Page 1


CONGRESO ACADÉMICO

Conferencia Científica Anual sobre Síndrome Metabólico INFORMACIÓN LEGAL Conferencia Científica Anual sobre Síndrome Metabólico, Año 3, No.1, Octubre 2015 - Octubre 2016, es una publicación anual editada por el Dr. Antonio González Chávez, Aguascalientes No.19 D, Col. Roma Sur, Delegación Cuauhtémoc, C.P. 06760, México, Distrito Federal, Tel: (55) 55 94 74 53, conferenciasindromemetabolico@gmail.com, www.conferenciasindromemetabolico.org. Editor responsable: Dr. Antonio González Chávez. Reserva de Derechos al Uso Exclusivo No. 04-2014111117412400-203, ISSN 2395-8103 ambos otorgados por el Instituto Nacional del Derecho de Autor. Responsable de la última actualización de este Número, Departamento Editorial, Rémi Daragnez, Aguascalientes No.19 D, Col. Roma Sur, Delegación Cuauhtémoc, C.P. 06760, México, Distrito Federal, fecha de última modificación, 30 de septiembre de 2016. Esta publicación es un óragno de difusión científico de la Conferencia Científica Anual sobre Síndrome Metabólico. Su función es publicar los resúmenes de los trabajos de investigación presentados en nuestro congreso anual relacionados al síndrome metabólico. Los trabajos son publicados tal como los autores los enviaron. El contenido de los artículos incluidos en esta publicación es responsabilidad única de los autores. Esta publicación esta dirigida únicamente y exclusivamente a los profesionales de la salud.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CONTENIDO °°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°° PRESENTACIÓN TRABAJOS LIBRES ORALES Prevalencia y factores de riesgo de obesidad y sobrepeso en escolares de quinto año de primaria de Chilpancingo Guerrero 2015 Dos modalidades de ejercicio aerobio sobre componentes del síndorme metabólico Frecuencia de alteraciones metabólicas detectadas en una comunidad indígena del estado de Puebla

Efecto de la función inmunomoduladora de la nitazoxanida en células mononucleares de pacientes con diabetes mellitus tipo 2 Niveles de ghrelina en embarazo y posparto de mujeres con diabetes mellitus gestacional y embarazo con tolerancia normal a la glucosa Estudio del estado de nutrición con índice de masa corporal y porcentaje de grasa en escolares de 6 a 10 años

Efecto del consumo de alimentos y bebidas adicionados con jarabe de maíz de alta fructosa en los niveles plasmáticos de ácido úrico, colesterol y triglicéridos Índices antropométricos e hipertensión arterial en pacientes con artritis reumatoide del Estado de Guerrero, México Prevalencia de síndrome metabólico en unidades académicas de la Universidad Autónoma de Guerrero Formación médica a traves de la investigación

Ácido úrico ¿biomarcador de alteraciones cardiometabólicas?

www.conferenciasindromemetabolico.org

11 14 17 21 24 27 29 33 36 40 43


Relación de los polimorfismos g5665t y +138/ex1 ins/ del a en el gen edn1 con hipertensión arterial en población Guerrerense

Acúmulo de grasa y su asociación con los componentes del síndrome metabólico y acantosis nigricans

Efecto de un programa de ejercicio aerobio en el medio acuático sobre el riesgo cardiovascular Ejercicio aerobio sobre antropometría en mujeres con síndrome metabólico Factores de riesgo metabólico en adolescentes menonitas, Tarahumaras y mestizos Chihuahuenses

Variabilidad circadiana de la presión arterial medida con mapa a médicos familiares adscritos al HGR #1 c/mf Cuernavaca Morelos

Transcendencia de síndrome metabólico como factor de riesgo en pacientes con cáncer de mama Participación de la ciclooxigenasa-1 en el daño vascular renal en un modelo experimental de diabetes. Un análisis de la evolución de la diabetes

Síndrome metabólico en derechohabientes de 25 a 50 años de edad adscritos al Hospital General Regional no. 1 de Cuernavaca Morelos Determinación del factor de riesgo cardiovascular y niveles de adipocitocinas en jóvenes universitarios con sobrepeso y obesidad Correlación del índice de adiposidad visceral con los datos de distribución corporal obtenidos mediante el sistema de absorciometría de rayos x de energía dual

La función de la célula beta en familiares de primer grado de pacientes con diabetes tipo 2

