Ensino Superior e especialistas do Centro de Excelência em Educação Expoente, instituição com mais de 25 anos de atuação em pré-vestibulares. O conteúdo do material foi pensado para reforçar sua capacidade de interpretação e o uso do raciocínio lógico, seguindo o novo formato da prova. O novo Enem, modificado em 2009, reforçou o fim da decoreba, em nome do espírito crítico e do raciocínio lógico. As disciplinas deixaram de existir de maneira separada. As questões estão divididas em quatro áreas de conhecimento: linguagens, códigos e suas tecnologias; ciências humanas e suas tecnologias; ciências da natureza e suas tecnologias e matemática e suas tecnologias. Ao final das atividades desta edição, você estará um passo mais próximo de seu objetivo. Um bom resultado no Enem garante acesso às principais universidades do país. Mantenha-se atualizado, resolva os exercícios e não esqueça: você é o sujeito ativo de seu processo de aprendizagem.

Sandra Poli Gerência do Centro de Excelência em Educação Expoente

expoENEM 3


ExpoEnem O Enem O Exame Nacional do Ensino Médio foi criado em 1998, com o objetivo de avaliar o desempenho dos estudantes ao fim da escolaridade básica. Até 2008, o Enem era uma prova clássica, com 63 questões interdisciplinares, sem articulação direta com os conteúdos do Ensino Médio e sem possibilidade de comparação das notas de um ano para outro. A partir de 2009, o Enem passou a ser reformulado, para ser comparável no tempo e abordar diretamente o currículo do Ensino Médio. Agora o novo exame é composto por perguntas objetivas em quatro áreas do conhecimento: Linguagens, códigos e suas tecnologias (incluindo redação); Ciências humanas e suas tecnologias; Ciências da natureza e suas tecnologias; Matemática e suas tecnologias. Além de ser uma avaliação geral, o Enem surgiu também para democratizar o acesso às vagas federais de Ensino Superior. Como exame unificado, o Enem permite a mobilidade dos estudantes pelo país. Com o novo Enem, o Ministério da Educação (MEC) busca um objetivo ainda mais ambicioso e importante: a reformulação do currículo do Ensino Médio. O vestibular de moldes tradicionais produziu efeitos insalubres sobre esse currículo, pelo acúmulo excessivo de conteúdos. A nova proposta incentiva uma formação mais adequada ao futuro, voltada ao pensamento crítico, às capacidades de formular hipóteses e solucionar problemas diversos, em face de realidades em transformação.

ExpoEnem O ExpoEnem foi elaborado com base na Matriz de Referência publicada pelo MEC. O volume único apresenta questões divididas em quatro áreas de conhecimento.

Linguagens, códigos e suas tecnologias (203 questões) Em que são cobrados conhecimentos de Língua Portuguesa, Literatura, Arte, Inglês e Espanhol.

Ciências humanas e suas tecnologias (166 questões) Em que são cobrados conhecimentos de Geografia, História, Filosofia e Sociologia.

Ciências da natureza e suas tecnologias (226 questões) Em que são cobrados conhecimentos de Biologia, Química e Física.

Matemática e suas tecnologias (152 questões) Em que são cobrados conhecimentos de Matemática, Álgebra e Geometria.

Matriz de referência A matriz traz um conjunto de 30 habilidades para cada uma das quatro áreas. Além disso, para cada área, também são explicitados os conteúdos curriculares específicos do Ensino Médio, relacionados com base na matriz de referência.

Eixos cognitivos (comuns a todas as áreas de conhecimento) I. Dominar linguagens: dominar a norma culta da Língua Portuguesa e fazer uso das linguagens matemática, artística e científica e das línguas espanhola e inglesa. II. Compreender fenômenos: construir e aplicar conceitos das várias áreas do conhecimento para a compreensão de fenômenos naturais, de processos histórico-geográficos, da produção tecnológica e das manifestações artísticas. III. Enfrentar situações-problema: selecionar, organizar, relacionar, interpretar dados e informações, representados de diferentes formas, para tomar decisões e enfrentar situações-problema. IV. Construir argumentação: relacionar informações, representadas em diferentes formas, e conhecimentos disponíveis em situações concretas, para construir argumentação consistente.

expoENEM 4


V. Elaborar propostas: recorrer aos conhecimentos desenvolvidos na escola para elaboração de propostas de interação solidária na realidade, respeitando os valores humanos e considerando a diversidade sociocultural.

Competências das áreas de conhecimento Matriz de Referência de Linguagens, Códigos e suas Tecnologias Competência de área 1 – Aplicar as tecnologias da comunicação e da informação na escola, no trabalho e em outros contextos relevantes para sua vida. Competência de área 2 – Conhecer e usar língua(s) estrangeira(s) moderna(s) como instrumento de acesso a informações e a outras culturas e grupos sociais. Competência de área 3 – Compreender e usar a linguagem corporal como relevante para a própria vida, integradora social e formadora da identidade. Competência de área 4 – Compreender a arte como saber cultural e estético gerador de significação e integrador da organização do mundo e da própria identidade. Competência de área 5 – Analisar, interpretar e aplicar recursos expressivos das linguagens, relacionando textos com seus contextos, mediante natureza, função, organização, estrutura das manifestações, de acordo com as condições de produção e recepção. Competência de área 6 – Compreender e usar os sistemas simbólicos das diferentes linguagens como meios de organização cognitiva da realidade pela constituição de significados, expressão, comunicação e informação. Competência de área 7 – Confrontar opiniões e pontos de vista sobre as diferentes linguagens e suas manifestações específicas. Competência de área 8 – Compreender e usar a língua portuguesa como língua materna, geradora de significação e integradora da organização do mundo e da própria identidade. Competência de área 9 – Entender os princípios, a natureza, a função e o impacto das tecnologias da comunicação e da informação na sua vida pessoal e social, no desenvolvimento do conhecimento, associando-o aos conhecimentos científicos, às linguagens que lhes dão suporte, às demais tecnologias, aos processos de produção e aos problemas que se propõe solucionar.

Matriz de Referência de Matemática e suas Tecnologias

Competência de área 1 – Construir significados para os números naturais, inteiros, racionais e reais. Competência de área 2 – Utilizar o conhecimento geométrico para realizar a leitura e a representação da realidade e agir sobre ela. Competência de área 3 – Construir noções de grandezas e medidas para a compreensão da realidade e para a solução de problemas do cotidiano. Competência de área 4 – Construir noções de variação de grandezas para a compreensão da realidade e a solução de problemas do cotidiano. Competência de área 5 – Modelar e resolver problemas que envolvem variáveis socioeconômicas ou técnico-científicas, usando representações algébricas. Competência de área 6 – Interpretar informações de natureza científica e social obtidas da leitura de gráficos e tabelas, realizando previsão de tendência, extrapolação, interpolação e interpretação. Competência de área 7 – Compreender o caráter aleatório e não determinístico dos fenômenos naturais e sociais e utilizar instrumentos adequados para medidas, determinação de amostras e cálculos de probabilidade para interpretar informações de variáveis apresentadas em uma distribuição estatística.

Matriz de Referência de Ciências da Natureza e suas Tecnologias

Competência de área 1 – Compreender as ciências naturais e as tecnologias a elas associadas como construções humanas, percebendo seus papéis nos processos de produção e no desenvolvimento econômico e social da humanidade. Competência de área 2 – Identificar a presença e aplicar as tecnologias associadas às ciências naturais em diferentes contextos. Competência de área 3 – Associar intervenções que resultam em degradação ou conservação ambiental a processos produtivos e sociais e a instrumentos ou ações científico-tecnológicos. Competência de área 4 – Compreender interações entre organismos e ambiente, em particular aquelas relacionadas à saúde humana, relacionando conhecimentos científicos, aspectos culturais e características individuais. Competência de área 5 – Entender métodos e procedimentos próprios das ciências naturais e aplicá-los em diferentes contextos. Competência de área 6 – Apropriar-se de conhecimentos da Física para, em situações-problema, interpretar, avaliar ou planejar intervenções científico-tecnológicas.

expoENEM 5


Competência de área 7 – Apropriar-se de conhecimentos da Química para, em situações-problema, interpretar, avaliar ou planejar intervenções científico-tecnológicas. Competência de área 8 – Apropriar-se de conhecimentos da Biologia para, em situações-problema, interpretar, avaliar ou planejar intervenções científico-tecnológicas.

Matriz de Referência de Ciências Humanas e suas Tecnologias

Competência de área 1 – Compreender os elementos culturais que constituem as identidades. Competência de área 2 – Compreender as transformações dos espaços geográficos como produto das relações socioeconômicas e culturais de poder. Competência de área 3 – Compreender a produção e o papel histórico das instituições sociais, políticas e econômicas, associando-as aos diferentes grupos, conflitos e movimentos sociais. Competência de área 4 – Entender as transformações técnicas e tecnológicas e seu impacto nos processos de produção, no desenvolvimento do conhecimento e na vida social. Competência de área 5 – Utilizar os conhecimentos históricos para compreender e valorizar os fundamentos da cidadania e da democracia, favorecendo uma atuação consciente do indivíduo na sociedade. Competência de área 6 – Compreender a sociedade e a natureza, reconhecendo suas interações no espaço em diferentes contextos históricos e geográficos.

QUER MAIS DETALHES? Acesse o portal do MEC (www.mec.gov.br) e confira a Matriz de Referência completa para o Enem.

expoENEM 6


Linguagens, códigos e suas tecnologias

01. Leia com atenção o texto a seguir. O ano zero da economia limpa Svante Arrhenius era um desconhecido físico sueco quando, em 1896, fez um alerta: se a humanidade continuasse a emitir dióxido de carbono na atmosfera no mesmo ritmo que fazia desde a alvorada da Revolução Industrial, em 1750, a temperatura média do planeta subiria de maneira dramática, em decorrência do efeito estufa. Pouca gente escutou o apelo de Arrhenius em seu tempo, um período sem carros, sem megalópoles, com apenas 1,2 bilhões de pessoas no mundo. Quase ninguém seguiu seu raciocínio na maior parte do século seguinte. Foi assim até que novas evidências científicas surgiram, além das catástrofes naturais. E nos anos 1960 brotou uma ideia romântica, utópica e alternativa de preservação da natureza. Ela hoje entrou na corrente principal do pensamento ocidental, ajudou a transformar os processos de produção industrial e moldou o perfil dos líderes empresariais que conduzem o capitalismo no século XXI. Há muito ainda a ser feito. Evidentemente, é um frágil equilíbrio, mas trata-se, agora, de agir já para pagar menos depois.

02. Economizar energia é uma atitude que não atinge somente os bolsos das famílias – trata-se de uma ação global que visa à preservação da vida no planeta. Com base na análise da tabela, o uso das lâmpadas incandescentes a. só é viável em períodos inferiores a um ano em relação às de LED e às fluorescentes. b. é viável após um período de cinco anos, haja vista que as lâmpadas de LED custam mais caro. c. é inviável em períodos menores que dois anos, pois as de LED têm custo total inferior em cinco anos. d. é viável em relação ao período de cinco anos se comparado às de LED. e. pode ser considerado inviável em qualquer tempo de utilização se relacionado às de LED e às fluorescentes. 03. Segundo a tabela, com relação à geração de energia necessária para abastecer uma casa, a. as lâmpadas incandescentes, em cinco anos, consumiriam menos energia.

Veja, “O ano zero da economia limpa”.

b. as lâmpadas fluorescentes, em cinco anos, consumiriam menos energia.

A importância da preservação ambiental suscitou e ainda suscita uma gama incrível de artigos sobre as causas, os efeitos e as previsões feitas sobre o impacto das ações do homem no futuro do planeta. O texto apresentado remonta à tese de que o homem há muito já se preocupa com o uso inconsequente dos recursos naturais. A previsão de Arrhenius foi a de que

c. juntas, as lâmpadas de LED e as fluorescentes, em cinco anos, consumiriam mais energia do que as incandescentes. d. as lâmpadas de LED, em cinco anos, seriam a melhor alternativa para a economia de energia.

a. haveria aumento da população mundial, o que geraria acentuado agravamento do efeito estufa.

e. as lâmpadas incandescentes e fluorescentes, em cinco anos, seriam a melhor alternativa para a economia de energia.

b. a preservação da natureza daria sinais do problema pelo aumento de catástrofes naturais.

Leia com atenção o texto a seguir. Ele serve de base para as questões 04 e 05.

c. a emissão de dióxido de carbono deveria ser contida para que a temperatura média do planeta não aumentasse. d. o capitalismo do século XXI transformaria os processos de produção industrial. e. a produção industrial seria mais cara caso não houvesse cuidados com o efeito estufa. Observe com atenção a tabela a seguir. Ela serve de base para as questões 02 e 03. Contas no claro Eis os gastos estimados, ao longo de cinco anos, para uma casa com vinte pontos de luz e utilização média de dez lâmpadas acesas durante seis horas. INCANDESCENTE

FLUORESCENTE

LED

Investimento inicial com lâmpadas

R$ 36

R$ 700*

R$ 1 500

Potência média de consumo das lâmpadas

60 W

18 W

8W

Consumo de energia

6 480 kWh

1 944 kWh

1 080 kWh

Lâmpadas trocadas

110

14

zero

Gasto com energia

R$ 2 628

R$ 778

R$ 345

R$ 195

R$ 140

zero

R$ 2 859

R$ 1 618

R$ 1 845

Gasto com lâmpadas Total

* Inclui os reatores Veja, “A reinvenção da luz”.

expoENEM 1

O pioneirismo de Edison Ele foi o primeiro empreendedor a incentivar o uso de energias alternativas A primeira vez que a palavra sustentabilidade apareceu no The New York Times com o sentido que leva hoje foi em 1973, durante a crise do petróleo. A expressão ambientalismo despontou um pouco antes, em 1957. Meio século mais cedo, Thomas Alva Edison (1847– 1931), o homem que tornou a lâmpada elétrica economicamente viável, já tinha preocupações que apenas recentemente os executivos mais sensatos começam a ter. Em um artigo de 1901, publicado pelo jornal The Atlanta Constitution, ele já sugeria o uso de moinhos de vento de modo a produzir energia para os cidadãos do campo, "para que eles possam ter luz durante a noite", sem depender do petróleo que movia as usinas de eletricidade. A primeira casa movida a energia eólica tinha sido construída em 1888, e a exploração de combustível fóssil mal completara quarenta anos de existência. Atento ao crescimento do consumo nos Estados Unidos, ele chegou a selar um acordo com Henry Ford para desenvolver um carro elétrico que pudesse rivalizar com o Modelo T, o primeiro a sair em série das linhas de montagem. Ao mesmo tempo, ergueu uma casa ecologicamente correta, a "Residência Urbana do Século XX", com aquecimento feito por meio de claraboias, unidades de aquecimento solar e eólico – além, é claro, de dezenas de lâmpadas elétricas. Com o apoio de um gerador movido a gás, ele conseguia produzir energia para a casa e para a vizinhança. Hoje, pequenas geradoras de energia, descentralizadas e independentes da sobrecarregada rede oficial, são uma das alternativas mais celebradas em todo o mundo. Mas os sonhos de Edison fracassaram – sua residência suburbana foi incapaz de produzir energia própria sustentável, e os veículos elétricos deram lugar aos carros movidos a petróleo,


a. pela imagem da menina observando outras crianças que partilham da mesma angústia que ela, o que traduziu por “paísmo” – expressão criada pela personagem, ou seja, um neologismo (uma palavra nova).

economicamente mais viáveis. Mesmo as lâmpadas, que ele imaginava fossem virar produto de massa no fim dos anos 1880, só se espalharam no início do século XX. Havia naquele tempo, como existem hoje, objeções financeiras: "Não há como o sistema elétrico de Edison concorrer com o gás, mesmo que os capitalistas encontrem financiadores que ajudem a contribuir com a ideia em Nova York", anotou um artigo do The New York Times em 1880.

b. pelas imagens de crianças que sofrem da mesma doença – paísmo (palavra inventada pela personagem e que gera graça). c. pela expressão “carregado”, a qual não encontra correspondente com a situação que se apresenta.

Pioneiro, Edison só não está se virando no túmulo, com o fim da lâmpada incandescente, porque foi o primeiro entre os grandes empreendedores a entender a importância de não gastar todos os recursos do planeta e a buscar saídas limpas para a economia suja.

d. pela última imagem, na qual a menina despreza o sentimento de um dos meninos e dá as costas a ele. e. pelo termo “ar” carregado de crianças tristes sem motivo.

Veja, “A reinvenção da luz”.

04. Thomas Edison foi inventor da lâmpada elétrica e grande incentivador da produção de energias alternativas, como apresenta o texto. Pode--se dizer que se trata de uma verificação histórica da preocupação do homem com a sustentabilidade do planeta. As informações presentes no texto que autorizam considerar Thomas Edison incentivador do uso de energias alternativas são

Leia com atenção o texto a seguir. Ele serve de base para as questões 07 e 08. Dormir depois da aula faz bem, mostra pesquisa Estudo brasileiro sugere que quem tira uma soneca vai melhor na escola A famosa soneca depois da escola já não precisa preocupar os pais. Pelo menos é isso que sugere uma pesquisa divulgada nesta terça-feira. O estudo, coordenado pelo Instituto Internacional de Neurociências de Natal (RN), mostra que dormir após a aula pode ajudar o estudante a memorizar o que lhe foi ensinado.

a. a construção de uma casa com claraboias e unidades de aquecimento solar e eólico; a criação do carro elétrico e a consolidação da ideia de que as lâmpadas incandescentes não eram tão viáveis para o meio ambiente quanto a energia vinda do petróleo. b. a construção de uma casa que utilizava, além da energia elétrica, a eólica e a solar, e a idealização do carro elétrico.

Os cientistas separaram em dois grupos uma turma de estudantes. Depois de uma aula de dez minutos, uma parte foi assistir à outra aula, enquanto a outra foi dormir por duas horas. Cinco dias depois, os estudantes passaram por uma prova cujo tema era justamente o apresentado na primeira aula. Os alunos que dormiram se saíram melhor. Aqueles que não conseguiram dormir, mas ficaram quietos, também tiveram desempenho superior a quem teve de voltar a estudar.

c. a preocupação com os danos causados pelo uso de energias advindas de combustíveis fósseis; a criação de uma casa com geração de energia 100% limpa e a idealização do carro elétrico. d. a busca pela conscientização de Henry Ford de que o carro elétrico era menos danoso ao meio ambiente e a construção de uma casa ecologicamente correta.

Além dos estudantes, os responsáveis pela pesquisa estudaram o processo em roedores. A conclusão foi que de ondas lentas e o sono REM, quando se sonha, têm funções complementares. O primeiro é o responsável pela reverberação da memória, e o segundo, pelo seu armazenamento.

e. a invenção de geradores de energia eólica e solar e a parceria com Henry Ford para a fabricação em série do carro elétrico. 05. O texto faz menção ao fato de que Thomas Edison

Os pesquisadores alertam, porém, que mais evidências precisam ser encontradas para que seja comprovada a relação entre a soneca e um melhor desempenho acadêmico. O próximo passo, segundo eles, é expandir o estudo.

a. hoje ficaria infeliz pelo fato de a lâmpada incandescente estar sendo substituída por outras menos prejudiciais ao meio ambiente. b. hoje ficaria feliz pelo fato de o ser humano ainda estar usando sua invenção (a lâmpada incandescente). c. não foi prontamente feliz com a invenção das lâmpadas incandescentes, posto que sua invenção só se popularizou no século seguinte. d. ficou revoltado com sua geração por ela pensar mais na sustentabilidade econômica do que na ambiental.

Veja, “Dormir depois da aula faz bem, mostra pesquisa”.

07. Palavras referenciais são aquelas que recuperam termos anteriormente citados sem repeti-los, garantindo assim a coesão textual. Nesse sentido, a expressão “o primeiro” (3°. parágrafo) refere-se a: a. “estudo, coordenado pelo Instituto Internacional de Neurociências de Natal (RN)”.

e. foi o precursor de novas tecnologias que levaram o homem à utilização do carro elétrico.

b. “Os alunos que dormiram se saíram melhor”. c. “roedores”.

06. Observe com atenção a tira a seguir.

d. “Aqueles que não conseguiram dormir”.

É quase dia dos pais e não sei que presente dar para o meu pai.

e. “ondas lentas”. 08. Há indícios no texto de que a pesquisa ainda não é confiável, e isso pode ser constatado pelo trecho: a. “O estudo, coordenado pelo Instituto Internacional de Neurociências de Natal (RN), mostra que dormir após a aula pode ajudar o estudante a memorizar o que lhe foi ensinado.” O ar está carregado de paísmo!

b. “Os cientistas separaram em dois grupos uma turma de estudantes.” c. “Cinco dias depois, os estudantes passaram por uma prova cujo tema era justamente o apresentado na primeira aula.” d. “Aqueles que não conseguiram dormir, mas ficaram quietos, também tiveram desempenho superior a quem teve de voltar a estudar.”

As tiras são textos que utilizam linguagem verbal e não verbal para formulação de sentido e, consequentemente, do humor. Na tira apresentada, o efeito de sentido se dá expoENEM 2

e. “Os pesquisadores alertam, porém, que mais evidências precisam ser encontradas para que seja comprovada a relação entre a soneca e um melhor desempenho acadêmico.”


09. Observe com atenção a tira a seguir.

b. A ideia está equivocada. c. Os brasileiros são muito preocupados com a questão social.

Tó, pode escolher. As mais fortes são as vermelhas.

d. As perspectivas de um mundo ambientalmente melhor estão em evidência.

Então vamos separar elas, pra não dar briga!

e. A solução para a questão ambiental está longe de ser alcançada. 11. O trecho “Houve um bônus inesperado: o gel protegeu as mulheres ainda mais contra o herpes genital...” pode ser interpretado, pelo contexto, como: a. com o gel, as mulheres agora são menos protegidas contra o herpes genital do que contra a Aids.

b. a proteção das mulheres contra o herpes genital é maior pelo uso do gel do que pelo uso de outros medicamentos.

A língua é um organismo vivo, cuja utilização promove a geração de novas palavras e a variação linguística. Tendo como base esse pressuposto e a análise da tira, pode-se postular que “separar elas” e “pra” podem ser explicados como sendo

c. o gel protege mais as mulheres com herpes genital do que os homens. d. a proteção contra o herpes genital em mulheres é maior pelo uso do gel.

a. expressões próprias da variedade culta da língua em modalidade oral.

e. as mulheres estão mais protegidas contra o herpes genital porque usam o gel.

b. expressões próprias da variedade culta da língua em modalidade escrita. c. expressões próprias da variedade popular da língua em modalidade oral e escrita.

12. Leia com atenção o texto a seguir. O Senado da Argentina aprovou o casamento homossexual em 15 de julho por 33 votos contra 27. A legislação concede direitos de herança e adoção e trata igualmente casais hetero e homossexuais em questões judiciais. Com isso, o país se tornou o primeiro da América Latina a autorizar e garantir os mesmos direitos civis para uniões entre pessoas do mesmo sexo.

d. expressões próprias da variedade popular da língua somente em modalidade escrita. e. expressões próprias da variedade culta da língua em modalidade oral e escrita. Leia com atenção o texto a seguir. Ele serve de base para as questões 10 e 11. Gel anti-HIV levanta questões polêmicas sobre sua eficácia e uso Menos de duas semanas após sua divulgação, criadores esclarecem dúvidas sobre o microbicida

Veja, “Primeiro casamento gay é celebrado na Argentina”.

A palavra “mesmo” aparece duas vezes no texto apresentado e semanticamente equivale a “igual”. Em sentido semelhante, a palavra “mesmo” ocorre em: a. Mesmo sem ajuda, irei longe em meus pensamentos.

A melhor novidade para a prevenção da Aids foi divulgada este mês, em uma conferência mundial sobre a doença em Viena: um gel vaginal microbicida, que pode ser usado sem o conhecimento do homem, deu às mulheres chance de 39% de evitar a infecção com o vírus mortal.

b. Não há mesmo mais nada a ser feito com relação ao problema.

Obviamente, os 39% não são exatos, embora as mulheres que usaram o gel no teste sul-africano tenham obtido resultados melhores, chegando a 54% de proteção. Depois de uma dúzia de fracassos com microbicidas, esse foi um grande alívio, e gerou aclamações e aplausos de pé pelos pesquisadores locais. “Esse é um campo que conheceu muita dor”, disse Catherine Hankins, a principal conselheira científica da Unaids, a agência de combate à Aids das Nações Unidas. Houve um alívio geral porque os dados não eram tão instáveis quanto os de um teste de vacinas contra a Aids, divulgado em setembro.

e. Não é mesmo que estamos vivendo uma nova era com relação ao meio ambiente?

c. Ele é assim mesmo: briga por nada. d. Não tenho o mesmo objetivo que os demais presentes nesta reunião.

13. Observe com atenção a tira a seguir. Eu sei que quando tem visita é pra me comportar melhor, mas tá difícil!

Senhor Haroldo, desculpe interromper...

“Há um sentimento de tranquilidade e prazer para mim, como cientista, de que os dados são estatisticamente significativos de qualquer forma que você os divida”, afirmou o Dr. Anthony S. Fauci, respeitado especialista em Aids do governo dos EUA, que bancou a maior parte dos custos do teste. Houve um bônus inesperado: o gel protegeu as mulheres ainda mais contra o herpes genital (os pesquisadores não souberam especificar o motivo, mas o gel contém tenofovir, um medicamento antiviral, e tanto a Aids quanto o herpes são virais). Veja, “Gel anti-HIV levanta questões polêmicas”.

10. A conotação é o emprego do sentido figurado (quando não se aplica o sentido usual à mensagem), e pode ser expressa por meio de figuras de linguagem. A prosopopeia ou personificação é a figura de linguagem na qual um ser inanimado ou um animal demonstra características humanas. No texto isso ocorre no trecho “Esse é um campo que conheceu muita dor”. A frase que contém a mesma figura de linguagem é: a. Este assunto foi muito comentado ultimamente. expoENEM 3

MUITO OBRIGADO!


Para entender o sentido humorístico da tira deve-se perceber a função da mensagem verbal presente no terceiro quadro, “ARROOO”, a qual pode ser entendida como

a. em época de Natal, um ateu não fica comovido.

a. uma expressão idiomática advinda de outra língua, tratando-se de um estrangeirismo.

b. a comoção durante uma partida de futebol faz com que um ateu mude de opinião sobre a existência de Deus.

b. um neologismo, ou seja, uma palavra nova, criada com a intenção de gerar humor. c. uma sigla que encontra significação em letras de músicas do gênero Ópera.

c. a possível utilização de expressões como “Meu Deus!” e “Pelo amor de Deus!” por um ateu durante uma partida de futebol não o faz propriamente acreditar em Deus, o que foi ironicamente explorado pelo criador do gráfico.

d. uma abreviação de palavra que simboliza o pensamento do personagem.

d. a busca de Deus por um ateu se dá durante uma perseguição policial.

e. uma abreviação de palavra que representa o som da ação do personagem: arroto.

e. um ateu que não estudou para uma prova vê em Deus uma saída para obter êxito no exame. 16. (Enem 2009)

14. Leia com atenção o texto a seguir. A criatividade é a síntese de duas coisas: fantasia e realização. Michelangelo é criativo não apenas porque projetou a cúpula da Catedral de São Pedro, mas depois de pensá-la convenceu o papa e coordenou a construção. Criatividade não é somente ter ideias, como se imagina. Isso é apenas fantasia. Só os gênios são fantasiosos e realizadores ao mesmo tempo. Como gênios não aparecem aos montes, o segredo é montar equipes que mesclem pessoas fantasiosas e realizadoras. Isso significará um ganho para os que têm ambos os perfis. A criatividade floresce em ambientes intelectualmente competitivos. Com os meios de comunicação de massa, ambientes assim poderiam ser criados em pouco tempo em todo o mundo. Podemos transformar o planeta em uma grande Florença do renascimento. Esse é o lado potencialmente bom da globalização.

Aumento do efeito estufa ameaça plantas, diz estudo O aumento de dióxido de carbono na atmosfera, resultante do uso de combustíveis fósseis e das queimadas, pode ter consequências calamitosas para o clima mundial, mas também pode afetar diretamente o crescimento das plantas. Cientistas da Universidade de Basel, na Suíça, mostraram que, embora o dióxido de carbono seja essencial para o crescimento dos vegetais, quantidades excessivas desse gás prejudicam a saúde das plantas e têm efeitos incalculáveis na agricultura de vários países. O Estado de São Paulo, 20 set. 1992, p. 32.

Veja, “Entrevista: Domenico de Masi”.

O efeito de humor que pode ser depreendido no gráfico advém de informações presentes nas entrelinhas, podendo-se afirmar que

a. a palavra “mas”, na linha 3, contradiz a afirmação inicial do texto: linhas 1 e 2. b. a palavra “embora”, na linha 4, introduz uma explicação que não encontra complemento no restante do texto. c. as expressões: “consequências calamitosas”, na linha 2, e “efeitos incalculáveis”, na linha 6, reforçam a ideia que perpassa o texto sobre o perigo do efeito estufa. d. o uso da palavra “cientistas”, na linha 3, é desnecessário para dar credibilidade ao texto, uma vez que se fala em “estudo” no título. e. a palavra “gás”, na linha 5, refere-se a “combustíveis fósseis” e “queimadas”, nas linhas 1 e 2, reforçando a ideia de catástrofe.

O sociólogo italiano Domenico de Masi concedeu essa entrevista na qual falou sobre criatividade. Para ele, ser criativo a. é conviver com pessoas que tenham duas características: fantasia e realização. b. é apresentar duas qualidades: a fantasia e a realização. c. é relacionar pessoas que possuam as duas qualidades: fantasia e realização. d. é relacionar pessoas que possuam qualquer das duas qualidades: fantasia ou realização. e. é conviver entre pessoas que tenham as duas qualidades: fantasia e realização.

O texto acima possui elementos coesivos que promovem sua manutenção temática. A partir dessa perspectiva, conclui-se que

17. (Enem 2009) Texto I

15. Observe com atenção o gráfico a seguir.

Ser brotinho não é viver em um píncaro azulado; é muito mais! Ser brotinho é sorrir bastante dos homens e rir interminavelmente das mulheres, rir como se o ridículo, visível ou invisível, provocasse uma tosse de riso irresistível.

Chances de um ateu acreditar em Deus

Paulo Mendes Campos, “Ser brotinho”.

Percentual

100%

80%

Texto II

60%

Ser gagá não é viver apenas nos idos do passado: é muito mais! É saber que todos os amigos já morreram e os que teimam em viver são entrevados. É sorrir, interminavelmente, não por necessidade interior, mas porque a boca não fecha ou a dentadura é maior que a arcada.

40%

Millôr Fernandes, “Ser gagá”.

20%

0% Discutindo Atrasado Em época Sendo com para o de Natal seguido alguém trabalho pela polícia

Quando não estudou para a prova

Vendo futebol

expoENEM 4

Os textos utilizam os mesmos recursos expressivos para definir as fases da vida, entre eles, a. expressões coloquiais com significados semelhantes. b. ênfase no aspecto contraditório da vida dos seres humanos. c. recursos específicos de textos escritos em linguagem formal. d. termos denotativos que se realizam com sentido objetivo. e. metalinguagem que explica com humor o sentido de palavras.


18. (Enem 2009)

Apesar da ciência, ainda é possível acreditar no sopro divino – o momento em que o Criador deu vida até ao mais insignificante dos microrganismos? Resposta de Dom Odilo Scherer, cardeal arcebispo de São Paulo, nomeado pelo papa Bento XVI em 2007:

Os dois entrevistados responderam a questões idênticas, e as respostas a uma delas foram reproduzidas aqui. Tais respostas revelam opiniões opostas: um defende a existência de Deus e o outro não concorda com isso. Para defender seu ponto de vista, a. o religioso ataca a ciência, desqualificando a Teoria da Evolução, e o ateu apresenta comprovações científicas dessa teoria para derrubar a ideia de que Deus existe.

“Claro que sim. Estaremos falando sempre que, em algum momento, começou a existir algo, para poder evoluir em seguida. O ato do criador precede a possibilidade de evolução: só evolui algo que existe. Do nada, nada surge e evolui.”

b. Scherer impõe sua opinião pela expressão “claro que sim”, por se considerar autoridade competente para definir o assunto, enquanto Dennett expressa dúvida, com expressões como “é possível”, assumindo não ter opinião formada.

Adaptado de: Eduardo Lima, “Testemunha de Deus”.

c. o arcebispo critica a teoria do Design Inteligente, pondo em dúvida a existência de Deus, e o ateu argumenta com base no fato de que algo só pode evoluir se, antes, existir.

Resposta de Daniel Dennet, filósofo americano ateu e evolucionista radical, formado em Harvard e Doutor por Oxford:

d. o arcebispo usa uma lacuna da ciência para defender a existência de Deus, enquanto o filósofo faz uma ironia, sugerindo que qualquer coisa inventada poderia preencher essa lacuna.

“É claro que é possível, assim como se pode acreditar que um super-homem veio para a Terra há 530 milhões de anos e ajustou o DNA da fauna cambriana, provocando a explosão da vida daquele período. Mas não há razão para crer em fantasias desse tipo.”

e. o filósofo utiliza dados históricos em sua argumentação, ao afirmar que a crença em Deus é algo primitivo, criado na época cambriana, enquanto o religioso baseia sua argumentação no fato de que algumas coisas podem “surgir do nada”.

Adaptado de: Eduardo Lima, “Advogado do Diabo”.

19. (Enem 2009)

O Globo, Rio de Janeiro, Segundo Caderno, 19 dez. 2008, p. 7.

O personagem Chico Bento pode ser considerado um típico habitante da zona rural, comumente chamado de “roceiro” ou “caipira”. Considerando a sua fala, essa tipicidade é confirmada primordialmente pela

b. explorar a facilidade de ler e escrever textos e receber comentários na internet para desenvolver a interatividade e a análise crítica, promovendo a construção do conhecimento.

a. transcrição da fala característica de áreas rurais.

c. estudar o uso de programas de processamento para imagens e vídeos de alta complexidade para capacitar profissionais em tecnologia digital.

b. redução do nome “José” para “Zé”, comum nas comunidades rurais.

d. exercitar a navegação pela rede em busca de jogos que possam ser “baixados” gratuitamente para serem utilizados como entretenimento.

c. emprego de elementos que caracterizam sua linguagem como coloquial. d. escolha de palavras ligadas ao meio rural, incomuns nos meios urbanos. e. utilização da palavra “coisa”, pouco frequente nas zonas mais urbanizadas.

e. estimular as habilidades psicomotoras relacionadas ao uso físico do computador, como mouse, teclado, monitor etc. 21. Leia com atenção o texto a seguir.

20. (Enem 2009) A sociedade atual testemunha a influência determinante das tecnologias digitais na vida do homem moderno, sobretudo daquelas relacionadas com o computador e a internet. Entretanto, parcelas significativas da população não têm acesso a tais tecnologias. Essa limitação tem pelo menos dois motivos: a impossibilidade financeira de custear os aparelhos e os provedores de acesso, e a impossibilidade de saber utilizar o equipamento e usufruir das novas tecnologias. A essa problemática dá-se o nome de exclusão digital.

No contexto das políticas de inclusão digital, as escolas, nos usos pedagógicos das tecnologias de informação, devem estar voltadas principalmente para a. proporcionar aulas que capacitem os estudantes a montar e desmontar computadores, para garantir a compreensão sobre o que são as tecnologias digitais. expoENEM 5

A Cristo crucificado estando o poeta na última hora da sua vida Pequei, Senhor; mas não porque hei pecado, Da vossa alta clemência me despido, Porque quanto mais tenho delinquido, Vos tenho a perdoar mais empenhado. Se basta a vos irar tanto pecado, A abrandar-vos sobeja um só gemido; Que a mesma culpa, que vos há ofendido, Vos tem para o perdão lisonjeado. Se uma ovelha perdida e já cobrada Glória tal e prazer tão repentino Vos deu, como afirmais na sacra história:


século XIX, ao século XXI e à internet. Relacionando as estéticas realista e contemporânea, nessa canção, o autor

Eu sou, Senhor, a ovelha desgarrada, Cobrai-a; e não queirais, pastor divino, Perder na vossa ovelha a vossa glória.

a. usa a intertextualidade para demonstrar que a ambiguidade da Capitu de Machado de Assis se distancia da Capitu internáutica.

Gregório de Matos, “A Cristo crucificado”.

b. mitifica o universo feminino contemporâneo por associá-lo ao universo da estética realista.

Nesse poema do poeta barroco Gregório de Matos, há uma relação entre pecado e culpa. Tal relação permite concluir

c. diminui o efeito semântico do universo feminino e dilui o poder da Capitu contemporânea, ao reproduzir a estrutura rítmica da sigla WWW.

a. que, se não houvesse pecado, não haveria necessidade de perdão; se houvesse a ofensa, não haveria a lisonja de perdoar.

d. evidencia que tanto na estética realista como na contemporânea não há preocupação com os aspectos sociais da mulher.

b. que o pecado ofende a Deus, o que afasta o pecador d’Ele, mas também O lisonjeia, porque permite a Deus que o perdoe.

e. usa referências intertextuais, agregadas a outros elementos, a fim de contribuir para uma melhor definição e expansão do personagem, estabelecendo um diálogo entre a ficção literária, a canção e a internet.

c. que o pecado e o perdão seriam duas faces da mesma moeda: a existência de um depende da inexistência de outro. d. que, se só existisse o pecador, não existiria a necessidade de alguém para perdoar. e. que o pecado e o perdão ofendem a Deus, então o pecador se afasta definitivamente d’Ele, não merecendo o perdão.

24. Leia com atenção o texto a seguir. Noite malandra, um luar de espelho, No meio da terra a índia colhe o brilho, Som de suor, cheirada musical, Palmeira que se verga em meio ao vendaval. Sentia macia floresta, Bolívia, montanha, seresta...

22. Leia com atenção o trecho bíblico a seguir, relacionando-o ao texto anterior. Parábola da ovelha desgarrada O que vos parece? Suponhamos que um homem possua cem ovelhas e uma se desgarre. Não deixará ele as noventa e nove na montanha para ir buscar a ovelha que se extraviou? E eu vos asseguro que, ao encontrá-la, sente mais alegria por ela do que pelas noventa e nove que não se extraviaram. Assim a vontade do Pai celeste é de que não se perca nem um só dos pecadores.

Índia guajira já colheu sua noite Volta para a tribo meio injuriada, Uma figueira numa encruzilhada Felina, um olho de paixão danada, Era Leão, famoso traficante, Um outdoor, bandido elegante, Que a levou para um apart-hotel Que tem em Cuiabá.

Lucas, 15: 3-7.

No soneto “A Cristo Crucificado”, de Gregório de Matos, há referência à parábola da “Ovelha desgarrada”. Considerando a relação entre o poema e a parábola, pode-se afirmar que

Índia, na estrada, largou a tribo Comprou um vestido, aprendeu a atirar, Índia virada, alucinada pelo cara-pálida do Pantanal, Índia guajira e o traficante Loucos de amor, trocavam o seu mel, Era um amor tipo 45, E tiroteios rasgando o vestido, Em quartos de motel.

a. O eu lírico se considera a ovelha desgarrada e afirma que, se Deus não recuperá-la, além de perder essa ovelha, perderá também a glória de recuperá-la. b. Se a recuperação da ovelha perdida deu “glória” e “prazer” a Deus, a não recuperação dela não o privaria disso.

Explode o amor, adiós para o pudor, Guajira e o traficante passam a escancarar, Rolam papéis, nos bares, nos bordéis, Os dois de Bonnie and Clyde, assunto dos cordéis, Maíra, pivete, amazônia, Esqueceu Tupã, a sem-vergonha... Dentro de um Cessna, bebendo champagne Leão e seu bando a fazem sua chefona, Índia fichada, retrata falada, A loto esperada pelos federais, Mas ela gosta de fotografia E vira capa dos jornais do dia, Enquanto espera uma tonelada da pura alegria. Índia, sujeira, foi dedurada Por um sertanista que era amigo seu, Índia traída – “mim tô passada” – Ela lamentava num mal português, A Índia, deu um ganho, num Landau negro, Chapa oficial, que era da Funai, Passou batido pela fronteira, Uma rajada de metralhadora... Morta no Paraguai!

c. A ovelha desgarrada (o eu lírico) suplica a Deus que a reintegre ao rebanho, porque está arrependida e não que pecar mais. d. O eu lírico reconhece que se desgarrou, ou melhor, que pecou, mas também percebe que isso não o afastará de Deus. e. O eu lírico defende que só os pecadores têm a atenção de Deus, haja vista a importância que Deus dá à ovelha desgarrada em detrimento das outras 99 ovelhas. 23. Leia com atenção o texto a seguir. De um lado / Vem você / Com seu jeitinho / Hábil, hábil, hábil / E pronto / Me conquista / Com seu dom De outro / Esse seu site petulante WWW / Ponto / Poderosa / Ponto com É esse o seu / Modo de ser ambíguo / Sábio, sábio / E todo encanto / Canto, canto / Raposa e sereia / Da terra e do mar / Na tela e no ar Você é virtualmente / Amada amante / Você real é ainda / Mais tocante / Não há quem não se encante Um método de agir / Que é tão astuto / Com jeitinho / Alcança tudo, / Tudo, tudo / É só entregar / E não resistir / É capitular

Eduardo Dusek & Luiz Carlos Góes, “A índia e o traficante”.

(...) Luiz Tatit, “Capitu”.

Na canção "Capitu", Luiz Tatit apresenta um forte imaginário feminino, que liga a obra literária “Dom Casmurro”, de Machado de Assis, do expoENEM 6

Dusek e Góes atualizam intertextualmente o personagem Iracema, do escritor romântico José de Alencar. Essa atualização acontece na transformação da Iracema alencariana em uma Iracema


a. aventureira e feliz à semelhança da personagem Bonnie, famosa assaltante dos anos de 1930 nos EUA.

b. análoga à do século XIX, a qual se entregou ao estrangeiro para a formação de uma raça formadora de uma nova nação.

A história do livro foi contada por um personagem denominado Dom Casmurro. A despeito de muitas ambiguidades que semeia em todo o romance, neste último capítulo, Dom Casmurro afirma categoricamente que

c. que desmonta as idealizações do romantismo do século XIX e dá lugar a uma índia vítima de uma modernidade falaciosa.

a. Capitu e Escobar o traíram.

d. que ainda simboliza a América, representada pelo vocabulário norte-americano de alguns versos.

c. o seu apego à Bíblia perdoa os amigos traidores.

e. que luta pelo nacionalismo proposto por José de Alencar, apesar de ela ser vítima da cultura americana.

e. a Capitu mulher não se manifestou na Capitu menina.

b. não tem certeza da traição de Capitu e Escobar. d. o seu ciúme não lhe permitiu ver a traição de que era vítima.

27. Observe a imagem e leia com atenção o texto a seguir.

25. Leia com atenção o texto a seguir. Longe do estéril turbilhão da rua, Beneditino escreve! No aconchego Do claustro, na paciência e no sossego, Trabalha, e teima, e lima, e sofre, e sua! Mas que na forma se disfarce o emprego Do esforço: e trama viva se construa De tal modo, que a imagem fique nua Rica, mas sóbria, como um templo grego. Não se mostre na fábrica o suplício Do mestre. E, natural, o efeito agrade, Sem lembrar os andaimes do edifício: Porque a Beleza, gêmea da Verdade, Arte pura, inimiga do artifício, É a força e a graça na simplicidade. Olavo Bilac, “A um poeta”.

Tarsila do Amaral, Abaporu

Esse poema de Olavo Bilac mostra-se como explicação do Parnasianismo. Sendo assim,

O Tropicalismo e a Antropofagia

a. a poesia parnasiana ressalta o valor da emoção e rejeita o racionalismo.

Quarenta e cinco anos depois da Semana de Arte Moderna, em 1967, os artistas Caetano Veloso e Gilberto Gil, o compositor Torquato Neto e o maestro Rogério Duprat, entre outros, lançaram o Tropicalismo, movimento de renovação musical, que ganhou adeptos na literatura, no cinema e no teatro. O Tropicalismo tem relação com a Antropofagia, o mais radical dos manifestos do Modernismo.

b. a poesia parnasiana, ao mesclar sentido e som, busca revelar as profundezas da alma humana. c. a formalidade do parnasianismo leva-o a valorizar a técnica do poema para, consequentemente, supervalorizar o tema. d. o fundamento do parnasianismo está no cuidado com a técnica na montagem do poema, na lapidação do texto e no refinamento da linguagem.

a. foi escrito por Oswald de Andrade e teve, como motivo inspirador, a obra “Abaporu”, de Tarsila do Amaral. O manifesto e a obra datam do mesmo ano, 1922, logo após a Semana de Arte Moderna.

e. a preocupação com a técnica do poema fez com que os parnasianos criassem o poema em prosa, conhecido como uma conquista do Modernismo posterior.

b. Oswald criou a principal proposição do Manifesto: devorar a cultura estrangeira e regurgitar somente aquilo que interessasse ao povo brasileiro, sem se cair na xenofobia e no ufanismo extremado dos verde amarelistas de Plínio Salgado.

26. Leia com atenção o trecho a seguir, retirado do último capítulo (148) do romance “Dom Casmurro”, de Machado de Assis.

c. ao escrever a frase símbolo da antropofagia – Tupi or not tupi – Oswald de Andrade acena para uma possível influência de elementos da cultura inglesa na formação da cultura brasileira.

Agora, por que é que nenhuma dessas caprichosas me fez esquecer a primeira amada do meu coração? Talvez porque nenhuma tinha os olhos de ressaca, nem os de cigana oblíqua e dissimulada. Mas não é esse propriamente o resto do livro. O resto é saber se a Capitu da praia da Glória já estava dentro da de Matacavalos, ou se esta foi mudada naquela por efeito de algum caso incidente. Jesus, filho de Sirach, se soubesse dos meus primeiros ciúmes, dir-me-ia, como no seu cap. IX, vers. 1: “Não tenhas ciúmes de tua mulher para que ela não se meta a enganar-te com a malícia que aprender de ti”. Mas eu creio que não, e tu concordarás comigo; se te lembras bem da Capitu menina, hás de reconhecer que uma estava dentro da outra, como a fruta dentro da casca. E bem, qualquer que seja a solução, uma coisa fica, e é a suma das sumas, ou resto dos restos, a saber, que a minha primeira amiga e o meu maior amigo, tão extremosos ambos e tão queridos também, quis o destino que acabassem juntando-se e enganando-me... A terra lhes seja leve! Vamos à História dos subúrbios.

Sobre o Manifesto Antropofágico, pode-se afirmar que

d. o Movimento Antropofágico propunha um nacionalismo primitivista e ufanista, que acabou evoluindo, em 1932, para o Integralismo. A anta foi escolhida como símbolo da nacionalidade por ter sido totem da raça tupi. e. “Macunaíma”, de Mário de Andrade, incorpora algumas propostas da Antropofagia, mas radicaliza no sentido de defender a cultura indígena, despida de qualquer influência estrangeira, como a única cultura brasileira. 28. Leia com atenção os textos a seguir.

Machado de Assis, “Dom Casmurro”.

expoENEM 7

Texto 1 Vem Floriano; estouram as granadas de Custódio; Gumercindo bate às portas de Roma; Incitatus derranca o país. O caboclo continua de cócoras, a modorrar... Nada o desperta. Nenhuma ferroada o


põe de pé. Social, como individualmente, em todos os atos da vida, Jeca, antes de agir, acocora-se. Jeca Tatu é um piraquara do Paraíba, maravilhoso epítome de carne onde se resumem todas as características da espécie. Pobre Jeca Tatu! Como és bonito no romance e feio na realidade!

foi burburinho que depressa passou à gritaria, e ainda mais depressa à algazarra, e não foi ainda mais adiante porque de vez em quando viam-se passar (...).

Monteiro Lobato, “Urupês”.

a. desafio / fado / minuete

Texto 2

b. burburinho / gritaria / algazarra

O sertanejo é, antes de tudo, um forte. Não tem o raquitismo exaustivo dos mestiços neurastênicos do litoral.

c. viola / rabeca / modinha d. casaca / calção / espadim

A sua aparência, entretanto, ao primeiro lance de vista, revela o contrário. Falta-lhe a plástica impecável, o desempeno, a estrutura corretíssima das organizações atléticas. (...)

e. português / brasileiro / corte 30. Leia com atenção o texto a seguir.

Basta o aparecimento de qualquer incidente exigindo-lhe o desencadear das energias adormecidas. O homem transfigura-se.

Vou-me embora pra Pasárgada Lá sou amigo do rei Lá tenho a mulher que eu quero Na cama que escolherei Vou-me embora pra Pasárgada.

Euclides da Cunha, “Os Sertões”.

Nesse texto, há uma gradação que caracteriza a ação de personagens que saem da convenção do comportamento social para a perda de limites e de medidas. Tal gradação é evidenciada na alternativa:

No Pré-modernismo, os escritores fizeram uma leitura crítica sobre o Brasil republicano recente. É certamente nessa leitura que se enquadram os textos de “Urupês” e de “Os Sertões”. Considerando essa leitura,

Vou-me embora pra Pasárgada Aqui eu não sou feliz Lá a existência é uma aventura (...) Em Pasárgada tem tudo É outra civilização Tem um processo seguro De impedir a concepção Tem telefone automático Tem alcaloide à vontade Tem prostitutas bonitas Para a gente namorar (...) Vou-me embora pra Pasárgada

a. a descrição de dois tipos regionais brasileiros, o caipira e o sertanejo, revela a preocupação dos autores em confirmar a nossa modernidade próxima à da Europa, em relação à imagem pós-republicana e parnasiana de um país civilizado. b. apesar das diferenças estilísticas e de tipos específicos de enfoque, Monteiro Lobato e Euclides da Cunha mostram, respectivamente no "Jeca Tatu" e no "sertanejo", paisagens urbanas e regionais. c. ao denunciar a existência desses tipos nacionais marginalizados, esquecidos pela literatura oficial cosmopolita, Monteiro Lobato e Euclides da Cunha se aproximam de nosso Modernismo, razão pela qual são designados pré-modernistas. d. Monteiro Lobato e Euclides da Cunha tinham por objetivo fazer a denúncia de problemas estruturais da sociedade brasileira de uma maneira menos mecanicista ou determinista. e. Ao focalizar diferentes regiões, as duas obras promovem um descentramento que nunca havia sido realizado na literatura brasileira.

Manuel Bandeira, “Vou-me embora pra Pasárgada”.

29. O romance romântico-realista “Memórias de um Sargento de Milícias”, de Manuel Antônio de Almeida, além de caracterizar a malandragem carioca, faz um retrato competente da índole do povo brasileiro. O texto seguinte, extraído desse romance, é parte da narração do batizado de Leonardo, o protagonista do livro, filho (?) de Leonardo Pataca e Maria da Hortaliça. Chegou o dia de batizar-se o rapaz. (...) Já se sabe que houve nesse dia função: os convidados do dono da casa, que eram todos dalém-mar, cantavam ao desafio, segundo seus costumes; os convidados da comadre, que eram todos da terra, dançavam o fado. O compadre trouxe a rabeca, que é, como se sabe, o instrumento favorito da gente do ofício. A princípio o Leonardo quis que a festa tivesse ares aristocráticos, e propôs que se dançasse o minuete da corte. Foi aceita a ideia, ainda que houvesse dificuldade em encontrarem--se pares. (...) O compadre foi quem tocou o minuete na rabeca. (...) Depois do minuete foi desaparecendo a cerimônia, e a brincadeira aferventou, como se dizia naquele tempo. Chegaram uns rapazes de viola e machete: o Leonardo, instado pelas senhoras, decidiu-se a romper a parte lírica do divertimento. Sentou-se num tamborete, em um lugar isolado da sala, e tomou uma viola. Fazia um belo efeito cômico vê-lo, em trajes de ofício, de casaca, calção e espadim, acompanhando com um monótono zunzum nas cordas do instrumento o garganteado de uma modinha pátria. (...)

Diz-se que Ciro II, rei da Pérsia (atual Irã), construiu uma cidade – Pasárgada – que representava suas glórias (imperador do mundo) e era um paraíso terrestre, isto é, lá havia tudo o que pudesse existir de bom e prazeroso. O poeta modernista Manuel Bandeira, tuberculoso incurável e sofrido, retomou, subjetivamente, a história de Pasárgada. Nesse poema, o eu lírico a. faz uma crítica jocosa à vida boêmia tão comum no Rio de Janeiro dos anos 1950. b. contrapõe-se ao sonho romântico de fuga da realidade, fazendo brincadeira com essa impossível Pasárgada. c. nega o valor que se dava na época às tecnologias apregoadas pelo Futurismo, uma das vanguardas que mais influenciaram o Modernismo. d. constrói um poema à moda parnasiana, isto é, em redondilha menor (cinco sílabas). e. reafirma o ideal romântico de fuga da realidade por meio de um sonho – Pasárgada.

31. O romance “Triste fim de Policarpo Quaresma”, do pré-modernista Lima Barreto, conta a história de um funcionário público que se apaixonou pelo Brasil. Ele achava que a verdadeira língua brasileira era o tupi-guarani, e por isso escreveu este requerimento ao Congresso Nacional:

Foi executada com atenção e aplaudida com entusiasmo. O canto do Leonardo foi o derradeiro toque de rebate para esquentar-se a brincadeira, foi o adeus às cerimônias. Tudo daí em diante expoENEM 8

Policarpo Quaresma, cidadão brasileiro, funcionário público, certo de que a língua portuguesa é emprestada ao Brasil; certo também de que, por esse fato, o falar e o escrever em geral, sobretudo no campo das letras, se veem na humilhante contingência de sofrer continuamente censuras ásperas dos proprietários da língua; sabendo, além, que, dentro do nosso país, os autores e os escritores, com


especialidade os gramáticos, não se entendem no tocante à correção gramatical, vendo-se, diariamente, surgir azedas polêmicas entre os mais profundos estudiosos do nosso idioma – usando do direito que lhe confere a Constituição, vem pedir que o Congresso Nacional decrete o tupi-guarani como língua oficial e nacional do povo brasileiro.

Ganhei novamente 10, o professor fez questão de ler, ele mesmo, a minha obrinha para a classe estupefata (...). Foi logo depois das férias de junho que o professor passou nova composição: Amanhecer na Fazenda. Ora, eu tinha passado uns quinze dias na Boa Esperança, fazenda de meu tio Cristóvão, e estava muito bem informado sobre os amanheceres da mesma. Peguei da pena e fui contando com a maior facilidade. Passarinhos, galinhas, patos, uma negra jogando milho para as galinhas e os patos, um menino tirando leite da vaca, vaca mugindo... e (...) para fecho de ouro: “Um burro zurrando escandalosamente”.

O suplicante, deixando de parte os argumentos históricos que militam em favor de sua ideia, pede vênia para lembrar que a língua é a mais alta manifestação da inteligência de um povo, é a sua criação mais viva e original; e, portanto, a emancipação política do país requer como complemento e consequência a sua emancipação idiomática. Demais, Senhores Congressistas, o tupi-guarani, língua originalíssima, aglutinante, é a única capaz de traduzir as nossas belezas, de pôr-nos em relação com a nossa natureza e adaptar-se perfeitamente aos nossos órgãos vocais e cerebrais, por ser criação de povos que aqui viveram e ainda vivem, portanto possuidores da organização fisiológica e psicológica para que tendemos, evitando-se dessa forma as estéreis controvérsias gramaticais, oriundas de uma difícil adaptação de uma língua de outra região à nossa organização cerebral e ao nosso aparelho vocal – controvérsias que tanto empecem o progresso da nossa cultura científica e filosófica. Seguro de que a sabedoria dos legisladores saberá encontrar meios para realizar semelhante medida e cônscio de que a Câmara e o Senado pesarão o seu alcance e utilidade.

Foi minha desgraça. O professor disse que daquela vez o senhor Braga o havia decepcionado, não tinha levado a sério seu dever e não merecia uma nota maior do que 5; e para mostrar como era ruim minha composição leu aquele final: “Um burro zurrando escandalosamente”. Foi uma gargalhada geral dos alunos, uma gargalhada que era uma grande vaia cruel. Sorri amarelo. Minha glória literária fora por água abaixo. Rubem Braga, “A minha glória literária”.

P. e E. deferimento.

a. a avaliação do professor, que valorizou as duas primeiras redações em detrimento da terceira, revela uma postura objetiva e coerente.

Lima Barreto, “Triste fim de Policarpo Quaresma”.

Tendo em vista a compreensão global do texto e algumas particularidades dele, infere-se que

b. ao afirmar ter sido "tímido e mal falante", motivo pelo qual se colocou em dúvida a autoria da composição “A Lágrima”, o cronista quis defender uma concepção de caráter universal de que só os indivíduos muito falantes, extrovertidos e sociáveis podem ser grandes escritores.

Esse pedido de Policarpo Quaresma obviamente tange as raias do impossível; então, a atitude de Quaresma permite que ele seja caracterizado como um personagem a. trovadoresco. b. picaresco. c. quixotesco d. bacharelesco. e. dantesco.

c. as três redações estavam no mesmo nível, por isso deveriam receber a mesma nota. d. não houve coerência na avaliação dos textos, uma vez que se supervalorizou o discurso prolixo, pleno de expressões estereotipadas e conceitos distorcidos.

32. Leia com atenção o texto a seguir.

e. as três redações foram avaliadas corretamente, considerando-se a originalidade das duas primeiras e a pobreza de estilo da última.

“Quando a minha alma vibra, atormentada...” Tremi de emoção ao ver essas palavras impressas. E lá estava o meu nome, que pela primeira vez eu via em letras de forma. O jornal era O Itapemirim, órgão oficial do Grêmio Domingos Martins, dos alunos do Colégio Pedro Palácios, de Cachoeiro do Itapemirim, Estado do Espírito Santo.

33. Leia com atenção o texto a seguir.

O professor de Português passara uma composição: A Lágrima. Não tive dúvidas: peguei a pena e me pus a escrever coisas sublimes. Ganhei 10, e ainda por cima a composição foi publicada no jornalzinho do colégio. Não era para menos. “Quando a alma vibra, atormentada, às pulsações de um coração amargurado pelo peso da desgraça, este, numa explosão irremediável, num desabafo sincero de infortúnios, angústias e mágoas indefiníveis, externa-se, oprimido, por uma gota de água ardente como o desejo e consoladora como a esperança; e esta pérola de amargura arrebatada pela dor ao oceano tumultuoso da alma dilacerada é a própria essência do sofrimento: a lágrima”. (...) Sim, eu era um pouco exagerado; hoje não me arriscaria a afirmar tantas coisas. Mas o importante é que minha composição abafara, e tanto que não faltou um colega despeitado que pusesse em dúvida a sua autoria: eu devia ter copiado aquilo de algum almanaque. A suspeita tinha seus motivos: tímido e mal falante, meio emburrado na conversa, eu não seria capaz de tamanha eloquência (...). Uma semana depois o professor mandou que nós escrevêssemos sobre a Bandeira Nacional. Foi então que – dá-lhe, Braga! – meti uma bossa que deixou todos maravilhados. Minha composição tinha poucas linhas, mas era nada menos que uma paráfrase do Padre-Nosso, que começava assim: “Bandeira nossa, que estais no céu...” Não me lembro do resto, mas era divino. expoENEM 9

Atrás de portas fechadas, à luz de velas acesas, brilham fardas e casacas, junto com batinas pretas. E há finas mãos pensativas, entre galões, sedas, rendas, e há grossas mãos vigorosas, de unhas fortes, duras veias, e há mãos de púlpito e altares, de Evangelho, cruzes, bênçãos. Uns são reinóis, uns, mazombos*; e pensam de mil maneiras; mas citam Virgílio e Horácio, e refletem, e argumentam, falam de minas e impostos, de lavras e de fazendas, de ministros e rainhas e das colônias inglesas. Atrás de portas fechadas, à luz de velas acesas, uns sugerem, uns recusam, uns ouvem, uns aconselham. Se a derrama for lançada, há levante, com certeza. *Filhos de pais estrangeiros, sobretudo de portugueses, nascidos no Brasil.

Cecília Meireles, “Romanceiro da Inconfidência”.


Há, no texto, referência indireta ao Arcadismo, estilo literário que se desenvolveu, no Brasil, no tempo dos fatos históricos de que trata o texto. Tal referência é evidenciada por Cecília Meireles na alternativa:

Seu João, perdido de catarata negra nos dois olhos: – Meu consolo que, em vez de nhá Biela, eu vejo uma nuvem. “Ministória 173”.

a. “de Evangelho, cruzes, bênçãos”. b. “e há grossas mãos vigorosas”.

– Se você me deixa, ó cara, quem espreme as tuas espinhas nas costas? E recorta no teu dedão, com tanto amor, essa unha encravada?

c. “à luz de velas acesas”. d. “falam de minas e impostos”. e. “mas citam Virgílio e Horácio”.

“Ministória 179”.

34. Leia com atenção o texto a seguir. © StudioR/Rosa Gauditano

Daí perguntou qual era o meu nome, Joana eu disse, quantos aninhos você tem, oito eu disse, você quer uma boneca de cachinho, quero eu disse. Ele prometeu todas as bonecas de cachinho se eu não gritasse. “Ah, é?”, conto 33.

Se a filha do Pádua não traiu Bentinho, Machadinho se chama José de Alencar. “Dinorá”.

No fundo do mato-virgem nasceu Macunaíma, herói da nossa gente. Era preto retinto e filho do medo da noite. (...) Já na meninice fez coisas de sarapantar. De primeiro passou mais de seis anos não falando. Se o incitavam a falar, exclamava:

Esses minicontos pertencem a um escritor contemporâneo de linguagem apurada, minimalista, criador de histórias sintéticas, breves, verdadeiros haicais em prosa; escritor irônico (cáustico até), pintor de tragédias cotidianas. Trata-se de a. Rubem Fonseca. b. Dalton Trevisan. c. Carlos Heitor Cony.

– Ai! Que preguiça!

d. Antônio Torres.

Mário de Andrade, “Macunaíma”.

e. João Ubaldo Ribeiro. São rudes, severos, sedentos de glória, Já prélios incitam, já cantam vitória, Já meigos atendem à voz do cantor: São todos Timbiras, guerreiros valentes! Seu nome lá voa na boca das gentes, Condão de prodígios, de glória e terror!

36. (Enem 2009) Cárcere das almas Ah! Toda a Alma num cárcere anda presa, soluçando nas trevas, entre as grades do calabouço olhando imensidades, mares, estrelas, tardes, natureza.

Gonçalves Dias, “I-Juca-Pirama”.

Tudo se veste de uma igual grandeza quando a alma entre grilhões as liberdades sonha e, sonhando, as imortalidades rasga no etéreo o Espaço da Pureza.

Em prosa ou em verso, o índio tem tido presença constante na Literatura Brasileira. A respeito da literatura sobre o índio, é correto afirmar que a. os textos (prosa ou verso) têm cumprido um claro projeto de retratar o índio de forma verdadeira ou bem próxima da realidade.

Ó almas presas, mudas e fechadas nas prisões colossais e abandonadas, da Dor no calabouço, atroz, funéreo!

b. os românticos José de Alencar (nos romances) e Gonçalves Dias (nos poemas) procuraram retratar o índio como o fizeram os cronistas viajantes do século XVI.

Nesses silêncios solitários, graves, que chaveiro do Céu possui as chaves para abrir-vos as portas do Mistério?!

c. José de Alencar e Gonçalves Dias, românticos, viram a relação índio X europeu de formas diferentes: aquele uniu ambos na formação do mestiço, ao passo que este via o europeu como um aniquilador dos índios. d. “Macunaíma”, rapsódia que Mario de Andrade dedicou a José de Alencar, retrata o índio vivendo entre civilizados e não se corrompendo.

Cruz e Sousa, “Cárcere das almas”.

e. Tanto o modernista Mário de Andrade como os românticos José de Alencar e Gonçalves Dias trataram o índio de forma idealizada. 35. Observe os cinco pequenos contos seguintes: Você pode contar nos dedos as pequenas delícias da vida: o azedinho da pitanga na língua do menino, a figurinha premiada de bala Zequinha, um e outro conto de Tchecov, o canto da corruíra bem cedo, o perfume da glicínia debaixo da janela, o êxtase do primeiro porrinho, o beijo com gosto de bolacha Maria e geleia de uva, um corpo nu de mulher. “Ministória 54”.

expoENEM 10

Os elementos formais e temáticos relacionados ao contexto cultural do Simbolismo encontrados no poema “Cárcere das almas”, de Cruz e Sousa, são a. a opção pela abordagem, em linguagem simples e direta, de temas filosóficos. b. a prevalência do lirismo amoroso e intimista em relação à temática nacionalista. c. o refinamento estético da forma poética e o tratamento metafísico de temas universais. d. a evidente preocupação do eu lírico com a realidade social expressa em imagens poéticas inovadoras. e. a liberdade formal da estrutura poética que dispensa a rima e a métrica tradicionais em favor de temas do cotidiano.


sincretismo religioso, as raízes africanas e indígenas que caracterizam o nosso povo.

37. (Enem 2009) Gênero dramático é aquele em que o artista usa como intermediária entre si e o público a representação. A palavra vem do grego drao (fazer) e quer dizer ação. A peça teatral é, pois, uma composição literária destinada à apresentação por atores em um palco, atuando e dialogando entre si. O texto dramático é complementado pela atuação dos atores no espetáculo teatral e possui uma estrutura específica, caracterizada: 1) pela presença de personagens que devem estar ligados com lógica uns aos outros e à ação; 2) pela ação dramática (trama, enredo), que é o conjunto de atos dramáticos, maneiras de ser e de agir das personagens encadeadas à unidade do efeito e segundo uma ordem composta de exposição, conflito, complicação, clímax e desfecho; 3) pela situação ou ambiente, que é o conjunto de circunstâncias físicas, sociais, espirituais em que se situa a ação; 4) pelo tema, ou seja, a ideia que o autor (dramaturgo) deseja expor, ou sua interpretação real por meio da representação.

e. Érico Veríssimo, Rachel de Queiroz, Simões Lopes Neto e Jorge Amado são romancistas das décadas de 30 e 40 do século XX, cuja obra retrata a problemática do homem urbano em confronto com a modernização do país promovida pelo Estado Novo. 39. (Enem 2009) Texto I (...) já foi o tempo em que via a convivência como viável, só exigindo deste bem comum, piedosamente, o meu quinhão, já foi o tempo em que consentia num contrato, deixando muitas coisas de fora sem ceder contudo no que me era vital, já foi o tempo em que reconhecia a existência escandalosa de imaginados valores, coluna vertebral de toda ‘ordem’; mas não tive sequer o sopro necessário, e, negado o respiro, me foi imposto o sufoco; é esta consciência que me libera, é ela hoje que me empurra, são outras agora minhas preocupações, é hoje outro o meu universo de problemas; num mundo estapafúrdio — definitivamente fora de foco — cedo ou tarde tudo acaba se reduzindo a um ponto de vista, e você que vive paparicando as ciências humanas, nem suspeita que paparica uma piada: impossível ordenar o mundo dos valores, ninguém arruma a casa do capeta; me recuso pois a pensar naquilo em que não mais acredito, seja o amor, a amizade, a família, a igreja, a humanidade; me lixo com tudo isso! me apavora ainda a existência, mas não tenho medo de ficar sozinho, foi conscientemente que escolhi o exílio, me bastando hoje o cinismo dos grandes indiferentes (...).

Adaptado de: Afrânio Coutinho, “Notas de teoria literária”.

Considerando o texto e analisando os elementos que constituem um espetáculo teatral, conclui-se que a. a criação do espetáculo teatral apresenta-se como um fenômeno de ordem individual, pois não é possível sua concepção de forma coletiva. b. o cenário onde se desenrola a ação cênica é concebido e construído pelo cenógrafo de modo autônomo e independente do tema da peça e do trabalho interpretativo dos atores.

Raduan Nassar, “Um copo de cólera”.

c. o texto cênico pode originar-se dos mais variados gêneros textuais, como contos, lendas, romances, poesias, crônicas, notícias, imagens e fragmentos textuais, entre outros.

Texto II

d. o corpo do ator na cena tem pouca importância na comunicação teatral, visto que o mais importante é a expressão verbal, base da comunicação cênica em toda a trajetória do teatro até os dias atuais.

Raduan Nassar lançou a novela “Um copo de cólera” em 1978, fervilhante narrativa de um confronto verbal entre amantes, em que a fúria das palavras cortantes se estilhaçava no ar. O embate conjugal ecoava o autoritário discurso do poder e da submissão de um Brasil que vivia sob o jugo da ditadura militar.

e. a iluminação e o som de um espetáculo cênico independem do processo de produção/recepção do espetáculo teatral, já que se trata de linguagens artísticas diferentes, agregadas posteriormente à cena teatral.

R. Comodo, “Um silêncio inquietante”. IstoÉ.

38. (Enem 2009) No decênio de 1870, Franklin Távora defendeu a tese de que no Brasil havia duas literaturas independentes dentro da mesma língua: uma do Norte e outra do Sul, regiões segundo ele muito diferentes por formação histórica, composição étnica, costumes, modismos linguísticos etc. Por isso, deu aos romances regionais que publicou o título geral de Literatura do Norte. Em nossos dias, um escritor gaúcho, Viana Moog, procurou mostrar com bastante engenho que no Brasil há, em verdade, literaturas setoriais diversas, refletindo as características locais.

a. é escrito em terceira pessoa, com narrador onisciente, apresentando a disputa entre um homem e uma mulher em linguagem sóbria, condizente com a seriedade da temática político-social do período da ditadura militar. b. articula o discurso dos interlocutores em torno de uma luta verbal, veiculada por meio de linguagem simples e objetiva, que busca traduzir a situação de exclusão social do narrador.

Antonio Candido, “A nova narrativa”.

c. representa a literatura dos anos 70 do século XX e aborda, por meio de expressão clara e objetiva e de ponto de vista distanciado, os problemas da urbanização das grandes metrópoles brasileiras.

Com relação à valorização, no romance regionalista brasileiro, do homem e da paisagem de determinadas regiões nacionais, sabe-se que

d. evidencia uma crítica à sociedade em que vivem os personagens, por meio de fluxo verbal contínuo de tom agressivo.

a. o romance do Sul do Brasil se caracteriza pela temática essencialmente urbana, colocando em relevo a formação do homem por meio da mescla de características locais e dos aspectos culturais trazidos de fora pela imigração europeia. b. José de Alencar, representante, sobretudo, do romance urbano, retrata a temática da urbanização das cidades brasileiras e das relações conflituosas entre as raças. c. o romance do Nordeste caracteriza-se pelo acentuado realismo no uso do vocabulário, pelo temário local, expressando a vida do homem em face da natureza agreste, e assume frequentemente o ponto de vista dos menos favorecidos.

Na novela “Um copo de cólera”, o autor lança mão de recursos estilísticos e expressivos típicos da literatura produzida na década de 70 do século passado no Brasil, que, nas palavras do crítico Antonio Candido, aliam “vanguarda estética e amargura política”. Com relação à temática abordada e à concepção narrativa da novela, o texto I

e. traduz, em linguagem subjetiva e intimista, a partir do ponto de vista interno, os dramas psicológicos da mulher moderna, às voltas com a questão da priorização do trabalho em detrimento da vida familiar e amorosa. 40. (Enem 2009)

d. a literatura urbana brasileira, da qual um dos expoentes é Machado de Assis, põe em relevo a formação do homem brasileiro, o expoENEM 11

Confidência do Itabirano Alguns anos vivi em Itabira. Principalmente nasci em Itabira. Por isso sou triste, orgulhoso: de ferro.


Noventa por cento de ferro nas calçadas. Oitenta por cento de ferro nas almas. E esse alheamento do que na vida é porosidade e [comunicação.

A vontade de amar, que me paralisa o trabalho, vem de Itabira, de suas noites brancas, sem mulheres [e sem horizontes. E o hábito de sofrer, que tanto me diverte, é doce herança itabirana.

Carlos Drummond de Andrade é um dos expoentes do movimento modernista brasileiro. Com seus poemas, penetrou fundo na alma do Brasil e trabalhou poeticamente as inquietudes e os dilemas humanos. Sua poesia é feita de uma relação tensa entre o universal e o particular, como se percebe claramente na construção do poema “Confidência de itabirano”. Tendo em vista os procedimentos de construção do texto literário e as concepções artísticas modernistas, conclui-se que o poema acima a. representa a fase heroica do modernismo, devido ao tom contestatório e à utilização de expressões e usos linguísticos típicos da oralidade.

De Itabira trouxe prendas diversas que ora te [ofereço: esta pedra de ferro, futuro aço do Brasil; este São Benedito do velho santeiro Alfredo Duval; este couro de anta, estendido no sofá da sala de [visitas; este orgulho, esta cabeça baixa...

b. apresenta uma característica importante do gênero lírico, que é a apresentação objetiva de fatos e dados históricos. c. evidencia uma tensão histórica entre o “eu” e a sua comunidade, por intermédio de imagens que representam a forma como a sociedade e o mundo colaboram para a constituição do indivíduo. d. critica, por meio de um discurso irônico, a posição de inutilidade do poeta e da poesia em comparação com as prendas resgatadas de Itabira.

Tive ouro, tive gado, tive fazendas. Hoje sou funcionário público. Itabira é apenas uma fotografia na parede. Mas como dói!

e. apresenta influências românticas, uma vez que trata da individualidade, da saudade da infância e do amor pela terra natal, por meio de recursos retóricos pomposos.

Carlos Drummond de Andrade, “Confidência de itabirano”.

Fique esperto! Analisando as questões de Arte propostas no Enem dos últimos anos, é possível notar a importância dada à interpretação e à criatividade. Então, a primeira dica é ler com muita atenção todas as questões como um todo, sem dissociar o enunciado, as ilustrações, os textos de apoio e as alternativas apresentadas. Muitas questões se resolvem com uma leitura atenta do enunciado e com a interpretação correta das imagens e textos de apoio. Além disso, muitas delas exigem conhecimentos teóricos básicos indispensáveis para a resolução. A disciplina de Arte é composta por quatro tipos de manifestações artísticas: artes visuais, dança, música e teatro, cada uma com sua história, teoria e técnica específicas. As questões elaboradas para este material foram formuladas com base na análise minuciosa das questões dos três últimos anos e na mesma linha desenvolvida pela proposta do Enem. Algumas questões foram formuladas em relação à abordagem teórica, possibilitando, além da resolução do exercício proposto, um material de estudo das artes fora de sala de aula.

41. Para a produção e leitura apropriada de uma obra de arte é necessário conhecer alguns elementos que formam sua Identidade Visual. Sobre esses elementos associe as colunas. 1. Linha

A. (

) Três dimensões – altura, largura e profundidade. A perspectiva dá à imagem uma ilusão de profundidade.

2. Superfície (plano) B. ( ) Contraste claro-escuro. Gera tensão, transparência e mistério. Grande artista a usar este elemento: Rembrandt.

3. Volume

C. (

) Duas dimensões – largura e comprimento. Organiza o espaço. Imagens “chapadas”.

4. Luz

D. (

) Excitação dos sentidos, vida para as pinturas. Grande artista: Matisse.

5. Cor

E. (

) Espaço linear, apenas uma dimensão. Pode ser vertical, horizontal, curva, espiral, oval, diagonal etc.

Assinale a alternativa que corresponde à associação correta. a. A1; B2; C4; D3; E5 b. A3; B2; C4; D5; E3 c. A1; B2; C5; D4; E3 d. A3; B4; C2; D5; E1 e. A3; B4; C5; D4; E5

42. Em 2009, no Bristol Museum, na Inglaterra, foi realizada uma exposição gigantesca do artista Banksy, cuja verdadeira identidade ninguém conhece, e que ficou famoso por seus stencils e grafites espalhados nas paredes e muros das cidades, com mensagens que, embora engraçadas, continham forte crítica social. A exposição contou com cerca de cem peças – pinturas, instalações, espaços com animatronics (marionetes e bonecos animados por robótica) e peças sensoriais –, setenta das quais inéditas. Entre elas estão salsichas que se movem como se estivessem vivas em um criadouro; um ninho de pássaro com pequenas câmeras sendo vigiadas por uma câmera maior; uma simpática coelha fazendo as unhas, cheia de maquiagem e joias; um policial

de elite brincando com um cavalinho de brinquedo; uma árvore na qual descansa uma onça de costas, balançando a cauda, e que, vista de frente, é um casaco com forro vermelho, além de muitas outras obras contextualizadoras. A exposição tem o nome provocativo “Banksy versus Bristol Museum”.

expoENEM 12

Sobre a exposição e a arte contemporânea em geral, analise as alternativas a seguir. I. Arte contemporânea é a arte produzida atualmente por artistas que não adotam uma linguagem técnica ou temas específicos.


II. Na arte contemporânea, o conceito e a mensagem que a obra transmite são mais importantes que a beleza.

c. A obra mostra os retirantes, povo simples do nordeste que foge da seca em busca de melhor qualidade de vida.

III. Os trabalhos contemporâneos de Banksy fazem uma crítica social ácida, agressiva e ao mesmo tempo sarcástica.

d. Criação imaginada pelo artista ao retratar um possível povo alienígena que mora no lado negro da lua.

Está correto o que se afirma em:

e. Os moradores de uma favela do Rio de Janeiro são vítimas de uma bala perdida que atinge o pequeno membro da família, enquanto seu pai chora emocionadamente, segurando o corpo morto da filha, exigindo justiça.

a. I, somente. b. I e II, somente. c. II, somente.

45. O Brasil é um grande polo artístico e cultural conhecido e respeitado em todo o mundo. Assinale a alternativa que reúne apenas artistas brasileiros da área de dança.

d. II e III, somente. e. I, II e III.

a. Arcangelo Lanelli; Candido Portinari; Tarsila do Amaral; Fernando Volpi.

43. Arte e ciência são muito importantes ao se planejar uma manifestação de arte, no momento de executá-la ou mesmo quando o público a aprecia. Sobre isso, assinale a alternativa incorreta.

b. Vinicius de Moraes; Tom Jobim; Chico Buarque; Gilberto Gil. c. Ana Botafogo; Deborah Colker; Denise Stoklos; Marcelo Gomes. d. Cecília Meireles; Manuel Bandeira; Paulo Leminski; Helena Kolody.

a. Muitos artistas estudam anatomia para representar o corpo humano com perfeição em desenhos, pinturas e esculturas. b. Um coreógrafo ou dançarino precisa de certo domínio da física para calcular corretamente a maneira como os movimentos serão executados. c. Na dança, é indispensável conhecer anatomia humana, principalmente no que diz respeito à estrutura óssea, musculatura, batimentos cardíacos e respiração. d. No cinema, para tornar as cenas o mais naturais possível é preciso pensar na iluminação, nos cenários, nos figurinos, no posicionamento de câmeras, nos ensaios com os atores e no trabalho de pós-produção na edição dos filmes. e. Aquecimento, treinamentos e condicionamento físico são usados somente por atletas e não por atores e dançarinos. 44. Observando a obra “Criança Morta” de Candido Portinari, podemos ter uma ideia da linha de trabalho desenvolvida por esse artista brasileiro que ganhou grande projeção internacional mostrando ao mundo temas, paisagens e personagens autenticamente brasileiros, divulgando nossa cultura.

e. Clarice Lispector; Jorge Amado; Machado de Assis; Monteiro Lobato. 46. Algumas civilizações do passado ajudaram a escrever a história do mundo como o conhecemos por sua grandiosidade, feitos memoráveis e também pela produção artística e cultural, deixando-nos um grande legado. Observando os movimentos históricos e artísticos abaixo, associe as colunas.

Coluna 1

1. Egito 2. Grécia 3. Roma

Coluna 2 A. ( ) Na pintura utilizaram a Lei da Frontalidade, na qual a figura humana era representada pela visão frontal dos olhos e dos ombros, e em perfil da cabeça, dos braços e pernas. B. ( ) A partir de uma figura idealizada, porém estruturada de forma orgânica, introduziram o nu nas esculturas artísticas. C. ( ) Grande parte da arte era de origem funerária, como as pinturas murais das tumbas dos faraós e as pirâmides. D. ( ) Também famoso pelos coliseus, lutas de gladiadores e corridas de bigas. E. ( ) Povo que criou a democracia, as olimpíadas, a matemática, o teatro, a filosofia e a estética.

Qual das alternativas abaixo contém a associação correta? a. A1; B2; C1; D3; E2 b. A2; B3; C1; D2; E1 c. A1; B2; C3; D2; E3 d. A3; B2; C1; D3; E2 e. A3; B1; C2; D2; E3

Candido Portinari. Criança Morta, 1944 – óleo sobre tela (180 x 190 cm). Museu de Arte de São Paulo Assis Chateaubriand, São Paulo, SP.

47. Por volta de 1840, a popularização da máquina fotográfica causou grande impacto em todo o mundo. Tal impacto foi mais forte nas artes visuais. Houve quem afirmasse que a fotografia viria substituir a pintura, que se tornaria desnecessária. Isso aconteceu na época do movimento artístico denominado impressionismo.

Sobre essa obra é correto afirmar: a. A criança no colo dorme tranquilamente enquanto sua família observa emocionada seu descanso. b. A cena triste mostra os refugiados da Segunda Guerra Mundial procurando um local mais seguro para viver. expoENEM 13

Sobre esse tema analise as questões a seguir. I. Enquanto alguns artistas odiavam a fotografia por fazer de maneira mecânica o trabalho dos pintores, outros a utilizavam como instrumento para, a partir das fotos, fazer pinturas ainda mais naturalistas. II. Com a invenção da fotografia, os pintores não tinham mais a função de criar algo naturalista e a pintura começou a desenvolver novos rumos.


III. Os artistas impressionistas inovaram ao fazer uma obra pictórica preocupados com a luz e o movimento, marcados por pinceladas soltas, em vez das temáticas clássicas e nobres anteriores.

III. Muitos artistas como Almeida Júnior pintaram apaixonadamente a paisagem e a cultura brasileira, como denota a obra representada, mostrando o personagem do típico caipira brasileiro com sua vida simples. IV. Apesar da grande beleza das pinturas e do surgimento de grandes artistas como Victor Meirelles e Pedro Américo, o período acadêmico/neoclássico não foi inovador, seguindo de forma copiosa a arte neoclássica europeia, com os ricos temas brasileiros.

IV. Mesmo nos dias de hoje, a fotografia é nada mais que um instrumento de registro de imagens, não sendo considerada uma linguagem de obra de arte.

Está correto o que se afirma em: a. I e II, somente.

b. I, II e III, somente.

Está correto o que se afirma em: a. I e II, somente.

c. I, III e IV, somente.

b. I, II e III, somente.

d. II, III e IV, somente.

c. I, III e IV, somente.

e. I, II, III e IV.

d. II, III e IV, somente.

48. Sobre a arte desenvolvida pelos povos indígenas brasileiros, qual das alternativas abaixo é falsa? a. Na pintura corporal, é comum a utilização de figuras geométricas, inspiradas na natureza. b. As tintas são naturais e as cores predominantes são o vermelho (sementes de urucum), o preto (sumo de jenipapo) e o branco (tabatinga). c. Não utilizam penas, dentes, ossos, sementes e outros objetos retirados da natureza. d. Fabricam utensílios – potes, armas etc. – e objetos decorativos com o uso de penas.

e. I, II, III e IV. 50. A fotografia tem suas origens nas câmeras escuras que projetavam imagens invertidas, nas experiências de Niepce – criando o primeiro registro fotográfico em 1822 – e aperfeiçoadas por Daguerre, que criou a primeira máquina fotográfica. A fotografia passou por grandes inovações tecnológicas em seus mais de 170 anos de existência. Atualmente é bastante popular, facilitada pelas câmeras digitais. Além da função utilitária, a fotografia também é uma forma de arte.

e. A pintura corporal serve como um indicador social do indivíduo e para rituais. 49. Dom João VI criou a primeira faculdade de arte brasileira, da qual emergiram os primeiros artistas nacionais com formação acadêmica. Almeida Júnior é um dos grandes expoentes da arte acadêmica/neoclássica brasileira. Observe uma de suas obras a seguir.

Qual das alternativas abaixo aponta elemento indispensável para fazer uma boa foto de arte? a. Câmera profissional. b. Boa técnica e embasamento teórico. c. Tripé, luzes e outros equipamentos. d. Sensibilidade do fotógrafo. e. Um bom modelo para as fotos.

51. O teatro é uma das formas de arte que acompanha a humanidade desde os primórdios. Além de funcionar como registro da sociedade nos mais variados períodos, serve como instrumento de diversão, meio de crítica e contextualização, além de inúmeras outras funções, tanto artísticas quanto sociais.

Associe as duas colunas. 1. Monólogo 2. Musical 3. Adaptação 4. Fantoches 5. Comédia, drama e tragédia A. ( ) Utiliza a manipulação de objetos como bonecos e marionetes. B. ( ) Peça que combina canções, sonoridades musicais e dança. C. ( ) Feito a partir de um texto que já existe. D. ( ) Gêneros mais comuns que levam o público a sorrir, chorar, meditar, pensar etc. E. ( ) É executado com apenas um ator em cena.

José Ferraz de Almeida Júnior. Caipira Picando Fumo, 1893 – óleo sobre tela (202 x 141 cm). Acervo da Pinacoteca do Estado de São Paulo/Brasil.

Qual das alternativas abaixo apresenta a associação correta? a. A1; B4; C3; D5; E2 b. A4; B2; C3; D5; E1 c. A1; B2; C3; D2; E3

Sobre esse tema analise as questões a seguir: I. Desconsiderando a arte indígena, os pioneiros da arte no Brasil foram os jesuítas, utilizando uma arte de cunho religioso como instrumento para catequização. II. A Missão Artística Francesa foi contratada em 1816 para viajar pelo Brasil, pintando suas paisagens, belezas, habitantes e costumes. O sucesso do projeto levou o governo a criar a Escola Real das Ciências, Artes e Ofícios, mais tarde denominada Escola de Belas Artes.

d. A4; B3; C1; D5; E2 e. A3; B1; C4; D2; E5 52. Qual dos elementos a seguir é indispensável para a realização da dança?

expoENEM 14

a. Ritmo b. Movimento c. Música


d. Coreografia

c. Propaganda de refrigerantes e fábricas de garrafas PET.

e. Preparação física

d. Estudos para criação de monumento sobre grandes invenções humanas.

53. Qual das alternativas abaixo apresenta a melhor definição de dança?

e. Projeto para criação de garrafas descartáveis em tamanho maior.

a. Sequência de movimentos ensaiados. b. Sequência de movimentos voluntários ou intencionais que obrigatoriamente são feitos ao som de música. c. Sequência de movimentos corporais executados de maneira ritmada, em geral ao som de música.

56. (Enem 2007) Sobre a exposição de Anita Malfatti, em 1917, que muito influenciaria a Semana de Arte Moderna, Monteiro Lobato escreveu, em artigo intitulado “Paranoia ou Mistificação”: Há duas espécies de artistas. Uma composta dos que veem as coisas e em consequência fazem arte pura, guardados os eternos ritmos da vida, e adotados, para a concretização das emoções estéticas, os processos clássicos dos grandes mestres. (...) A outra espécie é formada dos que veem anormalmente a natureza e a interpretam à luz das teorias efêmeras, sob a sugestão estrábica das escolas rebeldes, surgidas cá e lá como furúnculos da cultura excessiva. (...). Estas considerações são provocadas pela exposição da sra. Malfatti, onde se notam acentuadíssimas tendências para uma atitude estética forçada no sentido das extravagâncias de Picasso & cia.

d. Espetáculo que só pode ser executado no teatro. e. É o que o dançarino faz. 54. Sobre o artista Lasar Segall (Vilna/Lituânia 1891 – São Paulo/SP 1957), Mário de Andrade escreveu: Pintura fortemente sensível, é certo, mas já dotada daquele domínio que converte o tumulto do sentimento numa obra de expressão, isto é, numa arte voluntária. (...) Condensação anímica das figuras desvalorizadas proposital e insensualmente nos corpos, mas expandindo toda a significação dramática nas cabeças enormes de olhos ainda maiores, que ultrapassam os limites dos rostos numa vibratilidade angustiosíssima. (...) E também condensação cromática que, se exprimia em tonalidades intensas enervadas ainda mais pela bravura do pincel, já demonstrava um horror instintivo das cores radiantes e felizes.

Monteiro Lobato, “Paranoia ou Mistificação”, O Diário de São Paulo, dez./1917.

Em qual das obras a seguir identifica-se o estilo de Anita Malfatti criticado por Monteiro Lobato no artigo? a.

Mário de Andrade, “Lasar Segall”.

Lasar Segall. Bananal, 1927 – óleo sobre tela (87 x 127 cm). Acervo da Pinacoteca do Estado de São Paulo/Brasil.

Qual das características a seguir podemos relacionar com a pintura representada?

Acesso a Mont Serrat

b.

a. Imagem do cotidiano com aspectos cênicos. b. Valorização do inconsciente e dos sonhos. c. Forma de arte que não representa objetos próprios. d. Arte naturalista, bem próximo à fotografia. e. Tema satírico. 55. Em 2007/2008 Eduardo Srur, participando da Exposição “Quase Líquido”, fez uma intervenção urbana nas margens do Rio Tietê, em São Paulo, contendo vinte infláveis monumentais na forma de garrafas PET. Feitas com materiais que se assemelham a lona, as imensas garrafas infláveis possuem cores bem fortes e são iluminadas à noite, ficando ainda mais chamativas em meio às movimentadas ruas entre as pontes do Limão e Casa Verde na capital paulista.

Vaso de Flores

c.

Qual o tema trabalhado nessa obra? a. A obra mostra o local onde deveríamos jogar as garrafas PET, nas margens dos rios. b. Tema claramente ecológico sobre reaproveitamento e destinação do lixo. expoENEM 15

A Santa Ceia


d.

Considere que um marceneiro tenha encontrado algumas figuras supostamente desenhadas por Escher e deseje construir uma delas com ripas rígidas de madeira que tenham o mesmo tamanho. Qual dos desenhos a seguir ele poderia reproduzir em um modelo tridimensional real? a.

d.

b.

e.

Nossa Senhora Auxiliadora e Dom Bosco

c.

e.

58. (Enem 2007) Os melhores críticos da cultura brasileira trataram-na sempre no plural, isto é, enfatizando a coexistência no Brasil de diversas culturas. Arthur Ramos distingue as culturas não europeias (indígenas, negras) das europeias (portuguesa, italiana, alemã etc.) e Darcy Ribeiro fala de diversos Brasis: crioulo, caboclo, sertanejo, caipira e de Brasis sulinos, a cada um deles correspondendo uma cultura específica. F. Morais, “O Brasil na visão do artista”.

A Boba

Considerando a hipótese de Darcy Ribeiro de que há vários Brasis, a opção em que a obra mostrada representa a arte brasileira de origem negro-africana é: a.

57. (Enem 2007) Representar objetos tridimensionais em uma folha de papel nem sempre é tarefa fácil. O artista holandês Escher (18981972) explorou essa dificuldade criando várias figuras planas impossíveis de serem construídas como objetos tridimensionais, a exemplo da litografia Belvedere, reproduzida a seguir.

b.

c.

expoENEM 16


60. (Enem 2009)

d.

No programa do balé Parade, apresentado em 18 de maio de 1917, foi empregada publicamente, pela primeira vez, a palavra sur-realisme. Pablo Picasso desenhou o cenário e a indumentária, cujo efeito foi tão surpreendente que se sobrepôs à coreografia. A música de Erik Satie era uma mistura de jazz, música popular e sons reais tais como tiros de pistola, combinados com as imagens do balé de Charlie Chaplin, caubóis e vilões, mágica chinesa e Ragtime. Os tempos não eram propícios para receber a nova mensagem cênica demasiado provocativa devido ao repicar da máquina de escrever, aos zumbidos de sirene e dínamo e aos rumores de aeroplano previstos por Cocteau para a partitura de Satie. Já a ação coreográfica confirmava a tendência marcadamente teatral da gestualidade cênica, dada pela justaposição, colagem de ações isoladas seguindo um estímulo musical.

e.

Adaptado de: S. M. Silva, “O surrealismo e a dança”.

As manifestações corporais na história das artes da cena muitas vezes demonstram as condições cotidianas de um determinado grupo social, como se pode observar na descrição acima do balé Parade, o qual reflete a. a falta de diversidade cultural na sua proposta estética. b. a alienação dos artistas em relação às tensões da Segunda Guerra Mundial. c. uma disputa cênica entre as linguagens das artes visuais, do figurino e da música.

59. (Enem 2009) A música pode ser definida como a combinação de sons ao longo do tempo. Cada produto final oriundo da infinidade de combinações possíveis será diferente, dependendo da escolha das notas, de suas durações, dos instrumentos utilizados, do estilo de música, da nacionalidade do compositor e do período em que as obras foram compostas.

d. as inovações tecnológicas nas partes cênicas, musicais, coreográficas e de figurino. e. uma narrativa com encadeamentos claramente lógicos e lineares.

Inglês 61. In the following sentences, there are examples of English words being used in Portuguese. Agora trabalho em part-time. Sua performance foi horrível. Precisamos traçar a estratégia de marketing. Preciso do seu feedback.

Figura 1

Figura 3

In the Portuguese language, this is known as: a. estrabismo b. liberalismo linguístico c. estrangeirismo d. moralismo cultural e. agnosticismo

Read the following texts to answer question 62.

Figura 2

Figura 4

Das figuras que apresentam grupos musicais em ação, pode-se concluir que o(os) grupo(s) mostrado(s) na(s) figura(s) a. 1 executa um gênero característico da música brasileira, conhecido como chorinho. b. 2 executa um gênero característico da música clássica, cujo compositor mais conhecido é Tom Jobim.

BETWEEN HIGH SCHOOL and College? Over 18? Drop that entry level position. Earn what you’re worth!! Travel w/Successful Young Business Group. Paid Training. Transportation, lodging provided. 1-877646-5050 (50045) DRIVER – Weekly Hometime. Average 2,400 miles/week! Local orientation. New Trucks! Daily or weekly pay. Healthcare benefits. CDL-A, 6 months OTR experience. 800-414-9569. www.drveknight.com (50079)

c. 3 executa um gênero característico da música europeia, que tem como representantes Beethoven e Mozart. d. 4 executa um tipo de música caracterizada pelos instrumentos acústicos, cuja intensidade e nível de ruído permanecem na faixa dos 30 aos 40 decibéis.

Seattle Daily Journal of Commerce, “Classifieds”.

62. Consider the following items and select the correct alternative.

e. 1 a 4 apresentam um produto final bastante semelhante, uma vez que as possibilidades de combinações sonoras ao longo do tempo são limitadas. expoENEM 17

I. O primeiro anúncio é direcionado a jovens. II. No primeiro anúncio, a hospedagem faz parte do serviço ofertado. III. No segundo anúncio, o motorista receberá remuneração mensal. IV. No segundo anúncio, o motorista não terá nenhum benefício extra.


V. O motorista não necessita de experiência para começar a trabalhar, conforme o segundo anúncio.

64. De acordo com a leitura do texto, é correto afirmar que: a. Ciência é uma forma de interpretação absoluta do mundo, sem admitir contestações.

a. Estão corretos apenas os itens I, II, III e V.

b. As informações relativas às mudanças climáticas são sempre afirmadas como totalmente confiáveis para orientar as decisões políticas que afetem o futuro da humanidade.

b. Estão corretos apenas os itens I, II, III e IV. c. Todos os itens estão corretos.

c. “ClimateGate” refere-se a informações reconhecidas oficialmente e publicadas em periódicos científicos, com autorização dos governos envolvidos.

d. Apenas os itens I e II estão corretos. e. Apenas os itens I e IV estão corretos.

d. A ciência favorece a evolução do conhecimento ao se sujeitar a revisões e transformações, e pode sofrer alterações significativas, pois resulta do trabalho humano e não de ações mecânicas, as quais poderiam ser desempenhadas por robôs.

Read the following text to answer questions 63 to 65. ‘Show your working’: What ‘ClimateGate’ means The “ClimateGate” affair – the publication of e-mails and documents hacked or leaked from one of the world’s leading climate research institutions – is being intensely debated on the web. But what does it imply for climate science? Here, Mike Hulme and Jerome Ravetz say it shows that we need a more concerted effort to explain and engage the public in understanding the processes and practices of science and scientists.

e. A evolução científica sempre acarreta a desmistificação e a desmoralização das religiões, no campo das ideias. 65. Considering the text, select the most adequate answer to the following question: What distinguishes science from other forms of knowledge?

“Practicing scientists know that they do not simply follow a rulebook to do their science, otherwise it could be done by a robot.”

a. Science is different because it is based on intuition, inherited beliefs and myths.

As the repercussions of ClimateGate reverberate around the virtual community of global citizens, we believe it is both important and urgent to reflect on what this moment is telling us about the practice of science in the 21st Century.

b. Science is completely different because it is absolute and never changes with time.

In particular, what is it telling us about the social status and perceived authority of scientific claims about climate change?

c. Science is different because it provides a knowledge that is not based on absolute truths, but on experiments and observations.

We argue that the evolving practice of science in the contemporary world must be different from the classic view of disinterested – almost robotic – humans establishing objective claims to universal truth.

d. Science is different because it explains how you should behave in all particular situations in life.

Climate change policies are claimed to be grounded in scientific knowledge about physical cause and effect and about reliable projections of the future. As opposed to other ways of knowing the world around us – through intuition, inherited belief, myth – such scientific knowledge retains its authority by widespread trust in science’s reassuring norms of objectivity, universality and disinterestedness. These perceived norms work to guarantee to the public trustworthy scientific knowledge, and allow such knowledge to claim high authority in political deliberation and argumentation; this, at least, is what historically has been argued in the case of climate change. What distinguishes science from other forms of knowledge? On what basis does scientific knowledge earn its high status and authority? What are the minimum standards of scientific practice that ensure it is trustworthy? For an open, enquiring and participative society, these are questions that have become much more important in the wake of ClimateGate. They are also questions that scientists should continually be asking of themselves as the political and cultural worlds within which they do their work rapidly change. Doing science in 2010 demands something rather different from scientists than did science in 1960, or even in 1985. Mike Hulme & Jerome Ravetz, “Show your working”.

63. According to the sentence “Practicing scientists know that they do not simply follow a rulebook to do their science, otherwise it could be done by a robot”, it is correct to say: a. All the scientists must only follow pre-set rules. b. For scientists, it is important to make their own interpretations on their work. c. A robot can do everything exactly as a human would do. d. Science is made by parameters pre-set by a rulebook. e. For practicing scientists, it is important to have a robot educated by a rulebook.

e. Science is distinguished because it explains exactly how the mind works and how it influences our behavior.

Read the following text to answer questions 66 and 67. The ‘gravest issues’ Early on Tuesday 16 October 1962, John F. Kennedy’s national security assistant, McGeorge Bundy, brought to the President’s bedroom some high-altitude photographs taken from U-2 planes flying over Cuba. They showed Soviet soldiers hurriedly and secretly setting up nuclear-armed missiles. For some time previously the Soviets had openly been sending weaponry to Cuba, including surface-to-air anti-aircraft missiles (SAMs). To deflect any criticism about this from the Republicans, who were busy campaigning for the November congressional elections, Kennedy had said he would not protest about such defensive weaponry being installed in Cuba, but warned that if the Soviets ever introduced offensive weapons, ‘the gravest issues would arise’. Since Soviet premier Nikita Khrushchev had promised repeatedly not to send offensive weapons to Cuba, and America’s top intelligence analysts had predicted that he would keep his word, Kennedy felt safe in voicing this warning. The U-2 photographs, however, showed that Khrushchev had been lying. The ‘gravest issues’ were at hand. The United States at the time had more than 25,000 nuclear weapons in their arsenal. The Soviet Union had not quite half as many. Kennedy’s predecessor, Dwight Eisenhower, had calculated in 1960 that, if a crisis led either side to fire nuclear weapons, all humans in the northern hemisphere could perish. ‘Gravest issues’ indeed. Ernest R. May, “The ‘gravest issues’”.

66. What is the wrong alternative, according to the text?

expoENEM 18

a. The US national security assistant brought some photos to President Kennedy, showing the Soviet Union activities in Cuba. b. The U-2 was a spy plane that flew at high altitudes. c. We can consider Krushev’s attitude of sending offensive weapons to Cuba a “grave issue”.


d. The fact described changed drastically the outcome of World War II.

III. O prefeito da cidade recomendou que as pessoas ficassem em suas casas.

e. The “gravest issue” was considered so because it put in check the world security.

IV. Pelo menos 95 pessoas morreram na cidade do Rio de Janeiro. V. Ônibus pararam nas ruas, com água quase acima dos pneus.

67. During the years following World War II, the rivalry between the USA and the Soviet Union, in many areas such as sports, politics and international affairs, was named:

a. Apenas I, II e IV estão corretas. b. Apenas III e V estão corretas.

a. Cold War

c. Apenas IV e V estão corretas.

b. Third War

d. Apenas I e V estão corretas.

c. First War

e. Apenas II, III e IV estão corretas.

d. Iraq War

69. Consider the words in bold, and select the corresponding alternative.

e. Hot War

Read the following text to answer questions 68 and 69.

The banks of Rio’s lagoon were overflowing onto streets and playgrounds, and the city itself seemed like a ghost town, with few braving the outdoors. © Agência Brasil

Deadly flash floods paralyze Rio de Janeiro

a. Many cars are riding on the streets. b. Few people are facing the chaos and the flood outside. c. A small number of people are on the streets, but they are not brave in this situation. d. Many people are facing the situation outside. e. A lot of people are braving the bad situation outside.

Read the following text to answer questions 70 to 72.

© Wikipédia/Arthur Boppré

Brazil 2014 preparations “on track” RIO DE JANEIRO — Heavy rains and flash floods overnight left at least 95 people dead in the Brazilian state of Rio de Janeiro early Tuesday, the authorities said, paralyzing transportation and causing the city’s mayor to cancel all classes and urge people not to leave their homes. Some 9 inches of rain drenched downtown Rio in a relentless storm that shut down airports, metro stations and major highways and bridges. The banks of Rio’s lagoon were overflowing onto streets and playgrounds, and the city itself seemed like a ghost town, with few braving the outdoors. The rain continued throughout Tuesday, and city and state officials warned that hillsides would become vulnerable to mudslides if it continued much longer. Television coverage showed people abandoning cars along flooded highways and seeking to escape up stairs to overpasses or along railroad tracks. In some areas water was cascading down hillsides. Buses were stopped on underpasses, with water reaching almost above their tires. Some people waved from rooftops in parts of Rio’s slums, where roads had filled with mud, burying cars and stranding residents. The flooded area “is very big”, the city’s mayor, Eduardo Paes, said in an interview on Globo television. “We are asking people to seek safer ground, and if possible, for people to stay home.” Rio’s governor, Sergio Cabral, also recommended that people stay in their homes so that emergency workers could concentrate on reaching those in need. He also said that many residents living in hillside slums faced the danger that their homes could collapse from the drenched and unstable ground. Alexei Barrionuevo, “Deadly flash floods paralyze Rio de Janeiro”.

68. Sobre as chuvas no Rio de Janeiro, analise as seguintes afirmativas e assinale a alternativa correta, de acordo com o texto. I. As encostas dos morros não ficariam vulneráveis a deslizamentos, mesmo se a chuva continuasse. II. Apesar de um grande volume de água, as áreas inundadas não foram significativas.

Organizers insist preparations for the 2014 World Cup are back on track just two months after FIFA publicly criticised them for missing deadlines. “There are no problems”, Brazil football federation president Ricardo Teixeira said as the tournament’s official logo was launched. He acknowledged uncertainty over São Paulo’s role as a host city after Morumbi Stadium was removed from the project last month, despite repeated denials it would have to be dropped. FIFA secretary general Jerome Valcke previously described Brazil’s lack of progress as “amazing”. FIFA awarded the 2014 World Cup hosting rights six years ago, but Brazil has barely begun building and renovating the 12 stadiums it needs. Teixeira said that “the situation is completely different” to when Valcke spoke. “Some of the stadia have commenced building. We have already defined exactly what’s going to be happening in terms of budgets for the construction up to December”, he said, although he failed to highlight any specific details. Teixeira said construction work at Belo Horizonte and Salvador had begun, but there were doubts over the status of São Paulo, Brazil’s biggest city, and Curitiba as hosts. “We will come up with a definition about what role São Paulo will play in the World Cup. Will there be a stadium built or not? How will they participate as a city? “The issue with São Paulo will have to be solved as quickly as possible. Curitiba Stadium is facing some financial constraints, but once financial guarantees are in place construction will begin.

expoENEM 19


Teixeira also admitted that Brazil, which has a reputation for high urban crime, has issues guaranteeing security. “It’s not surprising and this is a problem that’s not linked to any specific country,” he said. “We have sent a huge security group to South Africa, they were here for a few days and they had to analyze the situation and pick on those issues that needed to be sorted.”

God and the man A man visits God and says: “God, do you mind if I ask you a few questions?” God says: “Not at all, you can ask me anything!” So the man asks: “God, you are the almighty, and since you live forever, a thousand years for you is like just a little moment, isn’t it?” God replies: “Yes, it is: for me, a thousand years is like just a little moment.” Then the man says: “Oh, that’s very interesting, God. So, for you, a million dollars is just a little cent, isn’t it?” God replies: “Yes it is: for me, a million dollars is just a little cent.” Then the man smiles and asks: “Well then, God: could you lend me just a little cent, please?” God smiles and says: “Of course, my son: but wait just a little moment!”

Organizers are considering dividing the 12 host cities into four regions to limit travel. Soccernet ESPN, “Brazil 2014 preparations ‘on track’”.

70. According to the text: a. Belo Horizonte and Salvador had not yet begun the local constructions. b. Curitiba received financial guarantees and will begin the construction soon. c. Brazil didn’t receive any criticism on its preparation for the 2014 World Cup.

74. What is the wrong alternative, according to the text?

d. It is not yet defined what role São Paulo will have in the 2014 World Cup.

a. God shows a good sense of humor.

e. FIFA is waiting for the tournament's official logo.

c. God is above the human comprehension of time.

b. God is smarter than the man in this joke. d. That man must be either Christian or Muslim.

71. Consider the following topics:

e. The man won’t be able to wait for so long to get the money he asked for.

I. Problems in the preparation for the 2014 World Cup. II. FIFA criticizes Brazil for missing deadlines.

III. CBF (Brazilian Football Federation) denies delays.

Read the following text to answer questions 75 to 77.

IV. Some cities started their projects and others have not started yet.

Help Haiti drop the debt

© Wikipédia

V. Ricardo Teixeira links the violence problem exclusively to Brazil. Which of them are mentioned in the text? a. I, II and V. b. I, IV and V. c. I, III and V. d. Only III and IV. e. I, II, III and IV. 72. About the sentence “Some of the stadia have commenced building. We have already defined exactly what's going to be happening in terms of budgets for the construction up to December”, it is correct to affirm: a. The stadia are not ready, but they will be in December. b. The abodes are not ready, but they will be up to December. c. The situation of the construction budgets is going to be defined up to December. d. The definitions on the budgets will be known in December, 2014. e. The abodes will be ready up to December, but just for some cities.

Read the following text to answer question 73. Here’s to you and yours and to mine and ours. And if mine and ours ever come across you and yours, I hope you and yours will do as much for mine and ours as mine and ours have done for you and yours! Irish toast

73. Qual das alternativas reflete mais adequadamente este “Irish toast”? a. Não podemos confiar em ninguém. b. Esperamos que nós e nossos amigos sejam gratos uns aos outros. c. Existem pessoas que não entendem uma piada. d. Os últimos serão os primeiros. e. Aqui se faz, aqui se paga.

Thanks to the more than 200,000 ONE members who signed the petition worldwide, the cancellation of Haiti’s debt may be all but a formality at this point. Over the weekend, four ONE members delivered the petition signatures at the G7 finance ministers summit in the small Arctic Canadian town of Iqaluit. Just before the scheduled handover, Canadian Finance Minister James Flaherty, speaking on behalf of all the G7 countries (the United States, Canada, United Kingdom, Germany, France, Italy and Japan), issued the following statement: “The earthquake caused unprecedented damage that requires exceptional measures. We agreed that the debt should not be a burden that will weigh on the recovery of the country. We are committed in the G7 to the forgiveness of debt. In fact all bilateral debt has been forgiven by G7 countries vis-à-vis Haiti. The debt to multilateral institutions should be forgiven and we’ll work with these institutions and other partners to make this happen as soon as possible. We discussed the long term reconstruction assistance that Haiti will need as it emerges from the current urgent situation as a result of the earthquake.” Though the $1 billion in debt is still not yet technically cancelled, the G7 countries hold considerable influence over the international lending institutions that must ultimately and officially cancel Haiti’s debt. We at ONE now feel confident that the full cancellation of Haiti’s

Read the following text to answer question 74. expoENEM 20


debt is closer to being a done deal than ever before — and we hope the details will be hammered out quickly.

President Lula arrived from Moscow, where he met Russian President Dmitry Medvedev.

And it’s all thanks to the hundreds of thousands around the globe who stood up for the people of Haiti to make this happen. Thank you!

There, he told reporters he was “optimistic” about persuading Iranian President Mahmoud Ahmadinejad to reach an agreement with the West.

One.org, “Help Haiti drop the debit”.

“I must now use everything I have learned over my long political career to convince my friend Ahmadinejad to come to an agreement with the international community”, he said.

75. Analyze the following statements, according to the text, and select the correct alternative.

President Lula’s visit to Tehran has been described by both senior American and Russian officials as the last chance for a compromise before new sanctions are imposed on Iran.

I. The humanitarian organization ONE is thankful because its members signed a worldwide petition claiming the cancelation of Haiti’s debt.

The Brazilian president will be trying to encourage Iran to agree to a deal under which its existing stocks of enriched uranium are shipped out of the country and converted to fuel for a research reactor, says the BBC’s Jon Leyne, reporting from London.

II. The organization ONE has less than 200,000 members in the world. III. In order to rebuild the country after the earthquake, Haiti needs exceptional measures.

This would prevent the material from being available to make a nuclear bomb.

IV. ONE is confident on the influence of G7 countries over the institutions that can cancel Haiti’s debt.

Turkey’s Prime Minister, Recep Tayyip Erdogan, has decided to join the talks amid suggestions that the country might be used as the location for the fuel swap, and is on the way to Tehran.

V. Countries such as Brazil and Argentina can cancel their debts as well.

Our correspondent says Iran has given mixed messages about a fuel swap deal, suggesting that it is still open to the idea, but then imposing conditions the West feels are unacceptable.

a. Only I, II, III and IV are correct. b. Only I, III and IV are correct.

Iran has been mounting a big diplomatic effort to prevent the new sanctions – the foreign minister has been travelling to all 15 members of the security council.

c. Only I, II, III and V are correct. d. Only I, II, and IV are correct.

But our correspondent says President Ahmadinejad is in a weak position following the dispute over his re-election last year, and it is not clear that he could deliver a compromise deal even if he wanted to.

e. All the statements are correct. 76. Find the wrong statement, according to the text.

BBC News, “Brazil’s Lula in key Iran talks”.

a. O primeiro ministro canadense falou apenas em nome do Canadá no texto. b. O cancelamento do débito não depende exclusivamente dos países do G7.

78. Consider the following statements. I. It is possible to assert that Brazil has been attempting to highlight itself before the United Nations, consequently having more influence on important global issues.

c. A organização ONE agradece a todos que lutaram pelo perdão da dívida do Haiti. d. A organização ONE tem plena confiança que o débito será perdoado.

II. Lula, as a politician, has a long experience and is capable to negotiate the situation between Iran and the international community.

e. O G7 lançou uma nota informando que concorda com o perdão às dívidas do Haiti.

III. Enriched uranium is very dangerous, because it is a component to produce nuclear bombs. IV. Iran has insisted that its nuclear program is just for peaceful purposes.

77. The best meaning to the term in bold in the following sentence is:

V. President Lula was pessimistic about finding a solution to the problem, because he doubted he could persuade the Iranian leader to find an agreement with the West.

In fact all bilateral debt has been forgiven by G7 countries vis-à-vis Haiti. a. in relation to

b. in comparison with c. in accordance with

b. Todas as afirmativas, exceto a V.

d. face to face

c. As afirmativas I, II, IV e V.

e. in front of

Which statements are right, according to the text? a. As afirmativas I, II, III e V.

d. As afirmativas I, III e V.

Read the following text to answer questions 78 to 79.

e. Todas as afirmativas, exceto a II.

Brazil’s Lula in key Iran talks Brazilian President Luiz Inacio Lula da Silva is holding talks with Iran’s leaders on the vexed nuclear issue.

79. According to the text, President Lula:

The Tehran meeting is being seen as a final attempt to find a compromise. U.S. officials have warned they are close to securing agreement on a new package of sanctions against Iran in the United Nations Security Council. The U.S. and other Western powers accuse Tehran of trying to build an atomic weapon. Iran insists that its nuclear programme is for peaceful purposes. expoENEM 21

a. wants to persuade the Iranian president to accept a deal that would not send the enriched uranium out of the country. b. was optimistic about persuading the West to accept the sanctions imposed by Iran. c. was optimistic about reaching an agreement with the Iranian president. d. wanted to avoid this difficult situation and invite the Iranian president to come to Brazil. e. was pessimistic to persuade the Iranian president to accept the West impositions on the nuclear issues.


Read the following text to answer question 80.

Raihana ha traído al mundo ya dos hijos en el que es el peor país para ser madre, según un informe de la ONG Save the Children. Vive en Eraghly, un pueblo del distrito de Shebirghan, una zona rural del norte de Afganistán. A sus 20 años, vive en casa de su familia política, donde realiza tareas domésticas, y apenas puede salir ni para ir al médico.

Neurons to inspire future computers The way neurons communicate could inspire the next generation of computers. Researchers are developing novel computers by mimicking the way that neurons are built and how they talk to each other.

La joven estudió hasta 5°. de primaria. La familia de su marido, con el que lleva casada cuatro años, no le permitió seguir asistiendo al colegio cuando se prometieron, según explica a una trabajadora de la ONG, que le hizo el cuestionario elaborado por El País.

Basing computers around neurons could lead to improvements in visual and audio processing on computers. It might mean that computers learn to see or to hear in the future rather than just rely on sensors.

Su primer hijo, Lal Mohammad, de dos años, nació en casa, tras un embarazo normal. Pero para dar a luz al segundo, Ghulam Mohammed, hace dos meses, acudió a casa de la comadrona, por las complicaciones sufridas durante la gestación. A diferencia de un embarazo anterior, malogrado a los tres meses después de una caída – sangró durante tres días –, en esta ocasión, la familia de su marido le permitió ir a la clínica cuando tuvo pérdidas de fluido, por recomendación de Maryam, la voluntaria de Save the Children que la visita a domicilio.

As well as building computers, the researchers are also helping to improve understanding of nerve cells and how they operate. While artificial neural networks have been around for more than 50 years, they typically do not copy real neurons very closely. By contrast the project being co-ordinated by computer scientist Dr Thomas Wennekers from the University of Plymouth wants to model specific physiological features of the way that neurons in one part of the brain communicate. “We want to learn from biology to build future computers,” said Dr Wennekers. “The brain is much more complex than the neural networks that have been implemented so far.”

Cecilia Jan, “Las caras de la maternidad”.

81. Según el texto, es correcto afirmar: a. Raihana se ha quedado embarazada dos veces.

BBC News, “Neurons to inspire future computers”.

b. La madre de Raihana vive con ella y sus dos hijos. c. Raihana vive con la familia de su marido.

80. De acordo com o texto: I. Pesquisadores estão desenvolvendo computadores imitando o modo como os neurônios se comunicam. II. Os pesquisadores estão aumentando seu entendimento sobre as células nervosas. III. No futuro, os computadores poderão aprender a ver e a escutar, sem depender somente de sensores. IV. A mente humana pode ser estudada para servir de modelo a novos computadores.

Quais afirmativas estão corretas?

d. Raihana tiene una niña y un niño. e. Raihana tuvo que interrumpir sus estudios después de su boda. 82. Sobre o texto, considere as seguintes informações: I. O sobrenome de Raihana. II. O sexo dos filhos de Raihana. III. O nome da cidade onde Raihana mora. IV. O nível de escolaridade de Raihana.

a. Only I and II.

a. I e II apenas.

b. Only III and IV.

b. II e III apenas.

c. Only II and III.

c. II, III e IV apenas.

d. All the affirmatives.

d. I, III e IV apenas.

e. Only II and IV.

e. I e IV apenas.

Espanhol

83. De acordo com o texto, é correto afirmar: a. A ONG Save the Children está no Afeganistão para ensinar métodos contraceptivos às mulheres.

Fique esperto!

b. Raihana trabalha na ONG Save the Children no Afeganistão.

As questões de língua espanhola têm como objetivo levar o aluno a ler e entender textos na língua estrangeira, sabendo diferenciar as ideias principais das ideias secundárias e sendo capaz de estabelecer relações entre as diferentes partes do texto. Para isso, o importante é estar atento às diferentes leituras que a internet, revistas e jornais possibilitam.

São informações presentes no texto:

c. As condições para a maternidade no Afeganistão são muito precárias. d. O governo do Afeganistão elaborou um questionário para levantar as condições de vida das mulheres do país. e. A família de Raihana está ligada à política do país. 84. La frase “...y apenas puede salir para ir al médico”, significa que Raihana:

El siguiente texto es referencia para las cuestiones 81 a 87.

a. No puede salir para ir al médico.