Medición por ecografía basado en radiofrecuencia del Grosor Intima Media Carotideo y su correlación con factores de riesgo cardiovascular y comorbilidades en pacientes con amputación de miembro inferior secundario a necrobiosis diabética

www.conferenciasindromemetabolico.org

47 50 52 55 58 61 64 67 70 72 75 78

81


El polimorfismo 894G>T en el gen NOS3 y su relación con prehipertensión en población Guerrerense

Prevalencia de diabetes gestacional y factores de riesgo asociados, en la jurisdicción sanitaria 8 de secretaría de salud del Estado de Guanajuato Evaluación de la calidad de vida en pacientes con obesidad severa programados para cirugía bariátrica y post operados con cuestionario b.A.R.O.S y sf-36

Interacción del consumo de sal con polimorfismos en el canal epitelial de sodio y su relación con presión arterial alta en población Guerrerense

Factores de riesgo asociados al diagnóstico de sindrome de apnea e hipopnea obstructiva del sueño en pacientes adultos de la UMF 2 del IMSS Puebla Disminución en los niveles de insulina e IR- HOMA en ratas obesas tratadas con jugo de Aloe Vera Determinación de niveles de citoquinas circulantes en sujetos con cáncer de mama a diferentes IMC Correlación de cortisol y sensibilidad a la insulina en sujetos del centro de México

Correlación entre el índice cardiovascular y resistina en pacientes con disglicemia Niveles de amilina en sujetos con síndrome metabólico

Caracterización de subpoblaciones celulares asociadas al proceso inflamatorio de pacientes con diabetes mellitus tipo 2

Relación del hadv-d36 con la resistencia a la insulina y niveles de adipocinas en personas obesas

SNP en genes de la vía antioxidante NRF2-ARE asociados a síndrome metabólico: Distribución en mestizos de Chihuahua, México Efecto del consumo de fibra de nopal y parámetros de síndrome metabólico en pacientes con obesidad Efecto del consumo de nopal sobre parámetros de síndrome metabólico en jóvenes con obesidad

www.conferenciasindromemetabolico.org

84 87 91 94 98 102 105 107 110 112 115 118 121 125 128


Fenotipo proinflamatorio de células T en sangre periférica de jóvenes con síndrome metabólico Polimorfismos G-6A en el gen AGT e I/D en el gen ECA y su relación con hipertensión arterial

Asociación de la seropositividad para Adenovirus 36 con obesidad abdominal, niveles séricos de citocinas y alteraciones metabólicas

PRESENTACIÓN TRABAJOS LIBRES CARTEL

Efecto del consumo de una galleta enriquecida con vaina de cacao sobre el perfil cardiometabólico y la microbiota intestinal: prueba de concepto Síndrome metabólico y sus factores de riesgo en una población Tabasqueña

Alteraciones de peso, dislipidemias y diabetes un riesgo para síndrome metabólico en Tenosique Tabasco Efecto de un programa de ejercicio aerobio acuático sobre componentes del síndrome metabólico

CEO: Validación de un programa de ejercicio online para niños con diabetes

Efecto de la suplementación de edulcorantes naturales y artificiales sobre el perfil histomorfologico y distribución del tejido adiposo en ratones balb/c Viabilidad de un material didáctico llamado «el reloj diabético t2» en pacientes diabéticos tipo 2

Fiber-bypass® fibra dietética para el control glicémico en diabetes mellitus tipo II Conocimiento del protocolo de atención para un paciente hipertenso en un tratamiento odontológico Frecuencia de síndrome metabólico en pacientes atendidos en CESSA Tehuacán en primer semestre del 2016 El tejido adiposo visceral está correlacionado con la condición cardiorrespiratoria y la composición corporal de la condición física relacionada con la salud obtenida a través de la batería ALPHA-FIT

www.conferenciasindromemetabolico.org

131 135 139

143 147 149 151 154 157 158 160 162 165

169


Página web de consultas geográficas a la base de datos de la ENSANUT Impacto de un programa de ejercicio sobre la salud cardiovascular y la calidad de vida de pacientes con amputación de miembro inferior secundaria a necrobiosis diabética. Estudio piloto

Relación de la somatometría y el tiempo de gestación del recién nacido de acuerdo al estado de nutrición del padre