Quedarse embarazada, dar a luz y criar a un hijo. Un proceso tan antiguo como la humanidad es tan distinto según el lugar del mundo en el que una mujer viva que lo que aquí puede preocupar – tener un parto natural en vez de inducido, cómo compaginar la crianza y el trabajo, la guardería donde llevar al niño – ni siquiera está en cuestión en lugares donde lo primero es sobrevivir. Nombre: Raihana (no tiene apellido). Edad: 20 años. Hijos: dos varones.

b. Difícilmente puede salir para ir al médico. c. Puede salir a solas solo para ir al médico. d. En cuanto sale, va al médico. e. Cuando sale, aprovecha para ir al médico. 85. Según el texto, es correcto afirmar:

expoENEM 22

a. Los embarazos de Raihana han sido todos exitosos.


b. La madrina de Raihana le ayudó en su último parto. c. Raihana perdió un hijo a los tres meses de embarazo. d. Después de una caída en su último embarazo, Raihana pidió la ayuda de una comadrona. e. Cuando Raihana empezó a desangrar, la llevaron a una clínica. 86. La frase “...la voluntaria de Save the Children que la visita a domicilio”, se refiere a: a. Maryam, que es voluntaria de la ONG y va a casa de Raihana a visitarla. b. Raihana, voluntaria de Save the Children, que visita a Maryam a domicilio. c. Maryam, trabajadora de la ONG, que acude a la casa de la madre de Raihana. d. Maryam, voluntaria de Save the Children, y a Raihana que se visitan a menudo. e. La visita de Raihana a la comadrona que le ayudó en su último embarazo. 87. Según el texto, es correcto afirmar: a. En todos los países del mundo, tener un hijo a través de parto natural en vez de inducido es la primera preocupación de las madres. b. Las madres en Afganistán prefieren quedarse en casa con sus hijos a acudir a un trabajo. c. En algunos países como Afganistán, la supervivencia del recién nacido es la primera preocupación de la madre. d. En Afganistán, cuando una madre no tiene quien le ayude a criar a su hijo, lo lleva a la guardería. e. Para compaginar la crianza y el trabajo, la mujer en Afganistán deja el bebé con su familia.

Nadie en el Gobierno, a excepción de la ministra de Igualdad, Bibiana Aído, había sido hasta la fecha tan claro como el ministro de Justicia, Francisco Caamaño, a la hora de expresar su opinión sobre el uso del ‘burka’. «Es difícilmente compatible con la dignidad del ser humano», dijo. El comentario no es baladí si se tiene en cuenta que su departamento es el principal responsable de la futura ley de Libertad Religiosa. Una norma que regulará la utilización de esa prenda en espacios públicos. El texto está aún en fase de borrador – o quizá sea más lógico decir borradores – a la espera de que el Ejecutivo tome una decisión política y determine hasta dónde está dispuesto a llegar en cuestiones tan polémicas como ésa (…). Sin embargo, Caamaño adelantó que abordará de forma «general» el uso de vestimentas religiosas fuera del ámbito privado. A pesar de que, según aseguran fuentes de la Vicepresidencia Primera – la responsable última del proyecto –, la norma está prácticamente lista para ser aprobada, el Ejecutivo la mantendrá en el congelador hasta que el momento político sea menos convulso. En La Moncloa creen que ahora no se entendería que José Luis Rodríguez Zapatero se ocupe de nada distinto a la economía y menos si se trata de una cuestión tan delicada, capaz de levantar ampollas incluso en sus propias filas pues afecta a los derechos civiles. SUR.es, “El Gobierno regulará el uso del ‘burka’ porque no respeta la «dignidad del ser humano»”.

89. De acordo com o texto, é correto afirmar: a. A ministra da igualdade expressou sua opinião de forma clara sobre o uso da burca em lugares públicos. b. Ninguém no governo espanhol tem uma opinião definida sobre o uso da burca. c. O ministro da justiça da Espanha é o único que tem uma opinião formada sobre o uso da burca.

88. Considera las siguientes afirmativas: I. Maryam aconsejó a la familia de Raihana que la llevaran a una clínica cuando tuvo pérdidas de fluido. II. Raihana prefirió tener su segundo hijo en casa como le recomendó su comadrona. III. En su segundo embarazo, Raihana dio a luz a una niña. IV. Por complicaciones sufridas durante la gestación, Raihana tuvo su último bebé en casa de la comadrona.

d. A ministra da igualdade propõe que as pessoas se vistam de forma similar para evitar polêmicas. e. Francisco Caamaño é o último responsável pelo projeto lei que regulará o uso da burca no território espanhol. 90. De acordo com o texto, a futura lei de liberdade religiosa a. possibilitará o uso de roupas religiosas fora do âmbito privado.

Según el texto, son verdaderas las afirmativas:

b. dialogará com as minorias religiosas para chegar a um consenso sobre a questão.

a. 1, 2 y 3 solamente. b. 2, 3 y 4 solamente. c. 1 y 3 solamente. d. 2 y 4 solamente. e. 1 y 4 solamente.

d. impedirá a divulgação de símbolos religiosos em qualquer lugar do país. e. determinará uma multa àqueles que não cumprirem a nova lei.

El siguiente texto es referencia para las cuestiones 89 a 96.

91. Na frase “sin embargo, Caamaño adelantó que abordará...”, a expressão destacada significa:

© Agência Brasil

c. regulará, de forma geral, a utilização da burka em espaços públicos.

a. além disso b. entretanto c. por isso d. e e. sem dúvida 92. La frase “El comentario nos es baladí...” quiere decir que el comentario no es a. suficiente.

El Gobierno regulará el uso del ‘burka’ porque no respeta la «dignidad del ser humano» Caamaño anuncia que la futura ley de libertad religiosa regulará la utilización de prendas rituales en los lugares públicos expoENEM 23

b. apropiado. c. correcto. d. insignificante. e. fundamental.


93. En la frase “…si se tiene en cuenta que su departamento es el principal responsable...”, la palabra destacada se refiere al departamento:

un bol de muesli. En lo que respecta a la fruta, que puede ser fresca o en forma de zumo, macedonia o smoothie, el plátano es sin duda el más energético, aunque también son recomendables los kiwis, las naranjas o las mandarinas, debido a su alto contenido en fibra. Para ‘rematar’, añade algo de embutido, como unas lonchas de jamón york o pavo, y... ¡ya estáis listos para ir a la playa!

a. del ministro de Justicia. b. del gobierno. c. de la ministra de Igualdad. d. de la ley de libertad religiosa.

Hola.com, “¿Qué lleva un auténtico ‘desayuno de campeones’?”.

e. de Bibiana Aído. 94. La frase “el texto está en fase de borrador” significa que:

97. Señala la alternativa que presenta la idea general del texto.

a. La redacción del texto es provisional.

a. Incluso en verano, el desayuno sigue siendo la comida más importante del día.

b. El texto no necesita ninguna corrección adicional. c. El texto ya ha pasado por varias discusiones.

b. Los alimentos que no pueden faltar en la comida de deportistas están reunidos en cuatro grupos.

d. Las correcciones que se han hecho en el texto han tenido que borrarse.

c. Los alimentos que deben estar presentes antes de ir a la playa son el jamón y el pavo.

e. La versión final se ha aprobado por el Ejecutivo.

d. En vacaciones de verano, no pueden faltar la leche, los hidratos de carbono, la fruta y las grasas.

95. En la frase “…una cuestión tan delicada, capaz de levantar ampollas incluso en sus propias filas...”, la expresión destacada significa:

e. Las frutas más saludables para el desayuno veraniego pueden ser consumidas frescas o en forma de zumo.

a. dejar tranquilos b. silenciar

98. Según el texto, es correcto afirmar:

c. entusiasmar

a. El jamón de york y el pavo no se recomiendan en un desayuno equilibrado.

d. causar gran irritación e. emocionar

b. “Picoteo” es la última comida del día, que se hace al atardecer o por la noche.

96. La frase: “El gobierno regulará el uso del 'burka' porque no respeta la dignidad del ser humano” significa que:

c. “Un desayuno en condiciones” es sinónimo de la expresión “un desayuno rápido”.

a. El gobierno no respeta la dignidad del ser humano cuando piensa en regular el uso del 'burka'.

d. “Cole” es la forma reducida de “colectivo”, también conocido por autobús o autocar.

b. Además de controlar el uso del 'burka', el gobierno debe considerar la dignidad del ser humano. c. La dignidad del ser humano tiene que ser respetada y eso conlleva la posibilidad de vestirse según su religión.

e. “Peque” es la forma utilizada en el habla popular para denominar “niño de corta edad”.

d. El gobierno es favorable al uso del 'burka' pues cree en la libertad religiosa.

99. A frase “...aunque estemos de vacaciones, los niños, tanto como los adultos, necesitan empezar el día con un desayuno en condiciones...” significa que:

e. El uso del 'burka' no se compagina con la dignidad del ser humano, según el gobierno.

a. Mesmo nas férias, crianças e adultos precisam de um bom café da manhã. b. Principalmente nas férias de verão, o café da manhã é importante.

El siguiente texto es referencia para las cuestiones 97 a 100.

c. Mas se estamos de férias, o café da manhã é normalmente rápido.

No es ningún secreto que el desayuno es la comida más importante del día: equilibrado y ‘completo’, el desayuno supone la cuarta parte de las calorías que necesitamos para ‘rendir’ durante horas y horas, y aporta la energía necesaria para afrontar todas las actividades de la jornada, ya sea en el cole por la mañana, en una clase de karate por la tarde o jugando con los amigos durante el fin de semana. Por eso, es importante recordar que, aunque estemos de vacaciones, los niños, tanto como los adultos, necesitan empezar el día con un desayuno en condiciones: los cambios en el horario y la rutina diaria, las prisas para bajar a la playa o la piscina, o el calor sofocante de los meses de julio y agosto, pueden traducirse en un desayuno rápido, ‘para salir del paso’, casi siempre reducido a un vaso de leche y unas galletas. Un desajuste que, a lo largo del día, se compensa casi siempre con picoteos, que aportan grandes cantidades de azúcar y grasa, pero cero o casi ningún nutriente al organismo.

d. Quando chegarem as férias, o café da manhã deve ser tomado antes de ir à praia. e. Se estivermos em férias, não podemos reduzir o café da manhã a leite e bolachas. 100. Considera las siguientes informaciones: I. Algunos alimentos que no pueden faltar en un buen desayuno. II. Ejemplos de frutas recomendables para desayunar. III. El tipo de galletas que se puede comer en un desayuno rápido. IV. Los alimentos que pueden sustituir las galletas rellenas de chocolate.

¿Y qué lleva un auténtico ‘desayuno de campeones’? Un poco de todo, pero nada en exceso: el desayuno perfecto para los ‘peques’ debe englobar al menos cuatro grupos de alimentos, entre los que no pueden faltar la leche, los hidratos de carbono, la fruta, las proteínas y las grasas. Eso sí, antes que unas galletas rellenas de chocolate, apuesta por las clásicas tostadas con margarina o aceite de oliva, o

expoENEM 24

Las informaciones que se apresentam en el texto son: a. I y II solamente. b. II y III solamente. c. II, III y IV solamente. d. I, II y IV solamente. e. I y IV solamente.


101. (Enem 2010)

Carnavália

Atualmente, os artistas apropriam-se de desenhos, charges, grafismos e até ilustrações de livros para compor obras em que se misturam personagens de diferentes épocas, como na seguinte imagem: a.

Repique tocou O surdo escutou E o meu corasamborim Cuíca gemeu, será que era meu, quando ela passou por mim? [...] Arnaldo Antunes, Carlinhos Brown e Marisa Monte, “Tribalistas”.

No terceiro verso, o vocábulo “corasamborim”, que é a junção coração + samba + tamborim, refere-se, ao mesmo tempo, a elementos que compõem uma escola de samba e à situação emocional em que se encontra o autor da mensagem, com o coração no ritmo da percussão. Essa palavra corresponde a um(a)

Romero Brito.“Gisele e Tom”.

b.

a. estrangeirismo, uso de elementos linguísticos originados em outras línguas e representativos de outras culturas. b. neologismo, criação de novos itens linguísticos, pelos mecanismos que o sistema da língua disponibiliza. c. gíria, que compõe uma linguagem originada em determinado grupo social e que pode vir a se disseminar em uma comunidade mais ampla. d. regionalismo, por ser palavra característica de determinada área geográfica. e. termo técnico, dado que designa elemento de área específica de atividade. 102. (Enem 2010) Andy Warhol.“Michael Jackson”.

O folclore é o retrato da cultura de um povo. A dança popular e folclórica é uma forma de representar a cultura regional, pois retrata seus valores, crenças, trabalho e significados. Dançar a cultura de outras regiões é conhecê-la, é de alguma forma se apropriar dela, é enriquecer a própria cultura.

c.

Roseli Aparecida Bregolato, “Cultura corporal da dança”.

As manifestações folclóricas perpetuam uma tradição cultural, é obra de um povo que a cria, recria e a perpetua. Sob essa abordagem deixa-se de identificar como dança folclórica brasileira a. o Bumba meu boi, que é uma dança teatral onde personagens contam uma história envolvendo crítica social, morte e ressurreição. b. a Quadrilha das festas juninas, que associam festejos religiosos e celebrações de origens pagãs envolvendo as colheitas e a fogueira. c. o Congado, que é uma representação de um reinado africano onde se homenageia santos através de música, cantos e dança. d. o Balé, em que se utilizam músicos, bailarinos e vários outros profissionais para contar uma história em forma de espetáculo. e. o Carnaval, em que o samba derivado do batuque africano é utilizado com o objetivo de contar ou recriar uma história nos desfiles.

Funny Filez.“Monabean”.

d.

103. (Enem 2010) Na busca constante pela sua evolução, o ser humano vem alternando a sua maneira de pensar, de sentir e de criar. Nas últimas décadas do século XVIII e no início do século XIX, os artistas criaram obras em que predominam o equilíbrio e a simetria de formas e cores, imprimindo um estilo caracterizado pela imagem da respeitabilidade, da sobriedade, do concreto e do civismo. Esses artistas misturaram o passado ao presente, retratando os personagens da nobreza e da burguesia, além de cenas míticas e histórias cheias de vigor. J. J. Razouk, “Histórias reais e belas nas telas”.

Andy Warhol. “Marilyn Monroe”. expoENEM 25


e.

Do leito embalde no macio encosto Tento o sono reter!... já esmorece O corpo exausto que o repouso esquece... Eis o estado em que a mágoa me tem posto! O adeus, o teu adeus, minha saudade, Fazem que insano do viver me prive E tenha os olhos meus na escuridade. Dá-me a esperança com que o ser mantive! Volve ao amante os olhos por piedade, Olhos por quem viveu quem já não vive! Aluísio Azevedo, “Obra completa”.

O núcleo temático do soneto citado é típico da segunda geração romântica, porém configura um lirismo que o projeta para além desse momento específico. O fundamento desse lirismo é a. a angústia alimentada pela constatação da irreversibilidade da morte.

Pablo Picasso. “Retrato de Jaqueline Roque com as Mãos Cruzadas”.

b. na melancolia que frustra a possibilidade de reação diante da perda.

104. (Enem 2010)

c. o descontrole das emoções provocado pela autopiedade. d. o desejo de morrer como alívio para a desilusão amorosa. e. o gosto pela escuridão como solução para o sofrimento. 106. (Enem 2010) A biosfera, que reúne todos os ambientes onde se desenvolvem os seres vivos, se divide em unidades menores chamadas ecossistemas, que podem ser uma floresta, um deserto e até um lago. Um ecossistema tem múltiplos mecanismos que regulam o número de organismos dentro dele, controlando sua reprodução, crescimento e migrações. Marcelo Duarte, “O guia dos curiosos”.

Predomina no texto a função da linguagem a. emotiva, porque o autor expressa seu sentimento em relação à ecologia.

MONET, C. Mulher com sombrinha. 1875, 100x81cm. In: BECKETT, W. História da Pintura. São Paulo: Ática,1997.

b. fática, porque o texto testa o funcionamento do canal de comunicação.

Em busca de maior naturalismo em suas obras e fundamentando-se em novo conceito estético, Monet, Degas, Renoir e outros artistas passaram a explorar novas formas de composição artística, que resultaram no estilo denominado Impressionismo. Observadores atentos da natureza, esses artistas passaram a a. retratar, em suas obras, as cores que idealizavam de acordo com o reflexo da luz solar nos objetos. b. usar mais a cor preta, fazendo contornos nítidos, que melhor definiam as imagens e as cores do objeto representado. c. retratar paisagens em diferentes horas do dia, recriando, em suas telas, as imagens por eles idealizadas. d. usar pinceladas rápidas de cores puras e dissociadas diretamente na tela, sem misturá-las antes na paleta.

c. poética, porque o texto chama a atenção para os recursos de linguagem. d. conativa, porque o texto procura orientar comportamentos do leitor. e. referencial, porque o texto trata de noções e informações conceituais. 107. O emprego de onde e aonde, conforme a norma culta, requer conhecimentos básicos de regência verbal: usa-se onde quando o verbo exigir a preposição em. Por exemplo: Onde você colocou meus livros? (colocar em); usa-se aonde quando o verbo exigir a preposição a. Por exemplo: Aonde você vai? (ir a). Há mais: onde e aonde referem-se somente a lugar físico. Então, considerando a norma culta, o emprego de onde ou de aonde está corretamente utilizado em

e. usar as sombras em tons de cinza e preto e com efeitos esfumaçados, tal como eram realizadas no Renascimento. 105. (Enem 2010)

a. Não descobri a gaveta onde estão guardados aqueles livros raros. b. Meu amigo, trata-se de uma situação aonde ninguém quer chegar. c. Penso que chegará um dia onde tudo será resolvido entre nós dois. d. Quando começamos a enxergar melhor a condição humana, concluímos que a sociedade onde vivemos é mais cruel do que mostram os meios de comunicação e os livros todos.

Soneto Já da morte o palor me cobre o rosto, Nos lábios meus o alento desfalece, Surda agonia o coração fenece, E devora meu ser mortal desgosto!

e. É na juventude onde percebemos que a existência humana é transitória. expoENEM 26


No texto seguinte, base para a questão 108, Capítulo LI do romance Dom Casmurro, de Machado de Assis, o narrador Dom Casmurro registra o episódio da despedida dos namorados adolescentes Bentinho e Capitu no dia em que ele foi para o Seminário São José, no Rio de Janeiro.

a. I, II, III, IV, V e VI. b. II, III, IV e V c. I , II e VI d. I, II, IV e V e. II, IV e V

Capítulo LI - Entre Luz e Fusco Entre luz e fusco, tudo há de ser breve como esse instante. Nem durou muito a nossa despedida, foi o mais que pôde, em casa dela, na sala de visitas, antes do acender das velas; aí é que nos despedimos de uma vez. Juramos novamente que havíamos de casar um com o outro, e não foi só o aperto de mão que selou o contrato, como no quintal, foi a conjunção das nossas bocas amorosas... talvez risque isso na impressão, se até lá não pensar de outra maneira; se pensar, fica. E desde já fica, porque, em verdade, é a nossa defesa. O que o mandamento divino quer é que não juremos em vão pelo santo nome de Deus. Eu não ia mentir ao seminário, uma vez que levava um contrato feito no próprio cartório do céu. Quanto ao selo, Deus, como fez as mãos limpas, assim fez os lábios limpos, e a malícia está antes na tua cabeça perversa que na daquele casal de adolescentes... oh! minha doce companheira da meninice, eu era puro, e puro fiquei, e puro entrei na aula de S. José, a buscar de aparência a investidura sacerdotal, e antes dela a vocação. Mas a vocação eras tu, a investidura eras tu.

110. O Teatro do Oprimido, sistematizado pelo dramaturgo e teatrólogo Augusto Boal (1931-2009), efetivou-se no Brasil no contexto da Ditadura Militar. Por meio de diversas técnicas, como o teatro-jornal, teatro-imagem, teatro-invisível, teatro-fórum, o Teatro do Oprimido faz com que o público participe da ação teatral com a discussão de temas sociais e a resolução de problemas, transformando o espectador passivo em protagonista, o cidadão passivo em cidadão atuante. Neste sentido, o teatro proposto por Boal busca a. entretenimento, pois faz com que os espectadores divirtam-se participando da ação dramática e sintam-se com mais liberdade de expressão. b. realização de um grande espetáculo para o público, pois utiliza-se de diversas técnicas que envolvem figurino, sonoplastia, iluminação, cenário, entre outros. c. politização do espectador na preparação de ações reais que o conduzam à própria liberação, superando a condição de opressão.

Machado de Assis, “Dom Casmurro”.

d. participação do espectador, que passa a integrar a ação dramática; inicialmente como figurante e, posteriormente, como profissional liberal.

108. Um escritor expoente como Machado de Assis jamais desvia um capítulo do foco principal da narrativa. Nesse sentido, esse capítulo do romance a. insinua que o narrador está tão incomodado com a despedida que confunde o leitor com a amada Capitu ao tratá-los com o pronome pessoal tu.

e. compreensão e aceitação por parte do espectador da opressão sofrida pelos teatrólogos durante o período da Ditadura Militar.

Quando cheguei(1), vi(2) que Joana brincava(3) com suas bonecas e Marcelo polia(4) seu carro, mas não vi(5) a minha namorada, Aninha, que tinha ido(6) às compras com sua mãe.

b. define objetivamente a natureza da narrativa que revela uma mulher claramente adúltera. c. tem como título uma metáfora do próprio romance na medida em que tal título sugere incerteza, indefinição, que constituem o vetor da narrativa. d. esclarece que o objetivo primordial do narrador é o leitor, especialmente quando afirma que a vocação dele é o leitor.

Observe a temporalidade no seguinte período:

111. Considerando os tempos verbais desse período, conclui-se que a relação lógica entre eles evidencia que a. a ação 1 é anterior à 2 e à 5, mas é posterior à 4.

e. ironiza o leitor mostrando-lhe que ele, o leitor, tem mãos e boca sujas, ao contrário dos dois adolescentes sem malícia alguma.

b. a ação 3 e a 4 são concomitantes e posteriores à ação 6. c. a ação 2 é concomitante à 5, mas é anterior à ação 6.

Texto base para a questão 109.

d. a ação 2 é posterior à 1, mas é concomitante à 3 e à 4. e. a ação 6 é anterior à 1 e à 2, mas é posterior à 3 e à 4.

O vento não mais me fareja a face como um cão amigo... Mas o azul irreversível persiste em meus olhos. Cecília Meireles

112.

109. Nos períodos seguintes foram feitas modificações nesses versos da poeta Cecília Meireles. Leia-os atentamente. Considerando a estrutura sintática dos versos, são possíveis, sem prejuízo do sentido, as modificações efetuadas em I – O azul irreversível persiste em meus olhos porque o vento não mais me fareja a face como um cão amigo. II – O azul irreversível persiste em meus olhos embora o vento não mais me fareje a face como um cão amigo. III – O vento não mais me fareja a face como um cão amigo, pois o azul irreversível persiste em meus olhos. IV – O azul irreversível persiste em meus olhos apesar de o vento não mais me farejar a face como um cão amigo. V – Mesmo que o vento não mais me fareje a face como um cão amigo, o azul irreversível persiste em meus olhos.

Tarsila do Amaral. “Antropofagia”.

VI – O azul irreversível persiste em meus olhos, porém o vento não mais me fareja a face como um cão amigo. expoENEM 27

Qualquer estudante de Ensino Médio, como você, relaciona a pintura Antropofagia, de Tarsila do Amaral, ao Modernismo Brasileiro. Em 1928, artista europeu algum pintaria um quadro com cores tão brasileiras. Sendo assim, pense nas propostas de brasilidade dos


nossos escritores modernistas e leia atentamente as afirmativas seguintes: I – "A língua sem arcaísmo, sem erudição. Natural e neológica. A contribuição milionária de todos os erros. Como somos." II – "Contra o índio de tocheiro. O índio filho de Maria, afilhado de Catarina de Médicis e genro de D. Antônio de Maris." III – "A pena é um pincel. Eu limo sonetos engenhosos e frios." IV – "Nomear um objeto significa suprimir as três quartas partes do gozo de uma poesia, que consiste no prazer de adivinhar pouco a pouco. Sugerir, eis o sonho."

d. Quero que vá tudo pro inferno. e. Alegria, alegria. 115. Um dos artistas mais expressivos do século XIX, no Brasil, foi o pintor catarinense Victor Meirelles (1832-1903). Aluno e, posteriormente, professor da Academia Imperial de Belas Artes do Rio de Janeiro, executou a obra intitulada Degolação de São João Batista, em 1855. O diretor da academia e também artista Manuel de Araújo Porto-Alegre (1806-1879), após análise da obra, escreve-lhe:

Ilmo. Sr. Victor:

V – "A poesia existe nos fatos. Os casebres de açafrão e de ocre nos verdes da Favela, sob o azul cabralino, são fatos estéticos."

O corpo troncado do Evangelista foi pouco estudado.[...] Esta é a parte mais fraca do seu painel, e sobretudo a perna que está dobrada, porque sua musculação está toda incorreta: o colorido, pelo contrário, é suave e bem degradado em suas mesclas.

São propostas do modernismo brasileiro as afirmativas a. I, III e IV.

Catálogo Victor Meirelles de Lima.

b. II, III e IV. c. I, II e III. d. I, II e V. e. II, IV e V.

Leia o fragmento do Soneto de fidelidade, de Vinicius de Moraes, para responder à questão 113. De tudo ao meu amor serei atento Antes e com tal zelo, e sempre, e tanto Que mesmo em face do maior encanto Dele se encante mais meu pensamento. Vinicius de Moraes, “Soneto de fidelidade”.

113. O vocábulo mesmo(a)(s) equivale semanticamente ao que se verifica no terceiro verso desse fragmento poético de Vinicius de Moraes na frase a. “Pai, para onde fores, também irei trilhando as mesmas ruas”. (Augusto dos Anjos) b. Mesmo que suas coisas sejam coisas do não, continuarei a negá-las.

MEIRELLES, Victor. Degolação de São João Batista, 1855. 130,5 x 97,1 cm.

Com base na representação da obra Degolação de São João Batista e no fragmento de texto acima, é correto afirmar que a. a obra de Victor Meirelles apresenta características das obras executadas na Idade Média, com temas bíblicos e o uso racional de elementos de composição como volume, cor, equilíbrio e o uso do claro-escuro.

c. Encontrei o mesmo número de respostas que você encontrou. d. Direi as mesmas palavras que disse no julgamento de ontem. e. Sempre encontro as mesmas pessoas nas festas que frequento.

b. a Academia Imperial de Belas Artes determinou em seu ensino o estilo Neoclássico, que caracterizava-se pela retomada de modelos clássicos da arte grega e romana.

114. A década de 1960 foi muito representativa quanto aos movimentos artísticos surgidos nesse período, principalmente no que se refere à música. Um ponto importante a ser destacado foi o espaço que os compositores encontraram, em meio a turbulências sociais e políticas, para promoverem manifestos com suas canções.

c. Victor Meirelles não tinha conhecimento sobre anatomia e nem sobre organização das figuras na tela, pois em seus estudos acadêmicos não foi priorizada a rigorosidade quanto a forma, a cor, a proporção, o equilíbrio e a harmonia.

A chamada canção de protesto, escrita por dezenas de compositores durante os anos 60, num primeiro momento, representava uma possível intervenção política do artista na realidade social do país, contribuindo assim para a transformação desta numa sociedade mais justa.

d. as atividades da Academia Imperial de Belas Artes foram iniciadas com um grupo de artistas pertencentes à Missão Artística Francesa, que trouxe ao Brasil o estilo denominado Surrealista. e. a Academia Imperial de Belas Artes determinou em seu ensino o estilo Neoclássico, que caracterizava-se pela retomada do movimento artístico denominado Neoplasticismo.

Arnaldo Daraya Contier. “Edu Lobo e Carlos Lyra: o nacional e o popular na canção de protesto (Os anos 60)”.

Geraldo Vandré, perseguido e censurado pela Ditadura Militar, compôs uma música que tornou-se hino de protesto contra esse sistema, denominada

Inglês Military-inspired

a. Apesar de você.

Brazil’s state-run alcohol fuel programme was set up for patriotic, not financial or environmental reasons.

b. A banda. c. Caminhando e cantando (Prá não dizer que não falei das flores).

expoENEM 28


The military government that ran the country from 1964 to 1985 wanted to reduce its dependence on Middle Eastern petroleum during the 1970s oil crisis.

Texto base para a questão 118. Analysis: Soccer violence an international problem

The technology was far from new, having been around since the 1920s, but no country had employed it on such a scale.

Soccer hooliganism has often been called ‘the British disease’ but this kind of antisocial behavior characterized by the term occurs almost everywhere the sport is played.

Under the Pro-Alcohol programme, farmers were paid generous subsidies to grow sugar-cane, from which ethanol was produced.

Fans of England’s national team do hit the headlines more than any other after their violent clashes on the international stage.

The price at the pump was also subsidised to make the new fuel cheaper than petrol, while the motor industry turned out increasing numbers of vehicles adapted to burn pure ethanol.

Hooligans in the rest of Europe, by contrast, usually fight their battles at home, often expressing local, regional or sub national rivalries.

Robert Plummer, “The rise, fall and rise of Brazil’s biofuel”.

But fans from Germany, Holland, Belgium and elsewhere have been prepared to bury internal differences to battle it out with foreign fans and police on the pavements of European cities.

116. O texto apresentado abrange características peculiares ao desenvolvimento do Programa do Álcool no Brasil, movido

During the 1998 World Cup a French policeman nearly died after being badly beaten by German fans. And earlier this year two Leeds United supporters were stabbed to death by followers of the Turkish club Galatasaray.

a. pela tentativa de copiar os americanos no desenvolvimento do programa de etanol.

Martin Asser, “Analysis: Soccer violence an international problem”.

b. por motivos patrióticos, tentando diminuir a dependência do Brasil em relação ao álcool americano. c. por motivos patrióticos, para se buscar alternativa ao petróleo, devido à grande elevação de preços, consequência da crise dos anos 70.

118. O texto acima faz uma análise sobre a violência nos campos de futebol europeus, situação a. exclusivamente inglesa e dos países do Reino Unido.

d. por um ato frustrado do governo militar brasileiro a fim de mudar as regras de comércio de combustíveis na América Latina.

b. famosa por ser praticada por seguidores da seleção inglesa e que não acontece em países como Turquia e Holanda.

e. pelo êxito dos militares brasileiros em produzir novos combustíveis para abastecer seus tanques de guerra parados nos quartéis.

c. restrita a países que possuem grandes populações. d. espalhada por todo continente europeu, sendo que fãs do esporte, na Alemanha, na Holanda e na Bélgica, estão a cada dia aumentando sua rivalidade local.

Texto base para a questão 117.

e. pertinente a todo o território europeu, sendo que os fãs que praticam hooliganism travam batalhas fora de seu país. 119. (Enem 2010) Viva la vida I used to rule the world Seas would rise when I gave the word Now in the morning and I sleep alone Sweep the streets I used to own I used to roll the dice Feel the fear in my enemy’s eyes Listen as the crowd would sing “Now the old king is dead! Long live the king!” One minute I held the key Next the walls were closed on me And I discovered that my castles stand Upon pillars of salt and pillars of sand […]

Midnight Oil used rock music to tell a story and send a message. Songs such as Put Down that Weapon, Blue Sky Mining, Beds are Burning and River Runs Red made popular music charts around the world. The band’s lead singer Peter Garrett said, ‘Rock and Roll has traditionally been about cars and girls and now we were... trying to make it about something else as well.’ The band used music to raise awareness of environmental and political issues, often performing with Aboriginal rock bands such as Warumpi. Kathryn Wells, “Australian rock music”.

Chris Martin, “Viva la vida”.

117. O texto acima fala da banda de rock australiana Midnight Oil, que mostra em suas composições a. letras que falam, especificamente, sobre carros e mulheres. b. preocupação com assuntos banais que não afetam a sociedade.

Letras de músicas abordam temas que, de certa forma, podem ser reforçados pela repetição de trechos ou palavras. O fragmento da canção Viva la vida, por exemplo, permite conhecer o relato de alguém que a. costumava ter o mundo aos seus pés e, de repente, se viu sem nada.

c. letras que falam sobre carros e poucos assuntos considerados importantes.

b. almeja o título de rei e, por ele, tem enfrentado inúmeros inimigos.

d. preocupação por temas essencialmente políticos e ambientais.

d. limpava as ruas e, com seu esforço, tornou-se rei de seu povo.

e. temas que abordam religiões australianas.

e. tinha a chave para todos os castelos nos quais desejava morar. expoENEM 29

c. causa pouco temor a seus inimigos, embora tenha muito poder.


120. (Enem 2010)

121. Considera las siguientes informaciones. I – La cantidad de personas que confirmaron presencia en la fiesta de cumpleaños de Jesse.

The record industry The record industry is undoubtedly in crisis, with labels laying off employees in continuation.This is because CD sales are plummeting as youngsters prefer to download their music from the Internet, usually free of charge. And yet it´s not all gloom and doom. Some labels are in fact thriving. Putumayo World Music, for example, is growing, thanks to its catalogue of ethnic compilation albums, featuring work by largely unknown artists from around the planet. Putumayo, which takes its name from a valley in Colombia, was founded in New York in 1993. It began life as an alternative clothing company, but soon decided to concentrate on music. Indeed its growth appears to have coincided with that of world music as a genre.

II – La razón que llevó Jesse a suspender su fiesta de cumpleaños. III – La forma utilizada por una adolescente australiana para invitar a sus amigos a su cumpleaños. IV – El sitio donde se celebró la fiesta de cumpleaños de Jesse. V – La fecha del cumpleaños de Jesse.

Están en el texto las informaciones a. I, II y III solamente. b. I, II, III y IV solamente. c. II, III, IV y V solamente.

Speak Up. Ano XXIII, n. 275 (fragmento).

d. III, IV y V solamente.

A indústria fonográfica passou por várias mudanças no século XX e, como consequência, as empresas enfrentaram crises. Entre as causas, o texto da revista Speak Up aponta

e. I, II y V solamente. 122. Considera las siguientes informaciones.

a. o baixo interesse dos jovens por alguns gêneros musicais. b. o acesso a músicas, geralmente sem custo, pela internet.

I – El nombre de la red social a través de la cual se dio publicidad del cumpleaños de la adolescente australiana.

c. a compilação de álbuns com diferentes estilos musicais.

II – El número de personas que acudieron a la fiesta de Jesse.

d. a ausência de artistas populares entre as pessoas mais jovens.

III – El nombre del grupo que difundió la invitación alrededor del mundo.

e. o aumento do número de cantores desconhecidos.

IV – La ciudad donde vive Jesse, la adolescente australiana. V – La razón de haber agentes de la policía en la fiesta de la adolescente australiana.

Espanhol

Texto para as questões 121, 122 e 123.

Están en el texto las informaciones a. I, II, III, IV y V. b. II, IV y V solamente.

Una adolescente australiana anula su cumpleaños tras apuntarse 200.000 personas por Facebook

c. I, III, IV y V solamente. d. I, III y V solamente. e. I, II y III solamente. 123. A expressão "pequeña fiesta de cumpleaños", no texto, está entre aspas com a finalidade de: a. assinalar uma transcrição textual, uma vez que Jesse queria fazer uma festa íntima e, portanto, pequena. b. ressaltar uma gíria, pois na internet esse tipo de linguagem é comum.

Una adolescente de Sídney tuvo que cancelar su “pequeña fiesta de cumpleaños” después de que unas 200.000 personas que no había invitado confirmasen su asistencia por Facebook, informaron hoy medios australianos y ha recogido la agencia Efe. Jesse quería estrenar sus 16 años con amigos y no se le ocurrió otra idea que anunciarla abiertamente a través de la citada red social. La estudiante publicó en su muro que no tenía “tiempo para invitar (personalmente) a cada uno” y por ello les pidió que lo comunicasen a otras personas. “Es una fiesta abierta, con la condición de que no se escape de las manos”, decía la invitación de la joven. Al día siguiente de colocar el anuncio, la estudiante, que vive en Chatswood, Sídney, se dio con la sorpresa de que más de 20.000 personas ya habían confirmado su asistencia y para hoy el número se había multiplicado por diez hasta los 200.000, porque siguen contestando aunque se haya anulado. Según el rotativo australiano, la invitación fue “secuestrada” por miembros del grupo denominado “Anonymous”, que la propagó como un virus por todo el mundo. Al final, la joven pudo celebrar el cumpleaños con sus amigos en una fiesta privada en casa y con agentes de la policía en el exterior para evitar incidentes. hola.com

c. expressar ironia, já que a festa de aniversário tomou proporções gigantescas e não mais de uma festa pequena como indica a expressão. d. evitar ambiguidade entre o tamanho da festa que a adolescente pretendia dar e o número de convidados que confirmaram presença. e. persuadir o leitor a participar da festa de aniversário da adolescente australiana.

(Enem 2010) Texto para as questões 124 e 125. Bilinguismo en la educación media Continuidad, no continuismo Aún sin escuela e incluso a pesar de la escuela, paraguayos y paraguayas se están comunicando en guaraní. La comunidad paraguaya ha encontrado en la lengua guaraní una funcionalidad real que asegura su reproducción y continuidad. Esto, sin embargo, no basta. La inclusión de la lengua guaraní en el proceso de educación escolar fue sin duda un avance de la Reforma Educativa. Gracias precisamente a los programas escolares, aun en contextos urbanos, el bilingüismo ha sido potenciado. Los guaraní-hablantes

expoENEM 30


a. ridicularizar a forma física do possível cliente do produto anunciado, aconselhando-o a uma busca de mudanças estéticas.

se han acercado con mayor fuerza a la adquisición del castellano, y algunos castellanohablantes perdieron el miedo al guaraní y superaron los prejuicios en contra de él. Dejar fuera de la Educación Media al guaraní sería echar por la borda tanto trabajo realizado, tanta esperanza acumulada.

b. enfatizar a tendência da sociedade contemporânea de buscar hábitos alimentares saudáveis, reforçando tal postura. c. criticar o consumo excessivo de produtos industrializados por parte da população, propondo a redução desse consumo.

Cualquier intento de marginación del guaraní en la educación paraguaya merece la más viva y decidida protesta, pero esta postura ética no puede encubrir el continuismo de una forma de enseñanza del guaraní que ya ha causado demasiados estragos contra la lengua, contra la cultura y aun contra la lealtad que las paraguayas y paraguayos sienten por su querida lengua. El guaraní, lengua de comunicación sí y mil veces sí; lengua de imposición, no. MELIÀ, B. Disponível em: <http://www.staff.uni-mainz.de> Acesso em: 27 abr. 2010 (adaptado)

d. associar o vocábulo “açúcar” à imagem do corpo fora de forma, sugerindo a substituição desse produto pelo adoçante. e. relacionar a imagem do saco de açúcar a um corpo humano que não desenvolve atividades físicas, incentivando a prática esportiva. 127. (Enem 2011) Entre ideia e tecnologia O grande conceito por trás do Museu da Língua é apresentar o idioma como algo vivo e fundamental para o entendimento do que é ser brasileiro. Se nada nos define com clareza, a forma como falamos o português nas mais diversas situações cotidianas é talvez a melhor expressão da brasilidade.

124. No último parágrafo do fragmento sobre o bilinguismo no Paraguai, o autor afirma que a língua guarani, nas escolas, deve ser tratada como língua de comunicação e não de imposição. Qual dos argumentos abaixo foi usado pelo autor para defender essa ideia? a. O guarani continua sendo usado pelos paraguaios, mesmo sem a escola e apesar dela. b. O Ensino Médio no Paraguai, sem o guarani, desmereceria todo o trabalho realizado e as esperanças acumuladas. c. A língua guarani encontrou uma funcionalidade real que assegura sua reprodução e continuidade, mas só isso não basta.

SCARDOVELI, E. Revista Língua Portuguesa. São Paulo: Segmento, Ano II, nº 6, 2006.

a. inauguração do museu e o grande investimento em cultura no país.

d. A introdução do guarani nas escolas potencializou a difusão da língua, mas é necessário que haja uma postura ética em seu ensino.

b. importância da língua para a construção da identidade nacional. c. afetividade tão comum ao brasileiro, retratada através da língua.

e. O bilinguismo na maneira de ensinar o guarani tem causado estragos contra a língua, a cultura e a lealdade dos paraguaios ao guarani. 125. Em alguns países bilíngues, uma língua pode sobrepor-se à outra, gerando uma mobilização social em prol da valorização da menos proeminente. De acordo com o texto, no caso do Paraguai, esse processo se deu pelo(a)

O texto propõe uma reflexão acerca da língua portuguesa, ressaltando para o leitor a

d. relação entre o idioma e as políticas públicas na área de cultura. e. diversidade étnica e linguística existente no território nacional. 128. (Enem 2011) Pequeno concerto que virou canção

a. falta de continuidade do ensino do guarani nos programas escolares.

Não, não há por que mentir ou esconder A dor que foi maior do que é capaz meu coração

b. preconceito existente contra o guarani principalmente nas escolas.

Não, nem há por que seguir cantando só para explicar

c. esperança acumulada na reforma educativa da educação média.

Não vai nunca entender de amor quem nunca soube amar

d. inclusão e permanência do ensino do guarani nas escolas.

Ah, eu vou voltar pra mim

e. continuísmo do ensino do castelhano nos centros urbanos.

Seguir sozinho assim Até me consumir ou consumir toda essa dor

126. (Enem 2011)

Até sentir de novo o coração capaz de amor VANDRÉ, G. Disponível em: <http://www.letras.terra.com.br>. Acesso em: 29 jun. 2011.

Na canção de Geraldo Vandré, tem-se a manifestação da função poética da linguagem, que é percebida na elaboração artística e criativa da mensagem, por meio de combinações sonoras e rítmicas. Pela análise do texto, entretanto, percebe-se, também, a presença marcante da função emotiva ou expressiva, por meio da qual o emissor a. imprime à canção as marcas de sua atitude pessoal, seus sentimentos. b. transmite informações objetivas sobre o tema de que trata a canção.

Disponível em: <http://www.ccsp.com.br>. Acesso em: 27 jul. 2010 (adaptado).

O texto é uma propaganda de um adoçante que tem o seguinte mote: “Mude sua embalagem”. A estratégia que o autor utiliza para o convencimento do leitor baseia-se no emprego de recursos expressivos, verbais e não verbais, com vistas a expoENEM 31

c. busca persuadir o receptor da canção a adotar um certo comportamento. d. procura explicar a própria linguagem que utiliza para construir a canção. e. objetiva verificar ou fortalecer a eficiência da mensagem veiculada.


131.

129. (Enem 2011)

Padre – (para o sacristão) Que está fazendo aí?

É água que não acaba mais

Sacristão – (à guisa de defesa) Estava conversando com aqueles homens.

Dados preliminares divulgados por pesquisadores da Universidade Federal do Pará (UFPA) apontaram o Aquífero Alter do Chão como o maior depósito de água potável do planeta. Com volume estimado em 86 000 quilômetros cúbicos de água doce, a reserva subterrânea está localizada sob os estados do Amazonas, Pará e Amapá. “Essa quantidade de água seria suficiente para abastecer a população mundial durante 500 anos”, diz Milton Matta, geólogo da UFPA. Em termos comparativos, Alter do Chão tem quase o dobro do volume de água do Aquífero Guarani (com 45 000 quilômetros cúbicos). Até então, Guarani era a maior reserva subterrânea do mundo, distribuída por Brasil, Argentina, Paraguai e Uruguai.

Padre – E eu lá dentro à sua espera para ajudar à missa. (repara em Bonitão e Zé-do-Burro) Quem são? (...) Padre – Deixe-me ver o seu ombro. Sacristão – Está em carne viva. Padre – Promessa? Zé – Pra Santa Bárbara. Estava esperando abrir a igreja... Sacristão – Deve ter recebido dela uma graça muito grande.

Época. Nº 623, 26 abr. 2010.

Zé – Graças a Santa Bárbara, a morte não levou o meu melhor amigo.

Essa notícia, publicada em uma revista de grande circulação, apresenta resultados de uma pesquisa científica realizada por uma universidade brasileira. Nessa situação específica de comunicação, a função referencial da linguagem predomina, porque o autor do texto prioriza

Padre – Mesmo assim não lhe parece um tanto exagerada a promessa? E um tanto pretensioso também? Zé – Nada disso, seu Padre. (...) Quando Nicolau adoeceu, o senhor não calcula como eu fiquei.

a. as suas opiniões, baseadas em fatos.

Padre – Foi por causa desse... Nicolau, que você fez a promessa?

b. os aspectos objetivos e precisos. c. os elementos de persuasão do leitor.

Zé – Foi. Nicolau foi ferido, seu Padre, por uma árvore que caiu, num dia de tempestade.

d. os elementos estéticos na construção do texto.

Sacristão – Santa Bárbara, a árvore caiu em cima dele?!

e. os aspectos subjetivos da mencionada pesquisa.

Zé – Só um galho, que bateu de raspão na cabeça. Ele chegou em casa, escorrendo sangue de meter medo. Eu e minha mulher tratamos dele, mas o sangue não havia meio de estancar.

130. Um texto coerente deve apresentar-se em partes semanticamente organizadas, obedecendo a uma sequência lógica de ideias, de argumentos. Deve constituir um conjunto harmônico livre de elementos destoantes, ilógicos, contraditórios e desconexos.

Padre – Uma hemorragia. Zé – Só estancou quando eu fui no curral, peguei um bocado de bosta de vaca e taquei em cima do ferimento.

Observe o texto de Millôr Fernandes.

Padre – Mas meu filho, isso é um atraso! Uma porcaria! (...)

A vaguidão específica

Dias Gomes, “O pagador de promessas”.

“As mulheres têm uma maneira de falar que chamo de vagoespecífica.” Richard Gehman

Esse é um texto de teatro. Ele apresenta semelhanças com o texto narrativo por utilizar personagens, representar ações e marcar tempo e espaço. Porém, também há dessemelhança entre esses dois tipos de texto, porque no teatro

— Maria, ponha isso lá fora em qualquer parte. — Junto com as outras? — Não ponha junto com as outras, não, senão pode vir alguém e querer fazer qualquer coisa com elas. Ponha no lugar do outro dia.

a. as ações dos personagens são descritas por um narrador, o mediador da narrativa.

— Sim senhora. Olha, o homem está aí.

b. as falas dos personagens são diluídas no texto, sendo confundidas com a voz do narrador.

— Aquele de quando choveu? — Não, o que a senhora foi lá e falou com ele no domingo.

c. as características dos personagens são reveladas por meio de suas falas, e assim a ação é conduzida por eles mesmos.

— Que é que você disse a ele?

d. as vozes dos personagens são importantes para a construção da narrativa, embora haja a voz de um narrador onisciente.

— Eu disse pra ele continuar. — Ele já começou?

e. as atitudes dos personagens são conduzidas por um narrador intruso, embora o conflito esteja nos diálogos.

— Acho que já. Eu disse que podia principiar por onde quisesse. — É bom? 132.

— Mais ou menos. O outro parece mais capaz. (...)

Apelo

Considerando o texto, é possível deduzir que A vaguidão específica, de Millôr Fernandes, a. é coerente porque satiriza a capacidade da mulher de falar muito e vagamente. b. é coerente porque ironiza o fato de as mulheres muitas vezes se comunicarem muito e especificamente. c. é coerente porque questiona a crença segundo a qual as mulheres sempre falam simultaneamente, vaga e especificamente. d. é coerente porque o leitor não consegue entender o que as mulheres falam entre si. e. é coerente se for considerada a intencionalidade do modo como o texto foi construído.

Amanhã faz um mês que a Senhora está longe de casa. Primeiros dias, para dizer a verdade, não senti falta, bom chegar tarde, esquecido na conversa da esquina. Não foi ausência por uma semana: o batom ainda no lenço, o prato na mesa por engano, a imagem de relance no espelho. Com os dias, Senhora, o leite primeira vez coalhou. A notícia da sua perda veio aos poucos: a pilha de jornais ali no chão, ninguém os guardou debaixo da escada. Toda a casa era um corredor deserto, e até o canário ficou mudo. Não dar parte de fraco, ah, Senhora, fui beber com os amigos. Uma hora da noite eles se iam e eu ficava só, sem o perdão da sua presença a todas as aflições do dia, como a última luz na varanda.

expoENEM 32


E comecei a sentir falta das pequenas brigas só por causa do tempero na salada – o meu jeito de querer bem. Acaso é saudade, Senhora? Às suas violetas, na janela, não lhes poupei água e elas murcham. Não tenho botão na camisa, calço a meia furada. Que fim levou o saca-rolhas? Nenhum de nós sabe, sem a Senhora, conversar com os outros: bocas raivosas mastigando. Venha para casa, Senhora, por favor.

um órgão qualquer, pedra ou indigesto, um grão, imastigável, de quebrar dente. Certo não, quando ao catar as palavras: a pedra dá à frase grão mais vivo: obstrui a leitura fluviante flutual, açula a atenção, isca-a com o risco.

Dalton Trevisan

Nesse texto em que o escritor paranaense Dalton Trevisan mescla o gênero narrativo e o epistolar e se traveste de homem-narrador-missivista, há evidências de que o autor

João Cabral de Melo Neto

Poeta do Neomodernismo, o pernambucano João Cabral de Melo Neto, nesse poema metalinguístico, pretende mostrar que a. a “pedra” não deve continuar no poema porque ela impede uma leitura linear, de entendimento fácil.

a. mostra que a ausência da mulher no dia a dia do homem provoca-lhe dor.

b. as ações de “catar feijões” e “escrever” opõem-se: do feijão deve ser retirado tudo o que é leve; na folha de papel esses elementos devem continuar.

b. esclarece as possíveis leitoras de que, quando elas se ausentam da vida dos homens, eles sentem-se aliviados. c. cria uma figura feminina com características de esposa, mãe e empregada para combater a condição da mulher atual.

c. no “catar feijões” e “catar palavras”, a “pedra” assume funções diferentes: no primeiro ela é indesejável e no segundo é o que deve permanecer.

d. sugere que todo homem precisa livrar-se do machismo e pedir à mulher ausente que volte para estancar a dor dele.

d. tanto no “catar feijões” como no “catar palavras” entra um risco: o de que permaneçam “pedras” que tornarão indigesto o alimento e sem valor o poema.

e. polemiza “a tal libertação feminina”, ocorrida nos últimos quarenta anos, mostrando que a mulher provocou um vazio na vida do homem e da casa.

e. o destino da “pedra” é o mesmo com relação ao “catar feijões” e “catar palavras”, isto é, ela deve ser jogada fora, pois não tem valor.

133. Leia o trecho da música a seguir: Além do horizonte Além do horizonte, deve ter algum lugar bonito para viver em paz, Onde eu possa encontrar a natureza, alegria e felicidade com certeza.

135. Leia o texto seguinte, extraído da coletânea Os cem menores contos brasileiros do século, organizada pelo escritor pernambucano Marcelino Freire. BOLETIM DE CARNAVAL

Lá nesse lugar o amanhecer é lindo, Com flores festejando mais um dia que vem vindo...

— Fui estuprada, vó. Três animais!

Onde a gente possa se deitar no campo, se amar na relva,

— E tu esperava o quê? Um noivo? Luiz Roberto Guedes

Escutando o canto dos pássaros. Erasmo e Roberto Carlos

A leitura desse miniconto permite inferir que

Os autores, contemporâneos, estão referindo-se a um lugar ideal, de um ambiente campestre, calmo. Na literatura, um grupo de escritores, no século XVIII, defendeu a vida bucólica e a necessidade de revalorização da vida simples, em contato com a natureza. Essas características fazem referência aos escritores do

a. trata-se de um texto curto, sintético, elíptico, o que é raro na literatura contemporânea. b. o texto confronta a indignação da moça com o ceticismo da avó. c. o vocábulo estuprada está grafado incorretamente – o correto deve ser estrupada.

a. Realismo, fugindo às exibições subjetivas e mantendo a neutralidade diante do narrado; as referências à natureza eram feitas em terceira pessoa.

d. o vocábulo quê está acentuado porque aparece no fim de frase interrogativa.

b. Romantismo, para quem encontrar-se com a natureza significava alargar a sensibilidade.

e. o conto está redigido na língua padrão, isto é, em língua culta.

c. Arcadismo, propondo um retorno à ordem natural, como na literatura clássica, na medida em que a natureza adquire um sentido de simplicidade, harmonia e verdade.

136. Durante a Idade Média, Deus era o grande tema para a arte. Nesse mundo teocêntrico, encontramos nas pinturas, esculturas, construções arquitetônicas, músicas e peças de teatro a expressão da relação entre o ser humano e Deus. Nas pinturas e iluminuras, as proporções das imagens que expressavam essa relação privilegiavam

d. Barroco, movimento que valorizava a tensão de elementos contrários, celebrando Deus ou as delícias da vida nas formas da natureza.

a. as figuras sacras, representadas em tamanho maior que seres humanos comuns, animais e natureza.

e. Simbolismo, quando os escritores se mostravam mais emotivos, transformando as palavras em símbolos da alma. A natureza era um puro mistério.

b. as figuras dos seres humanos comuns, como os pastores, representados em tamanho maior que anjos, santos e natureza.

134.

c. os animais e a natureza, representados em tamanho maior que as figuras sacras. Catar feijão Catar feijão se limita com escrever: joga-se os grãos na água do alguidar e as palavras na folha de papel; e depois, joga-se fora o que boiar. Certo, toda palavra boiará no papel, água congelada, por chumbo seu verbo; pois para catar esse feijão, soprar nele, e jogar fora o leve e oco; palha e eco. Ora, nesse catar feijão entra um risco: o de entre os grãos pesados entre

d. o povo analfabeto e inculto, representado em tamanho maior que as figuras sacras e a natureza. e. o homem, representado em tamanho maior que o menino Jesus, anjos, santos, animais e natureza. 137. A dança não é, como se tende a acreditar, um conjunto de passos mais ou menos arbitrários que são o resultado de combinações mecânicas e que, embora possam ser úteis como exercícios técnicos, expoENEM 33


não poderiam ter a pretensão de constituírem uma arte: são meios e não fim.

140. (Enem 2011)

Isadora Duncan. In: Roger Garaudy, “Dançar a vida”.

Com base no fragmento de texto e na concepção de dança de Isadora Duncan (1877–1927), pode-se afirmar que a bailarina a. defendia a dança clássica e seus cânones. PICASSO, P. Guernica. Óleo sobre tela, 349 x 777 cm. Museu Reina Sofia, 1937. Disponível

b. acreditava que os passos da dança moderna eram combinações mecânicas. c. rompeu com todos os cânones e tabus do balé clássico.

em: <http://www.fddreis.files.wordpress.com>. Acesso em: 16 jul. 2010.

O pintor espanhol Pablo Picasso (1881–1973), um dos mais valorizados no mundo artístico, tanto em termos financeiros quanto históricos, criou a obra Guernica em protesto ao ataque aéreo à pequena cidade basca de mesmo nome. A obra, feita para integrar o Salão Internacional de Artes Plásticas de Paris, percorreu toda a Europa, chegando aos EUA e instalando-se no MoMA, de onde sairia apenas em 1981. Essa obra cubista apresenta elementos plásticos identificados pelo

d. propunha uma forma de dança com regras e técnicas sistematizadas. e. argumentava contra o inusitado na dança. 138. Segundo Molina, a música do rádio no Brasil pode ser utilizada como instrumento de alienação e massificação. Esse tipo de música busca distrair os ouvintes, desviando os sentidos dos problemas e ajudando a esquecer a dura realidade imposta pelo capitalismo. Para exemplificar sua fundamentação, ele analisa grandes sucessos da mídia, como músicas de duplas sertanejas.

a. painel ideográfico, monocromático, que enfoca várias dimensões de um evento, renunciando à realidade, colocando-se em plano frontal ao espectador. b. horror da guerra de forma fotográfica, com o uso da perspectiva clássica, envolvendo o espectador nesse exemplo brutal de crueldade do ser humano.

A música a que se refere Molina é um exemplo a. do Classicismo. b. da indústria cultural.

c. uso das formas geométricas no mesmo plano, sem emoção e expressão, despreocupado com o volume, a perspectiva e a sensação escultórica.

c. do Romantismo. d. da arte engajada.

d. esfacelamento dos objetos abordados na mesma narrativa, minimizando a dor humana a serviço da objetividade, observada pelo uso do claro-escuro.

e. da MPB.

e. uso de vários ícones que representam personagens fragmentados bidimensionalmente, de forma fotográfica livre de sentimentalismo.

139. (Enem 2011)

141. (Enem 2011)

Going to university seems to reduce the risk of dying from coronary heart disease. An American study that involved 10 000 patients from around the world has found that people who leave school before the age of 16 are five times more likely to suffer a heart attack and die than university graduates. World Report News. Magazine Speak Up. Ano XIV, nº 170. Editora Camelot, 2001.

Em relação às pesquisas, a utilização da expressão university graduates evidencia a intenção de informar que a. as doenças do coração atacam dez mil pacientes. b. as doenças do coração ocorrem na faixa dos dezesseis anos. c. as pesquisas sobre doenças são divulgadas no meio acadêmico. d. jovens americanos são alertados dos riscos de doenças do coração. e. maior nível de estudo reduz riscos de ataques do coração.

LEIRNER, N. Tronco com cadeira (detalhe). 1964. Disponível em <http://www.itaucultural.org.br>. Acesso em: 27 jul. 2010.

Nessa estranha dignidade e nesse abandono, o objeto foi exaltado de maneira ilimitada e ganhou um significado que se pode considerar mágico. Daí sua “vida inquietante e absurda”. Tornou-se ídolo e, ao mesmo tempo, objeto de zombaria. Sua realidade intrínseca foi anulada. JAFFÉ, A. O simbolismo nas artes plásticas. In: JUNG, C. G. (org.). O homem e os seus símbolos. Rio de Janeiro: Nova Fronteira, 2008.

A relação observada entre a imagem e o texto apresentados permite o entendimento da intenção de um artista contemporâneo. Neste caso, a obra apresenta características a. funcionais e de sofisticação decorativa. b. futuristas e do abstrato geométrico. c. construtivistas e de estruturas modulares. d. abstracionistas e de releitura do objeto. e. figurativas e de representação do cotidiano.

142. (Enem 2011) How‘s your mood? For an interesting attempt to measure cause and effect try Mappiness, a project run by the London School of Economics, which offers a phone app that prompts you to record your mood and situation. The Mappiness website says: “We’re particularly interested in how people’s happiness is affected by their local environment – air pollution, noise, green spaces, and so on – which the data from Mappiness will be absolutely great for investigating.” Will it work? With enough people, it might. But there are other problems. We’ve been using happiness and well-being interchangeably. Is that ok? The difference comes out in a sentiment like: “We were happier during the war.” But was our well-being also greater then? Disponível em: <http://www.bbc.co.uk>. Acesso em: 27 jun. 2011 (adaptado).

expoENEM 34


O projeto Mappiness, idealizado pela London School of Economics, ocupa-se do tema relacionado

brought bread and other foods unsuitable for pelicans. The birds are being fed locally-bought sprats while fishing in the Caspian is impossible.

a. ao nível de felicidade das pessoas em tempos de guerra. b. à dificuldade de medir o nível de felicidade das pessoas a partir de seu humor.

BBC

c. ao nível de felicidade das pessoas enquanto falam ao celular com seus familiares.

a. Controvérsia entre o Ministério de Proteção à Natureza e os moradores sobre a pesca no Mar Cáspio

d. à relação entre o nível de felicidade das pessoas e o ambiente no qual se encontram.

b. Hábitos alimentares dos pelicanos quando se afastam da Rússia c. Pesca predatória na Rússia para alimentar os pelicanos

e. à influência das imagens grafitadas pelas ruas no aumento do nível de felicidade das pessoas.

d. Migração dos pelicanos devido à fome produzida pelo congelamento do Mar Cáspio

143.

e. Pelicanos são alimentados pela mão humana no Mar Cáspio congelado The techno-solution

Americans love technological solutions to problems: if insects are eating the crops, cover the fields with insecticides; if there is a drought, build dams and divert the rivers… So it’s not surprising that they are now looking at technological solutions to two of the worst environmental problems in the world today: the greenhouse effect and the destruction of the ozone layer.

145. Com relação ao texto sobre os pelicanos que vivem no sul da Rússia, considere os seguintes itens: 1. A razão de 20 pelicanos terem morrido de fome. 2. A quantidade de pelicanos que, acredita-se, vivem atualmente na Rússia. 3. A espécie de comida que se comprou para alimentar os pelicanos.

Accelerate, “The techino-solution”

4. O nome do estaleiro que abrigava os pelicanos. O texto The techno-solution explora o tema relacionado

5. O tipo de atendimento veterinário que os pelicanos receberam por parte do Ministério de Proteção à Natureza.

a. às diferentes soluções tecnológicas que os americanos encontraram para acabar com o efeito estufa. b. às soluções tecnológicas que os cientistas americanos encontraram para os mais complexos problemas ambientais que o mundo enfrenta hoje: os insetos nas colheitas e a seca.

Os itens abordados no texto são a. 1, 3 e 4 apenas. b. 1, 2 e 3 apenas.

c. à destruição da camada de ozônio e suas consequências para o meio ambiente.

c. 2, 4 e 5 apenas. d. 4 e 5 apenas.

d. a dois exemplos de problemas que tiveram soluções por meio da tecnologia e às soluções tecnológicas que estão sendo estudadas para dois problemas ambientais. e. à construção de represas, com a finalidade de manter a tecnologia nas plantações e sua consequente produtividade, mesmo que isso implique em desviar o curso dos rios.

e. 1, 2, 3 e 4 apenas. 146. (Enem 2011) Es posible reducir la basura En México se producen más de 10 millones de m3 de basura mensualmente, depositados en más de 50 mil tiraderos de basura legales y clandestinos, que afectan de manera directa nuestra calidad de vida, pues nuestros recursos naturales son utilizados desproporcionalmente, como materias primas que luego desechamos y tiramos convirtiéndolos en materiales inútiles y focos de infección.

144. Leia o texto e assinale a alternativa que apresenta o título mais adequado para ele.

Todo aquello que compramos y consumimos tiene una relación directa con lo que tiramos. Consumiendo racionalmente, evitando el derroche y usando sólo lo indispensable, directamente colaboramos con el cuidado del ambiente. Si la basura se compone de varios desperdicios y si como desperdicios no fueron basura, si los separamos adecuadamente, podremos controlarlos y evitar posteriores problemas. Reciclar se traduce en importantes ahorros de energía, ahorro de agua potable, ahorro de materias primas, menor impacto en los ecosistemas y sus recursos naturales y ahorro de tiempo, dinero y esfuerzo.

Authorities in the southern Russian province of Dagestan are trying to save hundreds of rare Dalmatian pelicans trapped by unusually cold weather.

Es necesario saber para empezar a actuar...

The birds migrated to the area near the city of Makhachkala last week. About 20 birds have already died of hunger after the Caspian Sea froze over, local government spokesman Arslan Dydymov told the Associated Press. Around 1,400 Dalmatian pelicans, the world’s largest variety of pelican, are thought to live in southern Russia. Mr Dydymov said hundreds of kilograms of fish had been bought every day by Dagestan’s Nature Protection Ministry for the pelicans. Local residents have been volunteering to help authorities in their efforts to feed the birds. But the authorities at the shipyard where the birds have been trapped at first refused the public entry. “We did not let them in for the sake of the pelicans,’’ chief guard Magomed Eldarov told AP, citing concerns that some residents had

Disponível em: <http://www.tododecarton.com>. Acesso em: 27 abr. 2010 (adaptado).

expoENEM 35

A partir do que se afirma no último parágrafo: “Es necesario saber para empezar a actuar...”, pode-se constatar que o texto foi escrito com a intenção de a. informar o leitor a respeito da importância da reciclagem para a conservação do meio ambiente. b. indicar os cuidados que se deve ter para não consumir alimentos que podem ser focos de infecção. c. denunciar o quanto o consumismo é nocivo, pois é o gerador dos dejetos produzidos no México.


d. ensinar como economizar tempo, dinheiro e esforço a partir dos 50 mil depósitos de lixo legalizados.

d. relatar os tipos de alimentos que existem nos supermercados de La Rioja, tanto os frescos como os enlatados, além dos embutidos que se servem como aperitivo.

e. alertar a população mexicana para os perigos causados pelos consumidores de matéria-prima reciclável.

e. incentivar a comercialização de alimentos diretamente do produtor, contando com o apoio do Ministério da Agricultura e Desenvolvimento Rural.

147. (Enem 2011) BIENVENIDO A BRASILIA

El Gobierno de Brasil, por medio del Ministerio de la Cultura y del Instituto del Patrimonio Histórico y Artístico Nacional (IPHAN), da la bienvenida a los participantes de la 34ª Sesión del Comité del Patrimonio Mundial, encuentro realizado por la Organización de las Naciones Unidas para la Educación, la Ciencia y la Cultura (UNESCO). Respaldado por la Convención del Patrimonio Mundial, de 1972, el Comité reúne en su 34ª sesión más de 180 delegaciones nacionales para deliberar sobre las nuevas candidaturas y el estado de conservación y de riesgo de los bienes ya declarados Patrimonio Mundial, con base en los análisis del Consejo Internacional de Monumentos y Sitios (Icomos), del Centro Internacional para el estudio de la Preservación y la Restauración del Patrimonio Cultural (ICCROM) y de la Unión Internacional para la Conservación de la Naturaleza (IUCN).

149. Na linha 8, a expressão “pasará a dejar de ser tal” quer dizer que o tipo de alimentação proposto no texto a. não mais será exercício de imaginação. b. acolherá propostas novas. c. deixará de ser objeto de desenvolvimento. d. terá 3 anos de prazo para se concretizar. e. não mais será questionado como proposta. 150. Ao considerar o provérbio “La palabra y la piedra suelta no tienen vuelta”, pode-se afirmar que esse provérbio nos ensina sobre a. a necessidade de se ter prudência ao falar. A palavra coloca-se como um objeto tão contundente quanto a pedra, significando assim o perigo de não calar-se em determinadas ocasiões. b. o saber popular que insiste em relacionar a palavra à pedra solta, posto que quando a primeira é dita ou a segunda é levada pelo vento não mais voltam, não mais podem ser lembradas.

Disponível em: http://www.34whc.brasilia2010.org.br. Acesso em: 28 jul. 2010.

c. a importância que tem a palavra para aqueles que a usam de maneira adequada e correta, bem como a necessidade de se preservar a natureza, representada aqui pela pedra.

O Comitê do Patrimônio Mundial reúne-se regularmente para deliberar sobre ações que visem à conservação e à preservação do patrimônio mundial. Entre as tarefas atribuídas às delegações nacionais que participaram da 34ª Sessão do Comitê do Patrimônio Mundial, destaca-se a

d. o dinamismo que existe na linguagem humana, comparado à atividade que existe em uma pedra solta. A língua muda, é algo vivo, e a pedra também pode mudar sua forma ao longo do tempo.

a. participação em reuniões do Conselho Internacional de Monumentos e Sítios.

e. o direito que têm as pessoas de voltar atrás quando falam. As palavras diferem das pedras, que quando soltas seguem seu caminho sem voltar atrás. No entanto, as palavras podem ser retificadas.

b. realização da cerimônia de recepção da Convenção do Patrimônio Mundial. c. organização das análises feitas pelo Ministério da Cultura brasileiro. d. discussão sobre o estado de conservação dos bens já declarados patrimônios mundiais.

(Enem 2008) Texto para as questões 151 e 152. A EMA

e. estruturação da próxima reunião do Comitê do Patrimônio Mundial.

Texto para responder às questões 148 e 149. I+D+ IMAGINACIÓN AGROALIMENTARIA EN LA RIOJA 1 2 3 4 5 6 7 8 9

10 11 12

¿Se imagina a la venta en el supermercado de su barrio embutidos riojanos en formato aperitivo, pelados, sin grasas, más saludables e incluso con ingredientes innovadores con efectos antimicrobianos e incorporación de fibra alimentaria y vegetales? ¿Y envases de coliflor en fresco comercializadas en mitades, perfectamente conservadas y de mayor duración? ¿O variedades exóticas orientales de setas y champiñón producidos en La Rioja? Pues este ejercicio de imaginación pasará a dejar de ser tal en el plazo de tres años, ya que estas novedosas propuestas serán objeto de desarrollo por parte de los Centros Tecnológicos Agroalimentarios de nuestra región, gracias a un proyecto emprendido por la Consejería de Agricultura, Ganadería y Desarrollo Rural, en el que invertirá más de 1 millón de euros.

O surgimento da figura da Ema no céu, ao leste, no anoitecer, na segunda quinzena de junho, indica o início do inverno para os índios do Sul do Brasil e o começo da estação seca para os do Norte. É limitada pelas constelações de Escorpião e do Cruzeiro do Sul, ou Cut’uxu. Segundo o mito guarani, o Cut’uxu segura a cabeça da ave para garantir a vida na Terra, porque, se ela se soltar, beberá toda a água do nosso planeta. Os tupis guaranis utilizam o Cut’uxu para se orientar e determinar a duração das noites e as estações do ano. A ilustração a seguir é uma representação dos corpos celestes que constituem a constelação da Ema, na percepção indígena.

Comunidad La Rioja, diciembre/enero 2010.

148. O parágrafo apresentado tem como finalidade principal a. informar o leitor sobre os diferentes produtos alimentares mais saudáveis e com ingredientes inovadores que estarão disponíveis em 3 anos. b. fazer perguntas para saber se o leitor tem interesse em importar produtos mais saudáveis produzidos em La Rioja. c. imaginar como seria a culinária espanhola com 1 milhão de euros de investimentos governamentais. expoENEM 36

Almanaque BRASIL, maio/2007 (com adaptações).


c. a mobilização de máquinas e de força humana torna o desmatamento mais caro que o aumento da produtividade de pastagens.

A próxima figura mostra, em campo de visão ampliado, como povos de culturas não indígenas percebem o espaço estelar em que a Ema é vista.

d. o superavit comercial decorrente da exportação de carne produzida na Amazônia compensa a possível degradação ambiental. e. a recuperação de áreas desmatadas e o aumento de produtividade das pastagens podem contribuir para a redução do desmatamento na Amazônia. 154. (Enem 2008)

<geocities.yahoo.com.br> (com adaptações).

151. Considerando a diversidade cultural focalizada no texto e nas figuras acima, avalie as seguintes afirmativas. I. A mitologia guarani relaciona a presença da Ema no firmamento às mudanças das estações do ano. II. Em culturas indígenas e não indígenas, o Cruzeiro do Sul, ou Cut’uxu, funciona como parâmetro de orientação espacial. III. Na mitologia guarani, o Cut’uxu tem a importante função de segurar a Ema para que seja preservada a água da Terra. IV. As três Marias, estrelas da constelação de Órion, compõem a figura da Ema.

Dick Browne. O melhor de Hagar, o horrível, v. 2. L&PM pocket, p.55-6 (com adaptações).

Assinale o trecho do diálogo que apresenta um registro informal, ou coloquial, da linguagem.

É correto apenas o que se afirma em

a. “Tá legal, espertinho! Onde é que você esteve?!”

a. I.

b. “E lembre-se: se você disser uma mentira, os seus chifres cairão!”

b. II e III.

c. “Estou atrasado porque ajudei uma velhinha a atravessar a rua...”

c. III e IV.

d. “... e ela me deu um anel mágico que me levou a um tesouro,”

d. I, II e III.

e. “mas bandidos o roubaram e os persegui até a Etiópia, onde um dragão...”

e. I, II e IV. 152. Assinale a opção correta a respeito da linguagem empregada no texto A Ema.

155. (Enem 2007) Há cerca de dez anos, estimava-se que 11,2% da população brasileira poderiam ser considerados dependentes de álcool. Esse índice, dividido por gênero, apontava que 17,1% da população masculina e 5,7% da população feminina eram consumidores da bebida. Quando analisada a distribuição etária desse consumo, outro choque: a pesquisa evidenciou que 41,2% de estudantes da educação básica da rede pública brasileira já haviam feito uso de álcool.

a. A palavra Cut’uxu é um regionalismo utilizado pelas populações próximas às aldeias indígenas. b. O autor se expressa em linguagem formal em todos os períodos do texto. c. A ausência da palavra Ema no início do período “É limitada (...)” caracteriza registro oral.

Dados atuais apontam que a porcentagem de dependentes de álcool subiu para 15%. Estima-se que o país gaste 7,3% do PIB por ano para tratar de problemas relacionados ao alcoolismo, desde o tratamento de pacientes até a perda da produtividade no trabalho. A indústria do álcool no Brasil, que produz do açúcar ao álcool combustível, movimenta 3,5% do PIB.

d. A palavra Cut’uxu está destacada em itálico porque integra o vocabulário da linguagem informal. e. No texto, predomina a linguagem coloquial porque ele consta de um almanaque. 153. (Enem 2008) Calcula-se que 78% do desmatamento na Amazônia tenha sido motivado pela pecuária — cerca de 35% do rebanho nacional está na região — e que pelo menos 50 milhões de hectares de pastos são pouco produtivos. Enquanto o custo médio para aumentar a produtividade de 1 hectare de pastagem é de 2 mil reais, o custo para derrubar igual área de floresta é estimado em 800 reais, o que estimula novos desmatamentos. Adicionalmente, madeireiras retiram as árvores de valor comercial que foram abatidas para a criação de pastagens. Os pecuaristas sabem que problemas ambientais como esses podem provocar restrições à pecuária nessas áreas, a exemplo do que ocorreu em 2006 com o plantio da soja, o qual, posteriormente, foi proibido em áreas de floresta.

Revista Brasileira de Psiquiatria, v. 28, n.º 4,dez./2006 e Internet: <www.alcoolismo. com.br> (com adaptações).

a. o país, para tratar pessoas com problemas provocados pelo alcoolismo, gasta o dobro do que movimenta para produzir bebida alcoólica. b. o aumento do número de brasileiros dependentes de álcool acarreta decréscimo no percentual do PIB gasto no tratamento dessas pessoas.

A partir da situação-problema descrita, conclui-se que

c. o elevado percentual de estudantes que já consumiram bebida alcoólica é indicativo de que o consumo do álcool é problema que deve ser enfrentado pela sociedade.

a. o desmatamento na Amazônia decorre principalmente da exploração ilegal de árvores de valor comercial.

d. as mulheres representam metade da população brasileira dependente de álcool.

b. um dos problemas que os pecuaristas vêm enfrentando na Amazônia é a proibição do plantio de soja.

e. o aumento na porcentagem de brasileiros dependentes de álcool deveu-se, basicamente, ao crescimento da indústria do álcool.

Época, 3/3/2008 e 9/6/2008 (com adaptações).

A partir dos dados acima, conclui-se que

expoENEM 37


156. (Enem 2009) Analise as seguintes avaliações de possíveis resultados de um teste na internet. RESULTADO

AVALIAÇÃO

Total de respostas a

Mais respostas a

Tola de resposta b Total de respostas c Caso tenha dado empate entre duas letras, responda à seguinte pergunta: Quando alguém, na vida real, pede os seus contatos, você: a) Dá o número do telefone e o endereço de e-mail b) Dá a URL* da sua rede social c) O que é URL*? * Endereço de uma página da rede de computadores

158. (Enem 2006)

O PRAGMÁTICO – Você consegue usar as redes sociais on-line como um complemento às amizades e à vida profissional sem que isso afete sua intimidade Mais respostas b

As linhas nas duas figuras geram um efeito que se associa ao seguinte ditado popular:

O FANÁTICO – Sua presença na internet está predomionando sobre sua vida real. Procure sair mais de casa e encontrar seus amigos pessoalmente

a. Os últimos serão os primeiros.

Mais respostas c

c. Quem espera sempre alcança.

O APRENDIZ – Você é um novato nos sites de relacionamentos ou ainda não descobriu como usá-los inteiramente

d. As aparências enganam.

b. Os opostos se atraem.

e. Quanto maior a altura, maior o tombo. 159. (Enem 2005) Leia com atenção o texto:

Fonte: Rita Khater, psicóloga e professora da PUC-Campinas Veja. 8 jul. 2009. p.102 (adaptado).

Depreende-se, a partir desse conjunto de informações, que o teste que deu origem a esses resultados, além de estabelecer um perfil para o usuário de sites de relacionamento, apresenta preocupação com hábitos e propõe mudanças de comportamento direcionadas

[Em Portugal], você poderá ter alguns probleminhas se entrar numa loja de roupas desconhecendo certas sutilezas da língua. Por exemplo, não adianta pedir para ver os ternos – peça para ver os fatos. Paletó é casaco. Meias são peúgas. Suéter é camisola – mas não se assuste, porque calcinhas femininas são cuecas. (Não é uma delícia?) (Ruy Castro. Viaje Bem. Ano VIII, no 3, 78.)

a. ao adolescente que acessa sites de entretenimento.

O texto destaca a diferença entre o português do Brasil e de Portugal quanto

b. ao profissional interessado em aperfeiçoamento tecnológico. c. à pessoa que usa os sites de relacionamento para complementar seu círculo de amizades.

a. ao vocabulário.

d. ao usuário que reserva mais tempo aos sites de relacionamento do que ao convívio pessoal com os amigos.

c. à pronúncia.

b. à derivação. d. ao gênero.

e. ao leitor que se interessa em aprender sobre o funcionamento de diversos tipos de sites de relacionamento. 157. (Enem 2009)

e. à sintaxe. 160. (Enem 2004)

Gerente – Boa tarde. Em que eu posso ajudá-lo? Cliente – Estou interessado em financiamento para compra de veículo.

FRANK & ERNEST / Bob Thaves

Gerente – Nós dispomos de várias modalidades de crédito. O senhor é nosso cliente? Cliente – Sou Júlio César Fontoura, também sou funcionário do banco. Gerente – Julinho, é você, cara? Aqui é a Helena! Cê tá em Brasília? Pensei que você inda tivesse na agência de Uberlândia! Passa aqui pra gente conversar com calma.

Nesta tirinha, a personagem faz referência a uma das mais conhecidas figuras de linguagem para

BORTONI-RICARDO, S. M. Educação em língua materna. São Paulo: Parábola, 2004 (adaptado).

a. condenar a prática de exercícios físicos. b. valorizar aspectos da vida moderna.

Na representação escrita da conversa telefônica entre a gerente do banco e o cliente, observa-se que a maneira de falar da gerente foi alterada, de repente, devido

c. desestimular o uso das bicicletas. d. caracterizar o diálogo entre gerações. e. criticar a falta de perspectiva do pai.

a. à adequação de sua fala à conversa com um amigo, caracterizada pela informalidade. b. à iniciativa do cliente em se apresentar como funcionário do banco. c. ao fato de ambos terem nascido em Uberlândia (Minas Gerais). d. à intimidade forçada pelo cliente ao fornecer seu nome completo.

161. (Enem 2011) Na modernidade, o corpo foi descoberto, despido e modelado pelos exercícios físicos da moda. Novos espaços e práticas esportivas e de ginástica passaram a convocar as pessoas a modelarem seus corpos. Multiplicaram-se as academias de ginástica, as salas de musculação e o número de pessoas correndo pelas ruas.

e. ao seu interesse profissional em financiar o veículo de Júlio.

SECRETARIA DA EDUCAÇÃO. Caderno do professor: educação física. São Paulo, 2008.

expoENEM 38


Diante do exposto, é possível perceber que houve um aumento da procura por

Comparando-se esses dois textos, verifica-se que, na segunda versão, houve mudanças relativas a

a. exercícios físicos aquáticos (natação/hidroginástica), que são exercícios de baixo impacto, evitando o atrito (não prejudicando as articulações), e que previnem o envelhecimento precoce e melhoram a qualidade de vida.

a. vocabulário.

b. mecanismos que permitem combinar alimentação e exercício físico, que permitem a aquisição e manutenção de níveis adequados de saúde, sem a preocupação com padrões de beleza instituídos socialmente.

d. fonética.

c. programas saudáveis de emagrecimento, que evitam os prejuízos causados na regulação metabólica, função imunológica, integridade óssea e manutenção da capacidade funcional ao longo do envelhecimento.

b. construções sintáticas. c. pontuação. e. regência verbal.

(Enem 2005) As questões 164 e 165 referem-se ao poema. A DANÇA E A ALMA A DANÇA? Não é movimento, súbito gesto musical. É concentração, num momento, da humana graça natural.

d. exercícios de relaxamento, reeducação postural e alongamentos, que permitem um melhor funcionamento do organismo como um todo, bem como uma dieta alimentar e hábitos saudáveis com base em produtos naturais. e. dietas que preconizam a ingestão excessiva ou restrita de um ou mais macronutrientes (carboidratos, gorduras ou proteínas), bem como exercícios que permitem um aumento de massa muscular e/ou modelar o corpo.

No solo não, no éter pairamos, nele amaríamos ficar. A dança – não vento nos ramos: seiva, força, perene estar.

162. (Enem 2007)

Um estar entre céu e chão, novo domínio conquistado, onde busque nossa paixão libertar-se por todo lado...

Se a exploração descontrolada e predatória verificada atualmente continuar por mais alguns anos, pode-se antecipar a extinção do mogno. Essa madeira já desapareceu de extensas áreas do Pará, de Mato Grosso, de Rondônia, e há indícios de que a diversidade e o número de indivíduos existentes podem não ser suficientes para garantir a sobrevivência da espécie a longo prazo. A diversidade é um elemento fundamental na sobrevivência de qualquer ser vivo. Sem ela, perde-se a capacidade de adaptação ao ambiente, que muda tanto por interferência humana como por causas naturais.

Onde a alma possa descrever suas mais divinas parábolas sem fugir à forma do ser, por sobre o mistério das fábulas. Carlos Drummond de Andrade. Obra completa. Rio de Janeiro: Aguilar, 1964. p. 366.

Internet: <www.greenpeace.org.br> (com adaptações).

Com relação ao problema descrito no texto, é correto afirmar que a. a baixa adaptação do mogno ao ambiente amazônico é causa da extinção dessa madeira.

164. A definição de dança, em linguagem de dicionário, que mais se aproxima do que está expresso no poema é

b. a extração predatória do mogno pode reduzir o número de indivíduos dessa espécie e prejudicar sua diversidade genética.

a. a mais antiga das artes, servindo como elemento de comunicação e afirmação do homem em todos os momentos de sua existência.

c. as causas naturais decorrentes das mudanças climáticas globais contribuem mais para a extinção do mogno que a interferência humana.

b. a forma de expressão corporal que ultrapassa os limites físicos, possibilitando ao homem a liberação de seu espírito. c. a manifestação do ser humano, formada por uma sequência de gestos, passos e movimentos desconcertados.

d. a redução do número de árvores de mogno ocorre na mesma medida em que aumenta a diversidade biológica dessa madeira na região amazônica.

d. o conjunto organizado de movimentos do corpo, com ritmo determinado por instrumentos musicais, ruídos, cantos, emoções etc.

e. o desinteresse do mercado madeireiro internacional pelo mogno contribuiu para a redução da exploração predatória dessa espécie.

e. o movimento diretamente ligado ao psiquismo do indivíduo e, por consequência, ao seu desenvolvimento intelectual e à sua cultura.

163. (Enem 2007) ANTIGAMENTE Acontecia o indivíduo apanhar constipação; ficando perrengue, mandava o próprio chamar o doutor e, depois, ir à botica para aviar a receita, de cápsulas ou pílulas fedorentas. Doença nefasta era a phtísica, feia era o gálico. Antigamente, os sobrados tinham assombrações, os meninos, lombrigas (...)

165. O poema “A Dança e a Alma” é construído com base em contrastes, como “movimento” e “concentração”. Em uma das estrofes, o termo que estabelece contraste com solo é: a. éter. b. seiva. c. chão.

Carlos Drummond de Andrade. Poesia completa e prosa. Rio de Janeiro: José Aguilar.

d. paixão. e. ser.

O texto acima está escrito em linguagem de uma época passada. Observe uma versão em linguagem atual.

ANTIGAMENTE Acontecia o indivíduo apanhar um resfriado; ficando mal, mandava o próprio chamar o doutor e, depois, ir à farmácia para aviar a receita, de cápsulas ou pílulas fedorentas. Doença nefasta era a tuberculose, feia era a sífilis. Antigamente, os sobrados tinham assombrações, os meninos, vermes (...)

expoENEM 39

(Enem 2006) O poema a seguir se refere às questões 166 e 167. AULA DE PORTUGUÊS 1

A linguagem na ponta da língua tão fácil de falar


4

e de entender.

c. condena os hábitos descritos, dando voz a Tia Policena, que tenta impedir Nhô Tomé de deitar-se após as refeições.

7

A linguagem na superfície estrelada de letras, sabe lá o que quer dizer?

d. utiliza a diversidade sociocultural e linguística para demonstrar seu desrespeito às populações das zonas rurais do início do século XX.

10

Professor Carlos Góis, ele é quem sabe, e vai desmatando o amazonas de minha ignorância. Figuras de gramática, esquipáticas, atropelam-me, aturdem-me, sequestram-me.

13 16

Já esqueci a língua em que comia, em que pedia para ir lá fora, em que levava e dava pontapé, a língua, breve língua entrecortada do namoro com a priminha.

O português são dois; o outro, mistério.

e. manifesta preconceito em relação a Tia Policena ao transcrever a fala dela com os erros próprios da região. 169. (Enem 2010)

Carlos Drummond de Andrade. Esquecer para lembrar. Rio de Janeiro: José Olympio, 1979.

166. Explorando a função emotiva da linguagem, o poeta expressa o contraste entre marcas de variação de usos da linguagem em a. situações formais e informais. b. diferentes regiões do país. c. escolas literárias distintas. d. textos técnicos e poéticos.

BESSINHA. Disponível em: http://pattindica.files.wordpress. com/2009/06/bessinha458904-jpg-image_1245119001858.jpeg (adaptado).

e. diferentes épocas. 167. No poema, a referência à variedade padrão da língua está expressa no seguinte trecho:

b. “A linguagem / na superfície estrelada de letras” (v. 5 e 6).

As diferentes esferas sociais de uso da língua obrigam o falante a adaptá-la às variadas situações de comunicação. Uma das marcas linguísticas que configuram a linguagem ora informada usada entre o avô e neto neste texto é

c. “[a língua] em que pedia para ir lá fora” (v. 14).

a. a opção pelo emprego da forma verbal “era” em lugar de “foi”.

d. “[a língua] em que levava e dava pontapé” (v. 15).

b. a ausência de artigo antes da palavra “árvore”.

e. “[a língua] do namoro com a priminha” (v. 17).

c. o emprego da redução “tá” em lugar da forma verbal “está”.

a. “A linguagem / na ponta da língua” (v. 1 e 2).

d. o uso da contração “desse” em lugar da expressão “de esse”. 168. (Enem 2006)

e. a utilização do pronome “que” em início de frase exclamativa.

Depois de um bom jantar: feijão com carne-seca, orelha de porco e couve com angu, arroz-mole engordurado, carne de vento assada no espeto, torresmo enxuto de toicinho da barriga, viradinho de milho verde e um prato de caldo de couve, jantar encerrado por um prato fundo de canjica com torrões de açúcar, Nhô Tomé saboreou o café forte e se estendeu na rede. A mão direita sob a cabeça, a guisa de travesseiro, o indefectível cigarro de palha entre as pontas do indicador e do polegar, envernizados pela fumaça, de unhas encanoadas e longas, ficou-se de pança para o ar, modorrento, a olhar para as ripas do telhado. Quem come e não deita, a comida não aproveita, pensava Nhô Tomé... E pôs-se a cochilar. A sua modorra durou pouco; Tia Policena, ao passar pela sala, bradou assombrada:

170. (Enem 2010) A biosfera, que reúne todos os ambientes onde se desenvolvem os seres vivos, se divide em unidades menores chamadas ecossistemas, que podem ser uma floresta, um deserto e até um lago. Um ecossistema tem múltiplos mecanismos que regulam o número de organismos dentro dele, controlando sua reprodução, crescimento e migrações. DUARTE, M. O guia dos curiosos. São Paulo: Companhia das Letras, 1995.

— Êêh! Sinhô! Vai drumi agora? Não! Num presta... Dá pisadêra e pode morre de ataque de cabeça! Despois do armoço num far-má... mais despois da janta?!”

Cornélio Pires. Conversas ao pé do fogo. São Paulo: Imprensa Oficial do Estado de São Paulo, 1987.

Nesse trecho, extraído de texto publicado originalmente em 1921, o narrador a. apresenta, sem explicitar juízos de valor, costumes da época, descrevendo os pratos servidos no jantar e a atitude de Nhô Tomé e de Tia Policena. b. desvaloriza a norma culta da língua porque incorpora à narrativa usos próprios da linguagem regional das personagens. expoENEM 40

Predomina no texto a função da linguagem a. emotiva, porque o autor expressa seu sentimento em relação à ecologia. b. fática, porque o texto testa o funcionamento do canal de comunicação. c. poética, porque o texto chama a atenção para os recursos de linguagem. d. conativa, porque o texto procura orientar comportamentos do leitor. e. referencial, porque o texto trata de noções e informações conceituais.


171. (Enem 2010)

Estava com o tempo sobrando, e curiosidade é algo que não me falta, então resolvi voltar ao teste e responder tudo diferente do que havia respondido antes. Marquei umas alternativas esdrúxulas, que nada tinham a ver com minha personalidade. E fui conferir o resultado, que dizia o seguinte: “Os acontecimentos da sua infância a marcaram até os 12 anos, depois disso você buscou conhecimento intelectual para seu amadurecimento”.

CÂNCER 21/06 A 21/07 O eclipse em seu signo vai desencadear mudanças na sua autoestima e no seu modo de agir. O corpo indicará onde você falha – se anda engolindo sapos, a área gástrica se ressentirá. O que ficou guardado virá à tona para ser transformado, pois este novo ciclo exige uma “desintoxicação”. Seja comedida em suas ações, já que precisará de energia para se recompor. Há preocupação com a família, e a comunicação entre os irmãos trava. Lembre-se: palavra preciosa é palavra dita na hora certa. Isso ajuda também na vida amorosa, que será testada. Melhor conter as expectativas e ter calma, avaliando as próprias carências de modo maduro. Sentirá vontade de olhar além das coisas materiais – sua confiança virá da intimidade com os assuntos da alma.

MEDEIROS, M. Doidas e Santas. Porto Alegre. 2008 (adaptado).

Quanto às influências que a internet pode exercer sobre os usuários, a autora expressa uma reação irônica no trecho: a. “Marquei umas alternativas esdrúxulas, que nada tinham a ver”. b. “Os acontecimentos da sua infância a marcaram até os doze anos”.

Revista Cláudia. N.º 7, ano 48, jul. 2009.

O reconhecimento dos diferentes gêneros textuais, seu contexto de uso, sua função social específica, seu objetivo comunicativo e seu formato mais comum relacionam-se aos conhecimentos construídos socioculturalmente. A análise dos elementos constitutivos desse texto demonstra que sua função é a. vender um produto anunciado.

c. “Dia desses resolvi fazer um teste proposto por um site da internet”. d. “Respondi a todas as perguntas e o resultado foi o seguinte”. e. “Fiquei radiante: eu havia realizado uma consulta paranormal com o pai da psicanálise”. 174. (Enem 2010)

b. informar sobre astronomia. O CHAT E SUA LINGUAGEM VIRTUAL

c. ensinar os cuidados com a saúde.

O significado da palavra chat vem do inglês e quer dizer “conversa”. Essa conversa acontece em tempo real, e, para isso, é necessário que duas ou mais pessoas estejam conectadas ao mesmo tempo, o que chamamos de comunicação síncrona. São muitos os sites que oferecem a opção de bate-papo na internet, basta escolher a sala que deseja “entrar”, identificar e iniciar a conversa. Geralmente, as salas são divididas por assuntos, como educação, cinema, esporte, música, sexo, entre outros. Para entrar, é necessário escolher um nick, uma espécie de apelido que identificará o participante durante a conversa. Algumas salas restringem a idade, mas não existe nenhum controle para verificar se a idade informada é realmente a idade de quem está acessando, facilitando que crianças e adolescentes acessem salas com conteúdos inadequados para sua faixa etária.

d. expor a opinião de leitores em um jornal. e. aconselhar sobre amor, família, saúde, trabalho. 172. (Enem 2010) S.O.S PORTUGUÊS Por que pronunciamos muitas palavras de um jeito diferente da escrita? Pode-se refletir sobre esse aspecto da língua com base em duas perspectivas. Na primeira delas, fala e escrita são dicotômicas, o que restringe o ensino da língua ao código. Daí vem o entendimento de que a escrita é mais complexa que a fala, e seu ensino restringe-se ao conhecimento das regras gramaticais, sem a preocupação com situações de uso. Outra abordagem permite encarar as diferenças como um produto distinto de duas modalidades da língua: a oral e a escrita. A questão é que nem sempre nos damos conta disso. S.O.S Português. Nova Escola. São Paulo: Abril, Ano XXV, nº 231, abr. 2010 (fragmento adaptado).

AMARAL, S.F., Internet: novos valores e novos comportamentos. In: SILVA, E.T. (Coord.) A leitura nos oceanos da internet. São Paulo: Cortez, 2003. (adaptado).

Segundo o texto, o chat proporciona a ocorrência de diálogos instantâneos com linguagem específica, uma vez que nesses ambientes interativos faz-se uso de protocolos diferenciados de interação. O chat, nessa perspectiva, cria uma nova forma de comunicação porque

O assunto tratado no fragmento é relativo à língua portuguesa e foi publicado em uma revista destinada a professores. Entre as características próprias desse tipo de texto, identificam-se as marcas linguísticas próprias do uso

a. possibilita que ocorra diálogo sem a exposição da identidade real dos indivíduos, que podem recorrer a apelidos fictícios sem comprometer o fluxo da comunicação em tempo real. b. disponibiliza salas de bate-papo sobre diferentes assuntos com pessoas pré-selecionadas por meio de um sistema de busca monitorado e atualizado por autoridades no assunto.

a. regional, pela presença de léxico de determinada região do Brasil. b. literário, pela conformidade com as normas as gramática.

c. seleciona previamente conteúdos adequados à faixa etária dos usuários que serão distribuídos nas faixas de idade organizadas pelo site que disponibiliza a ferramenta.

c. técnico, por meio de expressões próprias de textos científicos. d. coloquial, por meio do registro da informalidade. e. oral, por meio do uso de expressões típicas de oralidade.

d. garante a gravação das conversas, o que possibilita que um diálogo permaneça aberto, independente da disposição de cada participante.

173. (Enem 2010)

e. limita a quantidade de participantes conectados nas salas de bate-papo, a fim de garantir a qualidade e eficiência dos diálogos, evitando mal-entendidos.

TESTES Dia desses resolvi fazer um teste proposto por um site da internet. O nome do teste era tentador: “O que Freud diria de você”. Uau. Respondi a todas as perguntas e o resultado foi o seguinte: “Os acontecimentos da sua infância a marcaram até os doze anos, depois disso você buscou conhecimento intelectual para seu amadurecimento”. Perfeito! Foi exatamente o que aconteceu comigo. Fiquei radiante: eu havia realizado uma consulta paranormal com o pai da psicanálise, e ele acertou na mosca.

175. (Enem 2010) Venho solicitar a clarividente atenção de Vossa Excelência para que seja conjurada uma calamidade que está prestes a desabar em cima da juventude feminina do Brasil. Refiro-me, senhor presidente, ao movimento entusiasta que está empolgando centenas de moças,

expoENEM 41


atraindo-as para se transformarem em jogadoras de futebol, sem se levar em conta que a mulher não poderá praticar este esporte violento sem afetar, seriamente, o equilíbrio fisiológico das suas funções orgânicas, devido à natureza que a dispôs a ser mãe. Ao que dizem os jornais, no Rio de Janeiro, já estão formados nada menos de dez quadros femininos. Em São Paulo e Belo Horizonte também já estão constituindo outros. E, neste crescendo, dentro de um ano, é provável que em todo o Brasil estejam organizados uns 200 clubes femininos de futebol: ou seja: 200 núcleos destroçados da saúde de 2,2 mil futuras mães, que, além do mais, ficarão presas a uma mentalidade depressiva e propensa aos exibicionismos rudes e extravagantes.

c. o registro do pensamento e das crenças das sociedades em várias épocas. d. a repetição dos temas e a restrição do uso pelas classes dominantes. e. o uso exclusivista da arte para atender aos interesses da elite. 177. (Enem 2011) Quando os portugueses se instalaram no Brasil, o país era povoado de índios. Importaram, depois da África, grande número de escravos. O Português, o Índio e o Negro constituem, durante o período colonial, as três bases da população brasileira. Mas no que se refere à cultura, a contribuição do Português foi de longe a mais bem notada. Durante muito tempo o português e o tupi viveram lado a lado como línguas de comunicação. Era o Tupi que utilizavam os bandeirantes nas suas expedições. Em 1694, dizia o Padre Antônio Vieira que “as famílias dos portugueses e dos índios em São Paulo estão tão ligadas hoje umas com as outras, que as mulheres e os filhos se criam mística e domesticamente, e a língua que nas ditas famílias se fala é a dos Índios, e a portuguesa a vão os meninos aprender à escola”.

Coluna Pênalti. Carta Capital, 28 abr. 2010.

O trecho é parte de uma carta de um cidadão brasileiro, José Fuzeira, encaminhada, em abril de 1940, ao então presidente da República Getúlio Vargas. As opções linguísticas de mostram que seu texto foi elaborado em linguagem a. regional, adequada à troca de informações na situação apresentada. b. jurídica, exigida pelo tema relacionado ao domínio do futebol. c. coloquial, considerando-se que ele era um cidadão brasileiro comum. d. culta, adequando-se ao seu interlocutor e à situação de comunicação.

TEYSSIER, P. História da língua portuguesa. Lisboa: Livraria Sá da Costa, 194 (adaptado).

A identidade de uma nação está diretamente ligada à cultura de seu povo. O texto mostra que, no período colonial brasileiro, o português, o índio e o negro formaram a base da população e que o patrimônio linguístico brasileiro é resultado da

e. informal, pressupondo o grau de escolaridade de seu interlocutor.

a. contribuição dos índios na escolarização dos brasileiros. 176. (Enem 2011)

b. diferença entre as línguas dos colonizadores e as dos indígenas. TEXTO I

c. importância do Padre Antônio Vieira para a literatura de língua portuguesa. d. origem das diferenças entre a língua portuguesa e as línguas tupi. e. interação pacífica no uso da língua portuguesa e da língua tupi. 178. (Enem 2005) Leia os textos abaixo. I.  A situação de um trabalhador Paulo Henrique de Jesus está há quatro meses desempregado. Com o Ensino Médio completo, ou seja, 11 anos de estudo, ele perdeu a vaga que preenchia há oito anos de encarregado numa transportadora de valores, ganhando R$ 800,00. Desde então, e com 50 currículos já distribuídos, só encontra oferta para ganhar R$ 300,00, um salário mínimo. Ele aceitou trabalhar por esse valor, sem carteira assinada, como garçom numa casa de festas para fazer frente às despesas.

Toca do Salitre – Piauí Disponível em http://www.fumdham.org.br. Acesso em 27 jul. 2010.

TEXTO II

(O Globo, 20/07/2005.)

II.  Uma interpretação sobre o acesso ao mercado de trabalho Atualmente, a baixa qualificação da mão de obra é um dos responsáveis pelo desemprego no Brasil.

Arte Urbana. Foto: Diego Singh Disponível em http://www.diaadia.pr.gov.br. Acesso em 27 jul. 2010.

O grafite contemporâneo, considerado em alguns momentos como uma arte marginal, tem sido comparado às pinturas murais de várias épocas e às escritas pré-históricas. Observando as imagens apresentadas, é possível reconhecer elementos comuns entre os tipos de pinturas murais, tais como a. a preferência por tintas naturais, em razão de seu efeito estético. b. a inovação na técnica de pintura, rompendo com modelos estabelecidos. expoENEM 42

A relação que se estabelece entre a situação (I) e a interpretação (II) e a razão para essa relação aparece em: a. II explica I – Nos níveis de escolaridade mais baixos há dificuldade de acesso ao mercado de trabalho. b. I reforça II – Os avanços tecnológicos da Terceira Revolução Industrial garantem somente o acesso ao trabalho para aqueles de formação em nível superior. c. I desmente II – O mundo globalizado promoveu desemprego especialmente para pessoas entre 10 e 15 anos de estudo. d. II justifica I – O desemprego estrutural leva à exclusão de trabalhadores com escolaridade de nível médio incompleto. e. II complementa I – O longo período de baixo crescimento econômico acirrou a competição, e pessoas de maior escolaridade passam a aceitar funções que não correspondem a sua formação.


179. (Enem 2005) As dimensões continentais do Brasil são objeto de reflexões expressas em diferentes linguagens. Esse tema aparece no seguinte poema:

d. uma coisa menos importante para a vida que o dinheiro. e. algo que é muito útil na religião, para fazer parte dos cultos e das celebrações no cotidiano das denominações religiosas.

“(....) Que importa que uns falem mole descansado Que os cariocas arranhem os erres na garganta Que os capixabas e paroaras escancarem as vogais? Que tem se o quinhentos réis meridional Vira cinco tostões do Rio pro Norte? Junto formamos este assombro de misérias e grandezas, Brasil, nome de vegetal! (....)” (Mário de Andrade. Poesias completas. 6. ed. São Paulo: Martins Editora, 1980.)

c. uma necessidade que temos para viver plenamente nossa vida: além de comer, beber e ter dinheiro, precisamos de arte.

O texto poético ora reproduzido trata das diferenças brasileiras no âmbito

181. No decorrer da história, a arte sempre exerceu grande influência sobre a mente humana, fazendo parte do imaginário dos povos por meio de mitos, lendas e formas de organização social. A arte, presente no cotidiano, é usada para exprimir sentimentos e exteriorizar júbilo, tristeza, amor, instintos bélicos e crença nos poderes supremos, entre outras expressões humanas. Segundo o enunciado acima, a arte está presente na cultura de diversos povos na história da humanidade. Assinale a alternativa que contempla os momentos da vida das pessoas em que a arte está presente.

a. étnico e religioso.

a. No folclore, como forma de diversão para as camadas populares de vários países.

b. linguístico e econômico. c. racial e folclórico.

b. Na fé e espiritualidade, nos momentos de trabalho, nas guerras, nos sentimentos das pessoas e na cultura do cotidiano do ser humano.

d. histórico e geográfico. e. literário e popular.

c. Nos espaços comunitários, para que as pessoas menos favorecidas tenham uma atividade cultural.

180. Leia os textos a seguir.

d. Somente no interior, na mente das pessoas.

Texto 1

e. Nas mídias, como televisão (aberta e a cabo), rádio e internet, e em diversos outros suportes tecnológicos como tablets e celulares.

COMIDA A gente não quer só comida A gente quer comida Diversão e arte A gente não quer só comida A gente quer saída Para qualquer parte [...]

182. O Império Asteca se desenvolveu no México e em outros países da América Central, em meados do século XIV, e foi uma civilização muito poderosa. Além de dominar vastas regiões, construiu muitos monumentos e teve uma arte predominantemente religiosa, com representação de vários deuses.

A gente não quer Só dinheiro A gente quer dinheiro E felicidade A gente não quer Só dinheiro A gente quer inteiro E não pela metade... […]

a. Formas ovais e linhas circulares. b. Alto-relevo com formas cônicas. c. Formas retas e abstratas nas composições. d. Elementos figurativos e geométricos nas composições. e. Formas puramente geométricas, sem definição das figuras. 183. O arquiteto brasileiro Oscar Ribeiro de Almeida Niemeyer Soares Filho, nascido em 1907, conhecido por suas inúmeras obras pelo Brasil, como as edificações de Brasília e seu plano piloto, e também por outras obras em diversos continentes no mundo, é reconhecido como pioneiro nas possibilidades construtivas e plásticas do concreto armado.

Diversão e arte Para qualquer parte Diversão, balé Como a vida quer Desejo, necessidade, vontade Necessidade, desejo, eh! [...]

Marque a alternativa que apresenta a principal característica que Niemeyer introduziu na construção com concreto armado. a. Formas compactas e retas demonstrando grande densidade de volume.

ANTUNES, Arnaldo; FROMER, Marcelo; BRITO, Sérgio. Titãs. Acústico, WEA, 1997.

b. Utilização do concreto de maneira abstrata, sem superfícies planas, e definições plásticas.

Texto 2

c. Formas redondas fixadas no chão com concreto maciço, representando o peso das construções.

“A poesia é indispensável. Se eu ao menos soubesse para quê...” Com este encantador e paradoxal epigrama, Jean Cocteau resumiu ao mesmo tempo a necessidade da arte e o seu discutível papel no atual mundo burguês. (FISCHER, E. A necessidade da arte. Rio de Janeiro: Zahar, 1979.)

Assinale a alternativa que apresenta os elementos formais e estéticos que os astecas priorizavam em suas obras.

A função da arte na sociedade contemporânea é uma reflexão constante entre teóricos das ciências humanas, neurociências e outros estudos. No texto 1, a arte é descrita como a. uma coisa que serve só para diversão e não tem outra utilidade na vida. b. uma mercadoria que compramos para usar e dispensamos quando não está mais fazendo sucesso.

d. Formas finas representando que não estão sustentadas por nada, flutuando no ar. e. Linhas curvas e circulares com o concreto armado sustentando estruturas no espaço com leveza e estética. 184. A arte representa contextos da sociedade de determinada época. Esses contextos são denominados movimentos artísticos. Oscar Nemeyer, grande arquiteto que projetou o plano piloto de Brasília e inúmeras outras obras, reconhecido no mundo como inovador e criativo, foi um dos principais participantes de um movimento artístico das décadas de 1950 e 1960. Assinale a alternativa que apresenta esse importante movimento.

expoENEM 43


a. Neoimpressionismo

A música esteve muito presente nesses momentos históricos e contestava a violência das ditaduras, produzindo uma arte engajada, isto é, protestava contra a opressão do povo. Em contrapartida, existia uma música preparada para enaltecer a ditadura e suas realizações, a arte oficial, como porta-voz do poder. A música de Violeta Parra (1917–1967) era tocada por artistas brasileiros que se enquadram no conceito de

b. Concretismo c. Modernismo d. Renascimento

e. Pós-Modernismo

a. arte oficial.

185.

b. indústria cultural.

A música constitui um dos principais interesses na organização política do estado grego. Como em outras instâncias, suas regras deveriam ser observadas pelo estado, e por essa razão não caberia deixá-las a critério dos artistas. Por isso, a formação musical era um requisito básico na educação de qualquer cidadão livre, pois caberia a ela direcionar a conduta moral, social e política de cada indivíduo, para cumprir adequadamente seu papel junto ao estado. A música deveria exaltar as boas qualidades no indivíduo e ao mesmo tempo suscitar o significado de ordem, dignidade, capacidade de decisões rápidas, além do equilíbrio, simplicidade e temperança. NASSER, Najat. Boletim do CPA, Campinas, n. 4, jul./dez., 1997.

Platão, um dos principais filósofos da Grécia Antiga, que formava a consciência do povo na Grécia Clássica, considerava duas artes como fundamentais para a formação do cidadão e do guerreiro, por desenvolverem qualidades necessárias para suas vidas, como equilíbrio, simplicidade e temperança. Marque a alternativa que as apresenta. a. Ginástica e música b. Artes plásticas e arquitetura

c. Pós-Modernismo. d. arte engajada. e. arte religiosa. 187. O teatro foi uma das importantes formas de arte engajada, contestando a opressão no Brasil durante a ditadura militar. Com os movimentos musicais, como dos estudantes universitários e da tropicália, do cinema novo e da performance nas artes plásticas, dois grupos de teatro foram muito atuantes nos anos 1960. Marque a alternativa que os apresenta. a. Teatro de rua e de preparação para atores de televisão b. Teatro de Arena e Teatro Oficina c. Open Theater e Viola Spolin d. Teatro Experimental e Anárquico e. Teatro da Globo e da Record

Leia o texto a seguir para responder às questões 188 a 192. Brandon Smith

c. Geometria e matemática

I’m a Junior in high school, and I have a parttime job in a restaurant. I bus dishes on Saturdays and Sundays from 8:00 until 4:00. I earn $5.50 an hour. It isn’t much money, but I save almost every penny! I want to go to a good university, and the cost goes up every year. Of course, I spend some money when I go out on Saturday nights.

d. Teatro e oratória e. Oratória e física 186. Leia o trecho da música a seguir.

Erica Davis

LA CARTA Me mandaron una carta, por el correo templano, y en esta carta me dice, que cayó prieso mi hermano, así lo tema con grillos, por las calles lo arrastraron, si. La carta dice el motivo, que ha cometido Roberto, haber apoyado el paro, que ya se habia resuelto, si caso esto és el motivo, presa también voy sargiento, si. Yo que me encuentro tán lejo, esperando la noticia, me viene decir en la carta, que en mi patria no hay justicia, los hambrientos piden el pan, no molejan a la milicia, si. Esta manera pomposa, queren consiervar su aciento, los de abanicos y de flaque, si tiener merecimiento, van y volver a la iglesia, y olvidan los mandamientos, si. ................................................

I’m a freshman in college. College is very expensive, so I work in a law office for three hours every weekday in the afternoon. I make photocopies, file papers, and sort mail for $8.25 an hour. The job gives me good experience because I want to be a lawyer someday. But I don’t want to work every semester. I need time to study. RICHARDS, Jack C. New interchange. Cambridge: Cambridge University Press, 1998.

188. O texto tem a finalidade de a. mostrar a vida de pessoas da terceira idade que voltaram a estudar. b. incentivar jovens a estagiar para que assim possam entrar no mundo do trabalho sem problemas. c. descrever as dificuldades que os jovens têm para conseguir o primeiro emprego. d. descrever a rotina de dois estudantes que também trabalham. e. enfatizar a pressão que os pais exercem na profissão dos filhos. 189. De acordo com o que relata Brandon Smith, é possível afirmar que ele a. sai várias vezes durante a semana. b. gasta todo o dinheiro que ganha. c. não tem condições financeiras de frequentar uma universidade. d. é um rapaz muito econômico. e. trabalha durante a semana em um restaurante.

PARRA, Violeta.

190. Erica Davis

Na América do Sul dos anos 1960 e 1970, o sistema político e de poder nos países era a ditadura militar. No Brasil, na Argentina e no Chile, havia uma grande opressão à liberdade de opinião e, consequentemente, à produção artística. Muitos artistas, professores e estudantes, cientistas e outros profissionais foram perseguidos e exilados. expoENEM 44

a. já sabe a profissão que terá no futuro. b. trabalha nos finais de semana. c. deseja trabalhar sempre, paralelamente a seu estudo, para ganhar experiência.


d. tem intenção de entrar na faculdade no próximo ano. e. gosta de seu trabalho, mas está procurando outro mais atrativo economicamente.

195. Na frase: “She really meant: ‘Cut down eating…’”, o homem diz que sua mulher queria que ele a. gastasse menos dinheiro nos restaurantes. b. saísse mais em sua companhia.

191. No texto sobre Brandon Smith, a expressão: “I bus the dishes...” significa que ele

c. cortasse pela metade os encontros com os amigos.

a. lava a louça do jantar.

d. baixasse a compra de comida enlatada.

b. retira a louça suja das mesas.

e. reduzisse o consumo de comida.

c. dispõe na máquina a louça suja, depois das refeições.

d. coloca a mesa para que os clientes façam a refeição.

Cierta vez los días de la semana decidieron hacer una fiesta para descansar de la rutina del tiempo. Estaban ocupados y nerviosos durante todo el año y no encontraban un hueco para divertirse. Pero no podían llegar a un acuerdo para fijar la fecha.

e. faz a compra da louça que vai ser usada no restaurante. 192. O que Brandon e Erica têm em comum? a. Ambos trabalham à noite, mas em empresas diferentes.

Por fin, a uno de ellos se le ocurrió que podían aprovechar el día que le sobra al mes de febrero en los años bisiestos. A todos les pareció una buena idea y además decidieron que la fiesta fuera de disfraces. Y un 29 de febrero se celebró la fiesta. El domingo llegó con un manto de seda y clavel rojo en el ojal. El lunes, vestido de joven juerguista, pero con el rostro triste. El martes, disfrazado de comerciante. El miércoles apareció vestido de oficial con tres días delante y tres detrás. El jueves se presentó como un calderero, representando a Júpiter y a Thor. El viernes era una chica joven que quería divertirse libremente sin ser cortejada. El sábado venía de vieja ama de llaves con escoba, fregona y plumero.

b. Nenhum dos dois conseguiu entrar na universidade. c. O objetivo principal de ambos é usar o salário para pagar a universidade. d. Os dois estudam na mesma universidade, mas não se conhecem. e. Nenhum dos dois trabalha aos fins de semana.

Leia a charge a seguir para responder às questões 193 a 195. You look pretty well for a man whose wife just told him she wants a divorce!

Leia o texto a seguir para responder às questões 196 a 198.

Oh, come on! I know these paralinguistic and non-verbal cues very well! She really meant: “Cut down eating, you’re upsetting me by eating all the time lately”.

Todos se divirtieron hasta que, cansados, tomaron asiento. Y comenzaron a reír porque estaban muy contentos de que a febrero le sobrase un día cada cuatro años. Hay veces que la rutina de nuestras ocupaciones no nos deja pensar en lo maravillosa que es la vida. Por eso es conveniente tomarse un respiro y salir a divertirse. LOS DÍAS de la semana. Basado en el cuento original de Andersen. 20minutos.es. 22 abr. 2005. Disponível em: <http://www.20minutos.es/noticia/18646/0/dias/semanas/ andersen/>. Acesso em: 26 out. 2012.

196. O texto apresentado trata sobre os dias da semana e tem como um de seus objetivos a. comparar as diferenças lexicais entre os dias da semana em língua espanhola e em nossa língua. b. discorrer sobre a origem dos nomes dos dias da semana em espanhol. c. apresentar os dias da semana em que as pessoas costumam descansar na Espanha. d. descrever a festa que os dias da semana resolveram fazer para descansar da rotina diária.

193. No diálogo entre os dois amigos em um restaurante, a. um deles acaba de se separar e por isso bebe para esquecer.

e. explicar o acordo feito pelos dias da semana para fixar a data da festa.

b. os dois desabafam sobre os problemas que enfrentam no dia a dia, enquanto comem e tomam uma cerveja. c. os dois estão tristes por não terem a companhia de amigas. d. o amigo que foi pedido em divórcio pela esposa não leva a sério o que sua mulher realmente quer.

197. De acordo com o texto, na festa que se realizou no dia 29 de fevereiro, os dias da semana a. comemoraram até o amanhecer o ano bissexto.

e. um deles comenta que vai parar de comer sanduíches porque sua esposa acredita que isso engorda.

b. apareceram com diferentes fantasias. c. não puderam se divertir já que a segunda-feira não estava presente.

194. Um dos amigos fala em “paralinguistic and non-verbal cues”. Com isso, ele quis dizer que a. usou características que transcendem a própria fala para extrair o significado das palavras de sua mulher, e não o conteúdo literal. b. foi difícil conversar com sua mulher, uma vez que o tom verbal e não verbal que ambos utilizaram durante a discussão era cada vez mais áspero.

d. resolveram fazer outras festas a cada ano bissexto. e. viram o sábado e o domingo vestidos de gala. 198. O texto sobre os dias da semana nos traz o seguinte ensinamento: a. a vida das pessoas é basicamente feita de trabalho. É por meio dele que nos fortalecemos e nos tornamos pessoas melhores.

c. acredita que sua mulher estava cansada de tantas insinuações não verbais para que o casamento terminasse.

b. devemos descansar da rotina da semana para poder começar a segunda-feira com energia suficiente para o trabalho.

d. deu algumas dicas a sua mulher para que as palavras fossem melhor interpretadas pelas duas partes.

c. a vida é curta para se pensar só em trabalho. O lazer é mais importante que o trabalho para se ter uma vida saudável.

e. sabia tudo que sua mulher pensava sobre ele, especificamente sobre seu hábito de comer demasiadamente.

d. a rotina de nossas vidas não nos deixa pensar, às vezes, na beleza da vida e, por isso, é importante saber descansar e divertir-se.

expoENEM 45


e. a diversão deve ser parte integrante de nossas vidas desde que sempre coloquemos como prioridade nosso trabalho.

203. De acordo com o texto, em um futuro imediato, as oportunidades de trabalho estarão relacionadas à tecnologia e, entre elas, a. a assistência sanitária.

Leia o texto a seguir para responder às questões 199 a 203.

b. a engenharia de alimentos industrializados. c. o desenvolvimento de novos materiais cerâmicos.

LAS PROFESIONES CON MAYOR FUTURO En el futuro cercano, no importa la profesión que se estudie, serán muy necesarias las siguientes herramientas para conseguir un mejor empleo:

d. o cuidado a pessoas da terceira idade e crianças. e. a inteligência artificial.

•  dominio de idiomas, •  conocimientos de informática y tecnología, •  capacidad de coordinar y gestionar. En la nueva economía predominará el sector del conocimiento: ingenieros, científicos, educadores, técnicos, programadores de computadores, consultores. Todos los expertos en megatendencias coinciden en que las más prometedoras oportunidades de trabajo en un futuro inmediato tendrán que ver con las siguientes tecnologías: relacionadas con la informática, la telemática, la telefonía celular, la ingeniería genética, la biotecnología, la biónica, la realidad virtual, la información multimedia. También serán prometedoras las profesiones relacionadas con los cuidados a distancia para la tercera edad y la infancia, los cultivos acuáticos, la robótica, los sistemas de seguridad pública y la inteligencia artificial. Disponível em: <http://www.profesiones.com.mx/las_profesiones_con_mayor_futuro. htm>. Acesso em: 26 out. 2012.

199. O texto começa com: “En el futuro cercano...”. Essa expressão indica que a ideia de futuro mencionada no texto a. ainda está longe de se tornar realidade. b. já se tornou realidade em alguns países. c. não está distante de se tornar realidade. d. é incerta, dependendo da região. e. é possível, se as grandes potências estiverem envolvidas. 200. O texto apresenta algumas ferramentas necessárias para se conseguir um bom emprego no futuro. Entre elas está a. o contato com a realidade virtual. b. noções sobre a informação multimídia. c. habilidade de lidar com pessoas da terceira idade. d. especialização em inteligência artificial. e. conhecimento de língua estrangeira. 201. De acordo com o texto, na nova economia, a. o curso de educação dará lugar aos cursos ligados às engenharias. b. programadores de computadores e educadores terão igual importância. c. os cursos técnicos serão mais requisitados que os de nível superior. d. os engenheiros deverão também ser cientistas em suas áreas. e. o conhecimento técnico predominará sobre o conhecimento teórico. 202. Na expressão: “Todos los expertos en megatendencias…”, a palavra em negrito pode ser traduzida para o português como a. especialistas. b. técnicos. c. informados. d. espertos. e. engenheiros.

expoENEM 46

Anotações


Gabarito

0 0

1

2

3

4

5

6

7

8

9

c

a

d

b

c

a

e

e

c

1

b

d

d

e

b

c

c

e

d

a

2

b

b

a

e

c

d

a

b

c

b

3

e

c

d

e

c

b

c

c

c

d

4

c

d

e

e

c

c

a

b

c

e

5

d

b

b

c

a

b

e

e

a

a

6

d

c

d

b

d

c

d

a

b

b

7

d

e

c

b

d

b

a

a

b

c

8

d

c

c

c

b

c

a

c

e

a

9

c

b

d

a

a

d

e

a

e

a

10

d

b

d

c

d

b

e

a

c

e

11

c

b

d

b

c

b

c

d

e

a

12

b

b

c

c

d

d

d

b

a

b

13

e

c

e

c

c

b

a

c

b

d

14

a

e

d

d

e

b

a

d

a

a

15

a

d

b

e

a

c

d

a

d

a

16

e

e

b

a

b

a

a

b

a

c

17

e

e

c

e

a

d

c

e

e

b

18

c

b

d

e

c

a

d

b

d

d

19

a

b

c

d

a

e

d

b

d

c

20

e

b

a

d

Questões Comentadas 01. c A tônica do texto é a curiosidade do fato de que em 1896 Arrhenius já havia alertado sobre a importância da contenção de emissões de dióxido de carbono para que a temperatura média do planeta não aumentasse. 02. a Segundo a tabela, a viabilidade da utilização das lâmpadas incandescentes, em períodos de até um ano, é realmente notória. 03. d A tabela destaca a importância das lâmpadas de LED para a economia de energia em cinco anos. 04. b O pioneirismo de Thomas Edison está na procura de novas formas de geração de energia. 05. c A invenção da lâmpada incandescente só se popularizou a posteriori. 06. a “Paísmo” é uma palavra nova, criada a fim de gerar humor pelo caráter ingênuo do comentário do personagem; trata-se de um neologismo. 07. e O texto traz um equívoco de concordância: “o primeiro” deveria ter sido redigido como “as primeiras”. 08. e A pesquisa é um protótipo de análise de caso, o que, em ciência, é uma verificação a ser expandida.

09. c “Separar eles” em modalidade culta da escrita seria “separá-los”; “pra” seria “para”. Essas expressões podem ocorrer tanto em modalidade oral quanto escrita na linguagem informal/popular. 10. b Equívoco é algo que um ser humano pode cometer. Estando uma ideia equivocada, pressupõe-se que ela é um humano, ou possui características humanas. 11. d A palavra “ainda” é inclusiva e intensificadora, portanto, pode-se também interpretar o trecho como “o gel protegeu as mulheres contra o vírus da Aids, mas sua eficácia foi maior contra o herpes genital”. 12. d A palavra “mesmo” equivale semanticamente ao vocábulo “igual”; a substituição de um por outro resolveria a questão. 13. e “ARROOO” é uma onomatopeia, palavra que representa um som. Houve uma alteração da palavra para representar o som da ação. 14. b O texto destaca as características da fantasia e da realização como próprias do indivíduo criativo. 15. c A observância de que se trata de texto humorístico pressupõe o entendimento das entrelinhas. 16. c Trata-se de identificar os elementos que concorrem para a progressão temática e para a organização e estruturação de textos de diferentes gêneros e tipos.

expoENEM 47


17. e Para a resolução da questão, basta relacionar, em diferentes textos, opiniões, temas, assuntos e recursos linguísticos.

32. d Na visão do cronista Rubem Braga, o professor avaliou a redações de forma subjetiva, daí a incoerência na avaliação das três redações.

18. d Reconhecer no texto estratégias argumentativas empregadas para o convencimento do público, tais como a intimidação, sedução, comoção e chantagem, entre outras.

33. e Os árcades “imitavam” gregos, romanos e renascentistas; ora, Virgílio e Horário foram dois expoentes da poesia romana, e por isso esses dois poetas remetem ao Arcadismo, estilo dos poetas inconfidentes como Tomás Antônio Gonzaga e Cláudio Manuel da Costa.

19. a Identificar, em textos de diferentes gêneros, as marcas linguísticas que singularizam as variedades linguísticas sociais, regionais e de registro. 20. b Relacionar as tecnologias de comunicação e informação ao desenvolvimento das sociedades e ao conhecimento que elas produzem. 21. b A lógica desta resposta está presente em todo o texto, porque as estrofes repetem o mesmo tema. 22. a A irreverência do poeta barroco Gregório de Matos chega às raias de construir um silogismo para mostrar a Deus a necessidade que o eu lírico tem de ser perdoado. 23. e Luiz Tatit entrelaça a Capitu machadiana, a Capitu que todos somos e a Capitu internáutica, revelando-lhes as semelhanças. 24. c A índia Iracema, no romance homônimo, é idealizada como uma vestal que faz o chá milagroso que produz sonhos coloridos nos índios da sua tribo. Já na canção de Góes, a índia guajira é vítima do tráfico latino-americano. 25. d O poeta tem que se esconder e trabalhar insistentemente até que o poema fique perfeito, como uma joia.

34. c O índio em José de Alencar se une ao europeu para a formação de uma raça brasileira – o mameluco –, representada pelo personagem Moacir no romance “Iracema”. Em “Canto do Piaga”, Gonçalves Dias deixa clara a sua crença de que a presença do europeu na América destruiria o índio. 35. b Ministórias e haicais em prosa na literatura contemporânea? Somente Dalton Trevisan. 36. c O elaborador do teste considera formalmente refinado o texto de Cruz e Sousa; com relação ao tema, metafísica e universalidade são características do Simbolismo presentes no texto. 37. c Essa resposta advém dos elementos que podem originar um texto para teatro – o que não está evidente no texto. 38. c A proposta direciona a resposta para o Regionalismo, iniciado no Romantismo, em algumas obras de José de Alencar e de Franklin Távora, e que foi, na segunda fase do Modernismo (1930 a 1945), uma forma de protagonizar os menos favorecidos socialmente, haja vista “Vidas Secas” e “O Quinze”, respectivamente livros de Graciliano Ramos e de Raquel de Queirós. 39. d O discurso do personagem é claramente agressivo e expressa uma óbvia amargura política.

26. a A afirmação de Dom Casmurro fica clara no final do parágrafo, no trecho “a minha primeira amiga e o meu maior amigo (...) quis o destino que acabassem juntando-se e enganando-me”.

40. c Drummond pertenceu à segunda fase do Modernismo, a qual tematizava o conflito eu x mundo.

27. b Em sua gênese, o Manifesto Antropofágico, de 1928, pretendeu “bater” no ufanismo do Grupo Anta e no Manifesto Verde-Amarelo, de 1926.

41. d (Teoria Artes visuais) Os conceitos básicos e teóricos das artes visuais que permeiam a pintura, o desenho, a escultura e muitas outras formas de arte exigem conhecimento prévio. Nesta questão estão os elementos básicos da pintura e do desenho.

28. c Uma das propostas dos pré-modernistas era uma leitura crítica do Brasil. Nesse sentido, a literatura deles se aproximava do Modernismo que eclodiu em 1922. 29. b Embora o texto seja extenso, a proposta amarra a possível resposta ao último parágrafo, no qual a gradação é evidente. 30. e Manuel Bandeira se dispõe a fugir de sua realidade sofrida para um paraíso (Pasárgada), conforme faziam os românticos do século XIX. 31. c Em praticamente todas as análises de Policarpo Quaresma, ele é caracterizado como uma figura quixotesca porque, como o cavaleiro da obra do espanhol Cervantes, é um sonhador incorrigível.

42. e (Arte contemporânea – Artes visuais) Considera-se contemporânea a arte produzida desde a década de 1960 até os dias atuais. Existem os mais variados tipos de linguagem e temas, além de artistas que desenvolvem trabalhos completamente diferentes entre si. Os artistas estão amarrados ao seu tempo, e talvez no futuro os críticos dividam esse período gigantesco em grupos artísticos específicos. 43. e (Arte geral) Como o próprio enunciado diz, “a arte e a ciência” estão muito próximas. Em alguns espetáculos de dança e teatro é necessário que os atores tenham preparação física semelhante à de um atleta. É importante prestar atenção nos enunciados, como nesse caso específico, que pede para apontar a alternativa errada. 44. c (Artes visuais) Muitas das atuais questões do Enem na área de Arte pedem aos alunos que interpretem obras artísticas. Essa obra de Portinari, de 1944, da mesma série de “Os Retirantes”, tem como tema a fuga da

expoENEM 48


seca no sertão nordestino. Uma análise mais atenciosa ajuda a interpretar e responder questões como essa. 45. c (Arte geral) Mesmo não conhecendo todos os dançarinos citados, é possível diferenciar os grupos de artistas: em “A” temos os pintores, em “B” os músicos, em “C” os dançarinos, em “D” os poetas e na alternativa “E” os escritores. 46. a (História da arte) Mesmo não pedindo de maneira direta, muitas das questões do Enem exigem conhecimento da teoria e da história da arte. Esta questão é diferente da proposta exigida pelo Enem, porém, ao mesmo tempo, é um excelente material de estudo sobre os movimentos citados. 47. b (Fotografia e pintura – Impressionismo) O movimento impressionista foi muito importante no campo artístico, pois o início da arte moderna e contemporânea foi influenciado por esse movimento inspirador, marcado por uma nova e reveladora linguagem artística. A fotografia, dos seus primeiros anos até os dias de hoje, é considerada um linguagem artística importantíssima. 48. c (Arte indígena) Os trabalhos dos grupos étnicos relacionados ao Brasil, como os indígenas e afrodescendentes, foram cobrados diversas vezes no Enem dos anos anteriores. Além de ser importante para a arte, também é importante para conhecermos as origens dos povos pioneiros da nossa nação. 49. e (Pintura) Todas as alternativas estão corretas. Esta obra de Almeida Júnior não só é importante pelo tema trabalhado, mas também pela perfeição da técnica neoclássica/acadêmica usada pelo artista. A arte brasileira exige atenção especial, desde suas origens, passando pelos grandes movimentos como o modernismo, por exemplo. 50. d (Fotografia) Mesmo com todos os avanços tecnológicos na área da fotografia, nada substitui o olhar do fotógrafo, que pode tirar uma foto excelente mesmo sem possuir equipamento profissional ou dominar técnicas específicas.

58. a 59. a 60. d 61. c O aluno tem que reconhecer as diferenças dos conceitos nas opções da questão, e também conhecer o fenômeno que traz para o português palavras da língua inglesa. 62. d 63. b A questão, além de cobrar coerência na interpretação da frase, nos leva a pensar sobre ciência, sobre o método científico e sobre como examinar racionalmente sobre os resultados científicos. 64. d A ciência é dinâmica, evolui em seus conceitos e teorias, sempre buscando um aperfeiçoamento de suas afirmações. O aluno deve conseguir identificar essas ideias. 65. c É importante entender que ciência não implica um conhecimento absoluto, como os mitos e as religiões, que oferecem respostas prontas às questões sobre o universo e a existência humana. A ciência se baseia em análises e experimentos. 66. d Ao analisar a questão, fica claro que a época em que o fato ocorre não é a Segunda Grande Guerra e sim um período posterior. 67. a O período em que ocorre a grande rivalidade entre as duas superpotências mundiais USA e URSS é denominado Guerra Fria. 68. b A questão é sobre as fortes chuvas que atingiram o Rio de Janeiro em abril de 2010, uma das maiores enchentes na história da cidade. As alternativas corretas cobram uma interpretação exata do texto.

51. b (Teatro) Termos técnicos da arte também exigem atenção especial no Enem, como os termos citados nessa questão: monólogo, musicais, adaptação de textos literários, comédia, drama, tragédia, fantoches e manipulação de bonecos. Por mais que sejam simples e populares, exige-se muito cuidado na hora da leitura e interpretação.

69. b O leitor de textos em inglês sempre deve estar atento às situações em que alguns termos são utilizados. Nesta questão, a palavra “outdoors” tem significado diferente do aplicado normalmente em português. Deve ficar claro que um texto em inglês é criado para ser entendido em inglês.

52. b

70. d Nesta questão sobre a Copa do Mundo de 2014, a alternativa correta fala sobre a indefinição do papel da cidade de São Paulo no evento.

53. c (Dança) O movimento é a essência da dança. Mesmo tendo várias definições, a alternativa “c” da questão 53 é uma das mais completas, pois aborda conceitos básicos e importantes da dança. 54. a (Pintura) Lasar Segall representou nesta obra um agricultor brasileiro em meio aos bananais, local onde trabalhava, ou seja, uma imagem do cotidiano marcado por aspectos cênicos (exagero teatral). Questão de interpretação de imagem, comum nas últimas edições do Enem. 55. b (Arte contemporânea) Eduardo Srur, como muitos artistas contemporâneos, trabalha com uma visão crítica dos problemas sociais que assolam o mundo, entre eles os relacionados à ecologia, como vemos nessa obra. 56. e 57. e

71. e A questão levanta situações decorrentes dos problemas enfrentados pelo Brasil na realização dos projetos para a Copa do Mundo de 2014. 72. c É necessária a compreensão da expressão “stadia” (plural de “stadium”) para não haver má interpretação na solução. Também é importante a interpretação correta do termo “up to” (“até”), que geralmente é estudado somente no sentido de “para cima”. 73. b 74. d 75. b 76. a

expoENEM 49


O primeiro ministro canadense falou em nome do grupo G7, e não apenas do Canadá.

tan claro como el ministro de Justicia, Francisco Caamaño, a la hora de expresar su opinión sobre el uso del 'burka' ”.

77. a

90. c A alternativa correta aparece no texto três vezes:

78. b Além de interpretar o texto corretamente, o aluno tem que possuir conhecimentos sobre as relações internacionais atuais e sobre o urânio enriquecido na produção de armas nucleares. 79. c O aluno deve interpretar corretamente as ações do Presidente Lula perante o caso, levando em consideração a atitude do líder brasileiro nessa situação. 80. d Nesta questão, o aluno deve compreender as pesquisas feitas para criar novos computadores, neste caso a partir do conhecimento das células nervosas dos seres humanos. 81. c O texto diz: "A sus 20 años, vive en casa de su familia política...". A expressão destacada se refere à família do marido, pois define o parentesco que se estabelece pelo casamento. 82. c Afirmativa 2: Raihana tem dois filhos do sexo masculino. O texto diz: “Hijos: dos varones.” Afirmativa 3: Raihana mora na cidade de Eraghly. O texto diz: “Vive en Eraghly, un pueblo...”. Afirmativa 4: Raihana estudou até a 5ª série. O texto diz: “La joven estudió hasta 5° de primaria”. 83. c A partir da frase “Raihana ha traído al mundo ya dos hijos en el que es el peor país para ser madre”, retirada do texto, pode-se concluir que, se o Afeganistão é o pior país para ser mãe, as condições para a maternidade são, por conta disso, precárias. 84. b Neste contexto a palavra “apenas” significa, de acordo com o dicionário da Real Academia Española, “dificilmente, quase nunca”. 85. c O texto é claro quando diz: “A diferencia de un embarazo anterior malogrado a los tres meses...”. 86. a O importante é saber a que se referem “la voluntaria” e o pronome “la” na expressão “la visita”. No texto, “la voluntaria” se refere a Maryam e “la” em “la visita” se refere à visita que Maryam faz a Raihana. 87. c A segunda frase do texto descreve diferentes situações que podem preocupar a mulher, entre as quais “...lo primero es sobrevivir”. A primeira preocupação é, portanto, a sobrevivência do recém-nascido. 88. e Afirmativa 1: A última frase do texto explicita esta afirmativa: “...en esta ocasión, la familia de su marido le permitió ir a la clínica cuando tuvo pérdias de fluido, por recomendación de Maryam...”. Afirmativa 4: A frase que explicita esta afirmativa é: “Pero para dar a luz al segundo, Ghulam Mohammed, hace dos meses, acudió a casa de la comadrona, por las complicaciones sufridas durante la gestación”. 89. a A primeira frase do corpo do texto diz que “nadie en el gobierno, a excepción de la ministra de Igualdad, Bibiana Aído, había sido hasta la fecha

• “Caamaño anuncia que la futura ley de libertad religiosa regulará la utilización de prendas rituales en lugares públicos”. • “Una norma que regulará la utilización de esa prenda en espacios públicos”. • “Caamaño abordará de forma «general» el uso de vestimentas religiosas fuera del ámbito privado”. 91. b A expressão “sin embargo” significa “entretanto” em língua portuguesa. 92. d De acordo com o dicionário da Real Academia Española, a palavra “baladí” significa “de poca importancia, insignificante”. 93. a A expressão “su departamento” se refere ao departamento do ministro da justiça. 94. a De acordo com o dicionário da Real Academia Española “borrador” é o “escrito provisional en que pueden hacerse modificaciones”. 95. d Segundo o dicionário da Real Academia Española, a expressão “levantar ampollas” significa “causar notable disgusto o desasosiego; causar irritación”. 96. e A alternativa correta diz que “el uso del burka no se compagina con la dignidad del ser humano...”. O verbo “compaginar” significa “corresponder, harmonizar, concordar, ajustar-se” e a frase retirada do texto diz que o uso da burca não respeita a dignidade do ser humano ou, conforme a definição apresentada, seu uso não se harmoniza, não se ajusta à dignidade do ser humano. 97. a O texto trata do café da manhã como a refeição mais importante do dia. 98. e 99. a A expressão “aunque estemos de vacaciones...” significa “ainda que estejamos de férias”, “mesmo nas férias”. 100. d Afirmativa 1: O texto inclui exemplos de alimentos: o leite, a fruta, torradas com margarina ou azeite de oliva, entre outras. Afirmativa 2: Exemplos de frutas: kiwis, laranjas. Afirmativa 4: No lugar de umas bolachas de chocolate, aposte pelas clássicas torradas com margarina ou azeite de oliva ou uma tigela de cereal. 101. b Corasamborim é um vocábulo novo, por isso se trata de um neologismo formado pela aglutinação de coração + samba + tamborim. 102. d O balé nasceu na Itália no século XV, ou seja, no Renascimento italiano. 103. c Conforme a proposta desta questão, a mistura de diferentes épocas está clara na combinação entre Mona Lisa, do renascentista Leonardo da Vinci, e Mister Bean, personagem cômico de seriado de TV da década de 1990.

expoENEM 50


104. d O pintor impressionista não misturava cores na sua paleta. Para ele, quem mistura cores é o observador da pintura; por isso, costuma-se dizer que, no Impressionismo, a mistura das cores deixa de ser técnica para ser óptica.

122. c

105. b O eu-lírico demonstra melancolia ao constatar a inutilidade da reação diante da morte, especialmente no 9°. e no 14°. versos.

124. d

106. e O texto cuja função é informar e cuja linguagem é predominantemente denotativa tem função referencial. 107. a O verbo guardar exige a preposição em e o vocábulo onde se refere ao vocábulo gaveta, que é lugar concreto. 108. c O título do capítulo é um contraponto entre luz e escuridão; a despedida dos namorados se deu antes do acender das velas; o narrador confunde vocação e investidura; também confunde o leitor e a amada – esses são elementos que sugerem incerteza e indefinição, características do romance. 109. e As orações coordenadas adversativas (mas, porém, contudo...) têm sentido contrário ao das subordinadas adverbiais concessivas (embora, mesmo que, apesar de que, ainda que, posto que), por isso somente os períodos com orações concessivas correspondem ao sentido dos versos de Cecília Meireles. 110. c 111. b A ação 6 é anterior a todos as outras ações porque o verbo está conjugado no pretérito-mais-que-perfeito (fato anterior a outro fato passado); as ações 3 e 4, porque o verbo está no pretérito imperfeito (ações simultâneas), ocorrem ao mesmo tempo. 112. d

123. c

125. d 126. d O saco de açúcar da imagem se assemelha ao corpo de uma pessoa fora de forma. 127. b O texto sugere a relação de língua com a identidade nacional. 128. a Função poética: o texto bem elaborado de Vandré; função emotiva, a subjetividade, o lirismo de Vandré. 129. b O texto da revista Época é referencial, é denotativo, é informativo – por isso predomina nele a função referencial da linguagem. 130. e A intenção de Millôr foi elaborar um texto vago e específico (como o das mulheres) – nesse sentido, o texto mostra-se coerente. 131. c O texto de teatro não tem narrador: as ações se desenrolam pela ação e pelo diálogo entre os personagens. 132. e O conto-carta de Trevisan, metaforicamente, expressa a opinião do escritor sobre a “libertação da mulher”. 133. c A vida campestre como ideal foi cantada pelos árcades do século XVIII, haja vista as cartas pastoris de “Marília de Dirceu”, do ilustrado juiz Tomás Antônio Gonzaga.

As afirmações I, II e V são de Oswald de Andrade (Manifesto Pau-Brasil e Manifesto Antropofágico); a afirmação III é claramente parnasiana e a IV, simbolista.

134. c Metáfora metalinguística – Cabral defende a poesia substantiva, a palavra pesada, isto é, critica a superficialidade na linguagem.

113. b

135. b A avó, cética, intensifica a indignação da neta.

No verso de Vinicius de Moraes, mesmo é conjunção concessiva; assim como na alternativa b. 114. c 115. b 116. c 117. d 118. e 119. a 120. b

136. a A questão aborda as imagens nas pinturas e iluminuras da Idade Média. As figuras sagradas eram representadas em proporção maior, evidenciando o teocentrismo e o grau de importância que a religiosidade tinha em relação ao que era terreno. 137. c A questão aborda a dança e cita Isadora Duncan, uma das mais importantes bailarinas do século XX. Ela, apesar de considerar exercícios e técnicas úteis para a dança, rompeu com os cânones do balé clássico, apresentando uma nova forma de dançar e se expressar pelos movimentos do corpo. 138. b A questão aborda a arte como mercadoria. A partir do fragmento do texto de Molina, é possível perceber que ele faz crítica às músicas da mídia, portanto da indústria cultural, que é a alternativa correta.

121. b expoENEM 51


139. d A questão traz um registro fotográfico da obra Tronco com cadeira, de Leirner. Essa obra apresenta uma releitura do objeto cadeira, unindo-o novamente a sua matéria-prima, questionando seu sentido de maneira abstrata.

147. d Entre as tarefas atribuídas, pode-se destacar a discussão sobre o estado de conservação dos bens já declarados patrimônios mundiais. As outras alternativas referem-se a tarefas que não são especificadas no texto.

140. a A obra Guernica, de Picasso, um dos ícones do movimento cubista, apresenta um registro do bombardeio da cidade espanhola em tons monocromáticos azuis. A realidade é decomposta de tal forma que possibilita ao admirador estético ter acesso às várias dimensões do evento, buscando achar alguma reflexão válida sobre o massacre. Essa questão apresenta alguns problemas relacionados às alternativas. A mais próxima de uma afirmação verdadeira é a “a”, embora ela proponha que a tela está “renunciando à realidade”, quando, na verdade, está “decompondo a realidade”.

148. a A partir de perguntas, o texto tem como objetivo informar o leitor sobre alguns produtos alimentares saudáveis. Não trata, apesar de citar “variedades exóticas orientales”, de importação de produtos, nem tampouco é fruto da imaginação, posto que o texto fala em três anos para que o projeto se torne realidade. Finalmente, apesar de listar alguns produtos, o texto não tem como finalidade fazer um relato dos produtos dos supermercados de La Rioja e nem incentivar a sua comercialização diretamente do produtor.

141. e Lê-se no trecho “(...) people who leave school before the age of 16 are five times more likely to suffer a heart attack and die than university graduates”. (As pessoas que abandonam a escola antes dos 16 anos têm probabilidade cinco vezes maior de ter um ataque cardíaco e morrer do que pessoas com formação universitária.). 142. d Lê-se no trecho “We’re particularly interested in how people’s happiness is affected by their local environment (...)”. (Estamos especialmente interessados em saber como a felicidade das pessoas é afetada pelo ambiente em que elas se encontram.). 143. d Lê-se no texto: “(…) if insects are eating the crops, cover the fields with insecticides; if there is a drought, build dams and divert the rivers…” (se insetos estão comendo a plantação, cubra o campo com inseticidas, se há seca, construa represas e mude o curso dos rios…). Esses são os dois exemplos que o texto cita no início. Ao final do texto, o autor aponta: “(…) they are now looking at technological solutions to two of the worst environmental problems in the world today: the greenhouse effect and the destruction of the ozone layer.” (agora eles estão buscando soluções tecnológicas para dois dos piores problemas ambientais no mundo hoje: o efeito estufa e a destruição da camada de ozônio). 144. e No subtítulo, lê-se: “(…) Dalmatian pelicans trapped by unusually cold weather” (pelicanos presos pelo frio incomum). No texto lê-se: “hundreds of kilograms of fish had been bought (…) for the pelicans. Local residents have been volunteering to help authorities (...) feed the birds.” (centenas de quilos de peixe foram comprados (…) para os pelicanos. O povo tem se voluntariado e está ajudando as autoridades a alimentar os animais.).

149. a A questão aborda a referenciação e como tal expressão se refere ao início do texto e à expressão colocadas imediatamente antes, “este ejercicio de imaginación”, invalidando, dessa forma, as outras alternativas. 150. a A tradução literal do provérbio é: “A palavra e a pedra solta não têm volta”. A prudência ao falar é o ponto fundamental. Há a relação entre a palavra e a pedra solta, mas não pode-se considerar que quando a palavra é dita ou quando a pedra se solta não são mais lembradas. Também não há alusão à preservação da natureza. A mudança da linguagem e da pedra ao longo do tempo e o direito das pessoas de voltarem atrás quando dizem alguma coisa podem ser considerados, mas não no contexto do provérbio. 151. d 152. b 153. e 154. a 155. c 156. d 157. a 158. d 159. a 160. e

145. b Para explicitar o item 1, o texto diz: “About 20 birds have already died of hunger after the Caspian Sea froze over”. (Aproximadamente 20 pássaros já morreram de fome depois que o Mar Cáspio congelou). Para explicitar o item 2, o texto diz: “Around 1,400 Dalmatian pelicans… are thought to live in southern Russia.” (Acredita-se que aproximadamente 1400 pelicanos dálmatas vivem no sul da Rússia). Para explicitar o item 3, o texto diz: “The birds are being fed locally-bought sprats...” (Os pássaros estão sendo alimentados com peixes comprados localmente...).

161. e

146. a Com base no que se afirma no último parágrafo, pode-se constatar que o texto foi escrito com a intenção de informar o leitor a respeito da importância, para o meio ambiente, da reciclagem. O texto não apresenta dados que justifiquem as afirmações das demais alternativas.

166. a

162. b 163. a 164. b 165. a

167. b 168. a 169. c

expoENEM 52


170. e

202. a

171. e

203. d

172. c 173. e 174. a 175. d 176. c 177. e 178. e 179. b 180. c 181. b 182. d 183. e 184. c 185. a 186. d 187. b 188. d 189. d 190. a 191. b 192. c 193. d 194. a 195. e 196. d 197. b 198. d 199. c 200. e 201. b expoENEM 53


Referências

<http://veja.abril.com.br/noticia/internacional/primeiro-casamento-gay-e-celebrado-na-argentina>. Acesso em: 02 ago. 2010.

A reinvenção da luz. Veja. São Paulo, n. 2145, 30 dez. 2009. Disponível em: <http://veja.abril. com.br/301209/1-reinvencao-luz-p-218.shtml>. Acesso em: 2 ago. 2010.

¿Qué lleva un auténtico ‘desayuno de campeones’?. Hola.com, 29 jun. 2010. Disponível em: <http://www.hola.com/ninos/2010062925658/ninos/desayuno/vacaciones/1/>. Acesso em: 10 ago. 2010.

ACCELERATE – a skills based short course. Oxford: Maximillan Heinemann, 1999. ANDRADE, C. D. Poesia completa. Rio de Janeiro: Nova Aguilar, 2003. ANDRADE, Mário. Lasar Segall. In: ___. Modernidade: arte brasileira do século XX. Paris: Musée d’Art Moderne de la Ville de Paris, 1988. p. 20. ANTUNES, Arnaldo; BROWN, Carlinhos; MONTE, Marisa. Tribalistas. Rio de Janeiro: Phonomotor Records, 2002. ASSER, Martin. Analysis: soccer violence an international problem. Disponível em: <http://news. bbc.co.uk/2/hi/797601.stm>. ASSIS, Machado de. Dom Casmurro. Rio de Janeiro: Nova Aguilar, 1992. p. 862. AZEVEDO, Aluísio. Obra completa. Rio de Janeiro: Nova Aguilar, 2000. BARRIONUEVO, Alexei. Deadly flash floods paralyze Rio de Janeiro. NY Times. Disponível em: <http://www.nytimes.com/2010/04/07/world/americas/07brazil.html>. Ac esso em: 01 jul. 2010.

RAZOUK, J. J. (Org.). Histórias reais e belas nas telas. Curitiba: Posigraf, 2003. Speak Up. Ano XXIII, n. 275. SILVA, S. M. O surrealismo e a dança. In: GUINSBURG, J.; LEIRNER (Org.). O surrealismo. São Paulo: Perspectiva, 2008. TATIT, Luiz. Capitu. In: O meio. São Paulo, 2000. 1 CD. Una adolescente australiana anula su compleaños tras apuntarse 200.000 personas por Facebook. Hola.com. Disponível em: <http://www.hola.com/actualidad/2011031551586/fiesta/ facebook/anulada>. Acesso em: 06 jun. 2011 WELLS, Kathryn. Australian rock music. Disponível em: <http://www.cultureandrecreation.gov. au/articles/music/rock/>.

BBC. Disponível em: <http://www/bbc.co.uk/news/world-europe-17117482>. Acesso em: 06 jun. 2012. Brazil 2014 preparations ‘on track’. Soccernet ESPN. Disponível em: <http://soccernet.espn. go.com/>. Acesso em: 19 ago. 2010. Brazil’s Lula in key Iran talks. BBC News. Disponível em: <http://news.bbc.co.uk/2/mobile/ middle_east/8685036.stm>. Acesso em: 20 jul. 10. BREGOLATO, Roseli Aparecida. Cultura corporal da dança. São Paulo: Ícone, 2007. Catálogo Victor Meirelles de Lima. Rio de Janeiro: Pinakotheka,1982. p.37-41. BUARQUE, Chico. Letra e música. São Paulo: Cia das Letras, 1989. CAMPOS, Paulo Mendes. Ser brotinho. In: SANTOS, Joaquim Ferreira dos (Org.). As cem melhores crônicas brasileiras. Rio de Janeiro: Objetiva, 2005. p. 91. CANDIDO, A. A nova narrativa. In: ___. A educação pela noite e outros ensaios. São Paulo: Ática, 2003. COMODO, R. Um silêncio inquietante. IstoÉ. Disponível em: <http://www.terra.com.br>. Acesso em: 15 jul. 2009. CONTIER, Arnaldo Daraya. Edu Lobo e Carlos Lyra: o nacional e o popular na canção de protesto (Os anos 60). Revista Brasileira de História, São Paulo, v. 18, ed. 35, p. 13-52, 1998. COSTA, Cristina. Questões de arte: a natureza do belo, da percepção e do prazer estético. São Paulo: Moderna, 1999. COUTINHO, A. Notas de teoria literária. Rio de Janeiro: Civilização Brasileira, 1973. CRUZ E SOUSA, J. Poesia completa. Florianópolis: Fundação Catarinense de Cultura / Fundação Banco do Brasil, 1993. Dormir depois da aula faz bem, mostra pesquisa. Veja, 27 jul. 2010. Disponível em: <http://veja. abril.com.br/noticia/educacao/dormir-depois-da-aula-faz-bem>. Acesso em: 2 ago. 2010. DUARTE, Marcelo. O guia dos curiosos. São Paulo: Companhia das Letras, 1995. El Gobierno regulará el uso del ‘burka’ porque no respeta la «dignidad del ser humano». SUR. es, 16 jun. 2010. Disponível em: <http://www.diariosur.es/v/20100616/espana/gobierno-regulara-burka-porque-20100616.html>. Acesso em: 10 ago. 2010. FERNANDES, Millôr. Ser gagá. In: SANTOS, Joaquim Ferreira dos (Org.). As cem melhores crônicas brasileiras. Rio de Janeiro: Objetiva, 2005. p. 225. GARAUDY, Roger. Dançar a vida. Rio de Janeiro: Nova Fronteira, 1980. Gel anti-HIV levanta questões polêmicas sobre sua eficácia e uso. Veja, 30 jul. 2010. Disponível em: <http://veja.abril.com.br/noticia/saude/gel-anti-hiv-levanta-questoes-polemicas-sobre-sua-eficacia-e-uso>. Acesso em: 2 ago. 2010. HULME, Mike; RAVETZ, Jerome. Show your working. BBC News. Disponível em: <http://news. bbc.co.uk>. Acesso em: 15 jul. 2010. JAN, Cecilia. Las caras de la maternidad. El País, 08 jun. 2010. Disponível em: <http://www. elpais.com/articulo/sociedad/caras/maternidad/elpepusoc/20100608elpepusoc_4/Tes>. Acesso em: 10 ago. 2010. LIMA, Eduardo. Advogado do Diabo. SuperInteressante, São Paulo, n. 263-A, p. 11, mar. 2009. ______. Testemunha de Deus. SuperInteressante, São Paulo, n. 263-A, p. 9, mar. 2009. MARTIN, Chris. Viva la vida. In: Viva la vida or Death and all his friends. Parlophone, 2008.

Maringá, n. 01, p.127-134, jun.2004. MASI, Domenico de. O ócio é precioso: entrevista. Veja, São Paulo, n. 1744, 27 mar. 2002. Disponível em: <http://veja.abril.com.br/270302/entrevista.html>. MAY, Ernest R. The ‘gravest issues’. BBC News. Disponível em: <http://www.bbc.co.uk/history/ worldwars/coldwar/kennedy_cuban_missile_01.shtml>. Acesso em: 19 Ago. 2010. MOLINA, Adão Aparecido. A indústria cultural: considerações sobre a utilização da arte, pela mídia, como instrumento de alienação e massificação. Revista Uningá, jun. 2004. MORAIS, F. O Brasil na visão do artista: o país e sua cultura. São Paulo: Sudameris, 2003. NASSAR, R. Um copo de cólera. São Paulo: Companhia das Letras, 1992. Neurons to inspire future computers. BBC News. Disponível em: <http://www.bbc.co.uk/news/ technology-10685138>. Acesso em: 19 ago. 2010. O ano zero da economia limpa. Veja. São Paulo, n. 2145, 30 dez. 2009. Disponível em: <http:// veja.abril.com.br/301209/ano-zero-economia-limpa-p-215.shtml>. Acesso em: 2 ago. 2010. OSTROWER, Fayga. Universos da arte. Rio de Janeiro: Campus, 1991. PAULA, Carlos Alberto de. Arte. Curitiba: Expoente, 2011. PLUMMER, Robert. The rise, fall and rise of Brazil’s biofuel. Disponível em: <http://news.bbc. co.uk/2/hi/business/4581955.stm>. PRADO, Adélia. Bagagem. Rio de Janeiro: Guanabara, 1986. Primeiro casamento gay é celebrado na Argentina. Veja. São Paulo, 30 jul. 2010. Disponível em:

expoENEM 54


Ciências humanas e suas tecnologias

01. O aumento da demanda para as próximas décadas e a urgente necessidade de agregar fontes limpas à matriz energética mundial, além da eventual substituição de fontes emissoras de gases estufa, inserem-se nas perspectivas de revitalização econômica, com base em grandes investimentos em pesquisa e desenvolvimento tecnológico no setor de energia renovável.

A partir das informações e conhecimentos sobre a crise energética e as possíveis alternativas para substituição dos combustíveis fósseis, pode-se afirmar corretamente que:

em diferentes países e continentes, e uma crise iniciada nos Estados Unidos, a economia mais poderosa do planeta – responsável por cerca de um quarto de tudo que é produzido no mundo –, afeta todos os mercados em questão de horas. Paulo Zocchi; Frances Jones, “Entenda a crise”.

a. Entre as fontes alternativas encontra-se o xisto, que não produz gases estufa.

A partir dessas informações e dos conhecimentos sobre a crise econômica mundial e suas consequências, pode-se afirmar corretamente que: a. As características da globalização são o fechamento das economias nacionais e o fim da pobreza.

b. Os problemas causados pelos combustíveis fósseis são facilmente resolvidos com o plantio de árvores.

b. A crise americana é uma questão local de pouca importância mundial.

c. O Brasil tem destaque na produção de energia renovável, com a grande participação do etanol, usado no transporte.

c. A crise econômico-financeira de 1929 e a eclodida em 2008 apresentam como semelhança o processo de especulação, e como diferença a rapidez de propagação entre os mercados.

d. Países como o Brasil, devido à sua localização geográfica, não podem utilizar a energia solar. e. A utilização de petróleo é pouco importante economicamente para a produção mundial de energia.

d. Os países emergentes conhecidos como BRICs ficaram imunes aos efeitos da crise de 2008, por terem registrado grande crescimento econômico.

02. O texto a seguir é sobre o contexto brasileiro de fins da década de 1880. Com base na análise do texto e nos seus conhecimentos, assinale a afirmativa correta.

e. Com a globalização, as crises econômicas são facilmente contornadas, pois a comunicação permite que providências sejam tomadas rapidamente.

Os militares republicanos eram em sua maioria oficiais em início de carreira, como os formandos da Escola Militar da Praia Vermelha, no Rio de Janeiro. A maior parte desta “mocidade militar” era composta por homens com média de 30 anos de idade, educação superior e destaque em estudos de ciências exatas.

04. A partir da análise do gráfico e dos seus conhecimentos sobre a população brasileira, assinale a afirmativa correta.

A mocidade militar escolheu para liderá-la o prestigiado major Benjamin Constant, professor de Matemática na Escola Militar e grande divulgador do positivismo entre os jovens oficiais. Segundo o positivismo, as leis das Ciências Exatas e Naturais (Química, Física, Matemática, Biologia) deveriam ser utilizadas para a compreensão e solução dos problemas sociais. Para os positivistas, só o conhecimento científico traria progresso e felicidade. Nesse sentido, proclamar a República seria uma forma de acelerar o progresso do Brasil.

CLASSES A/B 15% da população 28 milhões de pessoas com renda familiar média de 2.217 reais

CLASSE C 46% da população 86,2 milhões de pessoas com renda familiar média de 1.062 reais

Alfredo Boulos Júnior, “História”.

a. A escolha da mocidade militar resultou de estudos de alta qualidade, sobretudo das ciências humanas. b. O ideal republicano positivista buscava o progresso do país, por meio do conhecimento científico. c. A monarquia confiava na democracia e, portanto, seria ideal para a aplicação do positivismo. d. Para os militares republicanos, a manutenção da monarquia seria a melhor forma de progresso. e. Para o positivismo, o progresso é uma consequência natural da melhoria econômica de um país.

CLASSES D/E 39% da população 72,9 milhões de pessoas com renda familiar média de 580 reais

DUAILIBI, J.; BORSATO, C. Ela empurra o crescimento. Veja, São Paulo: Abril, ed, 2054, ano 41, n. 13, p. 84, 2 abr. 2008.

a. As diferenças de classes não são significativas no Brasil, uma vez que os programas sociais resolveram as dificuldades das classes D e E. b. A maior parte da população, representada no topo do gráfico, pertence às regiões Nordeste e Norte. c. A classe C é a da maior parcela da população, e é formada, em boa parte, por pessoas que subiram das classes D e E.

03. Na atual época da globalização, há uma interligação entre as economias de todas as nações, os capitais se movem em grande velocidade, bancos e empresas se associam e se fundem expoENEM 1

d. A classe C tem acesso a saúde, educação, moradia e segurança, devido aos seus rendimentos. e. As classes A e B são atendidas por programas sociais do governo, o que garante boa qualidade de vida.


05.

finem as fronteiras nacionais, que se desenha o “corpo da pátria”. É nele que se concretizam as identidades, que se manifestam as culturas, que se estabelecem os hábitos, que se consolidam os costumes, que circulam os valores ideológicos. É nele, ou por ele, que se deflagram os conflitos entre as nações, que os homens se odeiam e aniquilam uns aos outros. É no espaço que as indústrias se estabelecem, que as transações comerciais se realizam, que os indivíduos trabalham. É no espaço que os sujeitos exploram e são explorados, que transgridem normas ou se submetem a elas. É nele que os climas se materializam, que as catástrofes naturais ocorrem, que os rios correm, que as vegetações se desenvolvem, que o relevo ganha relevo.

A sociedade política é como um cabo composto de muitos fios: o fato de se acharem esses diferentes fios torcidos e enrolados uns sobre os outros aumenta não somente a força do cabo, mas também sua flexibilidade. Existem fios de interesses econômicos, fios de sentimento nacional e doméstico, fios de crença religiosa, fios de diferentes graus de experiência e educação. O próprio cabo é complexo por natureza, e mais complexo o fazem ainda os nós representados pelas dificuldades políticas que clamam solução; para uma política sã impõe-se, porém, uma condição, a saber: que não se deve recorrer ao exemplo de Alexandre, de desembainhar a espada para cortar o nó górdio. Qualquer imbecil poderá resolver os problemas do poder político pela lei marcial; mas ninguém, a não ser um imbecil, tomaria por governo semelhante processo.

Na Geografia, o espaço é físico, é econômico, é político. Não há, pois, como pensar o homem abstraindo essa categoria. Em outros termos, não há como pensá-lo senão em razão do lugar que o constitui como sujeito: o homem não dá um passo fora do espaço. O ser humano é o espaço que ele habita: sem o espaço, o homem é uma categoria abstrata; sem o homem, o espaço é vazio.

Lewis Mumford, “A condição do homem”.

A análise do texto e os conhecimentos sobre a organização das sociedades modernas possibilitam afirmar apenas que:

P. Carvalho, “Espaço, um lugar prático”.

a. As dificuldades de organização social são resolvidas com o uso da força militar do estado, o que surte efeito positivo aos cidadãos.

b. Sociedades políticas organizadas em Estados Totalitários lançam mão, com frequência, do uso da força, para enfrentar dificuldades de ordem política.

Com base no texto e nos conhecimentos sobre as diversas maneiras de conceber e refletir sobre o espaço geográfico é correto afirmar apenas que:

c. Os vários fios que formam uma sociedade são rígidos e fortes, o que mantém as pessoas unidas em torno de um propósito.

a. O espaço é o resultado da história humana, pois é a relação sociedade-natureza que cria e recria as condições para a existência do ser humano.

d. Em uma sociedade democrática, o uso da força é justificado quando uma parcela da população não tem seus interesses atendidos.

b. Os espaços globalizados criaram um mundo único onde os sujeitos da história pouco podem agir.

e. Os nós, comuns às sociedades modernas, são resultado da falta de interesse, por parte dos jovens, pela política.

c. O relevo possui pouca relação com os componentes do espaço geográfico, sobretudo o econômico. d. Os resultados das intervenções humanas no espaço trouxeram progresso para toda a humanidade, sem prejuízos para a natureza.

06. O espaço é uma categoria fundamental no discurso geográfico: é no espaço que se constrói o imaginário territorial, que se de-

e. A produção do espaço é resultado exclusivo do capital e das relações de trabalho.

07. Com base na análise do mapa e nos conhecimentos sobre os aspectos sociais, políticos, econômicos e culturais da América Latina, pode-se afirmar corretamente que: US$ 626 bi (+3,8%) US$ bi — PIB (+%) — Variação do PIB para 2005 (projeção)

México Pop.: 106,1 milhões

República Dominicana Honduras

Guatemala El Salvador Nicarágua Costa Rica Panamá

US$ 85 bi (+6,5%)

US$ 79 bi (+3,5%)

Colômbia Pop.: 46 milhões

— População*

US$ 492 bi (+4,0%)

Venezuela Pop.: 26,6 milhões

US$ 27 bi (+3,4%) Equador Pop.: 13,2 milhões

US$ 60,6 bi (+4,5%)

Peru Pop.: 27,9 milhões US$ 8 bi (+3,0%)

Chile Pop.: 6,2 milhões US$ 72 bi (+6,2%)

Bolívia Pop.: 6,2 milhões

US$ 6 bi (+3,0%) Paraguai Pop.: 6,2 milhões US$ 130 bi (+6,5%)

Argentina Pop.: 38,6 milhões (*) Os dados da população são estimativas para 2005; os valores do PIB são de 2003 e estão convertidos para dólares americanos pelo câmbio médio daquele ano; a projeção para a variação do PIB em 2005 é da Cepal Fontes: Cepal (Comissão Econômica para a América Latina e o Caribe) e Banco Mundial

Brasil Pop.: 187,6 milhões

Uruguai Pop.: 6,2 milhões US$ 11 bi (+6,0%)

MOTA, Vinícius. Decolagem turbulenta na América Latina. Folha de S. Paulo, São Paulo, 29 de maio 2005. Mundo, p. A 26.

expoENEM 2


a. Os países da América Latina, em sua maioria, são de língua portuguesa, devido ao processo de colonização.

10. A meta é clara: reduzir à metade, para 2015, a porcentagem de pessoas que sobrevivem com menos de um dólar por dia e que passam fome. É um duplo objetivo alcançável, diz a ONU, ainda que ambicioso, porque a pobreza extrema afeta cerca de um bilhão de seres humanos, e a fome, 815 milhões. As crianças são as mais vulneráveis ante esta situação, porque a falta de alimentos pode acabar com suas vidas ou retardar seu desenvolvimento físico e mental.

b. A economia dos países latino-americanos está baseada na produção industrial, com destaque para a indústria da comunicação. c. Depois de um longo período vivendo sob a ditadura de governos militares, a America Latina encontrou o caminho do desenvolvimento econômico e social baseado no setor primário. d. O PIB dos países da América Latina é equivalente aos dos países que compõem o G8, devido à grande capacidade daqueles na geração de emprego e renda.

[...] A ONU adverte que as guerras e outros conflitos armados minimizam a eficácia dos esforços para erradicar a pobreza e a fome no mundo. Ocorreram 13 milhões de mortes entre 1994 e 2003, ao que se somam 37 milhões de refugiados e desaparecidos [...].

e. Entre os maiores problemas enfrentados pelos países da América Latina, está o da concentração de renda, sendo o Brasil um dos mais afetados por esse desequilíbrio.

“Pobreza extrema e fome: 25% das crianças do Terceiro Mundo são subnutridas”. A Tarde, Salvador, 1 jun. 2005. Caderno Internacional.

08.

Considerando-se o texto e os conhecimentos sobre a situação atual da pobreza em nível mundial, assinale a afirmativa verdadeira.

Até 1866, pode-se dizer que a escravidão era tanto res integra [coisa correta], como era res sacra [coisa sagrada]. Algumas vozes se levantaram em todo tempo contra o cativeiro, mas tinham ficado sem repercussão, não tinham chegado aos ouvidos nem dos senhores nem dos escravos, interceptadas como eram pela impenetrável camada política exterior, que isolava a escravidão nos seus latifúndios.

a. A fome é um problema mundial sem solução, pois além das questões econômicas existem problemas ambientais de difícil solução. b. As guerras são um obstáculo para a erradicação da fome no mundo, devido à utilização de crianças nas áreas de combate. c. Diminuir a fome é um objetivo que pode ser alcançado, mesmo que ainda seja necessário superar dificuldades suplementares, como as guerras e os conflitos armados.

Joaquim Nabuco, “Um estadista do Império”.

d. Mesmo com os problemas presentes na atualidade, a ONU acredita que até 2015 a fome será erradicada do planeta.

Com base na análise do texto e em seus conhecimentos sobre o processo da abolição da escravidão no Brasil, pode-se afirmar corretamente que: a. A escravidão possuía caráter somente religioso e era vista pela sociedade como uma maneira correta de utilizar o trabalho dos negros.

e. A fome é um problema que afeta apenas os países africanos e da América Latina, sendo, portanto, de origem histórica. 11. Somos a maior ‘nação solar’ do planeta Terra. Nenhum outro país detém tanta água doce – a contrapartida da energia solar para a formação dos hidratos de carbono, ou seja, da biomassa.

b. No Brasil a escravidão foi proibida já na chegada da família real, que mantinha estreitas relações econômicas com a Inglaterra, a qual era contra a escravidão. c. Os interesses pela abolição no Brasil variaram conforme a neces-sidade do trabalho escravo, utilizado principalmente pelos produ-tores agrícolas.

G. F. Vasconcellos & J. W. Bautista Vidal, “O poder dos trópicos”.

d. A escravidão teve fim devido aos altos custos para a manutenção dos escravos, que passaram a ter mais direitos após a declaração de independência.

a. A energia solar só pode ser utilizada em países onde os índices pluviométricos são elevados, como é o caso de todo o Brasil. b. A água é um recurso renovável que tem sua distribuição igual em todos os lugares da Terra; a falta de água está relacionada a questões políticas.

e. O Brasil foi o primeiro país a abolir a escravidão o que serviu de exemplo para outros países da América Latina.

c. Segundo o texto, a biomassa deverá substituir, no longo prazo, o uso de combustíveis fósseis, como o petróleo e o etanol.

09. [...] as migrações oceânicas, voluntárias e involuntárias (escravos), trouxeram muita morte e infortúnio ao mundo. Mas também, riquezas e oportunidades para os europeus, tanto para os que retornaram quanto para os que ficaram. Essa é a lei da migração em sociedades de mercado: pessoas saem de seus países para melhorar de situação e, assim fazendo, aumentam o poder de barganha dos que ficaram; [...].

d. O Brasil é um país com grande potencial para a produção de biomassa. e. A biomassa referida no texto trata da produção de cana-de-açúcar, que é uma planta xerófila e de grande produtividade. 12.

David Landes, “A riqueza e a pobreza das nações”.

Considerando-se o texto e os conhecimentos sobre os processos migratórios, assinale a alternativa verdadeira. a. As migrações humanas entre países são uma prática comum e tolerada por muitos países desenvolvidos, como os EUA e a Inglaterra. b. Os escravos trazidos para o Brasil caracterizam um tipo de migração forçada, porém pode-se afirmar que tal migração foi benéfica para os mesmos. c. A migração pendular tem destaque nos dias atuais, sobretudo entre as grandes cidades e suas respectivas regiões metropolitanas. d. Atualmente não há mais migrações forçadas, devido ao fim da escravidão e dos conflitos étnicos no mundo globalizado.

Considerando as informações do texto e os seus conhecimentos, assinale a afirmativa correta.

Número e porcentagem de empregos formais gerados em Montes Claros, em 2006 SETOR

VAGAS

%

Indústria

9 897

18.02

Construção Civil

3 237

5.89

Comércio

15 094

27.49

Serviços

24 831

45.23

Agropecuária

1 850

3.37

Total

54 909

100

  Fonte: GOMES, 2009.

e. A chegada dos imigrantes italianos no Brasil caracteriza um tipo de migração inter-regional, pois saíram do sul da Itália e se instalaram no Sul do Brasil. expoENEM 3

A análise da tabela e seus conhecimentos sobre os setores da economia permitem afirmar que: a. Em 2006, o setor que menos gerou empregos em Montes Claros foi o terciário, caracterizado pela produção agropecuária


b. O setor primário é responsável por empregar pessoas altamente qualificadas, principalmente nas áreas de informática e robótica.

dormir. Entrava por sua vez a dança de lampiões da China e da Sibéria. Depois vinha a vez dos acendedores de lampiões da Rússia e das Índias. Depois os da África e da Europa. Depois da América.

c. Em 2006, Montes Claros tinha mais da metade dos empregos formais no setor secundário.

E jamais se enganavam na ordem de entrada, quando apareciam em cena. Era um espetáculo grandioso.

d. Empregos formais são temporários, sem registro em carteira e sem reconhecimento dos direitos do trabalhador. e. Em 2006, mais da metade dos empregos formais de Montes Claros estavam no setor terciário.

Antoine de Saint-Exupéry, “O Pequeno Príncipe”.

Este trecho revela uma ordem na iluminação da Terra. Com relação ao movimento apresentado no texto, marque a alternativa verdadeira. a. O movimento de rotação faz com que ocorram as estações do ano e também determina o ano bissexto.

13. Analise o gráfico. Mortalidade Infantil no Brasil 40

b. A rotação da Terra se faz de Leste para Oeste e dura cerca de 24 horas.

39,6

39

38,4

38

c. A alternância de dia e noite é consequência do movimento de rotação que a Terra realiza em um período de aproximadamente 24 horas.

37,5

37

36,7

36

36,1

35,6

35

d. Nos meses de inverno, a rotação da Terra faz com que as noites sejam mais longas e os dias mais curtos no Hemisfério Sul.

35,3

34

e. Os equinócios de outono e verão são consequências do movimento de rotação.

2000

1999

1998

1997

1996

1995

1984

33 Fonte: IBGE, 2000

Com base no gráfico, e utilizando seus conhecimentos, pode-se inferir que:

16. A cidade, locus do cidadão e da cidadania, é um mundo de transformações rápidas e vida agitada. Sobre a cidade e as relações sociais nela existentes, marque a alternativa correta. a. As cidades grandes são dominadas economicamente pelo setor primário.

a. A taxa de mortalidade infantil caiu no período devido à diminuição da taxa de natalidade.

b. O acesso aos avanços na área de saúde é homogêneo para os cidadãos das grandes cidades.

b. Em países como o Brasil a mortalidade infantil é baixa devido ao poder de consumo de grande parte da população.

c. A cidade oferece as mesmas oportunidades às várias camadas sociais que nela vivem.

c. A queda na mortalidade infantil está relacionada à melhoria da qualidade de vida da população brasileira, e à vida nas cidades.

d. As regiões metropolitanas são caracterizadas, entre outros elementos, pelo fenômeno da conurbação.

d. Com a legalização do aborto na Constituição de 1988 a mortalidade vem diminuindo ano após ano.

e. Cidades globais são aquelas que possuem mais de dez milhões de habitantes, que em sua maioria trabalham nos setor terciário.

e. O gráfico mostra que a queda da mortalidade no Brasil é resultado dos programas oficiais de controle da natalidade. 14. O movimento de translação é a órbita que a Terra percorre ao redor do Sol. Essa trajetória é realizada em 365 dias, 5 horas, 48 minutos e 48 segundos, a uma velocidade média de 29,9 km/s. Devido à inclinação do eixo da Terra em relação ao plano de sua órbita, o planeta é iluminado de maneira diferente pelo Sol, em determinadas e diferentes épocas do ano, o que ocasiona as quatro estações do ano.

17. A concentração da população em determinadas áreas é geralmente explicada pelas condições naturais. Com base na distribuição mundial da população, assinale a alternativa correta. a. As áreas ecúmenas são aquelas com grande concentração populacional, devido à disponibilidade de recursos naturais. b. A distribuição da população mundial é determinada por questões religiosas e naturais.

Analisando o texto, e com base em seus conhecimentos sobre os movimentos da Terra e suas consequências, marque a alternativa correta.

c. As áreas anecúmenas são fracamente povoadas, devido a alguns fatores; entre eles, as condições naturais são o fator mais importante.

a. O movimento de translação é responsável, além das estações do ano, pela alternância dos dias e noites.

d. Um país povoado é aquele que possui grande número de habitantes, como é o caso do Brasil.

b. No Brasil, o equinócio de verão tem início no dia 21 de dezembro, quando o dia é mais longo que a noite.

e. A distribuição da população mundial é homogênea, devido aos avanços tecnológicos, que permitiram o domínio das condições naturais.

c. Os solstícios de inverno e outono têm duração aproximada de noventa dias. d. Quando tem início o solstício de verão no Hemisfério Sul, no Hemisfério Norte começa o solstício de inverno.

18. PAÍS

e. Durante os solstícios ocorrem os eclipses totais do Sol, e durante os equinócios, os eclipses da Lua. 15. A terra não é um planeta qualquer! [...] Para dar-lhes uma ideia das dimensões da Terra, eu lhes direi que, antes da invenção da eletricidade, era necessário manter, para o conjunto dos seis continentes, um verdadeiro exército de acendedores de lampião. Isso fazia, visto um pouco de longe, um magnífico efeito. [...]

Primeiro vinha a vez dos acendedores de lampião da Nova Zelândia e da Austrália. Esses, em seguida, acesos os lampiões, iam expoENEM 4

JOVENS (%)

ADULTOS (%)

IDOSOS (%)

EXPECTATIVA DE VIDA (ANOS)

A

18

49

33

77

B

21,5

53

25,5

76

C

45,5

50,5

4

43

Com base na tabela e em seus conhecimentos, assinale a alternativa correta. a. O país C possui a maior parte de sua população composta por mulheres jovens entre 10 e 24 anos. b. A é um país subdesenvolvido, com grande participação de trabalhadores no setor primário.


c. B é o país com maior número de jovens em idade escolar e com baixa esperança de vida.

d. os contatos com a sociedade nacional têm impedido a conservação da memória e dos costumes dos quilombolas em regiões como a do Sertão de Valongo.

d. A é o país com maior expectativa de vida, devido à população viver no campo. e. C é o país com menor qualidade de vida, o que está demonstrado no gráfico pela menor expectativa de vida e menor número de idosos.

e. a permanência de referenciais culturais que expressam a ancestralidade negra compromete o desenvolvimento econômico da região. 22. (Enem 2009) NORMALIDADE II – QUINO

19. Migrar temporariamente não significa apenas mudar física e geograficamente, mas principalmente alterar códigos, universos simbólicos, visões de mundo e comportamentos. Assinale a alternativa que melhor reflete esse enunciado. a. As migrações são um fenômeno recente, devido a diferenças econômicas entre países pobres e ricos. b. A migração dentro de um mesmo país recebe o nome de inter-regional, e no caso brasileiro se deve a questões religiosas. c. Quando migra, um indivíduo encontra dificuldades de comunicação, sobretudo devido aos diversos hábitos e costumes. d. Hoje a tipo de migração mais comum no Brasil é a transumância, caracterizada por movimentos sazonais. e. Nas últimas décadas, o Brasil deixou de ser um país de emigrantes e se tornou um país de imigrantes, rumo aos países ricos. 20. Em 2008, foi relembrada e comemorada uma data especialmente importante na história brasileira: os 200 anos da chegada da família real ao Brasil e da consequente transferência da capital do Reino para o Rio de Janeiro. A decisão de abandonar Portugal e vir para o Brasil, deveu-se:   

a. ao grande desenvolvimento econômico que o Brasil apresentava, com o comércio de escravos e drogas do sertão.

“Eu não vou mais precisar de muita força, vou usar todas as que tenho agora” – ele pensou. E ele se lembrou das moscas que rebentam suas perninhas ao tentarem escapar do mata-moscas.

b. a D. João VI querer ampliar sua influência na América, com a transferência da Corte para o Brasil. c. às constantes tentativas de outras potências para colonizar o Brasil, sendo necessária a presença do rei de Portugal na sua mais importante colônia. d. às doenças que afetavam a Europa e não existiam no Brasil; a família real, com muitos membros de saúde frágil, veio em busca de condições mais saudáveis e clima mais agradável.

Franz Kafka, “O processo”.

e. ao avanço militar dos franceses sobre a Península Ibérica; a corte portuguesa se viu obrigada a fugir de seu país e vir para o Brasil, sob a proteção da Inglaterra.

O Controle Social pode ser tomado como um conjunto de penalidades e aprovações, chamadas também de sanções. Estas são aplicadas aos indivíduos pela sociedade para assegurar a conformidade das condutas aos modelos estabelecidos. A imagem e o texto destacam aspectos relativos: a. à garantia de liberdade coletiva pelo uso da força. b. aos anseios idealistas utópicos perante as convenções sociais.

21. (Enem 2009) A Superintendência Regional do Instituto do Patrimônio Histórico e Artístico Nacional (Iphan) desenvolveu o projeto “Comunidades Negras de Santa Catarina”, que tem como objetivo preservar a memória do povo afrodescendente no Sul do país. A ancestralidade negra é abordada em suas diversas dimensões: arqueológica, arquitetônica, paisagística e imaterial. Em regiões como a do Sertão de Valongo, na cidade de Porto Belo, a fixação dos primeiros habitantes ocorreu imediatamente após a abolição da escravidão no Brasil. O Iphan identificou nessa região um total de 19 referências culturais, como os conhecimentos tradicionais de ervas de chá, o plantio agroecológico de bananas e os cultos adventistas de adoração.

c. à natureza imitadora da maioria dos indivíduos diante das instituições sociais. d. à possibilidade de reação e reversão de processos condicionantes. e. às relações de poder presentes nas sociedades. 23. (Enem 2009) Sigo o destino que me é imposto. Depois de decênios de domínio e espoliação dos grupos econômicos e financeiros internacionais, fiz-me chefe de uma revolução e venci. Iniciei o trabalho de libertação e instaurei o regime de liberdade social. Tive de renunciar. Voltei ao governo nos braços do povo. [...] Quis criar liberdade nacional na potencialização das nossas riquezas através da Petrobrás, mal começa esta a funcionar, a onda de agitação se avoluma.

Texto adaptado. Disponível em: <http://portal.iphan.gov.br/portal/>.

Disponível em: <http://www.filosofia.com.br/figuras/charge/49.jpg>.

O texto acima permite analisar a relação entre cultura e memória, demonstrando que: a. as referências culturais da população afrodescendente estiveram ausentes no Sul do país, cuja composição étnica se restringe aos brancos. b. a preservação dos saberes das comunidades afrodescendentes constitui importante elemento na construção da identidade e da diversidade cultural do país.

Getúlio Vargas, “Carta Testamento”.

c. a sobrevivência da cultura negra está baseada no isolamento das comunidades tradicionais, com proibição de alterações em seus costumes. expoENEM 5

O contexto político tratado refere-se a um significativo período da história do Brasil, o 2°. Governo de Vargas (1951-1954), que foi marcado pelo aumento da infiltração do Partido Comunista Brasileiro (PCB) nos sindicatos e pelo distanciamento entre Getúlio e os militares que o haviam apoiado durante o Estado Novo. O conteúdo da carta testamento de Getúlio aponta para a:


a. existência de um conflito ideológico entre as forças nacionais e a pressão do capital internacional.

Tá ligado? Dicas de estudo Lembre-se de que seus professores são preparados para responder quaisquer questões pertinentes. Pergunte sempre e não vá para casa com dúvidas. Não tenha receio de levantar a mão e perguntar quando não entender algo, ou ainda quando a explicação do professor não tiver resolvido as suas dúvidas. Durante as aulas, procure fazer ligações entre o conteúdo e a sua realidade, pois a ciência serve para compreendermos o mundo em que vivemos. Use as redes sociais como meio para debates e discussões sobre temas atuais e passados. Certamente há muita gente que pode contribuir com seu aprendizado. Procure ficar informado sobre o que acontece no mundo com relação às questões econômicas, políticas e sociais. Reserve algumas horas do seu dia para ler: a leitura abre caminho para o entendimento da realidade.

b. tendência de instalação de um governo com o apoio do povo e sob a égide das privatizações. c. construção de um pacto entre o governo e a oposição visando fortalecer a Petrobrás. d. iminência de um golpe protagonizado pelo Partido Comunista Brasileiro (PCB). e. pressão dos militares contra o monopólio estatal sobre a explo-ração e a comercialização do petróleo. 24. (Enem 2009) Em fevereiro de 1999, o Seminário Internacional sobre Direito Ambiental, ocorrido em Bilbao, na Espanha, propôs, na Declaração de Viscaia, a extensão dos direitos humanos ao meio ambiente, como instrumento de alcance universal. No parágrafo 3°. do artigo 1°. da referida declaração, fica estabelecido: “O direito ao meio ambiente deverá ser exercido de forma compatível com os demais direitos humanos, entre os quais o direito ao desenvolvimento.” No Brasil, o cumprimento desse direito configura um grande desafio. Na Região Amazônica, por exemplo, tem havido uma coincidência entre as linhas de desmatamento e as novas fronteiras de desenvolvimento do agronegócio, marcadas por focos de injustiça ambiental, com frequentes casos de escravização de trabalhadores, além de conflitos e crimes pela posse de terras, muitas vezes, impunes.

26. A Teoria da Deriva dos Continentes, elaborada pelo geofísico alemão Alfred Weneger, e a Teoria da Tectônica de Placas são os dois modelos teóricos das geociências que, no século XX, causaram uma revolução de conceitos, sobretudo quanto aos processos geológicos internos. Sobre essas teorias e os agentes internos da Terra, pode-se afirmar que: a. a Teoria da Deriva dos Continentes propõe que o posicionamento relativo das massas continentais não mudou consideravelmente ao longo do tempo geológico. b. os aspectos paleoclimáticos apresentados por Weneger para a Teoria da Deriva dos Continentes não podem ser empregados como fatores favoráveis à Teoria da Tectônica de Placas. c. as forças endógenas produzem movimentos muito lentos, dentre os quais se destaca o movimento tectônico das placas, o qual causa um acúmulo de forças de proporções gigantescas e pressões intensas (esforço tectônico) que, ao atingir o limite de resistência das rochas, produz violentos tremores em poucos segundos; tais tremores, quando ocorrem no fundo dos oceanos, produzem ondas sísmicas, que se deslocam com grande velocidade. d. nos terremotos do Haiti e do Chile, no início de 2010, os abalos tiveram origem em hipocentros, locais de grande profundidade, emissores de ondas sísmicas que se manifestaram em pontos da superfície denominadas epicentros; em ambos os casos, nas regiões dos epicentros o número de vítimas foi grande. e. o vulcanismo é um dos processos da dinâmica terrestre que sempre encantou e amedrontou a humanidade, existindo diversos registros históricos referentes; sabe-se que as atividades vulcânicas trazem novos materiais para locais próximos à superfície terrestre, sendo um dos poucos processos de liberação de energia interna que continuará ocorrendo indefinidamente na história evolutiva da Terra.

Disponível em: <http://www.unicen.com.br/universoverde>.

Promover justiça ambiental, no caso da Região Amazônica brasileira, implica: a. fortalecer a ação fiscalizadora do Estado e viabilizar políticas de desenvolvimento sustentável. b. ampliar o mercado informal de trabalho para a população com baixa qualificação profissional. c. incentivar a ocupação das terras pelo Estado brasileiro, em face dos interesses internacionais. d. promover alternativas de desenvolvimento em razão da precariedade tecnológica local.

sustentável,

e. ampliar a importância do agronegócio nas áreas de conflito pela posse de terras e combater a violência no campo. 25. (Enem 2009) O homem construiu sua história por meio do constante processo de ocupação e transformação do espaço natural. Na verdade, o que variou, nos diversos momentos da experiência humana, foi a intensidade dessa exploração. Disponível em: <http://www.simposioreformaagraria.propp.ufu.br> Acesso em: 09 jul. 2009

Uma das consequências que pode ser atribuída à crescente intensificação da exploração de recursos naturais, facilitada pelo desenvolvimento tecnológico ao longo da história, é:

27. Rochas são agregados naturais formados por um ou mais minerais. Alitosfera, camada externa sólida da Terra, é constituída, sobretudo, por rochas. De acordo com a origem, as rochas classificam-se como: magmáticas, sedimentares ou metamórficas. Sobre as rochas encontradas na crosta terrestre, pode-se afirmar que:

a. a diminuição do comércio entre países e regiões, que se tornaram autossuficientes na produção de bens e serviços. b. a ocorrência de desastres ambientais de grandes proporções, como no caso de derramamento de óleo por navios petroleiros. c. a melhora generalizada das condições de vida da população mundial, a partir da eliminação das desigualdades econômicas na atualidade. d. o desmatamento, que eliminou grandes extensões de diversos biomas improdutivos, cujas áreas passaram a ser ocupadas por centros industriais modernos. e. o aumento demográfico mundial, sobretudo nos países mais desenvolvidos, que apresentam altas taxas de crescimento vegetativo. expoENEM 6

a. as rochas não apresentam sempre o mesmo aspecto, o qual decorre da ação dos seguintes fatores: origem, composição química, textura e estrutura das rochas. b. as rochas vulcânicas, ao contrário das sedimentares, caracterizam- se pela abundância de poros e de fósseis, pois se formam na superfície da crosta. c. o granito é a mais comum das rochas intrusivas; caracteriza-se pela textura desorientada e granulação grossa; no Brasil, os granitos surgem em terrenos sedimentares. d. as ocorrências de rochas basálticas (encontradas somente no Sul do Brasil) testemunham fases de vulcanismo em diferentes idades, em face da complexa dinâmica da crosta. e. as rochas sedimentares clásticas ou detríticas (como por exemplo o mármore) são aquelas que resultam da precipitação de determinados compostos químicos.


28.

tra opção a não ser se estabelecerem em áreas de risco, constantemente sujeitas à ocorrência de deslizamentos, fenômenos provocados pelo escorregamento de materiais sólidos. Com base na figura e nos seus conhecimentos sobre os deslizamentos, pode-se afirmar que: a. afetam exclusivamente as áreas situadas em alta declividade. b. estão associados a tremores de terra, que desestabilizam as encostas e podem levar à morte um grande número de pessoas. c. sofrem pouca influência da retirada da vegetação, uma vez que a alta impermeabilização dos solos nas áreas de favela reduz a infiltração de água e, consequentemente, a ocorrência de desastres naturais. d. o poder público não tem responsabilidades nesses processos, pois a decisão de ocupar as encostas é dos próprios moradores. e. o tipo de solo, a declividade da encosta e a intensidade das chuvas influenciam no risco de deslizamentos.

O solo não é estável, nem inerte; muito pelo contrário: constitui um meio complexo em perpétua transformação, submetendo-se a leis próprias que regem sua formação, sua evolução e sua destruição. Forma-se no ponto de contato da atmosfera, da litosfera e da biosfera; participa intimamente nesses mundos tão diversos, pois mantém relações constitutivas com o mundo mineral, assim como com os seres vivos. Jean Dorst, “Antes que a natureza morra”.

Sobre os solos e a sua sustentabilidade, é possível afirmar que: a. os solos se desenvolvem por um lento processo de intemperismo físico e químico sobre uma determinada rocha, e sob a influência dos seres vivos, porém não do clima. b. a ação erosiva da água no solo ocorre quando, em vez de escoar superficialmente, sem qualquer empecilho, ela infiltra-se no subsolo. c. em áreas desmatadas, a velocidade de escoamento superficial é acelerada, e a água diminui sua capacidade de transportar partículas sólidas em suspensão. d. substâncias químicas provenientes de indústrias e agrotóxicos podem poluir o solo, mas felizmente o subsolo, devido à sua maior profundidade, está a salvo desses tipos de contaminações. e. a não exposição dos solos às intempéries e a adoção de medidas que reduzam a velocidade de escoamento superficial das águas diminuem a erosão.

30. Os elementos climáticos são os fenômenos meteorológicos básicos para definir o clima de uma região. Os fatores climáticos são os responsáveis pelas características ou modificações dos elementos do clima. Com base nos fatores climáticos, marque a alternativa correta. a. Regiões situadas em altas latitudes recebem maior quantidade e intensidade de radiações solares, devido à inclinação da Terra – e por isso são as mais quentes do globo.

29. Observe a figura a seguir. © Agência Brasil

b. A altitude compensa a latitude, principalmente em função da menor quantidade de moléculas de oxigênio para reter o calor – assim o ar rarefeito das altas montanhas é frio em qualquer latitude. c. Correntes marítimas quentes, ao passarem nas proximidades de litorais, contribuem para o surgimento de desertos, já que a massa de ar sobre elas é mais seca e dificulta a chegada de massas úmidas ao continente – como ocorre, por exemplo, na relação entre a Corrente de Humboldt e o deserto do Atacama. d. A continentalidade faz com que a amplitude térmica seja menor, pois o continente tende a aquecer-se e resfriar-se mais lentamente do que o mar. Por isso, o Hemisfério Norte, que tem mais terras do que águas, possui temperaturas menos extremas do que o Hemisfério Sul.

e. O relevo influencia no clima ao criar barreiras naturais ou corredores para o trânsito das massas de ar. A disposição das montanhas na Ásia, por exemplo, facilita a chegada das massas frias do Polo Norte até a região equatorial – ao contrário da América, onde as barreiras naturais do relevo dificultam tal trânsito.

A moradia é um dos direitos fundamentais do ser humano. No entanto, desigualdade e exclusão sociais acabam gerando bolsões de pobreza, cujos moradores não têm ou-

31. O climograma é uma representação gráfica que permite uma compreensão do perfil climático de determinada região.

Os climogramas abaixo referem-se a três localidades de diferentes partes do mundo. Precipitações (mm) 1000

Temperatura Precipitações (°C) (mm) 50 1000

Temperatura Precipitações (°C) (mm) 50 1000

Temperatura (°C) 50

900

45

900

45

900

45

800

40

800

40

800

40

700

35

700

35

700

35

600

30

600

30

600

30

500

25

500

25

500

25

400

20

400

20

400

20

300

15

300

15

300

15

200

10

200

10

200

10

100

5

100

5

100

5

0

0

0

0

0

J F M A M J J A S O N D LOCALIDADE  I

J F M A M J J A S O N D LOCALIDADE  II

A sua análise permite afirmar que: a. os climogramas das localidades I e II referem-se a climas do Hemisfério Norte e o climograma da localidade III, ao clima do Hemisfério Sul. b. nas localidades II e III, a amplitude térmica é pequena, caracterís-tica de climas temperados. expoENEM 7

J F M A M J J A S O N D

0

LOCALIDADE  III

c. a menor amplitude térmica está na localidade II e a maior amplitude pluviométrica está na localidade I. d. o pequeno volume pluviométrico do inverno, na localidade III, caracteriza o clima mediterrâneo. e. na localidade I, o inverno apresenta grande pluviosidade, sendo característico do clima tropical.


32. As formações vegetais encontradas na superfície terrestre sofrem influências diretas e indiretas de vários fatores estáticos e dinâmicos. Com relação às diferentes formações vegetais ou domínios e aos fatores que as caracterizam, é correto afirmar que:

econômico da região, é considerado por muitos políticos como “o preço do progresso”. Essa devastação da floresta causa grandes impactos ambientais, mas não chega a atingir as populações que vivem nessa área.

a. a altitude e a latitude são dois fatores dinâmicos que influenciam consideravelmente a distribuição das espécies vegetais sobre a superfície terrestre, propiciando uma zonação fitogeográfica.

b. O Pantanal Mato-Grossense é um dos patrimônios ecológicos da humanidade, segundo a ONU. A complexa formação natural dessa região, que lembra aspectos do Cerrado, da Floresta Amazônica e de campos, favorece a atividade turística.

b. nos ambientes tropicais, a existência dos solos lateríticos é a principal condição para que se desenvolvam as florestas latifoliadas perenifólias, em face da facilidade à penetração das raízes das árvores.

c. A Caatinga ocupa aproximadamente 11% do território brasileiro, sendo o sertão nordestino a típica representação desta paisagem natural. O clima seco, devido às chuvas escassas e ao solo árido, impede o cultivo de alimentos, mesmo utilizando técnicas modernas de irrigação.

c. no domínio das florestas equatoriais, o clima é permanentemente quente, e a amplitude térmica anual não ultrapassa 6°C; as chuvas são abundantes, de origem convectiva; nesse ambiente de calor e umidade, desenvolveu-se a maior diversidade vegetal do globo.

d. O Cerrado é a paisagem natural brasileira que sofreu menor transformação nos últimos 10 anos. O agronegócio, impulsionado pela possibilidade do plantio de soja nessa área, vem causando impactos ambientais insignificantes.

d. no domínio dos desertos e semidesertos, o total anual de precipitação é superior a 500 mm, muito mal distribuída; ocorre falta de umidade do ar e pequenas amplitudes térmicas diárias.

e. O domínio de pradarias tradicionalmente denominado de Pampa Gaúcho caracteriza-se pela vegetação herbácea, típica de climas temperados e subtropicais. É uma área propícia ao desenvolvimento da pecuária e da agricultura comercial, não tendo sofrido problemas ambientais significativos.

e. no domínio das florestas de folhas caducas, as precipitações são bem distribuídas e as temperaturas são elevadas o ano todo; primitivamente dominavam grandes extensões de florestas abertas, de espécies caducifólias, também chamadas decíduas. 33. De acordo com o IBGE, o bioma é “um conjunto de vida (vegetal e animal) constituído pelo agrupamento de tipos de vegetação contíguos e identificáveis em escala regional, com condições geoclimáticas similares e história compartilhada de mudanças, o que resulta em uma diversidade própria”.

35. O Brasil é dotado de uma vasta rede hidrográfica. Muitos de seus rios destacam-se pela extensão, largura, profundidade e volume de água es-coado, tornando o país detentor de uma das maiores reservas de água doce do mundo. Apesar desta realidade, o país já enfrenta problemas no que concerne ao abastecimento urbano de água potável, além de conflitos no campo pela distribuição de água para agricultura e pecuária. A respeito da hidrografia brasileira, é possível afirmar que:

BIOMA AMAZÔNIA

a. a Bacia Amazônica, a mais vasta do mundo, tem grande potencial hidrelétrico, contudo não há hidroelétrica construída ou em construção, devido aos problemas ambientais.

BIOMA CAATINGA

b. as bacias do Rio Paraná e do Rio São Francisco, em que predominam rios de planalto, têm elevado poder hidrelétrico, e nelas estão instaladas muitas das grandes hidrelétricas do país.

BIOMA CERRADO BIOMA PANTANAL

c. as bacias Platina, Amazônica e do São Francisco são genuinamente brasileiras, pois seus rios formadores, seus afluentes e subafluentes banham apenas território brasileiro.

BIOMA MATA ATLÂNTICA

d. embora o Brasil tenha grande riqueza fluvial, é desprovido de aquíferos.

BIOMA PAMPA

e. a bacia hidrográfica que banha o Pantanal Mato-Grossense é a do Rio Paraná.

Mapa 1: Biomas brasileiros

Com base no texto, no mapa e nos conhecimentos sobre o tema, pode--se afirmar que: a. a Mata Atlântica e a Amazônia são exemplos de biomas florestais, formados por plantas caducifólias e higrófitas. b. o bioma do Cerrado é uma formação vegetal na qual estão presentes o estrato arbóreo, composto em grande parte por árvores de pequena altura, troncos retorcidos e recobertos por cascas grossas, e abundante vegetação herbácea.

36. O grande vazamento de petróleo no Golfo do México, em 2010, chamou a atenção para os grandes problemas ambientais dos oceanos. A “crise ambiental oceânica”, contudo, é resultado de uma série de fatores, dentre eles o desaparecimento da vida marinha.

Nesse sentido, surgem “zonas mortas”, que contribuem para a extinção dos ecossistemas marinhos.

Assinale a única alternativa correta sobre as origens e causas das zonas mortas.

c. o bioma da Mata Atlântica é composto apenas por florestas tropicais latifoliadas, nas quais predomina o estrato herbáceo, onde se instalam as bromélias epífitas e as orquídeas. d. o bioma da Caatinga apresenta plantas com atividade decidual, raízes profundas e mecanismos de adaptação que minimizam a evapotranspiração, permitindo maior capacidade de sobrevivência em face do solo e do clima, e por isso as plantas são predominantemente tropófitas e latifoliadas. e. o bioma do Pampa, característico do clima tropical, é constituído pre-dominantemente de gramíneas. 34. Sobre as grandes paisagens naturais brasileiras e a ação antrópica nas mesmas, assinale a única alternativa correta. a. O desmatamento da Floresta Amazônica, para o desenvolvimento expoENEM 8

a. A contaminação das águas litorâneas pelo excesso de chorume (fósforo e oxigênio) contido nos depósitos de lixo litorâneos. b. As zonas mortas concentram-se principalmente nos litorais: do Atlântico e do Pacífico dos EUA; dos países africanos; do litoral antártico e dos países banhados pelo Mar de Aral, isto é, onde as atividades industriais e agrícolas são mais marcantes. c. Nos últimos cinquenta anos, a população mundial triplicou, e o consumo de frutos do mar aumentou dez vezes. A natureza não está conseguindo repor os estoques pesqueiros além da capacidade de recuperação das populações. d. Essas zonas são causadas pela redução do oxigênio, decorren-te da decomposição de algas, que proliferam devido aos resíduos orgânicos, ao fósforo e ao nitrogênio despejados no mar pelas atividades industriais e agrícolas.


e. Uma zona morta surge quando a concentração de nitrogênio é insuficiente para a manutenção da vida, exceto para algumas bactérias.

a. A crise que assolou o mundo nos últimos anos atingiu principal-mente os países em desenvolvimento. Após a crise, os países desenvolvidos voltaram a crescer de maneira mais acentuada do que a China, a Índia e o Brasil.

37. Leia os textos a seguir:

b. Existe nos países do Norte, desenvolvidos, uma distribuição equitativa entre as populações rural e urbana, sendo a sociedade de consumo altamente expressiva.

A natureza do conflito mudou. O século vinte, o mais sangrento da história da humanidade, foi definido, primeiro, pelas guerras entre países e, depois, pelos receios da guerra fria de confronto violento entre duas superpotências. Agora, esses receios deram lugar aos medos das guerras locais e regionais, travadas predominantemente em países pobres, no interior de Estados fracos ou falidos e com pequenas armas como as preferidas. A maioria das vítimas das guerras de hoje é civil. Há menos conflitos no mundo hoje do que em 1990, mas a parcela desses conflitos que ocorre em países pobres aumentou.

c. A desigualdade em algumas regiões é cada vez maior. A África Subsaariana, por exemplo, está cada vez mais afastada da economia global, apesar de despertar interesse como região consumidora e opção de investimento de capital especulativo. d. O chamado conflito “Norte x Sul” é de natureza econômica. Por-tanto, diferente do extinto conflito “Leste x Oeste”, de natureza geopolítica. e. A demarcação Norte x Sul, apesar de ser de natureza essencialmente geopolítica e econômica, estabelece também uma divisão entre duas áreas ecológicas, a temperada e a tropical.

Fonte: Relatório do Desenvolvimento Humano 2005. ONU.

Número de refugiados é o maior em cinco anos Segundo relatório de órgão da ONU, são 9,9 milhões, 14% a mais do que em 2005. Entre os primeiros países quanto à cifra de refugiados internacionais (*), encontra-se o Sudão, com 686 mil. Acrescente-se 1,3 milhão de indivíduos que se deslocaram internamente no país. Aos sudaneses, seguem-se imediatamente, em ordem decrescente, os somalis e os congoleses. Em Uganda, já há 1,6 milhão de refugiados internos.

39. A China implantou o socialismo em 1949. Contudo, a partir do final da década de 1970, esse país vem promovendo um intenso processo de reformulação econômica. O país enfrenta grandes problemas ambientais e ainda impõe restrições sobre as liberdades individuais. Quanto à China e suas mudanças em curso, assinale a alternativa correta. a. Tais mudanças não alavancaram a economia chinesa, pois o país continua tendo deficits na sua balança comercial, como aqueles registrados no período da Revolução Cultural. b. Deng Xiao Ping começou a transformação pela agricultura, promovendo o assalariamento rural e subsidiando o povo para a compra de produtos agrícolas. Esse processo evitou o êxodo rural.

(*) Não estão incluídos, nesse caso, os 4,3 milhões de palestinos refugiados na região. Folha de S. Paulo, 19 jun. 2007. p. A14. (Adaptado)

Com relação aos textos e baseando-se em seus conhecimentos sobre o assunto, pode-se afirmar que:

c. A partir da criação das Zonas Econômicas Especiais, a China vem enfrentando os problemas gerados pelo êxodo rural.

a. na província sudanesa de Darfur, em territórios do antigo Estado da Rodésia, trava-se hoje uma sangrenta guerra civil, envolvendo, entre outros, diferentes grupos étnicos e religiosos.

d. A política de abertura econômica na China gerou também uma maior preocupação com o meio ambiente, sendo que a China hoje é um país com as menores emissões de gases estufa.

b. a Etiópia, que sempre teve fronteiras relativamente bem definidas, foi, por essa mesma razão, o único país africano capaz de manter a paz interna até nossos dias. c. o traçado das fronteiras, herdado do período colonial, é um dos fatores responsáveis pelos conflitos que abatem o continente africano e agravam a miséria. d. a inserção da África na globalização nos anos 1990 agravou o quadro social e econômico, uma vez que até então o continente estava isento dos violentos conflitos vigentes nos dias atuais. e. o pleno esgotamento das riquezas minerais africanas, verificado nos dias atuais, fez com que as potências se desinteressassem do continente, motivo que agravou o quadro socioeconômico nos países da África Subsaariana.

e. Potência nuclear, a China tem atualmente como principal ponto de tensão a Coreia do Sul, pois os chineses pretendem reintegrar o arquipélago coreano ao seu território. 40. A União Europeia é formada por 27 países que foram aderindo aos poucos aos países fundadores: Alemanha, Bélgica, França, Itália, Luxemburgo e Holanda. Essa organização tem por objetivo propiciar a cooperação econômica e política dos seus membros. Passou a dispor de personalidade jurídica após a entrada em vigor do tratado de Lisboa.

38. Com o fim da Guerra Fria, estabeleceu-se uma “nova ordem mundial”, que substituiu o conflito Leste–Oeste do sistema bipolar por uma nova divisão dos países do mundo. Uma das formas de organização dessa nova ordem apresenta o mundo dividido entre países do Norte, desenvolvidos (ricos) e do Sul, subdesenvolvidos (pobres). O mapa a seguir mostra a divisão do mundo sob a ordem “Norte–Sul”.

Sobre a União Europeia e o seu processo de consolidação e ampliação, é correto afirmar que: a. Com a entrada em vigor do Tratado de Lisboa, em 1°. de Dezembro de 2009, a representação da União no mundo é unificada, mas não tem uma presidência que a represente. b. A União Europeia é uma das zonas mais ricas do mundo. Entretanto, existem disparidades internas significativas, em termos de rendimentos e oportunidades econômicas. Isso se agravou com a ampliação dos membros, ao serem incorporados países do Leste Europeu. c. Na União Europeia, os Estados componentes abrem mão de sua soberania em termos militares e por isso passam a cumprir decisões coletivas. Foi como uma entidade única na ONU que a UE votou, por exemplo, a favor da invasão do Iraque. d. A grave crise econômica que atingiu a Grécia, em 2010, não criou preocupações aos outros membros, pois ela não adota o Euro.

Com base nessas informações e em seus conhecimentos, assinale a alternativa correta. expoENEM 9

e. Por causa de objetivos geopolíticos relacionados ao combate ao terrorismo, a UE está relaxando as exigências para os países que querem uma vaga no “clube”, tal como no caso atual da candidatura da Turquia, país antidemocrático, por ser uma república islâmica.


41. Historicamente o Oriente Médio é zona de tensões entre povos, nações e países. A invasão de um navio turco, no Mar Mediterrâneo, pela marinha de Israel é mais uma cena dessas tensões. Um inquérito interno da Marinha de Israel apontou graves erros no ataque aos navios com ajuda humanitária que iam para a Faixa de Gaza, no dia 31 de maio. Os militares concluíram que a unidade de soldados que invadiu o navio “Mavi Marmara” não estava preparada, não tinha informações suficientes e não acertou na sua aproximação à embarcação turca. No confronto entre ativistas e soldados, nove pessoas morreram e alguns militares israelenses ficaram feridos.

43. A União das Nações Sul-Americanas (Unasul) é uma instância fundamental para efetivar os avanços já alcançados por outros organismos de integração regional, como o Mercosul [por exemplo]. Jornal da USP. Uma vitória da América do Sul, 02 a 08/06/2008, p. 3. 11 1

10

8 3

Sobre os conflitos nesta região pode-se afirmar que: a. O grupo Hamas, acusado por Israel de ataques terroristas, é um movimento que luta pela formação do Estado Independente da Palestina. Contudo, concorda com a existência do Estado de Israel.

4

7

2

0 1 000 km

c. Além dos conflitos de ordem histórica, religiosa e política, a região apresenta tensões decorrentes da escassez de recursos hídricos, que acentua a disputa pelo controle das nascentes do Rio Jordão. d. Uma das zonas de tensão é a fronteira do Líbano, onde se encontram as nascentes do Rio Jordão, área estratégica para o acesso e controle da água doce disponível na região.

6

5

b. O grupo Hezbollah luta pela desocupação israelense nos territórios de Gaza e Golã, e pela demarcação de Jerusalém como território independente, por sua importância religiosa para católicos, judeus e muçulmanos.

ALMEIDA, L. M. A. de; RIGOLIN, T. B. Geografia. São Paulo: Ática, 2005.p. 291. Série Novo Ensino Médio (adaptado).

Com base no Tratado assinado por representantes dos 12 países da América do Sul, no mapa acima, e em seus conhecimentos sobre a América do Sul, pode-se afirmar que: a. A Unasul não conta com a participação da Venezuela, e uma das razões é para que os outros países sul-americanos se protejam daquele país.

e. Em 2005, o Estado de Israel deu autonomia aos palestinos na Faixa de Gaza e devolveu as Colinas de Golã para a Síria, ocupadas na guerra de 1967. Esta autonomia, contudo, não vem sendo respeitada, como evidencia o ataque ao navio turco.

b. A Unasul será uma organização mais ampla que o Mercosul e a Comunidade Andina de Nações, pois visa promover a integração em outras dimensões, além da econômica.

42. Leia os textos a seguir.

c. Os países identificados com os números 2, 3 e 4 formam o conjunto regional denominado América Platina.

O que domina o mundo hoje é o confronto entre grupos islâmicos prontos a tudo, inclusive ao suicídio, e o império americano, que possui as armas mais poderosas, mas não consegue controlar totalmente o Afeganistão, o Iraque e os outros países do Oriente Médio.

d. Exceto o Brasil, todos os países da América do Sul foram colonizados por espanhóis. Até obterem a independência política, esses mesmos países foram fortemente marcados por serem colônias de povoamento.

Alain Touraine, “Um novo paradigma para compreender o mundo hoje”.

e. O Brasil tem suas terras mais concentradas na porção centro-ocidental do continente sul-americano.

O Oriente Médio é uma região à qual a imprensa sempre se refere como uma área conturbada, espécie de barril de pólvora com o estopim aceso, prestes a explodir. Essa imagem explica-se em função de ser essa região do mundo o lugar onde talvez ocorram os conflitos mais intensos.

44. Desde meados do século XX, os Estados Unidos da América se tornaram a potência-líder do capitalismo internacional, construindo um poder político e econômico que projetou o país na busca da hegemonia mundial. A expansão do modelo norte-americano tem contado com uma série de fatores que lhe garantiram sucesso, em um processo bastante complexo, produzindo problemáticas que não cessam de criar desdobramentos. Com base neste texto e nos seus conhecimentos, conclui-se que: a. O desmantelamento do poderio soviético, no final do século XX, permitiu uma ampliação acelerada do papel de superpotência desempenhado pelos Estados Unidos em escala mundial, com repercussões no âmbito político e econômico. O grande crescimento econômico deste país mostra que ele não terá rivais pelos próximos séculos. b. A partir do governo do presidente George W. Bush, iniciado em 2001, a democracia norte-americana se tornou mais sólida e eficiente, privilegiando o igualitarismo e a liberdade de opinião dos americanos, assim como dos imigrantes. O presidente Barack Obama, mantém a mesma linha de conduta do presidente anterior. c. A despeito da maciça aprovação popular norte-americana conseguida pelo governo do presidente George W. Bush após os atentados de 11 de setembro de 2001, atualmente há uma unanimidade da população em aprovar a política, de Barack Obama, para a manutenção do exercito norte-americano no Afeganistão. d. A participação dos Estados Unidos, como um dos países que mais polui o planeta, especialmente pela emissão de gases-estufa, é crucial em qualquer estratégia de ação na questão das mudanças climáticas globais. e. A crise mundial de 2008-2009 não atingiu os EUA.

Adaptado de: Nelson B. Olic, “Oriente Médio”.

9

Considerando os textos e os seus conhecimentos sobre o Oriente Médio, é correto afirmar que: a. Com a intermediação do Brasil e da Turquia, a ONU autorizou o Irã a enriquecer urânio. b. No Oriente Médio se concentra grande riqueza de petróleo. Localizados no Golfo Pérsico, os seus lençóis petrolíferos são considerados os maiores do globo terrestre. c. O presidente Barack Obama autorizou, em 2010, a retirada de todos os soldados americanos do Iraque e do Afeganistão. d. O fundamentalismo islâmico, cujo ideário é a revogação dos costumes modernos e a aplicação da lei corânica à vida cotidiana, bem como a rejeição completa ao mundo moderno, galgou o cenário político do Oriente Médio, a partir da Revolução Sunita iraniana, em 1979. e. Com exceção do Líbano, onde a maioria da população segue o judaísmo, os demais países do Oriente Médio professam o islamismo como religião.

expoENEM 10


d. Atualmente o maior problema do continente antártico, e que coloca em risco as convenções territoriais definidas globalmente, é a insistência de potências como Reino Unido, EUA e Rússia em despejarem, mesmo que de “maneira segura”, lixo radioativo em depósitos de grande profundidade no continente. e. O Brasil não tem interesses na Antártida.

45.

A Antártida foi o último continente a ser descoberto e explorado. Ao contrário da região Ártica, onde existe a presença dos esquimós, na Antártida nunca se instalaram povos nativos, devido ao frio excessivo. Hoje o continente representa uma gigantesca reserva da humanidade, protegida e destinada apenas a estudos científicos, não se desenvolvendo aí atividades comerciais, industriais, extrativas e militares. Adaptado de: <www.cptec.inpe.br/prod_antartica/publicações/2005>.

A Antártida e áreas oceânicas e continentais periféricas 30° N 40° N

46. (Enem 2005) Moradores de três cidades, aqui chamadas de X, Y e Z, foram indagados quanto aos tipos de poluição que mais afligiam as suas áreas urbanas. Nos gráficos a seguir estão representadas as porcentagens de reclamações sobre cada tipo de poluição ambiental. Lixo

50° N

O UL

60° N P O LA R A N

GREENWICH

0% 12%

Dejetos tóxicos Poluição sonora

34% 7%

AMÉRICA DO SUL

22%

A partir do texto, da análise do mapa e considerando-se outros conhecimentos sobre o assunto, é correto afirmar que:

12%

40%

Y

Fonte: Atlas geográfico escolar. 3 ed. Rio de Janeiro: IBGE, 2006. p. 33.(Adaptado)

X

Esgoto aberto

ANTÁRTIDA

ÁFRICA

24%

30%

Poluição do ar ICO RT

CÍR C

AUSTRÁLIA

Z 23%

36% 2%

a. A Antártida é um continente coberto por uma imensa capa de gelo de água doce, cercada de águas oceânicas, cujo equilíbrio ambiental não é de interesse planetário. b. O Círculo Polar Antártico limita o continente praticamente à Zona Polar, e por isso a Antártida é o mais extenso e contínuo domínio de clima polar continental da Terra. c. O Tratado da Antártida, de 1959, redefiniu as formas de apropriação do continente antártico, o que era desejado por vários países. A presença internacional no continente, regulamentada nesse tratado, só é admitida se os países se comprometerem a realizar pesquisas com fins pacíficos, permitindo-se exercícios militares e testes nucleares.

22%

23%

13%

Considerando a queixa principal dos cidadãos de cada cidade, a primeira medida de combate à poluição em cada uma delas seria, respectivamente: a. X – Manejamento de lixo; Y – Esgotamento sanitário; Z – Controle de emissão de gases. b. X – Controle de despejo industrial; Y – Manejamento de lixo; Z – Controle de emissão de gases. c. X – Manejamento de lixo; Y – Esgotamento sanitário; Z – Controle de despejo industrial. d. X – Controle de emissão de gases; Y – Controle de despejo industrial; Z – Esgotamento sanitário. e. X – Controle de despejo industrial; Y – Manejamento de lixo; Z – Esgotamento sanitário.

47. (Enem 2006) ERA

PERÍODO

CENOZOICA

QUATERNÁRIO

MILHÕES DE ANOS

5,3 23,8

Aparecimento dos hominídeos

0,01 1,8

NEOGÊNICO

34,6 PALEOGÊNICO

56

MESOZOICA

65 CRETÁCEO JURÁSSICO TRIÁSSICO PERMIANO

PALEOZOICA

CARBONÍFERO DEVONIANO

145 208 245

PRÉ–CAMBRIANO

Elevação dos Himalaias Ligação das duas Américas Fecho e dessecação do Mediterrâneo

Primeiros roedores

Elevação dos Pirineus

Primeiros primatas

Conclusão da abertura do Atlântico Norte Constituição do continente Norte-Atlântico

Últimos dinossauros

Abertura do Atlântico Sul

Primeiras angiospermas Primeiras aves Primeiros dinossauros

Início da fragmentação da Pangeia Constituição da Pangeia

363

Aparecimento dos répteis

409

Aparecimento dos anfíbios Primeiras gimnospermas Primeiras plantas e primeiros animais terrestres Primeiros peixes

439 CAMBRIANO

PALEOGEOGRAFIA

290

SILURIANO ORDOVICIANO

EVOLUÇÃO BIOLÓGICA Faunas e floras atuais Primeiras manifestações de arte Sepulturas mais antigas Extinção dos mastodontes e dinotérios Aparecimento dos bois, cavalos e veados Primeiros utensílios de pedra

510

Abertura dos oceanos Lapetus e Rheio

544 1 000 1 400 1 800 2 000 3 100 3 500 4 600

Fecho do oceano Lapetus

Reprodução sexuada Primeiros depósitos de carvão (algas) Oxigênio livre na atmosfera Aparecimento de organismos eucariontes Primeiros microrganismos procariontes Primeiros vestígios de vida Formação da Terra

Constituição da Avelônia Constituição do continente Rodinia

Considerando o esquema anterior, assinale a opção correta. a. Quando os primeiros hominídeos apareceram na Terra, os répteis já existiam há mais de 500 milhões de anos. expoENEM 11

b. Quando a espécie Homo sapiens surgiu no planeta, América do Sul e África estavam fisicamente unidas.


c. No Pré-Cambriano, surgiram, em meio líquido, os primeiros vestígios de vida no planeta.

a. incapacidade de se manter uma atividade econômica ao longo do tempo sem causar danos ao meio ambiente.

d. A fragmentação da Pangeia ocasionou o desaparecimento dos dinossauros.

b. incompatibilidade entre crescimento econômico acelerado e preservação de recursos naturais e de fontes não renováveis de energia.

e. A Era Mesozoica durou menos que a Cenozoica.

c. interação de todas as dimensões do bem-estar humano com o crescimento econômico, sem a preocupação com a conservação dos recursos naturais que estivera presente desde a Antiguidade.

48. (Enem 2009) As áreas do planalto do cerrado – como a chapada dos Guimarães, a Serra de Tapirapuã e a Serra dos Parecis, no Mato Grosso, com altitudes que variam de 400 m a 800 m – são importantes para a planície pantaneira mato-grossense (com altitude média inferior a 200 m), no que se refere à manutenção do nível de água, sobretudo durante a estiagem. Nas cheias, a inundação ocorre em função da alta pluviosidade nas cabeceiras dos rios, do afloramento de lençóis freáticos e da baixa declividade do relevo, entre outros fatores. Durante a estiagem, a grande biodiversidade é assegurada pelas águas da calha dos principais rios, cujo volume tem diminuído, principalmente nas cabeceiras. Cabeceiras ameaçadas. Ciência Hoje. Rio de Janeiro: SBPC. Vol. 42, jun. 2008. (Adaptado).

d. proteção da biodiversidade em face das ameaças de destruição que sofrem as florestas tropicais devido ao avanço de atividades como a mineração, a monocultura, o tráfico de madeira e de espécies selvagens. e. necessidade de se satisfazer as demandas atuais colocadas pelo desenvolvimento sem comprometer a capacidade de as gerações futuras atenderem suas próprias necessidades nos campos econômico, social e ambiental. 51. Leia com atenção o fragmento de texto a seguir. Imaginemos, portanto, alguém que tomasse a decisão de não aceitar as opiniões estabelecidas e começasse a fazer perguntas que os outros julgam estranhas e inesperadas. Em vez de “que horas são?” ou “que dia é hoje?”, perguntasse: O que é o tempo? Em vez de dizer “está sonhando” ou “ficou maluca”, quisesse saber: O que é o sonho? A loucura? A razão? [...] Este alguém estaria começando a adotar o que chamamos atitude filosófica.

A medida mais eficaz a ser tomada, visando à conservação da planície pantaneira e à preservação de sua grande biodiversidade, é a conscientização da sociedade e a organização de movimentos sociais que exijam: a. a criação de parques ecológicos na área do pantanal mato-gros-sense. b. a proibição da pesca e da caça, que tanto ameaçam a biodiversidade.

Marilena Chauí, “Convite à filosofia”.

Ao enfatizar a “atitude filosófica”, o texto pressupõe uma das principais habilidades a serem desenvolvidas no ensino de Filosofia, que é:

c. o aumento das pastagens na área da planície, para que a cobertura vegetal, composta de gramíneas, evite a erosão do solo.

a. Interpretar os problemas da sociedade.

d. o controle do desmatamento e da erosão, principalmente nas nascentes dos rios responsáveis pelo nível das águas durante o período de cheias.

b. Interpretar os textos clássicos da filosofia, selecionados para o vestibular.

e. a construção de barragens, para que o nível das águas dos rios seja mantido, sobretudo na estiagem, sem prejudicar os ecossistemas.

d. Questionar e problematizar os conhecimentos nas ciências.

49. (Enem 2009) À medida que a demanda por água aumenta, as reservas desse recurso vão se tornando imprevisíveis. Modelos matemáticos que analisam os efeitos das mudanças climáticas sobre a disponibilidade de água no futuro indicam que haverá escassez em muitas regiões do planeta. São esperadas mudanças nos padrões de precipitação, pois: a. o maior aquecimento implica menor formação de nuvens e, consequentemente, a eliminação de áreas úmidas e subúmidas do globo. b. as chuvas frontais ficarão restritas ao tempo de permanência da frente em uma determinada localidade, o que limitará a produtividade das atividades agrícolas. c. as modificações decorrentes do aumento da temperatura do ar diminuirão a umidade e, portanto, aumentarão a aridez em todo o planeta. d. a elevação do nível dos mares pelo derretimento das geleiras acarretará redução na ocorrência de chuvas nos continentes, o que implicará a esc assez de água para abastecimento. e. a origem da chuva está diretamente relacionada com a temperatura do ar, sendo que atividades antropogênicas são capazes de provocar interferências em escala local e global. 50. (Enem 2009) No presente, observa-se crescente atenção aos efeitos da atividade humana, em diferentes áreas, sobre o meio ambiente, sendo constante, nos fóruns internacionais e nas instâncias nacionais, a referência à sustentabilidade como princípio orientador de ações e propostas que deles emanam. A sustentabilidade explica-se pela:

c. Questionar os diferentes saberes dominantes no mundo. e. Questionar e problematizar os conhecimentos nas artes. Fique esperto! Características dos mitos gregos Em relação aos mitos de outros povos da Antiguidade, os mitos gregos apresentam algumas características essencialmente especiais, a saber: • Os deuses gregos apresentam aparência humana. • Os deuses gregos passam a manifestar sentimentos similares aos dos homens: amor, ódio, tristeza, alegria etc. • Os deuses gregos rivalizam entre si e estão sujeitos a sucessos e fracassos, acertos e erros. Essas características abrem espaço para questionamentos sobre os deuses e a possibilidade de interferirem na vida humana. A verdade do mito não mais é dogmática, e rejeições mitológicas são possíveis. Trata se do começo da filosofia.

52. Sobre a passagem do mito à filosofia, na Grécia Antiga, analise as afirmativas a seguir e assinale a opção que apresenta todas as corretas. I – A religiosidade grega contribuiu para a origem da filosofia, dando ênfase ao naturalismo, uma vez que nem homens nem deuses eram compreendidos como perfeitos. II – Ao perceber os deuses movidos por sentimentos similares aos dos homens e marcados pela imperfeição, os gregos iniciaram o processo de racionalização da cultura. III – A filosofia não superou o mito; ao contrário, continuou buscando respostas para os fenômenos naturais em elementos sobrenaturais.

expoENEM 12


a. Apenas a afirmativa I está correta. b. Apenas a afirmativa II está correta. c. Apenas as afirmativas II e III estão corretas. d. As I, II e III estão corretas. e. Apenas as afirmativas I e II estão corretas.

d. A atuação política é a marca característica do analfabetismo político. e. Os textos afirmam que ser analfabeto é o mesmo que ser “analfabeto político”.

53. Leia com atenção os seguintes fragmentos da Constituição Brasileira.

55. Sobre o fenômeno conhecido como “analfabetismo político” é correto afirmar: a. Problemas sociais como prostituição, violência e menores abandonados não são atribuídos à ignorância política.

Art. 1°. : (...) Parágrafo único: Todo o poder emana do povo, que o exerce por meio de representantes eleitos ou diretamente, nos termos desta Constituição

b. Somente as pessoas pobres e humildes são analfabetos políticos.

(...)

Art. 5°. : Todos são iguais perante a lei, sem distinção de qualquer natureza, garantindo-se aos brasileiros e aos estrangeiros residentes no País a inviolabilidade à vida, à liberdade, à igualdade, à segurança e à propriedade (...).

d. O analfabeto político, apesar de sua indiferença, é uma pessoa que se importa com os rumos da sociedade.

A forma de governo conhecida como democracia surgiu na Grécia Antiga. Assinale a alternativa que reúne as principais diferenças entre a democracia grega e a democracia brasileira atual. a. A democracia grega era direta e a democracia atual é representativa. Na democracia grega só cidadãos (homens livres) podiam votar e hoje todos acima de 16 anos podem votar.

c. A participação política das pessoas é de suma importância para a resolução dos problemas sociais.

e. Os problemas sociais jamais poderiam ser resolvidos pela participação política das pessoas, uma vez que essa ação cabe somente aos políticos. 56. No Brasil, os desafios para o alcance de resultados mais adequados aos valores democráticos exigem um maior envolvimento da sociedade, do governo e dos juristas que atuam na defesa dos direitos humanos. Sobre o conceito de justiça no Estado democrático, é correto afirmar:

a. Os critérios de justiça devem ser estabelecidos apenas pelos governantes a partir de sua própria concepção do que é justo ou injusto.

b. Na democracia grega todos podiam votar, inclusive os escravos; na democracia atual os menores de 16 anos não podem votar.

b. Os critérios de justiça devem ser estabelecidos pelos intelectuais, os únicos capazes de decidir algo tão importante.

c. Na democracia grega os homens se reuniam e escolhiam o colegiado; na democracia atual os próprios cidadãos vão ao Congresso expressar suas opiniões.

c. O conceito de justiça é subjetivo. Por isso, cada pessoa pode agir do modo que acredita ser justo.

d. Não há diferenças entre a democracia grega e a democracia atual.

d. Todos os grupos representantes da sociedade devem estar envolvidos na definição dos critérios de justiça, a ser estabelecidos e sempre revistos por meio de uma ampla discussão.

e. A democracia atual é uma continuação da democracia grega, com a única diferença sendo que, hoje, as cidades se transformaram em grandes metrópoles.

e. No Estado democrático, o governante pode usar a força, no sentido de coerção, como um critério legítimo para decidir e impor o que é justo para a sociedade.

Fique esperto! Política é um termo grego derivado da palavra polis que se refere às discussões e decisões de assuntos ligados à cidade. Aqueles que participavam dessas discussões e decisões passaram a ser denominados cidadãos, ou seja, que participam da organização da cidade. Foi assim que, além de inventar a política, os gregos inventaram também o ideal da democracia: a arte de participar das decisões políticas, escolhendo os governantes.

Se ligue! Características da filosofia A razão, novo instrumento do saber, tem nítida influência na polis da Grécia Antiga, onde surge propriamente a Filosofia. Enquanto o saber racional desperta, o saber mítico, baseado em explicações fantasiosas e dogmáticas, na crença e na fé, dá lugar à investigação filosófica, sem deixar de ter sua validade.

Leia com atenção os textos a seguir. Eles servirão de base para as questões 54 e 55. O analfabeto político pode ser concebido como aquela pessoa que não efetiva a “sua” importância democrática. [...] Este é o caso daquela pessoa que tem pleno domínio da leitura, da escrita, dos números e das operações matemáticas, só que resiste, de maneira voluntária ou omissa, a participar da discussão democrática da nação.

São características da filosofia a lógica, a observação e a racionalidade.

Leia com atenção o texto a seguir. Ele servirá de base para as questões 57 a 59.

Marco Aurélio Rodrigues da Cunha e Cruz, “O analfabeto político”.

O analfabeto político é tão burro, que se orgulha e estufa o peito dizendo que odeia política. Não sabe o imbecil, que da ignorância política nascem a prostituta, o menor abandonado, e o pior de todos os bandidos, que é o político vigarista, pilantra, corrupto e lacaio dos exploradores do povo. Bertolt Brecht, “O analfabeto político”.

54. De acordo com os textos podemos afirmar que: a. Somente as pessoas mais pobres são analfabetos políticos. b. O analfabetismo político é próprio da classe mais rica da população.

Os primeiros filósofos tinham uma coisa em comum. Eles acreditavam que determinada substância básica estava por trás destas transformações. Para nós o mais importante não é saber que respostas esses primeiros filósofos encontraram. O interessante é saber que perguntas eles fizeram e que tipo de respostas buscavam. Sabemos que os primeiros filósofos colocavam questões referentes às transformações que podiam observar na natureza. Eles queriam entender os fenômenos naturais, sem ter que para isto recorrer aos mitos... E assim, a filosofia se libertou da religião. Podemos dizer que os filósofos da natureza deram os primeiros passos na direção de uma forma científica de pensar.

c. A não participação ativa na esfera política é a principal característica do analfabetismo político. expoENEM 13

Jostein Gaarder, “O mundo de Sofia”.


57. Assinale a alternativa que apresenta a principal característica filosófica promovida pelos primeiros filósofos.

58. Com base no texto e em seus conhecimentos sobre os primeiros filósofos, é correto afirmar:

a. A aceitação das explicações sobrenaturais relativas aos acontecimentos naturais.

a. A aceitação dos fenômenos naturais pressupõe a aceitação de elementos sobrenaturais.

b. A discussão crítica das ideias e posições, que podem ser modificadas, uma vez que as verdades estão em construção.

b. Os primeiros filósofos continuaram a recorrer aos mitos como fundamentos para suas hipóteses.

c. A busca por uma verdade inquestionável, que pudesse substituir a verdade imposta pela mitologia.

c. Os primeiros filósofos acreditavam que o conhecimento dos fenômenos extrapola a capacidade racional.

d. A confiança na explicação mitológica como fundamento para o conhecimento.

d. A organização e a transformação dos seres naturais têm uma explicação natural, que pode ser compreendida racionalmente.

e. A desconfiança na capacidade da razão humana em conhecer todas as coisas.

e. A filosofia surgiu como discurso teórico, sem embasamento na realidade sensível.

Tá ligado? AS FASES DA FILOSOFIA GREGA PERÍODO SOCRÁTICO

PERÍODO PRÉ-SOCRÁTICO Séculos VII e VI a.C. As preocupações giram em torno da origem do mundo e da natureza – cosmologia. Os filósofos querem encontrar a arché (princípio que originou todas as coisas).

Séculos V e IV a.C. As discussões giram em torno da política e os assuntos relacionados à cidade. Fazem parte desse período os sofistas, Sócrates, Platão e Aristóteles.

59. A filosofia surgiu na Grécia, no século VI a.C. Os primeiros filósofos foram denominados pré-socráticos ou filósofos da natureza. De acordo com o texto, assinale a alternativa que expressa o principal problema por eles investigado. a. A cosmogonia, como aceitação da origem mitológica do mundo e da natureza. b. A filosofia ética, como análise dos fundamentos do agir humano. c. A filosofia da ciência, como avaliação dos procedimentos científicos. d. A filosofia política, como análise das formas de governo e fundamentos do Estado. e. A cosmologia, como investigação racional acerca da origem e da ordem do mundo e da natureza.

Séculos III e II a.C. Expansão da filosofia grega com Alexandre Magno. Após a morte de Alexandre, inicia-se a época helenística, marcada pela influência oriental. Destacam-se o estoicismo e o epicurismo.

a. Mostra um indivíduo satisfeito com a situação política do país. b. Representa um regime político democrático em que inexistem problemas de corrupção. c. É uma música utilizada para promover o governo vigente. d. Apresenta a percepção de um indivíduo indignado com a corrupção política do país. e. Mostra a ação de um indivíduo alienado dos problemas sociais e políticos do país. Fique esperto!

DIFERENÇAS ENTRE A DEMOCRACIA GREGA E A DEMOCRACIA ATUAL DEMOCRACIA GREGA Era direta: os cidadãos se reuniam em praça pública e tomavam decisões diretamente por meio do voto.

60. Leia com atenção o texto a seguir. Estão nas mangas dos senhores ministros

Só os cidadãos homens livres podiam participar da política.

Nas capas dos senhores magistrados

Era considerado cidadão aquele que participava das discussões da polis.

Nas golas dos senhores deputados Nos fundilhos dos senhores vereadores

DEMOCRACIA ATUAL

Nas perucas dos senhores senadores [...]

É representativa: escolhemos representantes (senadores, deputados, governadores...) que votam os projetos por nós.

Bandido! Corrupto! Ladrão!

Todos podem votar independentemente da renda ou sexo.

Titãs, “Vossa Excelência”.

PERÍODO PÓS-SOCRÁTICO

A letra da música “Vossa Excelência”, da banda Titãs, foi composta em meio à crise política deflagrada pelo escândalo do “mensalão” no Brasil. Sobre a canção, é correto afirmar: expoENEM 14

Cidadão é o indivíduo de uma sociedade que tem direitos garantidos por lei, inclusive o direito de voto.


61. Leia com atenção o texto a seguir. Quando troveja e relampeja, geralmente também chove. E a chuva era vital para os camponeses da era dos vikings. Assim, Tor era adorado como o deus da fertilidade. [...] a resposta mitológica à questão de saber por que chovia era, portanto, a de que Tor agitava seu martelo. E quando caía a chuva, as sementes germinavam e a plantas cresciam nos campos. Jostein Gaarder, “O mundo de Sofia”.

Esse texto é parte de uma narrativa mítica. Considerando que o mito pode ser uma forma de conhecimento, assinale a alternativa correta.

d. O texto afirma que os animais fazem cultura, pois manipulam conscientemente a natureza. e. Somente o homem faz cultura, pois somente ele transforma e manipula a natureza de acordo com suas necessidades, guiado por um processo racional. 64. É sabido que o homem é um ser que avalia suas ações a partir de um juízo moral, ou seja, por meio de valores éticos e morais. Esses valores só podem ser aplicados e avaliados na conduta humana.

Com base nisso, marque a alternativa que corresponde a um juízo moral.

a. O mito procura provar cientificamente suas verdades.

a. Esta mulher é bela.

b. O conhecimento mítico segue um rigoroso procedimento para provar suas verdades.

b. Esta garota é elegante.

c. As características essenciais do mito são argumentação e auto-crítica.

d. Este menino não agiu corretamente

c. Este colar é vermelho. e. A população deste país é numerosa.

d. A verdade do mito se fundamenta na crença e na fé, e independe de provas. e. O mito é uma forma de conhecimento que busca na racionalidade a fundamentação para suas verdades. 62. Leia com atenção o texto a seguir. Não vejo em todo animal senão uma máquina engenhosa, à qual a natureza deu sentidos para prover-se ela mesma. [...] Percebo precisamente as mesmas coisas na máquina humana, com a diferença de que só a natureza faz tudo nas operações do animal, ao passo que o homem concorre para as suas na qualidade de agente livre. Um escolhe ou rejeita por instinto, o outro por um ato de liberdade.

65. Leia com atenção o texto a seguir. O primeiro passo de todo existencialismo é o de pôr todo homem na posse do que ele é, de submetê-lo à total responsabilidade de sua existência. Assim, quando dizemos que o homem é responsável por si mesmo, não queremos dizer que o homem é apenas responsável pela sua estrita individualidade, mas que ele é responsável por todos os homens. Jean-Paul Sartre, “O existencialismo é um humanismo”.

Tomando esse texto como referência, assinale a alternativa correta. a. Para Sartre, cada indivíduo é responsável por todos os homens, porque devemos agir de acordo com a vontade da maioria, deixando a nossa vontade própria de lado.

Jean-Jacques Rousseau, “Discurso sobre a origem e os fundamentos da desigualdade entre os homens”.

Com base no texto é correto afirmar:

b. Para Sartre, ser responsável é enfatizar a individualidade, ignorando totalmente os outros.

a. Para Rousseau, a racionalidade é a característica que diferencia o homem de todos os outros animais.

c. Quando Sartre fala em “pôr todo homem na posse daquilo que ele é”, devemos entender que o filósofo acredita que a felicidade só se consegue com a posse de bens materiais.

b. Para Rousseau, não há diferença entre homens e animais. c. Para Rousseau, a liberdade é a característica que diferencia o homem de todos os outros animais.

d. Ser responsável, para Sartre, é agir de forma livre e consciente. Essa responsabilidade implica o compromisso com a humanidade, pois nela escolho o homem que desejo ser.

d. Para Rousseau, os homens se adaptam à natureza de forma instintiva.

e. A construção do homem que desejo ser é puramente individual, uma vez que sou livre para escolher.

e. Para Rousseau, os animais, mesmo agindo por instinto, conseguem ser livres, pois fazem escolhas.

Se ligue!

63. Leia com atenção o texto a seguir.

Com a tese “a existência precede a essência”, Sartre recusa uma essência, um modelo antes da existência. Essa posição de Sartre significa que o homem primeiramente existe, se descobre, surge no mundo, e só depois se define. Sua preocupação é de que o homem, diante de suas inúmeras escolhas, assuma a responsabilidade de uma opção. Para Sartre o existencialismo é uma doutrina que torna a vida humana possível, e declara que toda a verdade e toda a ação im-plicam um meio e uma subjetividade humana, ou seja, o homem não é mais do que aquilo faz de si mesmo.

Uma aranha executa operações semelhantes às do tecelão, e a abelha supera mais de um arquiteto ao construir sua colmeia. Mas o que distingue o pior arquiteto da melhor abelha é que ele figura na mente sua construção antes de transformá-la em realidade. [...] Ele imprime ao material o projeto que tinha conscientemente em mira, o qual constitui a lei determinante do seu modo de operar e ao qual tem de subordinar sua vontade. Karl Marx, “O capital”.

O texto aborda a concepção de cultura entendida como patrimônio informacional constituído de saberes, regras e maestrias próprias da raça humana. Sobre o fenômeno cultura, é correto afirmar: a. Não há diferenças entre animais e seres humanos, no que diz respeito à cultura. b. O homem é o único animal que, movido por seus instintos, adapta se e transforma a natureza. c. Segundo o texto, quando os animais se guiam por instintos e leis biológicas próprias de cada espécie, trata-se de um sinal evidente da manifestação cultural.

66. Observe com atenção os textos e a imagem a seguir. Kant diz: “Age apenas segundo aquelas máximas através das quais possas, ao mesmo tempo, querer que elas se transformem numa Lei Geral”. [...] Kant formulou o imperativo categórico de modo que nós tratemos as outras pessoas sempre como um fim em si mesmo, e não como um simples meio para se chegar a outra coisa.

expoENEM 15

Jostein Gaarder, “O mundo de Sofia”.