Frecuencia de síndrome metabólico e hiperuricemia y su asociación con el consumo calórico, en los trabajadores de turno diurno vs nocturno en un hospital comunitario del centro de México Factores de riesgo asociados a periodontitis en el paciente obeso

Ingesta dietética, obesidad y sobrepeso en pacientes con síndrome metabólico Relación del índice tg/hdl con factores de riesgo cardiovascular en sujetos aparentemente sanos Factores de riesgo en diabéticos tipo 2 que influyen en el control glucémico en la UMF 51

Prevalencia de sobrepeso y obesidad en adolescentes y su relación con el desarrollo puberal Malnutrición por deficit y por exceso en escolares de origen me’phaa del Estado de Guerrero Factores de riesgo asociados a comorbilidades perinatales en mujeres con diabetes gestacional Factores relacionados al estado de nutrición en los alumnos de ingreso a la Carrera de Médico Cirujano de la Facultad de Estudios Superiores Zaragoza

Factores de riesgo asociados a infarto agudo a miocardio y evento vascular cerebral en pacientes con diabetes mellitus 2 UMF 51 Calidad de la alimentación en niños de 12 a 47 meses del centro de desarrollo infantil en Gómez Palacio, Durango

www.conferenciasindromemetabolico.org

172

176 179

182 186 189 191 194 197 200 202 204 208 210


Prevalencia de sobrepeso y desnutrición en niños de un centro de desarrollo infantil de Gómez Palacio, Durango

Efecto del ejercicio aeróbico sobre perfil de lípidos en población estudiantil de la Facultad de Ciencias Químicas en Chihuahua, Chihuahua Frecuencia de diabetes mellitus, hipertención arterial y dislipidemias en pacientes que acudieron a CESSA Tehuacán en el primer semestre del 2016 Asociación de amilina y marcadores bioquímicos en una población ambulatoria con Síndrome Metabólico de la UMF No. 23 del IMSS

Indicencia de síndrome metabólico en población mexicana con trasplante renal y su impacto en la función del injerto Relación del índice HOMA-IR con periodontitis en sujetos aparentemente sanos Influencia del consumo de ácidos grasos saturados, fibra y agua, sobre los componentes del síndrome metabólico en jóvenes obesos

Prevalencia del síndrome metabólico y sus componentes en pacientes con diabetes Grupos de ayuda mutua, estrategia para el tratamiento de las enfermedades crónico degenerativas: impacto de la orientación nutricional

Cambios en el peso total de tejido graso inducidos por la infección de Taenia pisiformis en conejos macho con sobrepeso Evaluación del estado nutricional y grado de control metabólico en pacientes geriátricas con obesidad y diabetes mellitus

Relación entre variables metabólicas y de composición corporal en jóvenes universitarias La invisibilidad de la obesidad en los registros hospitalarios 2015

www.conferenciasindromemetabolico.org

213 216 219 222 225 229 232 235 237 244 247 249 252


Implementación de un programa de intervención educativa para reducir el sobrepeso y la obesidad en estudiantes de la Facultad de Farmacia de la UAEM

Determinación de hiperuricemia como factor de riesgo desencadenante de síndrome metabólico en estudiantes universitarios Índice cintura talla como factor de riesgo de síndrome metabólico y otras alteraciones cardiometabólicas Índice Cintura-Talla: Precisión diagnóstica de síndrome metabólico y otras alteraciones cardiometabólicas Factores asociados a obesidad en adolescentes de Chiapas Prevalencia y asociación de los componentes del síndrome metabólico en jóvenes universitarios con sobrepeso y obesidad

Componentes del síndrome metabólico, diferencias entre la edad y el tiempo de evolución

www.conferenciasindromemetabolico.org

254 257 260 263 266 268 271


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA Y FACTORES DE RIESGO DE OBESIDAD Y SOBREPESO EN ESCOLARES DE QUINTO AÑO DE PRIMARIA DE CHILPANCINGO GUERRERO 2015 Reyna Álvarez Malú Aidee1, Teliz Sánchez Martha H.2, Guzmán Aguilar Melva3, Álvarez Hilario Socorro4, Ramírez Montes Brian J.5, Reyna Álvarez Nallely6 ABSTRACT: A study in order to identify the prevalence and factors associated with obesity and overweight school was conducted. An observational study analytical. A total of 122 students in the fifth year Elementary School José Martí located in Chilpancingo Guerrero was studied. For analysis was used Statistical Package for the Social Sciences (SPSS) version 19 was used it was concluded that the factors associated with obesity or overweight were: signs of physical abuse, psychological abuse by the mother, psychological abuse by one of your parents, physical abuse by some parents, for any physical or psychological mistreatment room mate, and strong association with physical abuse by the mother was found. With P value <0.05. KEYWORDS: childhood obesity

I. INTRODUCCIÓN a salud es un elemento fundamental para el desarrollo económico del país.1 Solo a través de una población sana y del desarrollo de sus capacidades y potencialidades se puede lograr el Guerrero competitivo. El siguiente estudio comprende de dos fases; en la primera etapa se estimó la prevalencia de obesidad y sobrepeso de escolares de quinto año de primaria y, en la segunda etapa se identificaron los factores asociados a la obesidad. Este estudio incluye dos de las XII líneas prioritarias de la Secretaria de Salud del Estado de Guerrero las cuales son Obesidad y Maltrato infantil. Al conocer los factores que se asocian a la obesidad en la población de estudio, se podrán generar propuestas, recomendaciones y estrategias de mejora para los tomadores de decisiones y ellos puedan

L

realizar políticas públicas para mejorar la calidad de vida y de salud de los niños de esta institución. Los maestros han relacionado el aumento de obesidad infantil y a la ola de violencia suscitada en Chilpancingo Guerrero; es por ello que surgió el interés de realizar esta investigación y generar datos duros que puedan dirigir y mejorar la salud en los niños de esta escuela.

II. METODOLOGÍA El estudio fue descriptivo, observacional, transversal, el tipo de muestreo fue no probabilístico, por conveniencia dando un total de 122 escolares de 5to año de la Escuela Primaria José Martí de

Chilpancingo de los Bravo Gro. Este estudio consto de dos etapas, en la primera se tomó el peso y la talla para sacar el IMC, para la segunda etapa se utilizó un cuestionario con preguntas semiestructuradas que se forma de 31 ítems formada por las siguientes secciones: identificación general y datos personales, actividad física, maltrato familiar. El análisis estadístico se realizó en el software SPSS 19, obtenido como medida de asociación el OR (Odds Ratio) con su respectivo IC 95% y la significancia estadística: Valor p < 0.05.

III. RESULTADOS Se estudió un total de 122 (100%) alumnos que cursan el quinto año en la Escuela Primaria José Martí ubicado en Chilpancingo Guerrero. Se observó que el género predominante fue el femenino con 59.84% (73), el masculino 43.44% (49). Respecto al estado nutricional se encontró que el 32.79% (40) tuvo sobrepeso y un 7.37% (9) obesidad tipo I; aunque es elevado el porcentaje de niños con obesidad

Coordinadora Estatal de Educación en Investigación, Secretaría de Salud del Estado de Guerrero. 2 Jefa del Departamento de Investigación, Secretaría de Salud del Estado de Guerrero. 3 Catedrática de la Unidad Académica de Enfermería N° 1 UAGro. 4 Enf. Qx. Del Hospital General de Acapulco, Secretaría de Salud del Estado de Guerrero. 5 Medico del Servicio Social de Medicina, Secretaría de Salud del Estado de Guerrero. 6 Estudiante de la Facultad de Medicina de la UAGro. 1

www.conferenciasindromemetabolico.org

11


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

y sobrepeso, el mayor porcentaje lo obtuvieron los niños con bajo peso con 40.16% (49) y lo más alarmante de estos resultados es que solo el 19.67% tuvo peso normal; esto quiere decir que solo 24 niños de 122 tuvieron un esta-

Respecto a las “señales de maltrato físico”, encontramos diferencias significativas entre estos dos grupos con un OR=6.48, lo que indica la probabilidad de seis veces más de tener “obesidad o sobrepeso” para los que tiene señales de maltrato

do nutricional bueno. Decidimos realizar un análisis estadístico tomando como medida de asociación el Odds ratio y P valor con Chi cuadrado. En cuanto a la variable “frecuencia de ejercicio” (menos de dos veces) (más de dos veces a la semana), se ha encontrado un OR=1.15, lo que indica que esta variable no tiene asociación; así mismo no tiene significancia estadística ya que obtuvimos un P valor de .713. De la misma forma al estudiar el “tiempo frente al televisor” no resulto ser una variable asociada a la obesidad ya que se obtuvo un p valor de .766.