© 2001-2009 HAAP Media Ltd/ Vivek Chugh

De acordo com o texto, assinale a alternativa que apresenta uma das características fundamentais do discurso científico. a. Na ciência devem ser usadas expressões pessoais, fundamentadas em hábitos e preconceitos. b. Por meio de investigações metódicas, a ciência busca a coerência e a veracidade. c. A objetividade das expressões é uma característica sem importância para a ciência. d. Na ciência as pesquisas e investigações metódicas são desnecessárias. e. Senso comum e ciência são duas formas de conhecimento que procedem da mesma maneira e possuem o mesmo método de pesquisa.

Predomina em nosso país, clandestinamente, a prática do trabalho infantil. Essas crianças vivem em situação análoga à escravidão.

Analisando essa situação, sob a perspectiva Kantiana, é correto afirmar:

69. Leia com atenção o texto a seguir.

a. Todas as coisas têm um preço e, por isso, podem ser compradas, inclusive o ser humano.

[...] penso poder ser verdade que a fortuna seja árbitra de metade de nossas ações, mas que, ainda assim, ela nos deixe governar quase a outra metade. Comparo-a a um desses rios impetuosos que, quando se encolerizam, alagam as planícies, destroem as árvores, os edifícios, arrastam montes de terra de um lugar para outro.

b. Nesse caso específico, justifica-se o uso do ser humano como um meio para se atingir uma finalidade, ou seja, o sustento da família. c. A dignidade humana é o que assegura os direitos a todas as pessoas, principalmente às crianças.

[...]

d. As crianças, no trabalho escravo, não estão sendo usadas como meio.

Não é menos verdade que os homens, quando volta a calma, podem fazer reparos e barragens, de modo que, em outra cheia, aqueles rios correrão por um canal e o seu ímpeto não será tão livre nem tão danoso. Do mesmo modo acontece com a fortuna; o seu poder é manifesto onde não existe resistência organizada, dirigindo ela a sua violência só para onde não se fizerem diques e reparos para contê-la.

e. Segundo Kant, os fins justificam os meios. 67. Para Platão, havia outra forma de conhecer a realidade além daquela proveniente da experiência, do mundo dos sentidos. Em seu Mito da Caverna, a razão é valorizada como meio de acesso ao inteligível. Leia com atenção o texto a seguir. Platão acredita que havia outra realidade autônoma por trás do “mundo dos sentidos”. A esta realidade ele deu o nome de mundo das ideias. Nele estão as “imagens padrão”, as imagens primordiais, eternas e imutáveis, que encontramos na natureza. Esta notável concepção é chamada por nós de a teoria das ideias de Platão.

Nicolau Maquiavel, “O príncipe”.

O texto retrata a concepção da virtú maquiaveliana, ou seja, a capa-cidade e habilidade do príncipe em ser flexível e dominar as circunstâncias. A respeito do conceito de virtú, assinale a alternativa correta: a. Segundo o texto, todas as nossas ações são determinadas pela Fortuna.

Jostein Gaarder, “O mundo de Sofia”.

b. O homem de virtú é aquele que age guiado apenas pela sorte.

Segundo a teoria das ideias de Platão, é correto afirmar:

c. A virtú não depende das circunstâncias.

a. Só há uma única realidade: o mundo sensível.

d. A Fortuna diz respeito às forças das circunstâncias que não podem ser dominadas.

b. Só há uma única realidade: o mundo inteligível.

e. O príncipe é o homem de virtú, aquele que conhece as circunstâncias e as utiliza a seu favor.

c. As imagens primordiais, eternas e imutáveis presentes na natureza podem ser encontradas no mundo dos sentidos.

Tá ligado?

d. O verdadeiro mundo é aquele percebido pelos nossos sentidos. e. Existem níveis de realidade: um visível (mundo sensível) e outro inteligível (mundo das ideias).

Fique esperto! No livro VII de “A República”, Platão ilustra seu pensamento com o famoso Mito da Caverna. O mito oferece uma interpretação epistemológica, pela qual Platão procura descrever o processo do conhecimento – a famosa Teoria das Ideias. O filósofo, representado por aquele que se liberta das correntes (o mito pode ser visto como referência ao próprio Sócrates), ao contemplar a verdadeira realidade (mundo fora da caverna) passa da opinião ao verdadeiro conhecimento (episteme) e deve retornar para orientar os demais.

Maquiavel recusa a figura do Bom Governo encarnada no príncipe virtuoso, portador das virtudes cristãs, morais e principescas. Para Maquiavel, o príncipe precisa ter uma virtú propriamente política, referindo-se às qualidades do dirigente para tomar e manter o poder, mesmo que para isso deva usar a violência, a mentira, a astúcia e a força. A tradição pregava que o governante deveria ser amado e respeitado pelos governados. Maquiavel apenas afirma que o príncipe não deve ser odiado. A virtú é a capacidade do príncipe para ser flexível às circunstâncias, mudando com elas para agarrar e dominar a Fortuna (modo como as coisas são e se apresentam). 70. Leia com atenção o texto a seguir.

68. Leia com atenção o texto a seguir. A ciência distingue-se do senso comum porque este é uma opi-nião baseada em hábitos, preconceitos, tradições cristalizadas, enquanto a primeira baseia-se em pesquisas, investigações metódicas e sistemáticas e na exigência de que as teorias sejam internamente coerentes e digam a verdade sobre a realidade. A ciência é conhecimento que resulta de um trabalho racional. Marilena Chauí, “Convite à filosofia”.

Os cientistas costumam apregoar que a ciência veste o manto da imparcialidade. Mas os meios pelos quais ela é administrada sob a forma de tecnologia apresentam falhas, e a neutralidade científica é quase uma utopia. Essa é a visão do físico Marcelo Gleiser [...]. Para ele, o controle sobre os avanços da ciência de ponta – transgenia, clonagem, pesquisa de células-tronco – em princípio cabe ao Estado. Mas o Estado tem de estar desinteressado, e aí a

expoENEM 16


coisa fica mais complicada. Lembrando que boa parte da pesquisa científica recebe financiamentos do governo, Gleiser apontou que os cientistas nem sempre têm condição de controlar os frutos de seu trabalho.

72. (UEL-PR 2003) Leia o texto a seguir. Sinto no meu corpo A dor que angustia A lei ao meu redor

Salvador Nogueira, “Ciência neutra não existe, afirma Gleiser”.

A lei que eu não queria Com base no texto, é correto afirmar:

Estado violência

a. O texto afirma que a ciência é o único saber capaz de manter a imparcialidade.

Estado hipocrisia

b. O Estado, principal financiador das pesquisas científicas, defende e enfatiza a imparcialidade e a neutralidade para a ciência.

A lei que eu não queria

c. Segundo o texto, a ciência não é imparcial e neutra porque os cientistas são movidos por crenças pessoais. d. A ciência busca a neutralidade e a imparcialidade. No entanto, ela está condicionada aos interesses dos que financiam suas pesquisas.

A lei que não é minha [...] Titãs, “Estado violência”.

A letra da música “Estado violência”, dos Titãs, revela a percepção dos autores sobre a relação entre o indivíduo e o poder do Estado. Sobre a canção, é correto afirmar: a. Mostra um indivíduo satisfeito com a sua situação e que apoia o regime político instituído.

e. Segundo o texto, é possível manter a imparcialidade, mesmo contra os interesses de seus financiadores.

b. Representa um regime democrático em que o indivíduo participa livremente da elaboração das leis.

Fique esperto!

c. Descreve uma situação em que inexistem conflitos entre o Estado e o indivíduo.

A filosofia da ciência consiste no estudo da natureza da própria ciên-cia, analisando os métodos, conceitos, pressuposições e o estudo dos limites das várias ciências com o objetivo de especificar as relações entre elas. Nos últimos anos, surgiram outros problemas como o das relações sociais da ciência, ou seja, sua relação com a sociedade em termos políticos, laborais, artísticos, religiosos e morais.

d. Relata os sentimentos de um indivíduo alienado e indiferente à forma como o Estado elabora suas leis. e. Apresenta um indivíduo para quem o Estado, autoritário e violento, é indiferente a sua vontade. 73. (UEL-PR 2004) Observe a charge e leia o texto a seguir.

71. (UEL-PR 2003) Os traços pelos quais a democracia é considerada forma boa de governo são essencialmente os seguintes: é um governo não a favor dos poucos, mas dos muitos; a lei é igual para todos, tanto para os ricos quanto para os pobres, e portanto, é um gover-no de leis, escritas ou não escritas, e não de homens; a liberdade é respeitada seja na vida privada seja na vida pública, onde vale não o fato de se pertencer a este ou àquele partido mas o mérito. Norberto Bobbio, “Estado, governo, sociedade: para uma teoria geral da política”.

Com base no texto, considere as seguintes afirmativas sobre os direitos fundamentais da democracia grega. I. Todos os cidadãos submetem-se a uma elite, formada pelos ricos, que governa privilegiando seus interesses particulares.

Fonte: LAERTE. Classificados. São Paulo: Devir, 2001. p. 25.

É evidente, pois, que a cidade faz parte das coisas da natureza, que o homem é naturalmente um animal político, destinado a viver em Sociedade, e que aquele que, por instinto, e não porque qualquer circunstância o inibe, deixa de fazer parte de uma cidade, é um ser vil ou superior ao homem [...].

II. Todos os cidadãos possuem os mesmos direitos e devem ser tratados da mesma maneira, perante as leis e os costumes da polis. III. Todo cidadão tem a liberdade de expor, na assembleia, seus interesses e suas opiniões, discutindo-os com os outros. IV. Todo cidadão deve pertencer a um partido para que suas opiniões sejam respeitadas.

Assinale a alternativa correta.

Aristóteles, “A política”.

Com base no texto de Aristóteles e na charge, é correto afirmar: a. O texto de Aristóteles confirma a ideia exposta pela charge de que a condição humana de ser político é artificial e um obstáculo à liberdade individual. b. A charge apresenta uma interpretação correta do texto de Aristóteles segundo a qual a política é uma atividade nociva à coletividade devendo seus representantes serem afastados do convívio social. c. A charge aborda o ponto de vista aristotélico de que a dimensão política do homem independe da convivência com seus semelhantes, uma vez que o homem basta-se a si próprio.

a. Apenas as afirmativas I e II são corretas.

d. A charge, fazendo alusão à afirmação aristotélica de que o homem é um animal político por natureza, sugere uma crítica a um tipo de político que ignora a coletividade privilegiando interesses particulares e que, por isso, deve ser evitado.

b. Apenas as afirmativas I e IV são corretas. c. Apenas as afirmativas II e III são corretas. d. Apenas as afirmativas II e IV são corretas.

e. Tanto a charge quanto o texto de Aristóteles apresentam a ideia de que a vida em sociedade degenera o homem, tornando-o um animal.

e. Apenas as afirmativas III e IV são corretas. expoENEM 17


76.

Se ligue!

Na comunidade doméstica de constituição patriarcal, ainda bem viva durante nosso Império, os escravos constituíam uma simples ampliação do círculo familiar. Por isso e também por motivos compreensíveis de interesse econômico, o bem estar dos escravos devia ser mais caro ao fazendeiro do que o dos colonos.

Ética: é a área da filosofia que estuda os valores morais e as virtudes na conduta humana. Por isso, a ética está condicionada às relações humanas, analisando a relação entre vontade e razão, finalidades e valores da ação moral, ideias de liberdade, responsabilidade, dever, obrigação etc.

Sérgio Buarque de Holanda (na introdução a “Memória de um Colono no Brasil”, de Thomas Davatz).

Com base no texto, marque a alternativa correta.

74. (UEL-PR 2004)

I. Fica claro que os imigrantes e os escravos recebiam o mesmo tratamento nas fazendas.

– O que significa exatamente essa expressão antiquada: “virtude”? – perguntou Sebastião.

II. Na visão apresentada, os imigrantes recebiam um tratamento pior que o dado aos escravos.

– No sentido filosófico, compreende-se por virtude aquela atitude de, na ação, deixar-se guiar pelo bem próprio ou pelo bem alheio – esclareceu o senhor Barros.

III. Esta visão sobre o tratamento dado aos imigrantes está relacionada ao sistema de parceria, que foi desenvolvido nas fazendas de café e gerou intenso descontentamento por parte dos imigrantes.

– O bem alheio? – perguntou Sebastião. – Sim – disse o senhor Barros. – É verdade que a coragem e a moderação são virtudes, em primeiro lugar, para consigo mesmo, mas também há outras virtudes, como a benevolência, a justiça e a seriedade ou confiabilidade, ou seja, a qualidade de ser confiável, que são disposições orientadas para o bem dos outros. Ernst Tugendhat et al, “O livro de Manuel e Camila”.

É verdadeiro apenas o que se afirma em: a.  I.

d.  I e II.

b.  II.

e.  II e III.

c. III. 77.

Com base no texto, é correto afirmar:

Este comércio de carne humana é, pois, um cancro que corrói as entranhas do Brasil [...].

a. As ações virtuosas são reguladas por leis positivas, determinadas pelo direito, independentemente de um princípio de bem moral.

[...].

Acabe-se de uma vez o infame tráfico de escravatura africana Torno a dizer, porém, que eu não desejo ver abolida de repente a escravidão; tal acontecimento traria consigo grandes males. Para emancipar escravos, sem prejuízo da sociedade, cumpre fazê-los primeiramente dignos da liberdade: cumpre que sejamos forçados pela razão e pela lei a convertê-los gradualmente, de vis escravos em homens livres e ativos.

b. A virtude limita-se às ações que envolvem outras pessoas; em relação a si próprio a ação é independente de um princípio de bem. c. A ação virtuosa é orientada por princípios externos que determinam a qualidade da ação.

José Bonifácio (1823).

d. Ser virtuoso significa guiar suas ações por um bem, que pode ser tanto em relação a si próprio quanto em relação aos outros. e. As virtudes são disposições desvinculadas de qualquer orientação, seja para o bem, seja para o mal. 75. (UEL-PR 2007) Há, porém, algo de fundamentalmente novo na maneira como os Gregos puseram a serviço do seu problema último – da origem e essência das coisas – as observações empíricas que receberam do Oriente e enriqueceram com as suas próprias, bem como no modo de submeter ao pensamento teórico e casual o reino dos mitos, fundado na observação das realidades aparentes do mundo sensível: os mitos sobre o nascimento do mundo.

a. I.

d. I e II.

b. II.

e. II e III.

c. III.

Werner Jaeger, “Paideia”.

Com base no texto e nos conhecimentos sobre a relação entre mito e filosofia na Grécia, é correto afirmar:

Sobre o tema, marque a alternativa correta. I. Para José Bonifácio, a abolição da escravidão deveria acontecer “sem prejuízo da sociedade”, o que podemos interpretar como “sem prejuízo aos latifundiários”. II. Para o autor do texto, a abolição deveria ocorrer de maneira imediata. III. A abolição da escravidão no Brasil ocorreu logo após a independência da nação, em 1822. É verdadeiro apenas o que se afirma em:

78. [...]

a. Em que pese ser considerada como criação dos gregos, a filosofia se origina no Oriente sob o influxo da religião e apenas posteriormente chega à Grécia.

E ninguém percebe

b. A filosofia representa uma ruptura radical em relação aos mitos, representando uma nova forma de pensamento plenamente racional desde as suas origens.

tão bela e tão rica

c. Apesar de ser pensamento racional, a filosofia se desvincula dos mitos de forma gradual.

como é necessário que terra tão fértil, por si se governe! [...] A terra tão rica

d. Filosofia e mito sempre mantiveram uma relação de interdependência, uma vez que o pensamento filosófico necessita do mito para se expressar.

e ó almas inertes!

e. O mito já era filosofia, uma vez que buscava respostas para problemas que até hoje são objeto da pesquisa filosófica.

[...]

expoENEM 18

o povo tão pobre... Ninguém que proteste! Cecília Meirelles, “Romanceiro da Inconfidência”.


Neste livro, Cecília Meireles evoca de forma poética fatos históricos ocorridos principalmente em 1789, em Minas Gerais. Analise as afirmativas.

I. Relaciona-se a ausência de mobilidade social aos problemas educacionais do Brasil. II. Segundo o texto, o Brasil é o país de maior mobilidade social da América.

I. O movimento conhecido como Inconfidência Mineira recebeu a ade-são de toda a população da região, uma vez que, entre suas propostas, declarava-se abertamente que seria abolida a escravidão.

III. Segundo o texto, os problemas atuais do país em relação à mobilidade social seriam explicados por uma estrutura constituída no Período Colonial.

II. A “terra tão rica” citada na poesia é uma referência ao ouro, que no século XVIII era a principal riqueza explorada no Brasil Colônia.

É verdadeiro apenas o que se afirma em:

III. Uma vez vitorioso, o movimento promoveu a independência do Brasil, ainda em 1789, e estabeleceu novas formas de organização do país, com o governo republicano.

a. I. b. II.

É verdadeiro apenas o que se afirma em:

c. III.

a. I.

d. I e II.

b. II.

e. I e III.

c. III.

81. Analise as afirmativas sobre a ilustração, que remete ao conflito árabe--israelense.

d. I e II. e. II e III. 79. Analise a tabela a seguir. INVESTIMENTOS (em bilhões de dólares)

PERÍODO 1869

1897

1908

1914

1919

1924

I - Investimentos dos Estados Unidos no estrangeiro

0,08

0,69

2,5

3,5

7,0

10,9

II - Investimentos estrangeiros nos Estados Unidos

1,54

3,4

6,4

7,2

3,3

3,9

III - Posição líquida dos Estados Unidos (I - II)

-1,46

-2,71

-3,9

-3,7

+3,7

+7,0

Fonte: Historical Statistics of the United States, 1789 - 1945.

Sobre a situação econômica dos Estados Unidos apresentada na tabela, marque a alternativa correta.

I. Percebe-se o equilíbrio das forças antagônicas: Israel e Palestina. II. A situação no Oriente Médio ficou ainda mais explosiva após a Segunda Guerra Mundial, com a criação do Estado de Israel, em 1948. III. Atualmente, a Palestina consegue se sobrepor a Israel, em virtude de aquela possuir armas atômicas.

a. Durante o período, os investimentos dos Estados Unidos no estrangeiro apresentaram decréscimo em todas as épocas. b. O aumento considerável dos investimentos no estrangeiro, entre 1919 e 1924, deve-se aos resultados da Primeira Guerra Mundial, que elevaram os Estados Unidos à condição de nação mais rica do mundo.

É verdadeiro apenas o que se afirma em:

c. A posição negativa dos Estados Unidos no período de 1869 deve--se à vitória do sul escravista na Guerra da Secessão, fato que manteve a escravidão no país por mais 80 anos.

a. I. b. II.

d. O sucesso econômico dos Estados Unidos está relacionado a sua aliança com a Alemanha, firmada no início do século XX, para combater o imperialismo britânico. e. Os Estados Unidos tornaram-se uma nação rica porque, ao promover a abolição da escravidão em 1861, proporcionaram uma inserção total dos ex-escravos no mercado de trabalho e de produção.

c. III. d. I e II. e. I e III. 82. (UERJ-RJ 2005)

80. (UERJ 2005) Mobilidade social é mito no Brasil Um estudo do Banco Mundial derruba o mito de que o Brasil é um país de grande mobilidade social – onde os filhos dos mais pobres “sobem na vida” com o tempo. Segundo o trabalho, comparado com outros países da América Latina, o Brasil tem ainda menos mobilidade. A principal razão do fenômeno, segundo o Bird, é o acesso à educação, diretamente relacionado às oportunidades de ascensão. [...] “Na verdade, o Brasil é um dos países com o menor nível de mobilidade educacional do mundo”, diz o trabalho. Jornal do Brasil, 8 out. 2003.

A dificuldade na mobilidade social, característica da sociedade brasileira, encontra-se intrinsecamente relacionada a estruturas históricas que se originam no Período Colonial. A partir da leitura do texto, analise as afirmativas.

expoENEM 19

Esta seleção de capas da revista Veja apresenta importantes fatos e processos relacionados à história da China nas últimas três décadas, incluindo a previsão do surgimento de mais uma potência


mundial, numa edição de 2003. A respeito da história recente desse país, analise as afirmativas.

III. Os atletas do passado, assim como os da atualidade, participam dos jogos olímpicos apenas para honrar os deuses, sem qualquer interesse pessoal.

I. A capa da revista que estampa em sua manchete “Fúria na China”, diz respeito aos acontecimentos na Praça da Paz Celestial, em 1989, quando os jovens promoveram manifestações em prol da democracia.

É verdadeiro apenas o que se afirma em: a. I. b. II.

II. O chinês Mao Tsé-Tung, mostrado em duas das capas, foi um dos mais democráticos líderes do país, promovendo ampla participação popular nas decisões do governo. III. A capa que tem como manchete “A próxima potência” diz respeito ao momento atual vivido pela China, em que suas exportações e seu PIB já ultrapassam vários países do ocidente capitalista. É verdadeiro apenas o que se afirma em:

c. III. d. I e II. e. I e III. 85. Leia atentamente os textos, observe a figura e analise as afirmativas a seguir. Neste período [1789-1848], sem dúvida, os artistas eram diretamente inspirados e envolvidos pelos assuntos públicos. [...] O elo entre os assuntos públicos e as artes é particularmente forte onde a consciên-cia nacional e os movimentos de libertação ou de unificação nacional estavam se desenvolvendo.

a. I. b. II. c. III. d. I e II.

Eric Hobsbawm, “A era das revoluções”.

e. I e III. 83. EU MANDO LOGO OPRIMO!

EU MANDO LOGO OPRIMO!

SOU REPRIMIDO, LOGO DESISTO!

Fazendo uma relação com o Antigo Regime, marque a alternativa correta. a. No período histórico referido, a participação popular nas decisões políticas era garantida por Constituições. b. O Antigo Regime é marcado pela rivalidade e alternância de poder en-tre o Rei e os representantes da Igreja. c. As classes mandatárias (nobreza e clero) utilizavam seu poder para controlar e reprimir a população. d. Não existia nenhuma relação entre o poder político, exercido pelos reis, e o poder religioso. e. A população, fortemente politizada, revoltava-se constantemente, em busca de melhores condições de vida.

Eugène Delacroix, 1830.

Para Delacroix, e em geral para os românticos, liberdade é a independência nacional. Nesta tela, a mulher que agita o estandarte tricolor sobre as barricadas representa, ao mesmo tempo, a liberdade e a França. Giulio Carlo Argan, “Arte Moderna”.

I. O movimento artístico do Romantismo, demonstrado na tela, auxiliou no processo de independência de vários países, inclusive o do Brasil.

84. Por sua atitude exemplar durante a Maratona das Olimpíadas 2004, o brasileiro Vanderlei Cordeiro de Lima foi designado para receber a medalha Pierre de Coubertin (fundador dos Jogos Olímpicos da Era Moderna, o qual deixou para a posteridade alguns princípios como “O importante na vida não é o triunfo, mas o combate” e “O essencial não é ter vencido, mas ter lutado bem”). A propósito da noção de ideal olímpico e da participação dos atletas nos jogos da Antiguidade, podemos dizer que o atleta não era somente um desportista, pois os jogos olímpicos se inscreviam num contexto religioso e o bom desempenho era uma forma de honrar os deuses. Inicialmente, os atletas deviam pertencer à aristocracia, mas depois aparecem cada vez mais camponeses e artesãos. Nos primórdios, os atletas concorriam somente pela glória pessoal e da sua cidade-estado, mas aos poucos as cidades-estados passam a financiar seus atletas, que se dedicam exclusivamente aos treinos e às competições premiadas. Acontecem também negociações e transferências de atletas, denunciadas pelos filósofos, que veem nas novas práticas a negação do ideal olímpico. Julgue as afirmativas. I. A sociedade grega da Antiguidade, por ser igualitária, permitia a todas as pessoas participarem como atletas dos jogos olímpicos. II. Os jogos olímpicos na Antiguidade tinham forte ligação com a religiosidade grega.

II. No caso europeu, os movimentos de contestação à ordem absolutista, e de caráter nacionalista caracterizaram rebeliões como a de 1848, denominada de “Primavera dos Povos”. III. A França, no período romântico, apresenta-se em paz e não passa por nenhuma revolução política ou crise econômica. É verdadeiro apenas o que se afirma em: a. I. b. II. c. III. d. I e II. e. I e III. 86. A década de 60 assistiu a um fenômeno de dimensões psicológicas, sociais e culturais que nenhuma teoria fora capaz de prever. De maneira espontânea, quase súbita, a juventude dos países indus-

expoENEM 20


b. As duas guerras não têm nada em comum, pois a Guerra do Vietnã não teve participação dos Estados Unidos.

trializados, em particular os anglo-saxões, começou a negar todo o modo de vida ocidental, abandonando suas tradições tidas como mais firmes e contestando quase todos os seus valores, mesmo os mais sagrados.

c. Nas duas guerras os Estados Unidos contaram com apoio incondicional da União Soviética. d. A Guerra do Iraque é consequência direta da Guerra do Vietnã, pois aquele país comprava armas e tecnologia do Vietnã.

Luiz Carlos Maciel, “Anos 60”

e. As duas guerras foram facilmente vencidas pelos Estados Unidos, dado o seu poderio militar.

A respeito do contexto dos anos 60, analise as afirmativas. I. Os jovens do período eram apáticos e aceitavam todas as regras impostas pela sociedade e pelos governos. II. Nos Estados Unidos, vários movimentos culturais e sociais reivindicavam, entre outras coisas, igualdade racial e o fim da Guerra do Vietnã.

89. Os trechos a seguir se referem a momentos diferentes da história brasileira. Leia os textos e analise as afirmativas. Trecho 1 Pelos campos há fome em grandes plantações

III. No Brasil, os estudantes saíram às ruas em 1964 para apoiar o golpe militar que derrubou o presidente João Goulart.

Pelas ruas marchando indecisos cordões Inda fazem da flor seu mais forte refrão

É verdadeiro apenas o que se afirma em:

E acreditam nas flores vencendo o canhão

a. I.

Geraldo Vandré, 1968.

b. II.

Disponível em: <http://www.mpbnet.com.br>. Acesso em: set. 2004.

c. III.

Trecho 2

d. I e II.

[...] meu Brasil

e. I e III.

Que sonha com a volta do irmão do Henfil Com tanta gente que partiu num rabo de foguete

87. Leia atentamente o trecho a seguir e analise as afirmativas.

Chora a nossa pátria, mãe gentil Choram Marias e Clarices no solo do Brasil

Marx defendia a necessidade da ação política e da conquista do poder pelo proletariado organizado em um partido político. Bakunin propunha a necessidade da solidariedade e a prática da revolução, ou seja, a realização da revolução. Bakunin considerava que a manutenção do Estado, mesmo que na forma da ditadura do proletariado, acabaria levando à formação de uma nova classe exploradora e privilegiada, que perpetuaria a opressão econômica e política do Estado.

João Bosco e Aldir Blanc, 1979. Disponível em: <http://www.di.ufpe.br/>. Acesso em: set. 2004.

I. O trecho 1 é contemporâneo ao momento da edição do AI-5, que, entre outras medidas, implementava uma censura rígida e violenta. II. O trecho 2 trata do período da reabertura política, quando foi extinto o AI-5 e muitos exilados começaram a retornar ao Brasil.

Edilene Toledo, “Travessias revolucionárias”, p. 100.

III. Ambos os trechos tratam da mesma situação: o Brasil dominado por regras rígidas e sem perspectivas de mudanças políticas.

I. Tanto Marx quanto Bakunin defendiam a extinção do Estado, na revolução do proletariado.

É verdadeiro apenas o que se afirma em:

II. Enquanto Marx defendia a extinção do Estado, Bakunin defendia a ditadura do proletariado, como forma perfeita de democracia.

a. I.

III. A divergência entre Marx e Bakunin está no fato de este defender a extinção do Estado pela revolução.

c. III.

b. II. d. I e II.

É verdadeiro apenas o que se afirma em:

e. I e III.

a. I. b. II.

90. Em termos técnicos, a Revolução Industrial trouxe grandes inovações aos processos produtivos, porém, em termos sociais e humanos, as mudanças foram mais marcantes e radicais. Interprete a figura a seguir e marque a alternativa correta.

c. III.

© Wikipédia

d. I e II. e. I e III. 88. Leia o texto e marque a alternativa correta. Corações e Mentes [documentário realizado por Peter Davies, nos anos 70, sobre a Guerra do Vietnã] tem esse nome devido ao slogan do governo norte-americano na época, de que nós tínhamos que ganhar os corações e mentes do povo vietnamita. Estive no Iraque, e os americanos estão utilizando a mesma frase. E lá vi as mesmas atitudes, a mesma arrogância. Achei que o Vietnã tinha nos ensinado a lição: não ir para a guerra com países que não estão nos ameaçando. É assustador ver o quão rápido a lição foi esquecida. Adaptado de entrevista de Peter Davies ao jornal O Globo, 1 out. 2004, Segundo Caderno.

a. Apesar das diferenças no tempo e no espaço, as guerras do Vietnã e do Iraque – a última iniciada em 2003 e ainda em curso (2010) – têm em comum resultarem de intervenções militares estadunidenses ao redor do planeta. expoENEM 21

a. A Revolução Industrial promoveu uma melhoria nas condições de vida dos operários, uma vez que com seus altos salários eles podiam morar e se alimentar em melhores condições.


b. A exploração do trabalho feminino e infantil foi uma das características sociais mais marcantes da revolução.

Se lembrarmos que o Paraguai produzia algodão de boa qualidade, poder-se-ia deduzir o óbvio: a Inglaterra compraria algo-dão do Paraguai. Errado! A simples compra do algodão paraguaio era uma contradição para a expansão imperialista, pois fortalecia a economia do Paraguai, dando-lhe condições de, a longo prazo, concorrer com a própria Inglaterra nas suas exportações para o Prata. Na visão do imperialismo, o Paraguai – como seus vizinhos – deveria ser apenas um mercado consumidor tradicional de produtos industrializados e fornecedor de matérias-primas. Então, qual seria a saída para a Inglaterra? Destruir o Pa-raguai.

c. A situação do campo em nada se alterou em função da Revolução Industrial. d. Operários e patrões, já nos anos iniciais do processo, entraram em negociações para a implantação de leis trabalhistas que não prejudicassem nem operários e nem patrões. e. A Revolução Industrial, ao longo do século XIX, ficou restrita exclusivamente à Inglaterra, não atingindo outros países. 91. Leia os trechos de canções e analise as afirmativas.

Rubim Santos Leão de Aquino et al., “História das sociedades americanas”, 1990.

Inimigo do batente Se eu lhe arranjo trabalho

I. O primeiro trecho menciona a rivalidade das nações na Bacia Platina para explicar a Guerra do Paraguai.

Ele vai de manhã, de tarde pede a conta Eu já estou cansada de dar

II. O segundo trecho defende que o imperialismo britânico na região seria o responsável pelo conflito.

Murro em faca de ponta Que está esperando ser presidente

III. O Brasil teve total isenção nessa guerra, não chegando a participar efetivamente dela.

Tira patente do sindicato

É verdadeiro apenas o que se afirma em:

Ele disse pra mim

Dos inimigos do batente

a. I.

Wilson Batista e Germano Augusto, 1939/1940.

b. II.

Não admito Não, não admito

c. III.

Eu digo e repito

d. I e II.

Que não admito

e. I e III.

Que você tenha coragem De usar malandragem Pra meu dinheiro tomar Se quiser vá trabalhar, oi Vá pedir emprego na pedreira Que eu não estou disposta A viver dessa maneira Ciro de Souza e Augusto Garcez, 1940.

I. O período retratado nas canções é a Era Vargas, fase em que se tentava enaltecer a imagem de ordeiro e trabalhador do brasileiro, por meio de propagandas governamentais. II. Estas canções mostram a aversão do brasileiro ao trabalho, provando que este não “serve” ao trabalho até os dias de hoje.

93. A Revista de História da Biblioteca Nacional (edição de abril de 2006) traz uma matéria sobre a popularidade de “líderes históricos” em comunidades do Orkut (site de relacionamentos da internet, afiliado à empresa Google). A matéria destaca surpreendentes comentários, extraídos de comunidades devotadas a algumas dessas personalidades. Por exemplo: “Falar de Stalin é sempre uma emoção: jamais um líder político substituiu outro com tanta grandeza – e olhem que substituir Lênin era muito difícil. Só Stalin podia concretizar este fato. O ‘bicho’ era humilde e simples ao extremo. Era tranquilo, sabia de cor o nome de todos os oficiais do exército, cumprimentava todos à sua volta. Ele jamais levantava a voz, não se redimia, não dizia não, não se aborrecia com nada, não falava palavras inúteis jamais. Era humilde e compreensivo”.

III. O período retratado nas músicas é o Colonial, momento em que a valorização do trabalho escravo é total.

Em relação ao trecho e, levando em conta o contexto histórico do stalinismo, analise as afirmativas sobre o governo de Stalin na União Soviética, entre os anos de 1924 e 1953. I. As informações do texto estão totalmente corretas, pois o líder soviético foi, ao longo de todo o seu governo, democrático, popular e atencioso para com as reivindicações de dissidentes do governo.

É verdadeiro apenas o que se afirma em: a. I. b. II.

II. Durante o governo de Stalin, a União Soviética viveu uma fase de crise econômica que representou um grande atraso tecnológico e militar.

c. III. d. I e II. e. I e III. 92. Leia os trechos seguintes, sobre a Guerra do Paraguai, e analise as afirmativas. [...] o Brasil e a República Argentina, por motivos diversos não viam com bons olhos a situação excepcional em que o despotismo punha aquele país, ali no seio do continente; sobretudo depois que Solano Lopez revelou pruridos de expansão dominadora. O Brasil não podia suportar a política insidiosa de Lopez a ameaçar-lhe as províncias limítrofes; e a República Argentina tinha que intervir no primeiro conflito que se desse, porque Lopez, se viesse a ser lisonjeado de alguma fortuna, pelo menos poria em perigo a província de Corrientes, desde muito disputada pelo Paraguai à nação platina. Rocha Pombo, “Compêndio de História da América”, 1925.

expoENEM 22

III. O texto traz informações e opiniões sobre o líder soviético; não obstante, o governo de Stalin também foi marcado por violenta repressão e censura, principalmente a intelectuais e opositores políticos. É correto apenas o que se afirma em: a. I. b. II. c. III. d. I e II. e. I e III.


94.

É verdadeiro apenas o que se afirma em: a. I.

d. I e II.

b. II.

e. II e III.

c. III. 96. (Enem) Os cruzados avançavam em silêncio, encontrando por todas as partes ossadas humanas, trapos e bandeiras. No meio desse quadro sinistro, não puderam ver, sem estremecer de dor, o acampamento onde Gauthier havia deixado as mulheres e crianças. Lá, os cristãos tinham sido surpreendidos pelos muçulmanos, mesmo no momento em que os sacerdotes celebravam o sacrifício da Missa. As mulheres, as crianças, os velhos, todos os que a fraqueza ou a doença conservava sob as tendas, perseguidos até os altares, tinham sido levados para a escravidão ou imolados por um inimigo cruel. A multidão dos cristãos, massacrada naquele lugar, tinha ficado sem sepultura.

(Carlos Eduardo Novaes e Cesar Lobo. “História do Brasil para principiantes”. São Paulo: Ática, 1998. p. 209)

A charge mostrada faz alusão ao período da política do café com leite, no Brasil, momento em que os produtores de café utilizavam-se da máquina estatal para manter seus lucros. Sobre a prática mostrada na cena e o papel do Estado na economia, analise as afirmativas.

J. F. Michaud, “História das cruzadas”.

Foi, de fato, na sexta-feira 22 do tempo de Chaaban, do ano de 492 da Hégira, que os franj* se apossaram da Cidade Santa, após um sítio de 40 dias. Os exilados ainda tremem cada vez que falam nisso, seu olhar se esfria como se eles ainda tivessem diante dos olhos aqueles guerreiros louros, protegidos de armaduras, que espelham pelas ruas o sabre cortante, desembainhado, degolando homens, mulheres e crianças, pilhando as casas, saqueando as mesquitas.

I. Desde o século XVIII, com a consolidação do liberalismo, o Estado pratica a intervenção na economia, de maneira total. II. Em momentos de crise ou guerras, são frequentes as intervenções do Estado para regular a economia, como por exemplo no caso dos Estados Unidos durante a década de 1930, com o New Deal. III. O Brasil retratado na charge era economicamente um país agro-exportador, e por isso dependia muito do café. Sendo assim, o Estado promovia a “ajuda” ao produto, comprando os excedentes de produção.

*franj = cruzados. Amin Maalouf, “As Cruzadas vistas pelos árabes”.

É verdadeiro apenas o que se afirma em:

Sobre os textos acima, avalie as seguintes afirmações.

a. I.

I. Os textos referem-se ao mesmo assunto — as Cruzadas, ocorridas no Período Medieval —, mas apresentam visões distintas sobre a realidade dos conflitos religiosos desse período histórico.

b. II. c. III.

II. Ambos os textos narram partes de conflitos ocorridos entre cristãos e muçulmanos durante a Idade Média e revelam como a violência contra mulheres e crianças era prática comum entre adversários.

d. I e II. e. II e III. 95. Observe a charge sobre a França pré-revolucionária, da década de 1780, e analise as afirmativas.

III. Ambos narram conflitos ocorridos durante as Cruzadas medievais e revelam como as disputas dessa época, apesar dos confrontos militares, foram resolvidas com base na ideia do respeito e da tolerância cultural e religiosa. É correto apenas o que se afirma em: a. I.

d. I e II.

b. II.

e. II e III.

c. III. 97. (Enem) No princípio do século XVII, era bem insignificante e quase miserável a Vila de São Paulo. João de Laet dava-lhe 200 habitantes, entre portugueses e mestiços, em 100 casas; a Câmara, em 1606, informava que eram 190 os moradores, dos quais 65 andavam homiziados*.  

*homiziados: escondidos da justiça

In: ARRUDA, José Jobson de A. História Moderna e Contemporânea. 12. ed. São Paulo: Ática, 1980.

Nelson Werneck Sodré, “Formação histórica do Brasil”.

I. Percebe-se claramente na charge que as classes mais abastadas exploravam os camponeses, na França daquele período.

Na época da invasão holandesa, Olinda era a capital e a cidade mais rica de Pernambuco. Cerca de 10% da população, calculada em aproximadamente 2 000 pessoas, dedicavam-se ao comércio, com o qual muita gente fazia fortuna. Cronistas da época afirmavam que os habitantes ricos de Olinda viviam no maior luxo.

II. A Revolução que se seguiu, em 1789, teve como uma de suas causas essa opressão das elites sobre o povo, principalmente no que diz respeito aos impostos. III. Naquele contexto, o rei da França, Luís XVI, fez de tudo para evitar a revolução, promovendo mudanças sociais de grande monta, como a equiparação das classes.

Hildegard Féist, “Pequena história do Brasil holandês”.

expoENEM 23

Os textos acima retratam, respectivamente, São Paulo e Olinda no início do século XVII, quando Olinda era maior e mais rica. São Pau-


lo é, atualmente, a maior metrópole brasileira e uma das maiores do planeta. Essa mudança deveu-se, essencialmente, ao seguinte fator econômico: a. maior desenvolvimento do cultivo da cana-de-açúcar no planalto de Piratininga do que na Zona da Mata Nordestina.

vivia sob regime militar, que, embora politicamente autoritário, não chegou a fazer uso de métodos violentos contra seus opositores.

a. I. b. II.

b. atraso no desenvolvimento econômico da região de Olinda e Recife, associado à escravidão, inexistente em São Paulo.

c. III.

c. avanço da construção naval em São Paulo, favorecido pelo comércio dessa cidade com as Índias.

d. I e II. e. II e III.

d. desenvolvimento sucessivo da economia mineradora, cafeicultora e industrial no Sudeste. e. destruição do sistema produtivo de algodão em Pernambuco quando da ocupação holandesa. 98. (Enem 2006) A moderna democracia brasileira foi construída entre saltos e sobressaltos. Em 1954, a crise culminou no suicídio do Presidente Vargas. No ano seguinte, outra crise quase impediu a posse do presidente eleito, Juscelino Kubitschek. Em 1961, o Brasil quase chegou à guerra civil depois da inesperada renúncia do Presidente Jânio Quadros. Três anos mais tarde, um golpe militar depôs o Presidente João Goulart, e o país viveu durante vinte anos em regime autoritário.

É correto apenas o que se afirma em:

100. (Enem 2005) Um professor apresentou os mapas abaixo numa aula sobre as implicações da formação das fronteiras no continente africano. Com base na aula e na observação dos mapas, os alunos fizeram três afirmativas: AS FRONTEIRAS ÉTNICAS E POLÍTICAS DA ÁFRICA DIVISÃO POLÍTICA

A partir dessas informações, relativas à história republicana brasileira, assinale a opção correta. a. Ao término do governo João Goulart, Juscelino Kubitschek foi eleito presidente da República. b. A renúncia de Jânio Quadros representou a primeira grande crise do regime republicano brasileiro. c. Após duas décadas de governos militares, Getúlio Vargas foi eleito presidente em eleições diretas. d. A trágica morte de Vargas determinou o fim da carreira política de João Goulart. e. No Período Republicano citado, sucessivamente, um presidente morreu, um teve sua posse contestada, um renunciou e outro foi deposto.

DIVISÃO ÉTNICA

99. (Enem 2006) Os textos a seguir foram extraídos de duas crônicas publicadas no ano em que a seleção brasileira conquistou o tricam-peonato mundial de futebol. O General Médici falou em consistência moral. Sem isso, talvez a vitória nos escapasse, pois a disciplina consciente, livremente aceita, é vital na preparação espartana para o rude teste do campeonato. Os brasileiros portaram-se não apenas como técnicos ou profissionais, mas como brasileiros, como cidadãos deste grande país, cônscios de seu papel de representantes de seu povo. Foi a própria afirmação do valor do homem brasileiro, como salientou bem o presidente da República. Que o chefe do governo aproveite essa pausa, esse minuto de euforia e de efusão patriótica, para meditar sobre a situação do país. [...] A realidade do Brasil é a explosão patriótica do povo ante a vitória na Copa. Danton Jobim, Última Hora, 23 jun. 1970.

O que explodiu mesmo foi a alma, foi a paixão do povo: uma explosão incomparável de alegria, de entusiasmo, de orgulho. [...] Debruçado em minha varanda de Ipanema, [um velho amigo] perguntava: – Será que algum terrorista se aproveitou do delírio coletivo para adiantar um plano seu qualquer, agindo com frieza e precisão? Será que, de outro lado, algum carrasco policial teve ânimo para voltar a torturar sua vítima logo que o alemão apitou o fim do jogo? Rubem Braga, Última Hora, 25 jun. 1970.

Avalie as seguintes afirmações a respeito dos dois textos e do período histórico em que foram escritos.

(Atualidades/Vestibular 2005, 1°. sem., ed. Abril, p. 68)

I. A brutal diferença entre as fronteiras políticas e as fronteiras étnicas no continente africano aponta para a artificialidade em uma divisão com objetivo de atender apenas aos interesses da maior potência capitalista na época da descolonização. II. As fronteiras políticas jogaram a África em uma situação de constante tensão ao desprezar a diversidade étnica e cultural, acirrando conflitos entre tribos rivais. III. As fronteiras artificiais criadas no contexto do colonialismo, após os processos de independência, fizeram da África um continente marcado por guerras civis, golpes de estado e conflitos étnicos e religiosos. É verdadeiro apenas o que se afirma em:

I. Para os dois autores, a conquista do tricampeonato mundial de futebol provocou uma explosão de alegria popular.

a. I.

II. Os dois textos salientam o momento político que o país atravessava ao mesmo tempo em que conquistava o tricampeonato.

c. III.

III. À época da conquista do tricampeonato mundial de futebol, o Brasil expoENEM 24

b. II. d. I e II. e. II e III.


101.

A partir da leitura do poema e da interpretação da imagem, assinale a alternativa correta.

Os impasses da modernização

a. O texto e a imagem enaltecem a importância da propaganda para os regimes fascistas, utilizando-a como ideologia e instrumento de dominação, para convencer a população sobre a necessidade da guerra.

[...] jamais tantos homens e mulheres foram exterminados, tão submetidos, ou passaram tanta fome [...] dentro de uma nova ordem mundial alicerçada sob o signo do desemprego, da exclusão, da deportação dos exilados, dos apátridas, dos imigrantes, da guerra econômica entre os países da dívida externa, das guerras interétnicas.

b. O texto afirma a importância da propaganda como meio de incutir nas pessoas a ideologia fascista, enaltecendo o papel do líder político e militar. No entanto, a imagem contraria esta visão.

Jacques Derrida, “Espaço e Modernidade”, p. 27.

c. O texto enfatiza a neutralidade da propaganda, principalmente em tempos de guerra, uma vez que seu papel fundamental é informar as pessoas, com imparcialidade, sobre o que ocorre na representação da imagem.

Com base no texto e em seus conhecimentos sobre a situação social mundial, marque a alternativa correta.

d. A ideia central apresentada pelo texto difere da mensagem apresentada pela imagem, uma vez que a primeira faz crítica à propaganda como instrumento de dominação, e a segunda não aborda uma propaganda manipuladora.

a. A nova ordem mundial promoveu forte integração dos mercados e também diminuiu as diferenças econômicas entre os países. b. As diferenças encontradas no mundo são restritas às questões culturais presentes em cada país.

e. O texto e a imagem fazem uma análise objetiva e realista sobre a utilização das propagandas em período de guerras, desvinculando--as das ideologias político-partidárias dos fascistas.

c. O desemprego é uma consequência natural, promovido pelo desenvolvimento de novas tecnologias e facilmente resolvido pelos governos. d. Uma das consequências das migrações internacionais é a xenofobia, a aversão aos estrangeiros, principalmente àqueles de países pobres. e. No mundo atual, as comunicações receberam poucos recursos tecnológicos, sobretudo, nos países centrais.

103. A Revolução Industrial foi um processo de evolução tecnológica que ocorreu ao final do século XVIII e transformou a forma de produzir, as relações de trabalho e os costumes que vigoravam até então. Dentre as consequências da Revolução Industrial para o mundo desenvolvido, pode-se marcar como certa a seguinte afirmação. © Wikipédia

102. O poema a seguir foi escrito na década de 1930 por Bertolt Brecht (1998–1956), dramaturgo e poeta alemão. Marxista, Brecht foi um opositor ferrenho do nazismo. Leia o poema e compare-o com a imagem.

A necessidade da propaganda [...] Um bom propagandista Transforma um monte de esterco em local de veraneio. Quando não há manteiga, ele demonstra Como um talhe esguio faz um homem esbelto. Milhares de pessoas que ouvem discorrer sobre as autoestradas Alegram-se como se tivessem carros. Nos túmulos dos que morreram de fome ou em combate Ele planta louros. Mas já, bem antes disso, Falava de paz enquanto canhões passavam. Somente através da propaganda perfeita Pode-se convencer milhões de pessoas Que o crescimento do exército constitui obra de paz. Que cada novo tanque é uma pomba da paz E cada novo regimento uma prova de Amor à paz [...].

a. As novas tecnologias são usadas para criar novas necessidades e assim aumentar o desejo pelo novo. b. A substituição do trabalho humano pelas máquinas libera mão de obra do setor terciário para o primário. c. A evolução da tecnologia chega a todos os cantos do mundo com as mesmas velocidade e intensidade.

Bertolt Brecht, “Poemas (1913-1956)”, p. 197-199. © Wikipédia

d. Com as novas tecnologias, as condições climáticas deixaram de ser importantes para a produção agrícola. e. Os avanços promovidos pela tecnologia e aplicados à medicina promoveram forte declínio das taxas de mortalidade nos países pobres africanos assolados pela Aids. 104. Observe o texto a seguir e responda.

Hitler posa para foto ao lado das crianças.

[...] acredito poder ser verdadeiro o fato de que a fortuna arbitre metade de nossas ações, mas que, mesmo assim, ela nos permita governar a outra metade quase inteira. Comparo-a a um desses rios impetuosos que, quando se enfurecem, transbordam pelas planícies, acabam com as árvores, as construções, arrastam montes de terra de um ponto a outro; [...] não é menos verdade que os homens, quando a calmaria retorna, são capazes de fazer consertos e barragens, de sorte que, em outra cheia, aqueles rios estarão correndo por um canal, e seu ímpeto não será nem tão livre, nem tão nocivo. Assim também se expoENEM 25


a. o controle da natalidade é importante para o desenvolvimento econômico dos países.

passa com a fortuna; seu poder se manifesta onde não há resistência organizada, voltando ela a sua violência apenas para onde não se construíram diques nem se fizeram reparos para contê-la.

b. países como China e Índia só conseguiram se desenvolver após o sucesso dos programas de controle da natalidade.

Nicolau Maquiavel, “O príncipe”, p. 143-144.

c. a melhoria nas condições econômicas e sociais promove diminuição nas taxas de natalidade e aumento da expectativa de vida. d. países ricos como EUA e Inglaterra implementaram políticas de controle de natalidade nas décadas de 1950 e 1960. e. sem controle da natalidade, é impossível um país ter desenvolvimento econômico sustentável. 106. (Enem 2010) A maioria das pessoas daqui era do campo. Vila Maria é hoje exportadora de trabalhadores. Empresários de Primavera do Leste, Estado de Mato Grosso, procuram o bairro de Vila Maria para conseguir mão de obra. É gente indo distante daqui 300, 400 quilômetros para ir trabalhar, para ganhar sete conto por dia. (Carlito, 43 anos, maranhense, entrevistado em 22/03/98). Adaptado de: H. S. Ribeiro, “O migrante e a cidade: dilemas e conflitos”.

O texto retrata um fenômeno vivenciado pela agricultura brasileira nas últimas décadas do século XX, consequência a. dos impactos sociais da modernização da agricultura. b. da recomposição dos salários do trabalhador rural.

c. da exigência de qualificação do trabalhador rural.

O texto retrata a proposta política de Maquiavel, diferenciando a concepção de virtú, ou seja, a capacidade e habilidade do príncipe para ser flexível e dominar as circunstâncias, em oposição ao conceito de Fortuna, o modo como as coisas acontecem. Na proposta política de Maquiavel, defendida no livro O príncipe, o governante seria

d. da diminuição da importância da agricultura. e. dos processos de desvalorização de áreas rurais. 107.

a. o melhor soldado, selecionado nas batalhas da época. b. o melhor orador, uma vez que Maquiavel defendia a democracia. Por isso, seria governante aquele que conseguisse argumentar e convencer os eleitores. c. o mais sábio e ético, selecionado pela educação. d. o mais sábio e astuto, possuidor da virtú, uma habilidade política. e. aquele que tivesse mais votos nas assembleias democráticas.

Os vestígios dos povos tupi-guarani encontram-se desde as missões e o Rio da Prata, ao Sul, até o Nordeste, com algumas ocorrências ainda pouco conhecidas no sul da Amazônia. A Leste, ocupavam toda a faixa litorânea, desde o Rio Grande do Sul até o Maranhão. A Oeste, aparecem (no Rio da Prata) no Paraguai e nas terras baixas da Bolívia. Evitam as terras inundáveis do Pantanal e marcam sua presença discretamente nos cerrados do Brasil central. De fato, ocuparam, de preferência, as regiões de floresta tropical e subtropical.

© 2001-2010 HAAP Media Ltd

105. Os riscos que o crescimento demográfico representa para a humanidade são diferenciados. Dependem dos interesses econômicos, do desenvolvimento social e das políticas internas que países distintos adotam para controlar a natalidade e a dimensão das famílias. Acerca dos riscos das diferentes formas de crescimento demográfico, bem como das intervenções dos governos para evitá-los, é possível afirmar que

expoENEM 26

André Prous, “O Brasil antes dos brasileiros”.


Os povos indígenas citados possuíam tradições culturais específicas que se distinguiam de outras sociedades indígenas e dos colonizadores europeus. Entre as tradições tupi-guarani, destacava-se

d. parâmetro para assegurar o exercício político primando pelos interesses e ação privada dos cidadãos. e. aceitação dos valores universais implícitos numa sociedade que busca dimensionar sua veiculação a outras sociedades.

a. a organização em aldeias politicamente independentes, dirigidas por um chefe, eleito pelos indivíduos mais velhos da tribo. b. a ritualização da guerra entre as tribos e o caráter semissedentário de sua organização social.

110. Compare os textos a seguir e faça o que se pede.

c. a conquista de terras mediante operações militares, o que permitiu seu domínio sobre vasto território.

Texto 01

d. o caráter pastoril de sua economia, que prescindia da agricultura para investir na criação de animais.

Quando troveja e relampeja, geralmente também chove. E a chuva era vital para os camponeses da era dos vikings. Assim, Tor era adorado como o deus da fertilidade. [...] a resposta mitológica à questão de saber por que chovia era, portanto, a de que Tor agitava seu martelo. E quando caía a chuva, as sementes germinavam e as plantas cresciam nos campos.

e. o desprezo pelos rituais antropofágicos praticados em outras sociedades indígenas. 108. (Enem 2010) Em nosso país, queremos substituir o egoísmo pela moral, a honra pela probidade, os usos pelos princípios, as conveniências pelos deveres, a tirania da moda pelo império da razão, o desprezo à desgraça pelo desprezo ao vício, a insolência pelo orgulho, a vaidade pela grandeza de alma, o amor ao dinheiro pelo amor à glória, a boa companhia pelas boas pessoas, a intriga pelo mérito, o espirituoso pelo gênio, o brilho pela verdade, o tédio da volúpia pelo encanto da felicidade, a mesquinharia dos grandes pela grandeza do homem.

Jostein Gaarder, “O mundo de Sofia”.

Texto 02 Os primeiros filósofos tinham uma coisa em comum: eles acreditavam que determinada substância básica estava por trás de todas essas transformações. [...] O interessante é saber que perguntas eles fizeram e que tipo de resposta buscavam. Sabemos que eles colocavam questões referentes às transformações que podiam observar na natureza [...] Eles queriam entender os fenômenos naturais, sem ter que, para isto, recorrer aos mitos [...] E assim, a filosofia se libertou da religião. Podemos dizer que os filósofos da natureza deram os primeiros passos na direção de uma forma científica de pensar.

Adaptado de: L. Hunt, “Revolução Francesa e Vida Privada”.

O discurso de Robespierre, de 5 de fevereiro de 1794, do qual o trecho transcrito é parte, relaciona-se a qual dos grupos político-sociais envolvidos na Revolução Francesa? a. À alta burguesia, que desejava participar do poder legislativo francês como força política dominante. b. Ao clero francês, que desejava justiça social e era ligado à alta burguesia.

Jostein Gaarder, “O mundo de Sofia”.

c. A militares oriundos da pequena e média burguesia, que derrotaram as potências rivais e queriam reorganizar a França internamente.

Os textos expostos representam as formas de conhecimento mitológico e filosófico. A partir dos textos e de seus conhecimentos sobre as características do mito e da filosofia, assinale a alternativa correta. a. O texto 01 apresenta o conhecimento mitológico, segundo o qual a verdade do mito obedece a critérios empíricos e científicos de comprovação.

d. À nobreza esclarecida, que, em função do seu contato com os intelectuais iluministas, desejava extinguir o absolutismo francês. e. Aos representantes da pequena e média burguesia e das camadas populares, que desejavam justiça social e direitos políticos.

b. O texto 02 corresponde ao conhecimento filosófico, segundo o qual a razão é capaz de compreender parte dos fenômenos naturais, pois sua totalidade está além da capacidade humana.

109. (Enem 2010)

c. O texto 01 corresponde ao conhecimento mitológico, pois busca respostas para os fenômenos naturais em elementos sobrenaturais, atribuindo aos deuses a origem de tudo.

A ética precisa ser compreendida como um empreendimento coletivo a ser constantemente retomado e rediscutido, porque é produto da relação interpessoal e social. A ética supõe ainda que cada grupo social se organize sentindo-se responsável por todos e que crie condições para o exercício de um pensar e agir autônomos. A relação entre ética e política é também uma questão de educação e luta pela soberania dos povos. É necessária uma ética renovada, que se construa a partir da natureza dos valores sociais para organizar também uma nova prática política.

d. O texto 02 corresponde ao conhecimento filosófico, uma vez que busca uma explicação sobrenatural para os fenômenos naturais. e. Segundo o texto 02, a filosofia continua recorrendo ao mito, uma vez que a diversidade de fenômenos naturais pressupõe uma multiplicidade de explicações e nem todas essas explicações podem ser racionalmente compreendidas.

Adaptado de: Cordi et al., “Para filosofar”.

O século XX teve de repensar a ética para enfrentar novos problemas oriundos de diferentes crises sociais, conflitos ideológicos e contradições da realidade. Sob esse enfoque e a partir do texto, a ética pode ser compreendida como a. instrumento de garantia de cidadania, porque através dela os cidadãos passam a pensar e agir de acordo com valores coletivos.

111. A história humana nunca viveu uma situação tão privilegiada como a de agora. Há avanços tecnológicos, possibilidades de cura, capacidade de se produzir alimentos e de se resolver as questões litigiosas com o diálogo. Porém, em nenhum outro momento da história humana viu-se tanta diferença, tantas guerras e, sobretudo, a fome e a miséria atingindo bilhões de pessoas.

b. mecanismo de criação de direitos humanos, porque é da natureza do homem ser ético e virtuoso. c. meio para resolver os conflitos sociais no cenário da globalização, pois a partir do entendimento do que é efetivamente a ética, a política internacional se realiza. expoENEM 27

Baseado no texto e em seus conhecimentos, marque a alternativa correta. a. A fome e a miséria são condições explicadas pelas diferentes formas de viver de cada grupo humano. b. As diferenças sociais e econômicas entre os humanos têm causas naturais, que podem ser explicadas pelo determinismo geográfico.


c. O mundo vive uma situação ímpar na história humana, mas grande parte da população mundial ainda vive às margens do desenvolvimento tecnológico.

a. aliou-se aos partidos de oposição e organizou a campanha Diretas Já. b. manifestou-se contra a corrupção e pressionou pela aprovação da Lei da Ficha Limpa.

d. É muito importante que a maior parte da população mundial continue pobre, pois se existir desenvolvimento igual o consumo aumentará e a Terra entrará em colapso.

c. engajou-se nos protestos relâmpago e utilizou a internet para agendar suas manifestações.

e. Os avanços tecnológicos atingem de maneira equilibrada todos os cantos do planeta. As diferenças citadas no texto são de origem cultural.

d. espelhou-se no movimento estudantil de 1968 e protagonizou ações revolucionárias armadas. e. tornou-se porta-voz da sociedade e influenciou no processo de impeachment do então presidente Collor.

112. (Enem 2011)

114. Compare a charge e o texto a seguir e faça o que se pede.

Texto I A ação democrática consiste em todos tomarem parte do processo decisório sobre aquilo que terá consequência na vida de toda coletividade. GALLO, S. et al. Ética e cidadania. Campinas: Papirus, 1997 (adaptado).

Texto II É necessário que haja liberdade de expressão, fiscalização sobre órgãos governamentais e acesso por parte da população às informações trazidas a público pela imprensa. Disponível em: <http://www.observatoriodaimprensa.com.br>. Acesso em: 24 abr. 2010.

Partindo da perspectiva de democracia apresentada no Texto I, os meios de comunicação, de acordo com o Texto II, assumem um papel relevante na sociedade por a. orientarem os cidadãos na compra dos bens necessários à sua sobrevivência e bem-estar.

Belmonte, “Caricatura dos tempos”.

b. fornecerem informações que fomentam o debate político na esfera pública.

Defesa e ataque constituem, no quadro das operações militares, os conceitos chaves. Substituem a aparente simetria dos lutadores, em que cada qual quer jogar o outro por terra, a dissimetria política (um quer modificar o status quo) e militar (um toma a iniciativa de invadir o território do outro).

c. apresentarem aos cidadãos a versão oficial dos fatos. d. propiciarem o entretenimento, aspecto relevante para conscientização política.

Raymond Aron, “Pensar a guerra”.

e. promoverem a unidade cultural, por meio das transmissões esportivas. © Wikipédia

113. (Enem 2011)

A charge do cartunista Belmonte representa os presidentes Henry Truman, dos Estados Unidos, e Stalin, da União Soviética. Assim como o texto, ela procura denunciar os interesses que moveram as duas maiores potências no período da Guerra Fria, caracterizada pela(o) a. importância que os esportes em geral adquiriram no contexto da ordem internacional bipolarizada. b. disputa política e militar entre as duas superpotências, que buscavam assegurar sua hegemonia no cenário internacional. c. interesse político presente nos torneios de futebol, principalmente naqueles de caráter internacional. d. representação das disputas políticas em torno do controle mundial do petróleo. e. representação de uma disputa pelo controle do comércio internacional.

115. (Enem 2011) Quinto maior país do mundo em extensão territorial, sexta maior economia do planeta, maior nação de língua portuguesa, detentor da maior floresta equatorial e também do maior rio. Não faltam grandiosidades para classificar o Brasil, e também não faltam críticas a esse país de grandes e intoleráveis diferenças.

Movimento dos Caras-Pintadas <http://www1.folha.uol.com.br/folha/brasil/ult96u397259.shtml>. Acesso em: 11 maio 2012.

O movimento representado na imagem, do início dos anos de 1990, arrebatou milhares de jovens no Brasil.

Nesse contexto, a juventude, movida por um forte sentimento cívico,

expoENEM 28

Analisando o enunciado e utilizando seus conhecimentos sobre o Brasil, assinale a única alternativa correta. a. O Brasil ocupa uma posição de destaque dentro da América Latina no que se refere à mais equitativa distribuição de renda entre os países do Mercosul.


b. Estar entre as maiores economias do planeta garante ao Brasil um assento permanente no conselho de segurança da ONU, inclusive com direito a veto.

Texto 02 Como sempre, Bola de Neve e Napoleão não estavam de acordo. O primeiro argumentava que, se não fossem capazes de defender-se, estavam destinados à submissão; o segundo alegava que, fomentando revoluções em toda parte, não teriam necessidade de defender-se. Os animais ouviam Napoleão, depois Bola de Neve e não chegavam à conclusão sobre quem tinha razão; a verdade é que estavam sempre de acordo com aquele que falava no momento.

c. Nos últimos vinte anos, o Brasil tem recebido atenção especial dos países ricos por seus avanços nas áreas de saúde e educação, que já são comparadas aos países desenvolvidos. d. Mesmo tendo retirado milhões da miséria o governo brasileiro não conseguiu acabar com a imensa diferença entre ricos e pobres que ainda afasta muitos brasileiros de uma vida digna.

George Orwell, ”A revolução dos bichos”.

e. Com a crescente melhora nos padrões de consumo e acesso à casa própria não existem mais pobres no Brasil. Agora somos um povo de classe média e rapidamente chegaremos às classes A e B. 116. (Enem 2011) Segundo a letra de Jorge Ben Jor, o Brasil é um país “tropical abençoado por Deus e bonito por natureza”. Ser um país tropical tem suas vantagens e seus ônus.

Utilizando seus conhecimentos, marque a alternativa correta sobre as características climáticas do Brasil e suas consequências para a sociedade. a. Ser um país tropical implica ter verões chuvosos e invernos rigorosos nos anos em que existe a ocorrência do fenômeno El Niño. b. O clima tropical atua em todo o território brasileiro, provocando inundações frequentes em regiões serranas. A Revolução dos Bichos, livro escrito em 1945 por George Orwell, é uma contundente crítica aos rumos da Revolução Russa de 1917, e em 1999 virou filme.

c. A tropicalidade brasileira é um dos motivos da grande procura dos turistas pelas praias da Região Norte, assim como a diversidade da Floresta Amazônica.

A partir dos textos e de seus conhecimentos sobre a Revolução Russa e suas consequências, assinale a alternativa correta.

d. Cerca de 70% do território brasileiro é de clima tropical, que se caracteriza por duas estações bem definidas, sendo o verão a mais chuvosa.

a. A população russa participou ativamente de todas as decisões relativas aos acontecimentos da revolução que aconteceu naquele país.

e. Durante o verão, na Região Sul, o clima tropical apresenta-se com poucas chuvas. Durante o inverno, as geadas são frequentes.

b. Segundo os textos, a população não tem plena consciência dos acontecimentos; apenas segue as decisões propostas por seus líderes.

117. (Enem 2011)

c. Enquanto o segundo texto faz duras críticas à Revolução Russa, o primeiro enaltece o fato de poucos líderes assumirem sua direção.

O Centro-Oeste apresentou-se como extremamente receptivo aos novos fenômenos da urbanização, já que era praticamente virgem, não possuindo infraestrutura de monta, nem outros investimentos fixos vindos do passado.

d. Os textos enfatizam que a população era fortemente politizada, fato comprovado pela ampla participação popular na revolução.

Pôde, assim, receber uma infraestrutura nova, totalmente a serviço de uma economia moderna.

e. A Revolução Russa foi o grande acontecimento que concretizou os ideais da democracia participativa.

SANTOS, M. A urbanização brasileira. São Paulo: Edusp, 2005 (adaptado).

119. (Enem 2011)

O texto trata da ocupação de uma parcela do território brasileiro. O processo econômico diretamente associado a essa ocupação foi o avanço da(o)

No mundo árabe, países governados há décadas por regimes políticos centralizadores contabilizam metade da população com menos de 30 anos; desses, 56% têm acesso à internet. Sentindo-se sem perspectivas de futuro e diante da estagnação da economia, esses jovens incubam vírus sedentos por modernidade e democracia. Em meados de dezembro, um tunisiano de 26 anos, vendedor de frutas, põe fogo no próprio corpo em protesto por trabalho, justiça e liberdade. Uma série de manifestações eclode na Tunísia e, como uma epidemia, o vírus libertário começa a se espalhar pelos países vizinhos, derrubando em seguida o presidente do Egito, Hosni Mubarak. Sites e redes sociais – como o Facebook e o Twitter – ajudaram a mobilizar manifestantes do norte da África a ilhas do Golfo Pérsico.

a. industrialização voltada para o setor de base. b. economia da borracha no sul da Amazônia. c. fronteira agropecuária que degradou parte do cerrado. d. exploração mineral na Chapada dos Guimarães. e. extrativismo na região pantaneira. 118. Leia os textos que seguem e resolva a questão proposta.

SEQUEIRA, C.D.; VILLAMÉA, L. A epidemia da Liberdade. Isto é internacional. 2 mar. 2011 (adaptado).

Texto 01 A vida pública adormece progressivamente quando algumas dúzias de chefes, portadores de uma inesgotável energia e de um idealismo sem limites, dirigem e governam; [...] A elite do operariado é convocada de tempos em tempos para reuniões, para aplaudir o discurso do chefe e votar unanimemente as resoluções propostas.

Rosa Luxemburgo, “A Revolução Russa”

expoENEM 29

Considerando os movimentos políticos mencionados no texto, o acesso à internet permitiu aos jovens árabes a. reforçar a atuação dos regimes políticos existentes. b. tomar conhecimento dos fatos sem se envolver. c. manter o distanciamento necessário à sua segurança.


d. disseminar vírus capazes de destruir programas dos computadores.

Uma leitura dessas narrativas divergentes demonstra que ambas estão refletindo sobre

e. difundir ideias revolucionárias que mobilizaram a população.

a. a carência de fontes para a pesquisa sobre os reais motivos dessa Guerra.

120.

b. o caráter positivista das diferentes versões sobre essa Guerra. Assim, Querofonte, uma vez, indo para Delfos, ousou consultar o oráculo acerca da questão de que estamos a falar. Perguntou ele então à sacerdotisa Pítia se havia alguém mais sábio do que eu, e Pítia respondeu que não havia ninguém. [...] Depois de saber do fato, refleti comigo mesmo: o que o deus pretendia dizer e o que escondia sob os seus desígnios? [...] Certamente não está mentindo, porque isso não é possível a um deus. Assim, fiquei muito tempo em dúvida quanto ao sentido da resposta. Platão, “Apologia de Sócrates”.

c. o resultado das intervenções britânicas nos cenários de batalha. d. a dificuldade de elaborar explicações convincentes sobre os motivos dessa Guerra. e. o nível de crueldade das ações do exército brasileiro e argentino durante o conflito. 122. (Enem 2010) Quem construiu a Tebas de sete portas? Nos livros estão nomes de reis. Arrastaram eles os blocos de pedra? E a Babilônia várias vezes destruída. Quem a reconstruiu tantas vezes? Em que casas da Lima dourada moravam os construtores? Para onde foram os pedreiros, na noite em que a Muralha da China ficou pronta? A grande Roma está cheia de arcos do triunfo. Quem os ergueu? Sobre quem triunfaram os césares?

Os gregos acreditavam que os oráculos eram locais onde se podia interpretar a vontade dos deuses. Essa crença remete aos temas do destino e do determinismo. Ambos são características do mito grego e abordam a relação entre liberdade humana e providência divina. A expressão filosófica que tem como base a tese do determinismo é: a. Há certas coisas que são e podem deixar de ser porque dependem de nós, de nossa vontade e de nossa ação. Aristóteles

BRECHT, B. Perguntas de um trabalhador que lê. Disponível em: http://recantodasletras.uol.com.br. Acesso em: 28 abr. 2010.

b. Ter fé é assinar uma folha em branco e deixar que Deus nela escreva o que quiser.

Partindo das reflexões de um trabalhador que lê um livro de História, o autor censura a memória construída sobre determinados monumentos e acontecimentos históricos. A crítica refere-se ao fato de que

Santo Agostinho

c.

a. os agentes históricos de uma determinada sociedade deveriam ser aqueles que realizaram feitos heroicos ou grandiosos e, por isso, ficaram na memória.

O dever não é uma imposição externa, mas é a expressão de nossa liberdade, ou seja, da presença da lei moral em nós. Immannuel Kant

b. a História deveria se preocupar em memorizar os nomes de reis ou dos governantes das civilizações que se desenvolveram ao longo do tempo.

d. Tudo flui, nada persiste nem permanece o mesmo. Tudo é um eterno vir-a-ser.

c. grandes monumentos históricos foram construídos por trabalhadores, mas sua memória está vinculada aos governantes das sociedades que os construíram.

Heráclito

e.

d. os trabalhadores consideram que a História é uma ciência de difícil compreensão, pois trata de sociedades antigas e distantes no tempo.

O homem apresenta-se como uma escolha a fazer. Ele está condenado à liberdade.

e. as civilizações citadas no texto, embora muito importantes, permanecem sem terem sido alvos de pesquisas históricas.

Jean-Paul Sartre

123. (Unisinos-RS 2012) 121. (Enem 2010) O que me parece ser tipicamente grego é a atitude crítica com relação ao registro dos acontecimentos, isto é, o desenvolvimento de métodos críticos que nos permitem distinguir entre fatos e fantasias.

Substitui-se então uma história crítica, profunda, por uma crônica de detalhes onde o patriotismo e a bravura dos nossos soldados encobrem a vilania dos motivos que levaram a Inglaterra a armar brasileiros e argentinos para a destruição da mais gloriosa república que já se viu na América Latina, a do Paraguai. CHIAVENATTO, J. J. Genocídio americano: A Guerra do Paraguai. São Paulo: Brasiliense, 1979 (adaptado).

(MOMIGLIANO, Arnaldo. As raízes clássicas da historiografia moderna. Bauru: EDUSC, 2004, p. 55).

O imperialismo inglês, “destruindo o Paraguai, mantém o status quo na América Meridional, impedindo a ascensão do seu único Estado economicamente livre”. Essa teoria conspiratória vai contra a realidade dos fatos e não tem provas documentais. Contudo essa teoria tem alguma repercussão. DORATIOTO, F. Maldita guerra: nova história da Guerra do Paraguai. São Paulo: Cia. das Letras, 2002 (adaptado).

É comum afirmar-se que a história, como narrativa dos acontecimentos, teria nascido com os gregos antigos. Embora ela não fosse ainda uma ciência, dava os primeiros passos para contar as coisas que aconteceram com os homens por meio de razões humanas, e não mágicas. Dois autores que se destacaram na tarefa de narrar o mundo, na Grécia Clássica, são a. Heródoto e Tucídides. b. Heródoto e Homero. c. Tucídides e Homero.

expoENEM 30


d. Homero e Hesíodo.

Ainda que não haja uma data específica proposta para o início do Antropoceno, ele está associado à intensificação da ação humana sobre o ambiente. Considerando essa associação, o início desse novo período geológico deve coincidir, necessariamente, com o início da Idade que recebeu a seguinte denominação na História Ocidental:

e. Heródoto e Cícero.

124. (Enem 2009) Segundo Aristóteles, “na cidade com o melhor conjunto de normas e naquela dotada de homens absolutamente justos, os cidadãos não devem viver uma vida de trabalho trivial ou de negócios – esses tipos de vida são desprezíveis e incompatíveis com as qualidades morais –, tampouco devem ser agricultores os aspirantes à cidadania, pois o lazer é indispensável ao desenvolvimento das qualidades morais e à prática das atividades políticas”. VAN ACKER, T. Grécia. A vida cotidiana na cidade-Estado. São Paulo: Atual, 1994.

O trecho, retirado da obra Política, de Aristóteles, permite compreender que a cidadania

a. Antiga b. Moderna c. Medieval d. Contemporânea 127. (UFSM-RS 2011) Leia os textos: Texto I

a. possui uma dimensão histórica que deve ser criticada, pois é condenável que os políticos de qualquer época fiquem entregues à ociosidade, enquanto o resto dos cidadãos tem de trabalhar.

A intensa radiação solar na região equatorial é responsável direta pelas altas taxas de evaporação da água de sua superfície, levando à formação de massas de ar quente e úmido que condicionam os altos índices pluviométricos observados. Assim, elevadas temperaturas, intensa radiação solar e muita chuva caracterizam o clima das regiões tropicais e nos fazem entender as luxuriantes formações florestais e as riquezas dos recifes de corais típicos dessas latitudes. Esses fatores reunidos explicam, ainda, a elevada produtividade associada aos referidos ecossistemas.

b. era entendida como uma dignidade própria dos grupos sociais superiores, fruto de uma concepção política profundamente hierarquizada da sociedade. c. estava vinculada, na Grécia Antiga, a uma percepção política democrática, que levava todos os habitantes da polis a participarem da vida cívica. d. tinha profundas conexões com a justiça, razão pela qual o tempo livre dos cidadãos deveria ser dedicado às atividades vinculadas aos tribunais.

UZUNIAN & BIRNER. Biologia. São Paulo: Harbra, 2007. p. 820.

Texto II

e. vivida pelos atenienses era, de fato, restrita àqueles que se dedicavam à política e que tinham tempo para resolver os problemas da cidade.

É seguramente fácil encontrar casos de correlação íntima entre um fato geográfico e um fato social. A contiguidade* de duas regiões, planície e montanha, onde a ordem dos trabalhos não é a mesma e onde as colheitas amadurecem em datas diferentes, torna disponíveis os trabalhadores que alugarão periodicamente seus braços. A presença de uma grande cidade faz nascer à sua porta cultivos especiais, associados a hábitos igualmente especiais, como o dos horticultores. A ocorrência bem localizada de um produto de primeira necessidade pode engendrar consequências sociais e políticas.

125. (Enem 2009) O Egito é visitado anualmente por milhões de turistas de todos os quadrantes do planeta, desejosos de ver com os próprios olhos a grandiosidade do poder esculpida em pedra há milênios: as pirâmides de Gizeh, as tumbas do Vale dos Reis e os numerosos templos construídos ao longo do Nilo.

O que hoje se transformou em atração turística era, no passado, interpretado de forma muito diferente, pois

VIDAL DE LA BLANCHE, Paul. As condições geográficas dos fatos sociais. http://www4.fct.unesp.br/raul/saude_ambiental/condicoes_geograficas_faros_sociais.pdf

a. significava, entre outros aspectos, o poder que os faraós tinham para escravizar grandes contingentes populacionais que trabalhavam nesses monumentos.

*contiguidade = proximidade, vizinhança.

b. representava para as populações do alto Egito a possibilidade de migrar para o sul e encontrar trabalho nos canteiros faraônicos.

c. significava a solução para os problemas econômicos, uma vez que os faraós sacrificavam aos deuses suas riquezas, construindo templos.

d. representava a possibilidade de o faraó ordenar a sociedade, obrigando os desocupados a trabalharem em obras públicas, que engrandeceram o próprio Egito. e. significava um peso para a população egípcia, que condenava o luxo faraônico e a religião baseada em crenças e superstições.

O desenvolvimento das ciências neste século XXI oferece uma variedade de explicações sobre os processos que envolvem as relações entre os seres humanos e os ecossistemas. A História, ciência social, na medida em que estabelece o diálogo e o debate com os demais campos do conhecimento científico, pode confrontar explicações e buscar novas e mais abrangentes formas de entender o conjunto dos processos que envolveram as ações humanas ao longo do tempo e nos diversos espaços. Como se pode perceber, através das informações da Biologia e da Geografia nos textos apresentados, essa abertura é possível e necessária, porque a História é uma ciência cada vez mais a. pragmática.

126. (UERJ 2012)

b. experimental.

O Antropoceno, período geológico que começou quando o homem tomou o controle do planeta, acelerou as emissões de CO2 e “desregulou a máquina do mundo”, afirma o glaciólogo francês Claude Lorius, um pioneiro dos estudos sobre o clima, em seu novo livro, Viagem ao Antropoceno. “O homem é um agente determinante da vida sobre a Terra”, explica o especialista de 78 anos. Adaptado de http://exame.abril.com.br, 05/01/2011

expoENEM 31

c. teórica. d. interdisciplinar. e. factual.


128. (UFG 2010) Leia o texto a seguir.

Eu queria saber por que o Nilo sobe no começo do verão e subindo continua durante cem dias; por que ele se retrai e a sua corrente baixa, assim que termina esse número de dias, sendo que permanece baixo o inverno inteiro, até um novo verão. Alguns gregos apresentam explicações para os fenômenos do rio Nilo. Eles afirmam que os ventos do noroeste provocam a subida do rio, ao impedir que suas águas corram para o mar. Não obstante, com certa frequência, esses ventos deixam de soprar, sem que o rio pare de subir da forma habitual. Além disso, se os ventos do noroeste produzissem esse efeito, os outros rios que correm na direção contrária aos ventos deveriam apresentar os mesmos efeitos que o Nilo, mesmo porque eles todos são pequenos, de menor corrente.

Origens do regime feudal, diz-se. Onde buscá-las? Alguns responderam em “Roma”. Outros “na Germânia”. As razões dessas miragens são evidentes […]. Das duas partes, sobretudo, eram empregadas palavras – tais como “benefício” (beneficium) para os latinos, “feudo” para os germanos – das quais essas gerações persistiram em se servir, ainda que lhes conferindo, sem se dar conta, um conteúdo quase inteiramente novo. Pois, para o grande desespero dos historiadores, os homens não têm o hábito, a cada vez que mudam o costume, de mudar de vocabulário. BLOCH, Marc. Apologia da História ou o ofício do historiador. Rio de Janeiro: Zahar. p. 58. (Adaptado).

Heródoto. História (trad.). livro II, 19-23. Chicago: Encyclopaedia Britannica Inc. 2a. ed. 1990, p. 52-3 (com adaptações).

Neste fragmento, Marc Bloch discute de que forma os historiadores lidam com a questão das origens, indicando que a

a. origem dos fenômenos históricos deve ser buscada no encadeamento dos acontecimentos, o que confere à História um sentido de continuidade.

I. Para alguns gregos, as cheias do Nilo devem-se ao fato de que suas águas são impedidas de correr para o mar pela força dos ventos do noroeste.

b. origem é o ponto de partida da mudança que demarca a ruptura com as formas históricas precedentes.

II. O argumento embasado na influência dos ventos do noroeste nas cheias do Nilo sustenta-se no fato de que, quando os ventos param, o rio Nilo não sobe.

c. ideia de origem desconsidera a cronologia, ferramenta metodológica que concede sentido à explicação histórica. d. busca da origem dos fenômenos históricos encobre a relação entre as forças de conservação e de mudança que compõem a vida social. e. origem dos fenômenos históricos pode ser encontrada na permanência dos costumes e do uso do vocabulário.

Nessa passagem, Heródoto critica a explicação de alguns gregos para os fenômenos do rio Nilo. De acordo com o texto, julgue as afirmativas a seguir.

III. A explicação de alguns gregos para as cheias do Nilo baseava-se no fato de que fenômeno igual ocorria com rios de menor porte que seguiam na mesma direção dos ventos.

É correto apenas o que se afirma em a. I.

129. (Enem 2009)

b. II. No período 750-338 a.C., a Grécia antiga era composta por cidades-estados, como por exemplo Atenas, Esparta, Tebas, que eram independentes umas das outras, mas partilhavam algumas características culturais, como a língua grega. No centro da Grécia, Delfos era um lugar de culto religioso frequentado por habitantes de todas as cidades-estados. No período 1200-1600 d. C., na parte da Amazônia brasileira onde hoje está o Parque Nacional do Xingu, há vestígios de quinze cidades que eram cercadas por muros de madeira e que tinham até dois mil e quinhentos habitantes cada uma. Essas cidades eram ligadas por estradas a centros cerimoniais com grandes praças. Em torno delas havia roças, pomares e tanques para a criação de tartarugas. Aparentemente, epidemias dizimaram grande parte da população que lá vivia.

c. I e II. d. I e III. e. II e III. 131. (Enem 2007)

Folha de S. Paulo, ago. 2008 (adaptado).

Apesar das diferenças históricas e geográficas existentes entre as duas civilizações elas são semelhantes pois a. as ruínas das cidades mencionadas atestam que grandes epidemias dizimaram suas populações. b. as cidades do Xingu desenvolveram a democracia, tal como foi concebida em Tebas.

Pintura rupestre da Toca do Pajaú–PI. <www.betocelli.com>

A pintura rupestre mostrada na figura anterior, que é um patrimônio cultural brasileiro, expressa

c. as duas civilizações tinham cidades autônomas e independentes entre si.

a. o conflito entre os povos indígenas e os europeus durante o processo de colonização do Brasil.

d. os povos do Xingu falavam uma mesma língua, tal como nas cidades-estados da Grécia.

b. a organização social e política de um povo indígena e a hierarquia entre seus membros.

e. as cidades do Xingu dedicavam-se à arte e à filosofia tal como na Grécia.

c. aspectos da vida cotidiana de grupos que viveram durante a chamada pré-história do Brasil.

130. (Enem 2008) Ao visitar o Egito do seu tempo, o historiador grego Heródoto (484-420/30 a.C.) interessou-se por fenômenos que lhe pareceram incomuns, como as cheias regulares do rio Nilo. A propósito do assunto, escreveu o seguinte: expoENEM 32

d. os rituais que envolvem sacrifícios de grandes dinossauros atualmente extintos. e. a constante guerra entre diferentes grupos paleoíndios da América durante o período colonial.


132. (Enem 2002) Michel Eyquem de Montaigne (1533-1592) compara, nos trechos, as guerras das sociedades Tupinambá com as chamadas “guerras de religião” dos franceses que, na segunda metade do século XVI, opunham católicos e protestantes. (...) não vejo nada de bárbaro ou selvagem no que dizem daqueles povos; e, na verdade, cada qual considera bárbaro o que não se pratica em sua terra. (...) Não me parece excessivo julgar bárbaros tais atos de crueldade [o canibalismo], mas que o fato de condenar tais defeitos não nos leve à cegueira acerca dos nossos. Estimo que é mais bárbaro comer um homem vivo do que o comer depois de morto; e é pior esquartejar um homem entre suplícios e tormentos e o queimar aos poucos, ou entregá-lo a cães e porcos, a pretexto de devoção e fé, como não somente o lemos mas vimos ocorrer entre vizinhos nossos conterrâneos; e isso em verdade é bem mais grave do que assar e comer um homem previamente executado. (...) Podemos portanto qualificar esses povos como bárbaros em dando apenas ouvidos à inteligência, mas nunca se compararmos a nós mesmos, que os excedemos em toda sorte de barbaridades.

Ao ensino histórico incumbe o dever glorioso de fazer amar e de fazer compreender a pátria, todos os nossos heróis do passado, mesmo envoltos em lendas. Se o estudante não leva consigo a viva lembrança de nossas glórias nacionais, se não sabe que nossos ancestrais combateram por mil campos de batalha por nobres causas, se não aprendeu o que custou o sangue e o esforço para constituir a unidade da pátria e retirar, em seguida do caos de nossas instituições envelhecidas, as leis sagradas que nos fizeram livres, se não se torna um cidadão compenetrado de seus deveres e um soldado que ama sua bandeira, o professor perdeu seu tempo.

Com o auxílio das ideias defendidas pelo historiador Lavisse, julgue os itens que se seguem [V ou F]. (1) A História é escrita pelos pesquisadores e deve ser ensinada pelos mestres com o compromisso de quem pesquisa e ensina as grandes questões de seu tempo. (2) A visão excessivamente patriótica do autor expõe concepções que, no alvorecer do século XX, entendiam que o historiador tinha como função glorificar a nação, o Estado e as instituições.

(MONTAIGNE, Michel Eyquem de. Ensaios. São Paulo: Nova Cultural, 1984.)

De acordo com o texto, pode-se afirmar que, para Montaigne,

(3) O “ensino histórico”, no contexto do Brasil contemporâneo, deve ser, sobretudo, um instrumento de combate para fazer que as armas intelectuais estejam a favor da unidade da pátria e do amor de cada cidadão pela sua bandeira.

a. a ideia de relativismo cultural baseia-se na hipótese da origem única do gênero humano e da sua religião. b. a diferença de costumes não constitui um critério válido para julgar as diferentes sociedades.

(4) A revolução metodológica no ensino da História tornou-a, no fim do século XX, completamente racional e neutra, sem qualquer possibilidade de interferência da ideologia na teoria.

c. os indígenas são mais bárbaros do que os europeus, pois não conhecem a virtude cristã da piedade. d. a barbárie é um comportamento social que pressupõe a ausência de uma cultura civilizada e racional.

135. (Enem 1999)

e. a ingenuidade dos indígenas equivale à racionalidade dos europeus, o que explica que os seus costumes são similares.

Se compararmos a idade do planeta Terra, avaliada em quatro e meio bilhões de anos (4,5×109 anos), com a de uma pessoa de 45 anos, então, quando começaram a florescer os primeiros vegetais, a Terra já teria 42 anos. Ela só conviveu com o homem moderno nas últimas quarto horas e, há cerca de uma hora, viu-o começar a plantar e a colher. Há menos de um minuto percebeu o ruído de máquinas e de indústrias e, como denuncia uma ONG de defesa do meio ambiente, foi nesses últimos sessenta segundos que se produziu todo o lixo do planeta!

133. (Enem 2001) O texto a seguir reproduz parte de um diálogo entre dois personagens de um romance. – Quer dizer que a Idade Média durou dez horas? Perguntou Sofia. – Se cada hora valer cem anos, então sua conta está certa. Podemos imaginar que Jesus nasceu à meia-noite, que Paulo saiu em peregrinação missionária pouco antes da meia-noite e meia e morreu quinze minutos depois, em Roma. Até as três da manhã a fé cristã foi mais ou menos proibida. (...) Até as dez horas as escolas dos mosteiros detiveram o monopólio da educação. Entre dez e onze horas são fundadas as primeiras universidades.

O texto permite concluir que a agricultura começou a ser praticada há cerca de a. 365 anos. b. 460 anos.

Adaptado de GAARDER, Jostein. O Mundo de Sofia, Romance da História da Filosofia. São Paulo, Cia. das Letras, 1997.

c. 900 anos. d. 10000 anos.

O ano de 476 d.C., época da queda do Império Romano do Ocidente, tem sido usado como marco para o início da Idade Média. De acordo com a escala de tempo apresentada no texto, que considera como ponto de partida o início da Era Cristã, pode-se afirmar que a. as Grandes Navegações tiveram início por volta das quinze horas. b. a Idade Moderna teve início um pouco antes das dez horas. c. o Cristianismo começou a ser propagado na Europa no início da Idade Média. d. as peregrinações do apóstolo Paulo ocorreram após os primeiros 150 anos da Era Cristã. e. os mosteiros perderam o monopólio da educação no final da Idade Média.

134. (UnB-DF 2000) No limiar do século XX, às vésperas da Primeira Guerra Mundial, o historiador francês Ernest Lavisse fornecia as instruções para o ensino da História aos jovens de seu tempo, das quais reproduz-se o trecho seguinte.

e. 460000 anos. 136. (Enem 2010) Quando Édipo nasceu, seus pais, Laio e Jocasta, os reis de Tebas, foram informados de uma profecia na qual o filho mataria o pai e se casaria com a mãe. Para evitá-la, ordenaram a um criado que matasse o menino. Porém, penalizado com a sorte de Édipo, ele o entregou a um casal de camponeses que morava longe de Tebas para que o criasse. Édipo soube da profecia quando se tornou adulto. Saiu então da casa de seus pais para evitar a tragédia. Eis que, perambulando pelos caminhos da Grécia, encontrou-se com Laio e seu séquito, que, insolentemente, ordenou que saísse da estrada. Édipo reagiu e matou todos os integrantes do grupo, sem saber que entre eles estava seu verdadeiro pai. Continuou a viagem até chegar em Tebas, dominada por uma Esfinge. Ele decifrou o enigma da Esfinge, tornou-se rei de Tebas e casou-se com a rainha, Jocasta, a mãe que desconhecia.

expoENEM 33

Disponível em: http://www.culturabrasil.org. Acesso em: 28/08/2010 (adaptado).


No mito Édipo Rei, são dignos de destaque os temas do destino e do determinismo. Ambos são características do mito grego e abordam a relação entre liberdade humana e providência divina. A expressão filosófica que toma como pressuposta a tese do determinismo é: a. “Nasci para satisfazer a grande necessidade que eu tinha de mim mesmo.” (Jean-Paul Sartre) b. “Ter fé é assinar uma folha em branco e deixar que Deus nela escreva o que quiser.” (Santo Agostinho) c. “Quem não tem medo da vida também não tem medo da morte.” (Arthur Schopenhauer)

140. (Enem 2011) A introdução de novas tecnologias desencadeou uma série de efeitos sociais que afetaram os trabalhadores e sua organização. O uso de novas tecnologias trouxe a diminuição do trabalho necessário que se traduz na economia líquida do tempo de trabalho, uma vez que, com a presença da automação microeletrônica, começou a ocorrer a diminuição dos coletivos operários e uma mudança na organização dos processos de trabalho. A utilização de novas tecnologias tem causado inúmeras alterações no mundo do trabalho. Essas mudanças são observadas em um modelo de produção caracterizado

d. “Não me pergunte quem sou eu e não me diga para permanecer o mesmo.” (Michel Foucault)

a. pelo uso intensivo do trabalho manual para desenvolver produtos autênticos e personalizados.

e. “O homem, em seu orgulho, criou a Deus a sua imagem e semelhança.” (Friedrich Nietzsche)

b. pelo ingresso tardio das mulheres no mercado de trabalho no setor industrial. c. pela participação ativa das empresas e dos próprios trabalhadores no processo de qualificação laboral.

137. (Enem 2008) O limite de concentração de álcool etílico no sangue estabelecido para os motoristas revela que a nova legislação brasileira de trânsito é uma das mais rígidas do mundo. Apesar dos aspectos polêmicos, a “lei seca” pode mudar substancialmente os indicadores de mortalidade, particularmente no que se refere a

d. pelo aumento na oferta de vagas para trabalhadores especializados em funções repetitivas. e. pela manutenção de estoques de larga escala em função da alta produtividade.

a. gripe e pneumonia. b. doenças do aparelho urinário.

141. (Enem 2011)

c. acidentes vasculares cerebrais. d. doenças sexualmente transmissíveis.

Um volume imenso de pesquisas tem sido produzido para tentar avaliar os efeitos dos programas de televisão. A maioria desses estudos diz respeito às crianças – o que é bastante compreensível pela quantidade de tempo que elas passam em frente ao aparelho e pelas possíveis implicações desse comportamento para a socialização. Dois dos tópicos mais pesquisados são o impacto da televisão no âmbito do crime e da violência e a natureza das notícias exibidas na televisão.

e. agressões e acidentes de trânsito. 138. (Enem 2010) A Inglaterra pedia lucros e recebia lucros. Tudo se transformava em lucro. As cidades tinham sua sujeira lucrativa, suas favelas lucrativas, sua fumaça lucrativa, sua desordem lucrativa, sua ignorância lucrativa, seu desespero lucrativo. As novas fábricas e os novos altos-fornos eram como as Pirâmides, mostrando mais a escravização do homem que seu poder.

GIDDENS, A. Sociologia. Porto Alegre: Artmed, 2005

O texto indica que existe uma significativa produção científica sobre os impactos socioculturais da televisão na vida do ser humano. E as crianças, em particular, são as mais vulneráveis a essas influências porque

DEANE. P. A Revolução Industrial. Rio de Janeiro: Zahar, 1979 (adaptado).

Qual relação é estabelecida no texto entre os avanços tecnológicos ocorridos no contexto da Revolução Industrial Inglesa e as características das cidades industriais no início do século XIX?

a. codificam informações transmitidas nos programas infantis por meio da observação.

a. A facilidade em se estabelecer relações lucrativas transformava as cidades em espaços privilegiados para a livre iniciativa, característica da nova sociedade capitalista.

b. adquirem conhecimentos variados que incentivam o processo de interação social. c. interiorizam padrões de comportamento e papéis sociais com menor visão crítica.

b. O desenvolvimento de métodos de planejamento urbano aumentava a eficiência do trabalho industrial.

d. observam formas de convivência social baseadas na tolerância e no respeito.

c. A construção de núcleos urbanos integrados por meios de transporte facilitava o deslocamento dos trabalhadores das periferias até as fábricas. d. A grandiosidade dos prédios onde se localizavam as fábricas revelava os avanços da engenharia e da arquitetura do período, transformando as cidades em locais de experimentação estética e artística.

e. apreendem modelos de sociedade pautados na observância das leis. 142. (Enem 2010) Negro, filho de escrava e fidalgo português, o baiano Luiz Gama fez da lei e das letras suas armas na luta pela liberdade. Foi vendido ilegalmente como escravo pelo seu pai para cobrir dívidas de jogo. Sabendo ler e escrever, aos 18 anos de idade conseguiu provas de que havia nascido livre. Autodidata, advogado sem diploma, fez do direito o seu ofício e transformou-se, em pouco tempo, em proeminente advogado da causa abolicionista.

e. O alto nível de exploração dos trabalhadores industriais ocasionava o surgimento de aglomerados urbanos marcados por péssimas condições de moradia, saúde e higiene. 139. (Enade) Considerando a discussão sociológica sobre o conceito de integração, pergunta-se: o que pode levar à integração de um grupo? a. O fato de que todos têm a mesma nacionalidade.

AZEVEDO, E. O Orfeu de carapinha. In: Revista de História. Ano 1, no 3. Rio de Janeiro: Biblioteca Nacional, jan. 2004 (adaptado).

b. A aceitação quase irrestrita das regras do grupo. c. A submissão às lideranças políticas.

d. A ausência da anomia. e. O controle social exercido pela sociedade. expoENEM 34

A conquista da liberdade pelos afro-brasileiros na segunda metade do séc. XIX foi resultado de importantes lutas sociais condicionadas historicamente. A biografia de Luiz Gama exemplifica a


a. impossibilidade de ascensão social do negro forro em uma sociedade escravocrata, mesmo sendo alfabetizado.

de que as antigas controvérsias eram úteis, à medida que serviam para exercitar a faculdade dos competidores; pois não há controvérsia mais inócua que não possa ter alguma utilidade nesse aspecto. Mas, quando procuramos alguma coisa a mais, algo que acrescente algum conforto ou alivie as calamidades da raça humana, somos obrigados a nos confessar desapontados. Vemo-nos forçados a dizer, como Bacon, que essa celebrada filosofia terminou em nada mais que disputas, e que ela não foi nem a viticultura nem a plantação de oliveiras, mas sim um intrincado bosque de espinhos, dos quais os que ali se perderam só trouxeram muitos arranhões e nenhum alimento.

b. extrema dificuldade de projeção dos intelectuais negros nesse contexto e a utilização do Direito como canal de luta pela liberdade. c. rigidez de uma sociedade, assentada na escravidão, que inviabilizava os mecanismos de ascensão social. d. possibilidade de ascensão social, viabilizada pelo apoio das elites dominantes, a um mestiço filho de pai português. e. troca de favores entre um representante negro e a elite agrária escravista que outorgara o direito advocatício ao mesmo.

145. O texto faz uma crítica ao pensamento de Platão (e sua base socrática), usando como argumento as ideias de Francis Bacon.

143. (Enem 2009) Os Yanomami constituem uma sociedade indígena do norte da Amazônia e formam um amplo conjunto linguístico e cultural. Para os Yanomami, urihi, a, “terra floresta”, não é um mero cenário inerte, objeto de exploração econômica, e sim uma entidade viva, animada por uma dinâmica de trocas entre os diversos seres que a povoam. A floresta possui um sopro vital, wixia, que é muito longo. Se não a desmatarmos, ela não morrerá. Ela não se decompõe, isto é, não se desfaz. É graças ao seu sopro úmido que as plantas crescem. A floresta não está morta, pois, se fosse assim, as florestas não teriam folhas. Tampouco se veria água. Segundo os Yanomami, se os brancos os fizerem desaparecer para desmatá-la e morar no seu lugar, ficarão pobres e acabarão tendo fome e sede. ALBERT, B. Yanomami, o espírito da floresta. Almanaque Brasil Socioambiental. São Paulo: ISA, 2007 (adaptado).

(T. Macauley, Critical and Historical Essays. Tradução livre)

Da sua leitura, percebe-se que, para Bacon, a função da filosofia é: a. estabelecer critérios precisos para distinguir o falso do verdadeiro. b. apresentar resultados práticos e utilitários para a sociedade. c. criar um mecanismo prático para a obtenção da verdade a partir de postulados e demonstrações. d. definir normas de comportamento éticas, que possam nortear a vida em sociedade. e. oferecer ferramentas para uma argumentação de sucesso em caso de disputa retórica.

146. De acordo com o texto, a principal utilidade do platonismo está em:

De acordo com o texto, os Yanomami acreditam que

a. desenvolver um conhecimento prático que possa melhorar a vida dos homens.

a. a floresta não possui organismos decompositores.

b. servir para justificar e legitimar o regime político democrático.

b. o potencial econômico da floresta deve ser explorado.

c. ajudar a desenvolver a retórica, instrumento para obtenção do conhecimento verdadeiro.

c. o homem branco convive harmonicamente com urihi.

d. fornecer ferramentas para aliviar calamidades e aumentar o conforto humano.

d. as folhas e a água são menos importantes para a floresta que seu sopro vital. e. Wixia é a capacidade que tem a floresta de se sustentar por meio de processos vitais. 144. (Enem 2009) Na democracia estado-unidense, os cidadãos são incluídos na sociedade pelo exercício pleno dos direitos políticos e também pela ideia geral de direito de propriedade. Compete ao governo garantir que esse direito não seja violado. Como consequência, mesmo aqueles que possuem uma pequena propriedade sentem-se cidadãos de pleno direito. Na tradição política dos EUA, uma forma de incluir socialmente os cidadãos é

e. exercitar as mentes dos competidores no caso de controvérsias. 147. A expressão “árvore plantada por Sócrates e regada por Platão” faz uma referência: a. à releitura medieval da obra de Sócrates feita por Platão, a partir de textos preservados no Império Bizantino. b. ao fato de que Platão, ao dar continuidade à obra de Sócrates, inverteu alguns de seus princípios, conforme mostra o confronto entre os textos dos dois mestres. c. ao fato de que Platão foi discípulo e seguidor de Sócrates, que aparece como personagem em inúmeros diálogos platônicos.

a. submeter o indivíduo à proteção do governo.

d. irônica ao fato de que o seguidor de Sócrates foi Aristóteles, não havendo qualquer ligação entre aquele e Platão.

b. hierarquizar os indivíduos segundo suas posses. c. estimular a formação de propriedades comunais.

e. às Guerras Médicas, que resultaram na destruição de Atenas e na perda do conhecimento socrático, reinventado por Platão anos depois.

d. vincular democracia e possibilidades econômicas individuais. e. defender a obrigação de que todos os indivíduos tenham propriedades.

148.

(Enem) Texto para as questões 145 a 147. Certamente, se formos julgar a árvore plantada por Sócrates e regada por Platão por suas flores e folhas, ela será a mais nobre das árvores. Mas se adotarmos o simples teste de Bacon para a julgarmos pelos seus frutos, então nossa opinião sobre ela poderá ser menos favorável. Quando resumimos todas as verdades úteis que devemos a essa filosofia, qual a sua importância? Descobrimos, na realidade, provas abundantes de que alguns homens que a cultivaram eram de primeira ordem e intelecto. Encontramos, entre seus escritos, incomparáveis exemplos de arte dialética e retórica. Não temos dúvidas

Vamos voltar ao ovo e à galinha. Um ovo de galinha encerra a possibilidade de se transformar numa galinha. [...] Também é claro que um ovo de galinha jamais irá se transformar num ganso. Esta possibilidade não é inerente ao ovo de galinha. A forma de uma coisa, portanto, diz tanto sobre suas possibilidades quanto sobre suas limitações. GAARDER, Jostein. O mundo de Sofia. São Paulo: Companhia das Letras, 1995.

expoENEM 35

Segundo Aristóteles, cada coisa contém uma dinâmica interior, um movimento que faz com que ela passe da potência ao ato. Esta transformação surge por meio de uma causa externa, denominada por Aristóteles de teoria das quatro causas. Os quatro tipos de causas são


causa material, causa formal, causa eficiente e causa final. Assinale a alternativa em que as perguntas correspondem, respectivamente, às causas citadas. a. Por que foi gerado? Do que é feito? Como é? Quem gerou?

e. o intelecto procura compreender os fenômenos a partir do momento em que eles se revelam por meio da experiência, em uma relação de causa e efeito. 152. (Enem 2007)

b. Como é? Do que é feito? Por que foi gerado? Quem gerou? c. Do que é feito? Como é? Quem gerou? Por que foi gerado?

Não só de aspectos físicos se constitui a cultura de um povo. Há muito mais contido nas tradições, no folclore, nos saberes, nas línguas, nas festas e em diversos outros aspectos e manifestações transmitidos oral ou gestualmente, recriados coletivamente e modificados ao longo do tempo. A essa porção intangível da herança cultural dos povos dá-se o nome de patrimônio cultural imaterial.

d. Por que foi gerado? Quem gerou? Como é? Do que é feito? e. Quem gerou? Por que foi gerado? Como é? Do que é feito? 149.

(Internet: <www.unesco.org.br>.)

Da Filosofia nada direi, senão que, vendo-a cultivada pelos mais excelsos espíritos que viveram desde muitos séculos e que, no entanto, nela não se encontra ainda uma só coisa sobre a qual não se dispute, e por conseguinte, que seja duvidosa, eu não alimentava qualquer presunção de acertar mais do que os outros; e que, considerando quantas opiniões diversas, sustentadas por homens doutos, pode haver sobre uma e mesma matéria, sem que jamais possa existir mais que uma que seja verdadeira, reputava quase como falso tudo quanto era somente verossímil.

Qual das figuras a seguir retrata patrimônio imaterial da cultura de um povo? a.

DESCARTES, R. Discurso do Método. São Paulo: Nova Cultural, 1991. (Os Pensadores.) Primeira Parte.

René Descartes foi o primeiro filósofo a criar um método. Para tanto, ele rejeitou todos os conhecimentos que havia recebido em sua escola, por serem todos duvidosos. No entanto, havia uma ciência cujo método estava mais próximo da perfeição e serviu de base para o método cartesiano. Que ciência era esta? a. física

Cristo Redentor

b.

b. biologia c. filosofia d. matemática e. teologia 150. Vamos tomar um problema de cada vez. Locke está convencido de que todos os nossos pensamentos e todas as nossas noções nada mais são do que um reflexo daquilo que um dia já sentimos ou percebemos através de nossos sentidos. Antes de sentirmos qualquer coisa, nossa mente é como uma tábula, rasa, uma “lousa vazia”. GAARDER, Jostein. O mundo de Sofia. São Paulo: Companhia das Letras, 1995.

Pelourinho

c.

John Locke é o principal defensor do empirismo. Segundo este autor, a fonte dos nossos conhecimentos provém a. da razão inata. b. da experiência. c. da síntese entre razão e experiência. d. da iluminação divina feita diretamente por Deus. e. da intuição.

Bumba meu boi

151. O filósofo Kant supera a dicotomia entre racionalismo e empirismo. Sobre a teoria de Immanuel Kant, é correto afirmar que

d.

a. o intelecto procura entender como as coisas são em si, porque os fenômenos são justamente a parte a priori da experiência. b. o conhecimento é inato, porque todos os homens nascem com a alma, que sendo imortal, tudo conhece. c. as categorias com que o intelecto opera são todas extraídas da experiência. d. o conhecimento produzido pelas ciências é universal porque independe da estrutura da experiência. expoENEM 36

Cataratas do Iguaçu


© Wikipédia

e.

Esfinge de Gizé

153. (Enem 2004)

Essas imagens, em diferentes momentos da história, permitem afirmar que a. o nível de desenvolvimento é o mesmo, contudo, em épocas diferentes. b. a foto antiga se configura como uma paisagem natural, e a segunda, como uma paisagem humanizada. c. o princípio da atividade se faz presente, provando o dinamismo que existe no espaço geográfico. d. na foto recente, há um predomínio do espaço natural, visto que a cidade mantém muitas áreas verdes. e. a urbanização atual trouxe melhoria na qualidade de vida para todos os moradores da cidade, em função do desenvolvimento técnico.

Da minha aldeia vejo quanto da terra se pode ver no Universo...

155. Atualmente, a geografia precisa enfrentar o desafio de buscar soluções alternativas para o desenvolvimento econômico, com justiça social e racionalização do uso de recursos naturais, para atenuar os impactos ambientais. Além disso, também se considera função essencial dessa ciência

Por isso minha aldeia é grande como outra qualquer

a. priorizar a localização dos fatos históricos.

Porque sou do tamanho do que vejo

b. enumerar e localizar os acidentes geográficos pelo planeta, como as montanhas, os rios, os oceanos e as vegetações, entre outros.

E não do tamanho da minha altura... (Alberto Caeiro)

c. identificar e localizar os principais pontos turísticos dos países. d. compreender a relação do ser humano com a organização e a transformação espacial.

A tira “Hagar” e o poema de Alberto Caeiro (um dos heterônimos de Fernando Pessoa) expressam, com linguagens diferentes, uma mesma ideia: a de que a compreensão que temos do mundo é condicionada, essencialmente, a. pelo alcance de cada cultura.

e. fornecer conhecimentos gerais, proporcionando aumento de cultura e informação para as pessoas. 156. (Enem 2009) Para o registro de processos naturais e sociais, devem ser utilizadas diferentes escalas de tempo. Por exemplo, para a datação do sistema solar é necessária uma escala de bilhões de anos, enquanto que, para a história do Brasil, basta uma escala de centenas de anos. Assim, para os estudos relativos ao surgimento da vida no Planeta e para os estudos relativos ao surgimento da escrita, seria adequado utilizar, respectivamente, escalas de:

b. pela capacidade visual do observador. c. pelo senso de humor de cada um. d. pela idade do observador. e. pela altura do ponto de observação. 154. Observe as imagens da Avenida Paulista, na cidade de São Paulo. © Wikipédia

Vida no Planeta

Escrita

a.

Milhares de anos

Centenas de anos

b.

Milhões de anos

Centenas de anos

c.

Milhões de anos

Milhares de anos

d.

Bilhões de anos

Milhões de anos

e.

Bilhões de anos

Milhares de anos

157. (Enem 2008) Suponha que o universo tenha 15 bilhões de anos de idade e que toda a sua história seja distribuída ao longo de 1 ano – o calendário cósmico –, de modo que cada segundo corresponda a 475 anos reais e, assim, 24 dias do calendário cósmico equivaleriam expoENEM 37


a cerca de 1 bilhão de anos reais. Suponha, ainda, que o universo comece em 1.o de janeiro a zero hora no calendário cósmico e o tempo presente esteja em 31 de dezembro às 23h 59 min 59,99 s. A escala abaixo traz o período em que ocorreram alguns eventos importantes nesse calendário.

início da vida na Terra 2  4  (30/9)

dezembro 5

O sistema de fusos horários foi proposto na Conferência Internacional do Meridiano, realizada em Washington, em 1884. Cada fuso corresponde a uma faixa de 15° entre dois meridianos. O meridiano de Greenwich foi escolhido para ser a linha mediana do fuso zero. Passando-se um meridiano pela linha mediana de cada fuso, enumeram-se 12 fusos para leste e 12 fusos para oeste do fuso zero, obtendo-se, assim, os 24 fusos e o sistema de zonas de horas. Para cada fuso a leste do fuso zero, soma-se 1 hora, e, para cada fuso a oeste do fuso zero, subtrai-se 1 hora. A partir da Lei n.° 11.662/2008, o Brasil, que fica a oeste de Greenwich e tinha quatro fusos, passa a ter somente 3 fusos horários. Em relação ao fuso zero, o Brasil abrange os fusos 2, 3 e 4. Por exemplo, Fernando de Noronha está no fuso 2, o estado do Amapá está no fuso 3 e o Acre, no fuso 4. A cidade de Pequim, que sediou os XXIX Jogos Olímpicos de Verão, fica a leste de Greenwich, no fuso 8.

3

novembro

1

outubro

setembro

agosto

maio

abril

março

fevereiro

janeiro

origem de nossa galáxia (24/1)

julho

origem do sistema solar (9/9)

1/1

junho

origem do universo

159. (Enem 2008)

Considerando-se que a cerimônia de abertura dos jogos tenha ocorrido às 20h 8 min, no horário de Pequim, do dia 8 de agosto de 2008, a que horas os brasileiros que moram no estado do Amapá devem ter ligado seus televisores para assistir ao início da cerimônia de abertura?

Se a arte rupestre representada abaixo fosse inserida na escala, de acordo com o período em que foi produzida, ela deveria ser colocada na posição indicada pela seta de número

a. 9 h 8 min, do dia 8 de agosto. b. 12 h 8 min, do dia 8 de agosto. c. 15 h 8 min, do dia 8 de agosto. d. 1 h 8 min, do dia 9 de agosto. e. 4 h 8 min, do dia 9 de agosto. 160. (Enem 2005) Leia o texto abaixo. O jardim de caminhos que se bifurcam (...) Uma lâmpada aclarava a plataforma, mas os rostos dos meninos ficavam na sombra. Um me perguntou: O senhor vai à casa do Dr. Stephen Albert? Sem aguardar resposta, outro disse: A casa fica longe daqui, mas o senhor não se perderá se tomar esse caminho à esquerda e se, em cada encruzilhada do caminho, dobrar à esquerda.

a. 1. b. 2. c. 3.

Borges, J. Ficções. Rio de Janeiro: Globo, 1997. p.96 (adaptado).

d. 4. e. 5. 158. (Enem 2010) Pensando nas correntes e prestes a entrar no braço que deriva da Corrente do Golfo para o norte, lembrei-me de um vidro de café solúvel vazio. Coloquei no vidro uma nota cheia de zeros, uma bola cor rosa-choque. Anotei a posição e data: Latitude 49°49’N, Longitude 23°49’W. Tampei e joguei na água. Nunca imaginei que receberia uma carta com a foto de um menino norueguês, segurando a bolinha e a estranha nota.

Quanto à cena descrita acima, considere que

I – o sol nasce à direita dos meninos;

II – o senhor seguiu o conselho dos meninos, tendo encontrado duas encruzilhadas até a casa.

b. leste, sul e oeste. c. oeste, norte e leste.

KLINK, A. Parati: entre dois polos. São Paulo: Companhia das Letras, 1998 (adaptado).

Concluiu-se que o senhor caminhou, respectivamente, nos sentidos a. oeste, sul e leste.

d. leste, norte e oeste. e. leste, norte e sul.

No texto, o autor anota sua coordenada geográfica, que é a. a relação que se estabelece entre as distâncias representadas no mapa e as distâncias reais da superfície cartografada.

161. (Enem 2004) Um leitor encontra o seguinte anúncio entre os classificados de um jornal:

b. o registro de que os paralelos são verticais e convergem para os polos, e os meridianos são círculos imaginários, horizontais e equidistantes.

VILA DAS FLORES

c. a informação de um conjunto de linhas imaginárias que permitem localizar um ponto ou acidente geográfico na superfície terrestre.

Vende-se terreno plano medindo 200 m2.

d. a latitude como distância em graus entre um ponto e o Meridiano de Greenwich, e a longitude como a distância em graus entre um ponto e o Equador. e. a forma de projeção cartográfica, usado para navegação, onde os meridianos e paralelos distorcem a superfície do planeta. expoENEM 38

Frente voltada para o sol no período da manhã. Fácil acesso.

(443) 0677-0032


Interessado no terreno, o leitor vai ao endereço indicado e, lá chegando, observa um painel com a planta a seguir, onde estavam destacados os terrenos ainda não vendidos, numerados de I a V:

b. a escala do mapa 1 é maior, pois a área foi reduzida mais vezes. c. a escala 3 é a ideal para uma maior visualização da área, visto que está mais ampliada. d. a escala do mapa 2 é maior que a do mapa 3.

Rua dos Cravos

IV

Rua das Rosas

Rua dos Jasmins

II

V

Rua das Margaridas

164.

III I

e. a escala do mapa 1 oferece mais detalhes para serem visualizados.

N

A escala é uma relação de proporção entre o tamanho de uma representação e o real. No caso de uma planta urbana, por exemplo, a escala vai mostrar em que proporção a planta representa o objeto real – cidade. Na verdade, o conceito de escala introduz a noção de relação entre um fenômeno real na superfície terrestre, ou o todo, e a representação no papel.

Rua das Hortências 0    10    20m

CASTROGIOVANNI, Antonio Carlos. Apreensão e compreensão do espaço geográfico. Ensino de Geografia – práticas e contextualização no cotidiano. Porto Alegre: Mediação, p. 55.

Considerando as informações do jornal, é possível afirmar que o terreno anunciado é o a. I.

Considerando o elemento cartográfico descrito no texto, constata-se que

b. II.

a. escalas pequenas podem ser aplicadas apenas na forma gráfica.

c. III.

b. quando a escala é pequena, representa-se uma cidade.

d. IV.

c. escalas numéricas são aplicadas unicamente em escalas grandes.

e. V.

d. quando o mapa representa todo o globo em um planisfério, a escala é pequena.

162. (Enem 2004) Entre outubro e fevereiro, a cada ano, em alguns estados das regiões Sul, Sudeste e Centro-Oeste, os relógios permanecem adiantados em uma hora, passando a vigorar o chamado horário de verão. Essa medida, que se repete todos os anos, visa a. promover a economia de energia, permitindo um melhor aproveitamento do período de iluminação natural do dia, que é maior nessa época do ano.

e. dependendo da escala utilizada, não é possível representar o espaço no papel. 165. O mapa a seguir representa o sistema de fusos horários no Brasil. Com a aprovação da Lei 11.662, de 24 de julho de 2008, o Brasil passou a ter três fusos horários.

b. diminuir o consumo de energia em todas as horas do dia, propiciando uma melhor distribuição da demanda entre o período da manhã e da tarde. c. adequar o sistema de abastecimento das barragens hidrelétricas ao regime de chuvas, abundantes nessa época do ano nas regiões que adotam esse horário. d. incentivar o turismo, permitindo um melhor aproveitamento do período da tarde, horário em que os bares e restaurantes são mais frequentados. e. responder a uma exigência das indústrias, possibilitando que elas realizem um melhor escalonamento das férias de seus funcionários. 163. Observe as imagens a seguir. O mapa do Brasil em diferentes escalas Escala 1 1:170 000 000

Escala 2 1:120 000 00

–4h

Escala 3 1:60 000 000

–3h

–2h

A análise do mapa revela que a. os horários no Brasil estão todos adiantados em relação à hora do Meridiano de Greenwich. b. o fuso oficial do Brasil está no 1o. fuso. c. pela grande extensão territorial, os estados do Amazonas e do Pará têm mais de um fuso horário.

COELHO, Marcos A. Geografia geral: o espaço natural e socioeconômico. São Paulo: Moderna, 1992.

Os mapas mostram o Brasil em três escalas diferentes, das quais podemos concluir que a. a escala não interfere na visualização do mapa, pois o país pode ser observado em todas elas.

d. a maior parte dos estados brasileiros está no 2o. fuso, com –3 horas em relação a Greenwich, sem considerar o horário de verão. e. quando são 13 horas em Fernando de Noronha, são 15 horas no estado do Acre. 166. As competições esportivas, como Jogos Olímpicos e Copa do Mundo de Futebol, dentre outras, geralmente são realizadas no Hemisfério Norte, onde está localizada a maioria dos países desenvolvidos. Quando esses eventos são realizados em países europeus, no meio

expoENEM 39


do ano, temos um pouco de dificuldade de acompanhar as competições aqui no Brasil, sobretudo, porque a. muitos se esquecem de que aqui é horário de verão, e os jogos não coincidem com o horário europeu. b. estamos em horário adiantado, em que os jogos ocorrem tarde da noite. c. nunca sabemos efetivamente se o horário de verão é o padrão para acompanharmos os jogos. d. aqui, os jogos ocorrem no período da manhã, horário em que a maioria dos brasileiros está no trabalho ou na escola. e. aqui, os jogos ocorrem por volta da meia-noite, pelo fato de estarmos em horário atrasado.