físico en comparación a los que no tienen, con un IC=2.33-17.93, con un p valor de .000. En cuanto al “maltrato psicológico por el padre”, encontramos un OR= .452 lo que indica que tener “obesidad o sobrepeso” es un factor protector al maltrato psicológico por el padre, con un IC= .137-1.493, no se encontró significancia estadística con un p valor de .184. Acerca del “maltrato psicológico por la madre”, se encontró un OR=5.14 lo que indica la probabilidad de aproximadamente cinco veces más de tener “obesidad o sobrepeso” para los que presentan maltrato

12

www.conferenciasindromemetabolico.org

V3-N1 - 2016

psicológico por la madre, con un IC=2.02-13.07, con un p valor de .000. Sobre el “maltrato psicológico por alguno de tus padres”, se ha encontrado un OR=2.5, lo que indica que la probabilidad de tener “obesidad o sobrepeso” es dos veces mayor para los que tienen maltrato psicológico por alguno de tus padres que los que no, con un IC= 1.16-5.41, con un p valor de 0.017. En cuanto al “maltrato físico por padre” se obtuvo un OR = .901 y un P valor de .832 lo que indica hace esta variable no tiene significancia estadística. Acerca de “maltrato físico por la madre”, encontramos un OR=12.82 que indica aproximadamente trece veces mayor la probabilidad de tener “obesidad o sobrepeso” para los que presentan maltrato físico por la madre que para los que no, con IC=5.0-32.59, con un p valor de .000. De acuerdo al “maltrato físico por alguno de los padres”, se obtuvo en nuestro estudio un OR=4.4, indica que la probabilidad de tener “obesidad o sobrepeso” es aproximadamente cinco veces mayor para los que presentan maltrato físico por alguno de los padres que para los que no, IC= 2.0-9.7 con un p valor de .000. Respecto al “maltrato físico o psicológico por hermano”, se ha encontrado un OR=.374, lo que muestra que el tener “obesidad o sobrepeso” es un protector en cuanto el maltrato físico o psicológico por algún hermano, con un IC=1.28-.094, con un p valor de .065. De la misma manera al medir la variable Maltrato físico o psicológico por algún primo se encontró un OR= .117 y


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

un P valor de .018 haciendo esta variable un protector con significancia estadística. En cuanto al “maltrato físico o psicológico por algún compañero del salón, se ha encontrado un OR=3.42, muestra que la probabilidad de tener “obesidad o sobrepeso” es aproximadamente cuatro veces más para los presentan maltrato físico o psicológico por algún compañero del salón que para los que no, con un IC=1.55-7.52, con un p valor de .002. En cuanto al “maltrato físico o psicológico por algún maestro”, se ha encontrado un OR=1.72, lo que indica que esta variable no es muy representativa, con un p valor de .061. Respecto a la “frecuencia en la que consume comida rápida”, se encontró un OR=12.78, lo que indica la probabilidad de trece veces más de tener “obesidad o sobrepeso” para los que consumen comida rápida más de 3 veces a la semana que para los que consumen comida rápida menos de 3 veces a la semana, con un IC=5.34-30.59, con un p valor de 0.000. En cuanto a la “frecuencia en la que consume frutas y verduras”, se encontró un OR= 7.08, lo que indica la probabilidad de siete veces más de tener “obesidad y sobrepeso” para los que consumen frutas y verduras menos de tres veces a la semana que para los que consumen frutas y verduras más de tres veces a la semana, con un IC= 4.19-11.96, con un p valor de 0.000. Acerca del “frecuencia de bebidas azucaradas”, se observó un OR=41.64, lo que indica la probabilidad de aproximadamente cuarenta y dos veces más de tener

“obesidad o sobrepeso” para los que toman más de tres veces a la semana bebidas azucaradas que para los que toman menos de tres veces bebidas azucaradas, con un IC=14.49-119.59, con un p valor de 0.000.

IV. CONCLUSIONES En el presente trabajo se identificó que la prevalencia de obesidad de los niños de 5to año de Primaria José Martí fue de 7.37% y del sobrepeso de 32.79%. También se encontró un gran porcentaje de niños con bajo peso en el 40.16% y solo el 19.67% tuvo un estado de nutrición normal. Los factores asociados a la obesidad o sobrepeso fueron: señales de maltrato físico, maltrato psicológico por la madre, maltrato psicológico por alguno de tus padres, maltrato físico por algunos de los padres, maltrato físico o psicológico por algún compañero del salón, y con fuerte asociación se encontró el maltrato físico por la madre, consumir frutas y verduras menos de tres veces a la semana, consumir comida rápida más de tres veces a la semana, tomar bebidas azucaradas más de tres veces a la semana, todas con significancia estadística P valor < de 0.05.