Anotações

expoENEM 40


Gabarito

0 0

1

2

3

4

5

6

7

8

9

c

b

c

c

b

a

e

c

c

d

c

e

c

1

c

d

e

c

d

c

2

e

b

e

a

a

b

c

a

e

e

3

b

a

c

b

b

b

d

c

d

c

4

b

c

b

b

d

b

e

c

d

e

5

e

c

e

a

c

c

d

b

d

e

6

d

d

c

e

d

d

c

e

b

e

7

d

c

e

d

d

c

e

a

b

b

8

e

b

e

c

b

d

b

c

a

d

9

b

a

d

c

e

d

d

d

e

d

10

e

d

a

a

d

c

a

b

e

a

11

c

c

c

b

b

b

e

e

d

b

12

d

d

c

a

b

a

d

d

d

c

13

a

c

b

a

*

d

b

e

e

b

14

c

c

b

e

d

b

e

c

c

d

15

b

e

c

a

c

d

e

e

c

a

16

a

d

a

c

d

d

d

01. c Com a crise do petróleo nos anos 70, o Brasil desenvolveu o Proálcool, e desde então tem tido destaque na produção deste biocombustível. 02. b O positivismo esteve presente no processo de proclamação da república, como podemos observar na bandeira nacional, com o lema “ordem e progresso”. 03. c Um dos aspectos mais relevantes da globalização atual é a velocidade de comunicação entre as mais distantes regiões da Terra, principalmente nas questões que envolvem a economia. 04. c Questão que envolve raciocínio lógico e observação de gráficos, tabelas e a percepção da situação atual do país. 05. b Questão que envolve análise de texto e conhecimentos sobre os processos históricos, políticos e sociais da sociedade moderna. 06. a A questão envolve análise de texto e conhecimentos sobre o conceito de espaço, muito importante ao entendimento da geografia. 07. e Um dos problemas mais sérios enfrentados pelos países pobres é a concentração de renda que, apesar dos avanços na área social, mantém a maioria pobre e dificulta o crescimento econômico. 08. c A escravidão foi um dos marcos mais relevantes do período colonial vivido no Brasil e a maior resistência dos fazendeiros em abrir mão dos escravos estava relacionada com a obtenção de força de trabalho.

09. c As migrações internas têm aumentado principalmente nas grandes cidades, onde a população mais pobre precisa fazer deslocamentos constantes. 10. c A fome é um problema mundial, causado pela concentração de riquezas e não apenas por questões naturais. Vivemos em um mundo onde sobram alimentos e a fome persiste. 11. d A produção de energia é fundamental para a continuidade do desenvolvimento econômico e tecnológico. Já é sabido que as energias fósseis, além de poluentes, são finitas. O Brasil tem destaque mundial na produção de biomassa. 12. e Questão de análise de gráfico, que envolve conhecimentos sobre os setores da economia e domínio de outras disciplinas. 13. c Historicamente, a população brasileira tem melhorado a sua qualidade de vida conjuntamente com o êxodo rural e a consequente vida nas cidades que, mesmo para os mais pobres, oferece melhores serviços de saúde e educação. 14. d Conhecer a dinâmica dos movimentos da Terra é fundamental para a compreensão dos fenômenos naturais e de suas consequências para a vida humana, como as estações do ano. 15. c Interpretação de texto envolvendo várias disciplinas, que junto de conhecimentos relacionados à dinâmica da Terra permitem reconhecer a influência da rotação na vida humana.

expoENEM 41


16. d A conurbação é um fenômeno urbano característico das regiões metropolitanas, que interagem com as metrópoles tanto na economia quanto nos serviços de saúde e educação.

30. b Mesmo próximo ao Equador, isto é, em baixa latitude, se as altitudes forem elevadas, as temperaturas serão mais baixas que nas altitudes menores.

17. c A distribuição da população mundial é desigual e se deve a questões econômicas e também naturais, que provocam grandes vazios demográficos.

31. a As linhas contínuas nos climogramas representam a distribuição das temperaturas; no hemisfério norte, o verão acontece no meio do ano e por isso as temperaturas de junho e julho são mais elevadas.

18. e Análise de gráfico, que aponta a qualidade de vida das pessoas, tendo como base a maior ou menor expectativa de vida.

32. c O clima quente e úmido é o grande responsável pela grande biodiversidade das florestas tropicais.

19. c As migrações atuais caracterizam-se por serem feitas entre países de hábitos e costumes diferentes, o que causa grande dificuldade de adaptação.

33. b A Savana, identificada no Brasil como Cerrado, é uma vegetação de clima tropical. O solo ácido da região tem grande influência na formação vegetal.

20. e Conhecer a história do Brasil e as implicações da vinda da família real para o país é importante para o entendimento das relações econômicas entre o Brasil Colônia e o mundo do século XVIII.

34. b A vegetação complexa do Pantanal, com a sua fauna característica, forma condições adequadas para o turismo ambiental.

21. b Questão que aborda a produção da memória pelas sociedades humanas, nas suas mais diversas representações. 22. e Comparação de diferentes pontos de vista, presentes em textos analíticos e interpretativos, sobre situações ou fatos de natureza histórico-geográfica acerca das instituições sociais, políticas e econômicas. 23. a Saber avaliar criticamente conflitos culturais, sociais, políticos, econômicos ou ambientais ao longo da história é importante para que o aluno saiba se colocar frente aos problemas do dia a dia. 24. a Questão que aborda o desenvolvimento sustentável, um tema relevante para a preservação ambiental. Aborda também a participação do estado como agente fiscalizador. 25. b O grande vazamento de petróleo no Golfo do México, em 2010, mostrou que a preocupação com o crescimento econômico ainda é bem maior e mais decisiva do que a preocupação com o desenvolvimento sustentável. 26. c Os movimentos tectônicos são os responsáveis pela Deriva dos Continentes. Tanto o tectonismo quanto os abalos sísmicos são causados por forças internas que pressionam a crosta terrestre. 27. a Os vários fatores que determinam a diversidade de rochas na crosta terrestre estão bem apresentados neste item. 28. e Para a garantia alimentar da humanidade atual e futura, é preciso que os solos sejam devidamente conservados; a cobertura com palha da cultura anterior (plantio direto sobre palha), a construção de terraços em nível são ações eficientes na manutenção dos solos. 29. e Dentre os principais fatores que aumentam os riscos de deslizamentos, estão as encostas com declividade acentuada, chuvas abundantes e concentradas. O tipo de solo e sua profundidade também constituem fatores de risco.

35. b As bacias do Paraná e do São Francisco têm um número significativo de hidrelétricas construídas, pois além de seus rios serem de planalto, localizam-se próximos dos maiores mercados consumidores de energia. 36. d A multiplicação das algas acontece com intensidade em condições propícias de nutrientes, principalmente com grande concentração de fósforo e nitrogênio. À medida que as algas vão morrendo no seu ciclo natural, a grande quantidade de bactérias que se formam consomem o oxigênio das águas, surgindo as zonas mortas. 37. c O modelo de colonização imposto pelos europeus, juntando tribos inimigas num mesmo país, é uma das principais causas dos conflitos africanos até os dias atuais. 38. d O mundo atual é marcado pelo embate econômico. A disputa de mercado e a oposição entre desenvolvidos (Norte) X subdesenvolvidos (Sul) são as marcas mais evidentes. 39. c O desenvolvimento industrial chinês atraiu e continua atraindo o grande contingente de pessoas do campo para as cidades. 40. b O Leste Europeu não tem o mesmo nível de desenvolvimento do oeste. Os novos países da UE são da região menos desenvolvida da Europa. 41. c A disputa por água é, sem dúvida, um dos componentes nos conflitos históricos no Oriente Médio. 42. b Aproximadamente 60% das reservas conhecidas de petróleo no mundo encontram-se no Oriente Médio. Como o petróleo continua sendo a principal fonte de energia do mundo, esta região é de interesse mundial. 43. b Embora na América do Sul os blocos econômicos encontrem uma serie de entraves para o pleno funcionamento, com a Unasul criou-se uma entidade que tem objetivos mais amplos que um bloco econômico.

expoENEM 42


44. d O consumismo norte-americano tornou este país um grande poluidor. A consciência ambiental e sua participação efetiva em acordos para a redução de gases-estufa são fundamentais para o desenvolvimento sustentável do mundo. 45. b Enquanto o Ártico é um imenso oceano rodeado por continentes, a Antártida é um continente rodeado por oceanos.

59. e Como se dedicavam à compreensão racional dos fenômenos naturais, o tema estudado por eles é a cosmologia. 60. d A música apresenta como principal característica a crítica a um sistema corrupto, listando lugares nos quais os políticos do “mensalão” podem carregar propina. 61. d

46. e Os gráficos mostram que em X as maiores preocupações são os dejetos tóxicos, normalmente lançados em efluentes industriais. Em Y o maior problema é o lixo e, em Z, os problemas do esgoto. 47. c A vida surgiu, em forma rudimentar, no pré-cambriano, como pode ser observado no quadro sobre a evolução biológica. 48. d O uso intensivo dos solos do planalto central e a destruição dos cerrados e das matas de mananciais trazem uma série de problemas, dentre eles a redução do nível das águas no Pantanal.

O mito se caracteriza pela crença e fundamentação do conhecimento nos deuses. 62. c Segundo o texto, a natureza é a base das ações dos animais, enquanto o homem é livre para escolher como agir. 63. e Segundo o texto, ainda que os animais realizem criações (como a teia de uma aranha), é a capacidade racional que permite ao homem transformar a realidade e criar a cultura, de modo consciente. 64. d

49. e O aquecimento global e os desmatamentos interferem diretamente no volume das chuvas.

Um juízo moral se aplica apenas aos atos humanos, e a única alternativa a abordá-lo é a letra D.

50. e O desenvolvimento sustentável exige que a sociedade atual se comprometa com a sustentabilidade da sociedade futura.

Segundo o texto, o existencialismo de Sartre enfatiza que a liberdade humana implica na responsabilidade do homem para consigo mesmo e também para com toda a humanidade.

51. c O texto aborda como característica da filosofia a capacidade de questionamento das diversas realidades existentes no mundo. Esse questionamento é geral e não particularizado, como propõem as demais alternativas.

66. c

65. d

Segundo Kant, ninguém pode ser usado como meio para se atingir um fim. Por isso, conforme a ética kantiana, nada justifica a prática do trabalho infantil. 67. e

52. e A filosofia iniciou o processo de racionalização rompendo com a mitologia. Por isso, as afirmativas I e II estão corretas, pois os gregos, ao questionarem a perfeição dos deuses, colocaram em dúvida o conhecimento mítico. Na mesma lógica, a assertiva III está errada, pois mito e filosofia são completamente diferentes. 53. a A democracia grega era exercida de forma direta na Ágora, pelos próprios cidadãos. No entanto, somente os homens faziam parte da cidadania grega. Estavam excluídos os estrangeiros, as mulheres e os escravos. Hoje, tanto a democracia quanto o conceito de cidadania é mais abrangente. 54. c e 55. c O fenômeno do analfabetismo político não é próprio de uma classe ou grupo social específico, mas se caracteriza pela opção de não participar das decisões políticas. 56. d Os critérios de justiça envolvem toda a sociedade e, portanto, devem ser elaborados em uma ampla discussão que envolva todos os representantes dessa mesma sociedade.

Por meio do mito da caverna, Platão diferencia duas realidades de conhecimento. A primeira, visível, seria o mundo da caverna, denominado mundo sensível; a outra, invisível, seria o mundo fora da caverna, denominado mundo inteligível. 68. b Segundo o texto, a ciência, por meio de pesquisas, busca a objetividade, a coerência e a veracidade de suas proposições, evitando preconceitos e opiniões tradicionais sem embasamento. 69. e Segundo o texto e a teoria maquiaveliana, o homem de virtú é aquele que desenvolve a habilidade de lidar com as circunstâncias e utilizá-las a seu favor. Este conceito é fundamental para o sucesso de um governante. 70. d Segundo o texto, a ciência não consegue atingir a neutralidade e a imparcialidade porque está condicionada e limitada por seus financiadores, que possuem interesses econômicos ou políticos. 71. c

57. b A principal característica da filosofia nascente é a racionalidade.

A democracia grega era exercida de forma direta na Ágora, pelos próprios cidadãos. No entanto, somente os homens faziam parte da cidadania grega. Esses cidadãos possuíam os mesmos direitos e podiam se expressar livremente.

58 d Os primeiros filósofos acreditavam que podiam compreender racionalmente as transformações da natureza.

72. e A música apresenta como principais características a crítica e a denún-

expoENEM 43


cia de um regime político autoritário, afirmando que o narrador não se vê como agente criador das leis vigentes, nem as quer como são. 73. d O texto de Aristóteles enfatiza que o homem é um animal político, ou seja, se caracteriza e se define na coletividade. A charge, na mesma lógica, condena o político que se esquece da coletividade e procura beneficiar seus próprios interesses 74. d Segundo o texto, a virtude se orienta para um bem; esse bem pode ser o bem próprio ou o bem alheio. 75. c A principal característica da filosofia nascente é a racionalidade e, por isso, rompe de forma gradual com o mito, cuja característica é a fundamentação do conhecimento nos deuses. 76. e O autor do texto faz uma crítica ao sistema de parceria, implantado nas fazendas de café no século XIX, que utilizava mão de obra imigrante e que gerou o endividamento dos mesmos, devido à má fé dos fazendeiros. 77. a O tema da abolição da escravidão sempre gerou polêmica no Brasil, desde a época da independência. José Bonifácio, um dos mais importantes pensadores do Império, defendia a abolição, porém preocupava--se com os interesses dos fazendeiros latifundiários. 78. b O movimento da Inconfidência Mineira (1789) visava a independência política do Brasil, além de pretender instituir vários conceitos da República estadunidense em nossa realidade. No entanto, não havia concordância nem intenção declarada sobre a abolição da escravidão. 79. b Ao interpretarmos os dados da tabela apresentada, podemos concluir que o desenvolvimento dos Estados Unidos no período se deve aos efeitos da 1a. Guerra Mundial, quando os EUA passaram a financiar os países europeus, tanto durante o conflito, quanto após. 80. e O texto nos dá a informação de que a mobilidade social no Brasil é prejudicada pela falta de recursos e investimentos no setor educacional, e ainda mais, credita os problemas atuais ao nosso passado colonial. 81. b O conflito entre Israel e Palestina é um dos mais marcantes da atualidade. A disparidade de recursos e armamentos é gritante. A ilustração apresenta essa característica.

85. d Esta questão envolve conceitos do movimento artístico do Romantismo, no contexto histórico europeu do final do século XVIII e início do século XIX. 86. b Abordagem dos elementos culturais da década de 60, onde os jovens estudantes tiveram participação efetiva em vários movimentos de contestação, em diversos países, como os Estados Unidos, França e Brasil. 87. c O texto trata da concepção de Estado e organização social tanto do marxismo quanto do anarquismo. Estes movimentos divergiam quanto à manutenção ou não do Estado após a organização da sociedade em bases igualitárias. 88. a O texto, que trata da Guerra do Vietnã, ocorrida nos anos 60/70, faz uma comparação com a Guerra do Iraque (2003), criticando os interesses dos Estados Unidos em promovê-las. 89. d A questão insere duas letras de músicas do período da Ditadura Militar no Brasil, porém de momentos diferentes: a primeira letra é do período marcado pelo AI-5 (1968), quando os estudantes ainda se organizavam em manifestações de rua. Já a segunda letra pertence ao momento da abertura política, simbolizada pela anistia (1979). 90. b A figura mostrada na questão nos permite concluir que, mais que apenas um processo tecnológico, a Revolução Industrial foi um processo social, no qual o aproveitamento e a exploração da mão de obra feminina e infantil foram características distintivas. 91. a A Era Vargas foi marcada pelo enaltecimento ao trabalho e ao trabalhador brasileiro, uma tentativa de apagar traços do passado, herdados do Período Colonial, como a ideia de que o brasileiro nativo é avesso ao trabalho. 92. d A Guerra do Paraguai apresenta as mais diversas explicações para o seu ocorrido. Dependendo da característica do historiador, justificativas diferentes são apresentadas. Em alguns casos, a disputa entre os países da bacia Platina; em outros, o imperialismo britânico. Atualmente, a explicação mais utilizada pelos historiadores é um amálgama das duas versões. 93. c Os meios de comunicação da atualidade trabalham com informações imediatistas e sem muita reflexão, principalmente por parte dos consumidores deste veículo. Por isso, em alguns casos acontecem situações como a apresentada no texto. Vale sempre ressaltar que na História não existem somente os “bonzinhos” de um lado e os “maldosos” do outro. Cabe aos leitores e pesquisadores sensatos analisar as informações em profundidade e refletir a respeito.

82. e Comentário: As capas da revista Veja sobre a China mostram a evolução do país economicamente, até o ponto de tornar-se uma potência mundial. Vale ressaltar que durante o governo do líder Mao Tsé-Tung, a repressão e a violência foram muito utilizadas. 83. c A tira em quadrinhos retrata o período da Era Moderna na Europa, quando os estados nacionais estavam se constituindo, por meio da aliança do rei com a burguesia, mas não sem a participação do clero e da nobreza. A população, de maneira geral, ficava excluída deste processo. 84. b A análise do conceito de olimpíada retratado no texto faz menção aos atletas gregos do passado e aos atletas do presente.

94. e A charge remete a uma discussão muito atual sobre a intervenção ou não do Estado na economia. Historicamente, duas situações podem ser comparadas quanto a essa discussão: a Crise de 1929, com a subsequente política do New Deal – com a qual o governo estadunidense promoveu uma grande intervenção salvadora –; e a crise de 2008/09, quando se exigiram dos governos dos países ricos ações intervencionistas. 95. d A charge mostra de maneira satírica as classes sociais da Franca pré-revolucionária, onde os camponeses e trabalhadores urbanos arcavam com todas as despesas do Estado e das “classes superiores”, como os nobres e o clero.

expoENEM 44


96. d

113. d

Os textos trazem duas visões sobre as Cruzadas – a dos cristãos e a dos muçulmanos. A ideia é transmitir o conceito do conflito religioso e da violência cometida por ambos os lados.

114. e 115. c

97. d A questão trata sucinta e resumidamente da evolução econômica do Brasil, apontando a transformação da região sudeste na mais importante do país, graças aos ciclos sucessivos da mineração, cafeicultura e industrialização. 98. e O texto relata fatos ligados a três presidentes brasileiros: Vargas, Juscelino, Jânio Quadros e João Goulart. A leitura do texto permite a análise correta da questão. 99. d Os textos tratam da Ditadura Militar, momento em que se vivia a dicotomia do milagre econômico e a repressão política e social, advinda do AI-5. 100. e A leitura dos mapas permite perceber a diferença entre a divisão política do continente africano e sua disposição étnica. Esta diferença se dá principalmente em função da intervenção dos europeus, durante os séculos XVI a meados do XX, quando estes promoveram a divisão do continente, principalmente por meio da Conferência de Berlim (1885), sem levar em consideração a organização étnica. Daí o surgimento dos conflitos civis.

116. b O texto 01 enfatiza que as decisões geralmente são tomadas por uma minoria, e a população apenas segue essas decisões. No texto 2, essa mesma visão aparece quando se afirma que “os animais não chegavam à conclusão sobre quem tinha razão; a verdade é que estavam sempre de acordo com aquele que falava no momento”. 117. b Na Guerra Fria, Estados Unidos e União Soviética travaram uma disputa política, militar e ideológica, buscando atingir a hegemonia no cenário internacional. Essa visão fica muito clara na charge, em que o mundo está como centro dessa disputa, e no texto, quando se enfatiza que os grandes objetivos da guerra eram políticos e militares. 118. e A questão aborda o Movimento dos Caras-Pintadas, ilustrado pela imagem. Esse movimento esteve diretamente ligado ao processo de impeachment do presidente Collor, denunciado por escândalos de corrupção na política.

101. d A questão aborda os temas xenofobia e efeitos da globalização.

119. b A questão aborda o determinismo, cuja característica principal é a crença de que as ações humanas são predeterminadas. Na mitologia grega, por exemplo, o determinismo atribuía aos deuses a causa de todas as coisas. A alternativa b é a que mais se aproxima do determinismo, pois atribui a Deus a causa de todas as ações humanas.

102. a

120. b

103. a Questão sobre os avanços tecnológicos e suas implicações na vida atual. Explora as desigualdades na distribuição dos progressos científico e tecnológico.

A questão enfatiza a importância da democracia para a tomada de decisões sobre a coletividade. Além disso, enaltece o papel da imprensa como instrumento capaz de fornecer informações para que o debate político aconteça. 121. d

104. d 105. c Tema importante para as Ciências Humanas, os conceitos sobre o crescimento populacional são sempre muito cobrados no Enem, sendo necessário conhecimento atualizado sobre o assunto. 106. a Os avanços tecnológicos promovidos na agricultura levaram mais pessoas para as cidades e criaram a macrocefalia urbana, com grandes implicações para a qualidade de vida, sobretudo, para aqueles com pouca qualificação profissional.

122. c 123. a 124. b 125. a 126. d 127. d

107. b 128. d 108. e A questão aborda valores da Revolução Francesa que se contrapõem aos interesses liberais da burguesia. Esse movimento buscava justiça social e mais participação popular. Trata-se de um tema bastante relevante na atualidade. 109. a 110. c 111. c 112. d

129. c 130. a 131. c 132. b 133. a 134. V, V, F, F.

expoENEM 45


benefícios econômicos. Em outros termos, a democracia está vinculada ao enriquecimento individual.

135. d 136. b

145. b 137. e A “lei seca” não é uma novidade para o estudante brasileiro, em virtude da ampla veiculação da notícia de publicação da lei e de seu impacto na vida cotidiana do motorista. A questão pode ser considerada fácil justamente pelo oportuno vínculo entre a lei seca e o trânsito. 138. e Para responder a essa questão, deve-se ter em mente o contexto social que envolvia o período histórico da Revolução Industrial. A opção a não deixa de ser atrativa, porque remete à ideia da sociedade capitalista em comunhão com a Revolução Industrial. No entanto, é preciso prestar atenção no impacto dos avanços tecnológicos sobre a sociedade da época, não confundindo com a transformação das cidades em espaços de oportunidade para o lucro. 139. b

146. e 147. c 148. c 149. d 150. b 151. e 152. c 153. a

A questão remete à interpretação da ideia de “integração” com grupo. Para responder à questão, pode-se lembrar da noção de integração como “aceitação” e, dessa forma, a resposta está presente na alternativa b. Para que uma pessoa seja aceita em um grupo, ela deve, mesmo que não seja de maneira explícita, aceitar as regras desse grupo.

154. c 155. d 156. e

140. c Questão que requer atenção quanto à interpretação das informações no enunciado para os dias atuais. Para o uso de novas tecnologias, é preciso que haja um trabalhador treinado e qualificado. Esse processo de qualificação é urgente no Brasil, considerando a necessidade cada vez maior de trabalhadores com conhecimento especializado em determinadas áreas.

157. e 158. c 159. a

141. c O ponto de referência importante para a resposta está na expressão “impactos socioculturais da televisão”. Essa questão, como a anterior, refere-se ao cotidiano das famílias não apenas no Brasil, mas em termos mundiais. Uma das várias temáticas que permeiam esse tipo de pesquisa é a questão da interiorização pela criança das cenas de violência que repetidamente aparecem na programação dos canais de televisão. Essa é uma preocupação latente de pais quando deixam seus filhos assistindo à televisão, pois a percepção crítica da criança ainda não está completamente desenvolvida, e esse fato poderia gerar a interiorização de comportamentos violentos. 142. b Questão que envolve elementos de história com o aspecto sociológico de classes menos favorecidas em determinado período da história do Brasil. É possível levar em conta tanto elementos da opção a como da c para assinalar a resposta. No item a, a palavra impossibilidade não está de acordo com a biografia citada no enunciado da questão. Na letra c, o problema está no trecho sobre a “inviabilidade de ascensão social”, trecho que vai de encontro com a biografia citada também.

160. a 161. d 162. a 163. c 164. d 165. d 166. d

Anotações

143. e Questão voltada para a interpretação de texto e, a partir de elementos textuais, dedução do conceito de Wixia e da característica dessa “força”. 144. d Questão que envolve a política interna norte-americana e que faz menção à inserção do cidadão na sociedade. Mesmo apresentando sinais não tão positivos, a economia norte-americana é, em termos mundiais, muito forte. Essa característica se apresenta, também, devido ao incentivo para que os cidadãos possam ter capacidade de desenvolvimento econômico (como exemplo, transformar o hobby em negócio ou transformar o prazer em uma atividade de fonte de renda). Esse desenvolvimento econômico individual está vinculado à possibilidade de o cidadão adquirir bens e propriedades com a proteção do governo para a garantia de usufruto desses “frutos” dos

expoENEM 46


Referências

TOURAINE, Alain. Um novo paradigma para compreender o mundo hoje. Petrópolis: Vozes, 2006.

ARANHA, Maria Lúcia de Arruda; ARANHA, Maria Helena Martins. Introdução à filosofia. 2. ed. São Paulo: Moderna, 1998. ARGAN, Giulio Carlo. Arte Moderna. São Paulo: Companhia das Letras, 1982.

VARGAS, Getúlio. Carta Testamento, Rio de Janeiro, 23/08/1954. Disponível em: <http://www. rio.rj.gov.br/memorialgetuliovargas/>. Acesso em: 26 jun. 2009. VASCONCELLOS, G. F & VIDAL, J. W. Bautista. O poder dos trópicos. São Paulo: Casa Amarela, 1998.

ARISTÓTELES. A política. Trad. de Nestor Silveira Chaves. Rio de Janeiro: Ediouro, 1997. p. 13. ARON, Raymond. Pensar a guerra. In: CLAUSEWITZ. A era europeia. Brasília: UnB, 1986. BELMONTE. Caricatura dos tempos. São Paulo: Melhoramentos, 1982. BOBBIO, Norberto. Estado, governo, sociedade: para uma teoria geral da política. Trad. de Marco Aurélio Nogueira. 4. ed. Rio de Janeiro: Paz e Terra, 1987. BOULOS JÚNIOR, Alfredo. História: sociedade e cidadania. São Paulo: FTD, 2004. BRASIL. Constituição (1988). Constituição da República Federativa do Brasil. Disponível em: <http://www.stf.jus.br/portal/constituicao/constituicao.asp>. Acesso em: 29 jul. 2010. BRECHT, Bertolt. O analfabeto politico. Disponível em: <http://www.culturabrasil.pro.br/brechtantologia.htm>. Acesso em: 29 jul. 2010. . Poemas (1913-1956). São Paulo: Brasiliense, 1986. CARVALHO, P. C. Espaço, um lugar prático. Discutindo Geografia, São Paulo: Escala Educacional, ano 2, n. 8, 2005. CHAUÍ, Marilena. Convite à filosofia. São Paulo: Ática, 2005. CORDI et al. Para filosofar. São Paulo: Scipione, 2007. CRUZ, Marco Aurélio Rodrigues da Cunha. O analfabeto político. Disponível em: <http://www.jornaldedebates.com.br/debate/por-que-educacao-nao-tem-prioridade-no-brasil/ artigo/analfabeto-politico/12369>. Acesso em: 29 jul. 2010. DERRIDA, Jacques. In: OLIVA, Jaime; GIANSANTI, Roberto. Espaço e modernidade: temas da Geografia mundial. São Paulo: Atual, 1995. DORST, Jean. Antes que a natureza morra: por uma ecologia política. São Paulo: Edusp, 1973. FÉIST, Hildegard. Pequena história do Brasil holandês. São Paulo: Moderna, 1998. GALLO, S. et al. Ética e cidadania. Campinas: Papirus, 1997. GAARDER, Jostein. O mundo de Sofia. São Paulo: Companhia das Letras, 1995. HOBSBAWM, Eric J. A era das revoluções: Europa 1789-1848. Rio de Janeiro: Paz e Terra, 1981. HUNT, L. Revolução francesa e vida privada. In: PERROT, M. (Org.). História da vida privada: da revolução francesa à primeira guerra. São Paulo: Companhia das Letras, 1991. Vol. 4. JAEGER, W. Paideia. Tradução de Artur M. Parreira. 3. ed. São Paulo: Martins Fontes, 1995. p. 197. JONES, Frances & ZOCCHI, Paulo. Entenda a crise. In: Atualidades – Vestibular + Enem – Guia do Estudante. São Paulo: Abril, 2009. KAFKA, Franz. O processo. Porto Alegre: L & PM Pocket, 2007. LANDES, David. A riqueza e a pobreza das nações: por que algumas são tão ricas e outras tão pobres. [Tradução: Álvaro Cabral] Rio de Janeiro: Campus, 1998. LÓPES, Celso; TUGENDHAT, Ernst; VICUÑA, Ana Maria. O livro de Manuel e Camila: diálogos sobre moral. Trad. de Suzana Albornoz. Goiânia: UFG, 2002. p. 142. LUXEMBURGO, Rosa. A Revolução Russa. In: ARBEX, José. Revolução em três tempos. São Paulo: Moderna, 1993. MAALOUF, Amin. As Cruzadas vistas pelos árabes. 2. ed. São Paulo: Brasiliense, 1989. MACIEL, Luiz Carlos. Anos 60. Porto Alegre: LPM, 1987. MAQUIAVEL, Nicolau. O príncipe. São Paulo: Nova Cultural, 2000. Col. Os Pensadores. MICHAUD, J. F. História das cruzadas. São Paulo: Editora das Américas, 1956. MUMFORD, Lewis. A condição do homem: uma análise dos propósitos e fins do desenvolvimento humano. [The condition of man. Tradução: Miranda Reis]. São Paulo: Globo, s/d. NABUCO, Joaquim. Um estadista do Império. 5. ed. Rio de Janeiro: Topbooks, 1998. NOGUEIRA, Salvador. Ciência neutra não existe, afirma Gleiser. Jornal da Ciência. Disponível em: <http://www.jornaldaciencia.org.br/Detalhe.jsp?id=29442>. Acesso em 29 jul. 2010. OBSERVATÓRIO DA IMPRENSA. Disponível em: <http://www.observatoriodaimprensa.com. br>. Acesso em: 24 abr. 2010. OLIC, Nelson. Oriente Médio. São Paulo: Moderna, 1991. ORWELL, George. A revolução dos bichos. São Paulo: Círculo do Livro, 1975. PLATÃO. A república. Livro VII. São Paulo: Nova Cultural, 2000. Col. Os Pensadores. . Apologia de Sócrates. São Paulo: Nova Cultural, 2000. Coleção Os Pensadores. PROUS, A. O Brasil antes dos brasileiros. Rio de Janeiro: Jorge Zahar, 2005. RIBEIRO, H. S. O migrante e a cidade: dilemas e conflitos. Araraquara: Wunderlich, 2001. ROUSSEAU, Jean-Jacques. Discurso sobre a origem e os fundamentos da desigualdade entre os homens. Trad. de Maria Ermantina Galvão. São Paulo: Martins Fontes, 1999. SANTOS, M. A urbanização brasileira. São Paulo: Edusp, 2005. SARTRE, Jean Paul. O existencialismo é um humanismo. São Paulo: Nova Cultural, 2000. Col. Os Pensadores. SEQUEIRA, C.D.; VILLAMÉA, L. A epidemia da Liberdade. ISTOÉ INTERNACIONAL. 2 mar. 2011. SODRÉ, Nelson Werneck. Formação histórica do Brasil. São Paulo: Brasiliense, 1964. TITÃS. Estado violência. In: CABEÇA dinossauro. [S.L.] WEA, 1986. 1 CD (ca. 35’97”). Faixa 5 (3’07”).) . Vossa Excelência. In: ACÚSTICO MTV ao vivo. 2005. CD e DVD. Faixa 3 (3’09”). TOLEDO, Edilene. Travessias revolucionárias. Campinas: Unicamp, 2004.

expoENEM 47


Ciências da natureza e suas tecnologias

01. É comum ouvirmos no dito popular que “as cigarras cantam tão alto e tão forte que acabam explodindo”, ou “o canto da cigarra nos dias quentes é para chamar a chuva”. Essas crenças se baseiam no fato de que periodicamente são encontradas, presas a troncos de árvores, carapaças abandonadas por esses insetos, também conhecidas como exúvias. E quanto ao canto tão forte e estridente? São os machos com o seu aparelho estridulatório que cantam para cortejar as fêmeas. As trocas periódicas das carapaças externas verificadas nos artrópodes ocorrem

a. devido ao alto metabolismo requerido pelo animal durante o canto. b. como um fenômeno decorrente do mecanismo de cortejamento do macho, logo após o canto. c. para permitir às cigarras um melhor poder de canto. d. para que o animal possa crescer, já que o exoesqueleto impede o crescimento contínuo. e. apenas nas fêmeas, que se desnudam de sua carapaça para facilitar a cópula.

(...) “É a primeira forma de vida cujos pais são um computador”, disse Craig Venter na entrevista em que apresentou a bactéria ao mundo. Para gerar essa forma de vida, o DNA sintético teve de ser introduzido numa bactéria que já estava viva – cujo código genético foi substituído pelo genoma artificial. Ninguém conseguiu, ainda, gerar vida a partir de matéria inanimada. Mas a descoberta provou que é possível escrever DNA como se fosse um software, colocá-lo para rodar no hardware da vida (a célula), e disso obter uma nova forma de vida – que foi criada em laboratório e contém elementos definidos pelo homem. Vida artificial. Ou, se você preferir, vida sintética. Ela é filha de computadores. Mas também de um homem.

Tá ligado? O exoesqueleto quitinoso dos artrópodes protege e impermeabiliza o animal, porém impede o crescimento contínuo do corpo. Para que possam crescer, realizam periodicamente mudas ou ecdises e abandonam o exoesqueleto. Após o crescimento, um novo exoesqueleto é produzido pela epiderme.

O exoesqueleto quitinoso dos artrópodes Esta armadura resistente impede o crescimento contínuo do animal, obrigando-o a realizar periodicamente mudas ou ecdises. Nas fases de crescimento, o artrópode se desfaz da carapaça antiga, ficando temporariamente envolto por uma cobertura flexível. Isso permite que ele cresça durante certo tempo. Quando o novo exoesqueleto se completa e endurece, o crescimento cessa.

Considere o texto a seguir para resolver a questão 02. Vida artificial – O que a primeira célula sintética significa para o futuro da humanidade.

SuperInteressante, Ed. 280, jul. 2010, p. 68. “Vida Artificial”.

02. De acordo com o texto e com seus conhecimentos sobre o assunto, assinale a opção correta. a. Essa técnica pode resultar em aplicações importantes, como degradação de derramamento de óleo, cura de doenças, combate ao aquecimento global e produção de combustíveis. b. A célula artificial não seria eficaz, pois seus produtos metabólicos também serão artificiais e, portanto, não aplicáveis em biotecnologias. c. O processo da criação da célula artificial foi possível graças à introdução do DNA sintético ao núcleo da célula bacteriana, ficando este protegido da ação de enzimas nocivas presentes no citoplasma.

Tamanho A

d. A técnica da criação da célula artificial em laboratório se torna muito promissora na medida em que evita a ocorrência de acidentes biológicos, já que é totalmente controlada.

B

e. A produção da célula artificial corrobora a teoria da geração espontânea, já que a matéria viva pode surgir da matéria inanimada.

C

Se ligue!

D Tempo

O DNA produzido em laboratório comandará a produção de proteínas e enzimas de acordo com os genes que possui. Dessa forma, será possível criar bactérias capazes de desempenhar funções úteis, como produzir combustíveis e curar doenças, por exemplo.

© Wikipédia

A maioria dos animais apresenta o padrão de crescimento corporal A, ou seja, crescimento contínuo. Já os artrópodes, graças ao exoesqueleto, apresentam o padrão de crescimento corporal B, descontínuo. O exoesqueleto impede o crescimento do corpo (C e D), o qual só é possível após a realização da muda ou ecdise.

cigarra

Aplicações de microrganismos artificiais Produção de combustíveis Þ bactérias artificiais podem ser manipuladas para produzir hidrogênio, que seria utilizado como combustível, já que é muito eficaz e não polui.

exúvia

Cura de doenças Þ células cancerosas e infecções resistentes a antibióticos poderiam desaparecer com a ação de microrganismos programados. expoENEM 1


Combate ao aquecimento global Þ microrganismos podem ser programados para fazer fotossíntese mais eficientemente e assim remover mais CO2 da atmosfera, o que contribuiria para a redução do efeito estufa e consequentemente do aquecimento global.

Texto base para a questão 04. Cálculos renais, ou pedras nos rins, são formações endurecidas nos rins ou nas vias urinárias, resultantes do acúmulo de cristais existentes na urina. Sua presença pode passar despercebida, sem sintomas, mas pode também provocar dor muito forte que começa nas costas e se irradia para o abdômen em direção à região inguinal. (...)

Fim do lixo Þ microrganismos programados poderiam degradar derramamento de óleo e plástico, reduzindo drasticamente os efeitos da poluição.

Sintomas: sangue na urina; suspensão ou diminuição do fluxo urinário; necessidade mais frequente de urinar; infecções urinárias.

03. Ocorrendo a fecundação do óvulo, que normalmente se dá no primeiro terço distal dos ovidutos, forma-se o ovo que imediatamente passa a sofrer clivagens ou divisões mitóticas sucessivas, enquanto se dirige ao útero. Cerca de seis a sete dias após a fecundação, o embrião, já em estágio de blastocisto, implanta-se na mucosa uterina, onde passa a se desenvolver. Esse fenômeno é chamado nidação e marca o início da gravidez.

Recomendações: beba muita água regularmente. De dois a três litros por dia. Essa é a medida mais importante para prevenir cálculos renais; utilize um filtro de papel quando houver a possibilidade de eliminar um cálculo. A análise da composição do cálculo pode orientar o médico na escolha do tratamento mais adequado. O uso de medicamentos contra dor deve ser prescrito pelo médico. Alguns deles são desaconselháveis para pessoas com problemas estomacais e para gestantes; controle a ingestão de alimentos ricos em proteínas e cálcio se os cálculos forem formados por excesso de ácido úrico ou cálcio; não se automedique nem faça o próprio diagnóstico. Procure atendimento médico, especialmente se tiver dores intensas nas costas ou no abdômen e sinais de sangue na urina.

A respeito do ciclo reprodutivo humano, assinale a única opção correta. a. Os hormônios envolvidos no ciclo reprodutivo feminino são os gonadotróficos: folículoestimulante e luteinizante; e os ovarianos: estrógeno e progesterona. b. Com a nidação, ou seja, a implantação do embrião no útero, inicia--se a produção do hormônio HCG – gonadotrofina coriônica humana, produzido pelo ovário e essencial para a manutenção da gravidez. c. Denomina-se “coito interrompido” o fato de um casal interromper por um período de tempo as relações sexuais e assim evitar uma concepção indesejada. d. O período fértil feminino caracteriza-se pela eliminação do óvulo pelo ovário, concomitantemente com a descamação do endométrio, o que ocorre por volta do 25°. dia do ciclo. e. A vasectomia, método cirúrgico de esterilização masculina, tem sido muito questionado, pois além de impedir a eliminação de espermatozoides pelos testículos, impede a liberação do hormônio testosterona para o sangue, provocando diminuição da libido e da masculinidade.

Fonte: <http://www.drauziovarella.com.br>. (Adaptado).

04. Os néfrons desembocam em ductos coletores de urina, que originam um canal único, o ureter, que deixa o rim em direção à bexiga urinária. A bexiga urinária é uma bolsa de parede elástica de musculatura lisa, cuja função é acumular a urina produzida nos rins. A urina é eliminada periodicamente através da uretra. Sobre o sistema urinário humano e sua fisiologia, assinale a opção correta.

Fique esperto!

d. A ingestão demasiada de carne vermelha pode favorecer a formação de pedras nos rins, já que as proteínas da carne são convertidas em nucleotídeos e estes, no fígado, podem ser transformados em ácido úrico, que será lançado na corrente sanguínea.

O óvulo permanece capaz de ser fecundado por até (provavelmente) 24 horas após ter sido eliminado do ovário. Alguns espermatozoides podem permanecer vivos por até 48 horas (talvez mais) no aparelho reprodutor feminino, o período fértil da mulher compreende, em média, 5 dias antes da ovulação e 5 dias depois. A ovulação ocorre de 13 a 15 dias antes da próxima menstruação, o período fértil encontra-se, portanto, perto do meio do ciclo. O período estéril acha-se próximo ao início e ao fim do ciclo. É preciso lembrar, no entanto, que a duração do ciclo é variável, podendo oscilar entre 21 e 42 dias.

24

26 até 32

1

2

3

23

4

22

5

21

Infértil Menstruação

Infértil

6

20

7

19

8

Fértil

18

9 17

10 16

15

14

13

12

b. Considera-se um exame de urina normal, em um indivíduo da espécie humana, se forem encontradas na urina somente as seguintes substâncias: água, ureia, sais e proteínas. c. Os rins artificiais são aparelhos utilizados por pacientes com distúrbios renais, cuja função é retirar o excesso de gás carbônico que se acumula no sangue.

Os hormônios gonadotróficos são produzidos pela hipófise: FSH – hormônio folículoestimulante e LH – hormônio luteinizante, os quais estimulam o amadurecimento do folículo ovariano e a ovulação, respectivamente. Os hormônios ovarianos são estrógeno, que entre outras coisas determina os caracteres sexuais secundários femininos, e a progesterona, hormônio que age na manutenção do endométrio durante a gestação.

25

a. O rim é um órgão que se assemelha a um filtro de água ao contrário, considerando que elimina aquilo que não é bom para o organismo e retém o que é útil.

11

expoENEM 2

e. O sangue após passar pelos rins já está pobre em ureia e CO2, uma vez que essas substâncias tóxicas são eliminadas junto com a urina.

Fique esperto! Os seres humanos são ureotélicos. A ureia é sintetizada no fígado, a partir da amônia, em uma série de reações químicas conhecidas como ciclo da ureia. Excretamos também ácido úrico, o qual é proveniente principalmente do metabolismo dos ácidos nucleicos e da cafeína. Uma dieta rica em proteínas aliada à ingestão de álcool, especialmente cerveja, aumenta os níveis de ácido úrico no sangue, o que causa a formação de cristais desse ácido nas articulações, disfunção conhecida como gota. O sistema excretório humano é formado por rins, ureteres, bexiga urinária e uretra.

rim rim

ureter

bexiga urinária uretra

Esquema geral do sistema excretório ou urinário humano.


Texto base para a questão 05.

Fique esperto!

O Vaticano qualificou como “inaceitável” [...] a autorização dada pelos Estados Unidos para a realização de testes clínicos em seres humanos utilizando células-tronco embrionárias. “Apesar dos esforços feitos para negá-lo, a ciência segue afirmando que o embrião é um ser humano por nascer”, disse monsenhor Elio Sgreccia, presidente emérito da Academia Pontifícia para a Vida (instituição da cúria romana), à Rádio Vaticano. Os embriões são “sacrificados para se extrair as células-tronco e tudo isto, do ponto de vista ético, só pode receber um julgamento negativo”.

Células-tronco são as células com capacidade de autorreplicação, isto é, com capacidade de gerar uma cópia idêntica de si mesmas e com potencial de diferenciar-se em vários tecidos. Podem ser classificadas em totipotentes, pluripotentes, adultas e embrionárias. Totipotentes são células capazes de se diferenciar em todos os 216 tecidos do corpo humano, inclusive placenta e anexos embrionários – o ovo ou zigoto é uma célula totipotente. Pluripotentes ou multipotentes são células capazes de se diferenciar em quase todos os tecidos humanos, excluindo placenta e anexos embrionários. As células internas do blastocisto humano são pluripotentes e as células da membrana externa destinam-se à produção da placenta e das membranas embrionárias. Adultas são células extraídas dos diversos tecidos humanos, tais como, medula óssea, sangue, fígado, cordão umbilical, placenta etc. Estudos demonstram que a capacidade de diferenciação dessas células é limitada e que a maioria dos tecidos humanos não pode ser obtida a partir delas.

Disponível em: <http://veja.abril.com.br/noticia/ciencia/vaticano-reprova-testes-com-celulas-tronco-retiradas-de-embrioes>, 31/07/2010.

05. As células-tronco embrionárias são totipotentes e podem ser cultivadas em laboratório. Com estímulo ambiental adequado, essas células podem ser induzidas a se diferenciar em qualquer tipo de célula que compõe o organismo. Já as células-tronco adultas não são totipotentes, pois têm capacidade limitada para se diferenciar em certos tipos celulares, sendo denominadas pluripotentes, como é o caso de células de medula óssea de um adulto, que podem se diferenciar em um conjunto de células sanguíneas apenas. Uma técnica chamada clonagem terapêutica utiliza-se da manipulação de células-tronco para a produção de células e tecidos para transplantes em pacientes com lesões. Utilizando-se células--tronco do próprio paciente, evitam-se processos de rejeição, tão comuns em transplantes.

As células embrionárias só podem ser encontradas nos embriões humanos e são classificadas como totipotentes ou pluripotentes, dado seu alto poder de diferenciação. Embriões descartados (inviáveis para a implantação) podem ser encontrados nas clínicas de reprodução assistida ou podem ser produzidos por meio da clonagem para fins terapêuticos.

06. Observe a seguinte charge.

Não obstante a polêmica que envolve a tecnologia de células-tronco, assinale a única opção correta. a. Quando se utilizam células-tronco retiradas de embriões congelados, as questões éticas e religiosas associadas à obtenção de órgãos para transplantes são eliminadas. b. Células-tronco embrionárias podem ser obtidas de qualquer etapa do desenvolvimento embrionário, até o momento da formação do feto. c. As células-tronco embrionárias constituem a chamada massa celular interna da blástula (blastocisto), que dá origem ao embrião. Elas têm maior capacidade de diferenciação e podem originar todos os tecidos corporais. d. Na medula óssea de um adulto, existem células-tronco capazes de dar origem a células diferenciadas de todos os tecidos humanos.

e. As células-tronco têm grande poder de regeneração porque todos os seus genes estão desligados.

a. A gripe A, causada pelo vírus H1N1, que, assim como o vírus da dengue, é transmitido pela picada do mosquito Aedes, pode ser também transmitida pelo ar ou pelo contato com secreções de indivíduos infectados.

Cultura de células-tronco 1

2

b. A prevenção contra o vírus da gripe A é feita principalmente por meio da vacinação e o tratamento de pessoas infectadas é feito com o uso de antibióticos.

3 4 a

5 1. Ovo fertilizado in vitro; 2. Estágio de blastocisto (5-7 dias de vida) 3. Massa celular interna (embrioblasto = embrião); 4. Cultura de células-tronco indiferenciadas; 5. Células especializadas: a. células sanguíneas; b. células nervosas; c. células musculares.

A situação ilustrada refere-se a duas epidemias recentes e, de certa forma, ainda comuns nos dias de hoje no Brasil: a gripe A e a Dengue, doenças causadas por vírus. Independentemente do aspecto político abordado e focando apenas os aspectos biológicos que envolvem essas doenças, assinale a única opção correta.

c. A melhor forma de evitar a dengue é combater os focos de acúmulo de água, locais propícios para a criação do mosquito transmissor da doença, já que ele é holometábolo e apresenta um estágio larval aquático. d. Muitas outras doenças parasitárias são também transmitidas através da picada de mosquitos, caso da malária, da doença de chagas, da leishmaniose e da amebíase, estas causadas por protozoários.

b c

e. A máscara, em destaque no mosquito, quando devidamente usada pelos seres humanos, pode dificultar a transmissão da gripe A (H1N1) e da dengue, mas não da gripe comum. expoENEM 3


Dicas para combater o mosquito e os focos de larvas Entregue seus pneus velhos ao serviço de limpeza urbana ou guarde-os sem água em local coberto e abrigados da chuva.

Mantenha a caixa d’água sempre fechada com tampa adequada.

Coloque o lixo em sacos plásticos e mantenha a lixeira bem fechada. Não jogue lixo em terrenos baldios.

Remova folhas, galhos e tudo que possa impedir a água de correr pelas calhas

Disponível em: <http://www.dengue.org.br/dengue_prevenir.html>

Não deixe a água da chuva acumulada sobre a laje.

07. Durante a era Mesozoica, há cerca de 175 milhões de anos, uma linhagem de terópodes deu origem às aves. A ave fossilizada mais antiga que se conhece, a Archaeopteryx, que viveu há cerca de 150 milhões de anos, possuía dentes, era coberta com penas, tinha asas bem desenvolvidas e garras nos membros anteriores e posteriores. Muitos cientistas consideram esse fóssil um importante elo entre répteis crocodilianos e as aves modernas. © Wikipédia

Lave semanalmente por dentro com escovas e sabão os tanques utilizados para armazenar água.

Mantenha bem tampados tonéis e barris d’água.

Achaeopteryx é o fóssil semelhante às aves mais antigo até agora conhecido.

Encha de areia até a borda os pratinhos de vasos de planta.

Com relação aos répteis e às aves, estas também denominadas “dinossauros com penas”, pode-se afirmar corretamente que a. as aves apresentam semelhanças com os répteis, entre as quais aquelas que refletem adaptações ao ambiente seco: pele seca, ovo com casca e anexos embrionários, e excreção de ácido úrico como principal resíduo nitrogenado.

Se você tiver vasos de plantas aquáticas, troque a água e lave o vaso principalmente por dentro com escova, água e sabão pelo menos uma vez por semana.

b. nos répteis a respiração é pulmonar nas espécies terrestres e branquial nas espécies aquáticas. c. uma semelhança também marcante entre esses grupos de animais é que todos os répteis e todas as aves apresentam coração tetracavitário, com circulação dupla e completa. d. além das penas e das asas, são consideradas adaptações importantes ao voo das aves: ossos pneumáticos, osso esterno com quilha e ectotermia. e. os répteis não apresentam bexiga urinária nem intestino grosso, características que os assemelham às aves atuais. Tá ligado?

Guarde garrafas sempre de cabeça para baixo.

As aves compartilham certas estruturas fisiológicas com os répteis, o que sugere parentesco evolutivo. Entre as principais: pele seca, ovos com casca e anexos, excreção de ácido úrico. expoENEM 4


08. Observe o anúncio publicado no jornal santista A Tribuna, de 16 de setembro de 1928.

e. Os mosquitos transmissores, machos e fêmeas, necessitam de sangue para o amadurecimento sexual e, por isso, sugam o sangue humano para poderem se reproduzir. Uma medida profilática eficaz contra a doença seria a esterilização dos mosquitos. Se ligue! A malária é transmitida principalmente pela picada das fêmeas do mosquito do gênero Anopheles, seu hospedeiro definitivo. Os machos são herbívoros. Os picos febris ocorrem em virtude da ruptura das hemácias e liberação dos protozoários no sangue, uma das etapas do ciclo de vida do Plasmodium.

Resumo das principais doenças causadas por protozoários DOENÇA

O anúncio se refere a um remédio contra sezões (impaludismo, maleita, febre palustre ou febre intermitente). Trata-se da malária, protozoose que ainda constitui endemia grave no Brasil. Estima-se que mais de 40% da população mundial está exposta ao risco de adquirir malária. O Brasil, no ano de 2006, registrou 549.182 casos de malária, sendo a espécie P. vivax de maior incidência (73,4%). A região da Amazônia Legal concentra 99,7% dos casos de malária, tendo sido identificados nessa região 90 municípios de alto risco para a malária, ou seja, com um Índice Parasitário Anual (IPA) igual ou maior que 50 casos por 1.000 habitantes. A transmissão nessa área está relacionada a: (1) biológicos (presença de alta densidade de mosquitos vetores); (2) geográficos (altos índices de pluviosidade, amplitude da malha hídrica e a cobertura vegetal); (3) ecológicos (desmatamentos, construção de hidroelétricas, estradas e de sistemas de irrigação, açudes); (4) sociais (presença de numerosos grupos populacionais, morando em habitações com ausência completa ou parcial de paredes laterais e trabalhando próximo ou dentro das matas e dos criadouros). Fonte: Série A. Normas e Manuais Técnicos. Cadernos de Atenção Básica, n. 21.: 2. Ed. Ver. 2008. Ministério da Saúde. Disponível em: <http:// www.saude.gov.br/bvs>

De acordo com seus conhecimentos e com as informações contidas nos textos sobre a malária, assinale a opção correta. a. A transmissão é feita pela picada do mosquito Triatoma sp., o qual vive preferencialmente nas frestas de casas de pau a pique, também denominadas casas de sapê, e tem hábito de vida noturno. b. No ciclo da malária, o homem figura como hopedeiro definitivo e o mosquito é o hospedeiro intermediário. Tal classificação se baseia no modo de reprodução do protozoário P. vivax. c. O gráfico a seguir nos permite concluir corretamente que os picos de febre correspondem aos momentos das picadas do mosquito no homem, daí a doença ser conhecida como febre intermitente:

CLÍNICA

TRANSMISSÃO

Amebíase

Entamoeba histolytica

Diarreia, fraqueza, lesões ulcerativas no intestino.

Ingestão de cistos por meio de alimentos e água contaminados.

Giardíase

Giardia lamblia

Diarreia e colite.

Ingestão de cistos por meio de alimentos e água contaminados.

Doença de Chagas

Trypanosoma cruzi

Inflamação e destruição do miocárdio (miocardite).

Tripanossomos presentes nas fezes do “barbeiro” atravessam a pele e provocam danos no coração.

Malária

Plasmodium malariae

Febre cíclica, anemia, aumento do fígado e do baço.

Picada de fêmeas do mosquito Anopheles (mosquito-prego).

Doença do sono

Trypanosoma gambiense

Inflamação e lesão do sistema nervoso.

Picada da mosca tsé-tsé (Glossina palpalis).

Leishmaniose

Leishmania brasiliensis

Lesões ulcerosas na pele.

Picada do mosquito Phlebotomus (mosquito-palha ou birigui).

Calazar

Leishmania donovani

Emagrecimento, fraqueza, aumento do fígado e do baço.

Picada do mosquito Phlebotomus ou do mosquito Lutzomyia.

Tricomoníase

Trichomonas vaginalis

Inflamação e corrimento vaginal; uretrites.

Relações sexuais desprotegidas e uso de toalhas ou roupas íntimas contaminadas.

Toxoplasmose

Toxoplasma gondii

Lesões oculares, cegueira, alterações neurológicas e aborto.

Ingestão de cistos existentes em terra contaminada por fezes de gatos.

09. Os grupos vegetais atuais, segundo os cientistas, descendem das algas verdes clorofíceas aquáticas. À medida que foram ocupando o ambiente, adaptações importantes foram surgindo, como os vasos condutores de seiva, uma cutícula protetora que limita a transpiração e as sementes. Observe atentamente o esquema a seguir e assinale a opção que identifica corretamente I, II, III e IV, respectivamente.

Avasculares (I) Dias

1

2

3

4

5

6 78

9

10 11

12 13 14

15

Vasculares

39

Com frutos (II)

Com sementes

Plantas

16 17

40

Temperatura (°C)

PROTOZOÁRIO

Sem sementes (IV)

Sem frutos (III)

38

a. Briófita, pteridófita, gimnosperma e angiosperma.

37

b. Briófita, pteridófita, angiosperma e gimnosperma.

36

c. Pteridófita, gimnosperma, angiosperma e briófita.

d. Para a erradicação da doença, devem-se levar em conta fatores biológicos, geográficos, ecológicos e sociais das regiões endêmicas. expoENEM 5

d. Pteridófita, angiosperma, briófita e gimnosperma. e. Briófita, angiosperma, gimnosperma e pteridófita.


Fique esperto! Cladograma dos grupos vegetais plantas avasculares

plantas vasculares

plantas sem sementes

plantas com sementes

plantas sem flor

algas ancestrais clorófitas

briófitas

filicíneas

plantas com flor

gimnospermas

angiospermas

primeiras plantas com sementes primeiras plantas vasculares

10. Observe a tabela a seguir, que resume as principais DSTs humanas. DOENÇA Gonorreia Sífilis

Neisseria gonorrhoeae (bactéria) Treponema palidum (bactéria)

CONSEQUÊNCIA Homem: esterilidade. Mulher: inflamação da pélvis, esterilidade e possível cegueira do recém-nascido. Lesões nos sistemas circulatório e nervoso. Malformação ou morte do recém-nascido.

Uretrite e vulvovaginite

Clamydia trachomalis

Artrite. Infecções nos olhos, pele e boca.

Herpes genital

Virus hominis (vírus)

Pode contagiar o feto. Aumenta o risco de câncer do colo do útero.

Hepatite B

Vários tipos de vírus

Produz graves problemas no fígado. Pode causar a morte.

Aids Candidíase

AGENTE

HIV (vírus) Candida albicans (fungo)

Transmite-se ao feto. Infecções generalizadas e morte. Mais frequente na mulher. Não tem consequências.

A respeito de doenças sexualmente transmissíveis, assinale a única opção correta. a. No caso de uma gestante ter uma DST, seu filho não corre perigo de contrair a doença, pois não há contato entre o sangue da mãe e o do bebê. b. A Aids (síndrome da imunodeficiência adquirida) sempre causa lesões nos órgãos genitais. c. As DSTs ocorrem apenas em pessoas que mantêm relações sexuais. d. Quando comparada com o uso de anticonceptivos orais femininos, a camisinha, além de evitar a gravidez, protege os parceiros sexuais da contaminação por microrganismos, sem provocar sobrecarga hormonal para o organismo feminino. e. A descoberta da penicilina conferiu um benefício incalculável para a humanidade, e hoje é o antibiótico mais usado no mundo no combate de todas as DSTs relacionadas anteriormente. Tá ligado? O uso da camisinha durante as relações sexuais pode evitar gravidez indesejada e também proteger o corpo contra a transmissão de DSTs de parceiros contaminados.

11. A liberação de um ovócito secundário por um dos ovários (ovulação) é parte de uma sequência cíclica de eventos chamada ciclo menstrual. Esses eventos obedecem às interações de hormônios gonadotróficos (FSH e LH) com hormônios ovarianos (estrógeno e progesterona).

Os ciclos menstruais iniciam-se quando a menina começa a entrar na maturidade sexual, geralmente entre 11 e 15 anos de idade. A primeira menstruação é a menarca e se caracteriza pela eliminação da mucosa uterina e de sangue pela vagina, fenômeno que ocorre, em média, a cada 28 dias, por ocasião da baixa concentração no sangue dos hormônios FSH, LH, estrógeno e progesterona.

expoENEM 6


Observe a variação hormonal durante um ciclo ovulatório feminino humano.

Hormônios hipofisários

hormônio luteinizante (LH)

hipófise hormônio folículoestimulante (FSH)

progesterona

Hormônios ovarianos

estradiol

A partir de suas observações e conhecimentos a respeito, assinale a única opção correta sobre a ação dos hormônios gonadotróficos e ovarianos. a. O hormônio folículo estimulante (FSH) é secretado pela hipófise e estimula a ovulação. b. O hormônio luteinizante (LH) é secretado pela hipófise e estimula o amadurecimento do folículo ovariano. c. O hormônio estrógeno (estradiol) é produzido no ovário e atua na manutenção da gravidez. d. O hormônio progesterona é produzido no ovário e estimula o aparecimento dos caracteres sexuais femininos, além de provocar o espessamento da parede do endométrio. e. a pílula anticoncepcional combina os hormônios estrógeno e progesterona, os quais têm o efeito de inibir a secreção da hipófise, o que impede o amadurecimento do folículo ovariano e a consequente ovulação.

Fique esperto!

Hormônios

Ovulação

menstruação

preparação para ovulação

P

preparação para nidação

E

crescimento folicular

ruptura

LH

formação de corpo lúteo

Endométrio

Ovário

FSH

2 4 6 8 10 12 14 16 18 20 22 24 26 28 Dias Dias férteis Menstruação

Ovulação

Dias

1

5

9

12 14 16 18

22

28

A ovulação e fertilização são possíveis tão cedo quanto o 7°. dia e tão tarde quanto o 21°. dia

O FSH estimula o amadurecimento do folículo ovariano; o LH estimula a ovulação. O estrógeno determina os caracteres sexuais femininos e inicia a proliferação do endométrio. A progesterona atua na manutenção da gestação.

expoENEM 7


12. O desenvolvimento embrionário inicia-se com a fertilização do óvulo por um único espermatozoide. Nos humanos o óvulo é muito maior que o espermatozoide e carrega no citoplasma fatores que irão dirigir o desenvolvimento e a nutrição do embrião em crescimento. © Wikipédia

se dividem em classes, que são divididas em ordens, famílias, gêneros e espécies, os quais por sua vez sofrem subdivisões. Grupos de organismos em qualquer uma dessas classificações são chamados taxa (singular, taxon), phyla, ou grupos taxonômicos. Fonte: <http://pt.wikipedia.org/wiki/Taxonomia_de_Lineu>

De acordo com seus conhecimentos sobre taxonomia, assinale a opção correta. a. Dois animais pertencentes à mesma classe pertencem obrigatoriamente ao mesmo filo. b. Dois animais pertencentes à mesma ordem pertencem obrigatoriamente à mesma família. c. Canis familiaris (cão doméstico) e Vulpes vulpes (raposa) apresentam maior grau de parentesco entre si do que Canis latrans (coiote) e Canis lupus (lobo). d. A classificação atual admite cinco reinos, os quais estão divididos em dois grupos: os procariontes (Protoctistas, Fungi, Plantae e Animalia) e os eucariontes (Moneras).

A partir da fertilização, inicia-se o desenvolvimento do embrião.

Didaticamente, o desenvolvimento embrionário é dividido em três etapas: segmentação, gastrulação e organogênese.

A partir dos seus conhecimentos sobre o desenvolvimento embrionário humano, assinale a opção incorreta. a. A segmentação se caracteriza pelas divisões mitóticas iniciais da célula-ovo ou zigoto, até a fase de blástula, ou blastocisto.

e. O sistema de classificação de Lineu se baseia fundamentalmente no ambiente em que as espécies vivem. 15. No coração dos mamíferos, o sangue desoxigenado (venoso) circula pelo lado direito e o sangue oxigenado (arterial) circula pelo lado esquerdo. Dessa forma, o coração é uma bomba dupla, em que uma bombeia sangue para os pulmões e a outra para o restante do corpo.

b. A gastrulação caracteriza-se pela formação da gástrula, estrutura que apresenta uma cavidade interna, o arquêntero ou intestino primitivo, e um orifício que o comunica com o meio externo: o blastóporo.

Observe atentamente o esquema a seguir e assinale a única opção correta. coração I II A

c. A organogênese, também conhecida como neurulação, é a etapa em que surge o tubo neural, o qual originará o sistema nervoso central.

sangue + O2 tecidos

d. A placenta e o cordão umbilical são anexos embrionários que permitem a conexão entre o feto e a gestante, e são eliminados por ocasião do parto.

III B

e. O saco vitelínico é bastante desenvolvido e rico em alimento. Assim, garante a nutrição do feto durante toda a gestação. 13. A vida surgiu a partir dos mares primitivos. Assim, gradativamente, vegetais e animais foram colonizando o ambiente terrestre, o qual ofereceu (e oferece) as mesmas pressões adaptativas para esses grupos de seres vivos. Dessa forma, é comum encontrarmos estruturas adaptativas fisiológicas análogas quando comparamos certos grupos vegetais, como as gimnospermas, com certos grupos animais, como os répteis; ambos considerados, do ponto de vista evolutivo, os conquistadores da Terra.

Assinale a alternativa em que a correlação entre os grupos não se estabelece corretamente.

GIMNOSPERMAS – RÉPTEIS

sangue + CO2

coração

sangue + CO2

IV sangue + O2

pulmões a. A representa a pequena circulação, também denominada circulação sistêmica. b. B representa a circulação pulmonar, também denominada grande circulação. c. I e IV representam vasos que carregam sangue rico em oxigênio, ou seja, artérias. d. III representa a veia pulmonar e IV representa a artéria pulmonar. e. I representa a artéria aorta e II a veia cava. artéria pulmonar

a. cutícula que limita a transpiração – pele grossa queratinizada. pulmão

pulmão

b. semente que protege e nutre o embrião – ovo com casca e anexos embrionários.

veia pulmonar

c. estômatos desenvolvidos – respiração exclusivamente pulmonar. d. tubo polínico – fecundação interna. e. vasos condutores de seiva – circulação sanguínea. 14. A taxonomia de Lineu, extensamente usada nas ciências biológicas, foi desenvolvida por Carlos Lineu (Carolus Linnaeus) no Século XVIII, durante a grande expansão da história natural. A taxonomia de Lineu classifica os seres vivos em reinos, que se dividem em filos, os quais expoENEM 8

artéria aorta

veia cava corpo


16. (Enem 2008)

Tá ligado?

Um estudo recente feito no Pantanal dá uma boa ideia de como o equilíbrio entre as espécies, na natureza, é um verdadeiro quebra-cabeça. As peças do quebra-cabeça são o tucano-toco, a arara-azul e o manduvi. O tucano-toco é o único pássaro que consegue abrir o fruto e engolir a semente do manduvi, sendo, assim, o principal dispersor de suas sementes. O manduvi, por sua vez, é uma das poucas árvores onde as araras-azuis fazem seus ninhos.

Produtos da biotecnologia para aplicação medicinal PRODUTO

Até aqui, tudo parece bem encaixado, mas...é justamente o tucano-toco o maior predador de ovos de arara-azul – mais da metade dos ovos das araras são predados pelos tucanos. Então, ficamos na seguinte encruzilhada: se não há tucanos-toco, os manduvis se extinguem, pois não há dispersão de suas sementes e não surgem novos manduvinhos, e isso afeta as araras-azuis, que não têm onde fazer seus ninhos. Se, por outro lado, há muitos tucanos-toco, eles dispersam as sementes dos manduvis, e as araras-azuis têm muito lugar para fazer seus ninhos, mas seus ovos são muito predados. Disponível em: <http://oglobo.globo.com>. (Adaptado).

De acordo com a situação descrita, a. o manduvi depende diretamente tanto do tucano-toco como da arara-azul para sua sobrevivência. b. o tucano-toco, depois de engolir sementes de manduvi, digere-as e torna-as inviáveis. c. a conservação da arara-azul exige a redução da população de manduvis e o aumento da população de tucanos-toco. d. a conservação das araras-azuis depende também da conservação dos tucanos-toco, apesar de estes serem predadores daquelas. e. a derrubada de manduvis em decorrência do desmatamento diminui a disponibilidade de locais para os tucanos fazerem seus ninhos.

FINALIDADE

Insulina

Estimula a captação de glicose do sangue em pacientes com diabetes tipo I.

Hormônio de crescimento

Trata indivíduos de baixa estatura.

Fator VIII

Trata pacientes com hemofilia A.

Ativador de plasminogênio tecidual

Dissolve coágulos sanguíneos depois de ataques cardíacos e derrames.

Proteínas vacinais: hepatite B, herpes, gripe, meningite, coqueluche etc.

Prevenção de doenças infecciosas.

Fator dado de crescimento derivado de plaquetas

Estimula a cicatrização de feridas.

Eritropoietina

Previne anemia em pacientes que se submeteram a diálise renal e terapia contra o câncer.

Fator estimulador de colônias

Estimula a produção de células brancas do sangue em pacientes com câncer e aids.

Pharming: produção de proteínas no leite

Fatores de coagulação sanguínea para tratar a hemofilia; anticorpos para tratar câncer de colo do útero; terapia para fibrose cística etc.

Fique esperto! IMUNIZAÇÃO

18. (Enem 2009)

CONSEQUÊNCIA Natural: o organismo é infectado por algum antígeno, causando uma doença, e produz anticorpos naturalmente.

Ativa

Passiva

Para que todos os órgãos do corpo humano funcionem em boas condições, é necessário que a temperatura do corpo fique sempre entre 30°C e 37°C. Para manter-se dentro dessa faixa, em dias de muito calor ou durante intensos exercícios físicos, uma série de mecanismos fisiológicos é acionada.

Artificial: vacina – atua na prevenção da doença. Natural: ocorre transferência de anticorpos de modo natural, como quando a mãe passa anticorpos para o filho através da placenta ou durante a amamentação.

Artificial: soro – atua na terapia ou cura da doença ou enfermidade.

Pode-se citar como o principal responsável pela manutenção da temperatura corporal humana o sistema a. digestório, pois produz enzimas que atuam na quebra de alimentos calóricos. b. imunológico, pois suas células agem no sangue, diminuindo a condução do calor.

17. (Enem 2009) Um novo método para produzir insulina artificial que utiliza tecnologia de DNA recombinante foi desenvolvido por pesquisadores do Departamento de Biologia Celular da Universidade de Brasília (UnB) em parceria com a iniciativa privada. Os pesquisadores modificaram geneticamente a bactéria Escherichia coli para torná-la capaz de sintetizar o hormônio. O processo permitiu fabricar insulina em maior quantidade e em apenas 30 dias, um terço do tempo necessário para obtê-la pelo método tradicional, que consiste na extração do hormônio a partir do pâncreas de animais abatidos. Ciência Hoje. 24 abr. 2001. Disponível em: <http://cienciahoje.uol.com.br> (adaptado)

A produção de insulina pela técnica do DNA recombinante tem, como consequência, a. o aperfeiçoamento do processo de extração de insulina a partir do pâncreas suíno. b. a seleção de microrganismos resistentes a antibióticos. c. o progresso na técnica da síntese química de hormônios. d. impacto favorável na saúde de indivíduos diabéticos. e. a criação de animais transgênicos. expoENEM 9

c. nervoso, pois promove a sudorese, que permite perda de calor por meio da evaporação da água. d. reprodutor, pois secreta hormônios que alteram a temperatura, principalmente durante a menopausa. e. endócrino, pois fabrica anticorpos que, por sua vez, atuam na variação do diâmetro dos vasos periféricos.

Como o suor é produzido? Suamos constantemente mesmo sem perceber. É a maneira pela qual nosso corpo se livra do excesso de calor que é produzido pelo metabolismo ou pelo trabalho muscular. Quando a glândula sudorípara é estimulada, as células secretam um fluido similar ao do plasma sanguíneo, ou seja, basicamente composto de água, altas concentrações de sódio e cloreto e baixa concentração de potássio (não há proteínas e ácidos graxos, normalmente presentes no plasma). Esse fluido surge nos espaços entre as células


(espaços intersticiais) que o recebem dos capilares da derme. O fluido se desloca da porção espiralada e sobe através do duto reto, de onde é eliminado.

Organismo adulto (2n)

d.

mitose

Gametas (n)

meiose

Epiderme Fluxo baixo

Derme

Fluxo alto

Na+

Na

Zigoto (n)

+

fecundação

Cl–

Cl–

H2O

H2O

Organismo adulto (2n)

e. Fluido intersticial Altos Na+, Cl– Baixo K+

meiose

Gametas (n)

mitose H2O

Zigoto (n)

Na+

Cl–

Se ligue!

H2O Cl–

Os seres vivos podem apresentar formas adultas haploides ou diploides durante seu ciclo de vida. Alguns deles apresentam apenas uma destas formas e são denominados haplobiontes. Outros apresentam ambas as formas, e são por isso denominados diplobiontes.

K+ Na+

K+

Movimento de íons e de água para produzir suor.

Se o ser haplobionte for diploide (2n), como os mamíferos, é denominado haplobionte diplonte. O ciclo de vida de um organismo haplobionte diplonte caracteriza-se pela meiose gamética (meiose que ocorre na formação dos gametas).

19. Os seres vivos apresentam diferentes ciclos de vida, caracterizados pelas fases nas quais gametas são produzidos e pelos processos reprodutivos que resultam na geração de novos indivíduos.

Ciclo haplobionte diplonte Indivíduo adulto diploide 2(n)

Considerando-se um modelo simplificado padrão para geração de indivíduos viáveis, a alternativa que corresponde ao observado em seres humanos é: a.

Esporófito (2n)

meiose

Gametas (n)

Organismo adulto (2n)

gameta (n) fecundação

Gametófito (n)

mitose

Gametas (n)

meiose

Zigoto (2n)

Organismo adulto (2n)

c.

meiose gamética

20. (Enem 2007)

fecundação

b.

zigoto 2(n)

Esporos (n)

Zigoto (2n)

fecundação

fecundação

meiose

Gametas (n)

mitose

Zigoto (2n)

fecundação Fernando Gonsales. “Vá Pentear Macacos!” São Paulo: Devir, 2004.

expoENEM 10


Fique esperto!

São características do tipo de reprodução representado na tirinha: a. simplicidade, permuta de material gênico e variabilidade genética.

As bactérias se reproduzem apenas assexuadamente, por divisão binária ou cissiparidade. É um processo de reprodução extremamente simples. Inicialmente ocorre duplicação do material genético (DNA) e em seguida ocorre divisão da célula, originando dois novos organismos idênticos, caso não haja mutação, é claro.

b. rapidez, simplicidade e semelhança genética. c. variabilidade genética, mutação e evolução lenta. d. gametogênese, troca de material gênico e complexidade. e. clonagem, gemulação e partenogênese.

21. Vazamentos de petróleo como o do Golfo do México são verdadeiras catástrofes ambientais. Em contato com a flora e a fauna marítimas, o óleo asfixia algas, mata peixes, intoxica aves. O episódio na costa dos Estados Unidos, que vem causando danos irreparáveis, já dizimou uma espécie de tartaruga que só existia naquelas águas.

1 2

1

3 Quando o óleo chega, atinge primeiro os caules e sistemas radiculares das árvores. Eles ficam pintados de preto.

2

Parte do óleo derramado na superfície evapora em contato com o Sol. A ação solar quebra as cadeias de hidrocarbonetos. Em parte, há redução de carga poluente.

A outra parcela chega aos mangues com a maré, fica impregnada nas árvores e nos sedimentos.

3

Ao longo das décadas, o óleo é decomposto pelo vaivém das marés e pela ação biogeoquímica que o decompõe em hidrocarbonetos.

Escondidos em suas tocas, os caranguejos são atingidos pelo óleo dentro de casa. Para escapar, tentam subir nas árvores. Em vão. Em pouco tempo, observa-se uma chuva de caranguejos. Eles caem na lama e morrem.

Dependendo do grau de contaminação, os ecossistemas conseguem se recuperar de vazamentos. Alguns locais ainda apresentam sinais mesmo depois de décadas. É o caso da Baía de Guanabara, que cheira a petróleo e tem o sedimento impregnado de óleo.

maré baixa

mancha de óleo

Quando a maré baixa, o óleo entra em contato com o sedimento (o lamaçal no fundo do mangue). Os seres que ficam presos às arvores, como as cracas e os mexilhões, morrem à medida que o óleo vai descendo.

caranguejos

Asfixiadas, as árvores ficam amarelas e morrem. As aves são contaminadas pela comida. Em contato com suas penas, o óleo afeta a capacidade de isolamento térmico.

sedimento

Os microrganismos do sedimento, como crustáceos e moluscos, morrem por problemas no aparelho respiratório. Isso acontece num período de seis horas, tempo de uma maré.

microrganismos

Fonte: Aline Ribeiro (texto) e Alberto Cairo, Marco Vergotti e Nilson Cardoso (arte). “Até aonde a natureza se recupera.” Época, São Paulo, Editora Globo, 31 de maio de 2010, n. 628, p. 18.

Com base nos seus conhecimentos e nas informações constantes na imagem, marque a alternativa correta. a. Os manguezais constituem um bioma que ocupa toda a costa litorânea brasileira. Suas águas salobras são ricas em oxigênio, o que facilita a vida das plantas ali presentes. b. As cracas e os mexilhões são animais pertencentes ao filo Mollusca e apresentam corpo mole e viscoso. Nos mexilhões encontramos a rádula, que serve para raspar o substrato em busca de alimentos. c. Os caranguejos são crustáceos pertencentes ao filo Arthropoda. Esses animais apresentam respiração branquial. As brânquias ficam impregnadas de óleo, impedindo as trocas gasosas e levando o animal à morte. d. As árvores apresentadas no diagrama são angiospermas monocotiledôneas, basta observar algumas características presentes na ilustração: caule do tipo tronco, com crescimento secundário, e presença de raízes suporte, pois o solo é lodoso. e. Ao longo das décadas, o óleo pode ser decomposto pelo vaivém das marés, pois as bactérias presentes na água do mangue não conseguem promover a quebra desse poluente.

22. (Enem 2009) O ciclo da água é fundamental para a preservação da vida no planeta. As condições climáticas da Terra permitem que a água sofra mudanças de fase e a compreensão dessas transformações é fundamental para se entender o ciclo hidrológico. Numa dessas mudanças, a água ou a umidade da terra absorve o calor do Sol e dos arredores. Quando já foi absorvido calor suficiente, algumas das moléculas do líquido podem ter a energia necessária para começar a subir para a atmosfera. Disponível em: <http://www.keroagua.blogspot.com>. Acesso em: 30 mar. 2009 (Adaptado).

A transformação mencionada no texto é a a. fusão.

d. solidificação.

b. liquefação.

e. condensação.

c. evaporação. expoENEM 11


Texto base para a questão 23. Ciclo de vida básico do HIV Um comando de autocópia Os esforços para desenvolver vacinas e tratamentos contra o HIV dependem do conhecimento do ciclo de vida do vírus. O HIV invade as células hospedeiras e leva seu mecanismo a produzir mais cópias dele mesmo. Primeiro, uma proteína no vírus, chamada Envelope, deve se ligar às proteínas CD4 e CDR5 na superfície da célula (1). Conforme o vírus se funde com a célula, ele esvazia seu conteúdo no citoplasma (2). Uma enzima viral, a transcriptase reversa, então copia o genoma do RNA do vírus no duplo filamento do DNA (3), cometendo erros frequentes que resultam em cópias variadas do vírus. Uma outra enzima viral, a integrase, insere a cópia no DNA do hospedeiro (4). O mecanismo da célula transcreve os genes virais novamente em RNA (incluindo o RNA que pode servir como modelo para as proteínas) que viaja até o citoplasma, onde os ribossomos produzem as proteínas codificadas (5). O RNA viral e as proteínas então se movem na direção da membrana celular, onde se reúnem a partículas de vírus em brotamento (6), Na nova cópia imatura do vírus, a enzima protease do HIV modifica a cadeia de proteínas virais, permitindo que as partículas, ou “vírions”, amadureçam até estarem aptas a infectar uma nova célula (7).

genoma do RNA viral

7

proteína Envelope protease vírus maduro

fusão

1 CD4

2

CCR5 transcriptase reversa

vírus imaturo membrana celular

cópia do DNA

3

6

genoma viral

cadeia de proteína viral

5

vírus em brotamento

ribossomo integrase

4 DNA do hospedeiro RNA

DNA do HIV núcleo

David I. Watkins “Sucessivos fracassos na busca por uma vacina contra Aids levaram os pesquisadores a refazer rotas teóricas”. Scientific American Brasil, São Paulo: Duetto, Dezembro de 2008, nº 79, p. 28.

23. Considerando o infográfico, julgue as afirmações e marque as corretas. I. A grande proliferação do vírus HIV e a dificuldade em combatê-lo deve-se, em grande parte, à transcriptase reversa, proteína que, ao “ler” o filamento simples de RNA, comete frequentes erros, gerando um DNA diferente do anteriormente utilizado para infectar outra célula do hospedeiro. Tal grau de primitividade confere ao vírus uma capacidade de mutação única que “engana” o sistema imunológico humano. II. O processo realizado pela enzima integrase no núcleo da célula hospedeira do vírus HIV é semelhante ao desenvolvimento, em laboratórios de empresas agroquímicas, de sementes transgênicas, processo no qual, o gene de uma bactéria resistente a determinado defensivo agrícola é acoplado ao DNA da planta. III. O vírus HIV detém a capacidade de infectar qualquer célula do corpo humano, uma vez que é capaz de passar por qualquer parte da membrana celular, altamente vulnerável a vírus de RNA, como o da Aids e o da gripe. a. I b. II c. III d. I e III e. I e II

Fique esperto! Os vírus são altamente específicos para as proteínas de membrana, portanto, eles só são capazes de invadir células que possuam o sistema porta que eles identificam. Pode-se dizer que se comportam como armas inteligentes, que sabem identificar seu alvo.

24. (Enem 2009) Uma colônia de formigas inicia-se com uma rainha jovem que, após ser fecundada pelo macho, voa e escolhe um lugar para cavar um buraco no chão. Ali dará origem a milhares de formigas, constituindo uma nova colônia. As fêmeas geradas poderão ser operárias, que vivem cerca de um ano, ou novas rainhas. Os machos provêm de óvulos não fertilizados e vivem aproximadamente uma semana. As operárias se dividem nos trabalhos do formigueiro. Há formigas forrageadoras, que se encarregam da busca por alimentos; formigas operárias, que retiram dejetos da colônia e são responsáveis pela manutenção ou que lidam com o alimento e alimentam as larvas, e formigas patrulheiras. Uma colônia de formigas pode durar anos e dificilmente uma formiga social consegue sobreviver sozinha. MELO, A. “Como funciona uma sociedade de formigas?” Disponível em: <http://www.cienciahoje.uol.com.br>. Acesso em: 21 fev. 2009 (Adaptado).

expoENEM 12


Uma característica que contribui diretamente para o sucesso da organização social dos formigueiros é: a. a divisão de tarefas entre as formigas e a organização funcional da colônia. b. o fato de as formigas machos serem provenientes de óvulos não fertilizados. c. alta taxa de mortalidade das formigas solitárias ou das que se afastam da colônia. d. a existência de patrulheiras, que protegem o formigueiro do ataque de herbívoros. e. o fato de as rainhas serem fecundadas antes do estabelecimento de um novo formigueiro.

Texto base para a questão 25. Tutancâmon pode ter morrido de anemia falciforme Publicidade da New Scientist Tutancâmon, o rei-menino do Egito antigo, morreu de anemia falciforme, uma doença genética, não de malária, segundo cientistas alemães. A causa da morte de Tutancâmon tem sido motivo de especulação desde que seus restos mumificados foram encontrados em 1922. Ele morreu por volta de 1358 a.C., aos 19 anos, após ter governado por apenas nove anos. [...] [...] Com base em uma série de testes, incluindo raio X e análise genética, o grupo de Hawass concluiu que uma doença óssea genética enfraqueceu o rei e um ataque de malária o matou. Necrose severa nos ossos do pé esquerdo de Tutancâmon e a detecção de genes de Plasmodium falciparum, o parasita causador da malária, foram as principais evidências a favor da conclusão de Hawass. [...] Fonte: <http://www1.folha.uol.com.br/ciencia/757265-tutancamonpode-ter-morrido-de-anemia-falciforme.shtml>

25. Na talassemia os indivíduos homozigotos TMTM apresentam a forma mais grave, identificada como talassemia major, e os heterozigotos TMTN apresentam uma forma mais branda chamada de talassemia minor. Indivíduos homozigotos TNTN são normais. Todos os indivíduos com talassemia major morrem antes da maturidade sexual. Suponha que Tutancâmon e sua mulher sejam portadores de talassemia minor. Qual das alternativas a seguir representa a fração de indivíduos adultos que serão anêmicos? a. 1 8

d. 2 3

b. 1 4

e. 1 2

b. desviar a água dos mares para os rios e lagos, de maneira a aumentar o volume de água doce nos pontos de captação. c. promover a adaptação das populações humanas ao consumo de água do mar, diminuindo assim a demanda sobre a água doce. d. reduzir a poluição e a exploração dos recursos naturais, otimizar o uso da água potável e aumentar a captação da água da chuva. e. realizar a descarga dos resíduos municipais e industriais diretamente nos mares, de maneira a não afetar a água doce disponível. Texto base para a questão 27. A fibra medicinal O primeiro desafio foi proposto por Sirlene, especialista em celulose, que resolveu produzir um tipo de fibra utilizando como matéria-prima o bagaço de cana e palha do campo. Estes resíduos são usualmente queimados nas caldeiras de usinas para gerar energia, provocando poluição. Mas a celulose desse material também é muito usada na fabricação de algumas fibras têxteis, como viscose, modal, acetato e liocel. São fibras que conferem conforto e resistência ao tecido. “A quitosana age como bactericida, fungicida e cicatrizante, além de absorver umidade.” Ao implementar o projeto da irmã, Silgia, que trabalha com biomateriais, decidiu dar propriedades medicinais ao material. Para isso, incluiu na fórmula a quitosana, obtida a partir da quitina, [...] encontrada na carapaça de siris, caranguejos e outros [...] “A quitosana age como bactericida, fungicida e cicatrizante, além de absorver umidade”, explica a engenheira têxtil. “Além disso, é um polímero abundante e um resíduo da indústria da pesca”. Para que a fibra pudesse ter aplicações médicas significativas, Silgia também agregou enzimas e fármacos ao material – como lisozima e bromelina, enzimas obtidas da clara de ovo e da casca do abacaxi. A primeira, presente também nas lágrimas, atua como bactericida; já a segunda ajuda na limpeza de feridas, e seu uso é uma boa forma de se usar os resíduos da fruta. [...] Para acelerar a cura A fibra ainda está em fase de testes, mas a próxima etapa será usá-la para fabricar um tecido ou malha e fazer peças de vestuário e bandagens a partir do material. Esses curativos alternativos serão destinados a pessoas que sofrem com queimaduras ou feridas causadas por falta de mobilidade (propiciadas pelo acúmulo de bactérias). “A grande vantagem desse produto está no seu baixo custo de produção e no fato de tratar as inflamações de maneira natural”, ressalta Silgia. [...]

c. 1 3 26. (Enem 2009) Nos últimos sessenta anos, a população mundial duplicou, enquanto o consumo de água foi multiplicado por sete. Da água existente no planeta, 97% são constituídos por água salgada (mares e oceanos), 2% formam geleiras inacessíveis e apenas 1% corresponde à água doce, armazenada em lençóis subterrâneos, rios e lagos. A poluição pela descarga de resíduos municipais e industriais, combinada com a exploração excessiva dos recursos hídricos disponíveis, ameaça o meio ambiente, comprometendo a disponibilidade de água doce para o abastecimento das populações humanas. Se esse ritmo se mantiver, em alguns anos a água potável tornar-se-á um bem extremamente raro e caro.

A pesquisadora prevê que o curativo já deve estar no mercado dentro de um ano. “Recebemos algumas propostas de empresas farmacêuticas e o nosso objetivo é acelerar a produção para disponibilizá-lo o quanto antes”, conta à CH On-line. [...] Larissa Rangel Ciência Hoje On-line Disponível em: <http://cienciahoje.uol.com.br/noticias/2010/05/curativo-de-cana-e-casquinha-de-siri>.

27. Com base no texto e nos seus conhecimentos, assinale a afirmação correta.

MORAES, D. S. L.; JORDAO, B. Q. “Degradação de recursos hídricos e seus efeitos sobre a saúde humana”. Saúde Pública, São Paulo, v. 36, n°. 3, Jun. 2002 (adaptado).

Considerando o texto, uma proposta viável para conservar o meio ambiente e a água doce seria: a. fazer uso exclusivo da água subterrânea, pois ela pouco interfere na quantidade de água dos rios. expoENEM 13

a. A fibra obtida a partir da celulose possui propriedades antibióticas, pois combate bactérias. b. A quitina é uma proteína encontrada na carapaça dos crustáceos. c. A lisozima é uma proteína com função catalisadora. Os catalisadores atuam sobre qualquer substrato e diminuem a velocidade das reações. d. A cana de açúcar é classificada como monocotiledônea, apresenta caule do tipo colmo, raízes axiais ou pivotantes, folhas invaginantes.


Não possui crescimento em espessura devido à ausência de câmbio e felogênio. e. Algumas substâncias foram acrescentadas na fibra de celulose: a quitosana, e a lisozima têm funções bactericidas, a bromelina limpa os ferimentos. Esses procedimentos aumentam a capacidade da fibra em combater pequenos invasores. 28. (Enem 2009) Na região semiárida do nordeste brasileiro, mesmo nos anos mais secos, chove pelo menos duzentos milímetros por ano. Durante a seca, muitas pessoas, em geral as mães de família, têm de caminhar várias horas em busca de água, utilizando açudes compartilhados com animais e frequentemente contaminados. Sem tratamento, essa água é fonte de diarreias e parasitas intestinais, e uma das responsáveis pela elevada mortalidade infantil na região. Os açudes secam com frequência, tornando necessário o abastecimento das populações por carros-pipa, uma alternativa cara e que não traz solução definitiva ao abastecimento de água. OSAVA, M. “Chuva de beber: cisternas para 50 mil famílias”. Revista Eco21, n. 96, nov. 2004 (Adaptado).

Considerando o texto, a proposta mais eficaz para reduzir os impactos da falta de água na região seria: a. subsidiar a venda de água mineral nos estabelecimentos comerciais. b. distribuir gratuitamente remédios contra parasitas e outras moléstias intestinais. c. desenvolver carros-pipa maiores e mais econômicos, de forma a baratear o custo da água transportada. d. captar água de chuva em cisternas, permitindo seu adequado tratamento e armazenamento para consumo. e. promover a migração das famílias mais necessitadas para as regiões Sudeste e Sul, onde as chuvas são abundantes.

29. (Enem 2009) Estima-se que haja atualmente no mundo 40 milhões de pessoas infectadas pelo HIV (o vírus que causa a aids), sendo que as taxas de novas infecções continuam crescendo, principalmente na África, Ásia e Rússia. Nesse cenário de pandemia, uma vacina contra o HIV teria imenso impacto, pois salvaria milhões de vidas. Certamente seria um marco na história planetária e também uma esperança de tratamento antiviral e de acompanhamento médico para as populações carentes. TANURI, A.; FERREIRA JUNIOR, O. C. “Vacina contra Aids: desafios e esperanças”. Ciência Hoje (44) 26,

Uma vacina eficiente contra o HIV deveria: a. induzir a imunidade, para proteger o organismo da contaminação viral. b. ser capaz de alterar o genoma do organismo portador, induzindo a síntese de enzimas protetoras. c. produzir antígenos capazes de se ligarem ao vírus, impedindo que este entre nas células do organismo humano. d. ser amplamente aplicada em animais, visto que esses são os principais transmissores do vírus para os seres humanos. e. estimular a imunidade, minimizando a transmissão do vírus por gotículas de saliva.

Imunização ativa artificial: vacina. Na vacina existem antígenos mortos ou atenuados que obrigam o corpo a criar memória imunológica. Imunização ativa natural: Antígeno presente no meio. O organismo é exposto ao antígeno que está presente no meio, forçando o sistema imunológico criar anticorpos. Imunização passiva artificial: soro O indivíduo recebe soro com anticorpos produzidos por outro organismo, não estimulando, no entanto, a formação de memória imunológica. Imunização passiva natural – aleitamento materno e placenta.

Texto base para a questão 30. Arte na caverna Como é sabido, DNA é uma molécula capaz de se duplicar, ou seja, fazer uma cópia de si mesma. Como toda reação bioquímica, a duplicação do DNA não produz cópias absolutamente perfeitas. O processo sofre influências externas de origem química, da radiação solar e de outras fontes radioativas. Essas pequenas imperfeições tendem a ocorrer seguindo determinado padrão. Elas vão se acumulando com o tempo e tomam-se variações passadas como herança genética para os descendentes, criando uma linhagem. O isolamento entre as populações que escolheram rotas migratórias diferentes impede que as variações acumuladas por um grupo sejam compartilhadas com o outro – o que, em longo prazo, eliminaria as maiores diferenças pela miscigenação e as duas linhagens se fundiriam em uma só. As diferenças entre grupos isolados geograficamente tendem a se acentuar também pelas razões expostas por Charles Darwin e seus sucessores no estudo da Teoria da Evolução. As variações genéticas ocorrem ao acaso e com o tempo. Algumas se tomam predominantes em uma população porque elas se mostraram vantajosas para aquela espécie naquele determinado ambiente. Tome-se o exemplo das peles claras e escuras. O Homo sapiens tinha uma população inteiramente formada por indivíduos de pele escura quando saiu da África. As variações genéticas que tendem a produzir pele clara certamente ocorreram indistintamente em todos os contingentes humanos. Mas elas só se firmaram como mutações vantajosas para os grupos humanos que foram povoar as latitudes mais baixas do globo terrestre, onde o efeito protetor da melanina, o pigmento que dá cor escura à pele, é desnecessário – e até prejudicial por filtrar a fraca insolação das regiões frias, impedindo a absorção da vitamina D garantida pelos raios ultravioleta da luz solar. “Os resultados dos exames de ancestralidade de Charles Miller e Luis Fabiano são bonitos porque confirmam, cientificamente, o que imaginávamos encontrar”, diz Sérgio Pena. É uma beleza, do ponto de vista da antropologia genética, e demonstra a utilidade de entendê--la e esperar que, um dia, ela ajude a desvendar o enigma clássico da condição humana que é a eterna desconfiança do outro, do diferente, do estrangeiro com sua aparência, cultura e religião estranhas. O DNA nada sabe desse sentimento. No seu coração genético, a espécie humana é tão mais forte e sadia quanto mais variações apresenta. Se para a humanidade o inferno sempre foram os outros, para o DNA o inferno é o fim das diferenças. Fábio Altman. “Unidos pelo futebol e pelo DNA”, Veja, São Paulo, Editora Abril, 09 de junho de 2010, edição. 2168, ano 43 n° 23 p. 134.

30. Com base no texto assinale a alternativa correta. a. A duplicação do DNA ocorre durante a metáfase.

Se ligue!

b. O isolamento geográfico é suficiente para que ocorra especiação.

O princípio básico das vacinas é a inoculação do antígeno morto ou atenuado e em alguns casos injeta-se a proteína viral produzida por transgênicos, cuja função é sinalizar o sistema imunológico. Imunização é a capacidade de produzir anticorpos (proteínas), contra agentes estranhos conhecidos como antígenos. Ela pode ser de dois tipos: passiva e ativa. expoENEM 14

c. A duplicação do DNA produz cópias absolutamente perfeitas, pois o processo não sofre influências externas. d. As ideias de Charles Darwin foram imediatamente aceitas pela comunidade científica da época. e. As variações ocorrem ao acaso, algumas, vantajosas, são escolhidas através da seleção natural.


Texto base para a questão 31. A saúde dos brasileiros piorou [...] Nas mulheres, o índice é de 42% (em 2006, era de 38%). O Brasil está caminhando rapidamente para a situação de países como os Estados Unidos, onde 60% da população têm sobrepeso. “Não acredito que vamos derrubar esses índices. Se conseguirmos estabilizá-los, já será uma vitória”; diz Deborah. Entre as mulheres, ficou claro que o excesso de peso é mais comum entre as mais pobres. No estrato de menor escolaridade (zero a oito anos de estudo), 50% das mulheres têm sobrepeso. Na faixa mais culta (12 anos de estudo ou mais), o índice é de 31 %. No sexo masculino, a situação é diferente: a barriga independe da escolaridade. Nas últimas três décadas, o Brasil viveu uma complicada transição nutricional. Saiu da desnutrição para o sobrepeso (um pouco acima do normal) e a obesidade (bastante acima do normal). Quando uma criança sofre de desnutrição ainda no útero da mãe ou nos primeiros anos de vida, é bastante provável que se torne obesa no futuro – pois seu organismo se programou para viver com pouco. Quando essa pessoa tem mais alimento à disposição, ele vira excesso. Além disso, o aumento do peso da população também pode ser explicado pela expansão do acesso a alimentos baratos, engordativos e de baixo valor nutricional, como biscoitos, salgadinhos e fast-food. Com R$ 2 é possível comprar legumes e fazer uma boa sopa ou salada – desde que a pessoa tenha interesse e tempo para cozinhar. Um bom termômetro do tempo que as pessoas passam cozinhando em casa é o consumo regular de feijão. Como o preparo é trabalhoso, baixo consumo de feijão é um indicador de maior consumo de fast-food. O brasileiro está comendo menos feijão (o consumo caiu de 71% em ambos os sexos em 2006 para 65% em 2009), um alimento rico em proteínas vegetais, ferro e outros nutrientes. Entre as doenças provocadas pelos maus hábitos alimentares ou pela falta de exercícios, duas merecem especial atenção: hipertensão e diabetes. Entre os entrevistados, 24% disseram ter recebido diagnóstico de hipertensão (em 2006, eram 21%). Os diabetes foram mencionados por 5,8% dos entrevistados (em 2006, eram 5,2%). Mas é difícil saber se essas doenças estão realmente se tornando mais frequentes ou se a população está tendo mais acesso ao diagnóstico. Assustadora também é a porcentagem de pessoas que abusam de álcool. O governo considera abuso o consumo de mais de cinco doses num único dia em homens e quatro doses em mulheres. No sexo masculino, o consumo de álcool cresceu de 25,5% em 2006 para 28,8% em 2009. É bem mais do que os homens argentinos consomem (14,6%). “A nossa cultura é muito permissiva em relação ao álcool. Ele está sempre associado à celebração e ao lazer. Precisamos educar os brasileiros para mudar essa cultura”, diz Deborah Malta. [...] Cristiane Segatto e Marcela Buscato “A saúde dos brasileiros piorou”. Época, São Paulo, Editora Globo, 21 de junho de 2010, nº 631 p 84.

31. Considerando as informações contidas no texto e seus conhecimentos, marque a alternativa correta. a. A diabetes é causada pela carência do hormônio insulina, produzido pelas glândulas suprarrenais. b. O feijão pode ser utilizado como referencial para estabelecer o crescimento do consumo de fast-food. c. O aumento de casos de hipertensão e diabetes na população brasileira certamente se deve aos maus hábitos alimentares. d. Uma criança que sofreu de desnutrição durante o período gestacional dificilmente se tornará um adulto obeso. e. Com o aumento do poder aquisitivo, a população brasileira obteve maior acesso a alimentos saudáveis, deixando de consumir substâncias engordativas e de baixo valor nutritivo, como biscoitos e salgadinhos.

Fique esperto! O problema nutricional do povo brasileiro é grave e, somado ao sedentarismo, causa sérias dificuldades na gestão da saúde. A insulina, hormônio produzido pelo pâncreas, controla o nível de glicose no sangue, e uma dieta rica em carboidratos pode levar a pessoa a desenvolver um quadro de diabetes. O uso exagerado de álcool e cigarro estimula a produção de hormônios adrenérgicos que provocam vasoconstrição, promovendo um aumento da pressão arterial. Os carboidratos, compostos basicamente por carbono, hidrogênio e oxigênio, podem ser energéticos ou estruturais; os hidratos de carbono podem ser classificados em: a. monossacarídeos: – pentose: ribose e desoxirribose – hexose: glicose, galactose e frutose b. oligossacarídeos – dissacarídeos – maltose, sacarose e lactose c. polissacarídeos – estruturais: celulose e quitina – energético: amido e glicogênio

32. O filme Avatar foi um sucesso de bilheteria, e alguns detalhes dos habitantes, da vegetação e dos animais que vivem em Pandora aguçaram nossa curiosidade. Analise os itens abaixo e marque corretos conforme seus conhecimentos em biologia. I. Os “animais com seis patas” não são uma exclusividade de Pandora; nossos insetos, pertencentes ao filo Mollusca, também são hexápodes. II. “Corpo delgado e musculoso” sugere que os Na’Vis possuem um folheto embrionário semelhante à mesoderma, pois os dois tecidos, adiposo e muscular, são variedades do tecido conjuntivo. III. Em Pandora, diversas das espécies de plantas e animais brilham no escuro. Essa habilidade que alguns organismos possuem em criar luz própria, a bioluminescência, não é incomum na Terra, podendo ser observada em vaga-lumes, algas e várias criaturas das profundezas. expoENEM 15


As afirmativas corretas são: a. I e II

d. somente II

b. I e III

e. somente III

c. II e III 33. Analise a imagem e indique a alternativa correta. O envelhecimento do organismo está relacionado com a progressiva deterioração das células. Quanto mais uma célula se reproduz, maiores as chances de haver erros na cópia de seu material genético. Isso aumenta a probabilidade de que essas novas células deixem de funcionar corretamente. Com o passar dos anos, os mecanismos encarregados de corrigir essas possíveis falhas também deixam de funcionar.

Por que envelhecemos?

membrana celular

núcleo matérial genético

células

Fatores que influenciam no envelhecimento celular 1

Telômeros telômeros

DNA que codifica proteínas Nos extremos de cada cromossomo existem porções de material genético que não exercem nenhuma função ativa no organismo. São os telômeros.

2

Cada vez que uma célula se reproduz, ela perde um pedaço do telômero. Durante anos, esse corte não afeta as funções dos genes porque não atinge o corpo do cromossomo.

Mas, após anos de duplicação, os telômeros ficam tão curtos que os cortes podem afetar parte do material genético, o que pode alterar a ação dos genes.

Mutações

oxigênio usado

glicose energia

oxigênio

oxigênio

Poluentes, nicotina, raios solares podem agredir o material genético, quebrando as sequências e provocando mutações ruins. Há mecanismos que reparam danos, mas eles nem sempre resolvem tudo.

radicais livres

mecanismos de controle

mecanismos de controle

oxigênio radicais livres

Fatores internos Fatores externos

Por isso, à medida que os telômeros vão ficando mais curtos, o organismo retira da célula sua capacidade de se reproduzir.

A célula gera energia por uma reação química entre o oxigênio e a glicose obtida com a ingestão de alimentos. Essas reações também produzem outros compostos, conhecidos como radicais livres.

Estima-se que 5% do oxigênio encontrado na célula se transforma em radicais livres. Em circunstâncias normais, eles são usados pelo organismo em várias funções metabólicas.

Com a idade, os mecanismos de controle dos radicais livres se tornam ineficientes e a quantidade deles no organismo aumenta. Eles podem enfraquecer o DNA das células e facilitar o surgimento de doenças.

Fonte: Marcela Buscato e Aline Ribeiro. “O Segredo da longevidade”. Época, São Paulo: Editora Globo, 5 de julho de 2010, n. 633, p. 64–65.

a. Os cromossomos representados no esquema estão em anáfase, pois estão duplicados e unidos pelo centrômero. b. A reação química mencionada em fatores internos é a respiração celular, pela qual o organoide responsável é a mitocôndria. c. Em todas as células existe um mecanismo que faz uma cópia do telômero a fim de impedir que ele diminua de tamanho. d. Os cromossomos podem ser classificados em quatro categorias: metacêntricos, submetacêntricos, acrocêntricos e telocêntricos. No caso do esquema, todos são telocêntricos. e. Os fatores externos agridem o material genético, quebrando as sequências e provocando mutações ruins. Essas quebras podem ocorrer naturalmente durante a prófase da mitose (crossing-over). Texto base para a questão 34. O que acontece no organismo quando a pressão sobe 1 A pressão arterial é a força do fluxo de sangue contra a parede nas artérias. Ela é medida em dois momentos: quando o músculo cardíaco se contrai e bombeia sangue para o resto do organismo e quando, entre um batimento e outro, o coração relaxa e se enche de sangue. No primeiro caso, ela é chamada de pressão sistólica (ou máxima) e, no outro, diastólica (ou mínima).

2 Nos padrões normais de funcionamento, a pressão arterial faz com que o sangue flua facilmente pelas artérias sem agredi-las. 3 Quando a pressão está alta, os vasos se fecham e a circulação sanguínea fica mais difícil. O coração precisa trabalhar num ritmo mais acelerado, para bom-bear o sangue. 4 A pressão aumenta nas paredes dos vasos e as danifica. Elas ficam enrijecidas e os vasos podem se romper (derrame) ou entupir (infarto). 5 O organismo suporta alterações esporádicas na pressão. Mas, se ela se mantiver alta por muito tempo, poderá causar danos em órgãos vitais, como rins e coração.

expoENEM 16


Fatores de risco para a pressão alta O Presidente Lula tem pelo menos 6 deles, conforme assinalado com 1 Genética: os genes da hipertensão estão envolvidos nos mecanismos de contração e dilatação dos vasos. 2 Privação de sono: o corpo responde às noites mal dormidas com o aumento da secreção dos hormônios cortisol, adrenalina e noradrenalina, que têm ação vasoconstritora. 3 Consumo excessivo de sal: provoca a retenção de sódio e água nos rins, o que faz aumentar o volume de sangue em circulação. A maior quantidade de sangue nos vasos eleva a pressão arterial. 4 Sobrepeso e obesidade: intensificam a secreção de insulina. Em níveis elevados, o hormônio prejudica o sistema de regulação do calibre dos vasos, aumentando a pressão arterial. A insulina também favorece a retenção de sal e água nos rins. 5 Abuso de álcool: a bebida aumenta a atividade do sistema responsável pela vasoconstrição. 6 Estresse: aumenta a liberação de catecolaminas, substâncias que promovem o estreitamento dos vasos, elevando a frequência cardíaca e a pressão arterial. 7 Tabagismo: o fumo pode manter a pressão elevada por até meia hora depois de apagado o cigarro, facilitando as crises de hipertensão. Fonte: Daniela Macedo et al. “Suor, sufoco e susto”. Veja. São Paulo, Editora Abril, 3 fev. 2010, n. 2150, p. 57.

34. A respeito da pressão alta, problema cada vez mais comum em nossa sociedade, julgue os itens abaixo. I. Quando se afere a pressão arterial de uma pessoa, dentro dos padrões de boa saúde, seu valor esperado para sístole é, no máximo, 12 mmHg e para diástole é, no mínimo, 7 mmHg. II. Durante um pico de pressão, quando as paredes do capilar sanguíneo não suportam a força aplicada em uma determinada área, ocorre um acidente vascular, popularmente conhecido como derrame, tendo seu efeito mais devastador quando há alagamento de uma região do encéfalo, causando morte neuronal. III. Ao ingerirmos alimentos ricos em cloreto de sódio, o íon Na+ entra na célula, tornando-a hipertônica em relação ao plasma. Tal diferença de concentração desencadeará uma saída da água do sangue em direção à célula na tentativa de equilibrar a concentração dos dois meios. Por outro lado haverá dificuldade na circulação, uma vez que para um volume menor de líquido existirá o mesmo volume de elementos figurados, os quais poderão se acumular no vaso e formar um trombo.

São verdadeiras as afirmativas a. I e II. b. I e III. c. II e III. d. I, II e III. e. nenhuma.

35. Analise a tabela e assinale a alternativa correta. Linha do tempo da fotossíntese na Terra A fotossíntese desenvolveu-se cedo na história da Terra. Essa precocidade sugere que não se trata de um golpe de sorte e que poderia ser esperada em outros planetas também. Conforme os organismos liberam gases que mudam a condições de iluminação das quais dependem, precisam evoluir para novas cores. Primeiras evidências de oxigênio atmosférico (2,4 bilhões de anos – Ga)

Formação da Terra 4,6 bilhões de anos (Ga)

4 Ga

3 Ga 3,4 Ga

Primeiras bactérias fotossintetizantes: Elas absorviam luz do infravermelho próximo em vez de luz visível e produziam enxofre e compostos sulfúricos em vez de oxigênio. Seus pigmentos (possivelmente bacterioclorofilas) foram os predecessores da clorofila.

Cianobactérias: Essas bactérias abundantes foram as primeiras produtoras de oxigênio. Elas absorvem luz visível usando uma mistura de pigmentos: ficobilinas, carotenoides e várias formas de clorofila.

2 Ga

1 Ga 1,2 Ga

2,7 Ga

Algas vermelhas e marrons: Esses organismos possuem estruturas celulares mais complexas que as bactérias. Como as cianobactérias, elas possuem pigmentos de ficobilinas, assim como várias formas de clorofila.

Algas verdes: Algas verdes são mais eficientes que algas vermelhas e marrons na luz intensa de águas rasas. Elas não necessitam de ficobilinas.

Dias atuais

0,75 Ga

0,475 Ga

Primeiras plantas terrestres: Musgos, liquens, hepáticas e briófitas descendem de algas verdes. Sem estruturas vasculares (caules e raízes) para utilizar a água do solo, elas não conseguem crescer muito.

0,423 – 0,144 Ga

Plantas vasculares: Essas são, literalmente, as plantas de jardim, como samambaias, gramíneas, árvores e cactos. Elas são capazes de produzir grandes copas para capturar mais luz.

Fonte: Nancy Y. Kiang “A cor das plantas em outros mundos”. Scientific American, São Paulo: Duetto, maio de 2008, n. 72. p. 36 e 37.

expoENEM 17


a. As bacterioclorofilas, que absorvem o infravermelho, são encontradas no interior de vesículas membranosas denominadas cloroplastos. b. As Cyanobactérias, juntamente com as bactérias do gênero Rizobium promovem a fixação do N2 atmosférico. c. A superpopulação de algas vermelhas (1,2 Ga) é perigosa no meio aquático devido à ocorrência de um fenômeno denominado maré vermelha, o qual causa a morte dos peixes na competição pelo gás oxigênio. d. Em 0,475 Ga aparecem os liquens, os quais pertencem ao reino Fungi. Tais organismos realizam uma protocooperação entre fungos e algas. e. As plantas vasculares, citadas no quadro em 0,423 Ga, pertencem às Angiospermas, sendo as gramíneas e as samambaias exemplos típicos de monocotiledôneas. 36. Com base nas informações contidas na tabela, assinale a alternativa correta. Drogas no esporte DROGA OU TRATAMENTO

MELHORIA NO TRANSPORTE DE OXIGÊNIO

AUMENTO DE MASSA MUSCULAR E ÓSSEA

CONTROLE DE PESO

DISFARÇAR USO DE DROGAS

ESTIMULAR ENERGIA RÁPIDA

AUXÍLIO NO RELAXAMENTO MASCARAR A DOR

EFEITOS COLATERAIS

Eritropoietina recombinante (r-EPO)

Coágulos sanguíneos, ataque cardíaco, acidente vascular cerebral.

Transfusão de sangue e hemoderivados (dopping de sangue)

Reações alérgicas, dano renal, infecção (HIV, hepatite), sobrecarga circulatória, coágulos sanguíneos, choque metabólico.

Anabolizantes esteroides: androstenediona, testosterona, Winstrol (estanozolol)

Dano hepático, crescimento retardado, desenvolvimento de mamas em homens, mudanças de comportamento, cloracne na parte superior do corpo.

Agonistas beta-2 (especialmente via oral ou injeção): albuterol

Tremores, dor de cabeça, batimento cardíaco acelerado.

Moduladores hormonais: hormônio do crescimento humano (HGH)

Reações alérgicas; pode levar ao diabetes e à acromegalia (aumento de tecidos moles, crescimento de mandíbula, mãos e pés, expansão do crânio).

Agentes antiestrogênico: tamoxifeno

Diversos, como câncer, doença hepática, coágulos sanguíneos.

Diuréticos (para aumentar a taxa de excreção de urina): acetazolamida

Desidratação, câimbras musculares, pedras nos rins, desequilíbrio hidroeletrolítico.

Diuréticos (para diluir a urina)

Ver controle de peso (acima).

Epitestosterona (para mascarar um teste antidopping padrão para testosterona)

Nenhum conhecido.

Anfetaminas Agentes semelhantes à anfetamina: efedrina, ritalina

Aumento de frequência cardíaca, aumento da pressão sanguínea, alucinações, perda de peso, tremores.

Epinefrina

Irregularidade cardíaca, pressão sanguínea alta.

Betabloqueadores: acebutolol, alprenolol, atenolol

Baixa pressão sanguínea, baixa frequência cardíaca.

Narcóticos: morfina, oxicodona

Aumento da resistência à dor, o que leva à incapacidade de reconhecer lesões; dependência; risco de morte por overdose.

As drogas para “melhoria do desempenho” à escolha do atleta são um enorme conjunto de produtos especializados para vários efeitos desejados. Em quase todos os casos, no entanto, o atleta que usa substâncias dopantes pode sofrer desde efeitos colaterais meramente inconvenientes, até aqueles com risco de morte. Esta tabela é apenas ilustrativa, e não uma tentativa de fazer uma lista completa. As drogas cujo nome está escrito em itálico são exemplos específicos de uma determinada categoria.

Fonte: Michael Shemer. “O dilema do dopping”. Scientific American São Paulo, Editora Duetto, maio de 2008, n. 72, p. 75.

a. O HGH é um hormônio produzido nas glândulas suprarrenal e atua nos discos Epifineuros produzindo a divisão celular. b. O ADH (vasopressina) é o hormônio antidiurético, secretado pela adenohipófise, que pode ser bloqueado para disfarçar o uso de drogas. c. Somente duas drogas ou tratamentos levam à formação de coágulos sanguíneos. d. O aumento no número de hemácias (eritropoietina) facilita o transporte de O2, melhorando o rendimento do atleta. e. Em nenhum dos procedimentos mostrados no quadro ocorre a lesão do fígado.

Se ligue! O aumento da população das hemácias pode ser feito por transfusão ou com o auxílio da eritropoetina, estratégia que potencializa o transporte de O2. Os hormônios são substâncias sinalizadoras, transportadas em pequena quantidade pelo sangue, podendo ser de natureza lipídica ou proteica. A glândula hipófise é conhecida como glândula-mãe, pois a maioria dos seus hormônios tem a função de estimular outras glândulas a trabalharem, (processo de feedback). Como hormônios hipofisários podemos citar: GH, FSH, LH, ACTH e Prolactina (Adenohipófise); ADH E Oxitocina (Neurohipofise). O sangue é classificado como uma variedade do tecido conjuntivo, sendo composto por uma parte líquida, denominada plasma (55%) e pelos elementos figurados: hemácias, plaquetas e leucócitos (45%). A hemácia, responsável pelo transporte de gases (principalmente o oxigênio), representa o elemento figurado em maior número. Num indivíduo normal, a quantidade gira em torno de 5 milhões por mm3 de sangue, podendo chegar a 8 milhões onde o ar é rarefeito. Portanto, quanto maior a quantidade desse elemento no sangue, maior a oxigenação da fibra muscular durante o esforço físico.

expoENEM 18


37. Eventos adversos pós-vacinação contra influenza EVENTOS ADVERSOS

TEMPO DECORRENTE APLICAÇÃO/EVENTOS

DESCRIÇÃO

FREQUÊNCIA

CONDUTA

OBSERVAÇÃO

10 – 64% dos vacinados

Notificar e investigar abscesso quente e reações locais muito extensas com limitações de movimento. Administrar analgésicos se necessário.

Não contraindica doses subsequentes. Eventos locais graves devem ser avaliados.

Eventos locais

Dor local Eritema Enduração

1 – 2 dias após a vacinação; duração máxima de 48 horas

Eventos sistêmicos

Febre Mialgias Cefaleia Sintomas flulike leves

6 – 12 horas após a vacinação; duração máxima de 48 horas

Tratamento sintomático. Afastar outros diagnósticos.

Não há contraindicação formal para doses subsequentes.

Reações anafiláticas

Urticárias, sibilos, laringoespasmo, hipertensão arterial e choque

Menos de 2 horas após a aplicação da vacina

Tratamento rápido e adequado

Contraindicação formal para doses subsequentes.

Síndrome de Guillain-Barré (SGB)

Polirradiculoneurite com lesão de desmielinização, parestesias e deficit motor ascendente de intensidade variável

7 – 21 dias até 6 semanas após a vacinação

Notificar e investigar. Acompanhamento especializado

Avaliar risco-benefício da revacinação.

Disponível em: <http://portal.saude.gov.br/portal/saude/profissional/area.cfm?id_area=1534>

Diante da pandemia da influenza A, que atingiu nossa sociedade em 2009, governantes de todos os países tiveram que adotar medidas de controle e combate à gripe. Entre as medidas estavam a vigilância das fronteiras, a capacitação de profissionais da área da saúde, a conscientização da população e a vacinação, tendo sido esta última realizada no primeiro semestre de 2010. A vacina desenvolvida para esta cepa do vírus utilizou o antígeno atenuado a fim de estimular a resposta de nosso sistema imunológico à doença.

Diante do exposto, julgue os itens abaixo:

A leucemia é uma doença maligna dos glóbulos brancos (leucócitos) de origem, na maioria das vezes, não conhecida. Ela tem como principal característica o acúmulo de células jovens (blásticas) anormais na medula óssea, que substituem as células sanguíneas normais. A medula, local de formação das células sanguíneas, ocupa a cavidade dos ossos (principalmente esterno e bacia) e é conhecida popularmente por tutano. Nela são encontradas as células-mães ou precursoras, que originam os elementos figurados do sangue: glóbulos brancos, glóbulos vermelhos (hemácias ou eritrócitos) e plaquetas.

I. Mesmo enfraquecido, o vírus inoculado é reconhecido pelo corpo como um agente estranho, desencadeando uma reação de defesa do sistema imunológico, essencial para que seja criada a “memória” das proteínas do vírus, mas responsável pelas reações locais e sistêmicas.

Disponível em: <http://www.inca.gov.br/conteudo_view.asp?id=344>.

I. Devido ao acúmulo de células blásticas, a produção das células do sangue fica prejudicada, causando anemia (falta de glóbulos vermelhos), baixa imunidade e exposição a infecções (falta de glóbulos brancos) e hemorragias (falta de plaquetas).

II. As reações alérgicas apontadas na tabela se dão, em grande parte, pela proteína do ovo presente na vacina em decorrência de seu modo de produção. Diante disso, pessoas sensíveis a ovo não podem ser imunizadas com as vacinas de gripe existentes hoje.

II. Como não se trata de uma doença contagiosa, o paciente pode ter contato livre com qualquer pessoa, não havendo necessidade de isolamento.

III. Nenhuma das reações adversas apontadas na tabela impede que o paciente receba, se necessário, outra dose da vacina.

III. Doentes de diferentes idades requerem tipos de tratamentos específicos a cada caso; crianças e idosos, naturalmente mais sensíveis, não podem ser expostos a métodos muito agressivos. Também se enquadram como pacientes especiais aqueles que apresentam alguma outra doença grave.

Estão corretas as afirmativas a. I e II. b. I e III.

c. II e III.

São verdadeiras:

d. I, II e III.

a. I e II.

e. nenhuma.

b. I e III. c. II e III.

38. Considerando os dois fragmentos de texto, julgue os itens.

d. somente I. e. somente III.

Atriz Drica Moraes é diagnosticada com leucemia

Texto base para a questão 39.

A atriz Drica Moraes, 40, que está internada desde a última quarta--feira no hospital Samaritano, no Rio, foi diagnosticada com leucemia, confirmou seu assessor. Segundo ele, a doença foi descoberta durante uma bateria de exames realizada após a atriz se sentir mal. Ela está internada em um quarto comum, onde recebe a visita de familiares e amigos. Drica agora irá passar por novos exames para definir a que tipo de tratamento irá se submeter. Disponível em: <http://www1.folha.uol.com.br/folha/ilustrada/ult90u693292.shtml>.

O que é lúpus? Lúpus é uma doença rara, mais frequente nas mulheres do que nos homens, provocada por um desequilíbrio do sistema imunológico, exatamente aquele que deveria defender o organismo das agressões externas causadas por vírus, bactérias ou outros agentes. No lúpus, a defesa imunológica se vira contra os tecidos do próprio organismo como pele, articulações, fígado, coração, pulmão, rins e cérebro. Essas múltiplas formas de manifestação clínica, às vezes, confundem o diagnóstico. Lúpus exige tratamento cuidadoso por médicos

expoENEM 19


b. A hipótese mais aceita é que os humanos modernos surgiram na África, possivelmente a partir do Homo ergaster, e depois se irradiaram para as diversas partes do mundo.

especialistas. Pessoas tratadas adequadamente têm condições de levar vida normal. As que não se tratam acabam tendo complicações sérias, às vezes, incompatíveis com a vida.

c. O homem moderno pertence à espécie Homo neanderthalensis.

• Drauzio – O lúpus eritematoso é uma doença de autoagressão, uma doença autoimune. Quais as principais características da doença autoimune?

d. Fazendo uma análise da filogenia dos primatas, a espécie humana está mais próxima evolutivamente dos macacos do Velho Mundo do que dos chimpanzés.

Samuel Kopersztych – A doença autoimune é fundamentalmente caracterizada pela formação de autoanticorpos que agem contra os próprios tecidos do organismo. Por isso, o nome autoagressão, às vezes, é mais feliz. O paciente, geralmente do sexo feminino, fabrica substâncias nocivas para seu organismo. O anticorpo, que é um mecanismo de defesa, passa a ser um mecanismo de autoagressão nessas pacientes. Portanto, o que caracteriza a doença autoimune é a formação de anticorpos contra seus próprios constituintes.

e. Uma das espécies mais conhecidas de australopitecos é o Australopithecus afarensis chamado “Lucy”, em alusão à canção dos Beatles Lucy in the sky with diamonds. Seu esqueleto fóssil foi encontrado no Estreito de Bering. Tá ligado? Durante a copa da África do Sul, várias redes de televisão veicularam matérias sobre o surgimento do homem, que pertence à espécie Homo sapiens. A hipótese mais aceita é que os humanos modernos surgiram na África, na Era Cenozoica, possivelmente a partir do Homo ergaster, e depois se irradiaram para as diversas partes do mundo. O esqueleto fóssil do Australopithecus afarensis chamado “Lucy”, em alusão à canção dos Beatles Lucy in the sky with diamonds, foi encontrado na Etiópia.

• Drauzio – Teoricamente, esses anticorpos podem agredir qualquer tipo de tecido e provocar as mais variadas doenças? Samuel Kopersztych – Eles podem agredir qualquer tipo de território. De modo geral, a maior agressão ocorre no núcleo da célula, graças ao aparecimento de vários autoanticorpos contra substâncias presentes em seu interior. Entretanto, o mais importante não é o anticorpo isoladamente. Do ponto de vista anatomopatológico, o que define a autoimunidade nos tecidos é a formação dos chamados complexos imunes. Fonte: <http://www.drauziovarella.com.br/ExibirConteudo/919/lupus>

39. Em 2010, Lady Gaga, cantora pop de grande destaque no cenário mundial, anunciou sofrer de lúpus, doença descrita pelo doutor Drauzio Varella e pelo especialista Samuel Kopersztych. Com base nas explicações, assinale a alternativa verdadeira. a. Por não ter cura, o doente de lúpus não sobrevive mais do que alguns anos após o início do desenvolvimento da doença. b. O lúpus é uma doença que ataca especificamente o tecido conjuntivo em suas várias versões.

41. Em muitas empresas e residências, são utilizadas as chamadas “garrafas térmicas”, conhecidas no meio científico como vasos de Dewar, com a finalidade de impedir a perda de calor de líquidos em seu interior, mantendo a temperatura praticamente constante por algum tempo. O calor pode ser transmitido basicamente por condução, convecção ou irradiação. Na condução, o calor é transmitido ao longo de um meio material; na convecção, é transmitido por diferença de densidade em meios fluidos; na irradiação, transmite-se por meio de ondas eletromagnéticas. Constitui-se normalmente por duas paredes de vidro, com vácuo entre as duas partes, superfícies interna e externa espelhadas, tampa de boa vedação e revestimento externo protetor.

c. No caso de uma doença autoimune, as células do corpo passam a ser consideradas antígenos.

tampa

d. A diabetes tipo II também é uma doença autoimune, pois o corpo não reconhece as células do pâncreas que produzem insulina e passa a atacá-las.

vácuo

e. Por estar ocupado em atacar os próprios tecidos, o corpo deixa de se defender de outras patologias, podendo ocorrer o óbito do doente por uma doença aproveitadora.

parede dupla de vidro espelhado

40. Com base no texto a seguir e nos seus conhecimentos sobre evolução humana, marque a alternativa correta.

líquido

Antropologia O que se sabe sobre o habitante mais antigo do território que mais tarde seria chamado de África do Sul vem de teorias de antropólogos, que o chamam de hominídeo, precursor de espécies mais evoluídas como o Homo habilus, Homo erectus e Homo sapiens. Em 1947, fósseis de hominídeos de três milhões de anos de idade foram descobertos nas cavernas Sterkenfontein Caves, perto de Krugersdorf, a oeste de Joanesburgo.

O homem moderno apareceu no cenário há três mil anos. O povo africano Khoisan, que vivia na região norte de Botsuana, abriu mão da caça para criar gado, atividade que os outros africanos já estavam aprendendo. Eles chamavam a si mesmos de Khoikhoi, o que significa homens dos homens, e se referiam aos que permaneceram caçadores como San. Não havia fronteiras naquela época e os dois grupos, Khoikhoi e San, povoaram as terras. Fonte: <http://www.africadosul.org.br/?pg=historia>

a. O surgimento do homem moderno ocorreu na Era Mesozoica no Período Triássico, juntamente com os dinossauros. expoENEM 20

Assinale a única alternativa correta a respeito das formas utilizadas para impedir a perda de calor de líquidos no interior de uma garrafa térmica. a. O vácuo entre as paredes de vidro dificulta a perda de calor por irradiação. b. A tampa com boa vedação impede a perda de calor por irradiação. c. A superfície interna espelhada impede a perda de calor por irradiação. d. O vácuo impede o líquido de ganhar frio do meio externo. e. As paredes são constituídas de vidro por ser este um material de alto coeficiente de condutibilidade térmica, impedindo assim a saída de calor por condução.


Tá ligado? • O calor não se propaga no vácuo, pois necessita de um meio material para sua propagação. • A tampa com boa vedação impede a saída de calor por convecção. • Ondas eletromagnéticas são refletidas por superfícies espelhadas. A transmissão de calor por irradiação pode ser dificultada por superfícies espelhadas que refletem as “ondas de calor” (infravermelho). • Para a Física, frio é apenas uma sensação térmica, portanto não se fornece nem se recebe frio. É possível apenas receber ou fornecer calor. • O vidro apresenta baixa condutibilidade térmica, pois conduz o calor com dificuldade, comparado à maioria dos materiais.

42. Um assunto que gerou grande interesse por parte dos brasileiros foi a descoberta de uma possível reserva de petróleo no litoral do país, a chamada “camada pré-sal”. A seguir, é apresentada uma reportagem sobre esse assunto. De acordo com os dados do texto, assinale a única alternativa que contém uma afirmativa verdadeira a respeito desse assunto. Entenda o que é a camada pré-sal A chamada camada pré-sal é uma faixa que se estende ao longo de 800 quilômetros entre os estados do Espírito Santo e de Santa Catarina, abaixo do leito do mar, e engloba três bacias sedimentares (Espírito Santo, Campos e Santos). O petróleo encontrado nesta área está a profundidades que superam os 7 mil metros, abaixo de uma extensa camada de sal que, segundo geólogos, conserva a qualidade do petróleo (veja figura abaixo). Vários campos e poços de petróleo já foram descobertos no pré-sal, entre eles o de Tupi, o principal. Há também os nomeados Guará, Bem-Te-Vi, Carioca, Júpiter e Iara, entre outros.

As descobertas da camada pré-sal na bacia de Santos Governo quer mudar a forma de exploração no pré-sal cerca de 2 km

RJ

Leito do oceano

SP

Rio de Janeiro

Blocos do pré-sal

Parati Oceano Atlântico

Brasil

Camadas em área ultraprofunda, que fica entre 7 000 e 8 000 metros abaixo do leito do mar, depois de uma camada de sal.

Camada pós-sal

ES

BM–S–42 SP

RJ

PR

Sal

BM–S–50

de 7 km a 8 km

Iara e Tupi

Corcovado

SC A camada se estende por uma faixa de 800 Km, que vai do litoral de Santa Catarina ao do Espírito Santo.

Júpiter

Bem-Te-Vi Guará e Carioca

Camada pré-sal

BM–S–17

Petróleo

Caramba

BM–S–22

Gás

Folha Online Disponível em: <http://www1.folha.uol.com.br/folha/dinheiro/ult91u440468.shtml>. Acesso em: 16 ago. 2010.

(Dados: densidade da água do mar = 1 g/cm3; aceleração da gravidade = 10 m/s2; pressão atmosférica = 105 Pa; 1 atm = 105 Pa.) a. A camada pós-sal encontra-se sob pressão maior que a camada pré-sal. b. Segundo os dados da figura, em relação ao nível do mar, a perfuração da camada sólida deve se iniciar a 7 000 m de profundidade. c. De acordo com o perfil indicado pela figura, a pressão no leito do oceano é de 201 atm. d. A pressão no leito do oceano é maior que a pressão na camada de sal. e. A plataforma que flutua sobre a superfície do oceano se encontra sob pressão nula. expoENEM 21


43. O planeta Terra é constantemente bombardeado por ondas eletromagnéticas de alta frequência, entre elas as que se originam na superfície do Sol, em função de reações nucleares. São ondas muito perigosas para o organismo humano em caso de contato direto. A seguir, um texto trata desse tipo de onda, mas que tem origem diferente do Sol.

Caso as polias dos comandos de válvulas (indicação na figura) mantenham movimento constante, realizando 20 voltas por segundo, determine a indicação do conta-giros do automóvel. a. 1 200 rpm b. 2 100 rpm c. 2 400 rpm

Explosão de raios X de intensidade recorde cega observatório espacial Fenômeno foi milhares de vezes mais intenso que a maior fonte de raios X conhecida no espaço

d. 3 200 rpm e. 4 800 rpm

O feixe de raios X mais brilhante já detectado vindo de fora da região da Via Láctea cegou, temporariamente, a câmera do Observatório Espacial Swift, da Nasa, informam astrônomos.

Tá ligado? • Polias acopladas pela mesma correia apresentam a mesma velocidade linear. • Polias acopladas pelo mesmo eixo giram com a mesma frequência.

Os raios X viajaram pelo espaço por 5 bilhões de anos antes de atingir e sobrecarregar o telescópio de raios X do Swift, em 21 de junho. O feixe de radiação veio de uma explosão de raios gama, uma violenta erupção de energia gerada pela transformação de uma estrela em buraco negro. “Esta explosão de raios gama é, de longe, a mais brilhante fonte de luz nos comprimentos de onda dos raios X já vista a distâncias cosmológicas”, disse, em nota, David Burrows, principal cientista encarregado do telescópio de raios X do Swift. “A explosão foi tão brilhante que quando irrompeu nosso software de análise de dados desligou-se”, disse Phil Evans, que criou partes da programação do satélite. “Havia tantos fótons bombardeando o detector a cada segundo que ele simplesmente não era capaz de contá-los com velocidade suficiente”. Disponível em: <http://www.estadao.com.br/noticias/vidae,explosao-de-raios-x-de-intensidade-recorde-cega-observatorio-espacial,581125,0.htm>. Acesso em: 16 ago. 2010.

45. As fibras ópticas são tubos flexíveis de quartzo fundido que apresentam um ângulo limite em torno de 43º. São muito utilizadas na transmissão de dados por meio de ondas eletromagnéticas, que no interior da fibra atingem suas paredes com ângulos superiores ao limite, sendo refletidos e assim carregando os dados ao longo desse meio. O mesmo fenômeno que permite transmitir dados pelas fibras ópticas é responsável pelo intenso brilho em diamantes, que apresentam baixo ângulo limite, em torno de 24º. Os raios de luz que penetram no interior de um diamante convenientemente lapidado sofrem múltiplas reflexões internas, proporcionando o brilho conhecido.

O motivo principal pelo qual esses materiais são capazes de proporcionar, com relativa facilidade, a ocorrência do fenômeno conhecido como reflexão total deve-se a. à sua alta transparência.

Essas ondas, altamente nocivas aos seres humanos, são desviadas das regiões mais povoadas para outras regiões, gerando o fenômeno que se conhece como aurora boreal. Essa proteção natural do planeta Terra, em relação a essas ondas eletromagnética, deve-se

b. à sua cor opaca. c. ao seu espelhamento natural. d. ao seu alto índice de refração.

a. ao potencial elétrico gerado pela Terra.

e. ao seu alto poder de absorção.

b. ao campo magnético gerado pela Terra.

c. à atmosfera mais densa em regiões mais populosas.

Leia com atenção o texto a seguir. Ele serve de base para as questões 46 e 47.

d. à poluição da atmosfera, que reflete tais ondas. e. ao efeito estufa. 44. Na figura, há o desenho do perfil de um motor de automóvel, em que a correia dentada faz a transmissão de movimento entre várias polias. As duas polias localizadas na parte de cima apresentam o mesmo diâmetro, igual a 20 cm, e a polia inferior, que tem diâmetro de 10 cm, gira com a mesma frequência que o virabrequim do motor. referências para sincronismo vista geral da correia dentada

Trata-se de uma bobina enterrada debaixo do asfalto, exatamente nas faixas em que passam os carros. A bobina é dupla e detecta a presença de um material ferromagnético, ou seja, um veículo. A distância entre as bobinas dividida pelo tempo de passagem do carro entre elas aponta a velocidade do veículo. Se esta for superior à velocidade registrada na memória do computador, o flash dispara e uma foto da placa do carro é tirada.

polias dos comandos de válvulas

tensor de correia (esticador)

Existe também o radar portátil. Este, sim, é um radar de verdade, que mede a velocidade dos veículos por meio de um fenômeno físico natural chamado de Efeito Doppler. O físico austríaco Christian Doppler (1803–1853) descreveu esse efeito, em que o comprimento de onda observado é maior ou menor conforme sua fonte se afaste ou se aproxime do observador.

referência para sincronismo engrenagem do virabrequim

Nas grandes cidades, é cada vez maior o número de sensores que medem a velocidade de automóveis, conhecidos como radares fixos. Já em rodovias que ligam uma cidade a outra, é comum a utilização de medidores de velocidade conhecidos como radares móveis ou portáteis. A seguir, há um texto que descreve de forma sucinta o funcionamento desses dispositivos. O “radar” usado nas cidades não é, na verdade, um radar, mas um sensor localizado no chão trabalhando em conjunto com uma câmera digital e um flash.

O conta-giros de um automóvel indica a frequência que gira o virabrequim do motor. Considere que a engrenagem do virabrequim indicada na figura esteja diretamente ligada ao eixo também do virabrequim.

Podemos perceber isso no nosso cotidiano: quando estamos parados ao lado de uma estrada e passa uma ambulância com a sirene ligada, notamos que enquanto ela se aproxima de nós o som é mais agudo e enquanto ela se afasta o som é mais grave.

expoENEM 22


O modelo matemático baseado nessa constatação é usado no radar: este envia um sinal de rádio na direção do veículo e depois capta a reflexão (nesse veículo) do sinal, que retorna ao aparelho com uma frequência diferente, proporcional à velocidade do carro. Um sistema eletrônico no radar mede essa frequência e calcula, com base no valor obtido, a velocidade do veículo.

O eclipse solar acontece quando o Sol e a Lua se alinham com a Terra. O efeito durou pouco menos de cinco minutos na Ilha de Páscoa. Antes do acontecimento, o tempo estava nublado, mas pouco antes do eclipse, as nuvens se dissiparam, deixando o céu azul à mostra. O momento mais longo do elipse, de quase cinco minutos e meio, aconteceu no meio do oceano.

Marcelo Martins Werneck Departamento de Eletrônica, Escola Politécnica, UFRJ. Disponível em: <http://cienciahoje.uol.com.br/revista-ch/ revista-ch-2009/257/como-funcionam-os-radares-de-transito>. Acesso em: 16 ago. 2010.

46. No caso dos radares fixos utilizados nas cidades, considerando que a distância entre as bobinas é de 80 cm, qual é a indicação da velocidade obtida por esse dispositivo para um automóvel que demore 0,032s para percorrer essa distância?

Disponível em: <http://noticias.uol.com.br/bbc/2010/07/11/milhares-veem-eclipse-total-na-ilha-de-pascoa.jhtm>. Acesso em: 16 ago. 2010.

Assinale a alternativa que indica a localidade em que se presencia o eclipse total do Sol e a fase da Lua em que esse fenômeno ocorre. a. O eclipse total do Sol é observado na região de sombra formada por Marte na superfície da Terra, e ocorre na fase de lua cheia.

a. 20 km/h

b. O eclipse total do Sol é observado na região de sombra formada pela Terra na superfície da Lua, e ocorre na fase de lua nova.

b. 40 km/h c. 60 km/h

c. O eclipse total do Sol é observado na região de sombra formada pela Lua na superfície da Terra, e ocorre na fase de lua nova.

d. 72 km/h

d. o eclipse total do Sol é observado na região de sombra formada pela Lua na superfície da Terra, e ocorre na fase de lua cheia.

e. 90 km/h 47. No caso dos radares móveis, o sinal de rádio enviado na direção de um veículo que se aproxima do radar retorna por reflexão com frequência diferente da emitida. Esse sinal captado pelo radar, quando comparado ao sinal emitido, apresenta a. maior velocidade de propagação.

e. O eclipse total do Sol é observado na região de sombra formada pela Terra na superfície da Lua, e ocorre na fase de lua cheia. 50. Note no texto a seguir a imensa quantidade de conhecimento científico que ainda existe para explorar e compreender.

b. menor velocidade de propagação. c. maior frequência.

Por que ruiu? A Ponte de Minneapolis foi inspecionada e estava dentro das normas americanas. Agora, o desastre que matou pelo menos cinco pessoas obriga a uma revisão de padrões de segurança

d. menor frequência. e. maior comprimento de onda.

© Agência Brasil

48. Em uma residência, os maiores gastos com energia elétrica se devem basicamente a quatro aparelhos elétricos: um chuveiro elétrico de 5 000 W de potência, um forno micro-ondas de 1 000 W, um condicionador de ar de 2 000 W e um ferro de passar roupa de 1 000 W. Considere que, em média, o valor pago pelo consumo desses quatro dispositivos seja de R$ 150,00 por mês. Na tentativa de economizar, o dono da residência realiza a troca desses quatro equipamentos, comprando um chuveiro de 3 500 W, um forno de micro-ondas de 700 W, um condicionador de ar de 1 000 W e um ferro de passar roupa de 800 W. Supondo que o tempo de utilização dos aparelhos e o valor de kWh continuem os mesmos, determine a economia mensal causada por essas substituições. a. R$ 15,00 b. R$ 20,00 c. R$ 30,00 d. R$ 40,00 e. R$ 50,00 49. O eclipse solar é um fenômeno que ocorre com frequência em diferentes localidades da Terra. Em alguns locais, ocorre o eclipse total, ao passo que em outros o eclipse do Sol é parcial. A manchete a seguir é uma comprovação de que, quando há um eclipse total do Sol, ele ocorre apenas em uma determinada região da Terra. Milhares de turistas e cientistas assistiram neste domingo a um eclipse solar total na Ilha de Páscoa, na costa do Chile, famosa por suas misteriosas estátuas. O único fenômeno do tipo deste ano pôde ser visto apenas de algumas ilhas do Pacífico Sul, a partir das 15h15min (de Brasília). Ele chegou à Ilha de Páscoa às 17h11min, antes de terminar em algumas regiões no sul da Argentina e do Chile. A população da ilha chilena dobrou por causa do eclipse solar, chegando a 8 mil pessoas, mas, desde cedo, o tempo nublado já dava mostras de que o espetáculo não seria completo.

Desastre: carros em cima dos escombros da ponte sobre o Rio Mississipi. Falha estrutural fez com que a ponte ruísse inteiramente.

Não é uma imagem que se associe aos Estados Unidos. Equipes de resgate tentando salvar vidas no país mais rico e poderoso do mundo são normalmente vistas quando os inimigos dos EUA ou as catástrofes naturais se abatem sobre o país. Minneapolis, porém, viu um cenário mais complicado. Uma ponte de metal que cruzava o Rio Mississipi caiu no início da noite da quarta-feira. Pelo menos cinco pessoas morreram quando cerca de 50 carros que estavam na ponte caíram no rio ou se misturaram aos escombros 19 metros abaixo do nível da ponte. Os hospitais trataram 79 feridos, alguns em estado grave. Não houve ataque terrorista. Não houve tremor de terra. Não houve condições climáticas extremas. A ponte estava dentro dos padrões de segurança adotados nos EUA, supostamente os mais científicos e rigorosos do mundo, e passava por inspeções regulares. Mesmo assim caiu.

expoENEM 23


A cada queda de ponte nos EUA os técnicos vêm aprendendo algo novo. Em novembro de 1940, a ponte sobre o Estreito de Tacoma, no Estado de Washington, caiu espetacularmente por ter entrado em estado de oscilação com a ação do vento. Ela vibrou como uma corda de um instrumento musical até arrebentar. Por causa desse acidente, foram introduzidas exigências em relação à aerodinâmica na construção de pontes. Revista Época Disponível em: <http://revistaepoca.globo.com/Revista/Epoca/0,,EMI57740-15227,00POR+QUE+RUIU.html>. Acesso em: 16 ago. 2010.

remoto comum gasta de 40 a 100 microwatts. A energia produzida pela a vibração é convertida em energia elétrica por um gerador de indução eletromagnética localizado dentro da pilha. Revista Galileu Disponível em: <http://revistagalileu.globo.com/Revista/Common/0,,EMI15559217770,00-PILHA+RECARREGA+COM+CHACOALHAO.html>. Acesso em: 16 ago. 2010.

Qual é a sequência de transformações de energia que ocorrem ao se chacoalhar essas pilhas e, em seguida, colocá-las em um controle remoto que passa a ser utilizado após alguns instantes, emitindo ondas de infravermelho para ligar o televisor?

O fenômeno ondulatório responsável pelo ocorrido na ponte do Estreito de Tacoma nos Estados Unidos é o mesmo que se encontra em um veículo que começa a vibrar conforme a frequência de giro do motor. Esse fenômeno físico é denominado

a. Cinética – química – elétrica – radiante

a. eco.

d. Mecânica – elétrica – química – nuclear

b. dispersão.

e. Mecânica – química – sonora – elétrica

b. Potencial – magnética – sonora – luminosa c. Cinética – magnética – mecânica – potencial

c. refração. d. ressonância.

Se ligue!

e. polarização.

• Energia mecânica pode ser entendida como aquela capaz de gerar movimento ou de ser associada a um corpo já em movimento. Entre as energias do tipo mecânica podem-se destacar: energia cinética, potencial gravitacional e potencial elástica. • Energia química pode ser entendida como aquela obtida ou armazenada por meio de reações químicas. • Energia radiante pode ser considerada aquela transmitida por ondas eletromagnéticas. • Energia sonora é um tipo de energia mecânica. • Energia luminosa é um tipo de energia. • Energia nuclear pode ser entendida como aquela armazenada no núcleo de átomos, liberada a partir deles.

51. Um tenista, ao encordoar sua raquete, escolhe cuidadosamente a tensão que irá colocar em suas cordas, pois caso estejam muito frouxas, as bolas rebatidas saem com velocidade alta e não se tem o controle da direção que se quer dar à bola; caso estejam muito esticadas, as bolas rebatidas saem da raquete com velocidade abaixo da desejada.

O mesmo fato ocorre ao se chutar uma bola de futebol. Quando muito cheia, ela sai com velocidade menor se comparada à velocidade adquirida com ela um pouco menos inflada.

Assinale a alternativa que explica corretamente o motivo pelo qual a velocidade da bola de futebol é maior no caso de ela estar um pouco menos inflada. a. A bola menos inflada proporciona maior tempo de contato da força aplicada pelo chute, gerando maior impulso. b. A bola menos inflada proporciona menor tempo de contato da força aplicada pelo chute, gerando maior impulso. c. A bola menos inflada proporciona menor resistência à força aplicada pelo chute, gerando maior impulso. d. A bola menos inflada proporciona volume menor, criando menor resistência, gerando maior impulso.

53. Os sons são parte integrante do cotidiano. Mesmo em locais tranquilos, como em uma casa de campo, é possível escutar o som produzido pelos insetos ou pelas folhas das árvores. Além da comunicação, os sons são utilizados para tranquilizar ou motivar as pessoas, fazendo-as ouvir um ou mais instrumentos musicais. O texto a seguir trata justamente da evolução desses instrumentos.

e. A bola menos inflada proporciona menor atrito dinâmico, gerando energia cinética adicional que aumenta a velocidade.

Perde-se no fundo dos milênios a época em que o primeiro homem bateu numa pele de animal esticada à boca de um tronco e produziu uma nota grave. Não se pode precisar a data em que esse evento ocorreu, mas ele teria profunda influência em toda a história da civilização. O motivo, muito simples, é que desde então se descobriu como fazer vibrar o ar por meio de uma peça mecânica – a pele esticada, nesse caso. E tais vibrações são a matéria-prima essencial daquilo que se aprendeu a chamar de arte da música. Daí para a frente, embora ainda não conhecessem a ciência dos seus instrumentos, músicos e artesãos deram largas asas à imaginação na busca de meios cada vez mais sofisticados para gerar sons. Surgiram estreitos entalhes em caniços ocos, nas flautas; as placas finas e chatas de bambu, nas clarinetas e saxofones; ou as cordas percutidas, nos pianos.

52. O crescente aumento de inovações tecnológicas vem exigindo cada vez mais a necessidade de energia, dos tipos elétrica, química, nuclear, térmica, solar, entre outras. A principal característica da energia é sua conservação. Ela não pode ser criada, não pode ser eliminada, somente transformada. Então, quando se necessita de certa quantidade de energia, ela deve ser obtida por meio de transformações a partir de outra forma já existente. O texto a seguir trata de um equipamento que realiza esse tipo de transformação. Pilha recarrega com “chacoalhão” A empresa japonesa Brother Industries inventou um novo tipo de pilha recarregável – basta um chacoalhão e ela está pronta para ser usada novamente. Na verdade, trata-se de um gerador que produz energia a partir da vibração, no formato de pilhas AA ou AAA. Segundo o site Tech-On, a intenção é acabar com a grande quantidade de lixo tóxico produzido pelo descarte das pilhas comuns.

Flávio Dieguez e Marcelo Affini Disponível em: <http://super.abril.com.br/tecnologia/sons-gerados-circuitos-eletronicos-equacoes-sonoras-440122.shtml>. Acesso em: 16 ago. 2010.

A pilha foi feita para aparelhos que consomem pouca energia. Por exemplo, quando a bateria do controle remoto acabar, é só chacoalhar o controle para poder voltar a usá-lo. Ela poderá ser usada em aparelhos que não precisem ficar ligados durante a maior parte do tempo e que consumam até 100 microwatts de energia – um controle expoENEM 24

Segundo o texto, é comum a utilização de placas finas e chatas de bambu em clarinetas e saxofones. De que maneira essas placas auxiliam na produção de som? a. Ao soprar de modo adequado, as placas passam a vibrar, entrando em ressonância com o ar no interior das clarinetas e saxofones, produzindo som.


b. Ao soprar o tubo, as placas desviam o ar para uma câmara separada da entrada, que sofre interferência construtiva ao entrar em contato com o ar que se encontra em seu interior, produzindo assim o som.

d. Antes da cirurgia: utiliza uma lente corretiva de -2,5 dioptrias. Após a cirurgia: o cristalino passa a ter vergência menor que a anterior. e. Antes da cirurgia: utiliza uma lente corretiva de -5 dioptrias. Após a cirurgia: o cristalino passa a ter vergência menor que a anterior.

c. Ao soprar o tubo, as placas vibram, polarizando o ar em seu interior e produzindo o som. d. Ao soprar o tubo, as placas desviam o som para um dos lados do tubo, causando uma turbulência local que acaba provocando uma interferência destrutiva, produzindo assim o som. e. Ao soprar o tubo, as placas refletem o ultrassom gerado pelo contato com o bambu, sofrendo difração com o ar que se encontra em seu interior.

55. A produção de energia elétrica na maioria dos casos é feita distante dos grandes centros consumidores desse produto. Neste caso, a energia deve ser encaminhada por linhas de transmissão, os chamadas “fios de alta tensão”, frequentemente vistos ao longo de estradas. A seguir, há um texto que explica de forma sucinta como essa energia é transmitida.

54. As anomalias visuais, tais como miopia, astigmatismo, hipermetropia, presbiopia, daltonismo e estrabismo, são bastante comuns em grande parte da população mundial. A ciência evoluiu muito na tentativa de buscar formas de correção cada vez mais eficientes. O texto a seguir mostra esse avanço, em particular para a miopia, que entre as citadas é a mais comum.

Como se distribui a energia elétrica em uma cidade? 1. Independentemente do tipo de usina (hidrelétrica, nuclear, eólica etc.), em geral, a energia nasce da rotação de um gerador. Um ímã gira dentro de outro e daí surge uma corrente elétrica alternada. A diferença é que, na hidrelétrica, o que move o gerador é água; na eólica, vento; na nuclear, radiação...

Como é a cirurgia de correção da miopia?

2. Aumento de tensão. A energia sai da usina direto para uma subestação de transmissão, onde ela passa por um transformador. Esse equipamento tem a propriedade de mudar (ou transformar) a tensão elétrica para mais ou para menos. Aqui, ele faz a tensão subir dos 6 600 volts com que sai da usina para 345 mil volts.

Com um laser, o médico modela o cristalino – a lente que fica bem na frente dos nossos olhos –, deixando-o mais plano. Assim, a imagem se forma exatamente sobre a retina, o que não acontece no olho míope. O mesmo laser também pode ser usado para corrigir a visão de pacientes com hipermetropia e astigmatismo – a diferença é o local do cristalino onde o laser atua. Cirurgias de correção de miopia começaram a ser feitas nos anos de 1970, mas, na época, o paciente literalmente entrava na faca: com uma lâmina e muita habilidade manual, o médico cortava a córnea como uma pizza, deixando o centro livre. “Esse método causava uma ação exagerada: o paciente ia perdendo grau até chegar ao zero e depois começava a desenvolver a hipermetropia”, diz o oftalmologista Élcio Sato, da Universidade Federal de São Paulo (Unifesp). Com o laser, a cirurgia ficou mais precisa e muito menos dolorosa, ainda mais depois que os médicos deixaram de aplicar a luzinha na parte externa do olho. Isso aconteceu em 1989, com a invenção do método Lasik – o mais usado hoje –, que abre uma tampinha no globo ocular para trabalhar direto na córnea, reduzindo as dores após a cirurgia. Mas o método ainda não é infalível. “De 100 pacientes operados, conseguimos reverter completamente a deficiência em 90. Nos outros 10, sobra algum grau”, diz Élcio. Isso acontece porque a cicatrização e a resposta do cristalino ao laser podem variar de pessoa para pessoa. Aliás, não é qualquer um que pode encarar o laser: córneas muito finas, olhos muito secos, idade inferior a 21 anos (época em que o grau costuma se estabilizar) e doenças oculares são características que impedem a cirurgia.

3. A eletricidade segue seu caminho para as cidades por uma rede de alta tensão. Viajando por centenas de quilômetros de fios, parte da energia é perdida sob a forma de calor e a tensão cai. É para compensar a queda de tensão que a eletricidade sai da subestação anterior em altíssima voltagem. 4. Diminuição de tensão. Próximo às cidades, há subestações de distribuição, onde a tensão é rebaixada primeiro para 138 mil volts e, em seguida, em outro transformador, para 13 800 volts. É nessa tensão que a energia é encaminhada para as casas, mas parte dela segue para indústrias antes do segundo rebaixamento. 5. Diminuição de tensão. As indústrias consomem quase metade da energia produzida no Brasil. A maior parte do consumo está concentrada em empresas de grande porte, que recebem a eletricidade em 138 mil volts. Geralmente, elas têm suas próprias subestações, com transformadores que alteram a tensão elétrica conforme a necessidade.

Artur Louback Lopes Disponível em: <http://mundoestranho.abril.com.br/saude/pergunta_287348.shtml>. Acesso em: 16 ago. 2010.

Diminuição de tensão. A distribuição para residências é dividida em regiões. Cada circuito de 13 800 volts que sai da subestação atende de 5 mil a 10 mil lares. Entre a subestação e as casas, esse circuito passa por mais um transformador, instalado em um poste, e a tensão finalmente cai para os conhecidos 110 e 220 volts.

6. Antes de chegar às tomadas da sua casa, contudo, a energia ainda passa por um quadro de luz, onde fica o “relógio”, equipamento instalado pela fornecedora de energia para medir o consumo mensal em cada lar.

Sabendo que uma pessoa antes da cirurgia, sem o auxílio de qualquer dispositivo de correção, enxerga com nitidez até uma distância máxima de 40 cm, qual é a vergência da lente corretiva utilizada para corrigir esse problema? Além disso, de acordo com o texto, esse problema pode ser corrigido modificando-se as características do cristalino por meio de uma cirurgia a laser. Caso essa pessoa faça a cirurgia e tenha sucesso, o módulo da vergência do cristalino passará a ser maior ou menor que antes da operação cirúrgica?

7. Toda esta viagem da energia elétrica enfim se completa quando você conecta alguma coisa na tomada ou liga o interruptor. Aí, quanto maior a potência do seu equipamento, mais carga ele puxa da rede elétrica. E maior é a conta de luz no fim do mês, claro. Tarso Araújo Disponível em: <http://mundoestranho.abril.com.br/ tecnologia/pergunta_287803.shtml>. Acesso em: 16 ago. 2010.

a. Antes da cirurgia: utiliza uma lente corretiva de -2,5 dioptrias. Após a cirurgia: o cristalino passa a ter vergência maior que a anterior. b. Antes da cirurgia: utiliza uma lente corretiva de -5 dioptrias. Após a cirurgia: o cristalino passa a ter vergência maior que a anterior.

A elevação de tensão descrita no texto, para transmissão de energia a grandes distâncias, tem como objetivo tentar manter constante a potência transmitida, ou seja, evitar perdas de energia ao longo da linha.

c. Antes da cirurgia: utiliza uma lente corretiva de 2 dioptrias. Após a cirurgia: o cristalino passa a ter vergência menor que a anterior.

Assinale a alternativa que explica de que forma o aumento de tensão da rede elétrica ajuda a evitar perdas de energia durante transmissão a longas distâncias.

expoENEM 25


a. Ao aumentar a tensão, ocorre uma diminuição da intensidade de corrente necessária para a transmissão, e assim se reduz a perda de energia por efeito joule ao longo da linha de transmissão.

se expandir e se contrair com as variações de temperatura sem haver prejuízo na estrutura. O material utilizado por dentistas para preencher dentes cariados deve ter as mesmas propriedades de expansão térmica do dente. Alguns termômetros e termostatos são baseados na maneira diferente como se dilatam os materiais que constituem uma lâmina bimetálica.

b. Ao aumentar a tensão, ocorre um aumento da intensidade de corrente necessária para a transmissão, e assim se reduz a perda de energia por efeito joule ao longo da linha de transmissão. c. Ao aumentar a tensão, ocorre uma diminuição da resistência elétrica ao longo da linha de transmissão, e assim se reduz a perda de energia por efeito joule ao longo da linha de transmissão.

São diversas as aplicações que envolvem a dilatação de corpos. O conhecimento dessas propriedades depende do material observado, que é representado pelo seu coeficiente de dilatação. Uma lâmina bimetálica (figura 1) faz parte da composição de um termostato, que controla a temperatura de um aquecedor (figura 2). Uma das lâminas é de latão e a outra, de ferro. Ao se ligar o aquecedor, a corrente elétrica que atravessa a lâmina passa a aquecê-la, até que na temperatura desejada a lâmina se curva, o contato se desfaz e o aquecedor se desliga temporariamente. Ao se resfriar, o contato se refaz e o aquecedor volta a funcionar até a temperatura escolhida, quando se desfaz o contato novamente e as etapas narradas anteriormente voltam a se repetir, mantendo-se a temperatura próxima da escolhida por meio do botão de controle.

d. Ao aumentar a tensão, ocorre um aumento da resistência elétrica ao longo da linha de transmissão, e assim se reduz a perda de energia por efeito joule ao longo da linha de transmissão. e. Ao aumentar a tensão, ocorre uma diminuição do campo elétrico no interior da linha de transmissão, e assim se reduz a perda de energia por efeito ohm ao longo da linha de transmissão. 56. Provavelmente a maioria das pessoas já levou um pequeno choque ao tocar algum objeto metálico, como carroceria de carro, portão de ferro, fechadura, sem que houvesse contato com a rede elétrica. Esse fenômeno normalmente se deve ao fato de que o corpo armazena energia estática ao longo do dia, e quando entra em contato com outra pessoa ou objeto, descarrega essa energia. Esse acúmulo de energia estática ocorre de forma similar com as nuvens, que em uma tempestade descarregam a energia na forma de raios. Pode-se dizer que a energia estática que se acumula em pessoas ao longo de um dia se deve, principalmente,

latão

ferro

a. ao atrito de seus corpos com a roupa que vestem ou de suas vestimentas com outros objetos.

botão de controle

b. ao contato com o ar ou corpos ionizados por causa do campo magnético da Terra. c. a reações químicas que ocorrem no interior do organismo, dependendo do que se ingere durante as refeições.

latão

d. ao contato com outros corpos que apresentam propriedades diamagnéticas. e. ao contato com outros corpos que apresentam o mesmo potencial elétrico. 57. De acordo com as leis da eletrostática, no interior de corpos eletrizados a influência elétrica é nula. Esse fenômeno é conhecido como blindagem eletrostática. Um dos primeiros cientistas a testar esse fenômeno foi o físico experimental inglês Michael Faraday (1791–1867). Na tentativa de mostrar que em um condutor metálico as cargas se distribuem apenas em sua superfície externa, não gerando nenhuma ação nos pontos internos, Faraday construiu uma gaiola metálica sobre suportes isolantes. Ele próprio se colocou dentro e mandou eletrizar com carga intensa. Mesmo com descargas elétricas ocorrendo ao redor da gaiola, o cientista não sofreu nenhum efeito relacionado às cargas. Essa propriedade é utilizada quando é necessário manter um equipamento elétrico ou eletrônico a salvo das interferências elétricas externas. Envolve-se o aparelho ou equipamento com uma “capa” metálica, como se vê em aparelhos de DVD, rádios, celulares, home theaters, ou ainda telas metálicas que envolvem cabos elétricos e cabos coaxiais, usados para transmissão de sinais de TV e telefonia.

Qual é a explicação científica para essa ausência de influência elétrica no interior de corpos eletrizados, conhecida como blindagem eletrostática. a. No interior de corpos eletrizados, o vetor campo elétrico é nulo. b. No interior de corpos eletrizados, o potencial elétrico é nulo. c. No interior de corpos eletrizados, a resistência interna é nula. d. No interior de corpos eletrizados, o fluxo eletromagnético é nulo. e. As cargas positivas anulam as cargas negativas.

58. Uma tampa muito apertada de um pote de geleia pode ser aberta cobrindo-a com água quente, pois a tampa de metal se expande mais que o corpo de vidro. Ao passar com um veículo por uma ponte, nota--se um espaçamento entre as partes estruturais, para que ela possa

contatos corrente da rede

ferro

corrente para o aquecedor

A respeito das propriedades associadas à lâmina bimetálica que constitui esse termostato, assinale a única alternativa correta. a. O coeficiente de dilatação do latão é maior que o do ferro. b. Após atingir a temperatura selecionada pelo botão de controle, a lâmina se curva para cima. c. O contato se desfaz ao atingir a temperatura ambiente. d. O coeficiente de dilatação do latão é igual ao do ferro. e. O coeficiente de dilatação do latão é menor que o do ferro.

59. Uma das inovações tecnológicas da Segunda Revolução Industrial foi o desenvolvimento do motor de combustão interna, precursor dos motores utilizados atualmente. O seu funcionamento é baseado em um ciclo termodinâmico desenvolvido pelo engenheiro francês Nikolaus Otto, que é comentado no texto a seguir. CICLO OTTO Este ciclo termodinâmico foi idealizado pelo engenheiro francês Alphonse Beau de Rochas em 1862. De forma independente, o engenheiro alemão Nikolaus Otto concebeu coisa similar em 1876, além de construir um motor que operava com esse sistema, embora não fosse exatamente igual aos atuais motores. Motores de ciclo Otto usam combustíveis leves como gasolina, álcool, gás natural. É desnecessário dizer que sua principal aplicação está nos automóveis. A Figura 1 dá uma ideia da operação de um cilindro básico de um motor de ciclo Otto: dispõe de 2 válvulas (admissão no lado esquerdo e escape no lado direito) e de um dispositivo de centelha elétrica para ignição (vela). A mistura de ar e combustível é fornecida por um sistema de alimentação (carburador ou sistemas de injeção).

expoENEM 26


Em quais trechos do ciclo mostrado na Figura 2 ocorrem respectivamente uma compressão adiabática e o recebimento de calor para realização de trabalho?

FIGURA 01

a. Compressão adiabática: trecho EB. Recebimento de calor: trecho CD. b. Compressão adiabática: trecho CD. Recebimento de calor: trecho EB. c. Compressão adiabática: trecho DE. Recebimento de calor: trecho BC. 01

12

23

d. Compressão adiabática: trecho BC. Recebimento de calor: trecho CD. e. Compressão adiabática: trecho BC. Recebimento de calor: trecho AB. 60. Um dos brinquedos mais conhecidos em um parque de diversões é a montanha russa, que na maioria das vezes traz fortes emoções. Leia o texto que segue.

34

41

A boca seca, as pupilas dilatam-se, a pele empalidece, o coração dispara, os pelos se eriçam, o estômago vira. Em seguida vêm o alívio, a satisfação, o intenso prazer. A sequência de emoções é típica das situações de alto risco que encantam e atraem um número cada vez maior de adeptos no Brasil e no resto do mundo – gente que, em vez de ter os dois pés seguramente plantados no chão, prefere desafiar a sorte, abrindo um negócio próprio, aplicando dinheiro em ações ou então vivendo na vizinhança do risco físico. Alguns mergulham no meio de tubarões. Outros preferem andar em montanha-russa, vencer corredeiras em um bote inflável ou subir e descer paredões de montanhas. Trata-se de uma tendência mundial, que tem sua maior comprovação no crescimento do número de praticantes de esportes radicais.

10

Em 01, a válvula de admissão está aberta e o movimento do pistão aspira a mistura de ar e combustível. Ao atingir a posição mais inferior (ponto morto inferior), a válvula de admissão é fechada e o movimento ascendente comprime a mistura (12). Esse processo é rápido e a velocidade do pistão é alta, havendo pouco tempo para a troca de calor. Em 23 o pistão atinge sua posição mais acima (ponto morto superior), quando uma centelha na vela provoca a ignição da mistura. Ocorre, portanto, um fornecimento de calor pela reação de combustão. Desde que esta última é bastante rápida, pode-se considerar que o processo ocorre sob volume constante.

Em 41 o pistão atinge o ponto morto inferior, quando a válvula de escape é aberta, reduzindo rapidamente a pressão do gás. De forma similar a 23, pode-se supor um processo sob volume constante, durante o qual o ciclo cede calor ao ambiente.

Nem é preciso onda gigante – por muito menos, o trio adrenalina-endorfina-dopamina se faz presente. Descer na montanha-russa dá um frio na barriga? Culpa da adrenalina, que tira o sangue de áreas prescindíveis, como estômago, e o redireciona para os músculos, preparando o corpo para, mais uma vez, fugir ou lutar. “É justamente por causa da diminuição do fluxo sanguíneo no sistema digestivo que as pessoas têm enjoos em situações de risco”, explica o fisiologista Turíbio Leite de Barros.

Em 10 o movimento ascendente com a válvula de escape aberta remove a maior parte dos gases da combustão e o ciclo é reiniciado quando o pistão chega ao ponto morto superior.

Bel Moherdaui Disponível em: <http://veja.abril.com.br/071101/p_072.html>. Acesso em: 16 ago. 2010.

O fornecimento de calor eleva a pressão da mistura, que se expande, forçando o pistão para baixo como em 34 da figura.

Esse é o princípio de operação do motor de 4 tempos. Há também o arranjo de 2 tempos, que aqui não é demonstrado. O motor Wankel usa, no lugar do pistão e cilindro, rotor e câmara especiais, mas a operação é similar à do motor de 4 tempos.

O parque temático Mundo da Ferrari, localizado em Abu Dhabi, nos Emirados Árabes, promete aos usuários da montanha-russa batizada como Formula Rossa atingir uma velocidade de 234 km/h no ponto mais baixo, que se encontra no final da primeira descida. Na primeira subida, o carrinho atinge altura máxima de 48,8 m em relação ao ponto mais baixo, com velocidade v0. Nesse instante, perde contato com o dispositivo que o elevou e começa a descer somente sob ação da gravidade.

Determine a velocidade v0 que o carrinho deve ter no ponto de altura máxima para que consiga atingir a velocidade prometida no ponto mais baixo. Despreze a ação da forças de atrito e considere g = 10 m/s2.

(Observação: os valores indicados foram adaptados para a questão.)

A seguir é dado o diagrama pressão x volume (FIGURA 02), onde estão representadas as transformações indicadas na figura anterior (FIGURA 01). p D

FIGURA 02

C E A

a. 10 km/h

B

v

Na análise termodinâmica do ciclo ideal, é comum não considerar as etapas de admissão e exaustão dos gases (AB e BA respectivamente). Assim, o ciclo fica limitado à região BCDE do diagrama. Disponível em: <http://www.mspc.eng.br/termo/termod0520.shtml>. Acesso em: 16 ago. 2010. (Adaptado).

expoENEM 27

b. 20 km/h c. 50 km/h d. 108,4 km/h e. 205,2 km/h


61. (Enem 2009) O manual de instruções de um aparelho de ar-condicionado apresenta a seguinte tabela, com dados técnicos para diversos modelos: CAPACIDADE DE REFRIGERAÇÃO KW/(BTU/h)

POTÊNCIA (W)

3,52/(12 000)

1 193

5,42/(18 000)

1 790

5,42/(18 000)

CORRENTE ELÉTRICA – CICLO FRIO (A)

EFICIÊNCIA ENERGÉTICA COP (W/W)

VAZÃO DE AR (M3/h)

FREQUÊNCIA (Hz)

5,8

2,95

550

60

8,7

2,95

800

60

1 790

8,7

2,95

800

60

6,45/(22 000)

2 188

10,2

2,95

960

60

6,45/(22 000)

2 188

10,2

2,95

960

60

Fonte: <http://www.institucionalbrastemp.com.br>

Considere-se que um auditório possua capacidade para 40 pessoas, cada uma produzindo uma quantidade média de calor, e que praticamente todo o calor que flui para fora do auditório o faz por meio dos aparelhos de ar-condicionado.

Nessa situação, entre as informações listadas, aquelas essenciais para se determinar quantos e (ou) quais aparelhos de ar-condicionado são precisos para manter, com lotação máxima, a temperatura interna do auditório agradável e constante, bem como determinar a espessura da fiação do circuito elétrico para a ligação desses aparelhos, são

63. (Enem 2009) A instalação elétrica de uma casa envolve várias etapas, desde a alocação dos dispositivos, instrumentos e aparelhos elétricos, até a escolha dos materiais que a compõem, passando pelo dimensionamento da potência requerida, da fiação necessária, dos eletrodutos*, entre outras. Para cada aparelho elétrico existe um valor de potência associado. Valores típicos de potências para alguns aparelhos elétricos são apresentados no quadro seguinte: Aparelhos

Potência (W)

a. vazão de ar e potência.

Aparelho de som

120

b. vazão de ar e corrente elétrica–ciclo frio.

Chuveiro elétrico

3 000

Ferro elétrico

500

Televisor

200

Geladeira

200

Rádio

50

c. eficiência energética e potência. d. capacidade de refrigeração e frequência. e. capacidade de refrigeração e corrente elétrica–ciclo frio.

*Eletrodutos são condutos por onde passa a fiação de uma instalação elétrica, com a finalidade de protegê-la.

Fique esperto! • A escolha da espessura da fiação de um circuito depende da intensidade de corrente elétrica de utilização. Quanto maior a intensidade de corrente, maior é a espessura necessária para o fio. • A capacidade de refrigeração aumenta com o aumento da potência. Com o objetivo de manter a temperatura do ambiente constante, é necessário conhecer a capacidade de refrigeração de cada aparelho para definir o número de aparelhos que serão necessários. Após a definição do número de aparelhos, é preciso determinar a intensidade total de corrente que o funcionamento dos equipamentos demanda para a definição da espessura do fio que deverá ser utilizado.

A escolha das lâmpadas é essencial para obtenção de uma boa iluminação. A potência da lâmpada deverá estar de acordo com o tamanho do cômodo a ser iluminado. O quadro a seguir mostra a relação entre as áreas dos cômodos (em m2) e as potências das lâmpadas (em W), e foi utilizado como referência para o primeiro pavimento de uma residência. Potência da lâmpada (W) Área do 2 cômodo (m ) sala/copa/ quarto/varanda/ banheiro cozinha corredor Até 6,0 6,0 a 7,5 7,5 a 10,5

60 100 100

60 100 100

60 60 100

62. (Enem 2009) 3m

O Brasil pode se transformar no primeiro país das Américas a entrar no seleto grupo das nações que dispõem de trens-bala. O Ministério dos Transportes prevê o lançamento do edital de licitação internacional para a construção da ferrovia de alta velocidade Rio–São Paulo. A viagem ligará os 403 quilômetros entre a Central do Brasil, no Rio, e a Estação da Luz, no centro da capital paulista, em uma hora e 25 minutos.

geladeira chuveiro elétrico

Devido à alta velocidade, um dos problemas a ser enfrentado na escolha do trajeto que será percorrido pelo trem é o dimensionamento das curvas. Considerando-se que uma aceleração lateral confortável para os passageiros e segura para o trem seja de 0,1 g, em que g é a aceleração da gravidade (considerada igual a 10 m/s2), e que a velocidade do trem se mantenha constante em todo o percurso, seria correto prever que as curvas existentes no trajeto deveriam ter raio de curvatura mínimo de, aproximadamente,

ferro elétrico

1,5 m rádio

3m

aparelho de som

lâmpada

(Observação: para efeitos dos cálculos das áreas, as paredes são desconsideradas.) Considerando a planta baixa fornecida, com todos os aparelhos em funcionamento, a potência total, em watts, será de a. 4 070. b. 4 270. c. 4 320.

b. 430 m.

d. 4 390. e. 4 470.

c. 800 m. e. 6 400 m.

lâmpada

lâmpada

a. 80 m.

d. 1 600 m.

televisor

lâmpada

Disponível em: <http://oglobo.globo.com>. Acesso em: 14 jul. 2009.

2,8 m

64. (Enem 2009) O ônibus espacial Atlantis foi lançado ao espaço com cinco astronautas a bordo e uma câmera nova, que iria substituir uma outra danificada por um curto-circuito no telescópio Hubble. Depois de expoENEM 28


entrarem em órbita a 560 km de altura, os astronautas se aproximaram do Hubble. Dois astronautas saíram da Atlantis e se dirigiram ao telescópio.

Dentre os fenômenos decorrentes da interação entre a radiação e os átomos do indivíduo que permitem a obtenção desta imagem, inclui-se a a. absorção da radiação eletromagnética e a consequente ionização dos átomos de cálcio, que se transformam em átomos de fósforo.

Ao abrir a porta de acesso, um deles exclamou: “Esse telescópio tem a massa grande, mas o peso é pequeno.”

b. maior absorção da radiação eletromagnética pelos átomos de cálcio que por outros tipos de átomos.

© NASA

c. maior absorção da radiação eletromagnética pelos átomos de carbono que por átomos de cálcio. d. maior refração ao atravessar os átomos de carbono que os átomos de cálcio. e. maior ionização de moléculas de água que de átomos de carbono. 66. (Enem 2009) É possível, com 1 litro de gasolina, usando todo o calor produzido por sua combustão direta, aquecer 200 litros de água de 20°C a 55°C. Pode-se efetuar esse mesmo aquecimento por um gerador de eletricidade, que consome 1 litro de gasolina por hora e fornece 110 V a um resistor de 11 Ω, imerso na água, durante um certo intervalo de tempo. Todo o calor liberado pelo resistor é transferido à água.

Telescópio Hubble

Considerando o texto e as Leis de Kepler, pode-se afirmar que a frase dita pelo astronauta a. se justifica porque o tamanho do telescópio determina a sua massa, ao passo que seu pequeno peso decorre da falta de ação da aceleração da gravidade. b. se justifica ao verificar que a inércia do telescópio é grande comparada à dele próprio, e que o peso do telescópio é pequeno porque a atração gravitacional criada por sua massa era pequena. c. não se justifica, porque a avaliação da massa e do peso de objetos em órbita tem por base as Leis de Kepler, que não se aplicam a satélites artificiais. d. não se justifica, porque a força-peso é a força exercida pela gravidade terrestre, neste caso, sobre o telescópio e é a responsável por manter o próprio telescópio em órbita. e. não se justifica, pois a ação da força-peso implica a ação de uma força de reação contrária, que não existe naquele ambiente. A massa do telescópio poderia ser avaliada simplesmente pelo seu volume.

a. A quantidade de gasolina consumida é igual para os dois casos. b. A quantidade de gasolina consumida pelo gerador é duas vezes maior que a consumida na combustão. c. A quantidade de gasolina consumida pelo gerador é duas vezes menor que a consumida na combustão. d. A quantidade de gasolina consumida pelo gerador é sete vezes maior que a consumida na combustão. e. A quantidade de gasolina consumida pelo gerador é sete vezes menor que a consumida na combustão.

Tá ligado? • Quantidade de calor necessária para variar a temperatura: Q = m · c · ∆t; U2 • Potência de resistores: P = i · U = R · i2 = ; R • Energia consumida ou produzida em função da potência e do tempo de utilização de um equipamento: E = P · ∆t. 67. (Enem 2009) O Sol representa uma fonte limpa e inesgotável de energia para o nosso planeta. Essa energia pode ser captada por aquecedores solares, armazenada e convertida posteriormente em trabalho útil. Considere determinada região cuja insolação – potência solar incidente na superfície da Terra – seja de 800 watts/m2. Uma usina termossolar utiliza concentradores solares parabólicos que chegam a dezenas de quilômetros de extensão. Nesses coletores solares parabólicos, a luz refletida pela superfície parabólica espelhada é focalizada em um receptor em forma de cano e aquece o óleo contido em seu interior a 400°C. O calor desse óleo é transferido para a água, vaporizando-a em uma caldeira. O vapor em alta pressão movimenta uma turbina acoplada a um gerador de energia elétrica. © Wikipédia

65. (Enem 2009) Considere um equipamento capaz de emitir radiação eletromagnética com comprimento de onda bem menor que a radiação ultravioleta. Suponha que a radiação emitida por esse equipamento foi apontada para um tipo específico de filme fotográfico e entre o equipamento e o filme foi posicionado o pescoço de um indivíduo. Quanto mais exposto à radiação, mais escuro se torna o filme após a revelação. Após acionar o equipamento e revelar o filme, evidenciou-se a imagem mostrada na figura abaixo.

Considerando que o calor específico da água é igual a 4,19 Jg–1°C–1, aproximadamente qual a quantidade de gasolina consumida para o aquecimento de água obtido pelo gerador, quando comparado ao obtido a partir da combustão?

Coletor solar parabólico expoENEM 29


Considerando que a distância entre a borda inferior e a borda superior da superfície refletora tenha 6 m de largura e que focaliza no receptor os 800 watts/m2 de radiação provenientes do Sol, e que o calor específico da água é 1 cal · g–1°C–1 = 4 200 J · kg-1°C–1, então o comprimento linear do refletor parabólico necessário para elevar a temperatura de 1 m3 (equivalente a 1 t) de água de 20°C para 100°C, em uma hora, estará entre

Nos processos de transformação de energia envolvidos no funcionamento da geladeira, a. a expansão do gás é um processo que cede a energia necessária ao resfriamento da parte interna da geladeira. b. o calor flui de forma não espontânea da parte mais fria, no interior, para a mais quente, no exterior da geladeira. c. a quantidade de calor cedida ao meio externo é igual ao calor retirado da geladeira.

a. 15 m e 21 m. b. 22 m e 30 m.

d. a eficiência é tanto maior quanto menos isolado termicamente do ambiente externo for o seu compartimento interno.

c. 105 m e 125 m. d. 680 m e 710 m.

e. a energia retirada do interior pode ser devolvida à geladeira abrindo-se a sua porta, o que reduz seu consumo de energia.

e. 6 700 m e 7 150 m. Se ligue! • Quantidade de calor necessária para variar a temperatura: Q = m · c · ∆t; • Potência térmica: P = Q . ∆t

68. (Enem 2009) Durante uma ação de fiscalização em postos de combustíveis, foi encontrado um mecanismo inusitado para enganar o consumidor. Durante o inverno, o responsável por um posto de combustível compra álcool por R$ 0,50/litro, a uma temperatura de 5°C. Para revender o líquido aos motoristas, instalou um mecanismo na bomba de combustível para aquecê-lo, para que atinja a temperatura de 35°C, sendo o litro de álcool revendido a R$ 1,60. Diariamente o posto compra 20 mil litros de álcool a 5°C e os revende. Com relação à situação hipotética descrita no texto e dado que o coeficiente de dilatação volumétrica do álcool é de 1 · 10–3°C–1, desprezando-se o custo da energia gasta no aquecimento do combustível, o ganho financeiro que o dono do posto teria obtido devido ao aquecimento do álcool após uma semana de vendas estaria entre

70. (Enem 2009) Considere a seguinte situação hipotética: ao preparar o palco para a apresentação de uma peça de teatro, o iluminador deveria colocar três atores sob luzes que tinham igual brilho e os demais, sob luzes de menor brilho. O iluminador determinou, então, aos técnicos, que instalassem no palco oito lâmpadas incandescentes com a mesma especificação (L1 a L8), interligadas em um circuito com uma bateria, conforme mostra a figura. L1

L7

L2

L5

L3

L6

E

L8

Nessa situação, quais são as três lâmpadas que acendem com o mesmo brilho por apresentarem igual valor de corrente fluindo nelas, sob as quais devem se posicionar os três atores? a. L1, L2 e L3.

a. R$ 500,00 e R$ 1.000,00.

b. L2, L3 e L4.

b. R$ 1.050,00 e R$ 1.250,00.

c. L2, L5 e L7.

c. R$ 4.000,00 e R$ 5.000,00.

d. L4, L5 e L6.

d. R$ 6.000,00 e R$ 6.900,00.

e. L4, L7 e L8.

e. R$ 7.000,00 e R$ 7.950,00.

71. Nos dias 6 e 9 de agosto de 1945, após seis meses de intenso bombardeio em 67 outras cidades japonesas, a bomba nuclear “Little Boy” caiu sobre Hiroshima numa segunda-feira. Três dias depois, no dia 9, a “Fat Man” caiu sobre Nagasaki. Estimativas de mortos variam entre 140 mil em Hiroshima e 80 mil em Nagasaki, sendo algumas estimativas consideravelmente mais elevadas quando são contabilizadas as mortes posteriores, causadas pela exposição à radiação, levando o Império do Japão à rendição incondicional em 15 de agosto de 1945, com a subsequente assinatura oficial do armistício em 2 de setembro na Baía de Tóquio e o fim da Segunda Guerra Mundial.

69. (Enem 2009) A invenção da geladeira proporcionou uma revolução no aproveitamento dos alimentos, ao permitir que fossem armazenados e transportados por longos períodos. A figura apresentada ilustra o processo cíclico de funcionamento de uma geladeira, em que um gás no interior de uma tubulação é forçado a circular entre o congelador e a parte externa da geladeira. É por meio dos processos de compressão, que ocorre na parte externa, e de expansão, que ocorre na parte interna, que o gás proporciona a troca de calor entre o interior e o exterior da geladeira.

L4

Na bomba de Hiroshima foi usado o 235U (meia vida de 7,1 bilhões de anos) e na de Nagasaki, o 239Pu (meia vida de 24 mil anos). Porém, em qualquer dos casos, há formação de novos elementos, os quais também podem ser radioativos.

As possíveis reações nucleares que ocorreram nas explosões de cada bomba são representadas nas equações:

compartimento do congelador

compressor

válvula de expansão

235 92

U  +  n  →  +  14256 Ba  +

239 94

U  +  n  →  +  3997 Y   +  13855 Cs + 3n

91 36

Kr  + 3n

De acordo com os conceitos sobre radioatividade, sobre as informações do texto e sobre as explosões nucleares, é possível afirmar de forma correta que a. a radioatividade é um fenômeno da eletrosfera do átomo.

Disponível em: <http://home.howstuffworks.com>. Acesso em: 19 out. 2008 (Adaptado).

expoENEM 30

b. devem-se passar 72 mil anos para que uma amostra de plutônio-239 caia a 25% da taxa inicial.


registrada), um antiviral isolado da planta asiática Illicium verum, que foi distribuído para os pacientes da gripe.

c. a presença dos nêutrons não é necessária para a fissão nuclear. d. os nêutrons liberados nas reações podem iniciar um processo de reação em cadeia. e. a fissão nuclear tem como única aplicação as bombas nucleares.

O

NH

De acordo com as informações acima, essa substância química poderá ser

O Tamiflu

b. KNO3.

De acordo com as informações da estrutura do tamiflu, a molécula apresenta a. cadeia carbônica ramificada e aromática. b. as funções orgânicas amida, éter, amina e éster. c. cadeia com carbono quaternário. d. impossibilidade de existência de isômeros ópticos, pela ausência de carbono assimétrico. e. fórmula molecular C14H26N2O4

c. (NH4)2SO4. d. NaNO3. e. MgCO3. 73. A hidroxiapatita, Ca10(PO4)6(OH)2, representa um deposito de 99% do cálcio corporal e 80% do fósforo total. O esmalte que cobre os dentes contém o mineral hidroxiapatita, que em determinadas condições pode ser dissolvida em razão do equilíbrio representado pela equação: Ca10(PO4)6(OH)2 ↔ 10Ca2+ + 6PO43– + 2OH–.

As bactérias que causam a deterioração aderem-se aos dentes e produzem ácido lático por meio do metabolismo de açúcar. O ácido lático diminui o pH na superfície dos dentes para menos de 5. Num pH inferior a 5,5, a hidroxiapatita começa a dissolver e ocorre a deterioração dos dentes.

Considere três pessoas, X, Y e Z, que consomem diariamente os produtos cujos valores de pH estão apresentados na tabela. PESSOA

NH2

Em um jardim cujo solo estava muito alcalino (básico), um cultivador de flores, para obter hortênsias de cor azul, deveria usar uma substância química que diminuísse o pH do solo para obter a cor desejada dessa planta.

a. CaCO3.

PRODUTO CONSUMIDO

PH

A

Refrigerante

3

B

Suco de laranja

4

C

Antiácido

9

Considerando somente o efeito do uso continuado desses três produtos, ocorrerá dissolução da hidroxiapatita do esmalte dos dentes a. apenas da pessoa A. b. apenas da pessoa B. c. apenas da pessoa C. d. apenas das pessoas A e B.

O

O

72. O pH dos solos varia de 3,0 a 9,0, e para a grande maioria das plantas a faixa de pH entre 6,0 e 6,5 é a ideal, porque ocorre um ponto de equilíbrio no qual a maioria dos nutrientes permanece disponível às raízes. Cultivadores de flores e floriculturistas sabem que o controle do pH do solo é importante para o bom desenvolvimento das plantas. Um exemplo é a cor de alguns tipos de flores, como hortênsias, que mudam de acordo com o pH do solo. As hortênsias são azuladas em solo ácido e rosadas em solos neutros ou básicos.

75. Saneamento é definido pela Organização Mundial de Saúde (OMS) como “o controle de todos os fatores do meio físico do homem, que exercem efeitos deletérios sobre o seu bem-estar físico, mental ou social”. É importante salientar que quando se trata de saneamento, fala-se de purificador de água, coleta e tratamento dos esgotos, coleta e disposição do lixo, drenagem urbana e controle dos vetores por agentes de saúde. O saneamento é importante como condição de cidadania para os indivíduos, e este é um direito constitucional de todo brasileiro. O importante é controlar a poluição do ar, mas para isso as indústrias precisam se conscientizar. A importância do saneamento também se reflete nas condições ambientais, pois o esgoto não tratado é despejado diretamente nas reservas de água, causando a poluição da água, assim como o lixo que não é coletado e devidamente destinado acaba por poluir o solo, causando a degradação ambiental. Devem-se ingerir de dois a três litros de água por dia, já que todos os processos vitais humanos ocorrem em solução aquosa. Antigamente, não havia preocupação com a qualidade da água, pois as cidades eram pequenas e se localizavam às margens dos rios e lagos, que eram fontes de abastecimento. Com o crescimento das cidades, a quantidade de dejetos lançados nos rios criou um sério problema ambiental. Tornou-se necessário realizar o tratamento da água, e para isso algumas substâncias químicas são utilizadas: sulfato de alumínio, carbonato de sódio e óxido de cálcio. Antes de ser distribuída às residências, a água recebe cloro. As fórmulas químicas das substâncias citadas no texto são

e. apenas das pessoas B e C.

a. A2(SO4)3; NaHCO3; Ca2O; C2.

74. Em 2009, o mundo ficou assustado com um novo tipo de vírus, que causa a gripe suína e matou milhares de pessoas pelo mundo. A gripe A (H1N1) leva a uma doença respiratória aguda causada pelo vírus influenza A (H1N1). Ele é transmitido de pessoa a pessoa principalmente por meio de tosse ou espirro e de contato com secreções respiratórias, sendo locais fechados os mais propensos à disseminação. Os sintomas geralmente iniciam no período de 3 a 7 dias após o contato com o vírus, que pode ser evitado com algumas normas de higiene pessoal e restrição a ambientes com aglomeração de muitas pessoas. Uma das formas de tratamento é a utilização do oseltamivir (Tamiflu – marca

b. A2SO4; NaHCO3; Ca2O; C2. c. A2S3; Na2CO3; CaO; C2. d. A2(SO4)3; Na2CO3; CaO; C2. e. A3(SO4)2; Na2CO3; CaO; C2. 76. A nova Lei 11.705, que altera o Código de Trânsito Brasileiro, proíbe o consumo de praticamente qualquer quantidade de bebida alcoólica por condutores de veículos. A partir de agora, motoristas flagrados

expoENEM 31


Ela suga o sangue que vai parar no abdômen (cerca de 5 microlitros por refeição para um mosquito Aedes aegypti). © 2001-2009 HAAP Media Ltd/Gabor Bibor

excedendo o limite de 0,2 grama de álcool por litro de sangue pagarão multa de R$ 957,00, perderão a carteira de motorista por um ano e ainda terão o carro apreendido. Para alcançar o valor-limite, basta beber uma única lata de cerveja ou uma taça de vinho. Quem for apanhado pelos já famosos “bafômetros” com mais de 0,6 grama de álcool por litro de sangue (equivalente a três latas de cerveja) poderá ser preso. Disponível em: <http://veja.abril.com.br/idade/exclusivo/perguntas_respostas/ lei_seca/index.shtml>. Acesso em: 20 jul. 2010.

Abaixo, os gráficos mostram a presença de álcool detectada no sangue de uma pessoa que ingeriu uma bebida com alguma dosagem alcoólica.

O tempo aproximado para que a concentração de álcool detectada no sangue volte a ser inferior a 0,2 g/ℓ, como rege o novo código penal após o consumo, de forma ininterrupta, de 2, 3 e 4 latas de cerveja, respectivamente, será de

Depois da picada, o mosquito deixa um pouco de saliva na ferida. As proteínas da saliva evocam uma resposta imunológica do corpo, em que células mastócitos liberam histamina e outros agentes de defesa para combater a invasão. A área picada incha, criando uma pústula, e o inchaço no seu entorno coça como reação à saliva. Depois de algum tempo, o inchamento desaparece, mas a coceira continua até que as células de imunidade decomponham as proteínas da saliva. A respeito do texto e da estrutura da histamina, são feitas algumas considerações: (Dado: 7N.)

2 latas de cerveja

0,5

CAS (g/l)

0,4 0,3 0,2 0,1 0

0

100

200 Tempo (minutos)

300

400

CH2 – CH2 – NH2

N

3 latas de cerveja

0,7 0,6

CAS (g/l)

0,5 0,4 0,3

N | H

0,2 0,1 0

0

100

200 Tempo (minutos)

300

400

I. A histamina é um agente de defesa do organismo contra as substâncias encontradas na saliva do mosquito.

4 latas de cerveja

0,8

II. Na molécula da histamina, encontra-se a função orgânica amina.

CAS (g/l)

0,6

III. A histamina apresenta caráter básico em razão da presença de elétrons livres nos átomos de nitrogênio.

0,4

IV. A fórmula molecular da histamina é C5H7N3.

0,2

V. É solúvel em água por causa da formação de pontes de hidrogênio com o solvente.

0

0

100

200 300 Tempo (minutos)

400

500

As informações corretas são a. apenas I, II e III.

CAS = concentração de álcool no sangue. 1 lata = 350 ml

b. apenas II, III e IV.

a. 1 hora, 1 hora e meia, 2 horas.

c. apenas I, II, III e IV.

b. 1 hora e 40 minutos, 3 horas, 4 horas e 40 minutos.

d. apenas I, II, III e V. e. Todas estão corretas.

c. 1 hora e 40 minutos, 2 horas, 3 horas. d. 2 horas, 4 horas, 5 horas e meia.

78.

e. 3 horas, 4 horas, 7 horas e meia. 77. Por que a picada de pernilongo coça?

Só os mosquitos fêmea picam. Eles são atraídos por várias coisas, incluindo calor, luz, transpiração, odor corporal, ácido láctico e dióxido de carbono. A fêmea pousa na pele e perfura-a com a tromba (a tromba é muito afiada e fina, então a picada pode passar despercebida). A saliva da fêmea contém anticoagulantes, anestésicos e outras substâncias.

Atualmente, 300 milhões de pessoas são obrigadas a usar a água do mar ou de lençóis freáticos salobros – em ambos os casos, salgada demais para o consumo humano. As usinas de dessalinização começaram a ser implantadas no Oriente Médio na década de 1970, e desde então foram instaladas em 150 países. Nos próximos seis anos, novas usinas podem acrescentar até 50 bilhões de litros ao suprimento global de água doce.

expoENEM 32


O processo agora é bem mais em conta que há décadas. O método inicial de dessalinização, e o mais comum, é uma destilação em grande escala: a água do mar é aquecida até se vaporizar, perdendo assim o sal, e depois condensada. Já o processo mais avançado se baseia na osmose reversa, na qual a água é forçada a passar por uma membrana que recolhe o sal. O bombeamento da água do mar a uma pressão superior a 70,31 kg/cm2 consome menos energia do que seria preciso para fervê-la, mas ainda assim o processo continua dispendioso.

Observação: Constam ainda frações menores de massa, as quais totalizam cerca de 0,2% da massa total, em ordem decrescente: ferro, flúor, zinco, rubídio, estrôncio, bromo, chumbo, cobre, alumínio, cádmio, boro, bário, prata, manganês, iodo, níquel, ouro, molibdênio, cromo, césio, cobalto, urânio, berílio e rádio.

Sobre as informações do texto e da tabela,

(Dados: número de Avogadro = 6 · 1023; massa molar do carbono = 12 g/mol.) a. a massa de oxigênio no homem referência é de aproximadamente 16 kg.

NATIONAL GEOGRAPHIC BRASIL: edição especial, abr. 2010. p. 43.

b. a massa de potássio é maior do que a massa de fósforo.

Já o processo de osmose normal é a difusão do solvente através de uma membrana semipermeável do meio menos concentrado para o meio mais concentrado. A osmose é uma propriedade coligativa, ou seja, depende do número de partículas dispersas em solução e não da natureza do soluto.

c. o volume do homem referência é de 71 750 cm3 ou 71,75 dm3. d. no homem referência, existem cerca de 8 · 1026 átomos de carbono. e. dos elementos citados no texto nas frações menores, o rádio é o elemento mais abundante.

De acordo com o processo de osmose e dessalinização, a. a destilação é um processo mais barato do que a osmose reversa. b. tanto na osmose normal como na reversa, o solvente migra do meio menos para o mais concentrado.

80. São apresentadas características de alguns materiais, propriedades e aplicações de seis substâncias muito utilizadas pelo homem na sociedade moderna.

c. o meio menos concentrado é chamado de hipertônico, ao passo que o mais concentrado é chamado de hipotônico. d. no dispositivo esquematizado a seguir, de um sistema de osmose reversa, em que os ramos A e B, exatamente iguais, são separados por uma membrana semipermeável, o nível da solução no ramo A vai aumentar e no ramo B vai diminuir. A

B

água do mar

água pura

MATERIAL

PROPRIEDADES E USOS

I

Na forma comercial, é conhecido como ácido muriático, utilizado em limpeza de superfícies metálicas, na indústria de papel, couros, tecidos, tintas etc.

II

É obtido, industrialmente, pela eletrólise aquosa de NaCℓ, sendo sólido, iônico, tóxico, corrosivo e muito solúvel em água (dissolução muito exotérmica). Emprega-se na produção de sabões, seda artificial, papel, produtos de limpeza, refino do petróleo e glicerol.

III

É um líquido incolor, solúvel em água (dissolução muito exotérmica), muito corrosivo e oleoso. É importante em todos os ramos da Química. Produz-se em larga escala e é utilizado na fabricação de fertilizantes, velas, explosivos, corantes, tintas, plásticos e baterias de automóveis.

IV

É conhecido há cerca de 5 000 a.C., porém só passou a ter importância quando esse metal avermelhado brilhante foi fundido com o estanho, originando uma liga extremamente dura e resistente: o bronze. Seus principais usos são em fios condutores de eletricidade, canos para refrigeração e peças mecânicas.

V

Apresenta-se na forma de sólido, muito pouco solúvel em água. Encontra-se espalhado na natureza sob diversas modalidades, como o mármore, a calcita, o calcário e a aragonita. Esse composto é utilizado na produção de cal virgem, gás carbônico, vidro, cimento e adubos. Também é empregado na siderurgia, na medicina e na correção do pH do solo.

VI

É o elemento mais abundante da galáxia, especialmente na superfície do Sol (99%) e, na forma combinada, é encontrado na água e nos hidrocarbonetos. Usa-se na fabricação de margarinas, como combustível e como agente redutor na indústria química.

membrana semipermeável

e. se uma bolsa de material semipermeável cheia com água destilada for lançada ao mar, com o passar do tempo, terá murchado pelo sistema da osmose normal. 79. O homem referência é a composição padrão do corpo humano, definida em termos de massa e porcentagem de cada elemento. A tabela abaixo apresenta a composição química do homem referência com uma massa de 70 kg e densidade de 1,025 g/cm3 (1,025 g de massa a cada 1 cm3 de volume). COMPOSIÇÃO DO HOMEM REFERÊNCIA ELEMENTO QUÍMICO

PERCENTUAL EM MASSA (%)

Oxigênio

61

Carbono

23

Hidrogênio

10

Nitrogênio

2,6

Com base nos conhecimentos sobre as relações da Química com as tecnologias, a sociedade e o meio ambiente, pode-se afirmar que os materiais acima são a. I – HClO3, II – NaCl, III – H2SO4, IV – Fe, V – Ca(OH)2 e VI – O2. b. I – HCl, II – NaOH, III – H2SO4, IV – Cu, V – CaO e VI – O2. c. I – HCl, II – NaOH, III – H2SO4, IV – Cu, V – CaCO3 e VI – H2.

Cálcio

1,4

Fósforo

1,1

d. I – HCl, II – NaOH, III – H2SO4, IV – Al, V – CaCO3 e VI – H2. e. I – HCl, II – NaOH, III – HNO3, IV – Cu, V – CaCO3 e VI – H2.

Enxofre

0,2

Potássio

0,2

Sódio

0,14

Cloro

0,12

Magnésio

0,027

Silício

0,026

Adaptado de: “Radioproteção e dosimetria: fundamentos”. 5a. rev. Rio de Janeiro: IRD/CNEN, 2003.

81. O termo combustível nuclear é comumente empregado para designar o material que pode sofrer fissão nuclear. O dióxido de urânio (UO2) é matéria-prima para fabricação do combustível nuclear nos reatores nucleares. Esse óxido é muito pobre em urânio físsil (92U235), isto é, que pode sofrer fissão nuclear. Apenas 0,7% dos átomos de urânio presentes nesse óxido são (92U235); os 99,3% restantes são de (92U238), não físsil. Assim, é necessário um novo tratamento para expoENEM 33


separar o isótopo físsil do isótopo não físsil. Esse tratamento é conhecido como enriquecimento do urânio. Um dos processos para realizá-lo consiste em transformar o dióxido de urânio no gás hexafluoreto de urânio (UF6) e fazer esse gás difundir-se por placas porosas. Com isso, consegue-se separar o (235UF6) do (238UF6). Em seguida, o gás hexafluoreto de urânio enriquecido volta a ser convertido em dióxido de urânio. Esse óxido é o que constituirá finalmente o combustível nuclear. Para se obter 1,5 kg do dióxido de urânio puro, matéria-prima para a produção de combustível nuclear, é necessário extrair-se e tratar-se 1,0 tonelada de minério. Assim, o rendimento (dado em % em massa) do tratamento do minério até chegar ao dióxido de urânio puro é de a. 0,15%.

d. 1,5%.

b. 0,20%.

e. 2,0%.

c. 0,25%. 82. Um dos problemas ambientais decorrentes da industrialização é a poluição atmosférica pelos óxidos de enxofre, com destaque para o dióxido de enxofre (SO2), um gás proveniente da oxidação de compostos de enxofre (S) contidos nos combustíveis fósseis e na matéria orgânica que é queimada, causando vários danos ao meio ambiente (chuva ácida).

Um dos danos ao meio ambiente diz respeito à corrosão de certos materiais. Considere os seguintes objetos e obras de arte:

a. o sistema 1 contém somente substâncias simples. b. o sistema 2 contém o mesmo composto químico. c. o sistema 3 contém substância pura. d. os sistemas 1 e 3 contêm misturas. e. o sistema 1 apresenta 12 elementos químicos diferentes. 84. O efeito estufa é uma das consequências do acúmulo, na atmosfera, de alguns gases, como gás carbônico, óxido nitroso, gás metano, CFC (clorofluorcarbonetos), entre outros. Esses gases são transparentes para a maior parte da radiação solar que chega à Terra, principalmente os raios ultravioletas, permitindo que ela atinja a superfície terrestre, onde é absorvida. No entanto, são opacos para a radiação térmica emitida a partir da superfície da Terra, não permitindo que ela escape para o espaço. Assim, eles retêm o calor na superfície da Terra e nas camadas inferiores da atmosfera, contribuindo para um possível aquecimento global do planeta. O aquecimento global, ocasionado pela liberação de CO2 (dióxido de carbono) na atmosfera, seria muito mais rápido, não fosse pela capacidade dos oceanos de remover do ar grandes quantidades desse gás. Por outro lado, a captação de CO2 pelos oceanos vem causando a destruição do exoesqueleto de carbonato de cálcio CaCO3 de organismos marinhos, como os corais, cujas consequências também podem ser desastrosas para a vida no planeta.

Do ponto de vista químico, a respeito das substâncias e quanto aos processos descritos no enunciado, pode-se afirmar que

I. Monumento Itamaraty – Brasília-DF (mármore);

a. os compostos responsáveis pelo efeito estufa correspondem a substâncias simples.

II. esculturas de Aleijadinho – MG (pedra-sabão; contém carbonato de cálcio);

III. grades de ferro ou alumínio de casas ou edifícios.

b. a decomposição de exoesqueletos de CaCO3 ocorre porque a captação do CO2 torna os oceanos mais ácidos.

A ação da chuva ácida pode acarretar danos em

c. a decomposição de exoesqueletos de CaCO3 ocorre porque a absorção do CO2 torna maior o pH dos oceanos.

a. I, apenas.

d. a decomposição de exoesqueletos de carbonato de cálcio não acarretaria nenhuma alteração para a vida marinha.

b. I e II, apenas.

e. a captação do CO2 ocorre com eficiência, pois o CO2, sendo uma molécula apolar, é muito solúvel em água.

c. I e III, apenas. d. II e III, apenas. e. I, II e III. 83. O cientista John Dalton foi um dos pioneiros na tentativa de ordenar e definir propriedades dos elementos e das moléculas. Segundo sua teoria atômica, apresentada em 1803, toda a matéria seria composta por pequenas partículas indivisíveis denominadas átomos. Átomos do mesmo elemento teriam as mesmas características, podendo ligar-se entre si ou com outros elementos, formando moléculas. Estão representados abaixo três sistemas diferentes, nos quais as figuras de mesma forma e cor representam o mesmo elemento químico. Com base nessas informações,

85. Polímeros são macromoléculas em que existe uma unidade que se repete, denominada monômero. O nome vem do grego: poli = muitos + meros = partes, ou seja, muitas partes. A reação que forma os polímeros é chamada de polimerização.

Para demonstrar a importância do estudo dos polímeros, basta se mencionar que a variedade de objetos a que se tem acesso hoje se deve à existência de polímeros sintéticos, como garrafas de refrigerantes, sacolas plásticas, para-choques de automóveis, tubos e conexões hidráulicos, panelas antiaderentes, mantas, colas, tintas, e chicletes. Na tabela, são apresentadas algumas características de quatro importantes polímeros. POLÍMERO

sistema 1

ESTRUTURA QUÍMICA

USOS

X

(— CH2 — CH2 —)n

Isolante elétrico, fabricação de copos, sacos plásticos, embalagens de garrafas.

Y

— CH2 — CH — | CH3

Fibras, fabricação de cordas e de assentos de cadeiras.

Z

sistema 2

W

— CH2 — CH — | Cl

b. X, Z e W. expoENEM 34

n

n

Embalagens descartáveis de alimentos, fabricação de pratos, matéria-prima para fabricação de isopor.

Acessórios de tubulações, filmes para embalagens.

Polietileno, policloreto de vinila e poliestireno são, respectivamente, os polímeros a. X, Y e Z.

sistema 3

n

— CH2 — CH — |


c. X, W e Z. d. Y, Z e X. e. Y, Z e W. 86. As medalhas de ouro conquistadas pelos atletas que disputam uma Olimpíada, ao contrário do que muitos pensam, não apresentam valor financeiro relevante, pois são feitas de prata e apenas recobertas com uma fina camada de ouro. O Comitê Olímpico Internacional requer que as moedas de ouro olímpicas contenham um valor mínimo, em gramas de ouro em cada medalha.

O uso de corrente elétrica para produzir uma reação química, chamada de eletrólise, é a técnica aplicada para recobrir a prata com o ouro, produzindo assim a tão almejada medalha de ouro.

O processo consiste em reduzir uma solução aquosa de Ouro III contendo excesso de íons cloreto, a ser depositada sobre a prata, que atua como um eletrodo, conforme a reação total a seguir:

88. O “leite de magnésia” é uma suspensão com aproximadamente 8% em massa de hidróxido de magnésio em água. O hidróxido de magnésio é um dos compostos utilizados como antiácido e para aliviar a prisão de ventre por seu efeito laxante, podendo também ser usado como eficiente desodorante de pés e axilas, pois alcaliniza a pele, impedindo a proliferação de bactérias que causam mau cheiro.

No estômago, o ácido clorídrico, que é responsável pela acidez, é neutralizado segundo a equação química (não balanceada): Mg(OH)2 + HCl → MgCl2 + H2O.

Leve em consideração que na bula do produto constam as seguintes informações: Posologia e administração – LEITE DE MAGNÉSIA Cada colher de chá contém em média 15 gramas de leite de magnésia.

Au3+(aq) + 3 Cl–(aq) → Au(s) + 3 Cl2(g). 2

Como laxante e antiácido, uma a quatro colheres de chá diluídas em água.

Supondo que tenha sido utilizada uma corrente elétrica constante de 4,2 ampere durante 35 minutos, a quantidade de ouro depositada em cada medalha é cerca de

(Dados: constante de Faraday = 9,65 · 104 Coulomb mol–1; 1 ampere = 1 Coulomb s–1; massa molar do ouro = 197 g/mol.)

Supondo um paciente que ingira duas colheres de chá de leite de magnésia, a massa (em gramas) de ácido clorídrico que será neutralizada é de aproximadamente

(Considere as seguintes massas atômicas: Mg = 24, O = 16, H = 1 e Cl = 35,5.)

a. 5,0 gramas.

a. 1,5.

b. 6,0 gramas.

b. 3,0.

c. 7,0 gramas.

c. 4,2.

d. 12 gramas.

d. 8,4.

e. 10 gramas.

e. 18,9.

87. A combustão apresenta uma enorme participação na produção total de energia por meio de processos de queima de derivados de petróleo, gás natural, carvão ou biomassa, tendo muitas aplicações, como nos transportes terrestre, marítimo e aéreo, na geração de energia elétrica em termelétricas, em processos industriais, caldeiras e no cozimento de alimentos.

A combustão completa é uma reação de uma substância (combustível) com o oxigênio (O2) (comburente) presente na atmosfera, com liberação de energia. A equação, em síntese, de uma reação de queima de hidrocarbonetos é sempre a seguinte:

hidrocarboneto + oxigênio → dióxido de carbono + água + calor.

A tabela a seguir apresenta o calor de combustão de alguns hidrocarbonetos utilizados como combustíveis.

89. Para diminuir a poluição atmosférica, causada principalmente pelos veículos de combustão, foi criada a lei da obrigatoriedade de uso do catalisador. Com essa medida, o índice de poluição proveniente dos motores automotivos não cresce desde 1992.

O verbo catalisar significa estimular ou acelerar uma reação. É exatamente o que faz o catalisador de um automóvel que converte, por meio de reações complexas, os gases poluidores e tóxicos originados no processo de combustão incompleta, como monóxido de carbono, compostos orgânicos voláteis e óxidos de nitrogênio, que são filtrados por uma estrutura em forma de colmeia acoplada ao escapamento do veículo, convertendo-os em vapor de água e outros gases não tóxicos, como o gás carbônico e o nitrogênio.

Dentro desse contexto, pode-se dizer que um catalisador atua a. obtendo os produtos de uma reação química mais rapidamente, em razão de diminuir a energia de ativação dessa reação.

SUBSTÂNCIA

OCORRÊNCIA

CALOR DE COMBUSTÃO (kcal/mol)

Metano (CH4)

Gás natural veicular (GNV)

212,8

b. aumentando os índices de poluição atmosférica.

Butano (C4H10)

Gás liquefeito de petróleo (GLP)

635,9

Octano (C8H18)

Gasolina

1 320,6

c. alterando o valor da variação de entalpia da reação. d. diminuindo a velocidade da reação, ao aumentar a energia de ativação do sistema.

Com base nos dados da tabela, (Dados de massas atômicas: C = 12; H = 1; O = 16.)

e. aumentando a constante de equilíbrio da reação.

a. o GNV é o combustível que apresenta a maior liberação de energia em kcal/grama de combustível. b. o octano é o combustível que apresenta o maior poder calorífico em kcal/grama de combustível.

90. Em 1780, ao dissecar uma rã, Luigi Galvani (1737–1798) notou que a perna da rã se encolhia quando o bisturi tocava os nervos e suspeitou que houvesse eletricidade na musculatura do anfíbio.

Alessandro Volta (1745–1827) discordou de Luigi Galvani e concluiu que a eletricidade provinha do contato entre metais, usando três discos: zinco, cobre e papelão embebido em solução ácida, sendo o nome pilha usado até hoje em decorrência do empilhamento dos discos.

Fazendo parte do cotidiano, as pilhas correspondem a um assunto muito interessante não só para a formação escolar, mas para seu conhecimento de cultura geral.

c. as três reações de combustão são processos endotérmicos. d. o calor liberado na combustão completa de 1 grama de octano é de aproximadamente 15 kcal. e. a combustão completa de 1 mol de butano consome mais oxigênio do que a de 1 mol de octano.

expoENEM 35


Pode-se montar uma pilha com um limão, uma fita de magnésio, um pedaço de fio de cobre e um relógio digital, como mostra a figura

depositados na forma pura no cátodo. Quanto às impurezas metálicas, algumas são oxidadas, passando à solução, ao passo que outras simplesmente se desprendem do ânodo e se sedimentam abaixo dele. As impurezas sedimentadas são posteriormente processadas, e sua comercialização gera receita que ajuda a cobrir os custos do processo. A série eletroquímica a seguir lista o cobre e alguns metais presentes como impurezas no cobre bruto de acordo com suas forças redutoras relativas.

13:32

Cu

Ouro Platina Prata Cobre Chumbo Níquel Zinco

Mg

O suco ácido do limão faz o contato entre a fita de magnésio e o fio de cobre, e a corrente elétrica produzida é capaz de acionar o relógio. Dados: Mg + 2e

®

2H+ + 2e–

® H2(g)

Cu2+ + 2e–

®

2+

Mg(s) Cu(s)

Entre as impurezas metálicas que constam na série apresentada, as que se sedimentam abaixo do ânodo de cobre são a. Au, Pt, Ag, Zn, Ni e Pb. b. Au, Pt e Ag.

E° = –2,36V

c. Zn, Ni e Pb.

E° = 0,00V

d. Au e Zn.

E° = +0,34V

e. Ag e Pb.

Em relação a esta pilha, pode-se afirmar que a. o eletrodo de cobre funciona como o polo positivo da pilha por apresentar um potencial de redução maior do que o magnésio. b. a voltagem dessa pilha é de 2,02 V. c. o eletrodo de magnésio funciona como cátodo. d. o fluxo de elétrons pelo circuito é proveniente do eletrodo de cobre. e. a reação global que ocorre na pilha é Cu(s) + Mg2+ → Cu2+ + Mg(s). 91. (Enem 2009) Sabões são sais de ácidos carboxílicos de cadeia longa utilizados com a finalidade de facilitar, durante processos de lavagem, a remoção de substâncias de baixa solubilidade em água, por exemplo, óleos e gorduras. A figura a seguir representa a estrutura de uma molécula de sabão.

93. (Enem 2009) O processo de industrialização tem gerado sérios problemas de ordem ambiental, econômica e social, entre os quais se pode citar a chuva ácida. Os ácidos usualmente presentes em maiores proporções na água da chuva são o H2CO3, formado pela reação do CO2 atmosférico com a água, o HNO3, o HNO2, o H2SO4 e o H2SO3. Esses quatro últimos são formados principalmente a partir da reação da água com os óxidos de nitrogênio e de enxofre gerados pela queima de combustíveis fósseis. A formação de chuva mais ou menos ácida depende não só da concentração do ácido formado, como também do tipo de ácido. Essa pode ser uma informação útil na elaboração de estratégias para minimizar esse problema ambiental. Se consideradas concentrações idênticas, quais dos ácidos citados no texto conferem maior acidez às águas das chuvas? a. HNO3 e HNO2. b. H2SO44 e H2SO3.

CO2– Na+ Sal de ácido carboxílico

Força redutora

c. H2SO3 e HNO2.

Em solução, os ânions do sabão podem hidrolisar a água e, desse modo, formar o ácido carboxílico correspondente. Por exemplo, para o estearato de sódio, é estabelecido o seguinte equilíbrio: → (CH ) COOH + OH– CH3(CH2)16COO– + H2O ← CH 3 2 16

Uma vez que o ácido carboxílico formado é pouco solúvel em água e menos eficiente na remoção de gorduras, o pH do meio deve ser controlado de maneira a evitar que o equilíbrio acima seja deslocado para a direita.

Com base nas informações do texto, é correto concluir que os sabões atuam de maneira

d. H2SO4 e HNO3. e. H2CO3 e H2SO3. 94. (Enem 2009) O álcool hidratado utilizado como combustível veicular é obtido por meio da destilação fracionada de soluções aquosas geradas a partir da fermentação de biomassa. Durante a destilação, o teor de etanol da mistura é aumentado, até o limite de 96% em massa.

a. mais eficiente em pH básico. b. mais eficiente em pH ácido. c. mais eficiente em pH neutro. d. eficiente em qualquer faixa de pH. e. mais eficiente em pH ácido ou neutro.

Considere que, em uma usina de produção de etanol, 800 kg de uma mistura etanol/água com concentração 20% em massa de etanol foram destilados, sendo obtidos 100 kg de álcool hidratado 96% em massa de etanol. A partir desses dados, é correto concluir que a destilação em questão gerou um resíduo com uma concentração de etanol em massa a. de 0%. b. de 8,0%.

92. (Enem 2009) Para que apresente condutividade elétrica adequada a muitas aplicações, o cobre bruto obtido por métodos térmicos é purificado eletroliticamente. Nesse processo, o cobre bruto impuro constitui o ânodo da célula, que está imerso em uma solução de CuSO4. À medida que o cobre impuro é oxidado no ânodo, íons Cu2+ da solução são expoENEM 36

c. entre 8,4% e 8,6%. d. entre 9,0% e 9,2%. e. entre 13% e 14%.


95. (Enem 2003) A chuva em locais não poluídos é levemente ácida. Em locais onde os níveis de poluição são altos, os valores do pH da chuva podem ficar abaixo de 5,5, recebendo, então, a denominação chuva ácida. Esse tipo de chuva causa prejuízos nas mais diversas áreas: construção civil, agricultura, monumentos históricos, entre outras. A acidez da chuva está relacionada ao pH da seguinte forma: concentração de íons hidrogênio = 10–pH, sendo que o pH pode assumir valores entre 0 e 14.

Para isso, pode-se, por exemplo, lançar calcário, minério rico em carbonato de cálcio (CaCO3), na região atingida. A equação química que representa a neutralização do H2SO4 por CaCO3, com a proporção aproximada entre as massas dessas substâncias, é:

Ao realizar o monitoramento do pH da chuva em Campinas-SP nos meses de março, abril e maio de 1998, um centro de pesquisa coletou 21 amostras, das quais quatro têm seus valores mostrados na tabela: MÊS Março Abril Abril Maio

97. (Enem 2004) Em setembro de 1998, cerca de 10 000 toneladas de ácido sulfúrico (H2SO4) foram derramadas pelo navio Bahamas no litoral do Rio Grande do Sul. Para minimizar o impacto ambiental de um desastre desse tipo, é preciso neutralizar a acidez resultante.

AMOSTRA 6a. 8a. 14a. 18a.

H2SO4

+ CaCO3 → CaCO4 + H2O + CO2

reage 1 tonelada com 1 tonelada

PH 4 5 6 7

sólido sedimentado

gás

Pode se avaliar o esforço de mobilização que deveria ser empreendido para enfrentar tal situação estimando a quantidade de caminhões necessária para carregar o material neutralizante. Para transportar certo calcário que tem 80% de CaCO3, esse número de caminhões, cada um com carga de 30 toneladas, seria próximo de

A análise da fórmula e da tabela permite afirmar que

a. 100.

I. da 6a. para a 14a. amostra ocorreu um aumento de 50% na acidez;

b. 200.

II. a 18ª amostra é a menos ácida dentre as expostas;

c. 300.

III. a 8a. amostra é dez vezes mais ácida que a 14a. ;

d. 400.

IV. as únicas amostras de chuvas denominadas ácidas são a 6a. e a 8a. .

e. 500. 98. (Enem 2004) Ferramentas de aço podem sofrer corrosão e enferrujar. As etapas químicas que correspondem a esses processos podem ser representadas pelas equações:

São corretas apenas as afirmativas a. I e II.

Fe + H2O + 1/2O2 → Fe(OH)2

b. II e IV.

Fe(OH)2 + 1/2H2O + 1/4O2 → Fe(OH)3

c. I, II e IV.

Fe(OH)3 + nH2O → Fe(OH)2 → nH2O (ferrugem)

d. I, III e IV.

e. II, III e IV.

Uma forma de tornar mais lento esse processo de corrosão e formação de ferrugem é engraxar as ferramentas. Isso se justifica porque a graxa proporciona

96. (Enem 2007) Há diversas maneiras de o ser humano obter energia para seu próprio metabolismo utilizando energia armazenada na cana--de-açúcar. O esquema abaixo apresenta quatro alternativas dessa utilização.

a. lubrificação, evitando o contato entre as ferramentas. b. impermeabilização, diminuindo seu contato com o ar úmido. c. isolamento térmico, protegendo-as do calor ambiente. d. galvanização, criando superfícies metálicas imunes.

1 caldo de cana 2

e. polimento, evitando ranhuras nas superfícies.

1 2

99. (Enem 2008)

rapadura 3

A China comprometeu-se a indenizar a Rússia pelo derramamento de benzeno de uma indústria petroquímica chinesa no Rio Songhua, um afluente do Rio Amur, que faz parte da fronteira entre os dois países. O presidente da Agência Federal de Recursos de Água da Rússia garantiu que o benzeno não chegará aos dutos de água potável, mas pediu à população que fervesse a água corrente e evitasse a pesca no Rio Amur e seus afluentes. As autoridades locais estão armazenando centenas de toneladas de carvão, já que o mineral é considerado eficaz absorvente de benzeno.

3 açúcar refinado

4

4

etanol transporte/indústria

alimentos industrializados

Adaptado de: <jbonline.terra.com.br>.

A partir dessas informações, conclui-se que a. a alternativa 1 é a que envolve maior diversidade de atividades econômicas.

b. a alternativa 2 é a que provoca maior emissão de gás carbônico para a atmosfera. c. as alternativas 3 e 4 são as que requerem menor conhecimento tecnológico. d. todas as alternativas requerem trabalho humano para a obtenção de energia. e. todas as alternativas ilustram o consumo direto, pelo ser humano, da energia armazenada na cana. expoENEM 37

Levando-se em conta as medidas adotadas para a minimização dos danos ao ambiente e à população, é correto afirmar que a. o carvão mineral, ao ser colocado na água, reage com o benzeno, eliminando-o. b. o benzeno é mais volátil que a água e, por isso, é necessário que esta seja fervida. c. a orientação para se evitar a pesca deve-se à necessidade de preservação dos peixes. d. o benzeno não contaminaria os dutos de água potável, porque seria decantado naturalmente no fundo do rio.


de energia elétrica deverá ganhar espaço: as células a combustível hidrogênio/oxigênio.

e. a poluição causada pelo derramamento de benzeno da indústria chinesa ficaria restrita ao Rio Songhua. 100. (Enem 2003) Os acidentes de trânsito, no Brasil, em sua maior parte são causados por erro do motorista. Em boa parte deles, o motivo é o fato de dirigir após o consumo de bebida alcoólica. A ingestão de uma lata de cerveja provoca uma concentração de aproximadamente 0,3 g/l de álcool no sangue.

+

A tabela abaixo mostra os efeitos sobre o corpo humano provocados por bebidas alcoólicas em função de níveis de concentração de álcool no sangue. CONCENTRAÇÃO DE ÁLCOOL NO SANGUE (G/L)

2e– H2

2e–

EFEITOS

0,1 – 0,5

Sem influência aparente, ainda que com alterações clínicas.

0,3 – 1,2

Euforia suave, sociabilidade acentuada e queda da atenção.

0,9 – 2,5

Excitação, perda de julgamento crítico, queda da sensibilidade e das reações motoras.

1,8 – 3,0

Confusão mental e perda da coordenação motora.

2,7 – 4,0

Estupor, apatia, vômitos e desequilíbrio ao andar.

3,5 – 5,0

Coma e morte possível.

e–

2H+

O2 H2O

H2 ânodo

eletrólito

O2

cátodo

VILLULLAS, H.M; TICIANELLI, E.A; GONZÁLEZ, E.R. Química Nova na Escola. n. 15, maio 2002.

Com base no texto e na figura, a produção de energia elétrica por meio da célula a combustível hidrogênio/oxigênio diferencia-se dos processos convencionais porque a. transforma energia química em energia elétrica, sem causar danos ao meio ambiente, porque o principal subproduto formado é a água.

PESQUISA, n. 57, set. 2000.

b. converte a energia química contida nas moléculas dos componentes em energia térmica, sem que ocorra a produção de gases poluentes nocivos ao meio ambiente.

Uma pessoa que tenha tomado três latas de cerveja provavelmente apresenta

c. transforma energia química em energia elétrica, porém emite gases poluentes da mesma forma que a produção de energia a partir dos combustíveis fósseis.

a. queda de atenção, de sensibilidade e das reações motoras. b. aparente normalidade, mas com alterações clínicas. c. confusão mental e falta de coordenação motora.

d. converte energia elétrica proveniente dos combustíveis fósseis em energia química, retendo os gases poluentes produzidos no processo sem alterar a qualidade do meio ambiente.

d. disfunção digestiva e desequilíbrio ao andar. e. estupor e risco de parada respiratória. 101. (Enem 2010) Em visita a uma usina sucroalcooleira, um grupo de alunos pôde observar a série de processos de beneficiamento da cana-de-açúcar, entre os quais se destacam:

e. converte a energia potencial acumulada nas moléculas de água contidas no sistema em energia química, sem que ocorra a produção de gases poluentes nocivos ao meio ambiente. 103. Observe a charge abaixo e leia atentamente os textos que seguem.

1. A cana chega cortada da lavoura por meio de caminhões e é despejada em mesas alimentadoras que as conduzem para as moendas. Antes de ser esmagada para a retirada do caldo açucarado, toda a cana é transportada por esteiras e passada por um eletroímã para a retirada de materiais metálicos. 2. Após se esmagar a cana, o bagaço segue para as caldeiras, que geram vapor e energia para toda a usina. 3. O caldo primário, resultante do esmagamento, é passado por filtros e sofre tratamento para transformar-se em açúcar refinado e etanol. Com base nos destaques da observação dos alunos, quais operações físicas de separação de materiais foram realizadas nas etapas de beneficiamento da cana-de-açúcar? a. Separação mecânica, extração, decantação. b. Separação magnética, combustão, filtração. Biodiesel como alternativa encarece preço da soja

c. Separação magnética, extração, filtração.

Fato de o óleo de soja ser a matéria-prima predominante para a fabricação do biodiesel acaba por encarecê-lo.

d. Imantação, combustão, peneiração. e. Imantação, destilação, filtração.

Folha de S. Paulo, 27 abr. 2011.

102. (Enem 2010) O crescimento da produção de energia elétrica ao longo do tempo tem influenciado decisivamente o progresso da humanidade, mas também tem criado uma séria preocupação: o prejuízo ao meio ambiente. Nos próximos anos, uma nova tecnologia de geração

[...] Atualmente, o Brasil é o terceiro maior produtor mundial do combustível, ficando atrás apenas da França e da Alemanha. Com apenas 47% da capacidade industrial instalada, o Brasil consegue atender a demanda de biodiesel para cumprir a venda de diesel B5

expoENEM 38


(mistura de 95% de diesel e 5% de biodiesel). [...] o biodiesel tem diversas vantagens, entre as quais a principal é o seu caráter ecologicamente correto, tanto pelas menores emissões de gás carbônico como de outros gases tóxicos. [...] Disponível em: <http://www.portaldoagronegocio.com.br/conteudo.php?id=54156>. Acesso em: 27 abr. 2011.

104. (Enem – 2010) No que tange à tecnologia de combustíveis alternativos, muitos especialistas em energia acreditam que os alcoóis vão crescer em importância em um futuro próximo. Realmente, alcoóis como metanol e etanol têm encontrado alguns nichos para uso doméstico como combustíveis há muitas décadas e, recentemente, vêm obtendo uma aceitação cada vez maior como aditivos, ou mesmo como substitutos para gasolina em veículos.

Biodiesel de soja pode gerar quatro vezes mais emissões que diesel convencional [...] O bloco europeu estabeleceu uma meta de obter 10% do seu combustível para veículos de fontes renováveis, principalmente biocombustíveis, até o final desta década. Mas agora a Europa começa a se preocupar com os impactos ambientais inesperados. Quatro grandes estudos estão em andamento. E o maior temor é de que a produção de biocombustível absorva grãos dos mercados globais de commodity, forçando o preço dos alimentos a subir e encorajando agricultores a desmatar áreas de floresta tropical em busca de novas terras de plantio. A queimada de florestas emite grandes quantidades de dióxido de carbono e geralmente cancela os benefícios dos biocombustíveis para o clima. [...]

Algumas das propriedades físicas desses combustíveis são mostradas no quadro seguinte. ÁLCOOL

DENSIDADE A 25°C (g/ml)

CALOR DE COMBUSTÃO (kJ/mol)

Metanol (CH3OH)

0,79

–726,0

Etanol (CH3CH2OH)

0,79

–1 367,0

BAIRD, C. Química ambiental. São Paulo: Artmed, 1995 (adaptado).

Dados: Massas molares em g/mol: H = 1,0; C = 12,0; O = 16,0.

Considere que, em pequenos volumes, o custo de produção de ambos os alcoóis seja o mesmo. Dessa forma, do ponto de vista econômico, é mais vantajoso utilizar a. metanol, pois sua combustão completa fornece aproximadamente 22,7 kJ de energia por litro de combustível queimado.

“O ponto principal é que precisamos trabalhar mais, desenvolver novos critérios de sustentabilidade e precisamos ter muito cuidado com a origem do biocombustível”, disse Wolfgang Eichhammer, do Instituto Frauhofer. “E também precisamos encontrar uma forma de excluir os biocombustíveis ineficientes.”

b. etanol, pois sua combustão completa fornece aproximadamente 29,7 kJ de energia por litro de combustível queimado. c. metanol, pois sua combustão completa fornece aproximadamente 17,9 MJ de energia por litro de combustível queimado.

Disponível em: <http://www.noticiasagricolas.com.br/noticias/biocombustivel/65809-biodiesel-de-soja-pode-gerar-quatro-vezes-mais-emissoes-que-diesel-convencional.html>. Acesso em: 04 maio 2011.

d. etanol, pois sua combustão completa fornece aproximadamente 23,5 MJ de energia por litro de combustível queimado. e. etanol, pois sua combustão completa fornece aproximadamente 33,7 MJ de energia por litro de combustível queimado.

De um lado, vemos o Brasil investindo e cuidando do seu valoroso mercado de biocombustíveis, principalmente o bioetanol da cana-de--açúcar e o biodiesel de soja; de outro lado, estudos estão em andamento sobre a verdadeira contribuição desses biocombustíveis “limpos” ao meio ambiente, lembrando também que o preço da soja tem aumentado nos últimos anos, o que acarreta aumento nos preços dos alimentos dela derivados.

Com base nessas constatações e a respeito do assunto tratado, assinale a opção correta. a. O Brasil deve continuar seus investimentos pesados na produção dos biocombustíveis, principalmente o biodiesel da soja, independentemente de impactos ambientais que sejam devidamente apurados em pesquisas, já que pretendemos ser um país ecologicamente correto.

105. No dia 11 de março de 2011, o Japão foi abalado por um terremoto de 8,9 graus na escala Richter, o que gerou um tsunami que deixou milhares de mortos. Uma das piores consequências foi o vazamento de material radioativo da Usina de Fukushima, produzido com base na reação da fissão nuclear do urânio-235 com o iodo-131, o césio-137, o césio-134 e o estrôncio-90. Desses isótopos, o que mais contamina os alimentos é o iodo-131, um radioisótopo emissor de partículas beta, de vida curta, que apresenta meia vida de oito dias. Porém, o maior risco de contaminação com o iodo-131 é pelo vazamento no mar, com a contaminação de peixes e outros animais marinhos que podem levar as pessoas que ingerem esses alimentos a desenvolverem câncer na tireoide.

b. O Brasil deve questionar seus investimentos e pesquisas na produção de biocombustíveis periodicamente, pois pesquisas apontam que a poluição gerada na produção desses combustíveis pode cancelar os benefícios de sua utilização para o ambiente.

d. Com a descoberta recente do “pré-sal”, o Brasil poderia deixar de investir na produção de biocombustíveis, pois tudo indica que seremos os maiores produtores de combustíveis derivados de petróleo do mundo.

© Agência Brasil

c. Os países que mais contribuem para a poluição do ar é que devem procurar soluções para a redução da emissão do dióxido de carbono na atmosfera. Como o Brasil é apenas o terceiro maior produtor de biocombustíveis do mundo, ainda não deve preocupar-se com questões ecológicas.

(Dado: número atômico do iodo = 53.)

Com base no texto e nas características fundamentais da radioatividade, podemos concluir que

e. O atual governo deve manter os investimentos na produção de biocombustíveis, pois se trata de uma herança saudável e ecologicamente correta, deixada pelos seus antecessores.

expoENEM 39

a. no decaimento do iodo-137 por uma partícula beta, haverá formação de 52Te137. b. a fissão nuclear, além de ser usada na produção de energia elétrica em reatores nucleares, é a principal fonte de energia das estrelas.


c. após oito dias, não mais existirá o iodo-131 nos alimentos.

107. Leia os textos a seguir e faça o que se pede.

d. após dezesseis dias, haverá uma taxa de 12,5% de iodo-131 nos alimentos.

Tsunami atinge o litoral do Japão após terremoto de magnitude 8,9

e. após 24 dias, uma amostra de peixe com 20 mg de iodo-131 decai para 2,5 mg.

Um terremoto de magnitude 8,9 atingiu nesta sexta-feira a costa nordeste do Japão gerando um tsunami, com ondas de até dez metros de altura, e deixando inúmeros feridos nas cidades de Tóquio e Miyagi, informaram autoridades locais.

106. O que é o urânio enriquecido?

O terremoto, que ocorreu às 14h46 da hora local (2h46 de Brasília) e alcançou 7 graus na escala japonesa – o nível máximo, teve epicentro no Oceano Pacífico, a 130 quilômetros da Península de Ojika.

Só de ler esse nome a gente já pensa em bombas nucleares, né? Mas a principal utilidade do urânio enriquecido é gerar energia elétrica. Ele recebe o adjetivo porque o urânio encontrado na natureza é bastante “pobre”: 99,27% do metal é formado por urânio-238, que não serve para as usinas nucleares. Energeticamente falando, o que interessa mesmo é o urânio-235 (U-235), que compõe menos que 1% da massa total do urânio extraído nas minas. O produto enriquecido nada mais é que o metal bruto com uma porcentagem de U-235 aumentada artificialmente. Quando essa quantidade chega a 2% ou 3%, o produto já é capaz de gerar energia nas usinas.

A emissora de TV local NHK transmitiu imagens que mostram colunas de fumaça saindo de edifícios na Ilha de Odaiba, na baía de Tóquio. A Agência Meteorológica do Japão emitiu um alerta de alto risco de tsunamis, com ondas de até seis metros em Miyagi e de até três metros em Iwate, onde os habitantes que se encontram perto do litoral foram orientados a se dirigir para terrenos elevados. A mesma recomendação foi lançada nas províncias de Fukushima, Ibaraki e Aomori, além da costa da província de Chiba, contígua a Tóquio.

Mesmo com essa proporção aparentemente baixa, a força que tal matéria-prima gera é absurda: alguns gramas de urânio enriquecido fornecem energia equivalente à da queima de toneladas de carvão ou de milhões de litros de gasolina. Esse poder todo vem da fissão, ou seja, da quebra dos átomos do U-235. Não existe forma mais eficiente de obter energia do que quebrar átomos. E o U-235 tem justamente a propriedade de se romper sem resistência. Basta lançar uma partícula – um nêutron, no caso – para que ele arrebente e gere energia pura. Um exemplo funesto dessa força está nas bombas atômicas. A diferença é que o urânio dessas armas é bem mais rico em U-235 que o das usinas. O urânio-238 que sobra do enriquecimento não vai todo para o lixo. Entre outras coisas, ele pode ser convertido em plutônio, que também serve para as usinas nucleares e, infelizmente, para a fabricação de mais bombas.

Disponível em: <http://www1.folha.uol.com.br/mundo/887167-tsunami-atinge-o-litoral-do-japao-apos-terremoto-de-magnitude-89.shtml>. Acesso em: 03 maio 2011.

Especialista explica fenômeno que atingiu a costa japonesa O tsunami é uma onda muito veloz. O tsunami que varreu parte do litoral japonês viajou a 700 km/h, quase a velocidade de um jato comercial. Ao se aproximar da costa, a velocidade diminui, mas a altura cresce à medida que o fundo do mar fica mais raso. As ondas desta sexta-feira (11) chegaram a dez metros.

Disponível em: <http://mundoestranho.abril.com.br/ciencia/pergunta_286679.shtml>. Acesso em: 04 maio 2011.

Disponível em: <http://g1.globo.com/jornal-nacional/noticia/2011/03/especialista-explica-fenomeno-que-atingiu-costa-japonesa.html>. Acesso em: 03 maio 2011.

Para compreender a preferência por parte de alguns governantes pela energia nuclear em vez das usinas termoelétricas, sem medir as consequências ambientais, calcule e assinale a única alternativa que indica a quantidade de carvão que devemos queimar em uma usina termoelétrica para produzir a mesma quantidade de energia que a produzida pela fissão nuclear de 1 g de urânio U-235.

Muitas vezes as informações divulgadas pelos meios de comunicação não nos fornecem tudo o que queremos saber. Supondo que se queira conhecer o horário em que a onda atingiu a Península de Ojika, os textos acima não fornecem diretamente esse dado, mas, com um pouco de conhecimento cinemático, é possível obter essa informação.

Faça essa determinação e assinale a alternativa que apresenta o horário em que a onda atingiu a Península de Ojika.

© Wikipédia

Considere: • que a energia produzida pela queima de 1 kg de carvão mineral utilizado nas usinas termoelétricas, se fosse integralmente utilizada por 40 litros de água, fariam sua temperatura se elevar de 20°C para 100°C; • que a fissão de 1 g de urânio U-235 libera 8,4 . 107 kJ; • calor específico da água = 1 cal/g . °C; • massa específica da água = 1 cal = 4,2 J. a. 300 kg b. 980 kg c. 2 toneladas d. 6,25 toneladas e. 9 toneladas Fique esperto! No caso particular da água: 1 litro = 1 000 cm3

a. 2h50

m m µ = v ® 1 g/cm3 = ® m = 1 000 g = 1 kg 1 000 cm2

c. 2h57

Portanto, 1 litro de água = 1 kg. Logo, 40 litros de água = 40 kg = 40 000 g.

d. 3h05

b. 2h52

e. 3h12 expoENEM 40


mol

Se ligue! • Para o cálculo do tempo gasto pela onda para atingir a península, a redução de velocidade na costa é desprezível em relação à distância percorrida pela onda. Pode-se considerar a velocidade da onda constante e igual a 700 km/h.

0,8

• No caso em que a velocidade se mantém constante (movimento uniforme), ela pode ser calculada pela expressão matemática Dx . v= Dt

0,4

0,7 0,6

I

0,5 0,3 0,1

(Dados: massas molares em g/mol: H = 1,0; C = 12,0; O = 16,0.)

A respeito das informações do gráfico e sobre o processo de combustão da glicose, podemos notar que a. a velocidade de combustão da glicose é maior no trecho III. b. a velocidade de combustão da glicose é maior no trecho II. c. após 30 minutos de reação, houve queima de 36 gramas de glicose. d. após 20 minutos, a velocidade de produção de CO2 é de 0,15 mol/min. e. após 10 minutos, a velocidade média de combustão da glicose é de 0,05 mol/min.

110. Um profissional de laboratório de uma empresa farmacêutica que produz soro fisiológico com a finalidade de higienização nasal recebeu a tarefa de preparar a solução de cloreto de sódio. Para tanto, ele realizou as seguintes etapas: • mediu em uma balança 4,5 gramas de NaCl; • transferiu essa massa para um recipiente apropriado; • completou com água até o volume de 500 ml.

CH2 — OH R1COOCH3 Catalisador | CH — OH + R2COOCH3 | CH2 — OH R3COOCH3 Biodiesel

R1, R2 e R3 representam grupos alquílicos de cadeia longa (12 a 18 átomos de carbonos).

Em relação ao biodiesel e ao mecanismo de transesterificação, pode-se afirmar que

(Dados: massas molares em g/mol: Na = 23,0; Cl = 35,5; densidade da solução: 1g/ml.)

A solução preparada apresenta concentração de soluto igual a

a. o subproduto A é o álcool isopropílico.

a. 0,009 g/l.

b. o biodiesel pertence à função orgânica dos ésteres.

b. 0,15 mol/l.

c. o subproduto A e o biodiesel são separados pela destilação fracionada.

c. 0,9 g/l.

d. em médio e longo prazo trará aumento de importação de petróleo para o Brasil.

e. 9 % m/v.

e. o biodiesel é um combustível derivado de fontes renováveis, assim como o petróleo. 109.

d. 1,5 mol/l.

111. Bafômetro é um aparelho utilizado para a medição da concentração de álcool exalado pela respiração de uma pessoa que ingeriu alguma bebida alcoólica. Os aparelhos mais simples são constituídos por pequenos tubos que contêm uma mistura de solução aquosa de dicromato de potássio e sílica, umedecida com ácido sulfúrico.

A nossa principal fonte de energia são os alimentos, compostos basicamente de carboidratos, proteínas e gorduras. Aliás, cerca de 50% do que comemos é de carboidratos, mas boa parte não sofre o processo de digestão e, portanto a energia que está armazenada nessas substâncias não é aproveitada. Os carboidratos digeríveis são os açúcares e amidos. Nosso organismo transforma essas substâncias em glicose (C6H12O6), que se dissolve na corrente sanguínea e pode ser transportada até as células. Nos animais, inclusive em seres humanos, a glicose (C6H12O6) passa por reação de combustão e fornece a energia necessária para o organismo. Disponível em: <http://cdcc.usp.br/ciencia/artigos/art_11/energiacalorica.html>. Acesso em: 14 abril 2011.

Tempo (min)

Catalisador

Subproduto A

10 20 30

Em uma experiência alimentar, foram feitas várias medidas do nível de glicose no organismo em função do tempo, e os dados estão representados no gráfico a seguir. expoENEM 41

© Wikipédia

CH2 — OCOR1 | CH — OCOR2 + 3CH3OH | CH2 — OCOR3

III

0,2 0

108. Em 13 de janeiro de 2005, passou a vigorar a Lei 11.097, que obriga em todo o território nacional o uso de uma mistura em volume de 2% de biodiesel e 98% de diesel de petróleo, denominada B2, considerando-se que essa quantidade subirá para 5% em janeiro de 2013 (B5). O biodiesel é um combustível obtido por um processo denominado transesterificação, que utiliza gordura animal, óleos vegetais (mamona, girassol, amendoim, soja, entre outros) e um álcool de cadeia curta na presença de um catalisador específico.

II


130 g de arroz de carreteiro, uma fatia de alcatra, duas unidades de costeletas de porco, uma coxa de frango, duas fatias de cupim e uma fatia de picanha.

O procedimento de identificação de uma possível embriaguez é visual, convertendo-se a coloração alaranjada em esverdeada pela oxidação do álcool em aldeído, conforme a reação a seguir.

© 2010-2011 HAAP Media Ltd/Mark Cardy

Cr2O2–7 + 8H+ + CH3CH2OH ↔ Cr3+ + 3CH3CHO + 7H2O alaranjado esverdeado

A partir do texto e da reação que ilustra o funcionamento do bafômetro, conclui-se que a. o aumento da concentração de álcool deixa o bafômetro na coloração alaranjada, pois favorece a reação inversa. b. a presença de ácido sulfúrico não é necessária para a ocorrência da reação. c. a mudança de coloração de alaranjado para esverdeado deve-se ao processo de oxidação do cromo do íon Cr2O72– para o íon de Cr3+. d. a coloração esverdeada é caracterizada pelo aumento da concentração de álcool, que favorece a reação direta. e. o aumento de umidade no tubo contribui para a coloração esverdeada, pois favorece a reação inversa.

112. Acima da superfície do solo encontramos uma camada de ar denominada troposfera, onde ocorre a maioria dos fenômenos climáticos da Terra. A temperatura no seu topo pode chegar a -50°C, e sua pressão é cerca de 0,25 atm.

De acordo com a tabela a seguir, assinale a alternativa que indica o intervalo de tempo que uma lâmpada fluorescente de 20 W de potência ficaria acesa caso toda energia contida nesses alimentos pudesse ser transformada em energia elétrica e fornecida direta e integralmente para a lâmpada em vez de ser fornecida à pessoa que os ingeriu.

Dado: considere 1 cal = 4J. Arroz de carreteiro

1 colher de sopa (20 g)

56 kcal

2 fatias (150 g)

302 kcal

Costeleta de porco

2 unidades (100 g)

483 kcal

Coxa de frango

1 unidade (100 g)

140 kcal

Cupim

2 fatias (150 g)

375 kcal

Picanha

1 fatia (100 g)

287 kcal

Alcatra assada

Fonte: <http://www.faac.unesp.br/pesquisa/nos/bom_apetite/tabelas/cal_ali.htm>.

a. 20h b. 40h c. 50h d. 80h e. 100h

Um grupo de pesquisadores confeccionou um balão meteorológico para estudar os fenômenos elétricos na troposfera, com um material elástico que suporta um volume de até 40 litros.

Tá ligado? • A unidade W (watt) é equivalente a J/s. Por esse motivo, a quantidade de energia total consumida que é dada em kcal deve ser transformada em J.

Em seguida, foi cheio com gás hélio até um volume de 20,0 l, a 1,00 atm e 27°C, e foi solto. Porém, depois de certo tempo, a missão fracassou, porque o balão estourou antes da hora. Qual era o volume do balão quando atingiu as condições da troposfera?

• Ao trabalhar com a unidade W, o tempo é obtido em segundos, então deve ser transformado em horas.

a. 18,6 litros b. 59,5 litros

114.

c. 86,1 litros d. 105,7 litros

Por que o navio flutua?

e. 148,1 litros

Porque o navio é mais leve que a água. Absurdo? Em parte, sim. O problema é que ninguém aceita muito bem essa explicação tão simplista. Afinal, todo mundo sabe que um punhado do aço inox que forma a carcaça de qualquer barco pesa muito mais que o mesmo punhado de água. Onde está o segredo, então? Está no tamanho do navio, e não no seu peso. Para entender isso melhor, vamos usar uma pessoa como exemplo. Imagine se ela resolve dar uma de messias e tenta andar sobre a água. Não vai funcionar, claro, e ela acabará afundando. Mas essa mesma pessoa, deitada, e não em pé na água, consegue boiar sem grandes problemas. E o peso do corpo é

113. O consumo de carne bovina como fonte de proteína animal é um hábito consolidado no Brasil. Podemos notar esse fato pelas churrascarias lotadas aos finais de semana. Em contrapartida, é crescente a preocupação da população com o excesso de “peso” e o consumo exagerado de comida. Com a intenção de chamar a atenção quanto à quantidade de energia armazenada nesse tipo de alimento, imagine que uma pessoa durante um almoço em uma churrascaria consuma

expoENEM 42


115. Em shows musicais, encontramos frequentemente violinos, violoncelos, pianos, violões, guitarras, baixos, cavaquinhos, entre muitos outros instrumentos mais raros, como harpa, berimbau, koto e shamisen.

exatamente igual nas duas situações. A diferença está na concentração desse peso. No primeiro exemplo, ele fica todo concentrado nos pés da pessoa. Já no segundo é distribuído por toda a área do corpo. Aí, é como se você ficasse mais leve, pelo menos do ponto de vista da água que o ampara. Para os barcos, vale exatamente a mesma regra.

A diversidade de instrumentos musicais de corda se deve a variáveis como comprimento, espessura, densidade, tipo de material que constitui a corda e a força de tração a que está sujeita.

A seguir, assinale a única alternativa que relaciona de forma correta a qualidade fisiológica do som produzido por um instrumento de corda em função das variáveis citadas anteriormente. © Wikipédia

O segredo de tudo isso está na quantidade de água deslocada por cada material, seja o corpo de uma pessoa ou um navio. Se o volume de um material – o espaço ocupado por sua massa – for grande, mais água será tirada do lugar, certo? E o líquido reage tentando ocupar novamente esse espaço. Quanto mais água é tirada do lugar, maior é a reação. Essa força contrária é que tem o poder de sustentar um material volumoso mergulhado na água. “É justamente seu volume que permite isso”, diz o engenheiro naval Cláudio Sampaio, da Universidade de São Paulo (USP). Se o volume for bem razoável, a quantidade de líquido deslocado por ele terá poder suficiente para manter um corpo de peso enorme flutuando. É esse princípio que está por trás da navegabilidade de todos os barcos desenvolvidos pelo homem, das primeiras e relativamente leves galeras do Egito Antigo aos modernos porta-aviões nucleares, verdadeiras máquinas navais de guerra, que podem pesar aproximadamente 100 mil toneladas.

VERSIGNASSI, Alexandre. Disponível em: <http://mundoestranho.abril.com.br/ ciencia/pergunta_286390.shtml>.

a. Um dos motivos para o cavaquinho produzir sons mais altos que o violão se deve ao fato de as cordas do cavaquinho se encontrarem menos tensionadas que as do violão.

O texto cita uma força que surge com o deslocamento de certo volume de água, capaz de sustentar um porta-aviões. Assinale a alternativa que indica o número aproximado de piscinas olímpicas necessárias para fornecer o volume equivalente ao que o porta-aviões, citado no texto, necessita deslocar para conseguir flutuar na água do mar.

b. Em um piano, a tecla que produz o som mais baixo é aquela que apresenta menor comprimento da corda. c. Em um violão, a corda mais fina produz som de menor frequência em relação às demais, pois é a corda que apresenta menor densidade linear.

© 2010 MORGUEFILE

d. As ondas estacionárias formadas nas cordas para produção de som são originadas por meio dos fenômenos de reflexão e difração. e. Um guitarrista, para emitir um som de alta frequência por meio de seu instrumento sonoro, altera a posição dos dedos que prendem as cordas, diminuindo seu comprimento. Se ligue! • Som agudo é um som de alta frequência, e por isso é classificado como um som alto.

Considere: I. piscina olímpica; • Comprimento = 50 m • Largura = 25 m • Altura = 2,20 m • O nível da água encontra-se 20 cm abaixo do ponto máximo de altura da estrutura da piscina.

• Som grave é um som de baixa frequência, e por isso é classificado como um som baixo. • A frequência do som é inversamente proporcional ao comprimento da corda. Quanto menor o comprimento, maior é a frequência do som produzido, ou seja, o som é mais agudo.

II. densidade da água do mar = 1 g/cm3; III. aceleração da gravidade = 10 m/s2.

Texto para a questão 116.

a. 30 piscinas olímpicas b. 35 piscinas olímpicas

Arco-íris

c. 40 piscinas olímpicas

Se a luz se propaga em linha reta, por que o arco-íris é curvo? O arco-íris ocorre porque as gotas da água da chuva (ou de qualquer outra coisa que deixe partículas de água em suspensão, como neblina ou cachoeiras muito altas) funcionam como prismas, ou seja, decompõem a luz solar em vermelho, alaranjado, amarelo, verde, azul anil e violeta. Cada raio de luz dessas sete cores sai da gota em sentido contrário e num ângulo de 42 graus, aproximadamente, em relação ao raio de luz incidente. Por isso, para observar o arco-íris, é necessário estar entre o Sol e a chuva; e o Sol não deve nem estar muito alto nem muito baixo, para que a luz alcance o observador no ângulo ideal de 42 graus. O arco-íris é curvo porque essa é a única forma de os raios de luz formarem ângulos de 42 graus, de onde quer que se olhe. É como desenhar uma semicircunferência como um compasso aberto de 42 graus: todos os pontos de arco “olharão” o centro do compasso no mesmo ângulo.

d. 45 piscinas olímpicas e. 50 piscinas olímpicas Fique esperto! • A força que surge com o deslocamento da água é o empuxo, que pode ser calculado pela relação: E = µlíquido . Vsubmerso . g. • 1 tonelada = 1 000 kg. • 1 g/cm3 = 103 kg/m3. • A piscina apresenta formato de um paralelepípedo, em que: volume = comprimento x largura x altura. • Altura da coluna de água = altura da piscina – 20 cm = 2,20 m – 0,2 m = 2 m.

expoENEM 43

COELHO, Ricardo Dias; OLIVEIRA, Adilson José Costa. <http://super.abril.com.br/ cotidiano/arco-iris-438912.shtml>. Acesso em: 04 maio 2011.


A formação de um arco-íris é um fenômeno que normalmente provoca fascinação por parte de quem o observa. Para os cientistas, nada mais é do que a constatação de dois fenômenos bastante comuns na natureza, a refração e a reflexão total da luz.

O valor a ser pago pelo consumo de energia elétrica registrado seria de a. R$ 41,80. b. R$ 42,00. c. R$ 43,00.

© 2001-2010 HAAP Media Ltd/Aneta Blaszczyk

d. R$ 43,80. e. R$ 44,00. Se ligue! Em cada um dos marcadores, o valor a ser considerado deve ser igual ou imediatamente menor que o número indicado.

116. A respeito desses dois fenômenos que ocorrem no interior das gotas de chuva, assinale a única alternativa correta.

Dado: Um arco-íris formado pelas gotas de água suspensas no ar, observado da Terra, tem a cor vermelha na parte exterior da curva e a cor violeta na parte interna. a. A cor vermelha na parte externa se deve ao fato de o feixe de luz vermelha sofrer o maior desvio em relação às demais cores na refração.

118. (Enem 2010) As ondas eletromagnéticas, como a luz visível e as ondas de rádio, viajam em linha reta em um meio homogêneo. Então, as ondas de rádio emitidas na região litorânea do Brasil não alcançariam a região amazônica do Brasil por causa da curvatura da Terra. Entretanto sabemos que é possível transmitir ondas de rádio entre essas localidades devido à ionosfera.

Com a ajuda da ionosfera, a transmissão de ondas planas entre o litoral do Brasil e a região amazônica é possível por meio da a. reflexão.

b. A cor violeta não sofre refração, apenas reflexão total.

b. refração.

c. Uma pessoa na superfície da Terra, no Brasil, perceberá o arco-íris formado por meio das gotas de chuva suspensas no ar de forma mais nítida no horário próximo ao meio-dia.

c. difração.

d. A dispersão das cores ao penetrar nas gotas de água se deve ao fato de cada cor apresentar velocidades diferentes ao se propagarem no interior da água.

e. interferência.

d. polarização.

Fique esperto!

e. A cor verde é a única que não sofre variação da velocidade ao passar do ar para a água.

As ondas de rádio têm menor frequência e maior comprimento de onda que a luz visível, por isso podem sofrer reflexão com maior facilidade.

Tá ligado? • O arco-íris mais comum é o formado pela dispersão da luz nas gotículas de água suspensas na atmosfera, durante ou logo após a chuva. • A luz do Sol é constituída pelo conjunto de todas as cores. • Cada uma das cores que compõem a luz do Sol apresenta frequências diferentes.

119. (Enem 2010) Sob pressão normal (ao nível do mar), a água entra em ebulição à temperatura de 100°C. Tendo por base essa informação, um garoto residente em uma cidade litorânea fez a seguinte experiência: • colocou uma caneca metálica contendo água no fogareiro do fogão de sua casa;

• A reflexão total ocorre somente quando a luz se propaga do meio mais refringente em direção ao meio menos refringente.

117. (Enem 2010) A energia elétrica consumida nas residências é medida, em quilowatt-hora, por meio de um relógio medidor de consumo. Nesse relógio, da direita para esquerda, tem-se o ponteiro da unidade, da dezena, da centena e do milhar. Se um ponteiro estiver entre dois números, considera-se o último número ultrapassado pelo ponteiro. Suponha que as medidas indicadas nos esquemas seguintes tenham sido feitas em uma cidade em que o preço do quilowatt-hora fosse de R$ 0,20.

• quando a água começou a ferver, encostou cuidadosamente a extremidade mais estreita de uma seringa de injeção, desprovida de agulha, na superfície do líquido e, erguendo o êmbolo da seringa, aspirou certa quantidade de água para seu interior, tapando-a em seguida; • verificando após alguns instantes que a água da seringa havia parado de ferver, ele ergueu o êmbolo da seringa, constatando, intrigado, que a água voltou a ferver após um pequeno deslocamento do êmbolo.

leitura atual

Considerando o procedimento anterior, a água volta a ferver porque esse deslocamento a. permite a entrada de calor do ambiente externo para o interior da seringa. b. provoca, por atrito, um aquecimento da água contida na seringa. c. produz um aumento de volume que aumenta o ponto de ebulição da água.

leitura do mês passado

d. proporciona uma queda de pressão no interior da seringa que diminui o ponto de ebulição da água. FILHO, A.G.; BAROLLI, E. Instalação elétrica. São Paulo: Scipione, 1997.

expoENEM 44

e. possibilita uma diminuição da densidade da água que facilita sua ebulição.


Tá ligado?

Se ligue!

A temperatura de ebulição diminui com a redução da pressão sobre o líquido.

120. (Enem 2010)

Segundo o texto, esse material tem propriedades ópticas diferentes de qualquer outro material natural.

121.

Um grupo de cientistas liderado por pesquisadores do Instituto de Tecnologia da Califórnia (Caltech) nos apresenta valor negativo do índice de refração relativo para a luz visível. Denomina-se metamaterial um material óptico artificial, tridimensional, formado por pequenas estruturas menores do que o comprimento de onda da luz, o que lhe dá propriedades e comportamentos que não são encontrados em materiais naturais. Esse material tem sido chamado de “canhoto”.

Iodeto de potássio protege pessoas contra radiação? Indústrias farmacêuticas alegam que estão ficando sem remédios contra o câncer de tireoide. Como medida de precaução contra a exposição à radiação, os japoneses distribuíram 230 mil unidades de pastilhas de iodeto de potássio, contendo uma forma estável de iodo, em áreas em torno dos complexos nucleares Daiichi e Daini de Fukushima, de acordo com a Agência Internacional de Energia Atômica (AIEA). Foi demonstrado que o iodeto de potássio protege a glândula tireoide da forma radiativa de iodo liberada por acidentes nucleares. O câncer de tireoide acabou tornando-se o maior impacto na saúde pública causado pelo desastre do reator nuclear em Chernobyl, de acordo com um relatório publicado no mês passado pela Comissão Científica das Nações Unidas sobre os Efeitos da Radiação Atômica.

Disponível em: <http://inovacaotecnologica.com.br>. Acesso em: 28 abr. 2010. (Adaptado.)

Considerando o comportamento atípico desse metamaterial, qual é a figura que representa a refração da luz ao passar do ar para esse meio? metamaterial

a.

GREENEMEIER, Larry. Scientific American Brasil. n. 107, abr. 2011. Disponível em: <http://www2.uol.com.br/sciam/artigos/iodeto_de_potassio_ protege_pessoas_contra_radiacao_.html>. Acesso em: 24 abr. 2011.

luz incidente

Cientistas afirmam que a glândula tireoide age como uma esponja para o iodo. Ao se administrar iodo normal a uma pessoa, a tireoide o absorverá e então bloqueará a absorção de exposições subsequentes a iodo radiativo. Assim, se uma pessoa tomar iodeto de potássio e for exposta ao iodo radiativo, este não será absorvido e será eliminado do corpo. Que fique bem claro que o iodeto de potássio protege contra o câncer de tireoide, mas não contra outras possíveis formas de câncer.

Na hipótese do desenvolvimento de câncer na tireoide e a consequente remoção dessa glândula, o paciente deveria se submeter a medicamentos de uso contínuo, pois a ausência dessa glândula certamente acarretaria:

b.

luz incidente metamaterial

a. queda generalizada do metabolismo basal, inclusive com diminuição da temperatura do corpo.

metamaterial

c.

b. aumento no teor de açúcar na corrente sanguínea, por causa da ausência de hormônios específicos. c. redução das funções sexuais, podendo levar à esterilidade. d. dificuldade de enxergar em ambientes mal iluminados, por causa da ausência de certas vitaminas que deixariam de ser produzidas.

luz incidente

e. aumento no volume de urina, por causa da ausência do hormônio ADH.

metamaterial

d.

Fique esperto! O hormônio tiroxina é estimulante do metabolismo, ou seja, atua principalmente acelerando a taxa de respiração celular. Sua deficiência na infância pode levar ao cretinismo, mal em que ocorre retardamento físico e mental. No adulto, a diminuição da produção da tiroxina leva ao hipotireoidismo, provocando sonolência, reduzindo a atividade geral do organismo e um inchaço característico no pescoço – o mixedema.

luz incidente

metamaterial

e.

Ao contrário, quando há grande produção de tiroxina – hipertireoidismo –, ocorre aceleração do metabolismo geral, levando o indivíduo à hiperatividade, ocasionando emagrecimento, irritabilidade, aumento nos batimentos cardíacos e instabilidade emocional. Em casos graves de hipertireoidismo, a glândula tireoide pode aumentar de tamanho (bócio) e provocar a exoftalmia, condição em que os olhos ficam arregalados e saltam das órbitas – trata-se do bócio exoftálmico.

luz incidente expoENEM 45


A falta de iodo na alimentação pode levar o indivíduo ao bócio carencial ou endêmico, situação em que o aumento da glândula tireoide resulta de um mecanismo compensatório, permitindo a máxima obtenção de iodo disponível quando a dieta é pobre nesse elemento. Com a obrigatoriedade da adição de iodo ao sal de cozinha comercializado, muitas regiões do Brasil deixaram de ser afetadas pelo bócio carencial.

Um homem daltônico é filho de pais normais. Diante dessa informação, pode-se afirmar corretamente que esse homem a. é homozigoto e recessivo para o gene do daltonismo. b. é heterozigoto para o daltonismo. c. recebeu o gene para o daltonismo de seu pai, que é heterozigoto. d. recebeu o gene para o daltonismo de sua mãe, que é heterozigota.

Outro importante hormônio da tireoide é a calcitonina, que atua na diminuição de cálcio no sangue, promovendo sua fixação nos ossos.

e. recebeu o gene do seu pai, pois o cromossomo Y é transmitido do pai para os filhos do sexo masculino. Fique esperto!

laringe

glândula tireoide direita

Pesquisas recentes mostram que a visão em cores está relacionada a três loci: dois localizados no cromossomo X e um no cromossomo 7. Os genes para a percepção do vermelho e do verde estão situados no braço longo (q) do cromossomo X e apresentam caráter recessivo. Já o gene para a percepção do azul está no braço longo (q) do cromossomo 7 e, diferentemente dos anteriores, obedece à herança autossômica dominante.

glândula tireoide esquerda

traqueia

123. O código genético é universal, ou seja, é utilizado praticamente por todos os seres vivos. Cada códon é constituído por uma trinca, ou seja, é formado por três bases nitrogenadas. Como existem quatro tipos de bases no RNA, o código genético é formado por 64 códons. Desse total, 61 códons determinam a inclusão de aminoácidos no peptídio, ao passo que três (UGA, UAG, UAA) são códons de terminação, isto é, são usados como sinais de parada da síntese proteica.

Glândula tireoide vista de frente

glândula tireoide glândulas paratireoides

Os códons se relacionam com os aminoácidos. Como existem apenas vinte aminoácidos para serem codificados por 61 códons, alguns aminoácidos devem ser codificados por mais de um códon.

Observe a representação do código genético e assinale a afirmativa correta.

Na parte de trás da tireoide localizam-se as quatro glândulas paratireoides.

U

As glândulas paratireoides produzem o paratormônio, hormônio que atua no aumento do nível de cálcio no sangue, provocando sua liberação pelos ossos.

U

Assim a calcitonina e o paratormônio atuam juntos no controle da taxa de cálcio no sangue.

A

© Wikipédia

122. Em 1794, o químico inglês John Dalton (1766–1844) notou que apresentava dificuldades para identificar as cores verde e vermelha. Estudando a si próprio, fez a primeira publicação científica sobre a doença, que ficou conhecida como daltonismo. O daltonismo é determinado por um gene raro, de caráter recessivo e ligado ao cromossomo X. Afeta 8% da população masculina e 0,04% da população feminina. Essa baixa frequência verificada nas mulheres decorre do fato de que precisam reunir dois desses genes em seu genótipo para expressar o daltonismo.

C

G

C

A

G

UUU

Phe

UCU

Ser

UAU

Tyr

UGU

Cys

U

UUC

Phe

UCC

Ser

UAC

Tyr

UGC

Cys

C

UUA

Leu

UCA

Ser

UAA

Pare

UGA

Pare

A

UUG

Leu

UCG

Ser

UAG

Pare

UGG

Trp

G

CUU

Leu

CCU

Pro

CAU

His

CGU

Arg

U

CUC

Leu

CCC

Pro

CAC

His

CGC

Arg

C

CUA

Leu

CCA

Pro

CAA

Gln

CGA

Arg

A

CUG

Leu

CGC

Pro

CAG

Gln

CGG

Arg

G

AUU

Ile

ACU

Thr

AAU

Asn

AGU

Ser

U

AUC

Ile

ACC

Thr

AAC

Asn

AGC

Ser

C

AUA

Ile

ACA

Thr

AAA

Lys

AGA

Arg

A

AUG

Met

ACG

Thr

AAG

Lys

AGG

Arg

G

GUU

Val

CGU

Ala

GAU

Asp

AGU

Gly

U

GUC

Val

GCC

Ala

GAC

Asp

GGC

Gly

C

GUA

Val

GCA

Ala

GAA

Glu

GGA

Gly

A

GUG

Val

GCG

Ala

GAG

Glu

GGG

Gly

G

a. A partir da sequência do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, é formado o seguinte peptídio: Leu-Gly-Glu-Thr-Arg-Gln-Glu. expoENEM 46


b. O código genético é denominado degenerado, pois um único códon pode codificar diversos aminoácidos.

• Cobra-de-vidro (Classe Reptilia/ Ordem Lacertilia) – a popularmente chamada cobra-de-vidro não é uma cobra, muito menos de vidro. Apesar de pertencer à mesma classe das serpentes (classe Reptilia) e de apresentar o formato do corpo semelhante ao delas, as cobras-de-vidro pertencem à ordem dos Lagartos (ordem Lacertilia ou Sauria, família Anguidae), e podem ser reconhecidas pela presença de patas vestigiais e pálpebras móveis.

c. O ribossomo desloca-se pelo filamento de RNAm no sentido 3’ ® 5’ e, à medida que os códons traduzem os anticódons, os aminoácidos vão sendo inseridos na cadeia proteica. d. O dogma da síntese proteica obedece a sequência: replicação ® tradução ® transcrição.

Agência Brasil/Fagner Delfim

e. Proteínas para uso próprio são produzidas pelos polissomos aderidos ao retículo endoplasmático granular, ao passo que as proteínas para exportação são produzidas nos polissomos livres no citoplasma. Tá ligado? Diz-se que o código genético é redundante ou degenerado porque a maioria dos aminoácidos pode ser codificada por diferentes códons. Desse modo, não é possível deduzir, a partir da estrutura primária de um peptídio, a sequência do RNAm que foi traduzido para formá-lo, pois seria impossível saber quais códons estavam presentes nesse RNAm.

Cobra-de-vidro (Ophiodes fragilis)

124. (Enem 2010) As misturas efervescentes, em pó ou em comprimidos, são comuns para a administração de vitamina C ou de medicamentos para azia. Essa forma farmacêutica sólida foi desenvolvida para facilitar o transporte, aumentar a estabilidade de substâncias e, quando em solução, acelerar a absorção do fármaco pelo organismo. As matérias-primas que atuam na efervescência são, em geral, o ácido tartárico ou o ácido cítrico que reagem com um sal de caráter básico, como o bicarbonato de sódio (NaHCO3), quando em contato com a água. A partir do contato da mistura efervescente com a água, ocorre uma série de reações químicas simultâneas: liberação de íons, formação de ácido e liberação do gás carbônico – gerando a efervescência.

© Wikipédia

• Cobra-de-duas-cabeças (classe Reptilia/ ordem Lacertilia) – “duas-cabeças” faz referência ao fato de a cauda desse animal não afilar, tomando assim o aspecto rombudo (arredondado, ovalado) que lembra a cabeça. Pode ser distinguida de uma serpente pelo fato de suas escamas serem todas do mesmo tamanho, tanto no ventre quanto no dorso.

As equações a seguir representam as etapas da reação da mistura efervescente na água, em que foram omitidos os estados de agregação dos reagentes, e H3A representa o ácido cítrico. I. NaHCO3 ® Na+ + HCO–3 II. H2CO3 ® H2O + CO2 III. HCO3– + H+® H2CO3 IV. H3A ® 3H + A–

Cobra-de-duas-cabeças (Amphisbaena trachura)

A ionização, a dissociação iônica, a formação do ácido e a liberação do gás ocorrem, respectivamente, nas seguintes etapas: a. IV, I, II e III.

b. I, IV, III e II. c. IV, III, I e II.

Apesar de algumas confusões entre os dois grupos, anfíbios e répteis, esses cordados apresentam características bastante distintas. Sobre esse assunto, assinale a única opção correta. a. Os anfíbios foram os primeiros vertebrados a sobreviver em ambiente terrestre, e para tanto, desenvolveram pele áspera e rígida, que os protege da desidratação imposta pelo meio seco.

d. I, IV, II e III. e. IV, I, III e II. 125. Os animais que mais são confundidos com as serpentes são três: um deles é um anfíbio e os outros dois são lagartos. Acompanhe a seguir.

© Wikipédia

• Cobra-cega ou cecília (Classe Amphibia) – este animal não é cego e muito menos é serpente. Trata-se de um anfíbio. A cobra-cega é confundida somente pelo formato sem patas de seu corpo, e pode ser diferenciada pelo fato de não apresentar escamas.

b. Os répteis foram os primeiros vertebrados a conquistar a independência da água para sobrevivência no ambiente terrestre. Dentre essas conquistas, podemos citar a pele seca e grossa, a fecundação interna e a postura de ovos, entre outras. c. Apesar de os anfíbios terem surgido anteriormente aos répteis, apresentam coração tetracavitário e circulação completa, condições essenciais para a passagem do ambiente aquático para o terrestre. d. Répteis e anfíbios apresentam desenvolvimento indireto, com fecundação externa, fatos que os distinguem dos demais vertebrados e os unem como o grupo de animais que primeiro chegou ao ambiente terrestre. e. Cobra-cega, cobra-de-vidro e cobra-de-duas-cabeças podem ser agrupados em uma nova classe de vertebrados, uma vez que não são tetrápodos como os demais.

Cobra-cega (Siphonops annulatus) expoENEM 47


126. Observe a seguir a tirinha de Fernando Gonzales.

Disponível em: <http://www2.uol.com.br/niquel/bau/bau_tiras/20.gif>. Acesso em: 04 maio 2011.

A engenharia genética, também denominada manipulação genética ou tecnologia do DNA recombinante, pode ser definida como o conjunto de métodos e técnicas usado na manipulação direta dos genes de um organismo. A aplicação da engenharia genética tem tido algum sucesso na obtenção de organismos “engenheirados” ou organismos geneticamente modificados (OGM), mais comumente referidos como organismos transgênicos.

Sobre esse assunto, assinale a afirmativa correta. a. O DNA recombinante é formado pela junção de dois segmentos de DNA oriundos de fontes diferentes. b. Uma bactéria que recebe uma molécula de DNA que codifica uma proteína humana não poderá produzir essa proteína, pois o DNA humano é estranho a ela. c. A obtenção de organismos geneticamente modificados só é possível graças à degeneração do código genético. d. Uma das principais ferramentas empregadas na tecnologia do DNA recombinante são as enzimas de restrição, cujo papel biológico na natureza é auxiliar no processo de duplicação do DNA bacteriano. e. Utilizando as técnicas da engenharia genética, para que uma bactéria passe a produzir insulina humana, ela deve receber altas doses dessa proteína. Se ligue!

Produtos da biotecnologia para aplicação medicinal: PRODUTO

FINALIDADE

Insulina

Estimular a captação de glicose do sangue em pacientes com diabetes tipo I.

Hormônio de crescimento

Tratar indivíduos de baixa estatura.

Fator VIII

Tratar pacientes com hemofilia A.

Ativador de plasminogênio tecidual

Dissolver coágulos sanguíneos depois de ataques cardíacos e derrames.

Proteínas vacinais: hepatite B, herpes, gripe, meningite, coqueluche etc.

Prevenir doenças infecciosas.

Fator dado de crescimento derivado de plaquetas

Estimular a cicatrização de feridas.

Eritropoietina

Prevenir anemia em pacientes que se submeteram a diálise renal e terapia contra o câncer.

Fator estimulador de colônias

Estimular a produção de células brancas do sangue em pacientes com câncer e Aids.

Pharming: produção de proteínas no leite

Fatores de coagulação sanguínea para tratar a hemofilia: anticorpos para tratar câncer de colo; terapia para fibrose cística etc.

Figura 1

m

5c

expoENEM 48

Figura 2

5 cm

127. (Enem 2010) Para explicar a absorção de nutrientes, bem como a função das microvilosidades das membranas das células que revestem as paredes internas do intestino delgado, um estudante realizou o seguinte experimento: Colocou 200 ml de água em dois recipientes. No primeiro recipiente, mergulhou, por 5 segundos, um pedaço de papel liso, como na Figura 1; no segundo recipiente, fez o mesmo com um pedaço de papel com dobras simulando as microvilosidades, conforme Figura 2. Os dados obtidos foram: a quantidade de água absorvida pelo papel liso foi de 8 ml, enquanto pelo papel dobrado foi de 12 ml.

10 cm 10 cm


Com base nos dados obtidos, infere-se que a função das microvilosidades intestinais com relação à absorção de nutrientes pelas células das paredes internas do intestino é a de a. manter o volume de absorção. b. aumentar a superfície de absorção. c. diminuir a velocidade de absorção. d. aumentar o tempo de absorção. e. manter a seletividade na absorção.

Fique esperto! É por absorção que os produtos finais da digestão dos alimentos passam à circulação, sendo esse processo facilitado pela grande quantidade de vilosidades e microvilosidades encontradas na parede do intestino delgado, as quais aumentam sua superfície de contato e, por conseguinte, a absorção.

veias carregando sangue para o fígado microvilosidades

células epiteliais

lúmen

camadas musculares

capilares sanguíneos

dobras circulares vilosidades

células epiteliais

vaso linfático

vilosidade

Parede intestinal

Estrutura da parede do intestino delgado. Em destaque, as vilosidades e as microvilosidades que aumentam consideravelmente a superfície de absorção intestinal.

128. (Enem 2010)

A partir da leitura do texto, que discute as causas do aparecimento de cáries, e da sua relação com as informações do dicionário, conclui-se que a cárie dental resulta, principalmente, de

A cárie dental resulta da atividade de bactérias que degradam os açúcares e os transformam em ácidos que corroem a porção mineralizada dos dentes. O flúor, juntamente com o cálcio, e um açúcar chamado xilitol agem inibindo esse processo. Quando não se escovam os dentes corretamente e neles acumulam-se restos de alimentos, as bactérias que vivem na boca aderem aos dentes, formando a placa bacteriana ou biofilme. Na placa, elas transformam o açúcar dos restos de alimentos em ácidos, que corroem o esmalte do dente formando uma cavidade, que é a cárie. Vale lembrar que a placa bacteriana se forma mesmo na ausência de ingestão de carboidratos fermentáveis, pois as bactérias possuem polissacarídeos intracelulares de reserva.

a. falta de flúor e de cálcio na alimentação diária da população brasileira. b. consumo exagerado do xilitol, um açúcar, na dieta alimentar diária do indivíduo. c. redução na proliferação bacteriana quando a saliva é desbalanceada pela má alimentação. d. uso exagerado do flúor, um agente que em alta quantidade torna-se tóxico à formação dos dentes. e. consumo excessivo de açúcares na alimentação e má higienização bucal, que contribuem para a proliferação de bactérias.

Disponível em: <http://www.diariodasaude.com.br>. Acesso em: 11 ago. 2010. (Adaptado.)

Cárie 1. destruição de um osso por corrosão progressiva. *cárie dentária: efeito da destruição da estrutura dentária por bactérias. HOUAISS, Antônio. Dicionário eletrônico. Versão 1.0. Rio de Janeiro: Objetiva, 2001. (Adaptado.)

Veja essa! Dentes perfeitos para rir à vontade Metade dos adultos brasileiros perde os dentes por falta de higiene. Mas ostentar um sorriso bonito e saudável não é nenhum bicho de sete cabeças. Os cuidados devem começar antes mesmo de nascer o primeiro. Para nosso desgosto, não contamos com incisivos de roedores, que crescem à medida que se desgastam. Nós, humanos, só temos

expoENEM 49


duas dentições: a de leite, até os 6 anos, e a permanente, que se completa, aos 17 anos ou mais, com os populares “dentes do juízo”, ou sisos, se é que eles decidem aparecer. Ao longo da vida, nossa dentição, [...] com os demais componentes da boca, terá de rasgar, esmagar, triturar e começar a digerir de 25 a 30 toneladas de alimentos. Suportará centenas de agressões e terá de enfrentar o constante ataque de bactérias que aderem à superfície para formar primeiro a placa dental, pegajosa e transparente, e depois o duro tártaro: em 1 g de placa arrancada do sulco gengival existem até 100 milhões de bactérias de 500 espécies diferentes – “especialistas em sobrevivência”, segundo a expressão dos odontólogos americanos Walter Loesche e Erika De Boever, da Universidade de Michigan. Alguns desses indesejados inquilinos bucais aproveitam qualquer ocasião para crescer de forma desmedida e liberar ácidos que literalmente dissolvem o esmalte da capa mais externa do dente, formada pelo tecido mais duro e mineralizado do corpo. O resultado dessa ação é um ponto de cárie que, se não for tratado, pode destruir o esmalte, perfurar a dentina e invadir a polpa. Para prevenir essa fatal decomposição, certos componentes da saliva, como as imunoglobinas, a mucina, o fosfato, a ureia e o bicarbonato, têm uma ação antibacteriana, neutralizam a acidez e remineralizam o esmalte. De fato, uma das funções vitais dos 27 mil litros de saliva que produzimos em nossa existência não é outra senão preservar os tecidos bucais. [...]

130. (Enem 2010) No ano de 2000, um vazamento em dutos de óleo na Baía de Guanabara (RJ) causou um dos maiores acidentes ambientais do Brasil. Além de afetar a fauna e a flora, o acidente abalou o equilíbrio da cadeia alimentar de toda a baía. O petróleo forma uma película na superfície da água, o que prejudica as trocas gasosas da atmosfera com a água e desfavorece a realização de fotossíntese pelas algas, que estão na base da cadeia alimentar hídrica. Além disso, o derramamento de óleo contribuiu para o envenenamento das árvores e, consequentemente, para a intoxicação da fauna e flora aquáticas, bem como conduziu à morte diversas espécies de animais, entre outras formas de vida, afetando também a atividade pesqueira. LAUBIER, L. Diversidade da Maré Negra. In: Scientific American Brasil 4(39), ago. 2005. (Adaptado.)

Disponível em: <http://super.abril.com.br/saude/dentes-perfeitos-rirvontade-446372.shtml>. Acesso em: 24 abr. 2011.

129. (Enem 2010) Alguns anfíbios e répteis são adaptados à vida subterrânea. Nessa situação, apresentam algumas características corporais como, por exemplo, ausência de patas, corpo anelado que facilita o deslocamento no subsolo e, em alguns casos, ausência de olhos.

Suponha que um biólogo tentasse explicar a origem das adaptações mencionadas no texto utilizando conceitos da teoria evolutiva de Lamarck. Ao adotar esse ponto de vista, ele diria que a. as características citadas no texto foram originadas pela seleção natural. b. a ausência de olhos teria sido causada pela falta de uso dos mesmos, segundo a lei do uso e desuso. c. o corpo anelado é uma característica fortemente adaptativa, mas seria transmitida apenas à primeira geração de descendentes. d. as patas teriam sido perdidas pela falta de uso e, em seguida, essa característica foi incorporada ao patrimônio genético e então transmitida aos descendentes. e. as características citadas no texto foram adquiridas por meio de mutações e depois, ao longo do tempo, foram selecionadas por serem mais adaptadas ao ambiente em que os organismos se encontram.

A situação exposta no texto e suas implicações a. indicam a independência da espécie humana com relação ao ambiente marinho. b. alertam para a necessidade do controle da poluição ambiental para redução do efeito estufa. c. ilustram a interdependência das diversas formas de vida (animal, vegetal e outras) e o seu hábitat. d. indicam a alta resistência do meio ambiente à ação do homem, além de evidenciar a sua sustentabilidade mesmo em condições extremas de poluição. e. evidenciam a grande capacidade animal de se adaptar às mudanças ambientais, em contraste com a baixa capacidade das espécies vegetais, que estão na base da cadeia alimentar hídrica. Fique esperto! As plantas e os demais organismos fotossintetizantes utilizam energia luminosa, água e dióxido de carbono (CO2) para a produção de substâncias orgânicas como a glicose, que lhes servem de alimento para obtenção de energia e de matéria para a produção de seus tecidos e órgãos. Esse é, de modo resumido, o processo da fotossíntese, em que é liberado o gás oxigênio, que serve aos animais (e às próprias plantas!) no processo da respiração. Fotossíntese básica energia luminosa

oxigênio

Se ligue! Lamarck imaginava que “o meio ambiente cria a necessidade de uma determinada a estrutura em um organismo. Este se esforça para responder a essa necessidade. Como resposta a esse esforço, há uma modificação na estrutura do organismo (lei do uso e desuso). Tal modificação é transmitida aos descendentes (Lei da Transmissão dos Caracteres Adquiridos)”.

dióxido de carbono

As propostas de Lamarck são, então, resumidas em dois princípios: a hipótese do uso e desuso e a hipótese da transmissão dos caracteres adquiridos.

água

A seguir, estão colocadas duas frases. Uma delas pode muito bem ser atribuída ao naturalista francês Jean-Baptiste de Lamarck (1744–1829). Qual delas é verdadeiramente lamarckista? a. O gafanhoto é verde porque vive na grama. b. O gafanhoto vive na grama porque é verde. Procure justificar sua resposta. expoENEM 50

As plantas fazem fotossíntese: utilizam água, dióxido de carbono e energia luminosa. Elas produzem substâncias orgânicas (alimento) e liberam oxigênio no ambiente.

Plantas e algas planctônicas servem de alimento a muitos animais, e estes a outros animais, em uma transferência de matéria e energia. Destruição dos organismos fotossintetizantes, seja no ambiente aquático ou no ambiente terrestre, implicará um desequilíbrio de toda a comunidade relacionada.


131. (Enem 2011)

Sabendo que a energia que a radiação carrega é diretamente proporcional a sua frequência, para que possamos ter noção do perigo que corremos caso a camada de ozônio se reduza a ponto de permitir a incidência da radiação UV-C na superfície da Terra, e utilizando os dados fornecidos no texto, calcule quantas vezes a maior energia da radiação UV-C é maior que o valor da maior energia da radiação UV-B. Considere as velocidades das radiações UV-B e UV-C iguais na atmosfera terrestre.

Belém é cercada por 39 ilhas, e suas populações convivem com ameaças de doenças. O motivo, apontado por especialistas, é a poluição da água do rio, principal fonte de sobrevivência dos ribeirinhos. A diarreia é frequente nas crianças e ocorre como consequência da falta de saneamento básico, já que a população não tem acesso à água de boa qualidade. Como não há água potável, a alternativa é consumir a do rio.

a. 1,2 vezes.

O LIBERAL. 8 jul. 2008. Disponível em: <http://www.oliberal.com.br>.

b. 1,8 vezes. c. 2,9 vezes.

O procedimento adequado para tratar a água dos rios, a fim de atenuar os problemas de saúde causados por microrganismos a essas populações ribeirinhas é a

d. 3,2 vezes. e. 4,0 vezes.

a. filtração. b. cloração.

Fique esperto!

c. coagulação. d. fluoretação.

• Ondas eletromagnéticas no ar apresentam aproximadamente a mesma velocidade.

e. decantação.

• Para qualquer onda, é possível utilizar a equação fundamental v = l· f, em que, para a mesma velocidade, comprimento de onda e frequência são grandezas inversamente proporcionais.

132. (Enem 2011) A pele humana, quando está bem hidratada, adquire boa elasticidade e aspecto macio e suave. Em contrapartida, quando está res- secada, perde sua elasticidade e se apresenta opaca e áspera. Para evitar o ressecamento da pele é necessário, sempre que possível, utilizar hidratantes umectantes, feitos geralmente à base de glicerina e polietilenoglicol:

• Quanto menor o comprimento de onda, maior a energia associada à radiação.

134.

HO OH OH | | | H2C — CH — CH2 glicerina

Gestação de quadrigêmeos era farsa, diz advogado de “supergrávida”

HO — CH2 — CH2 — O — CH2 — CH2 n — O — CH2 — CH2 — OH

Caso aconteceu em Taubaté, no interior de São Paulo.

polietilenoglicol

O advogado Enilson de Castro, que representa a mulher que disse estar grávida de quadrigêmeos em Taubaté, no interior de São Paulo, admitiu durante entrevista coletiva nesta sexta-feira (20) que a gestação era falsa. Ele não esclareceu, porém, o que levou Maria Verônica Vieira a mentir sobre a gravidez. “A gente ainda não pode responder essa pergunta”, disse. O advogado afirmou apenas que ela tem problemas psicológicos. A professora afirmou a ele que está “destroçada” com a situação. A história da gravidez de quadrigêmeos surgiu no início do ano e foi noticiada pelo G1. Na ocasião, a mulher disse em entrevistas que as quatro crianças eram meninas e teriam como primeiro nome Maria. (...)

BRASIL ESCOLA. Disponível em: <http://www.brasilescola.com>. Acesso em: 23 abr. 2010 (adaptado).

A retenção de água na superfície da pele, promovida pelos hidratantes, é consequência da interação dos grupos hidroxila dos agentes umectantes com a umidade contida no ambiente por meio de a. ligações iônicas. b. forças de London. c. ligações covalentes. d. forças dipolo-dipolo. e. ligações de hidrogênio.

Adaptado de: G1.

133. A redução da camada de ozônio, que bloqueia a maior parte da radiação nociva ao ser humano, fez com que a preocupação com a proteção contra radiação aumentasse. Entre as radiações emitidas pelo Sol, a ultravioleta é a mais comentada pelos meios de comunicação, por poder provocar o câncer de pele. Os raios ultravioleta são subdivididos em raios UV-A (320–400 nm), UV-B (290–320 nm) e UV-C (100–290 nm), dos quais os mais perigosos, UV-C, são bloqueados totalmente pelo ozônio na estratosfera. Os raios UV-A constituem o principal componente da radiação solar à qual estamos expostos, sendo responsáveis por danos mais leves. Já os raios UV-B, bloqueados em torno de 90% pela camada de ozônio, são os responsáveis por queimaduras na pele e apresentam potencial de provocar câncer de pele.

Avalia-se que cerca de 90% dos casos de câncer de pele sejam consequência da ação do UV-B sobre o tecido cutâneo, acumulada ao longo do tempo. Estima-se que cada 1% de redução na espessura da camada de O3, que atua justamente sobre o UV-B, represente um acréscimo de 2% na radiação UV que atinge a Terra, o que por sua vez significaria aumentar a incidência de câncer de pele em cerca de 4 a 6%. A.S. Ker, et al. “Notas sobre poluição do ar – III”.

expoENEM 51

Na possibilidade de uma gravidez que resulte em gêmeos de mesmo sexo, pode-se afirmar que a. certamente foram oriundos de fecundação de apenas um espermatozoide em um óvulo, seguida da formação de vários embriões, processo denominado poliembrionia. b. certamente foram oriundos de fecundações múltiplas, de vários espermatozoides no mesmo óvulo, de acordo com o número de gêmeos. c. certamente foram oriundos de espermatozoides que fecundaram óvulos distintos, originando cada um dos zigotos formados um organismo, processo denominado poliovulação. d. certamente a mãe fez inseminação artificial de vários embriões, quantos foram os gêmeos formados, situação corriqueira nos dias de hoje. e. apenas a informação do sexo dos gêmeos é insuficiente para determinar sua origem, quer seja por poliembrionia ou por poliovulação.


135. Maria consulta um oftalmologista e recebe a seguinte receita: LENTE ESFÉRICA

c.  F3C —

LENTE CILÍNDRICA

O.D.

– 2,00

– 0,50

O.E.

– 2,00

– 0,75

d.

Em seguida, vai à ótica para fazer o pedido das lentes para seus óculos. Chegando à loja, a vendedora mostra uma tabela com os diferentes materiais disponíveis com seus respectivos índices de refração. PLÁSTICAS

H3C

CH3 CH3

O

CH2

MINERAIS

Resina Cr39

1,499

Cristal Crown

1,523

Resina Orma

1,501

Cristal médio índice

1,601

Resina médio índice

1,560

Cristal Hi-Lite

1,701

Resina alto índice 1

1,600

Cristal Super Hi-Lite

1,800

Resina alto índice 2

1,660

Cristal Hiper-Hi-Lite

1,900

H3C e.  

CH3

O O

COOH OOCCH3

137.

Sindioptica RS.

A equação que relaciona o índice de refração da lente com os raios de curvatura das faces da lente, em função da vergência que se deseja, é dada por: V=

— O — CH — CH2 — NH — CH3 |

nlente –1 nmeio

Quando policiais, cientistas e médicos iniciaram investigação sobre remédios piratas no Sudeste da Ásia, descobriram, chocados, que quase metade dos antimaláricos apreendidos eram falsificados. Mais alarmante ainda foi a descoberta de que muitas das caixas, que deveriam conter comprimidos que salvam vidas, estavam contaminadas com safrol, composto cancerígeno usado para produzir ecstasy, uma droga ilícita. A presença do safrol destacou a ligação entre medicamentos falsos e associações criminosas, que florescem em uma zona cinzenta legal que premia falsificadores com lucros altos e baixo risco.

1 1 + R1 R2

Se Maria tem por objetivo ter as lentes mais finas, qual material deve escolher? E quais anomalias visuais essa lente deve corrigir? a. Cristal Hiper-Hi-Lite, para corrigir miopia e hipermetropia.

Katherine Rowland. “Falsificação de medicamentos”.

b. Resina Cr39, para corrigir miopia e astigmatismo. c. Cristal Crown, para corrigir hipermetropia e astigmatismo.

d. Cristal Hiper-Hi-Lite, para corrigir miopia e astigmatismo. e. Resina Cr39, para corrigir presbiopia e estrabismo.

Cl

Se ligue! • Na receita do oftalmologista, estão indicadas as vergências das lentes corretivas a serem utilizadas. • Em lentes esféricas, a vergência positiva indica a utilização de lente convergente, ao passo que o sinal negativo indica lente divergente.

• cadeia aromática;

CH3

Um laboratório analisou uma amostra de cloroguanida para verificar ua composição e encontrou a fórmula molecular e a porcentagem de carbono, em massa, igual a (Dados: Massas atômicas: H = 1; C = 12; N = 14; Cℓ = 35,5.)

b. C10H16CℓN5 e 49,7%. c. C11H16CℓN5 e 49,1%. d. C11H11CℓN5 e 53,1%. e. C11H11CℓN5 e 52,1%.

http://bioducando2010.blogspot.com.br/2010/05/ charges-sobre-biologia-as-pessoas-do.html

• cadeia insaturada; • cadeia com carbono terciário; • cadeia com carboxila; • cadeia que apresenta mais de 11 átomos de carbonos na estrutura. A estrutura que corresponde à pesquisa da empresa é

CH3    | CH H3C   CH2

NH

138. Observe a seguinte tirinha.

• cadeia homogênea;

NH

a. C11H16CℓN5 e 52,1%.

136. Para elaborar um medicamento anti-inflamatório, uma indústria farmacêutica iniciou uma pesquisa a fim de encontrar uma molécula para fabricar seu princípio ativo. Após várias pesquisas, chegou-se à conclusão de que a molécula deveria ter as seguintes características:

a. H   H      O   |  |     C—C—C— C   H2N |  |   H  NH2 b.

Proguanil é um fármaco antimalárico H Htambém H denominado cloroguanida: N N N CH3

O OH

Atualmente a clonagem transcende o simples conceito de produzir uma cópia de um organismo. Sua prática atual é muito abrangente quando se trata de clonagem terapêutica, por exemplo, em que se cultivam tecidos para reparos e transplantes. Sobre a cultura de tecidos e seus desdobramentos, assinale a afirmação correta. a. As pesquisas com células-tronco podem ser uma alternativa segura para a produção de tecidos e órgãos que, obtidos do próprio indivíduo, poderiam ser usados para restaurar tecidos ou órgãos lesados.

CH3   | CH    CO2H

b. Células-tronco são células indiferenciadas e totipotentes, isto é, que podem se transformar em qualquer célula especializada do expoENEM 52


corpo, com exceção das hemácias, que trazem em seu núcleo informações específicas para o transporte de gases. c. É possível cultivar colônias de células em processo de diferenciação a partir de células-tronco de seres humanos adultos, as quais poderão ser implantadas em qualquer pessoa, pois não oferecem risco de rejeição. d. A clonagem de tecidos pode ser reconhecida como clonagem reprodutiva, ao passo que a clonagem de organismos completos é denominada clonagem terapêutica.

jetos de carros, estradas e pontes, ou seja, em praticamente tudo que é confeccionado pelo homem. Entre os vários exemplos vamos analisar a construção de calçadas de concreto, em que encontramos frequentemente espaços deixados entre placas para que a variação de suas dimensões possa ocorrer de modo livre, sem prejudicar o piso. Nesses espaços, deixam-se terra, grama, ripas de madeira ou de plástico. Suponha que você queira concretar uma calçada de 20,01 m de comprimento por 2 m de largura, com apenas duas placas de concreto, deixando espaço entre elas e entre as placas e as beiradas, conforme indicado na figura. Considerando a dimensões das beiradas inalteradas (20,01 m e 2 m), assinale a alternativa que indica valores possíveis para X e L0 para que, ao enfrentar uma variação de 50°C a partir do comprimento inicial L0, a estrutura não sofra danos em razão da dilatação. Considere o coeficiente de dilatação volumétrico do concreto igual a 3 · 10–5°C–1.

e. Atualmente a clonagem é totalmente segura, pois se conhecem todos os seus procedimentos técnicos, e possíveis implicações éticas já foram superadas. 139. Quando se inicia a época de chuvas mais intensas, os noticiários passam a informar com frequência a ocorrência de tragédias causadas por deslizamentos de terra. Para evitar que os deslizamentos ocorram, sugere-se manter uma vegetação com raízes profundas, que prenda o solo ao sistema radicular e dificulte o processo de erosão. No entanto, em muitos locais isso não é respeitado, e o movimento de placas de terra torna-se inevitável. A infiltração de água de maneira contínua faz com que os poros sejam preenchidos por água, aumentando a densidade do solo e diminuindo a coesão entre as partículas, o que facilita a movimentação de blocos de terra. Na beira de estradas é comum encontrarmos obras de contenção de encostas. Suponha que uma família com residência na base de um morro deseje construir um muro para segurar um volume de terra que possa deslizar. O morador resolve calcular a força que o muro deve suportar caso ocorra um desprendimento de uma placa de terra de 100 m de comprimento, 2 m de profundidade constante e 10 m de largura, que forma 30° com a horizontal, conforme indica a ilustração que segue. 2m

vista lateral 100 m

20,01 m espaço para dilatar

x

Concreto

Concreto

x

2m

L0

a. L0 = 9,8 m b. L0 = 9,8 m c. L0 = 10 m d. L0 = 10 m e. L0 = 9,5 m

X = 10,25 cm X = 10 cm X = 2,5 mm X = 5 mm X = 25 cm

Tá ligado?

vista frontal 10 m

• Para a medida de comprimento, é necessário o coeficiente de dilatação linear.

30°

• Os espaços vazios serão ocupados pela soma das suas dilatações (DL = X + 2X + X = 4X), então podemos considerar o comprimento inicial como 2L0.

muro muro

2x

Considerando a densidade da terra encharcada com água igual a 1,7 g/cm3, determine o valor da força obtida pelo cálculo do morador, em meganewton, em razão do contato com a massa de terra que supostamente tende a deslizar. Considere a massa de terra como um bloco único movimentando-se e despreze quaisquer forças de atrito existentes. a. 17 MN

As histórias de Monteiro Lobato vão além de divertir e entreter o público infantil. Com muitas delas, ele trouxe à tona os problemas de saúde pública existentes no Brasil. Jeca Tatu é um dos personagens que serviram como ferramenta de campanha em favor do saneamento, além de esclarecer e educar a população sobre uma doença tropical que, na época, vitimava milhões de brasileiros.

b. 28 MN

Leia um trecho dessa história, que serve às questões 141 e 142.

c. 34 MN d. 54 MN e. 64 MN Fique esperto! • Em um plano inclinado, a força peso pode ser decomposta nas componentes tangencial e normal. • O volume do prisma de base retangular pode ser calculado pelo produto da área da base e da altura.

Jeca Tatu era um caboclo que vivia no campo na maior pobreza. Sua rotina baseava-se em ficar o dia inteiro sem fazer tarefa alguma, fumando seu cigarro de palha, bebendo sua pinga e observando o dia passar. Sua roupa parecia um trapo e andava o tempo todo descalço [...]. Um dia um médico passou em frente a casa e espantou-se com tanta miséria. Percebendo que o caboclo estava amarelado e muito magro, resolveu examiná-lo. Jeca disse a ele que sentia muito cansaço e dores pelo corpo. O médico constatou que se tratava de uma doença chamada amarelão. Explicou que tal doença era causada por pequenos vermes que entravam no seu corpo. Receitou-lhe, então, remédios e um par de botas. Adaptado de: Instituto de biociências.

140. A dilatação é um fenômeno que acontece de maneira despercebida pela maior parte das pessoas, pois normalmente não é visível sem a utilização de equipamentos adequados. Mas, em projetos de construção essas propriedades devem ser sempre levadas em consideração, para que as partes possam aumentar ou reduzir suas dimensões sem comprometer o funcionamento e a estrutura da construção. Essa preocupação pode ser observada em várias áreas de atuação do cotidiano, como em restaurações dentárias, montagem de computadores e pro-

141. A respeito dos vermes causadores da doença de Jeca Tatu, assinale a alternativa que apresenta apenas informações corretas.

expoENEM 53

a. Os vermes causadores do amarelão são denominados Wuchereria sp. e vivem alojados no intestino delgado humano. b. São vermes da espécie Taenia solium, parasitas dos vasos sanguíneos do sistema porta-hepático humano.


c. São vermes denominados Enterobius vermicularis, conhecidos pela migração por diversos órgãos do corpo humano, tais como fígado, coração e pulmões.

lante depende da inversão da corrente elétrica que circula na bobina. Por que a bobina executa o movimento de vai e vem? O que ocorrerá se aumentarmos a frequência com que essa inversão ocorre?

d. Há duas espécies conhecidas de nematelmintos causadores dessa doença: Necator americanus e Ancylostoma duodenale.

a. A inversão da corrente é provocada pela produção ora de cargas positivas, ora de cargas negativas, gerando o movimento oscilatório. Ao aumentarmos a frequência, o som produzido pelo alto-falante torna-se mais baixo.

e. O amarelão é uma doença causada pelos vermes Ancylostoma braziliensis e que se caracteriza pelo aparecimento de sintomas como fraqueza e apatia, ambos causados pela anemia que o verme provoca ao alimentar-se de sangue humano.

b. A inversão da corrente é provocada pela produção ora de cargas positivas, ora de cargas negativas, gerando o movimento oscilatório. Ao aumentarmos a frequência, o som produzido pelo alto-falante torna-se mais alto.

142. A recomendação médica para que Jeca Tatu usasse botas deve-se a. à prevenção de nova contaminação pelo parasito, cujas larvas presentes no solo penetram ativamente pela pele humana.

c. A inversão se deve à Lei de Coulomb. Ao aumentarmos a frequência, o som produzido pelo alto-falante torna-se mais forte.

b. à possibilidade de contaminação pelos ovos do parasito, que estando dispersos no solo podem penetrar pela pele.

d. A inversão da corrente provoca inversão do campo magnético no interior da bobina, produzindo forças magnéticas que invertem o sentido com a mesma frequência que ocorrem as inversões de sentido da corrente elétrica, provocando o movimento de vai e vem da bobina. Ao aumentarmos a frequência, o som produzido pelo alto-falante torna-se mais alto.

c. apenas ao conforto de Jeca, já que a criação de rede de esgoto e o uso de água tratada são as únicas medidas preventivas para essa doença. d. apenas como forma de resgate da dignidade de Jeca, já que o uso de botas não diminui o risco de contaminação pelo helminto causador da doença.

e. A inversão da corrente provoca inversão do campo magnético no interior da bobina, produzindo forças magnéticas variáveis gerando movimento oscilatório. Ao aumentarmos a frequência, o som produzido pelo alto-falante torna-se mais baixo.

e. à prevenção da contaminação por bactérias causadoras do tétano que, estando no solo, poderiam agravar o quadro de saúde de Jeca.

Fique esperto!

143. Em uma residência, encontramos diferentes equipamentos que utilizam alto-falantes como emissores de som: televisor, telefone, computador, aparelho de som, despertador, celular, campainha etc. O texto a seguir, retirado de um site informativo, tenta explicar de maneira simplificada o funcionamento de um alto-falante. Uma bobina percorrida por uma corrente elétrica comporta-se da mesma maneira que um ímã de barra com dois polos magnéticos, norte (N) e sul (S), orientados ao longo de um eixo imaginário (vide figura 1-a). Outro fato importante que permite a utilização das bobinas na estrutura dos alto-falantes é o seguinte: a inversão da corrente elétrica que circula em uma bobina inverte também o sentido do campo magnético que ela produz (veja as figuras 1-a e 1-b). N

• A passagem de corrente em uma bobina gera em suas extremidades um polo norte e um polo sul, como em um ímã em forma de barra (eletroímã).

144. (Enem 2011) O peróxido de hidrogênio é comumente utilizado como antisséptico e alvejante. Também pode ser empregado em trabalhos de restauração de quadros enegrecidos e no clareamento de dentes. Na presença de soluções ácidas de oxidantes, como o permanganato de potássio, este óxido decompõe-se, conforme a equação a seguir:

S +

S

5H2O2(aq)+2KMnO4(aq)+3H2SO4(aq)→5O2(aq)+2MnSO4(aq)+K2SO4(aq)+ H2O(l)

+

ROCHA-FILHO, R.C.R.; SILVA, R.R. Introdução aos cálculos da Química. São Paulo: McGraw-Hill, 1992.

N figura 1-a

figura 1-b

A figura 2 mostra esquematicamente a estrutura de um alto-falante. Esse aparelho consiste, basicamente, em uma bobina presa a um diafragma. Além de estar presa ao diafragma, a bobina é constantemente submetida ao campo magnético produzido por um ímã permanente. Sem ser percorrida por uma corrente elétrica, a bobina de cobre não interage com o imã permanente. Essa situação muda quando estabelecemos uma corrente elétrica no interior da bobina. Nessas condições, a bobina irá comportar-se como um imã que poderá ser atraído ou repelido pelo ímã permanente que existe na estrutura do alto-falante. ímã em forma de “disco”

som

• Corrente produzida pela rede elétrica em uma residência é alternada.

bobina que executa movimento de “vai e vem”

De acordo com a estequiometria da reação descrita, a quantidade de permanganato de potássio necessária para reagir completamente com 20,0 ml de uma solução 0,1 mol/l de peróxido de hidrogênio é igual a a. 2,0 · 100 mol. b. 2,0 · 10–3 mol. c. 8,0 · 10–1 mol. d. 8,0 · 10–4 mol. e. 5,0 · 10–3 mol.

145. O vinho é uma bebida obtida pela fermentação das uvas e está presente na humanidade há vários milênios. Considere uma garrafa com 750 ml de vinho e que apresenta uma graduação alcoólica de 13% (v/v). Levando em consideração que a densidade do etanol presente na bebida é de 0,8 g/ml, a concentração de etanol, em mol/l, nesta garrafa é (Massas molares: C = 12 g/mol; H = 1 g/mol; O = 16 g/mol.) a. 1,69 mol/l.

diafragma que oscila por estar preso à bobina

b. 2,13 mol/l.

figura 2

Biblioteca virtual. “Alto-falantes, microfones e telefones”.

Por meio do texto, podemos notar que o som produzido por um alto-faexpoENEM 54

c. 2,26 mol/l. d. 2,75 mol/l. e. 3,00 mol/l.


146. (Enem 2011) A cal (óxido de cálcio, CaO), cuja suspensão em água é muito usada como uma tinta de baixo custo, dá uma tonalidade branca aos troncos de árvores. Essa é uma prática muito comum em praças públicas e locais privados, geralmente usada para combater a proliferação de parasitas. Essa aplicação, também chamada de caiação, gera um problema: elimina microrganismos benéficos para a árvore.

148. (Enem 2011) Uma das modalidades presentes nas olimpíadas é o salto com vara. As etapas de um dos saltos de um atleta estão representadas na figura: Etapa I

Etapa II

a. difusão, pois a cal se difunde nos corpos dos seres do microambiente e os intoxica.

Atleta corre com a vara

Atleta apoia a vara no chão

b. osmose, pois a cal retira água do microambiente, tornando-o inviável ao desenvolvimento de microrganismos.

Etapa III

Etapa IV

Atleta atinge certa altura

Atleta cai em um colchão

SUPERINTERESSANTE. Disponível em: <http://super.abril.com.br>. Acesso em: 1º abr. 2010 (adaptado).

A destruição do microambiente, no tronco de árvores pintadas com cal, se deve ao processo de

c. oxidação, pois a luz solar que incide sobre o tronco ativa fotoquimicamente a cal, que elimina os seres vivos do microambiente. d. aquecimento, pois a luz do Sol incide sobre o tronco e aquece a cal, que mata os seres vivos do microambiente. e. vaporização, pois a cal facilita a volatilização da água para a atmosfera, eliminando os seres vivos do microambiente.

147. (Enem 2011) Em um manual de um chuveiro elétrico são encontradas informações sobre algumas características técnicas, ilustradas no quadro, como a tensão de alimentação, a potência dissipada, o dimensionamento do disjuntor ou fusível, e a área da seção transversal dos condutores utilizados.

CARACTERÍSTICAS TÉCNICAS Especificação Modelo

A

B

127

220

0

0

2 440

2 540

4 400

4 400

5 500

6 000

Disjuntor ou fusível (ampère)

50

30

Seção dos condutores

10

4

Tensão (V~)

Potência (Watt)

Fique esperto!

Uma pessoa adquiriu um chuveiro do modelo A e, ao ler o manual, verificou que precisava ligá-lo a um disjuntor de 50 ampères. No entanto, intrigou-se com o fato de que o disjuntor a ser utilizado para uma correta instalação de um chuveiro do modelo B devia possuir amperagem 40% menor. Considerando-se os chuveiros de modelos A e B, funcionando à mesma potência de 4 400 W, a razão entre as suas respectivas resistências elétricas, RA e RB, que justifica a diferença de dimensionamento dos disjuntores, é mais próxima de a. 0,3. b. 0,6.

• Após a pessoa adquirir velocidade e iniciar o salto, não havendo a ação de forças dissipativas, o sistema idealizado pode ser considerado conservativo. 149. (Enem 2011) Em um experimento realizado para determinar a densidade da água de um lago, foram utilizados alguns materiais conforme ilustrado: um dinamômetro D com graduação de 0 N a 50 N e um cubo maciço e homogêneo de 10 cm de aresta e 3 kg de massa. Inicialmente, foi conferida a calibração do dinamômetro, constatando-se a leitura de 30 N quando o cubo era preso ao dinamômetro e suspenso no ar. Ao mergulhar o cubo na água do lago, até que metade do seu volume ficasse submersa, foi registrada a leitura de 24 N no dinamômetro.

c. 0,8. d. 1,7.

D

e. 3,0. Tá ligado? • Potência de resistores pode ser calculada por: P=i·U P = R · i2 P = U2/R

expoENEM 55

® Interbits

Seletor de temperatura multitemperaturas

Desprezando-se as forças dissipativas (resistência do ar e atrito), para que o salto atinja a maior altura possível, ou seja, o máximo de energia seja conservada, é necessário que a. a energia cinética, representada na etapa I, seja totalmente convertida em energia potencial elástica, representada na etapa IV. b. a energia cinética, representada na etapa II, seja totalmente convertida em energia potencial gravitacional, representada na etapa IV. c. a energia cinética, representada na etapa I, seja totalmente convertida em energia potencial gravitacional, representada na etapa III. d. a energia potencial gravitacional, representada na etapa II, seja totalmente convertida em energia potencial elástica, representada na etapa IV. e. a energia potencial gravitacional, representada na etapa I, seja totalmente convertida em energia potencial elástica, representada na etapa III.


Considerando que a aceleração da gravidade local é de 10 m/s2, a densidade da água do lago, em g/cm3, é a. 0,6.

d. 2,4.

b. 1,2.

e. 4,8.

Em qual das situações a seguir está representado o fenômeno descrito no texto? a. Ao se esconder atrás de um muro, um menino ouve a conversa de seus colegas. b. Ao gritar diante de um desfiladeiro, uma pessoa ouve a repetição do seu próprio grito.

c. 1,5.

c. Ao encostar o ouvido no chão, um homem percebe o som de uma locomotiva antes de ouvi-lo pelo ar.

Se ligue! • Volume do cubo = (aresta)3 = (a)3 • Para calcular o empuxo, é necessário conhecer o volume da parte submersa. 150. Os brinquedos radicais são os preferidos dos adolescentes. Entre eles, a “Big Tower”, localizada no parque Beto Carrero World, é uma das mais emocionantes, com 100 metros de queda livre. Quando alcança uma velocidade de 126 km/h, passa a atuar uma força para frear o carrinho, e a força trocada entre as pessoas e o assento é aproximadamente igual a 2,6 g. Isto é, a pessoa troca com o assento uma força equivalente a 2,6 vezes o seu peso. Com o objetivo de descobrir o tempo aproximado que dura essa aventura siga os seguintes passos: 1°.  passo: determine o tempo gasto pelo veículo para alcançar velocidade máxima. 2°.  passo: determine a aceleração a que o veículo fica sujeito no momento em que passa a atuar a força para freá-lo. 3°.  passo: supondo que a força se mantenha constante até a parada no solo, determine o tempo gasto para percorrer o trecho em que ocorre essa desaceleração constante. 4°.  passo: some os tempos obtidos no 1°. e no 3°. passo para obter o tempo total dessa brincadeira. Considerando g = 10 m/s2 e desprezando quaisquer atritos envolvidos durante a queda, assinale a alternativa que indica o tempo total aproximado da queda até o solo. a. 2,2 s

d.  5,7 s

b. 3,1 s

e.  6,8 s

d. Ao ouvir uma ambulância se aproximando, uma pessoa percebe o som mais agudo do que quando aquela se afasta. e. Ao emitir uma nota musical muito aguda, uma cantora de ópera faz com que uma taça de cristal se despedace. Fique esperto! • Difração é a propriedade que as ondas apresentam de contornar obstáculos.

152. Observe atentamente o experimento realizado em uma aula de Química. • Pegue quatro clipes e obtenha um fio. • Prenda o fio em uma pinça de madeira ou um grampo de roupa. • Coloque o fio na solução de cloreto de sódio e leve-o à chama do bico de gás, observando atentamente a cor emitida. • Lave bem o fio e repita o procedimento para o cloreto de estrôncio.

a. transferência de energia aos elétrons dos sais, fazendo com que eles se passem para níveis energéticos mais altos, emitindo luz. b. transferência de energia aos elétrons dos sais, fazendo com que eles se passem para níveis energéticos mais baixos, emitindo luz.

c. 4,8 s

c. transferência de energia aos elétrons dos sais, fazendo com que eles passem para níveis energéticos mais altos e, ao voltarem a níveis energéticos inferiores, eles emitam a energia absorvida sob a forma de luz.

Tá ligado? • Em uma queda livre o veículo realiza um movimento uniformemente variado (MUV), com aceleração igual a a = g = 10 m/s2.

d. transferência de energia aos elétrons dos sais, fazendo com que eles passem para níveis energéticos mais baixos e, ao voltarem a níveis energéticos superiores, eles emitam a energia absorvida sob a forma de luz.

151. (Enem 2011) Ao diminuir o tamanho de um orifício atravessado por um feixe de luz, passa menos luz por intervalo de tempo, e próximo da situação de completo fechamento do orifício, verifica-se que a luz apresenta um comportamento como o ilustrado nas figuras. Sabe-se que o som, dentro de suas particularidades, também pode se comportar dessa forma. lâmpada

Durante a experiência, o aluno deveria verificar o aparecimento de uma coloração amarela para o sal de sódio e vermelha para o sal de estrôncio. Segundo o modelo de Bohr, isto se deve à

e. coloração dos sais em água, sendo o cloreto de sódio amarelo e o cloreto de estrôncio vermelho. 153.  A figura a seguir mostra algumas substâncias que constituem a composição de um cigarro e onde podem ser encontradas.

buraco

raios de luz

® Interbits

FIOLHAIS, C. Física divertida. Brasília: UnB, 2000 (adaptado).

expoENEM 56

Os grupos funcionais orgânicos presentes nas substâncias encontradas em desinfetantes, removedor de tintas e esmaltes, combustível de foguetes e no fluido de embalsamento são, respectivamente,


C   OH |

b. 

O

,

R1        R2

  | — C — OH , 1        2 ,  e  R R   |

,

O || C

, R1        R2

  C  

O H

O   | || d.  — C — OH , , C R1        R2   | OH | e. 

 e

O || C

OH | c. 

,

OH

,

  C  

O , OH

  C  

  C  

O

  C  

  C  

O

http://www2.uol.com.br/niquel/tiras_mes/2012/04/06.gif

a. 

155. Observe a seguinte tirinha, de Fernando Gonsales.

O || C

OH |

.

H

O H

.

A tira faz alusão ao processo de “sono hibernal” realizado pelos ursos, muitas vezes confundido pelos leigos como um processo de hibernação. Segundo os fisiologistas, estão hibernando os animais de sangue quente que passam o inverno em estágio letárgico, ou seja, um estado no qual a temperatura do corpo é muito reduzida e assim também se reduzem o metabolismo, a respiração, a taxa cardíaca etc. Os mamíferos que hibernam pertencem a três ordens: insetívoros, quirópteros e roedores, incluindo, entre outros, marmotas, hamsters, ouriços, esquilos e muitos morcegos. Os ursos não são considerados verdadeiros hibernadores porque, apesar de dormirem a maior parte do inverno, suas temperaturas corpóreas não descem mais que alguns graus. Portanto, o urso mantém uma taxa metabólica relativamente alta, podendo ser acordado sem passar por um longo período de reaquecimento.

Sobre esse assunto, podemos afirmar corretamente que o urso adota esse comportamento de sono hibernal durante o inverno porque a. um animal de grande porte e que apresenta taxa metabólica relativamente baixa pode deitar-se em uma caverna e dormir durante meses, enquanto vai usando pouco a pouco suas reservas de gordura. b. fingindo dormir, pode ser confundido com um hibernante verdadeiro e assim capturar presas com mais facilidade e sem gastar energia. c. simplesmente não sente fome durante o inverno. d. o dispêndio de energia para a captura de presas sobre a neve é bem maior do que no verão, quando se locomove mais facilmente e sem gasto de energia. e. pode acordar facilmente e assim se defender de possíveis predadores, como esquilos e morcegos.

  | e  — C — OH .   |

O

OH | e 

.

H

O e R        R1 .

H

154. Responsáveis pela fabricação da Coca-Cola e da Pepsi terão de alterar a composição do corante caramelo dos seus refrigerantes. A decisão foi baseada na legislação da Califórnia, nos Estados Unidos, que obriga as empresas a incluir nos rótulos das bebidas com certas doses de substâncias cancerígenas essa informação. A Coca-Cola e a Pepsi controlam cerca de 90% do mercado norte-americano de refrigerantes. As alterações na composição da Coca-Cola e da Pepsi, que começaram a ser feitas na Califórnia, vão ser ampliadas para todo o país. Mas a expectativa, segundo analistas, é que se estenda para os outros países. [...] O objetivo da medida, segundo a Coca-Cola, é reduzir a substância química denominada 4-metilimizadol – N CH3

N H

– apontada como uma ameaça à saúde. De acordo com Garza-Ciarlante, a empresa tomou a iniciativa, apesar de acreditar que não há risco para a saúde pública que justifique a alteração na composição da Coca-Cola. A associação norte-americana que representa a indústria das bebidas informou que a Califórnia adicionou o corante à lista de substâncias cancerígenas sem provas que associem o seu consumo ao aparecimento da doença. Utilidade pública. “Coca-Cola e Pepsi terão de informar no rótulo riscos à saúde”.

156. De acordo com a Primeira Lei de Mendel, um caráter é determinado por um par de fatores (alelos) que se separam de maneira independente na formação dos gametas. Assim, no momento da fecundação, ocorre a combinação dos alelos carregados pelos gametas, gerando o genótipo do descendente. Sobre esse fenômeno, é correto afirmar que a. a proporção genotípica esperada para cruzamentos entre dois indivíduos heterozigóticos para um certo caráter é 50% dominante e 50% recessivo. b. a proporção fenotípica esperada para cruzamentos entre dois indivíduos homozigóticos dominantes para um certo caráter é 25% homozigoto dominante, 50% heterozigoto dominante e 25% homozigoto recessivo. c. na ausência de dominância entre os genes alelos, espera-se que 50% dos indivíduos gerados do cruzamento entre dois indivíduos heterozigotos sejam idênticos a seus progenitores. d. quando um filho de pais normais apresenta uma anomalia hereditária, essa manifestação é condicionada por um gene dominante. e. filhos de pais normais que nascem com determinada anomalia hereditária são obrigatoriamente homozigotos recessivos, e seus irmãos que nasceram normais são obrigatoriamente heterozigotos. 157. (Enem 2011) Os personagens da figura estão representando uma situação hipotética de cadeia alimentar.

A respeito do texto e da molécula de 4-MEI, é correto afirmar que a. a molécula de 4-MEI apresenta a fórmula C4H4N2 e não apresenta nenhum risco à saúde. b. a molécula de 4-MEI apresenta a fórmula C4H6N2 e a função orgânica amina. c. a molécula de 4-MEI apresenta a fórmula C4H6N2 e apresenta carbono assimétrico. d. a molécula de 4-MEI apresenta a fórmula C4H6N2 e a função orgânica amida. e. a molécula de 4-MEI apresenta a fórmula C4H4N2 e não terá sua concentração reduzida na bebida. expoENEM 57

Disponível em: <http://www.cienciasgaspar.blogspot.com>.


Suponha que, em cena anterior à apresentada, o homem tenha se alimentado de frutas e grãos que conseguiu coletar. Na hipótese de, nas próximas cenas, o tigre ser bem-sucedido e, posteriormente, servir de alimento aos abutres, tigre e abutres ocuparão, respectivamente, os níveis tróficos de

160. (Enem 2011) Um instituto de pesquisa norte-americano divulgou recentemente ter criado uma “célula sintética”, uma bactéria chamada de Mycoplasma mycoides. Os pesquisadores montaram uma sequência de nucleotídeos, que formam o único cromossomo dessa bactéria, o qual foi introduzido em outra espécie de bactéria, a Mycoplasma capricolum. Após a introdução, o cromossomo da M. capricolum foi neutralizado e o cromossomo artificial de M. mycoides começou a gerenciar a célula, produzindo suas proteínas.

a. produtor e consumidor primário. b. consumidor primário e consumidor secundário. c. consumidor secundário e consumidor terciário. d. consumidor terciário e produtor.

GILBSON et al. Creation of a bacterial cell controlled by a chemically synthesized genome. Science, v. 329, 2010 (adaptado).

e. consumidor secundário e consumidor primário. 158. (Enem 2011) Um paciente deu entrada em um pronto-socorro apresentando os seguintes sintomas: cansaço, dificuldade em respirar e sangramento nasal. O médico solicitou um hemograma ao paciente para definir um diagnóstico. Os resultados estão dispostos na tabela.

A importância dessa inovação tecnológica para a comunidade científica se deve à a. possibilidade de sequenciar os genomas de bactérias para serem usados como receptores de cromossomos artificiais. b. capacidade de criação, pela ciência, de novas formas de vida, utilizando substâncias como carboidratos e lipídios.

Constituinte

Número normal

Paciente

Glóbulos vermelhos

4,8 milhões/mm3

4 milhões/mm3

c. possibilidade de produção em massa da bactéria Mycoplasma capricolum para sua distribuição em ambientes naturais.

Glóbulos brancos

(5 000 – 10 000)/mm3

9 000/ mm3

Plaquetas

(250 000 – 400 000)/mm3

200 000/ mm3

d. possibilidade de programar geneticamente microrganismos ou seres mais complexos para produzir medicamentos, vacinas e combustíveis. e. capacidade da bactéria Mycoplasma capricolum de expressar suas proteínas na bactéria sintética e estas serem usadas na indústria.

TORTORA, G. J. Corpo Humano: fundamentos de anatomia e fisiologia. Porto Alegre: Artmed, 2000 (adaptado)

Relacionando os sintomas apresentados pelo paciente com os resultados de seu hemograma, constata-se que

161. (Enem 2011)

a. o sangramento nasal é devido à baixa quantidade de plaquetas, que são responsáveis pela coagulação sanguínea.

Segundo dados do Balanço Energético Nacional de 2008, do Ministério das Minas e Energia, a matriz energética brasileira é composta por hidrelétrica (80%), termelétrica (19,9%) e eólica (0,1%). Nas termelétricas, esse percentual é dividido conforme o combustível usado, sendo: gás natural (6,6%), biomassa (5,3%), derivados de petróleo (3,3%), energia nuclear (3,1%) e carvão mineral (1,6%). Com a geração de eletricidade da biomassa, pode-se considerar que ocorre uma compensação do carbono liberado na queima do material vegetal pela absorção desse elemento no crescimento das plantas. Entretanto, estudos indicam que as emissões de metano (CH4) das hidrelétricas podem ser comparáveis às emissões de CO2 das termelétricas.

b. o cansaço ocorreu em função da quantidade de glóbulos brancos, que são responsáveis pela coagulação sanguínea. c. a dificuldade respiratória decorreu da baixa quantidade de glóbulos vermelhos, que são responsáveis pela defesa imunológica. d. o sangramento nasal é decorrente da baixa quantidade de glóbulos brancos, que são responsáveis pelo transporte de gases no sangue. e. a dificuldade respiratória ocorreu pela quantidade de plaquetas, que são responsáveis pelo transporte de oxigênio no sangue.

MORET, A. S.; FERREIRA, I. A. As hidrelétricas do Rio Madeira e os impactos socioambientais da eletrificação no Brasil. Revista Ciência Hoje. V. 45, n° 265, 2009 (adaptado).

159. (Enem 2011) Nos dias de hoje, podemos dizer que praticamente todos os seres humanos já ouviram em algum momento falar sobre o DNA e seu papel na hereditariedade da maioria dos organismos. Porém, foi apenas em 1952, um ano antes da descrição do modelo do DNA em dupla hélice por Watson e Crick, que foi confirmado sem sombra de dúvidas que o DNA é material genético. No artigo em que Watson e Crick descreveram a molécula de DNA, eles sugeriram um modelo de como essa molécula deveria se replicar. Em 1958, Meselson e Stahl realizaram experimentos utilizando isótopos pesados de nitrogênio que foram incorporados às bases nitrogenadas para avaliar como se daria a replicação da molécula. A partir dos resultados, confirmaram o modelo sugerido por Watson e Crick, que tinha como premissa básica o rompimento das pontes de hidrogênio entre as bases nitrogenadas.

No Brasil, em termos do impacto das fontes de energia no crescimento do efeito estufa, quanto à emissão de gases, as hidrelétricas seriam consideradas como uma fonte a. limpa de energia, contribuindo para minimizar os efeitos deste fenômeno. b. eficaz de energia, tornando-se o percentual de oferta e os benefícios verificados. c. limpa de energia, não afetando ou alterando os níveis dos gases do efeito estufa. d. poluidora, colaborando com níveis altos de gases de efeito estufa em função de seu potencial de oferta. e. alternativa, tomando-se por referência a grande emissão de gases de efeito estufa das demais fontes geradoras.

GRIFFITHS, A. J. F. et al. Introdução à Genética. Rio de Janeiro: Guanabara Koogan, 2002.

Considerando a estrutura da molécula de DNA e a posição das pontes de hidrogênio nela, os experimentos realizados por Meselson e Stahl a respeito da replicação dessa molécula levaram à conclusão de que

162. (Enem 2011)

d. a replicação do DNA é conservativa, isto é, as fitas filhas consistem de moléculas de DNA parental.

Diferente do que o senso comum acredita, as lagartas de borboletas não possuem voracidade generalizada. Um estudo mostrou que as borboletas de asas transparentes da família Ithomiinae, comuns na Floresta Amazônica e na Mata Atlântica, consomem, sobretudo, plantas da família Solanaceae, a mesma do tomate. Contudo, os ancestrais dessas borboletas consumiam espécies vegetais da família Apocinaceae, mas a quantidade dessas plantas parece não ter sido suficiente para garantir o suprimento alimentar dessas borboletas. Dessa forma, as solanáceas tornaram-se uma opção de alimento, pois são abundantes na Mata Atlântica e na Floresta Amazônica.

e. a replicação é semiconservativa, isto é, as fitas filhas consistem de uma fita molde e uma fita codificadora.

Cores ao vento. Genes e fósseis revelam origem e diversidade de borboletas sul-americanas. Revista Pesquisa FAPESP. N° 170, 2010 (adaptado).

a. a replicação do DNA é conservativa, isto é, a fita dupla filha é recém-sintetizada e o filamento parental é conservado. b. a replicação do DNA é dispersiva, isto é, as fitas filhas contêm DNA recém-sintetizado e parentais em cada uma das fitas. c. a replicação é semiconservativa, isto é, as fitas filhas consistem de uma fita parental e uma recém-sintetizada.

expoENEM 58


Nesse texto, a ideia do senso comum é confrontada com os conhecimentos científicos, ao se entender que as larvas das borboletas Ithomiinae encontradas atualmente na Mata Atlântica e na Floresta Amazônica, apresentam

O gás mencionado no texto é produzido a. como subproduto da respiração aeróbia bacteriana. b. pela degradação anaeróbia de matéria orgânica por bactérias. c. como produto da fotossíntese de organismos pluricelulares autotróficos.

a. facilidade em digerir todas as plantas desses locais. b. interação com as plantas hospedeiras da família Apocinaceae. c. adaptação para se alimentar de todas as plantas desses locais.

d. pela transformação química do gás carbônico em condições anaeróbias.

d. voracidade indiscriminada por todas as plantas existentes nesses locais.

e. pela conversão, por oxidação química, do gás carbônico sob condições aeróbias.

e. especificidade pelas plantas da família Solanaceae existentes nesses locais.

166. (Enem 2011)

163. (Enem 2011)

Colocaram a culpa do aquecimento global nas vacas.

Os vaga-lumes machos e fêmeas emitem sinais luminosos para se atraírem para o acasalamento. O macho reconhece a fêmea de sua espécie e, atraído por ela, vai ao seu encontro. Porém, existe um tipo de vaga-lume, o Photuris, cuja fêmea engana e atrai os machos de outro tipo, o Photinus fingindo ser desse gênero. Quando o macho Photinus se aproxima da fêmea Photinus, muito maior que ele, é atacado e devorado por ela. BERTOLDI, O. G.; VASCONCELLOS, J. R. Ciência & sociedade: a aventura da vida, a aventura da tecnologia. São Paulo: Scipione, 2000 (adaptado).

E o que faremos?

Culparemos as galinhas

A relação descrita no texto, entre a fêmea do gênero Photuris e o macho do gênero Photinus, é um exemplo de a. comensalismo.

www.explosm.blogsapot.com

b. inquilinismo. c. cooperação.

De acordo com o relatório “A grande sombra da pecuária” (Livestock’s Long Shadow), feito pela Organização das Nações Unidas para a Agricultura e a Alimentação, o gado é responsável por cerca de 18% do aquecimento global, uma contribuição maior que a do setor de transportes.

d. predatismo. e. mutualismo. 164. (Enem 2011) O controle biológico, técnica empregada no combate a espécies que causam danos e prejuízos aos seres humanos, é utilizado no combate à lagarta que se alimenta de folhas de algodoeiro. Algumas espécies de borboleta depositam seus ovos nessa cultura. A microvespa Trichogramma sp. introduz seus ovos nos ovos de outros insetos, incluindo os das borboletas em questão. Os embriões da vespa se alimentam do conteúdo desses ovos e impedem que as larvas de borboleta se desenvolvam. Assim, é possível reduzir a densidade populacional das borboletas até níveis que não prejudiquem a cultura. A técnica de controle biológico realizado pela microvespa Trichogramma sp. consiste na a. introdução de um parasita no ambiente da espécie que se deseja combater. b. introdução de um gene letal nas borboletas para diminuir o número de indivíduos. c. competição entre a borboleta e a microvespa para a obtenção de recursos. d. modificação do ambiente para selecionar indivíduos melhor adaptados.

Disponível em: www.conpet.gov.br. Acesso em: 22 jun. 2010.

A criação de gado em larga escala contribui para o aquecimento global por meio da emissão de a. metano durante o processo de digestão. b. óxido nitroso durante o processo de ruminação. c. clorofluorcarbono durante o transporte de carne. d. óxido nitroso durante o processo respiratório. e. dióxido de enxofre durante o consumo de pastagens.

167. (Enem 2010) Um agricultor, buscando o aumento da produtividade de sua lavoura, utilizou o adubo NPK (nitrogênio, fósforo e potássio) com alto teor de sais minerais. A irrigação dessa lavoura é feita por canais que são desviados de um rio que abastece os canais, devido à contaminação das águas pelo excesso de adubo usado pelo agricultor.

e. aplicação de inseticidas a fim de diminuir o número de indivíduos que se deseja combater.

Que processo biológico pode ter sido provocado na água do rio pelo uso do adubo NPK? a. Lixiviação, processo em que ocorre a lavagem do solo, que acaba disponibilizando os nutrientes para a água do rio. b. Acidificação, processo em que os sais, ao se dissolverem na água do rio, formam ácidos.

165. (Enem 2011) Moradores sobreviventes da tragédia que destruiu aproximadamente 60 casas no Morro do Bumba, na Zona Norte de Niterói (RJ), ainda defendem a hipótese de o deslizamento ter sido causado por uma explosão provocada por gás metano, visto que esse local foi um lixão entre os anos 1960 e 1980. Jornal Web. Disponível em: http://www.ojornalweb.com. Acesso em: 12 abr. 2010 (adaptado).

expoENEM 59

c. Eutrofização, ocasionada pelo aumento do fósforo e nitrogênio dissolvidos na água, que resulta na proliferação do fitoplâncton. d. Aquecimento, decorrente do aumento de sais dissolvidos na água do rio, que eleva sua temperatura. e. Denitrificação, processo em que o excesso de nitrogênio que chega ao rio é disponibilizado para a atmosfera, prejudicando o desenvolvimento dos peixes.


168. (Enem 2010) A figura representa uma cadeia alimentar em uma lagoa. As setas indicam o sentido do fluxo de energia entre os componentes dos níveis tróficos.

171. (Enem 2009) Confirmada pelos cientistas e já sentida pela população mundial, a mudança climática global é hoje o principal desafio socioambiental a ser enfrentado pela humanidade. Mudança climática é o nome que se dá ao conjunto de alterações nas condições do clima da Terra pelo acúmulo de seis tipos de gases na atmosfera – sendo os principais o dióxido de carbono (CO2) e o metano (CH4) – emitidos em quantidade excessiva através da queima de combustíveis (petróleo e carvão) e do uso inadequado do solo. SANTILLI, M. Mudança climática global. Almanaque Brasil Socioambiental 2008. São Paulo, 2007 (adaptado).

Suponha que, ao invés de superaquecimento, o planeta sofresse uma queda de temperatura, resfriando-se como numa era glacial, nesse caso a. a camada de geleiras, bem como o nível do mar, diminuiriam. b. as geleiras aumentariam, acarretando alterações no relevo do continente e no nível do mar. c. o equilíbrio do clima do planeta seria reestabelecido, uma vez que ele está em processo de aquecimento. d. a fauna e a flora das regiões próximas ao círculo polar ártico e antártico nada sofreriam com a glaciação. e. os centros urbanos permaneceriam os mesmos, sem prejuízo à população humana e ao seu desenvolvimento.

Sabendo-se que o mercúrio se acumula nos tecidos vivos, que componente dessa cadeia alimentar apresentará maior teor de mercúrio no organismo se nessa lagoa ocorrer um derramamento desse metal? a. As aves, pois são os predadores do topo dessa cadeia e acumulam mercúrio incorporado pelos componentes dos demais elos. b. Os caramujos, pois se alimentam das raízes das plantas, que acumulam maior quantidade de metal. c. Os grandes peixes, pois acumulam o mercúrio presente nas plantas e nos peixes pequenos. d. Os pequenos peixes, pois acumulam maior quantidade de mercúrio, já que se alimentam das plantas contaminadas.

172. (Enem 2009)

e. As plantas aquáticas, pois absorvem grande quantidade de mercúrio da água através de suas raízes e folhas.

O lixo orgânico de casa – constituído de restos de verduras, frutas, legumes, cascas de ovo, aparas de grama, entre outros –, se for depositado nos lixões, pode contribuir para o aparecimento de animais e de odores indesejáveis. Entretanto, sua reciclagem gera um excelente adubo orgânico, que pode ser usado no cultivo de hortaliças, frutíferas e plantas ornamentais. A produção do adubo ou composto orgânico se dá por meio da compostagem, um processo simples que requer alguns cuidados especiais. O material que é acumulado diariamente em recipientes próprios deve ser revirado com auxílio de ferramentas adequadas, semanalmente, de forma a homogeneizá-lo. É preciso também umedecê-lo periodicamente. O material de restos de capina pode ser intercalado entre uma camada e outra de lixo da cozinha. Por meio desse método, o adubo orgânico estará pronto em aproximadamente dois a três meses.

169. (Enem 2010) O despejo de dejetos de esgotos domésticos e industriais vem causando sérios problemas aos rios brasileiros. Esses poluentes são ricos em substâncias que contribuem para a eutrofização de ecossistemas, que é um enriquecimento da água por nutrientes, o que provoca um grande crescimento bacteriano e, por fim, pode promover escassez de oxigênio. Uma maneira de evitar a diminuição da concentração de oxigênio no ambiente é: a. Aquecer as águas dos rios para aumentar a velocidade de decomposição dos dejetos. b. Retirar do esgoto os materiais ricos em nutrientes para diminuir a sua concentração nos rios. c. Adicionar bactérias anaeróbicas às águas dos rios para que elas sobrevivam mesmo sem o oxigênio.

Como usar o lixo orgânico em casa? Ciência Hoje, v. 42, jun. 2008 (adaptado).

d. Substituir produtos não degradáveis por biodegradáveis para que as bactérias possam utilizar os nutrientes. e. Aumentar a solubilidade dos dejetos no esgoto para que os nutrientes fiquem mais acessíveis às bactérias. 170. (Enem 2010) O aquecimento global, ocasionado pelo aumento do efeito estufa, tem como uma de suas causas a disponibilização acelerada de átomos de carbono para a atmosfera. Essa disponibilização acontece, por exemplo, na queima de combustíveis fósseis, como a gasolina, os óleos e o carvão, que libera o gás carbônico (CO2) para a atmosfera. Por outro lado, a produção de metano (CH4), outro gás causador do efeito estufa, está associada à pecuária e à degradação de matéria orgânica em aterros sanitários. Apesar dos problemas causados pela disponibilização acelerada dos gases citados, eles são imprescindíveis à vida na Terra e importantes para a manutenção do equilíbrio ecológico, porque, por exemplo, o a. metano é fonte de carbono para os organismos fotossintetizantes. b. metano é fonte de hidrogênio para os organismos fotossintetizantes. c. gás carbônico é fonte de energia para os organismos fotossintetizantes.

Suponha que uma pessoa, desejosa de fazer seu próprio adubo orgânico, tenha seguido o procedimento descrito no texto, exceto no que se refere ao umedecimento periódico do composto. Nessa situação, a. o processo de compostagem iria produzir intenso mau cheiro. b. o adubo formado seria pobre em matéria orgânica que não foi transformada em composto. c. a falta de água no composto vai impedir que microrganismos decomponham a matéria orgânica. d. a falta de água no composto iria elevar a temperatura da mistura, o que resultaria na perda de nutrientes essenciais. e. apenas microrganismos que independem de oxigênio poderiam agir sobre a matéria orgânica e transformá-la em adubo.

173. (Enem 2009) Suponha que o chefe do departamento de administração de uma empresa tenha feito um discurso defendendo a ideia de que os funcionários deveriam cuidar do meio ambiente no espaço da empresa. Um dos funcionários levantou-se e comentou que o conceito de meio ambiente não era claro o suficiente para se falar sobre esse assunto naquele lugar. Considerando que o chefe do departamento de administração entende que a empresa é parte do meio ambiente, a definição que mais se aproxima dessa concepção é:

d. gás carbônico é fonte de carbono inorgânico para os organismos fotossintetizantes. e. gás carbônico é fonte de oxigênio molecular para os organismos heterotróficos aeróbios. expoENEM 60

a. Região que inclui somente cachoeiras, mananciais e florestas. b. Apenas locais onde é possível o contato direto com a natureza. c. Locais que servem como áreas de proteção onde fatores bióticos são preservados. d. Apenas os grandes biomas, por exemplo, Mata Atlântica, Mata Amazônica, Cerrado e Caatinga.


e. Qualquer local em que haja relação entre fatores bióticos e abióticos, seja ele natural ou urbano.

Para o reflorestamento da região desmatada, a. a espécie 8 é mais indicada que a 1, uma vez que aquela possui melhor adaptação a regiões com maior incidência de luz.

174. (Enem 2009)

b. recomenda-se a utilização de espécies pioneiras, isto é, aquelas que suportam alta incidência de luz, como as espécies 2, 3 e 5.

O cultivo de camarões de água salgada vem se desenvolvendo muito nos últimos anos na região Nordeste do Brasil e, em algumas localidades, passou a ser a principal atividade econômica. Uma das grandes preocupações dos impactos negativos dessa atividade está relacionada à descarga, sem nenhum tipo de tratamento, dos efluentes dos viveiros diretamente no ambiente marinho, em estuários ou em manguezais. Esses efluentes possuem matéria orgânica particulada e dissolvida, amônia, nitrito, nitrato, fosfatos, partículas de sólidos em suspensão e outras substâncias que podem ser consideradas contaminantes potenciais. CASTRO, C. B.; ARAGÃO, J. S.; COSTA-LOTUFO, L. V. Monitoramento da toxicidade de efluentes de uma fazenda de cultivo de camarão marinho. Anais do IX Congresso Brasileiro de Ecotoxicologia, 2006 (adaptado).

c. sugere-se o uso de espécies exóticas, pois somente essas podem suportar a alta incidência luminosa característica de regiões desmatadas. d. espécies de comunidade clímax, como as 4 e 7, são as mais indicadas, uma vez que possuem boa capacidade de aclimatação a diferentes ambientes. e. é recomendado o uso de espécies com melhor desenvolvimento à sombra, como as plantas das espécies 4, 6, 7, 9 e 10, pois essa floresta, mesmo no estágio de degradação referido, possui dossel fechado, o que impede a entrada de luz. 176. (Enem 2009)

Suponha que tenha sido construída uma fazenda de carcinicultura próximo a um manguezal. Entre as perturbações ambientais causadas pela fazenda, espera-se que

Metade do volume de óleo de cozinha consumido anualmente no Brasil, cerca de dois bilhões de litros, é jogada incorretamente em ralos, pias e bueiros. Estima-se que cada litro de óleo descartado polua milhares de litros de água. O óleo no esgoto tende a criar uma barreira que impede a passagem da água, causa entupimentos e, consequentemente, enchentes. Além disso, ao contaminar os mananciais, resulta na mortandade de peixes. A reciclagem do óleo de cozinha, além de necessária, tem mercado na produção de biodiesel. Há uma demanda atual de 1,2 bilhões de litros de biodiesel no Brasil. Se houver planejamento na coleta, transporte e produção, estima-se que se possa pagar até R$ 1,00 por litro de óleo a ser reciclado.

a. a atividade microbiana se torne responsável pela reciclagem do fósforo orgânico excedente no ambiente marinho. b. a relativa instabilidade das condições marinhas torne as alterações de fatores físico-químicos pouco críticas à vida no mar. c. a amônia excedente seja convertida em nitrito, por meio do processo de nitrificação, e em nitrato, formado como produto intermediário desse processo. d. os efluentes promovam o crescimento excessivo de plantas aquáticas devido à alta diversidade de espécies vegetais permanentes no manguezal. e. o impedimento da penetração da luz pelas partículas em suspensão venha a comprometer a produtividade primária do ambiente marinho, que resulta da atividade metabólica do fitoplâncton. 175. (Enem 2009) Uma pesquisadora deseja reflorestar uma área de mata ciliar quase que totalmente desmatada. Essa formação vegetal é um tipo de floresta muito comum nas margens de rios dos cerrados no Brasil central e, em seu clímax, possui vegetação arbórea perene e apresenta dossel fechado, com pouca incidência luminosa no solo e nas plântulas. Sabe-se que a incidência de luz, a disponibilidade de nutrientes e a umidade do solo são os principais fatores do meio ambiente físico que influenciam no desenvolvimento da planta. Para testar unicamente os efeitos da variação de luz, a pesquisadora analisou, em casas de vegetação com condições controladas, o desenvolvimento de plantas de 10 espécies nativas da região desmatada sob quatro condições de luminosidade: uma sob sol pleno e as demais em diferentes níveis de sombreamento. Para cada tratamento experimental, a pesquisadora relatou se o desenvolvimento da planta foi bom, razoável ou ruim, de acordo com critérios específicos. Os resultados obtidos foram os seguintes:

“Programa mostra caminho para uso do óleo de fritura na produção de biodiesel” Disponível em: http://www.nutrinews.com.br. Acesso em: 14 fev. 2009.

a. utilizar o óleo para a produção de biocombustíveis, como etanol. b. coletar o óleo devidamente e transportá-lo às empresas de produção de biodiesel. c. limpar periodicamente os esgotos das cidades para evitar entupimentos e enchentes. d. utilizar o óleo como alimento para os peixes, uma vez que preserva seu valor nutritivo após o descarte. e. descartar o óleo diretamente em ralos, pias e bueiros, sem tratamento prévio com agentes dispersantes. 177. (Enem 2009) Desde os anos 1990, novas tecnologias para a produção de plásticos biodegradáveis foram pesquisadas em diversos países do mundo. No Brasil, foi desenvolvido um plástico empregando-se derivados da cana-de-açúcar e uma bactéria recém-identificada, capaz de transformar açúcar em plástico. “A bactéria se alimenta de açúcar, transformando o excedente do seu metabolismo em um plástico biodegradável chamado PHB (polihidroxibutirato). Sua vantagem é que, ao ser descartado, o bioplástico é degradado por microorganismos existentes no solo em no máximo um ano, ao contrário dos plásticos de origem petroquímica, que geram resíduos que demoram mais de 200 anos para se degradarem.”

Condição de luminosidade Espécie

Sol

Sombreamento

pleno

30%

50%

90%

1

Razoável

Bom

Razoável

Ruim

2

Bom

Razoável

Ruim

Ruim

3

Bom

Bom

Razoável

Ruim

4

Bom

Bom

Bom

Bom

5

Bom

Razoável

Ruim

Ruim

6

Ruim

Razoável

Bom

Bom

7

Ruim

Ruim

Ruim

Razoável

8

Ruim

Ruim

Razoável

Ruim

9

Ruim

Razoável

Bom

Bom

10

Razoável

Razoável

Razoável

Bom

De acordo com o texto, o destino inadequado do óleo de cozinha traz diversos problemas. Com o objetivo de contribuir para resolver esses problemas, deve-se

GOMES, A. C. Biotecnologia ajuda na conservação do ambiente. Revista Eletrônica Vox Sciencia. Ano V, nº 28. São Paulo: Núcleo de Divulgação Científica José Gomes. Acesso em: 30 abr. 2009 (adaptado).

A nova tecnologia, apresentada no texto, tem como consequência, a. a diminuição da matéria orgânica nos aterros e do mau cheiro nos lixões. b. a ampliação do uso de recursos não renováveis, especialmente, os plásticos. c. a diminuição do metabolismo de bactérias decompositoras presentes nos solos.

expoENEM 61


d. a substituição de recursos não renováveis por renováveis para fabricar plásticos.

d. das nuvens de maior altitude, que trazem para a floresta NCNs produzidos a centenas de quilômetros de seu local de origem.

e. o lançamento no meio ambiente de produtos plásticos inertes em relação ao ciclo da matéria.

e. da intervenção humana, mediante ações que modificam as características físicas e químicas da atmosfera da região.

178. (Enem 2009) Nas últimas décadas os ecossistemas aquáticos têm sido alterados de maneira significativa em função de atividades antrópicas, tais como mineração, construção de barragens, desvio do curso natural de rios, lançamento de efluentes domésticos e industriais não tratados, desmatamento e uso inadequado do solo próximo aos leitos, superexploração dos recursos pesqueiros, introdução de espécies exóticas, entre outros. Como consequência, tem-se observado expressiva queda da qualidade da água e perda da biodiversidade aquática, em função da desestruturação dos ambientes físico, químico e biológico. A avaliação de impactos ambientais nesses ecossistemas tem sido realizada através da medição de alterações nas concentrações de variáveis físicas e químicas da água. Este sistema de monitoramento, juntamente com a avaliação de variáveis biológicas, é fundamental para a classificação de rios e córregos em classes de qualidade de água e padrões de potabilidade e balneabilidade humanas.

180. (Enem 2009) O lixo radioativo ou nuclear é resultado da manipulação de materiais radioativos, utilizados hoje na agricultura, na indústria, na medicina, em pesquisas científicas, na produção de energia, etc. Embora a radioatividade se reduza com o tempo, o processo de decaimento radioativo de alguns materiais pode levar milhões de anos. Por isso, existe a necessidade de se fazer um descarte adequado e controlado de resíduos dessa natureza. A taxa de decaimento radioativo é medida em termos de um tempo necessário para que uma amostra perca metade de sua radioatividade original. O gráfico seguinte representa a taxa de decaimento radioativo do rádio–226, elemento químico pertencente à família dos metais alcalinos terrosos e que foi utilizado durante muito tempo na medicina. 1 kg

DAVE, M.; GOULART, C.; CALLISTO, M. Bioindicadores de qualidade de água como ferramenta em estudo de impacto ambiental. Disponível em: http://www.icb. ufmg.br. Acesso em: 9 jan. 2009 (adaptado).

1/2 kg

Se um pesquisador pretende avaliar variáveis biológicas de determinado manancial, deve escolher os testes de

1/4 kg 1/8 kg

a. teor de oxigênio dissolvido e de temperatura e turbidez da água. b. teor de nitrogênio amoniacal e de temperatura e turbidez da água. c. densidade populacional de cianobactérias e de invertebrados bentônicos.

1 620

b. Apenas 1/8 de uma amostra de rádio–226 terá decaído ao final de 4 860 anos. c. Metade da quantidade original de rádio–226, ao final de 3 240 anos, ainda estará por decair.

179. (Enem 2008)

d. Restará menos de 1% de rádio–226 em qualquer amostra dessa substância após decorridas 3 meias-vidas. e. a amostra de rádio–226 diminui a sua quantidade pela metade a cada intervalo de 1 620 anos devido à desintegração radioativa. 181. (UFRN 2011) Leia o texto abaixo. TRAQUINAGENS ETÍLICAS Análises de átomos de carbono flagram adulterações no processo de fabricação de bebidas alcoólicas Nos últimos cinco anos pesquisadores brasileiros passaram a estudar o grau de adulteração em produtos nacionais e estrangeiros a partir de análise da quantidade existente, em seu conteúdo, da forma estável mais pesada do átomo de carbono denominado carbono 13 (6C13), muito mais raro do que o leve carbono 12 (6C12). A relação entre o número de átomos desses dois tipos de carbono pode denunciar a adoção de alguns procedimentos ilegais. De acordo com os ingredientes usados, cada produto apresenta uma assinatura padrão que reflete a proporção de átomos do escasso carbono 13 em relação aos átomos de carbono 12. Se numa amostra de bebida essa proporção se distancia de sua assinatura padrão, é sinal de que o produto foi alvo de alguma adulteração.

Paulo Artaxo et al. O mecanismo da floresta para fazer chover. In: Scientific American Brasil, ano 1, n°. 11, abr./2003, p. 38-45 (com adaptações).

Na Amazônia, o ciclo hidrológico depende fundamentalmente

Anos

As informações fornecidas mostram que

e. teor de nitrogênio amoniacal e de densidade populacional de invertebrados bentônicos.

4 860

a. Quanto maior a meia-vida de uma substância mais rápido ela se desintegra.

d. densidade populacional de cianobactérias e do teor de alumínio dissolvido.

Os ingredientes que compõem uma gotícula de nuvem são o vapor de água e um núcleo de condensação de nuvens (NCN). Em torno desse núcleo, que consiste em uma minúscula partícula em suspensão no ar, o vapor de água se condensa, formando uma gotícula microscópica, que, devido a uma série de processos físicos, cresce até precipitar-se como chuva. Na floresta Amazônica, a principal fonte natural de NCN é a própria vegetação. As chuvas de nuvens baixas, na estação chuvosa, devolvem os NCNs, aerossóis, à superfície, praticamente no mesmo lugar em que foram gerados pela floresta. As nuvens altas são carregadas por ventos mais intensos, de altitude, e viajam centenas de quilômetros de seu local de origem, exportando as partículas contidas no interior das gotas de chuva. Na Amazônia, cuja taxa de precipitação é uma das mais altas do mundo, o ciclo de evaporação e precipitação natural é altamente eficiente. Com a chegada, em larga escala, dos seres humanos à Amazônia, ao longo dos últimos 30 anos, parte dos ciclos naturais está sendo alterada. As emissões de poluentes atmosféricos pelas queimadas, na época da seca, modificam as características físicas e químicas da atmosfera amazônica, provocando o seu aquecimento, com modificação do perfil natural da variação da temperatura com a altura, o que torna mais difícil a formação de nuvens.

3 240

Pivetta Marcos. Traquinagens etílicas. Revista Pesquisa FAPESP Dez 2003 [Adaptado]

a. da produção de CO2 oriundo da respiração das árvores.

O teste descrito no texto se baseia na propriedade dos átomos de carbono conhecida como

b. da evaporação, da transpiração e da liberação de aerossóis que atuam como NCNs.

a. isotopia.

c. das queimadas, que produzem gotículas microscópicas de água, as quais crescem até se precipitarem como chuva.

c. isotonia.

expoENEM 62

b. isomeria. d. isobaria.


182. (UFAC 2010) A energia gerada pelas usinas de energia nuclear é produzida pela fissão nuclear. O combustível nuclear deve ser uma substância de natureza físsil como o 235U. Na natureza, o urânio é encontrado na composição de 99,284% do isótopo 238U e 0,711% do isótopo 235U. Para ser usado como combustível nuclear, o urânio é submetido a um processo de enriquecimento, a fim de concentrar na mistura de isótopos o teor do isótopo físsil.

186. (Enem 2007) A duração do efeito de alguns fármacos está relacionada à sua meia-vida, tempo necessário para que a quantidade original do fármaco no organismo se reduza à metade. A cada intervalo de tempo correspondente a uma meia-vida, a quantidade de fármaco existente no organismo no final do intervalo é igual a 50% da quantidade no início desse intervalo.

Com relação aos isótopos 235U e 238U, é incorreto afirmar que os mesmos possuem

100

a. o mesmo número de prótons. b. diferentes números de massa.

90

c. diferentes números de elétrons. 80

d. o mesmo número de elétrons. e. diferentes números de nêutrons. % de fármaco no organismo

70

183. (FEPECS-DF 2011) “Um cientista da Faculdade de Engenharia de Alimentos da Universidade Estadual de Campinas declarou que quando há consumo excessivo de produtos a base de grãos integrais, os fibratos presentes nas fibras destes grãos podem reduzir a absorção de minerais como zinco, ferro e cálcio.” (O Estado de S. Paulo, p. A28, 12/09/2010.)

Os elementos zinco (30Zn), ferro (26Fe) e cálcio (20Ca) podem ser absorvidos no organismo na forma de seus cátions bivalentes. Considerando os metais citados, a configuração eletrônica em subníveis energéticos para o cátion bivalente do metal alcalino terroso é 2

6

2

6

2

50 40 30 20

a. 1s 2s 2p 3s 3p 4s 3d . 2

60

4

10

b. 1s2 2s2 2p6 3s2 3p6 3d10. c. 1s2 2s2 2p6 3s2 3p6 3d6.

0

d. 1s2 2s2 2p6 3s2 3p6 4s2.

0

1

e. 1s2 2s2 2p6 3s2 3p6. 184. (Unificado-RJ 2011) O ferro é bastante utilizado pelo homem em todo o mundo. Foram identificados artefatos de ferro produzidos em torno de 4 000 a 3 500 a.C. Nos dias atuais, o ferro pode ser obtido por intermédio da redução de óxidos ou hidróxidos, por um fluxo gasoso de hidrogênio molecular (H2) ou monóxido de carbono. O Brasil é atualmente o segundo maior produtor mundial de minério de ferro. Na natureza, o ferro ocorre, principalmente, em compostos, tais como: hematita (Fe2O3), magnetita (Fe3O4), siderita (FeCO3), limonita (Fe2O3. H2O) e pirita (FeS2), sendo a hematita o seu principal mineral. Assim, segundo o diagrama de Linus Pauling, a distribuição eletrônica para o íon ferro 26Fe3+, nesse mineral, é representada da seguinte maneira:

3 4 5 números de meias-vidas

6

7

O gráfico acima representa, de forma genérica, o que acontece com a quantidade de fármaco no organismo humano ao longo do tempo. F. D. Fuchs e Cher l. Wannma. Farmacologia Clínica. Rio de Janeiro: Guanabara Koogan,1992, p. 40.

a. 1s2 2s2 2p6 3s2 3p6 3d5

A meia-vida do antibiótico amoxicilina é de 1 hora. Assim, se uma dose desse antibiótico for injetada às 12 h em um paciente, o percentual dessa dose que restará em seu organismo às 13 h 30 min será aproximadamente de a. 10%.

d. 35%.

b. 15%.

e. 50%.

c. 25%.

b. 1s2 2s2 2p6 3s2 3p6 4s2 3d6 c. 1s2 2s2 2p6 3s2 3p6 4s2 3d9

187. (Enem 2004) O debate em torno do uso da energia nuclear para produção de eletricidade permanece atual. Em um encontro internacional para a discussão desse tema, foram colocados os seguintes argumentos:

d. 1s2 2s2 2p6 3s2 3p6 4s2 3d3 e. 1s2 2s2 2p6 3s2 3p6 3d2

I. Uma grande vantagem das usinas nucleares é o fato de não contribuírem para o aumento do efeito estufa, uma vez que o urânio, utilizado como “combustível”, não é queimado, mas sofre fissão.

185. (Enem 1999) A gasolina é vendida por litro, mas em sua utilização como combustível, a massa é o que importa. Um aumento da temperatura do ambiente leva a um aumento no volume da gasolina. Para diminuir os efeitos práticos dessa variação, os tanques dos postos de gasolina são subterrâneos. Se os tanques não fossem subterrâneos:

II. Ainda que sejam raros os acidentes com usinas nucleares, seus efeitos podem ser tão graves que essa alternativa de geração de eletricidade não nos permite ficar tranquilos.

I. Você levaria vantagem ao abastecer o carro na hora mais quente do dia, pois estaria comprando mais massa por litro de combustível. II. Abastecendo com a temperatura mais baixa, você estaria comprando mais massa de combustível para cada litro.

III. Se a gasolina fosse vendida por kg em vez de por litro, o problema comercial decorrente da dilatação da gasolina estaria resolvido.

2

Destas considerações, somente

A respeito desses argumentos, pode-se afirmar que a. o primeiro é válido e o segundo não é, já que nunca ocorreram acidentes com usinas nucleares. b. o segundo é válido e o primeiro não é, pois de fato há queima de combustível na geração nuclear de eletricidade. c. o segundo é valido e o primeiro é irrelevante, pois nenhuma forma de gerar eletricidade produz gases do efeito estufa.

a. I é correta. b. II é correta.

d. ambos são válidos para se compararem vantagens e riscos na opção por essa forma de geração de energia.

c. III é correta. d. I e II são corretas.

e. ambos são irrelevantes, pois a opção pela energia nuclear está-se tornando uma necessidade inquestionável.

e. II e III são corretas. expoENEM 63


188. (Enem 2006) O funcionamento de uma usina nucleoelétrica típica baseia-se na liberação de energia resultante da divisão do núcleo de urânio em núcleos de menor massa, processo conhecido como fissão nuclear. Nesse processo, utiliza-se uma mistura de diferentes átomos de urânio, de forma a proporcionar uma concentração de apenas 4% de material físsil. Em bombas atômicas, são utilizadas concentrações acima de 20% de urânio físsil, cuja obtenção é trabalhosa, pois, na natureza, predomina o urânio não físsil. Em grande parte do armamento nuclear hoje existente, utiliza-se, então, como alternativa, o plutônio, material físsil produzido por reações nucleares no interior do reator das usinas nucleoelétricas. Considerando-se essas informações, é correto afirmar que: a. a disponibilidade do urânio na natureza está ameaçada devido à sua utilização em armas nucleares. b. a proibição de se instalarem novas usinas nucleoelétricas não causara impacto na oferta mundial de energia. c. a existência de usinas nucleoelétricas possibilita que um de seus subprodutos seja utilizado como material bélico. d. a obtenção de grandes concentrações de urânio físsil é viabilizada em usinas nucleoelétricas. e. a baixa concentração de urânio físsil em usinas nucleoelétricas impossibilita o desenvolvimento energético. 189. (Enem 1998) O sol participa do ciclo da água, pois além de aquecer a superfície da Terra dando origem aos ventos, provoca a evaporação da água dos rios, lagos e mares. O vapor da água, ao se resfriar, condensa em minúsculas gotinhas, que se agrupam formando as nuvens, neblinas ou névoas úmidas. As nuvens podem ser levadas pelos ventos de uma região para outra. Com a condensação e, em seguida, a chuva, a água volta à superfície da Terra, caindo sobre o solo, rios, lagos e mares. Parte dessa água evapora retornando à atmosfera, outra parte escoa superficialmente ou infiltra-se no solo, indo alimentar rios e lagos. Esse processo é chamado de ciclo da água.

Considere, então, as seguintes afirmativas: I. a evaporação é maior nos continentes, uma vez que o aquecimento ali é maior do que nos oceanos.

Dessas propostas, são adequadas apenas a. I e II. b. I e III. c. II e III. d. I, III e IV. e. II, III e IV.

191. (Enem 2005) Um problema ainda não resolvido da geração nuclear de eletricidade é a destinação dos rejeitos radiativos, o chamado “lixo atômico”. Os rejeitos mais ativos ficam por um período em piscinas de aço inoxidável nas próprias usinas antes de ser, como os demais rejeitos, acondicionados em tambores que são dispostos em áreas cercadas ou encerrados em depósitos subterrâneos secos, como antigas minas de sal. A complexidade do problema do lixo atômico, comparativamente a outros lixos com substâncias tóxicas, se deve ao fato de a. emitir radiações nocivas, por milhares de anos, em um processo que não tem como ser interrompido artificialmente. b. acumular-se em quantidades bem maiores do que o lixo industrial convencional, faltando assim locais para reunir tanto material. c. ser constituído de materiais orgânicos que podem contaminar muitas espécies vivas, incluindo os próprios seres humanos. d. exalar continuamente gases venenosos, que tornariam o ar irrespirável por milhares de anos. e. emitir radiações e gases que podem destruir a camada de ozônio e agravar o efeito estufa. 192. (Enem 2003) Um grupo de estudantes, saindo de uma escola, observou uma pessoa catando latinhas de alumínio jogadas na calçada. Um deles considerou curioso que a falta de civilidade de quem deixa lixo pelas ruas acaba sendo útil para a subsistência de um desempregado. Outro estudante comentou o significado econômico da sucata recolhida, pois ouvira dizer que a maior parte do alumínio das latas estaria sendo reciclada. Tentando sintetizar o que estava sendo observado, um terceiro estudante fez três anotações, que apresentou em aula no dia seguinte:

II. a vegetação participa do ciclo hidrológico por meio da transpiração.

I. A catação de latinhas é prejudicial à indústria de alumínio;

III. o ciclo hidrológico condiciona processos que ocorrem na litosfera, na atmosfera e na biosfera.

II. A situação observada nas ruas revela uma condição de duplo desequilíbrio: do ser humano com a natureza e dos seres humanos entre si;

IV. a energia gravitacional movimenta a água dentro do seu ciclo.

III. Atividades humanas resultantes de problemas sociais e ambientais podem gerar reflexos (refletir) na economia.

V. o ciclo hidrológico é passível de sofrer interferência humana, podendo apresentar desequilíbrios.

a. Todas as afirmativas estão corretas.

Dessas afirmações, você tenderia a concordar, apenas, com

b. Somente as afirmativas I, II e V estão corretas.

a. I e II

c. Somente as afirmativas II, III, IV e V estão corretas.

b. I e III

d. Somente a afirmativa III está correta.

c. II e III

e. Somente as afirmativas III e IV estão corretas

d. II e. III

190. (Enem 2001) Considere os seguintes acontecimentos ocorridos no Brasil: – Goiás, 1987 – Um equipamento contendo césio radioativo, utilizado em medicina nuclear, foi encontrado em um depósito de sucatas e aberto por pessoa que desconhecia o seu conteúdo. Resultado: mortes e consequências ambientais sentidas até hoje. – Distrito Federal, 1999 – Cilindros contendo cloro, gás bactericida utilizado em tratamento de água, encontrados em um depósito de sucatas, foram abertos por pessoa que desconhecia o seu conteúdo. Resultado: mortes, intoxicações e consequências ambientais sentidas por várias horas.

193. (Enem 2010) Em nosso cotidiano, utilizamos as palavras “calor” e “temperatura” de forma diferente de como elas são usadas no meio científico. Na linguagem corrente, calor é identificado como “algo quente” e temperatura mede a “quantidade de calor de um corpo”. Esses significados, no entanto, não conseguem explicar diversas situações que podem ser verificadas na prática.

Do ponto de vista científico, que situação prática mostra a limitação dos conceitos corriqueiros de calor e temperatura? a. A temperatura da água pode ficar constante durante o tempo em que estiver fervendo.

Para evitar que novos acontecimentos dessa natureza venham a ocorrer, foram feitas as seguintes propostas para a atuação do Estado:

b. Uma mãe coloca a mão na água da banheira do bebê para verificar a temperatura da água.

I. Proibir o uso de materiais radioativos e gases tóxicos.

c. A chama de um fogão pode ser usada para aumentar a temperatura da água em uma panela.

II. Controlar rigorosamente a compra, uso e destino de materiais radioativos e de recipientes contendo gases tóxicos. III. Instruir usuários sobre a utilização e descarte destes materiais.

d. A água quente que está em uma caneca é passada para outra caneca a fim de diminuir sua temperatura.

IV. Realizar campanhas de esclarecimentos à população sobre os riscos da radiação e da toxicidade de determinadas substâncias.

e. Um forno pode fornecer calor para uma vasilha de água que está em seu interior com menor temperatura do que a dele.

expoENEM 64


d. a energia térmica consumida nesse banho é posteriormente transformada em energia elétrica.

194. (Enem 2010) Em visita a uma usina sucroalcooleira, um grupo de alunos pôde observar a série de processos de beneficiamento da cana-de-açúcar, entre os quais se destacam: 1. A cana chega cortada da lavoura por meio de caminhões e é despejada em mesas alimentadoras que a conduzem para as moendas. Antes de ser esmagada para a retirada do caldo açucarado, toda a cana é transportada por esteiras e passada por um eletroímã para a retirada de materiais metálicos.

e. como a geração da energia perturba o ambiente, pode-se concluir que sua fonte é algum derivado do petróleo. 197. (UPE 2012) Um laboratório brasileiro desenvolveu uma técnica destinada à identificação da origem de “balas perdidas”, comuns nos confrontos entre policiais e bandidos. Trata-se de uma munição especial, fabricada com a adição de corantes fluorescentes, visíveis apenas sob luz ultravioleta. Ao se disparar a arma carregada com essa munição, são liberados os pigmentos no atirador, no alvo e em tudo o que atravessar, permitindo rastrear a trajetória do tiro.

2. Após se esmagar a cana, o bagaço segue para as caldeiras, que geram vapor e energia para toda a usina. 3. O caldo primário, resultante do esmagamento, é passado por filtros e sofre tratamento para transformar-se em açúcar refinado e etanol.

Com base nos destaques da observação dos alunos, quais operações físicas de separação de materiais foram realizadas nas etapas de beneficiamento da cana-de-açúcar? a. Separação mecânica, extração, decantação.

maio, 24-31, 2011.

c. Separação magnética, extração, filtração.

Qual dos modelos atômicos a seguir oferece melhores fundamentos para a escolha de um equipamento a ser utilizado na busca por evidências dos vestígios desse tipo de bala?

d. Imantação, combustão, peneiração.

a. Modelo de Dalton.

e. Imantação, destilação, filtração.

b. Modelo de Thompson.

b. Separação magnética, combustão, filtração.

Adaptado de MOUTINHO, Sofia. À caça de evidências. Ciência Hoje,

c. Modelo de Rutherford-Bohr.

(Enem 1998) Texto para as questões 195 e 196.

Seguem abaixo alguns trechos de uma matéria da revista “Superinteressante”, que descreve hábitos de um morador de Barcelona (Espanha), relacionando-os com o consumo de energia e efeitos sobre o ambiente. “Apenas no banho matinal, por exemplo, um cidadão utiliza cerca de 50 litros de água, que depois terá que ser tratada. Além disso, a água é aquecida consumindo 1,5 quilowatt-hora (cerca de 1,3 milhões de calorias), e para gerar essa energia foi preciso perturbar o ambiente de alguma maneira...”

d. Modelo de Dalton-Thompson. e. Modelo de Rutherford-Thompson. 198. (UFU-MG 2009) Nas festas de Réveillon, o céu fica embelezado pelas cores emitidas pela queima dos fogos de artifício. A esses fogos são adicionadas substâncias, cujos átomos emitem radiações de luminosidades diferentes.

Considerando uma explicação para a observação das cores, na queima dos fogos de artifício, por meio de modelos atômicos propostos no início do século XX, marque a alternativa incorreta. a. Na emissão de energia, devido à transição de elétrons, encontra-se uma explicação para a observação das cores dos fogos de artifícios, pois segundo os estudos de Bohr, o elétron pode emitir ou absorver uma quantidade definida de energia chamada quantum.

“Na hora de ir para o trabalho, o percurso médio dos moradores de Barcelona mostra que o carro libera 90 gramas do venenoso monóxido de carbono e 25 gramas de óxidos de nitrogênio... Ao mesmo tempo, o carro consome combustível equivalente a 8,9 kwh.”

b. Os estudos realizados por Thomson, assim como o modelo atômico proposto por ele, reconhecem a natureza elétrica da matéria e explicam a eletrização por atrito, a corrente elétrica, a formação dos íons e as descargas elétricas em gases. Contudo, o modelo não explica as cores observadas na queima dos fogos de artifício.

“Na hora de recolher o lixo doméstico... quase 1 kg por dia. Em cada quilo há aproximadamente 240 gramas de papel, papelão e embalagens; 80 gramas de plástico; 55 gramas de metal; 40 gramas de material biodegradável e 80 gramas de vidro.”

c. Os estudos realizados por Dalton, assim como o modelo atômico proposto por ele, contribuíram para resgatar as ideias sobre o átomo, ao proporem que átomos diferentes possuem diferentes pesos atômicos. No entanto, o peso atômico não é o responsável pela exibição das cores quando da queima dos fogos de artifícios.

195. No trecho I, a matéria faz referência ao tratamento necessário à água resultante de um banho. As afirmações a seguir dizem respeito a tratamentos e destinos dessa água. Entre elas, a mais plausível é a de que a água: a. passa por peneiração, cloração, floculação, filtração e pós-cloração, e é canalizada para os rios.

d. De acordo com o modelo de Rutherford-Bohr, as cores produzidas na queima de fogos são as emissões de energia na forma de luz. Essa emissão de energia ocorre quando os elétrons excitados dos íons metálicos, presentes nos fogos de artifícios, retornam para os níveis de maior energia.

b. passa por cloração e destilação, sendo devolvida aos consumidores em condições adequadas para ser ingerida. c. é fervida e clorada em reservatórios, onde fica armazenada por algum tempo antes de retornar aos consumidores. d. passa por decantação, filtração, cloração e, em alguns casos, por fluoretação, retornando aos consumidores.

199. (FEPECS-DF 2010) EQUIPAMENTO COM CÉSIO-137 CAI E ASSUSTA UNIVERSIDADE FEDERAL DO PARANÁ

e. não pode ser tratada devido à presença do sabão, por isso é canalizada e despejada em rios. 196. Também com relação ao trecho I, supondo a existência de um chuveiro elétrico, pode-se afirmar que a. a energia usada para aquecer o chuveiro é de origem química, transformando-se em energia elétrica. b. a energia elétrica é transformada no chuveiro em energia mecânica e, posteriormente, em energia térmica. c. o aquecimento da água deve-se à resistência do chuveiro, onde a energia elétrica é transformada em energia térmica.

A queda de uma peça de um equipamento de cintilografia assustou alunos, professores e funcionários da Universidade Federal do Paraná. O equipamento, da unidade de farmacologia, estava sendo transportado para descarte e a cápsula com césio-137 (55Cs137) foi encontrada nesta manhã. Embora tenha provocado susto, a cápsula não apresentou atividade radioativa. O susto provocado pela queda do equipamento relembra o acidente ocorrido em setembro de 1987, quando um equipamento contendo uma cápsula com césio-137 foi parar num ferro-velho em Goiânia. O dono do ferro-velho abriu a peça e se encantou com a pedra que viu dentro, que irradiava uma luz azul.

expoENEM 65


Maravilhado, levou para a casa e passou a mostrá-la para parentes e amigos. Quatro pessoas morreram. Centenas foram contaminadas naquele que foi o maior acidente radioativo do Brasil.

202. (UEL-PR 2012) Observe a figura e leia o texto a seguir.

Adaptado de: http://oglobo.globo.com/cidades/mat/2009/11/05/equipamento-com-cesio-137-cai-assusta-universidade-federal-do-parana- 914610320.asp Acesso em: 05/11/2009.

O isótopo radioativo citado no texto apresenta as seguintes partículas subatômicas: a. 55 prótons, 58 elétrons e 78 nêutrons; b. 55 prótons, 55 elétrons e 78 nêutrons; c. 55 prótons, 55 elétrons e 82 nêutrons; d. 58 prótons, 58 elétrons e 79 nêutrons; e. 58 prótons, 58 elétrons e 82 nêutrons. 200. (UNESP 2010) No campo da metalurgia é crescente o interesse nos processos de recuperação de metais, pois é considerável a economia de energia entre os processos de produção e de reciclagem, além da redução significativa do lixo metálico. E este é o caso de uma microempresa de reciclagem, na qual desejava-se desenvolver um método para separar os metais de uma sucata, composta de aproximadamente 63% de estanho e 37% de chumbo, usando aquecimento. Entretanto, não se obteve êxito nesse procedimento de separação. Para investigar o problema, foram comparadas as curvas de aquecimento para cada um dos metais isoladamente com aquela da mistura, todas obtidas sob as mesmas condições de trabalho.

Figura 1:

O Lápis ( ), imagem celestial do ouro terreno, é produzido pela rotação dos elementos, na unificação do superior e do inferior, do fogo (D) e da água (∇). Empédocles propôs “quatro raízes para todas as coisas”: a terra, a água, o ar e o fogo, formando assim os quatro elementos. Acredita-se que, na medida em que o homem manipula estas propriedades, é também possível alterar as estruturas elementares da matéria e transmutá-la. Encontrar a matéria-prima e trazê-la para a terra era a tarefa primordial do alquimista, através das repetidas transmutações dos elementos. Surgem dessa busca superior muitas tentativas analíticas de transformar outras substâncias em ouro. (Adaptado de: ROOB, Alexander. O museu hermético: alquimia e misticismo. New York: Taschen, 1997. p.14-30.)

Com base no texto e nos conhecimentos sobre estrutura atômica e radioatividade, assinale a alternativa que preenche, correta e respectivamente, as lacunas do texto a seguir.

Considerando as informações das figuras, é correto afirmar que a sucata é constituída por uma:

Hoje, com a construção de aceleradores de partículas, é possível produzir artificialmente o ouro por meio de processos de nuclear (também chamada de transmutação artificial). Como exemplo do núcleo de chumbo (82Pb207) deste processo, tem-se o resultando em ouro , lítio (3Li7) e liberando por .

a. mistura eutética, pois funde a temperatura constante. b. mistura azeotrópica, pois funde a temperatura constante. c. substância pura, pois funde a temperatura constante. d. suspensão coloidal que se decompõe pelo aquecimento.

a. fissão / aquecimento / partículas alfa (2a4) / (80Au199) / 5(0n1).

e. substância contendo impurezas e com temperatura de ebulição constante. 201. (UFF-RJ 2008) Em 11 de novembro de 1999, trinta e três pessoas morreram em Salvador em razão da ingestão de cachaça de fabricação clandestina. Segundo os médicos os sintomas eram dor de cabeça, hipertensão e vertigem. O que levou a crer que a cachaça tenha sido contaminada com metanol. Um laboratório confirmou tal hipótese. Durante muito tempo, a única maneira de produzir metanol era destilando a madeira a seco e na ausência de ar, daí o nome “álcool da madeira” que alguns comerciantes inescrupulosos vendiam como sendo álcool etílico. Atualmente, é produzido em escala industrial a partir do carvão e água, sendo monitorado pelos órgãos do governo a fim de que não seja utilizado incorretamente. Com base nas informações, assinale a opção correta. a. A destilação é um processo físico de separação. b. O metanol, assim obtido, constitui uma mistura heterogênea. c. A cachaça, é uma substância pura. d. Toda substância pura é constituída por apenas dois tipos de elementos químicos.

b. fissão / aquecimento / pósitrons (0n1) / (79Au197) / 3( –1β 0). c. fissão / bombardeamento / nêutrons (0n1) / (79Au197) / 4(0n1). d. fusão / bombardeamento / partículas alfa (2a4) / (80Au203) / 1p1. e. fusão / bombardeamento / nêutrons (0n1) / (79Au198) / 3(0n1). 203. (UFPB 2010) Gigantes reservas de petróleo foram encontradas recentemente no Brasil. Essas reservas situam-se em regiões de grandes profundidades em águas oceânicas e abaixo de uma camada de sal, por isso, denominadas de pré-sal. Com a exploração dessas reservas, o Brasil aumentará significativamente a produção de petróleo. Após a extração, o petróleo é transportado até as refinarias, onde passará por uma série de processos de purificação denominada de refino, em que o petróleo entra na fornalha, é aquecido e segue para a torre de destilação, onde serão separadas as diversas frações. Ao abastecer o veículo em um posto, o consumidor adquire a gasolina “C”, uma mistura de gasolina “A” (pura) com álcool anidro. A proporção em volume de álcool anidro nessa mistura é determinada por resoluções federais, podendo variar entre 20% e 25%. O teor de álcool na gasolina deve ser analisado, a fim de aferir a qualidade desse combustível, como ilustrado a seguir:

expoENEM 66


1

tanto que considerava a Terra como centro do sistema planetário (sistema geocêntrico). Tal consideração estava baseada nas observações cotidianas, pois as pessoas observavam o Sol girando em torno da Terra.

Primeiro você pega uma proveta de 100 ml...

205. (Unimontes-MG 2011) Dois aviões do grupo de acrobacias (Esquadrilha da Fumaça) são capazes de realizar manobras diversas e deixam para trás um rastro de fumaça. Nessas condições, para que os aviões descrevam duas semirretas paralelas verticais (perpendiculares ao solo, considerado plano), de tal sorte que o desenho fique do mesmo tamanho, os pilotos controlam os aviões para que tenham velocidades constantes e de mesmo módulo. Considerando o mesmo sentido para o movimiento dos aviões durante essa acrobacia, pode-se afirmar corretamente que a. os aviões não se movimentam em relação ao solo. b. os aviões estão parados, um em relação ao outro. c. um observador parado em relação ao solo está acelerado em relação aos aviões. d. um avião está acelerado em relação ao outro.

2 ...depois você coloca 50 ml da amostra de gasolina na proveta...

3

É correto afirmar que o homem da Antiguidade concluiu que o Sol girava em torno da Terra devido ao fato de que: a. considerou o Sol como seu sistema de referência. b. considerou a Terra como seu sistema de referência. c. esqueceu de adotar um sistema de referência. d. considerou a Lua como seu sistema de referência. e. considerou as estrelas como seu sistema de referência.

206. (Enem 2008) O gráfico a seguir modela a distância percorrida, em km, por uma pessoa em certo período de tempo. A escala de tempo a ser adotada para o eixo das abscissas depende da maneira como essa pessoa se desloca.

1 ...e em seguida coloca 50 ml de água na proveta, agite e observe.

10 km

4

0

Gasolina 34 ml

1

2

Tempo

Qual é a opção que apresenta a melhor associação entre meio ou forma de locomoção e unidade de tempo, quando são percorridos 10 km? a. carroça – semana b. carro – dia

Solução aquosa 66 ml

c. caminhada – hora d. bicicleta – minuto e. avião – segundo

Disponível em: <http://www.labvirtq.fe.usp.br/simulacoes/quimica/sim_qui_gasolinaadulterada.htm>. Acesso em: 29 set. 2009. (Adaptado).

A partir dos dados da ilustração, é correto afirmar que, em volume, o teor de álcool presente nessa gasolina é de: a. 32% b. 68%

207. (UFPE 2003) A imprensa pernambucana, em reportagem sobre os riscos que correm os adeptos da “direção perigosa”, observou que uma pessoa leva cerca de 4,0 s para completar uma ligação de um telefone celular ou colocar um CD no aparelho de som de seu carro. Qual a distância percorrida por um carro que se desloca a 72 km/h, durante este intervalo de tempo no qual o motorista não deu a devida atenção ao trânsito? a. 40 m

c. 66%

b. 60 m

d. 20%

c. 80 m

e. 24%

d. 85 m

204. (IFSC 2012) Hoje sabemos que a Terra gira ao redor do Sol (sistema heliocêntrico), assim como todos os demais planetas do nosso sistema solar. Mas na Antiguidade, o homem acreditava ser o centro do Universo, expoENEM 67

e. 97 m


208. (UEL-PR 2011)

Espaço percorrido (m)

Atletismo Corrida

Tempo de prova

a. 4,7.

100

9,69 s

b. 7,2.

50

21,30 s

c. 9,5.

Atletismo Corrida

1500

4 min 01,63 s

Nado livre

5200

14 min 41,54 s

Nado livre

Volta de Classificação de um carro de Fórmula 1

Sabendo que um desses elevadores de ultravelocidade sobe do térreo até o 89°. andar percorrendo 380 metros em 40 segundos, conclui-se que a sua velocidade média vale, em m/s,

1 min 29,619 s

Conforme os dados da tabela, assinale a alternativa que apresenta a velocidade média aproximada, em km/h, para a modalidade nado livre 1500 m. a. 3 b. 6 c. 9 d. 12 e. 15

209. (UFPR 2012) Num teste de esforço físico, o movimento de um indivíduo caminhando em uma esteira foi registrado por um computador. A partir dos dados coletados, foi gerado o gráfico da distância percorrida, em metros, em função do tempo, em minutos, mostrado abaixo: Interbits®

distância (metros) 1400 1000

d. 12,2. e. 15,5. 211. (Unicamp-SP 2011) Considere uma situação em que o dono de um cão lança um graveto e, no mesmo instante, o cão que está ao seu lado parte para apanhá-lo. O cão alcança o graveto 10 s após o lançamento e a velocidade média do cão desde a posição de partida até alcançar o graveto é de 5,0 m/s.

Sabendo que o graveto atinge o repouso 4,0 s após o lançamento, a velocidade média horizontal do graveto do lançamento até alcançar o repouso é de a. 2,0 m/s. b. 5,5 m/s. c. 12,5 m/s. d. 20,0 m/s.

212. (Ufop-MG 2010) Em um terremoto, são geradas ondas S (transversais) e P (longitudinais) que se propagam a partir do foco do terremoto. As ondas S se deslocam através da Terra mais lentamente do que as ondas P.  Sendo a velocidade das ondas S da ordem de 3 km/s e a das ondas P da ordem de 5 km/s através do granito, um sismógrafo registra as ondas P e S de um terremoto. As primeiras ondas P chegam 2,0 minutos antes das primeiras ondas S. Se as ondas se propagaram em linha reta, a que distância ocorreu o terremoto? a. 600 km

600

b. 240 km c. 15 km

200

d. 900 km 2

6

8

10

De acordo com esse gráfico, considere as seguintes afirmativas: 1. A velocidade média nos primeiros 4 minutos foi de 6 km/h. 2. Durante o teste, a esteira permaneceu parada durante 2 minutos. 3. Durante o teste, a distância total percorrida foi de 1200 m.

Assinale a alternativa correta.

213. (Unicamp-SP 2012) O transporte fluvial de cargas é pouco explorado no Brasil, considerando-se nosso vasto conjunto de rios navegáveis. Uma embarcação navega a uma velocidade de 26 nós, medida em relação à água do rio (use 1 nó = 0,5 m/s). A correnteza do rio, por sua vez, tem velocidade aproximadamente constante de 5,0 m/s em relação às margens. Qual é o tempo aproximado de viagem entre duas cidades separadas por uma extensão de 40 km de rio, se o barco navega rio acima, ou seja, contra a correnteza?

a. Somente as afirmativas 1 e 3 são verdadeiras.

a. 2 horas e 13 minutos.

b. Somente as afirmativas 2 e 3 são verdadeiras.

b. 1 hora e 23 minutos.

c. Somente as afirmativas 1 e 2 são verdadeiras.

c. 51 minutos.

d. Somente a afirmativa 3 é verdadeira.

d. 37 minutos.

e. As afirmativas 1, 2 e 3 são verdadeiras.

(Enem 1998) Texto para as questões 214 e 215.

Em uma prova de 100 m rasos, o desempenho típico de um corredor padrão é representado pelo gráfico a seguir: 12 10

Velocidade (m/s)

Interbits®

210. (CPS-SP 2010) O edifício Taipei 101 é um ícone de Taiwan e combina tradição e modernidade. Suas características de segurança permitem-lhe suportar tufões e terremotos, que são frequentes nessa região. O edifício possui 61 elevadores, sendo dois de ultravelocidade.

Interbits®

4

tempo (minutos)

8 6 4 2 0 0

  2   4   6   8   10 Tempo (s)

(http://maisprojeto.files.wordpress.com Acesso em: 17.04.2010) expoENEM 68

12

14

16


e.

214. Em que intervalo de tempo o corredor apresenta aceleração máxima? a. Entre 0 e 1 segundo.

v (km/h)

b. Entre 1 e 5 segundos.

30

c. Entre 5 e 8 segundos. d. Entre 8 e 11 segundos.

20

e. Entre 9 e 15 segundos. 215. Baseado no gráfico, em que intervalo de tempo a velocidade do corredor é aproximadamente constante?

1,5

1,0

2,0

t (h)

a. Entre 0 e 1 segundo. b. Entre 1 e 5 segundos. d. Entre 8 e 11 segundos. e. Entre 12 e 15 segundos. 216. (UFPB 2011) Um ciclista observa que, após pedalar por uma hora, sua velocidade média foi de 20 km/h. Considerando que, após pedalar por mais uma hora, a sua velocidade média em todo o percurso foi de 22 km/h, é correto afirmar que uma representação possível do movimento do ciclista no último trecho está no gráfico:

Interbits®

217. (UFF-RJ 2012 ) Policiais rodoviários são avisados de que um carro B vem trafegando em alta velocidade numa estrada. No instante t0 em que o carro B passa, os policiais saem em sua perseguição. A figura ilustra as velocidades do carro B e do carro dos policiais (P) em função do tempo.

c. Entre 5 e 8 segundos.

Carro B

velocidade

Carro P

a. v (km/h)

v0

22 20

1,0

1,5

2,0

t0

t (h)

t1

t2

t3

t4

t5

tempo

b.

v (km/h)

Assinale a alternativa que especifica o instante de tempo em que o carro P alcança o carro B. a. t1

30

b. t2 c. t3

20

d. t4 e. t5 1,5

1,0

2,0

t (h)

218. (Enem 2011) Para medir o tempo de reação de uma pessoa, pode-se realizar a seguinte experiência: I. Mantenha uma régua (com cerca de 30 cm) suspensa verticalmente, segurando-a pela extremidade superior, de modo que o zero da régua esteja situado na extremidade inferior.

c. v (km/h)

II. A pessoa deve colocar os dedos de sua mão, em forma de pinça, próximos do zero da régua, sem tocá-la. 22

III. Sem aviso prévio, a pessoa que estiver segurando a régua deve soltá-la. A outra pessoa deve procurar segurá-la o mais rapidamente possível e observar a posição onde conseguiu segurar a régua, isto é, a distância que ela percorre durante a queda. 1,5

1,0

2,0

t (h)

d. v (km/h) 26

22

O quadro seguinte mostra a posição em que três pessoas conseguiram segurar a régua e os respectivos tempos de reação. Distância percorrida pela régua durante a queda (metro)

Tempo de reação (segundo)

0,30

0,24

0,15

0,17

0,10

0,14

Disponível em: http://br.geocities.com. Acesso em: 1 fev. 2009.

1,0

1,5

2,0

t (h) expoENEM 69


A distância percorrida pela régua aumenta mais rapidamente que o tempo de reação porque a

1

2

a. energia mecânica da régua aumenta, o que a faz cair mais rápido. b. resistência do ar aumenta, o que faz a régua cair com menor velocidade. c. aceleração de queda da régua varia, o que provoca um movimento acelerado. d. força peso da régua tem valor constante, o que gera um movimento acelerado.

A

B

e. velocidade da régua é constante, o que provoca uma passagem linear de tempo. 219. (UPE) Um naturalista, na selva tropical, deseja capturar um macaco de uma espécie em extinção, dispondo de uma arma carregada com um dardo tranquilizante. No momento em que ambos estão a 45 m acima do solo, cada um em uma árvore, o naturalista dispara o dardo. O macaco, astuto, na tentativa de escapar do tiro se solta da árvore. Se a distância entre as árvores é de 60 m, a velocidade mínima do dardo, para que o macaco seja atingido no instante em que chega ao solo, vale em m/s:

3

4

a. 1 e 2 no sentido horário; 3 e 4 no sentido anti-horário. b. 1 e 3 no sentido horário; 2 e 4 no sentido anti-horário. c. 1 e 2 no sentido anti-horário; 3 e 4 no sentido horário.

Despreze a resistência do ar e adote g = 10 m/s2.

d. 1 e 4 no sentido horário; 2 e 3 no sentido anti-horário.

a. 45

e. 1, 2, 3 e 4 no sentido anti-horário.

b. 60

223. (Enem 1998) As bicicletas possuem uma corrente que liga uma coroa dentada dianteira, movimentada pelos pedais, a uma coroa localizada no eixo da roda traseira, como mostra a figura A.

c. 10 d. 20 e. 30 (UERJ 2012) Texto para as questões 220 e 221.

Três bolas – X, Y e Z – são lançadas da borda de uma mesa, com velocidades iniciais paralelas ao solo e mesma direção e sentido. A tabela abaixo mostra as magnitudes das massas e das velocidades iniciais das bolas. BOLAS

MASSA (G)

VELOCIDADE INICIAL (m/s)

X

5

20

Y

5

10

Z

10

8

Interbits®

O número de voltas dadas pela roda traseira a cada pedalada depende do tamanho relativo destas coroas. Em que opção a seguir a roda traseira dá o maior número de voltas por pedalada?

a.

220. As relações entre os respectivos tempos de queda tx, ty e tz das bolas X, Y e Z estão apresentadas em: a. tx < ty < tz b. ty < tz < tx c. tz < ty < tx

b.

d. ty = tx = tz 221. As relações entre os respectivos alcances horizontais A x, Ay e Az das bolas X, Y e Z, com relação à borda da mesa, estão apresentadas em: a. Ax < Ay < Az b. Ay = Ax = Az c. Az < Ay < Ax d. Ay < Az < Ax

c.

222. (Enem 2006) Na preparação da madeira em uma indústria de móveis, utiliza-se uma lixadeira constituída de quatro grupos de polias, como ilustra o esquema ao lado. Em cada grupo, duas polias de tamanhos diferentes são interligadas por uma correia provida de lixa. Uma prancha de madeira é empurrada pelas polias, no sentido A → B (como indicado no esquema), ao mesmo tempo em que um sistema é acionado para frear seu movimento, de modo que a velocidade da prancha seja inferior à da lixa. O equipamento acima descrito funciona com os grupos de polias girando da seguinte forma: expoENEM 70


d.

B A

e.

a. Em módulo, a aceleração centrípeta de A é maior do que a aceleração centrípeta de B.

224. (Enem 1998) As bicicletas possuem uma corrente que liga uma coroa dentada dianteira, movimentada pelos pedais, a uma coroa localizada no eixo da roda traseira, como mostra a figura A.

b. Em módulo, as velocidades angulares de A e B são iguais. c. A poderia acompanhar B se a velocidade angular de A fosse maior do que a de B, em módulo.

Fig. A

d. Se as massas dos corredores são iguais, a força centrípeta sobre B é maior do que a força centrípeta sobre A, em módulo. e. Se A e B estivessem correndo na mesma raia, as forças centrípetas teriam módulos iguais, independentemente das massas.

80 cm

Fig. B

10 cm

Anotações

30 cm

O número de voltas dadas pela roda traseira a cada pedalada depende do tamanho relativo destas coroas.

Quando se dá uma pedalada na bicicleta da figura B (isto é, quando a coroa acionada pelos pedais dá uma volta completa), qual é a distância aproximada percorrida pela bicicleta, sabendo-se que o comprimento de um círculo de raio R é igual a 2πR, onde π ≈ 3? a. 1,2 m b. 2,4 m c. 7,2 m d. 14,4 m e. 48,0 m

225. (UFRGS 2010) Levando-se em conta unicamente o movimento de rotação da Terra em torno de seu eixo imaginário, qual é aproximadamente a velocidade tangencial de um ponto na superfície da Terra, localizado sobre o equador terrestre? (Considere π = 3,14; raio da Terra RT = 6.000 km.) a. 440 km/h. b. 800 km/h. c. 880 km/h. d. 1.600 km/h. e. 3.200 km/h. 226. (UFSM-RS 2012) A figura representa dois atletas numa corrida, percorrendo uma curva circular, cada um em uma raia. Eles desenvolvem velocidades lineares com módulos iguais e constantes, num referencial fixo no solo. Atendendo à informação dada, assinale a resposta correta.

expoENEM 71


expoENEM 72


Gabarito

0 0

1

2

3

4

d

a

a

a

e

e

e

a

5

6

7

8

9

c

c

a

d

e

e

d

d

c

c

1

d

2

b

c

c

e

a

d

d

e

d

a

3

e

b

e

b

a

b

d

a

b

c

4

b

c

c

b

c

d

e

c

e

c

5

d

a

a

a

d

a

a

a

a

d

6

e

e

e

d

d

b

d

a

d

b

7

b

d

c

d

b

d

b

d

e

d

8

c

a

e

c

b

c

b

a

b

a

9

a

a

b

d

d

e

d

d

b

b

10

a

c

a

b

d

e

d

c

b

d

11

b

d

b

e

c

e

d

e

a

d

12

d

a

d

a

e

b

a

b

e

b

13

c

b

e

c

e

d

b

a

a

a

14

c

d

a

d

d

c

b

a

c

b

15

d

a

c

b

b

a

c

c

a

c

16

d

d

e

d

a

b

a

c

a

b

17

d

b

c

e

e

b

b

d

c

b

18

e

a

c

e

a

e

d

d

c

c

19

e

a

c

a

c

d

c

c

d

c

20

a

a

c

a

b

b

c

c

b

e

21

c

c

d

b

d

c

d

d

d

d

22

d

c

c

a

c

d

a

Questões Comentadas

quais ocorre o desenvolvimento larval, seguido da pupa ou crisálida, é denominado holometábolo (metamorfose total).

01. d 02. a O DNA produzido em laboratório comandará a produção de proteínas e enzimas de acordo com os genes que possui. Dessa forma, será possível criar bactérias capazes de desempenhar funções úteis, como produzir combustíveis e curar doenças, por exemplo. 03. a 04. a Os rins filtram o sangue, retirando substâncias tóxicas, principalmente a ureia proveniente do metabolismo das proteínas. 05. c As células-tronco embrionárias presentes na massa interna do blastocisto são capazes de formar todos os tecidos do corpo. 06. c A principal forma de combate à dengue é eliminar os focos de água doce acumulada em recipientes, para impedir o desenvolvimento larval do mosquito transmissor. Insetos com desenvolvimento indireto, nos quais ocorre o desenvolvimento larval, seguido da pupa ou crisálida, é denominado holometábolo (metamorfose total). 07. a A principal forma de combate à dengue é eliminar os focos de água doce acumulada em recipientes, para impedir o desenvolvimento larval do mosquito transmissor. Insetos com desenvolvimento indireto, nos

08. d A malária é transmitida principalmente pela picada das fêmeas do mosquito do gênero Anopheles, seu hospedeiro definitivo. Os machos são herbívoros. Os picos febris ocorrem em virtude da ruptura das hemácias e liberação dos protozoários no sangue, uma das etapas do ciclo de vida do Plasmodium. 09. e I. briófitas são avasculares; II. angiospermas são vasculares com sementes e frutos; III. gimnospermas são vasculares, com sementes e sem frutos; IV. pteridófitas são vasculares sem sementes. 10. d 11. e O FSH estimula o amadurecimento do folículo ovariano; o LH estimula a ovulação. O estrógeno determina os caracteres sexuais femininos e inicia a proliferação do endométrio. A progesterona atua na manutenção da gestação. 12. e Nos mamíferos placentários (inclusive no homem, é claro), o saco vitelínico é pouco desenvolvido. Os nutrientes que irão permitir o desenvolvimento do feto provêm da mãe, através da placenta. 13. e 14. a

expoENEM 73


15. e Vasos que saem do coração levando sangue, são artérias; vasos que chegam ao coração são veias. I, II, III e IV representam, respectivamente: artéria aorta; veias cavas; artéria pulmonar e veia pulmonar. A é a circulação sistêmica (grande) e B é a circulação pulmonar (pequena). 16. d 17. d Indivíduos com diabetes melito tipo 1 não sintetizam o hormônio insulina em suas células pancreáticas. Portanto, a técnica do DNA recombinante que permite a fabricação da insulina em maior quantidade, terá como consequência um impacto favorável na saúde dos diabéticos. 18. c A sudorese é acionada pelo sistema nervoso e constitui um importante mecanismo termorregulador, permitindo a perda de calor por meio da evaporação da água. 19. c Este é o ciclo haplobionte diplonte verificado nos mamíferos. 20. b A reprodução assexuada das bactérias caracteriza-se pela rapidez, simplicidade e semelhança genética. 21. c 22. c 23. e 24. a As formigas são insetos sociais. A divisão de trabalho é condição básica para a sobrevivência de todos. Esse comportamento é altruísta, isto é, um indivíduo abre mão de um direito para o bem da comunidade. 25. d TMTN X TMTN (TM) (TN) X (TM) (TN) TMTM (Não chega à fase adulta) TMTN TMTN = 2/3 TNTN = 1/3 26. d 27. e 28. d 29. a 30. e 31. b 32. e 33. b

Os pontos de um mesmo perfil, sob ação da gravidade, terão maior pressão quanto maior for a profundidade em que se encontram. Na superfície do oceano ocorre ação da pressão atmosférica. Então: • no leito do oceano há uma profundidade de h = 2 km = 2 000 m. • a densidade da água deve estar no sistema internacional para ser utilizada na equação mágua = 1 g/cm3 = 103 kg/m3. ptot = p0 + págua ptot = p0 + m · g · h ptot = 105 + 103 · 10 · 2 000 = 201 · 105 Pa = 201 atm 43. b Por causa do movimento do núcleo da Terra, o planeta tem propriedades semelhantes às de um ímã, gerando um campo magnético ao seu redor, com o Polo Norte magnético próximo ao sul geográfico, e o Polo Sul magnético próximo ao norte geográfico. Essas radiações são desviadas, em razão desse campo magnético, para seus polos, que em seu encontro com a atmosfera geram, na região dos polos, o fenômeno conhecido como aurora boreal. 44. c A frequência de cada uma das polias do comando de válvulas deve ser transformada para rpm, a fim de se adequar às alternativas. fC = 20 Hz = 1 200 rpm Raio das polias: Raio da polia de comando de válvula Rc = 10 cm. Raio da engrenagem do virabrequim Rv = 5 cm. As polias do comando de válvulas e a engrenagem do virabrequim se encontram ligadas pela mesma correia, logo: vc = vv 2 · p · Rc . fc = 2 · p · Rv · fv Rc · fc = Rv · fv 10 · 1 200 = 5 · fv fv = 2 400 rpm A frequência da engrenagem do virabrequim é a mesma do virabrequim, pois ambos estão acoplados pelo mesmo eixo. Logo, a indicação do conta-giros será igual a 2 400 rpm. fconta-giros = 2 400 rpm 45. d Quanto menor o ângulo limite, maior o intervalo de valores em que o ângulo de incidência pode sofrer reflexão total. Neste caso, é possível afirmar que é facilitada a ocorrência desse fenômeno. Como as fibras ópticas e os diamantes são constituídos por materiais com alto índice de refração em relação ao ar, apresentam baixo ângulo limite, facilitando a ocorrência da reflexão total.

34. a

46. e

35. b

No caso em que a velocidade se mantém constante (movimento uniforme), Dx . ela pode ser calculada pela seguinte expressão matemática v = Dt Dx = 80 cm = 0,80 m Dt = 0,032s

36. d 37. a 38. b 39. c 40. b 41. c 42. c

No pequeno espaço de tempo em que o veículo passa pelas duas bobinas, a velocidade do carro pode ser considerada constante, logo: 0,80 Dx = = 25 m/s = 90 km/h. v= 0,032 Dt 47. c Quando há movimento relativo entre uma fonte de ondas e um receptor, ocorre o fenômeno conhecido como efeito Doppler–Fizeau, em que, ao expoENEM 74


haver aproximação entre a fonte e o receptor, a frequência captada pelo receptor é maior que a frequência real emitida pela fonte. No caso contrário, em que há afastamento entre a fonte e o receptor, a frequência captada pelo receptor é menor que a frequência real emitida pela fonte. O radar móvel emite um sinal em determinada frequência (f) que, ao refletir no carro que se aproxima, retorna com uma frequência maior que f (emitida pelo radar), pois ocorre aproximação entre a fonte (o carro, que reflete o sinal) e o receptor (radar). Essa frequência de retorno, que é captada novamente pelo radar, será tanto maior quanto for a velocidade do carro. Dessa forma, pode-se estimar a velocidade do carro por meio da frequência de retorno. 48. e O valor pago pelo consumo de energia é diretamente relacionado com a potência dos equipamentos elétricos utilizados em uma residência. Para reduzir o consumo de energia elétrica em uma residência, além de diminuir o tempo de utilização dos aparelhos, é necessário trocá-los por outros menos potentes. No caso de grandezas diretamente proporcionais, para relacioná-las, é possível utilizar a propriedade conhecida como “regra de três”. Potência total anterior à troca = 5 000 + 1 000 + 2 000 + 1 000 = 9 000 W. Potência total após a troca = 3 500 + 700 + 1 000 + 800 = 6 000 W. Redução de potência = 9 000 – 6 000 = 3 000 W. Se o tempo de utilização dos equipamentos continua o mesmo, pela equação abaixo, tem-se que a energia elétrica total consumida na residência é diretamente proporcional à potência total utilizada: energia = potência . tempo Logo, é possível concluir que o valor a ser pago é diretamente proporcional à potência utilizada, ou seja, quanto maior a potência total consumida na casa, maior será o valor a ser pago na conta de luz. Então, é possível utilizar uma “regra de três” entre essas medidas. R$ 150,00 9 000 W x 3 000 W X = 50,00 Portanto, a redução de potência de 3 000 W irá acarretar uma economia mensal de R$ 50,00. 49. c O eclipse solar ocorre quando a Lua se posiciona entre o Sol e a Terra, impedindo parcial ou totalmente a observação do Sol. Para que isso possa ocorrer, é necessário que a Lua se encontre na fase de lua nova. O Sol é considerado, nessa situação, uma fonte extensa que, por causa da posição da Lua, é capaz de gerar três regiões distintas na superfície da Terra: sombra, penumbra e iluminada. Na região de sombra da Lua é que se tem o chamado eclipse solar, e na região de penumbra o eclipse é parcial. 50. d A ressonância é o fenômeno em que uma onda atinge um corpo que passa a vibrar na mesma frequência de oscilação que a onda incidente. Em um veículo, as ondas mecânicas emitidas pela vibração do motor atingem diversas partes que constituem a estrutura do automóvel, fazendo-o vibrar com a mesma frequência. Esse fenômeno é conhecido como ressonância. 51. a Impulso = força · tempo de contato A bola menos inflada proporciona maior tempo de contato. Para uma mesma força aplicada, quanto maior o tempo de aplicação da força, maior o impulso gerado. 52. a Ao chacoalhar a pilha, produz-se energia mecânica, mais especificamente energia cinética, que se transforma em química ao ficar armazenada na pilha. Ao apertar o botão do controle, a pilha transforma a energia química em elétrica, finalmente produzindo uma onda eletromagnética (infravermelho), que envia o sinal para o televisor. 53. a Para produzir sons em instrumentos musicais, é necessária a formação de ondas estacionárias. Em cordas sonoras, essas ondas são formadas a partir dos fenômenos da reflexão e interferência; em tubos sonoros, são

formadas pelo fenômeno da ressonância entre o ar no interior do tubo e a vibração emitida, ou pelos lábios do músico ou por uma fina placa (palheta). O músico, ao soprar de forma adequada a fina placa de bambu, faz com que esta vibre, gerando uma onda mecânica que entra em ressonância com o ar no interior do tubo, formando uma onda estacionária e produzindo o som. 54. d Para calcular a vergência da lente corretiva do míope: 1 V=– PR Para corrigir a miopia, é necessária a utilização de uma lente divergente, lembrando que o cristalino é uma lente convergente. Ponto remoto = PR = 40 cm = 0,4 m 1 1 =– = – 2,5 di V=– PR 0,4 Para corrigir a miopia, é necessário divergir os raios de luz que saem do cristalino. Então, este deve convergir com menor intensidade a luz que o atravessa. Consequentemente, a vergência do cristalino deve ser diminuída com a cirurgia. 55. a Na transmissão, o objetivo é, mantendo a mesma energia enviada, ou seja, a mesma potência, tentar diminuir a perda de energia por efeito joule ao longo da linha. Mantendo a potência constante, tem-se pela equação indicada que tensão e intensidade de corrente são grandezas inversamente proporcionais. P i= U Se não houver mudança nas características físicas do resistor, tais como comprimento, resistividade e área de secção transversal, sua resistência permanecerá constante. Então, mantendo a potência constante, ao aumentar a tensão diminui-se o valor da intensidade de corrente (grandezas inversamente proporcionais). A resistência da linha de transmissão é praticamente constante, pois suas características físicas quase não se alteram. Nessas condições, de acordo com a equação a seguir, a potência dissipada na linha de transmissão é diretamente proporcional ao quadrado da intensidade de corrente elétrica. P = R · i2 Ao diminuir a intensidade de corrente, diminui-se a potência dissipada por efeito joule ao longo da linha. 56. a Corpos podem se eletrizar por atrito. Ao se atritarem dois corpos de materiais diferentes, elétrons passam de um corpo a outro. Ao final, ambos adquirem cargas de sinais opostos. 57. a As cargas elétricas distribuem-se somente pela superfície de um condutor, mantendo o campo elétrico em seu interior nulo. 58. a Ao se aquecer uma lâmina bimetálica, ela se curva para o lado da lâmina de menor coeficiente de dilatação. Então, ao se ligar o aquecedor, a corrente elétrica que atravessa a lâmina bimetálica se aquecerá, e quando atingir a temperatura selecionada pelo botão de controle, vai se curvar para baixo e desfazer o contato. Isso indica que o coeficiente de dilatação do cobre é maior que o do ferro. 59. d Vale lembrar que as transformações gasosas são dos tipos: • isotérmica – ocorre com temperatura constante; • isovolumétrica (isocórica ou isométrica) – ocorre com volume constante; • isobárica – ocorre com pressão constante; • adiabática – ocorre sem haver trocas de calor com o meio externo; • compressão – ocorre diminuição do volume; • expansão – ocorre aumento do volume.

expoENEM 75


A compressão adiabática ocorre no estágio em que há diminuição do volume de forma bastante rápida, com aumento da pressão. Por ser muito rápida, não há tempo para a troca de calor com o meio externo, e por isso pode ser considerada adiabática. Esse estágio, no gráfico, corresponde ao trecho BC. O recebimento de calor ocorre no momento da explosão, aumentando a pressão. O intervalo de tempo em que ocorre a reação química é muito pequeno, podendo o volume ser considerado constante. No gráfico, o trecho CD corresponde a um aumento de pressão a volume constante.

que corresponde a aproximadamente 90% da força gravitacional que teria na superfície da Terra.

60. e Se não há ação de forças não conservativas, o sistema é considerado conservativo. Nesses sistemas, a energia mecânica se conserva. vfinal = 234 km/h = 65 m/s

66. d Energia produzida pela combustão direta de 1 litro de gasolina: 200 litros de água = 200 kg = 200 000 g

EMi = EMf

Q = 200 000 · 4,19 · 35

Q = m · c · Dt Q = 2,933 · 107 J

Eci + EPg = Ecf

Potência do resistor: U2 (110)2 = = 1 100 W P= R 11

m· v m· v + m · g · hi = (a massa pode ser simplificada) 0,4 2 v20 65 + 10 · 48,8 = 2 2 v0 = 57 m/s = 205,2 km/h 2 i

65. b A parte escura do filme corresponde à região atingida pela radiação, ao passo que a parte clara indica a região a que a radiação não conseguiu chegar, sendo absorvida pelas partes ósseas, constituídas principalmente por cálcio.

2 f

Tempo que deve ficar ligado para produzir a mesma quantidade de energia que a combustão: E = P · Dt

61. e

2,933 · 107 = 1 100 · Dt

62. e

∆t @ D 26 663s @ 7,4h Determinação do volume de gasolina necessário para fazer o gerador elétrico funcionar produzindo a mesma quantidade de energia que a combustão direta. 1litro de gasolina 1h x 7,4h x = 7,4 litros de gasolina

Dx Em movimentos uniformes, v = . Dt v2 . Em movimento curvilíneo e uniforme, a = acp = R Dt = 1h e 25min = 3 600s + 1 500s = 5 100s a = acp = 0,1 · g = 0,1 · 10 = 1 m/s² Dx = 403 km = 403 000 m

67. a Quantidade de calor necessária para o aquecimento da água:

403 000 Dx = @ 80 m/s Dt 5 100 2 v acp = R 802 1= R v=

Q = m · c · ∆t Q = 1 000 · 4 200 · 80 Q = 3,36 · 108 J

R = 6 400 m 63. d Para o cálculo da potência total, é necessária a determinação da potência das lâmpadas em função das áreas fornecidas.

A potência correspondente: Q 3,36 · 108 = = 9,3 · 104 W = 93 000 W P= Dt 3 600 Área para obter a potência necessária: 1 m2

800 W 93 000 W

Área da cozinha = 3 · 3 = 9 m² Área do corredor = 1,5 · 0,9 = 1,35 m² Área da sala = 2,8 · 3 = 8,4 m² Área do banheiro = 1,5 · 2,1 = 3,15 m²

A

A = 116,25 m Determinação do comprimento x do refletor para uma largura de 6 m: 2

A=B· h 116,25 = x · 6

Utilizando a tabela que relaciona as áreas de cada cômodo com a potência de cada lâmpada necessária, tem-se: • lâmpada da cozinha = 100 W • lâmpada do corredor = 60 W • lâmpada do banheiro = 60 W • lâmpada da sala = 100 W Potência total das lâmpadas = 320 W Potência total dos equipamentos, incluindo as lâmpadas: Ptot = 200 + 500 + 50 + 3 000 + 120 + 200 + 320 W = 4 390 W 64. d Corpos em movimento circular e uniforme ficam sujeitos a uma força resultante centrípeta. m · v2 . Resultante centrípeta: Fcp = 2 O satélite fica em órbita (aproximadamente circular) por causa da ação da força de atração gravitacional, também chamada de força-peso. Para manter o satélite em alta velocidade em órbita, é necessária uma força elevada,

x = 19,375 m 68. d Dilatação volumétrica: DV = V0 · g · Dt O volume comercializado por semana = 7 · 20 000 litros = 140 000 litros. DV = V0 . g . Dt = 140 000 · 1 · 10–3 · (35 – 5) DV = 4 200l A venda deste volume que é resultado da dilatação do líquido corresponde ao ganho financeiro causado pelo aquecimento. Ganho = 4 200 · 1,60 = 6 720 R$ 6.720,00 69. b A geladeira tem como princípio de funcionamento a transmissão de calor de um meio de menor temperatura (mais frio) para um meio de maior temperatura (mais quente). Por ser um processo não espontâneo, é necessária a realização de um trabalho para que a transmissão ocorra – neste caso, pelo motor da geladeira.

expoENEM 76


70. b Redesenhando o circuito:

O (5)

(6)

(7)

(8)

O

ÉSTER

(4) (1)

ÉTER O

U

(2)

O

U

R (6)

R

R

(7)

(8)

R

R

(2)

(3)

R

75. d sulfato de alumínio → Al2(SO4)3 carbonato de sódio → Na2CO3 óxido de cálcio → CaO cloro → Cl2

Pode-se concluir que no ponto P a corrente se divide igualmente pela parte superior e inferior (como indicado na figura), pois a resistência equivalente na parte superior é igual à da parte inferior. Portanto, as três lâmpadas que têm a mesma resistência e a mesma intensidade de corrente são L2, L3 e L4. 71. d A radioatividade é um fenômeno nuclear, relativo ao núcleo do átomo. A fissão nuclear é a divisão de um núcleo grande pela colisão de um nêutron, gerando núcleos menores com liberação de grande quantidade de energia juntamente com mais nêutrons, os quais se chocam com outros núcleos, formando novas reações, o que cria a reação em cadeia. As aplicações da fissão nuclear correspondem à produção de energia elétrica em reatores nucleares e à produção da bomba nuclear. Meia vida é o tempo necessário para desintegrar metade dos átomos radioativos. Logo, para que uma amostra de plutônio se reduza a 25% da taxa inicial, irão se passar 48 mil anos. 50% 25% 100% Cada meia vida tem 24 mil anos, então duas meias vidas correspondem a 48 mil anos.

76. b Para 2 latas de cerveja: aproximadamente 100 minutos (1h40 minutos). 2 latas de cerveja 0,5 0,4 0,3 0,2 0,1 0 0

100

200

300

400

Tempo (minutos)

Para 3 latas de cerveja: aproximadamente 180 minutos (3 horas). 3 latas de cerveja

0,7 0,6 0,5

CAS (g/l)

(1)

(4)

R (5)

AMIDA

CAS (g/l)

R

R

AMINA

NH

A associação de resistores indicada abaixo tem resistência equivalente R.

i

NH2

(3)

0,4 0,3 0,2 0,1 0

73. d A → ácido → neutraliza a OH– → desloca o equilíbrio para a direita. B → ácido → neutraliza a OH– → desloca o equilíbrio para a direita. C → básico → aumenta a concentração de OH– → desloca o equilíbrio para a esquerda.

0

100

200

300

400

Tempo (minutos)

Para 4 latas de cerveja: aproximadamente 280 minutos (4h40min). 4 latas de cerveja 0,8 0,6

CAS (g/l)

72. c Para neutralizar a alcalinidade do solo, deveria ser adicionada uma substância com caráter básico. Logo, a melhor opção será (NH4)2SO4. a. CaCO3 → sal proveniente de base forte e ácido fraco → pH básico → pH > 7 b. KNO3 → sal proveniente de base forte e ácido forte → pH neutro → pH = 7 c. (NH4)2SO4 → sal proveniente de base fraca e ácido forte → pH ácido → pH < 7 d. NaNO3 → sal proveniente de base forte e ácido forte → pH neutro → pH = 7 e. MgCO3 → sal proveniente de base forte e ácido fraco → pH básico → → pH > 7

0,4 0,2 0 0

100

200

300

400

500

Tempo (minutos)

77. d I. Verdadeira. Conforme o texto, “resposta imunológica do corpo, em que células mastócitos liberam histamina e outros agentes de defesa para combater a invasão”. II. Verdadeira.

74. b A molécula do oseltamivir (Tamiflu) apresenta fórmula molecular C16H28N2O4, mas não é aromática, pois faltam duplas ligações na cadeia fechada para caracterizar o anel aromático. Essa molécula apresenta isômeros ópticos (presença de carbonos quirais ou assimétricos), além das seguintes funções orgânicas:

expoENEM 77

CH2 – CH2 – NH2

N

AMINA

N | H


III. Verdadeira. Como o nitrogênio se encontra na família 5A ou 15, ele apresenta 5 elétrons na camada de valência, logo realiza 3 ligações covalentes, restando 2 elétrons livres, sendo, pelo conceito de Lewis, uma base. IV. Falsa. A fórmula molecular da histamina é C5H9N3. V. Verdadeira. CH2 – CH2 – NH2

N

PONTE DE HIDROGÊNIO

N | H A ponte de hidrogênio é caracterizada pela ligação do hidrogênio com os elementos altamente eletronegativos flúor, oxigênio e nitrogênio. 78. e a. Falsa. Conforme o texto, “consome menos energia do que seria preciso para fervê-la”. b. Falsa. Na osmose normal, o solvente migra do meio menos para o mais concentrado. Já na osmose reversa, o solvente migra do meio mais para o menos concentrado. c. Falsa. O meio menos concentrado é chamado de hipotônico, o mais concentrado de hipertônico, e quando as soluções apresentam as mesmas concentrações, de isotônico. d. Falsa. Como ocorre osmose reversa, o nível da solução no ramo A vai diminuir e, no ramo B, vai aumentar. e. Verdadeira. Como ocorre osmose normal, a água destilada (menos concentrada) migra para o meio mais concentrado (água do mar). 79. d a. Falsa. 70 kg 100 % 61% x x = 42,7 kg b. Falsa. A porcentagem em massa do fósforo (1,1%) é maior que a do potássio (0,2%). c. Falsa. 1,025 g 1 cm3 70 000 g x x = 68 293 cm3 ou 68,293 dm3 d. Verdadeira. 70 kg 100 % 23% x x = 16,1 kg ou 16 100 gramas 12 gramas 6 · 1023 átomos 16 100 gramas x x = 8,05 · 1026 átomos e. Falsa. Conforme o texto, “em ordem decrescente: ferro, flúor, zinco, rubídio, estrôncio, bromo, chumbo, cobre, alumínio, cádmio, boro, bário, prata, manganês, iodo, níquel, ouro, molibdênio, cromo, césio, cobalto, urânio, berílio e rádio”. 80. c I – HCl; II – NaOH; III – H2SO4; IV – cobre; V – CaCO3; VI – H2. 81. a 1 tonelada = 1 000 kg 1 000 kg 1,5 kg x = 0,15%

100% x

82. e O dióxido de enxofre (SO2), que reage com o oxigênio do ar dando SO3, que em seguida, com o vapor de água da atmosfera, forma o ácido sulfúrico (H2SO4): SO2 + 1/2O2 → SO3 SO3 + H2O → H2SO4 O ácido sulfúrico ataca os carbonatos (mármore e pedra-sabão), produzindo sal, água e gás carbônico. H2SO4 + CaCO3 → CaSO4 + H2O + CO2 Também ataca o ferro e o alumínio gerando sal e liberando gás hidrogênio. H2SO4 + Fe → FeSO4 + H2 3H2SO4 + 2Al → Al2(SO4)3 + 3H2 83. c A substância simples é formada pelo mesmo elemento químico, ao passo que a substância composta forma-se por dois ou mais elementos químicos. No sistema 1, há uma mistura de quatro substâncias diferentes; no sistema 2, há uma mistura de duas substâncias diferentes; no sistema 3, há uma substância pura (a molécula é a mesma). 84. b O CO2 reage com a água produzindo H2CO3(aq), que torna o meio ácido. Como o CaCO3 tem caráter básico, ele sofrerá decomposição pela ação ácida da água. 85. c Noções básicas sobre polímeros. X → polietileno Y → polipropileno Z → poliestireno W → policloreto de vinila 86. b Quantidade de carga elétrica: Q=i· t Q = 4,2 · 35 · 60 = 8 820 C Cálculo da massa de ouro: 3e– →→ 1Au 1Au3+ + 3 mols de e– -----1 mol de Au 197 g 3 · 96 500 C x 8 820 C x=6g 87. a Metano = 16 g/mol → 212,8 / 16 = 13,3 kcal Butano = 58 g/mol → 635,9 / 58 = 10,96 kcal Octano = 114 g/mol → 1 320,6 / 114 = 11,58 kcal 1 C4H10(g) + 13/2 O2(g) → 4 CO2(g) + 5 H2O(l) 1 CH4(g) + 2O2(g) → 1CO2(g) + 2 H2O(ℓ) 1 C8H18(g) + 25/2 O2(g) → 8 CO2(g) + 9 H2O(l) 88. b Considerem-se as informações do texto: O leite de magnésia é uma solução 8% em massa de hidróxido de magnésio; cada colher de chá contém 15 gramas de leite de magnésia; paciente ingere duas colheres de chá de leite de magnésia. 15 gramas 1 colher x 2 colheres x = 30 gramas de leite de magnésia 100% 30 gramas x x = 2,4 gramas de Mg(OH)2

expoENEM 78


1 → ácido moderado. Exemplo: HNO2. 0 → ácido fraco. Exemplo: HBrO. Exceção: H2CO3 é um ácido fraco.

Mg(OH)2 + 2HCl → MgCl2 + 2H2O 2HCl Mg(OH)2 2 · 36,5 gramas 58 gramas x 2,4 gramas x = 3 gramas 89. a Características dos catalisadores: • eles podem ou não participar da reação durante a formação do complexo ativado, porém sua composição e massa são integralmente recuperadas ao término da reação; • a ação catalítica só é possível quando há afinidade química entre os reagentes; • se a reação a ser catalisada é reversível, o catalisador age com a mesma intensidade tanto na reação direta quanto na inversa; • o catalisador atua apenas sobre a energia de ativação da reação, não se alterando o valor de ΔH. 90. a O potencial de redução do eletrodo de cobre é maior que o do magnésio. Logo, ocorrerá redução do cobre (cátodo → polo positivo) e oxidação do magnésio (ânodo → polo negativo). O fluxo de elétrons vai do ânodo para o cátodo (Mg → Cu). A diferença de potencial é de 2,70 V. 91. a Como é demonstrado no texto, para que o sabão funcione de maneira eficiente na remoção de gorduras, deve-se evitar que o equilíbrio seja deslocado para a direita. Logo, se o pH for básico, aumentará a concentração de OH-, e com isso, segundo o Princípio de Le Chatelier, o equilíbrio será deslocado para a esquerda, aumentando a eficiência dos sabões. 92. b Força redutora tem o mesmo significado de redutor ou agente redutor, ou seja, a estrutura que provoca a redução, perdendo elétrons (sofre oxidação). O redutor sofre oxidação. Na série apresentada, os elementos que apresentam força redutora menor que o chumbo, ou seja, que irão se sedimentar (sofrem o processo de redução), correspondem aos metais Au, Pt e Ag. 93. d A força de cada ácido é avaliada pelo seu grau de ionização, ou seja, pela quantidade de íons H+ que o ácido libera na água. O grau de ionização pode ser expresso tanto na forma de número decimal como em porcentagem. Assim, se de cada 100 moléculas de ácido adicionadas em água, 90 se ionizarem, o grau de ionização do ácido será de 90% ou 0,9. De acordo com o grau de ionização, os ácidos podem ser fortes, moderados ou fracos: 0%

5%

ácidos fracos

50% ácidos moderados

100% ácidos fortes

Podem-se prever a força dos ácidos por meio de duas regras: HIDRÁCIDOS Fortes: HCl, HBr, HI Moderado: HF Fracos: todos os demais. Exemplos: HCN e H2S. OXIÁCIDOS Considera-se a seguinte fórmula: número de oxigênios – número de hidrogênios ionizáveis Ao realizar a subtração, pode-se obter: 3 → ácido muito forte. Exemplo: HClO4. 2 → ácido forte. Exemplo: H2SO4.

94. d Mistura 100% 800 kg 20% x x = 160 kg de álcool hidratado No destilado 100 kg x x = 96 kg

100% 96%

Resíduo 800 kg (mistura) – 100 kg (álcool hidratado) = 700 kg 160 kg – 96 kg = 64 kg 700 kg 64 kg x = 9,1%

100% x

95. e Conforme o texto, a escala de pH varia e pode assumir valores entre 0 e 14. O centro da escala (pH = 7) apresenta pH neutro. Valores inferiores a 7 caracterizam pH ácido e valores superiores a 7 indicam pH básico. Quanto menor for o pH, maior será a acidez; da mesma maneira, quanto maior for o pH, maior será a basicidade. I. Falsa. 6ª. amostra; [H+] = 10–4 mol/l. 14ª. amostra; [H+] = 10–6 mol/l. Portanto, da 6ª. para a 14ª. amostra ocorreu uma diminuição da acidez. II. Verdadeira. A 18ª. amostra apresenta o maior pH, portanto, a menor acidez. III. Verdadeira. 8ª. amostra; [H+] = 10–5 mol/l. 14ª. amostra; [H+] = 10–6 mol/l. 10–5/10–6= 10 → A 8ª. amostra é dez vezes mais ácida que a 14ª. . IV. Verdadeira. Conforme o texto: os valores do pH da chuva podem ficar abaixo de 5,5, recebendo então a denominação chuva ácida. As únicas amostras de chuvas denominadas ácidas são a 6ª. e a 8ª. . 96. d Caldo de cana ou garapa é o nome que se dá ao líquido extraído da cana de açúcar no processo de moagem. Rapadura é um doce de origem açoriana ou canária. É feita a partir do caldo da cana após moagem, fervura, moldagem e secagem. O açúcar é uma forma possível dos hidratos de carbono; a forma mais comum de açúcar consiste em sacarose no estado sólido e cristalino. É produzido comercialmente a partir de cana de açúcar ou de beterraba. O etanol (CH3CH2OH), também chamado de álcool etílico e, na linguagem popular, simplesmente de álcool, é uma substância orgânica obtida da fermentação de açúcares, hidratação do etileno ou redução a acetaldeído. Todos os processos necessitam de atividade humana para a obtenção de energia. 97. d H2SO4 1 tonelada 10 000 toneladas x = 10 000 toneladas

expoENEM 79

CaCO3 1 tonelada x


10 000 toneladas x x = 12 500 toneladas 1 caminhão x x = 400 caminhões

Energia liberada por litro de etanol queimado: 0,79 g 1 ml 1 000 ml (1litro) z z = 790 g

80% de pureza 100%

30 toneladas 12 500 toneladas

98. b Como a graxa apresenta propriedades apolares, não apresenta solubilidade em água, permitindo a impermeabilização, impedindo o contato do ferro com o ar úmido (H2O + O2). O uso da graxa diminui a superfície de contato entre as ferramentas e o ar úmido. 99. b O benzeno apresenta uma pressão de vapor maior que a da água. Logo, é mais volátil. Ao se aquecer a água, o benzeno irá se volatilizar, e a água ficará livre desse composto. O benzeno é líquido, inflamável, incolor, com ponto de ebulição de 80,09°C, densidade de 0,8765 g/cm3 e tem um aroma doce e agradável. É um composto tóxico, cujos vapores, se inalados, causam tontura, dores de cabeça e até mesmo inconsciência. Se inalados em pequenas quantidades por longos períodos, causam sérios problemas sanguíneos, como leucopenia. Também é conhecido por ser carcinogênico. É uma substância usada como solvente (de iodo, enxofre, graxas, ceras etc.) e matéria-prima básica na produção de muitos compostos orgânicos importantes, como fenol, anilina, trinitrotolueno, plásticos, gasolina, borracha sintética e tintas. 100. a 0,3 g/l 1 lata de cerveja x 3 latas x = 0,9 g/l Como essa faixa de concentração se enquadra em duas linhas da tabela (linhas 2 e 3), os efeitos no organismo deveriam ser: euforia suave, sociabilidade acentuada e queda da atenção e excitação, perda de julgamento crítico, queda da sensibilidade e das reações motoras. 101. c Processo 1: separação magnética. Processo 2: o esmagamento para retirada do caldo é uma extração. A combustão do bagaço é uma transformação química. Processo 3: filtração. 102. a As células (pilha) combustíveis convertem energia química em energia elétrica. A reação envolvida nessa reação é H2(g) + ½O2 ® H2O. Logo o único produto formado é a água.

1 mol etanol = 46 g 1 367 kJ 46 g w 790 g w = 23 476 kJ = 23,5 MJ Considerando volumes iguais (1 litro) dos dois combustíveis, o etanol é mais vantajoso, pois sua combustão libera maior quantidade de energia. 105. e I137 ® -1β0 + 54Xe137 53 A fissão nuclear é utilizada na produção de energia elétrica em reatores nucleares e na bomba atômica. A energia produzida no Sol é proveniente da fusão nuclear. A meia vida é o tempo necessário para desintegrar metade dos átomos radioativos. 0 100%

8 dias 50%

16 dias 25%

0 20 mg

8 dias 10 mg

16 dias 5 mg

24 dias 2,5 mg

106. d Quantidade de calor liberada por 1 kg de carvão: m = 40 litros = 40 kg = 40 000 g Dt = 100 – 20 = 80°C Q = m . c . Dt = 40 000 . 1 . 80 = 3 200 000 cal = 13 440 000 J = 13 440 kJ 1 kg de carvão 13 440 kJ x 8,4 . 107 kJ x = 6 250 kg de carvão = 6,25 toneladas 107. c 130 Dx ® 700 = ® Dt @ 0,186h @ 11min V= Dt Dt t = 2h46min + 11min = 2h57min 108. b O subproduto A é o 1,2,3 – propanotriol ou propan-1,2,3-triol. Na estrutura do biodiesel encontra-se a função éster. R1COOCH3

éster

103. b Em vista de pesquisas recentes que questionam a utilização de biocombustíveis e seu impacto para o ambiente, os países produtores devem rever periodicamente seus conceitos, a fim de apurar e minimizar possíveis efeitos danosos, buscando o equilíbrio sustentável.

R2COOCH3

104. d Energia liberada por litro de metanol queimado: 1 ml 0,79 g 1 000 ml (1 litro) x x = 790 g/l

Como o biodiesel apresenta cadeia carbônica longa, é praticamente insolúvel em água, ao passo que o subproduto A (glicerina) apresenta pontes de hidrogênio, sendo solúvel em água. Logo a melhor técnica de separação de dois líquidos imiscíveis é a decantação. O petróleo é uma fonte não renovável e o uso do biodiesel, por ser renovável, trará redução das importações do petróleo.

1 mol metanol = 32 g 726 kJ 32 g y 790 g y = 17 923 kJ ou 17,9 MJ

R3COOCH3 Biodiesel

109. d Trecho I: 0,8 – 0,5 0,3 ® Vm = ® Vm = 0,03 mol/min Vm = 10 – 0 10 Trecho II: 0,5 – 0,3 0,2 Vm = ® Vm = ® Vm = 0,02 mol/min 20 – 10 10 expoENEM 80


Trecho III: 0,3 – 0,2 0,1 ® Vm = ® Vm = 0,01 mol/min Vm = 30 – 20 10 Após 30 minutos de reação ocorreu a queima de 0,6 mol (0,8 mol – 0,2 mol) de glicose, logo: 180 g 1 mol de C6H12O6 x 0,6 mol x = 108 gramas Após 20 minutos ocorreu a queima de 0,5 mol (0,8 mol – 0,3 mol). Logo a velocidade média é de 0,025 mol/min de glicose. Na reação de combustão C6H12O6(aq) + 6 O2(g) ® 6 CO2(g) + 6 H2O(l) , temos uma relação de 1 : 6 entre a glicose e o dióxido de carbono: 6 CO2(g) C6H12O6(aq) 1 mol 6 mol 0,025 mol/min y y = 0,15 mol/min

Uma coxa de frango = 144 kcal Duas fatias de cupim = 375 kcal Uma fatia de picanha = 287 kcal Total consumido = 1 800 kcal = 1 800 000 cal . 4 = 7 200 000 J Para a lâmpada: E = P . Dt 7 200 000 = 20 . Dt Dt = 360 000s = 100h 114. c Cálculos preliminares: m = 100 000 t = 100 000 000 kg = 108 kg µágua = 1 g/cm3 = 103 kg/m3 Vpiscina = 50 . 25 . 2 = 2 500 m3 Para que haja flutuação, o peso do porta-aviões deve ser equilibrado pelo empuxo: E=P µlíquido . Vsubmerso . g = m . g . 10 = 108 . 10 103 . V submerso

110. b Solução de soro = 500 g 100% 500 g x 4,5 g x = 0,9%

O volume submerso corresponde ao volume de água deslocado, logo: 1 piscina olímpica 2 500 m3 x 100 000 m3 x = 40 piscinas olímpicas

Concentração em g/l 0,5 l 4,5 g 1l y y = 9 g/l

a. Falso. O cavaquinho produz som mais alto (agudo) que o violão, pois tem cordas de menor comprimento.

Vsubmerso = 105 m3 = 100 000 m3

115. e

b. Falso. O som mais baixo (grave) é produzido pela corda de maior comprimento.

Quantidade de matéria em mol/l 58,5 g 1 mol de NaCl 4,5 g w w = 0,077 mol

c. Falso. A corda mais fina (menor densidade linear) produz som de maior frequência (agudo). d. Falso. A onda estacionária formada em uma corda se deve aos fenômenos da reflexão e da interferência.

0,5 l 0,077 mol 1l z z = 0,15 mol/l 111. d a. Falsa. O aumento da concentração de álcool favorece a reação direta, deixando o bafômetro na coloração esverdeada. b. Falsa. A reação necessita de íons H+, provenientes do ácido sulfúrico. c. Falsa. Ocorre o processo de redução do íon Cr2O72– para o íon de Cr3+: +6 +3

e. Verdadeiro. Para produzir som de alta frequência (agudo), o guitarrista diminui o comprimento da corda por meio de seus dedos, pois o comprimento da corda e a frequência são grandezas inversamente proporcionais. 116. d a. Falso. A cor vermelha é a que sofre menor desvio ao sofrer refração do ar para a água. b. Falso. Todas as cores irão sofrer refração ao incidirem sobre a gota.

Cr2O72– ® Cr3+

d. Verdadeira. O aumento da concentração de álcool favorece a reação direta, com o aparecimento da coloração esverdeada. e. Falsa. O aumento de umidade (H2O) favorece a reação inversa com o aparecimento da coloração alaranjada.

c. Falso. Para se observar o arco-íris, o Sol deve estar posicionado numa região localizada atrás da cabeça do observador. No horário indicado, isso não é possível. d. Verdadeiro. As cores têm diferentes velocidades no interior da água, provocando diferentes desvios e ocorrendo a separação.

112. b Usa-se a equação geral dos gases:

e. Falso. Todas as cores, ao passarem do ar para a água, sofrem alteração de velocidade.

P1 V1 P2 V2 = T1 T2

117. e Leitura atual = 2 783 kWh Leitura do mês passado = 2 530 kWh A diferença entre as leituras indica a energia consumida no mês = 220 kWh. R$ 0,20 1 kWh x 220 kWh x = R$ 44,00

Condições na troposfera: Condições iniciais: P2 = 0,25 atm P1 = 1 atm V1 = 20 l V2 = ? T2 = 223 T1 = 300 K 1 . 20 0,25 . V2 = 223 300 V2 = 59,5 litros 113. e 130 g de arroz de carreteiro = 364 kcal Uma fatia de alcatra = 151 kcal Duas unidades de costeletas de porco = 483 kcal

118. a As ondas de rádio que apresentam comprimentos de onda maior podem sofrer reflexão na ionosfera.

expoENEM 81


119. d Ao erguer o êmbolo, ocorreu uma diminuição da pressão no interior da seringa, diminuindo nesse instante a temperatura de mutação de estado e a água começou a ferver novamente, porém por pouco tempo, pois a pressão aumentou novamente com a ebulição. 120. d A única alternativa que indica uma trajetória que não seria possível com um material natural é a indicada no item d, pois em materiais naturais o raio incidente e o raio refratado se encontram em lados opostos em relação à reta normal, ao passo que no “canhoto” o raio incidente e o raio refratado se encontram do mesmo lado em relação à reta normal. 121. a A tireoide produz dois hormônios, tiroxina e triiodotironina, derivados do aminoácido tirosina. Na síntese desses hormônios, a tireoide usa o iodo. Esses hormônios aceleram o metabolismo celular, portanto auxiliam na manutenção da temperatura do corpo. 122. d O genótipo do casal normal é XDXd (mãe normal, portadora) e XDY (homem normal). O filho daltônico tem genótipo XdY. Portanto, recebeu o Xd da sua mãe, que é heterozigota. 123. a A sequência exata do mensageiro dado traduz o peptídio em questão. 124. e O processo de ionização é a formação de íons em solução em compostos moleculares. H3A ↔ 3H+ + A–

131. b A cloração é usada para o tratamento da água, pois apresenta ação bactericida. 132. e Ocorre a formação de pontes de hidrogênio da molécula de água com a glicerina e pelo polietilenoglicol. 133. c No texto é dito que energia e frequência são grandezas inversamente proporcionais. Logo: EUVC f E E 290 l = UVC ⇒ UVC = UVB ⇒ UVC = ⇒ 2,9 · EUVB 100 EUVB fUVB EUVB EUVB lUVC 134. e 135. d Analisando a equação de Halley, percebemos que para determinada vergência, o aumento do índice de refração aumenta o raio de curvatura da lente. O aumento do raio de curvatura dá à superfície uma “curva mais suave”, deixando a lente mais fina. Logo, a lente a ser escolhida deve ser Cristal Hiper-Hi-Lite. A lente esférica negativa indica a utilização de lente divergente, caracterizando a miopia. A indicação de lentes cilíndricas caracteriza o astigmatismo. 136. b carbono terciário

CH3 carboxila | CH    CO2H

CH3    | CH H3C   CH2

O processo de dissociação iônica é a formação de íons em solução em compostos iônicos. NaHCO3 → Na+ + HCO –3 A formação do ácido é representada pela etapa HCO3– + H+ ↔ H2CO 3

cadeia aromática e insaturada

fórmula molecular: C13H18O2

A liberação do gás é representada pela equação H2CO3 ↔ H2O + CO 2 125. b Os répteis são os representantes dos cordados que conseguiram adaptações formidáveis ao ambiente terrestre: fecundação interna, postura de ovos com anexos embrionários, pele seca e grossa com queratina, respiração exclusivamente pulmonar, excreção de ácido úrico, ausência de glândulas. 126. a O DNA recombinante é um processo que une segmentos de DNA de espécies diferentes na obtenção de produtos de interesse. 127. b As microvilosidades permitem que ocorra aumento de superfície de contato para absorção dos nutrientes resultantes da digestão dos alimentos pelas paredes internas do intestino. 128. e O consumo exagerado de açúcares e a má higienização bucal são as principais causas da cárie dentária.

137. a C11H16ClN5 = 253,5 g/mol 253,5 g -----------------100% 132 g (carbono) ------- x x = 52,1% 138. a 139. a Densidade do bloco de terra no SI: m = 1,7 g/cm3 = 1,7 · 103 kg/m3 Volume = Ab · h = 100 · 10 · 2 = 2 · 103 m3 m m m= ⇒ 1,7 · 103 = ⇒ m = 3,4 · 106 kg V 2103 P = m · g = 3,4 · 106 · 10 = 3,4 · 107 N N 2m 100 m

129. b Lamarck defendia a lei de uso e desuso. Segundo ele, adaptados à vida subterrânea, anfíbios e répteis não precisariam usar seus olhos e patas. A falta de uso levaria ao desaparecimento desses órgãos. Lamarck não conhecia os conceitos de gene e mutação, o que exclui as alternativas d e e. 130. c Os efeitos do derrame de petróleo na Baía de Guanabara em 2000 ilustram a grande interdependência entre as diversas formas de vida e seu hábitat. Ao desfavorecer a realização da fotossíntese, o derrame de petróleo desfavorece toda a comunidade marinha.

PN

30°

PT

Pela figura, nota-se que a força que o muro deve suportar deve ser equivalente ao valor de PT: F = PT = P · sen 30° = 3,4 · 107 · 0,5 = 1,7 · 107 N = 17 · 106 N = 17 MN

expoENEM 82


140. c

149. b Volume do cubo: V = (a)3 = (10–1)3 = 10–3 m3 10–3 Volume submerso: Vsub = = 5 · 10–4 m3 2

g = 3 · a ⇒ 3 · 10 = 3 · a ⇒ a = 1 · 10 °C DL = L0 · a · DT 4X = 2L0 · 1 · 10–5 · 50 X = 2,5 · 10–4 · L0 Para L0 = 10: X = 2,5 · 10–4 · 10 = 2,5 · 10–3 m = 2,5 mm –5

–5

–1

E

T

141. d P

142. a 143. d A inversão do sentido da corrente provoca inversão do sentido do vetor indução magnética no interior da bobina. A inversão dos polos da bobina provoca a inversão da força magnética que o ímã permanente exerce sobre a bobina (eletroímã), gerando o movimento oscilatório. O aumento da frequência deixa o som cada vez mais agudo, ou seja, cada vez mais alto. 144. d 0,1 mol -------- 1 l x -------------- 0,02 l x = 0,002 mol ou 2 · 10–3 mol 5 H2O2 -------------- 2 KMnO4 5 mols -------------- 2 mols 2 · 10–3 mol -------- y y = 0,8 · 10–3 mol ou 8 · 10–4 mol 145. c 750 ml ---------100% x -------------- 13% x = 97,5 ml de etanol

Da figura, temos: T + E = P ⇒ E = P – T = 30 – 24 = 6 N E = mágua · Vsub · g 6 = mágua · 5 · 10–4 · 10 mágua = 1,2 · 10–3 kg/m3 = 1,2 g/cm3 150. d 1°. passo Velocidade na queda livre: v = 126 km/h = 35 m/s v = v0 + a · t 35 = 0 + 10 · t t = 3,5 s 2°. passo No momento em que passa a atuar a força normal (vertical para cima), temos: FR = N – P = 2,6P – P = 1,6P 3°. passo Aplicando a 2ª. Lei de Newton: FR = m · a 1,6P = m · a 1,6 · m · g = m · a |a| = 16 m/s2 ⇒ a = –16 m/s2 v = v0 + a · t 0 = 35 – 16 · t t = 2,2 s 4°. passo tTOT = 3,5 + 2,2 = 5,7 s

0,8 g ---------- 1 ml y ------------- 97,5 ml y = 78 g de etanol 1 mol de etanol (C2H6O) -------- 46 g w ---------------------------------- 78 g w = 1,7 mol

151. a Na figura, quando o comprimento de onda da luz fica próximo das dimensões do orifício, passa a ocorrer a difração da luz. Esse fenômeno também pode ocorrer quando uma pessoa conversa com outra do outro lado de um muro, em que o som acaba contornando esse obstáculo.

1,7 mol ------- 0,75l z -------------- 1l z = 2,26 mol/l 146. b O óxido de cálcio reage com a água formando hidróxido de cálcio, conforme a reação CaO + H2O → Ca(OH)2. Ao ser aplicado em troncos de árvores, na forma de suspensão, apresenta uma concentração maior que a do ambiente (hipertônico), provocando o processo de osmose, o que leva à morte dos microrganismos. 147. a Os dois chuveiros têm a mesma potência: PA = PB UA2 UB2 (127)2 (220)2 RA = ⇒ = ⇒ = 0,3 RA RB RA RB RB

152. c Pelo modelo atômico de Bohr, pode-se explicar que quando um elétron recebe energia, pode “saltar” para um nível energético mais afastado do núcleo e, ao retornar, libera essa energia na forma de fótons (luz). 153. b Desinfetante → fenol Removedor de tintas e esmalte → cetona Combustível de foguetes → álcool Fluido de embalsamento → aldeído 154. b

148. c Considerando o sistema como conservativo, toda a energia cinética que o atleta apresenta na etapa I é transformada em energia potencial na etapa III, quando ele praticamente estaciona no ar. expoENEM 83

N CH3

N H

fórmula molecular: C4H6N2 Amina


155. a

tade. Após 3 240 anos, a amostra se reduz a 1/4 de sua quantidade inicial. d. Falsa. Após decorridas três meias-vidas do rádio–226, teremos 1/8 de sua quantidade inicial, que equivale a 12,5% do total. e. Verdadeira. A meia-vida de um elemento radioativo é o intervalo de tempo no qual a quantidade de uma amostra radioativa é reduzida pela metade, e, a cada intervalo de tempo equivalente a 1 620 anos, as amostras de rádio–226 são reduzidas em 50%.

156. c 157. c 158. a

181. a Isótopos são elementos que apresentam o mesmo número atômico.

159. c 160. d

182. c Como os átomos são neutros, o número de prótons deve ser igual ao número de elétrons.

161. d 162. e

183. e O metal alcalino é o cálcio (Z = 20) e, como é bivalente, a distribuição eletrônica é 1s2 2s2 2p6 3s2 3p6.

163. d 164. a

184. a A distribuição eletrônica do ferro é 1s2 2s2 2p6 3s2 3p6 4s2 3d6. Para o íon, é necessário retirar os elétrons da última camada eletrônica, ficando deste modo: 1s2 2s2 2p6 3s2 3p6 3d5.

165. b 166. a

185. e Na relação de densidade, a massa é inversamente proporcional ao volume e, como o volume varia com a temperatura, em dias quentes, ocorre aumento do volume e consequente redução da massa. Seria correto vender o combustível por massa, porque ela não sofre influência da temperatura.

167. c 168. a 169. b

186. d A cada hora, o percentual da dose cai pela metade, ou seja, 50%. Passadas uma hora e meia, o valor deve ficar entre 25% e 50%.

170. d 171. b

187. d

172. c

188. c Como o plutônio pode ser usado tanto na usina quanto na fabricação de artefatos nucleares, isso possibilita que um de seus subprodutos seja utilizado como material bélico.

173. e 174. e

189. c I – Falsa. O aquecimento é o mesmo tanto no continente quanto no oceano. II – Verdadeira. A vegetação absorve água do solo e a libera na forma de vapor pela transpiração. III – Verdadeira. IV – Verdadeira. Permite a penetração da água no solo. V – Verdadeira.

175. b 176. b 177. d 178. c 179. b 180. e a. Falsa. Quanto maior for a meia-vida, mais tempo levará para que ocorra o decaimento radioativo pela metade, logo, será mais lenta a desintegração. b. Falsa. Após o intervalo de tempo equivalente a 4 860 anos, 7/8 da massa do elemento já terá decaído. c. Falsa. A meia-vida de um elemento radioativo é o intervalo de tempo no qual a quantidade de uma amostra radioativa é reduzida pela me-

190. e Algumas substâncias tóxicas, corrosivas, radioativas trazem uma série de vantagens e benefícios para nossa sociedade, porém, é necessário tratar do assunto com responsabilidade e conhecimento. 191. a Um dos maiores problemas da energia atômica é a produção de lixo nuclear, que continua a emitir radiação por longos períodos de tempo. 192. c

expoENEM 84


193. a Como a água é uma substância, ela apresenta ponto de ebulição constante, embora esteja recebendo calor da fonte. Se a temperatura medisse a quantidade de calor de um corpo, em toda situação em que um corpo recebesse calor, sua temperatura deveria aumentar.

206. c Dx = 10 km Carroça: do cotidiano, sabe-se que esse veículo não gastaria duas semanas e meia para percorrer 10 km. Carro: do cotidiano, sabe-se que esse veículo não gastaria dois dias e meio para percorrer 10 km.

10 Dx = = 4 km/h (valor possível) 2,5 Dt 2,5 1 Bicicleta: Dt = 2,5 min = h= h 60 24

194. c

Caminhada: vm =

195. d 196. c

10 Dx = = 240 km/h (valor incompatível com o de uma bicicleta) 1 Dt 24 2,5 1 h= h Avião: Dt = 2,5 s = 3600 1440 10 Dx vm = = = 14 400 km/h (valor incompatível com o de um 1 Dt 1440

vm =

197. c A experiência de Rutherford utilizou o bombardeamento de partículas alfa na lâmina de ouro. Para a identificação dessas partículas, foi utilizado um anteparo com sulfeto de zinco que brilhava toda vez que ocorria uma colisão. 198. d A emissão de energia ocorre quando os elétrons excitados dos íons metálicos, presentes nos fogos de artifícios, retornam para os níveis de menor energia.

avião comercial, que viaja em torno de 1 000 km/h) 207. c v = 72 km/h = 20 m/s

x Dx ⇒ 20 = ⇒ Dx = 80 m 4 Dt

199. c

vm =

200. a O chumbo e o estanho são substâncias porque apresentam propriedades físicas constantes, porém, ao fazer a liga metálica, ocorre a formação de uma mistura eutética, pois apenas o ponto de fusão está constante.

208. b Dt = 14 min 41,54 s = (14 · 60) + 41,54 = 881,54 s

201. a a. Verdadeira b. Falsa. O metanol é uma substância. c. Falsa. A cachaça é uma mistura. d. Falsa. Uma substância pode ser formada por um, dois, três ou mais elementos químicos.

209. e

202. c Fissão nuclear é o processo pelo qual um núcleo de número de massa grande se divide em fragmentos de números de massa menores. Pb207 + 0n1 → 79Au197 + 3Li7 + 4 0n1 82 203. a Ao colocar 50 mℓ de gasolina na proveta, tem-se uma mistura de gasolina e álcool. Quando se coloca a água, a quantidade de gasolina fica em 34 mℓ, ou seja, 16 mℓ de álcool se dissolveram na água. 50 mℓ ––– 100% 16 mℓ ––– x x = 32% 204. b As observações eram feitas considerando a mudança de posição do Sol em relação à superfície da Terra, logo, a Terra era considerada o sistema de referência para o estudo desse movimento. 205. b Em relação ao solo, as velocidades dos dois aviões são iguais, e as trajetórias são paralelas. Dessa forma, um avião se encontra em repouso em relação ao outro.

vm =

1500 Dx = ≅ 1,70 m/s ≅ 6 km/h 881,54 Dt

1. Verdadeiro. Dt = 4 min = 240 s vm =

x –x 600 – 200 400 400· 3,6 Dx = f i = = m/s = = 6 km/h t 240 240 240 Dt

2. Verdadeiro. De 6 min a 8 minutos, a esteira esteve parada, pois não houve mudança de posição. 3. Verdadeiro. Não houve inversão, logo, a distância percorrida = deslocamento = Dx = xf – xi = 1400 – 200 = 1200 m 210. c vm =

380 Dx = = 9,5 m/s 40 Dt

211. c O deslocamento de ambos é o mesmo, logo: Dxgraveto = Dxcão vgraveto · Dtgraveto = vcão · Dtcão vgraveto · 4 = 5 · 10 vgraveto = 12,5 m/s 212. d Ao percorrer a mesma distância d, as ondas S gastam 2 minutos a mais que as ondas P, logo: 2 min = 120 s DtS = DtP + 120

d d DxS DxP = + 120 ⇒ = + 120 ⇒ d = 900 km 3 5 vS vP

213. b vbarco = 26 nós = 26 · 0,5 = 13 m/s vrio = 5 m/s Dx = 40 km = 40 000 m

expoENEM 85


Rio acima: vresultante = vbarco – vrio = 13 – 5 = 8 m/s

219. d Para que ocorra o encontro do dardo com o macaco, os dois movimentos devem acontecer no mesmo intervalo de tempo.

x 40000 ⇒8= vresultante = Dt Dt

60 m

Dt = 5000 s = 3600 s + 1400 s ≅ 1 h + 23 min

macaco dardo   v = ?

214. a No gráfico velocidade versus tempo, a maior inclinação da reta em relação ao eixo do tempo indica o móvel com maior aceleração, logo a aceleração é máxima entre 0 s e 1 s.

45 m

215. c No gráfico velocidade versus tempo, a velocidade é constante no trecho em que o gráfico é uma reta paralela ao eixo do tempo, logo a velocidade é constante entre 5 s e 8 s.

encontro

1 1 Vertical → Queda livre (macaco): Dx = g · t2 ⇒ 45 = 10 · t2 ⇒ t = 3 s 2 2

216. d

Dx Dx   ⇒ 20 =    ⇒  Dx = 20 km Dt 1 Dx Dx Deslocamento total: vm = ⇒ 22 = ⇒ Dx = 44 km Dt 2 Primeiro trecho: vm = 

Horizontal  → Movimento uniforme (dardo): Vm =

Segundo trecho: Dx2 = Dxtotal – Dx1 = 44 – 20 = 24 km, logo deve-se procurar o gráfico em que a área tem esse valor, pois, neste gráfico, a área é numericamente igual ao deslocamento. Gráfico D: Dx2 = Área =

(B + b) · h 2

=

(26 + 22) · 1 2

= 24 km

217. d No gráfico velocidade versus tempo, a área do gráfico é numericamente igual ao deslocamento, logo, para se encontrarem partindo do mesmo ponto, devem ter o mesmo deslocamento, ou seja, devem ter a mesma área. Esse fato ocorre no instante t4.

t1

t2

tempo

t3

t4

velocidade

Carro B Carro P

Em um lançamento horizontal, o tempo de queda é o mesmo para qualquer velocidade horizontal, desde que os objetos sejam lançados da mesma altura. O movimento independe da massa do corpo. 221. c Em um lançamento horizontal, para a mesma altura de lançamento, o alcance é diretamente proporcional à velocidade inicial. O movimento independe da massa do corpo.

interbits®

Segundo o texto, embora a prancha seja freada durante seu movimento para a direita, é levada nessa direção pelo movimento do sistema de polias. Para que isso aconteça, é necessário que as polias ligadas diretamente à prancha pela parte de cima (1 e 2) girem no sentido anti-horário, e as polias na parte de baixo (3 e 4), no sentido horário.

v0

t0

220. d

222. c

223. a Quanto maior a frequência com que gira a roda traseira, maior o número de pedaladas. Analisando a relação de acoplamento com mesma correia, encontrada entre as coroas traseira e dianteira, temos:

t5 interbits®

velocidade

Carro B Carro P

60 Dx = = 20 m/s 3 Dt

Rtraseira · ftraseira = Rdianteira · fdianteira ftraseira =

Rdianteira · fdianteira Rtraseira

Por meio da equação, notamos que, quanto maior for o raio da roda dianteira em relação à traseira, a roda traseira irá girar com maior frequência, logo a melhor opção para que isso aconteça é o indicado na figura A.

v0

t0

t1

t2

tempo

t3

t4

224. c

t5

As polias de diâmetros 30 cm e 10 cm apresentam raios de Rdianteira = 15 cm e Rtraseira = 5 cm respectivamente.

218. d Durante a queda, o peso permanece constante, gerando movimento uniformemente variado, logo a equação que representa o movimento é:

1 g · t2, em que a distância percorrida durante a queda é diretamenDx = 2

te proporcional ao quadrado do tempo, ou seja, ao dobrar o tempo, o deslocamento quadruplica. Por esse motivo, o deslocamento aumenta mais rapidamente que o tempo de reação, ou seja é um movimento acelerado.

f=

n. de voltas n = t t

Estas polias estão ligadas pela mesma correia, logo: Rd · fd = Rt · ft

expoENEM 86


Rd ·

nd n = Rt · t (os intervalos de tempo são iguais, logo podem ser td tt

Referências

simplificados)

ÁLVARES, Beatriz Alvarenga; LUZ, Antônio Máximo Ribeiro da. Curso de Física. São Paulo: Harper & Row do Brasil, 1979.

Rd · nd = Rt · nt

AMABIS, José Mariano; MARTHO, Gilberto Rodrigues. Biologia dos organismos – a diversidade dos seres vivos. 2. ed. São Paulo: Moderna, 2004. v. 2. BAIRD, C. Química ambiental. São Paulo: Artmed, 1995.

15 · 1 = 5 · nt ⇒ nt = 3 voltas

BIBLIOTECA VIRTUAL. Alto-falantes, microfones e telefones. Disponível em: <http://www.educativa.org.br/servicos/mad-a2-5.htm>. Acesso em: 15 maio 2012.

A roda traseira apresenta diâmetro de 80 cm, ou seja, de raio Rp = 40 cm = 0,4 m Deslocamento para 3 voltas: Dx = 3 · (2 · p · R) = 3 · (2 · 3 · 0,4) = 7,2 m

BRASIL ESCOLA. Disponível em: <http://www.brasilescola.com>. Acesso em: 23 abr. 2010.

CARVALHO, Wanderley. Biologia em foco. v. 1. São Paulo: FTD, 1998. São Paulo: Saraiva, 1997. ______. Bio. V. único. São Paulo: Saraiva, 1999.

2 · 3,14 · 6000 2pR = = 1 570 km/h ≅ 1 600 km/h 24 T

CIÊNCIA HOJE NA ESCOLA. Tempo & Espaço. v. 7. São Paulo: SBPC, 1999. COELHO, Ricardo Dias; OLIVEIRA, Adilson José Costa. Disponível em: <http://super.abril.com. br/cotidiano/arco-iris-438912.shtml>. Acesso em: 04 maio 2011.

226. a Pela equação acp =

BÔAS, Newton Villas; DOCA, Ricardo Helou; BISCUDA, Gualter José. Os tópicos da Física. 20 ed. São Paulo: Saraiva, 2007. v. 1, 2, 3. CALÇADA, Caio Sérgio; SAMPAIO, José Luiz; Física clássica. 2. ed. São Paulo: Atual, 1998. v. 1, 2, 3, 4, 5.

225. d Vm =

BÔAS, Newton Villas; DOCA, Ricardo Helou; BISCUDA, Gualter José. Os tópicos da Física. 4. ed. São Paulo: Saraiva, 1987.

v2 , para a mesma velocidade linear, a aceleração R

centrípeta é inversamente proporcional ao raio da trajetória descrita, logo, o corpo A, que descreve trajetória de menor raio, tem maior aceleração centrípeta.

FILHO, A.G.; BAROLLI, E. Instalação elétrica. São Paulo: Scipione, 1997. <http://inovacaotecnologica.com.br>. Acesso em: 28 abr. 2010. FONSECA, Albino, Biologia. São Paulo: IBEP, 1999. GESTAÇÃO de quadrigêmeos era farsa, diz advogado de “supergrávida”, 20 jan. 2012. G1. Disponível em: <http://g1.globo.com/sao-paulo/noticia/2012/01/advogado-de-gravida-confirma-farsa-em-gestacao-de-quadrigemeos.html>. Acesso em: 10 maio 2012. GREF. Física. 7. ed. São Paulo: Edusp, 2002. v. 1, 2, 3. GREENEMEIER, Larry. Scientific American Brasil. n. 107, abr. 2011. Disponível em: <http://www2.uol.com.br/sciam/artigos/iodeto_de_potassio_protege_pessoas_ contra_radiacao_.html>. Acesso em: 24 abr. 2011. GILBSON et al. Creation of a bacterial cell controlled by a chemically synthesized genome. Science, v. 329, 2010. GRIFFITHS, A. J. F. et al. Introdução à genética. Rio de Janeiro: Guanabara Koogan, 2002. HALLIDAY, David; RESNICK, Robert; WALKER, Jearl. Fundamentos de Física. 8. ed. Rio de Janeiro: Livros Técnicos e Científicos, 2009. v. 1, 2, 3, 4. HOUAISS, Antônio. Dicionário eletrônico. Versão 1.0. Rio de Janeiro: Objetiva, 2001. INSTITUTO de biociências. UNESP. Disponível em: <www.ibb.unesp.br>. Acesso em: 30 mar. 2012. KERR, A.S. et al. Notas sobre poluição do ar – III. Disponível em: <http://www.fap.if.usp. br/~akerr/texto_ozonio.pdf>. Acesso em: 15 maio 2012. LAUBIER, L. Diversidade da Maré Negra. In: Scientific American Brasil 4(39), ago. 2005. LINHARES, Sérgio; GEWANDSZNAJDER, Fernando. Biologia hoje. 10. ed. São Paulo: Ática, 1999. LOPES, Sonia Godoy Bueno Carvalho. Bio. São Paulo: Saraiva, 1997. V. 3. LOPES, Sônia. Bio. 2. ed. São Paulo: Saraiva, 2008. v. único. ______. Biologia. 2. ed. São Paulo: Saraiva, 2010. v. 1, 2, 3. LUZ, Antônio Máximo Ribeiro da; ÁLVARES, Beatriz Alvarenga. Curso de física. 6. ed. São Paulo: Scipione, 2005. v. 1, 2, 3. MACHADO, Sídio. Biologia: ciência & tecnologia. São Paulo: Scipione, 2009. MORANDINI, Clezio; BELLINELLO, Luiz Carlos. Biologia. São Paulo: Saraiva, 1999. O LIBERAL. Disponível em: <http://www.oliberal.com.br>. Acesso em: 8 jul. 2008 PAULINO, Wilson Roberto. Biologia. São Paulo: Ática, 1998. V. único. ______. São Paulo: Ática, 1998. V. 3. SADAVA, David; HELLER, H. Craig; ORIANS, Gordon H.; PURVES, William K.; HILLIS, David. Vida: a ciência da biologia. 8. ed. Porto Alegre: Artmed, 2009. v. 1, 2, 3. SOARES, José Luís. Biologia no terceiro milênio. São Paulo: Scipione, 1999. V. 3. ______. Biologia. 9. ed. São Paulo: Scipione, 1999. NATIONAL GEOGRAPHIC BRASIL: edição especial. São Paulo: Abril. abr. 2010. PARANÁ, Djalma Nunes. Física. 4. ed. São Paulo: Ática, 2002. v. 1, 2, 3. PESQUISA. n. 57. São Paulo: Fapesp, set. 2000. RADIOPROTEÇÃO E DOSIMETRIA: fundamentos. 5ª rev. Rio de Janeiro: IRD/CNEN, 2003. RAMALHO JR., Francisco; FERRARO, Nicolau Gilberto; SOARES, Paulo Antônio de Toledo. Os fundamentos da Física. 6. ed. São Paulo: Moderna, 1993. ROCHA-FILHO, R.C.R.; SILVA, R.R. Introdução aos cálculos da Química. São Paulo: McGraw-Hill, 1992. ROWLAND, Katherine. Falsificação de medicamentos. Disponível em: <http://www2.uol.com.br/ sciam/noticias/falsificacao_de_medicamentos.html>. Acesso em: 16 maio 2012. SADAVA, David et al. Vida: a ciência da Biologia. 8. ed. Porto Alegre: Artmed, 2009. SEARS, Francis; ZEMANSKY, Mark W.; YOUNG, Hugh D. Física. 12. ed. Rio de Janeiro: Livros Técnicos e Científicos, 2010. v. 1, 2, 3, 4. SINDIOPTICA RS. Disponível em: <http://www.sindioptica-rs.com.br/sind/index.php?option=com _content&view=article&id=79&Itemid=101>. Acesso em: 15 maio 2012. SUPERINTERESSANTE. Disponível em: <http://super.abril.com.br>. Acesso em: 1º abr. 2010. Utilidade pública. COCA-COLA e Pepsi terão de informar no rótulo riscos à saúde. Dispo-nível em: <http://utilidadepublica.inf.br/up/coca-cola-e-pepsi-terao-de-informar-no-rotulo-riscos-a-saude/>. Acesso em: 16 maio 2012.

expoENEM 87


TIPLER, Paul A. Física. 3. ed. Rio de Janeiro: Guanabara Koogan, 2009. v. 1, 2, 3. TORTORA, G. J. Corpo humano: fundamentos de anatomia e fisiologia. Porto Alegre: Artmed, 2000. VILLULLAS, H.M.; TICIANELLI, E.A.; GONZÁLEZ, E.R. Química Nova na Escola. n. 15, maio 2002.

Anotações

<jbonline.terra.com.br> <http://veja.abril.com.br/idade/exclusivo/perguntas_respostas/lei_seca/index.shtml> <http://www1.folha.uol.com.br/folha/dinheiro/ult91u440468.shtml> <http://www.estadao.com.br/noticias/vidae,explosao-de-raios-x-de-intensidade-recorde-cega-observatorio-espacial,581125,0.htm> <www.injetronic.com.br/imagens_dicas/dica23a.jpg> <http://cienciahoje.uol.com.br/revista-ch/revista-ch-2009/257/como-funcionam-os-radares-de-transito> <http://noticias.uol.com.br/bbc/2010/07/11/milhares-veem-eclipse-total-na-ilha-de-pascoa.jhtm> <http://revistaepoca.globo.com/Revista/Epoca/0,,EMI57740-15227,00-POR+QUE+RUIU.html> <http://revistagalileu.globo.com/Revista/Common/0,,EMI155592-17770,00PILHA+RECARREGA+COM+CHACOALHAO.html> <http://super.abril.com.br/tecnologia/sons-gerados-circuitos-eletronicos-equacoes-sonoras-440122.shtml> <http://mundoestranho.abril.com.br/saude/pergunta_287348.shtml> <http://mundoestranho.abril.com.br/tecnologia/pergunta_287803.shtml> <http://www.mspc.eng.br/termo/termod0520.shtml> <http://veja.abril.com.br/071101/p_072.html> <http://www.institucionalbrastemp.com.br> <http://oglobo.globo.com> <http://home.howstuffworks.com> <http://cdcc.usp.br/ciencia/artigos/art_11/energiacalorica.html>. Acesso em: 14 abril 2011. <http://g1.globo.com/jornal-nacional/noticia/2011/03/especialista-explica-fenomeno-que-atingiu-costa-japonesa.html>. Acesso em: 03 maio 2011. <http://mundoestranho.abril.com.br/ciencia/pergunta_286390.shtml>. Acesso em: 05 maio 2011. <http://mundoestranho.abril.com.br/ciencia/pergunta_286679.shtml>. Acesso em: 04 maio 2011. <http://super.abril.com.br/saude/dentes-perfeitos-rir-vontade-446372.shtml>. Acesso em: 24 abr. 2011. <http://www1.folha.uol.com.br/mundo/887167-tsunami-atinge-o-litoral-do-japao-apos-terremoto-de-magnitude-89.shtml>. Acesso em: 03 maio 2011. <http://www2.uol.com.br/niquel/bau/bau_tiras/20.gif>. Acesso em: 04 maio 2011. <http://www.biodieselbr.com/images/stories/charges/lula_dilma540.jpg>. Acesso em: 05 maio 2011. <http://www.diariodasaude.com.br>. Acesso em: 11 ago. 2010. <http://www.faac.unesp.br/pesquisa/nos/bom_apetite/tabelas/cal_ali.htm>. Acesso em: 05 maio 2011. <http://www.noticiasagricolas.com.br/noticias/biocombustivel/65809-biodiesel-de-soja-pode-gerar-quatro-vezes-mais-emissoes-que-diesel-convencional.html>. Acesso em: 04 maio 2011. <http://www.portaldoagronegocio.com.br/conteudo.php?id=54156>. Acesso em: 27 abr. 2011.

expoENEM 88


Matemática e suas tecnologias

01. A função do 1o grau tem a seguinte lei de formação: y = ax + b. Uma das funções do movimento uniforme é dada pela expressão espaço em função do tempo: s = s0 + vt. A comparação entre as expressões deixa bem claro que a fórmula definida como espaço em função do tempo é uma função do 1o grau. Com base nessa definição, considere o enunciado que segue. Dois carros se movem em linha reta, em movimento uniforme e no mesmo sentido. No instante t0 = 0 eles estão distantes 400 m um do outro, conforme a ilustração.

B

tas das armas utilizadas hoje são “filhas” das criações dele, como as metralhadoras e os tanques de guerra. Na figura a seguir, há o modelo de uma ponte invasora proposta por Da Vinci.

c

A

h

60o 400 m

Se o carro A desenvolve uma velocidade constante de 40 m/s e o carro B, de 30 m/s, quanto tempo o carro A levará para alcançar o carro B?

a. 10s

Suponha um castelo cuja muralha de proteção tem 34 m de altura. Sendo o ângulo formado pela escada em relação ao solo de 60o, é correto afirmar que, I. se o comprimento c da rampa plana for igual à medida h da altura da muralha, um soldado terá de percorrer, partindo da base da escada, uma distância de 64 m. (Dado: 3 @ 1,7)

b. 20s c. 30s d. 40s

II. se a rampa plana está protegida por um triângulo equilátero e a base da escada mede 2,0 m de largura, um soldado de altura 1,67 m pode passar em pé pela rampa plana.

e. 50s 02. Os fogos de artifício, também denominados foguetes pirotécnicos, são explosivos dotados de um pavio para iniciar a combustão. A combustão inicial provoca a rápida ascensão do foguete, que a certa altura explode violentamente. Esses fogos são usados em festas populares ou celebrações para criar um efeito ruidoso, ou como meio de avisar que algum acontecimento está iniciando ou terminando. Um cientista observou que a trajetória de um desses foguetes seguiu a lei matemática h(t) = –x2 + 10x – 5, na qual h é a altura, em metros, atingida pelo foguete em função do tempo t, em segundos, após o lançamento. Com base nessa situação, analise as afirmativas a seguir.

III. se a rampa plana tem 15 m de comprimento, serão necessários 138 m2 de madeira para confeccionar a escada.

a. todas as afirmativas são verdadeiras. b. todas as afirmativas são falsas. c. somente a afirmativa I é falsa. d. somente a afirmativa II é verdadeira.

I. O gráfico que traduz a função acima descrita é uma parábola com concavidade voltada para cima. II. A altura máxima atingida por esse foguete é de 20 m. III. Essa função tem duas raízes reais. IV. Se o foguete explodiu após 8 segundos do lançamento, ele se encontrava a 11 metros do solo.

É correto afirmar que

e. somente a afirmativa III é verdadeira. 04. A quantidade Q de cafeína em um indivíduo, t horas após sua ingestão, é dada pela expressão: Q(t) = Q0 a–t. Um indivíduo tomou uma xícara de café que contém 80 mg de cafeína. Sabe-se que o tempo necessário para que a quantidade de cafeína no organismo passe para metade é de, aproximadamente, 4 horas. Então: I. o valor de a é 2; 4

É correto afirmar que

II. a quantidade de cafeína que permanece no organismo, 3 horas 4 após a ingestão, é 20 2 mg;

a. todas as afirmativas são verdadeiras. b. todas as afirmativas são falsas.

III. admita que para valores inferiores a 15 mg de cafeína no organismo esta deixa de exercer efeitos estimulantes. Assim, são necessárias mais de 9 horas para que a cafeína deixe de exercer efeito sobre o organismo. (Dados: log2 = 0,3 e log3 = 0,4)

c. somente a afirmativa I é falsa. d. somente a afirmativa II é verdadeira. e. somente a afirmativa III é verdadeira. 03. Leonardo da Vinci é conhecido por suas lindas e famosas obras de arte, como a Gioconda (ou Mona Lisa). Poucos sabem que Leonardo da Vinci também foi cientista, matemático, inventor, engenheiro, arquiteto, escultor, poeta, botânico e músico. Da Vinci é considerado um dos maiores pintores de todos os tempos, e possivelmente a pessoa dotada de talentos mais diversos a ter vivido. Também foi um dos precursores da balística e da arte das armas. Mui-

expoENEM 1

É correto afirmar que a. todas as afirmativas são verdadeiras. b. todas as afirmativas são falsas. c. somente a afirmativa I é falsa. d. somente a afirmativa II é falsa. e. somente a afirmativa III é falsa.


05. Um estudante quer comprar um dentre dois carros usados. O carro A custa R$ 15 000,00 e faz 7,5 km/ℓ de gasolina, ao passo que o carro B custa R$ 21 000,00, porém faz 12,5 km/ℓ. Estima-se o custo da gasolina em cerca de R$ 2,50 por litro. Ambos os veículos estão em boas condições, assim, espera-se que o custo de consertos seja desprezível em médio prazo. Quantos quilômetros o estudante deve rodar antes que o carro B torne-se a melhor compra?

É correto dizer que a. todas as afirmativas são verdadeiras. b. todas as afirmativas são falsas. c. somente a afirmativa I é falsa. d. somente a afirmativa II é falsa. e. somente a afirmativa III é falsa.

a. 26 500 km b. 32 500 km

08. Dois aviões militares de caça A e B situam-se à distância de 45 km. Pretende-se calcular a distância entre dois outros aviões militares inimigos M e N fazendo medidas de ângulos a partir dos aviões A e B, como ilustra a figura abaixo.

c. 42 500 km d. 45 000 km e. 52 500 km

A

M 30o

06. Conforme ilustrado na figura, mantém-se fixa uma moeda girando a outra ao seu redor sem escorregões. Qual é o ângulo de giro da segunda moeda em torno de seu próprio centro quando volta à posição original?

60o

30o 60o

N

B

A distância, em km, entre M e N vale a. 50 km. b. 55 km. c. 60 km. d. 82 km. e. 100 km.

09. Um observador vê uma torre, construída em uma área plana, sob um ângulo de 45º. Aproximando-se 140 metros da torre, passa a vê-la sob um ângulo de 60º. Sabendo que a torre é dividida em plataformas numeradas a partir do solo, que distam uma da outra 20 metros, pode-se afirmar que (considere 3 = 1,7): I . a altura da torre é de 420 metros;

a. 360o

II. ao aproximar-se 140 metros da torre, o observador verifica a presença de um operário subindo as escadas que ligam uma plataforma a outra sob o ângulo de 30º. Esse operário encontra-se entre as plataformas 5 e 6;

b. 720o c. 1080

o

d. 1440o e. 1800o

III. ao chegar ao topo da plataforma, o operário observa um incêndio, sob um ângulo de 15º com uma horizontal paralela ao solo. O incêndio se encontra a aproximadamente 1 230 m da torre;

07. Denomina-se “função de produção” a quantidade máxima de produto

IV. se o operário desce da torre na velocidade 1,25 m/s e o incêndio se aproxima a 36 km/h, ambos em velocidade constante, ele desce antes de o incêndio alcançar a base da torre.

que pode ser produzida dada uma determinada quantidade de fatores produtivos e uma determinada tecnologia. Esse conceito pode ser aplicado a um produto ou a um serviço, a uma empresa, a um setor de atividade ou mesmo a toda uma economia. Considerando-se fixos todos os

a. todas as afirmativas são verdadeiras.

fatores menos um, a quantidade produzida será função desse fator. De-

b. todas as afirmativas são falsas.

nominando P a quantidade produzida na unidade de tempo e x a quanti-

c. somente a afirmativa I é falsa.

dade do fator variável utilizado na unidade de tempo, tem-se a função de produção P = f(x). Denomina-se produtividade média do fator variável o P . Considere a função de produção dada por valor indicado por Pm = x P(x) = 1200 4 x, em que P(x) é o número de sacos de soja produzidos por safra numa fazenda, e x é o número de pessoas empregadas por safra. Pode-se afirmar que I. serão produzidos 3 600 sacos de soja se forem contratadas 81 pessoas por safra; II. a produtividade é inferior a 50 sacos de soja por pessoa; III. na safra 1 foram contratadas x pessoas, e na safra 2 foram contratadas 16x pessoas. Portanto, com esse procedimento, a produção triplicou.

É correto dizer que

d. somente as afirmativas I e IV são falsas. e. somente a afirmativa IV é falsa. 10. Um grupo de pessoas apresentou problemas de saúde depois de almoçar em um restaurante recém-inaugurado, que não apresentava a autorização dos órgãos competentes para o funcionamento. Após uma investigação, descobriu-se a presença da bactéria Staphylococcus aureus na carne picada cozida, pois tal bactéria produz uma toxina que não é destruída a altas temperaturas. Suponha que essa bactéria multiplica-se segundo a lei N(t) = 15 + 5 . 2kt, em que N(t) é o número de bactérias encontradas na amostra de carne picada cozida t horas após o início do almoço e k é uma constante real. Se após 1 hora e 30 minutos de início do almoço o número de bactérias era 55, pode-se afirmar que

expoENEM 2


I. o valor da constante real k é –2;

Gráfico I: Produção de grãos e população brasileira entre 1997 e 2003.

É correto dizer que a. todas as afirmativas são verdadeiras. b. todas as afirmativas são falsas.

feijão

176

milho 174

soja trigo

40

172

população

170

30

168

20

166 10

c. somente a afirmativa I é falsa. d. somente as afirmativas I e II são falsas.

164

0 1997

e. somente a afirmativa III é falsa.

1998

1999

2000

2001

2002

162 2003 Fonte: IBGE.

11. Um turista paga pelo aluguel diário de um automóvel a uma empresa A um valor fixo de R$ 100,00 e mais R$ 0,50 por quilômetro rodado. Uma empresa B cobra pelo aluguel diário de um automóvel semelhante uma taxa fixa de R$ 190,00 e mais R$ 0,45 por quilômetro rodado. Para que a empresa B seja mais vantajosa economicamente para o turista, o menor número N de quilômetros que ele deve percorrer com o automóvel é tal que

Gráfico II: Distribuição da renda da população em 2003

10%

b. 1 400 < N £ 1 600.

sal entre ário 10 sm e2 ínim 0 os

c. 1 600 < N £ 1 800. d. 1 800 < N £ 2 000.

0 de 2 os maiss mínim rio salá

a. 1 200 < N £ 1 400.

4%

dimento

6%

sem re n

178

arroz

50

produção (milhões de toneladas)

III. uma das pessoas contaminadas apresentou sintomas de mal-estar às 14h30min. Considerando que o restaurante começou o atendimento às 11h e no momento da refeição desta pessoa o número de bactérias era 75, então entre a refeição e o início dos sintomas passaram-se 1h42min. (Dados: log2 = 0,30 e log3=0,48)

60

população (milhões de habitantes)

II. existiam 20 bactérias no início do processo de contaminação;

e. 2 000 < N £ 2 200.

28% até 2 salários mínimos

19% entre 5 e 10 salários mínimos

12. (Simulado Enem 2009) A Evolução da Luz As lâmpadas LED já substituem com grandes vantagens a velha invenção de Thomas Edison A tecnologia do LED é bem diferente das lâmpadas incandescentes e das fluorescentes. A lâmpada LED é fabricada com material semicondutor semelhante ao usado nos chips de computador. Quando percorrido por uma corrente elétrica, ele emite luz. O resultado é uma peça muito menor, que consome menos energia e tem uma durabilidade maior. Enquanto uma lâmpada comum tem vida útil de 1 000 horas e uma fluo-rescente de 10 000 horas, a LED rende entre 20 000 e 100 000 horas de uso ininterrupto. Há um problema, contudo: a lâmpada LED ainda custa mais caro, apesar de seu preço cair pela metade a cada dois anos. Essa tecnologia não está se tornando apenas mais barata. Está também mais eficiente, iluminando mais com a mesma quantidade de energia. Uma lâmpada incandescente converte em luz apenas 5% da energia elétrica que consome. As lâmpadas LED convertem até 40%. Essa diminuição no desperdício de energia traz benefícios evidentes ao meio ambiente.

33% entre 2 e 5 salários mínimos

Fonte: IBGE.

• Debatedor 1 – O Brasil não produz alimento suficiente para sua população. Como a renda média do brasileiro é baixa, o país não consegue importar a quantidade necessária de alimentos e isso é a causa principal da fome.

VEJA, “A evolução da luz”.

Considerando que a lâmpada LED rende 100 mil horas, a escala de tempo que melhor reflete a duração dessa lâmpada é o a. dia. b. ano. c. decênio. d. século. e. milênio.

Considere que três debatedores, discutindo as causas da fome no Brasil, chegaram às conclusões a seguir.

• Debatedor 2 – O Brasil produz alimentos em quantidade suficiente para toda sua população. A causa principal da fome, no Brasil, é a má distribuição de renda. • Debatedor 3 – A exportação da produção agrícola brasileira, a partir da inserção do país no mercado internacional, é a causa majoritária da subnutrição no país.

13. (Simulado Enem 2009) As condições de saúde e a qualidade de vida de uma população humana estão diretamente relacionadas com a disponibilidade de alimentos e a renda familiar. O gráfico I mostra dados da produção brasileira de arroz, feijão, milho, soja e trigo e do crescimento populacional no período compreendido entre 1997 e 2003. O gráfico II mostra a distribuição da renda familiar no Brasil no ano de 2003.

expoENEM 3

Considerando que são necessários, em média, 250 kg de alimentos para alimentar uma pessoa durante um ano, os dados dos gráficos I e II, relativos ao ano de 2003, corroboram apenas a tese do(s) debatedor(es) a. 1. b. 2. c. 3. d. 1 e 3. e. 2 e 3.


14. (Enem 2009) O desfibrilador é um equipamento utilizado em pacientes durante parada cardiorrespiratória, com objetivo de restabelecer ou reorganizar o ritmo cardíaco. O seu funcionamento consiste em aplicar uma corrente elétrica intensa na parede torácica do paciente em um intervalo de tempo da ordem de milissegundos. O gráfico seguinte representa, de forma genérica, o comportamento da corrente aplicada no peito dos pacientes em função do tempo.

16. Um empresário emprestou R$10 000,00 de um banco a uma taxa de juros simples de 5% ao mês, que deverá ser pago em x meses. Nessas condições, o montante M(x) a ser pago ao banco após x meses da realização do empréstimo está mais bem representado por qual dos gráficos a seguir? a.

b.

M(x)

M(x) 80 1,4 10 000

10 000

60

c.

40

d. M(x)

M(x) 20 3,9 10 000

0

10 000

5,2 0,1 7,2

–20

e. 0

2

4

6

t (ms)

10 500

De acordo com o gráfico, a contar do instante em que se inicia o pulso elétrico, a corrente elétrica inverte o seu sentido após

M(x)

a. 0,1 ms. c. 3,9 ms. d. 5,2 ms. e. 7,2 ms. 15. (Enem 2009) A cada ano, a Amazônia Legal perde, em média, 0,5% de suas florestas. O percentual parece pequeno, mas equivale a uma área de quase 5 mil quilômetros quadrados. Os cálculos feitos pelo Instituto do Homem e do Meio Ambiente da Amazônia (Imazon) apontam um crescimento de 23% na taxa de destruição da mata em junho de 2008, quando comparado ao mesmo mês do ano de 2007. Aproximadamente 612 quilômetros quadrados de floresta foram cortados ou queimados em quatro semanas. Nesse ritmo, um hectare e meio (15 mil metros quadrados ou pouco mais de um campo de futebol) da maior floresta tropical do planeta é destruído a cada minuto. A tabela abaixo mostra dados das áreas destruídas em alguns estados brasi