V3-N1 - 2016

ción de la antropometría. Cap. 5. Informe de un comité de expertos de la OMS. Ginebra., p. 190-307. 3.- Olaiz R. Encuesta Nacional de salud y nutrición 2012. 4.- Fuentes M. El mal del siglo: obesidad. 23 Julio 2013 México social en Excélsior. 5.- Olaiz R. Óp. Cit. Pág. 3.

V. REFERENCIAS 1.- Aranceta, J. Epidemiologia de la obesidad en los países desarrollados. En: Nutrición y obesidad. Enero- febrero vol. 1 no. 1, p. 1222. 2.- Organización Mundial de la Salud (OMS). Lactantes y niños. En: El estado físico: Uso e interpreta-

www.conferenciasindromemetabolico.org

13


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

DOS MODALIDADES DE EJERCICIO AEROBIO SOBRE COMPONENTES DEL SÍNDROME METABÓLICO M.C. Viviana Navarrete Miramontes, Dra. María de Lourdes De la Torre Díaz ABSTRACT: The MS is associated with a 2-fold increase in the risk of cardiovascular disease, cardiovascular death, myocardial infarction and stroke, and increased 1.5fold risk of death from any cause. Methodology: convenience sample of 23 men with MS; before and after the intervention lipid profile, blood pressure, glucose, IA, anthropometry, BMI, Total subcutaneous adiposity and %BF was analyzed. 2 intervention groups were established: karate (6 weeks) and gymnastics (12 weeks). Exercise programs were aerobic with incremental loads. Results: In the K group the weight was reduced -1.81%, BMI -2.29%, waist circumference -3.40% all with p <.000; cholesterol -8.24% (p <.01), TG -28.51% %GC -3.74 both with p<.05, and IA -11.76% (p <.001). A tendency to decrease in SBP -7.38% DBP -9.65%, LDL -5.41% was observed; and to increase glucose 6.76% and 4.56% HDL. In the group Gm weight decreased -2.77% BMI -3.84%, TG -39.55% all of the above with p <.05; SBP -4.78% (p <.001); IA -25.43% (p <.01); a tendency to decrease the DBP -1.89%, glucose -8.12%, cholesterol -20.24%, LDL-21.70%, %BF -1.79% and HDL increased 11.80%. Conclusion: in both groups it was significantly reduced 2 of the 5 components of MS; in group K the IA significantly decreased -11.76% and 25.43% in Gm group. A systematic program of aerobic exercise at moderate intensity with incremental loads is effective in reducing MS components, IA and anthropometry. KEYWORDS: karate, gimnasia, ejercicio físico, aeróbico

I. INTRODUCCIÓN l Síndrome Metabólico (SM) es un conjunto de alteraciones fisiológicas, bioquímicas, clínicas y metabólicas interrelacionadas entre sí, como lo son el aumento de la circunferencia de cintura, niveles de triglicéridos (TG) elevados, lipoproteínas de alta densidad (HDL) disminuida, hipertensión (HTA) y glucosa elevada en ayunas(1). La ENSANUT 2012 revela que en México 6.4 millones de adultos mexicanos padecen diabetes (DM), de los cuales el 47% ya ha sido diagnosticado también con HTA; la prevalencia de sobrepeso y obesidad en este mismo grupo es de 71.28%(2). Tan solo en Chihuahua los casos nuevos en el año 2014 por DM2 fueron 15162, de HTA 25861 y

E

14

www.conferenciasindromemetabolico.org

20516 por obesidad(3).

II. METODOLOGÍA Estudio longitudinal con evaluaciones pre y post test. Se analizó una muestra por conveniencia de 23 varones con SM de la ciudad de Chihuahua. La investigación se apegó a los estatutos de la Ley General de Salud y a la Declaración de Helsinki(4). Antes y después de la intervención se analizó tensión arterial (TA), glucosa, perfil lipídico, Índice Aterogénico (IA); se determinó según protocolo ISAK(5) peso (kg), talla (cm), pliegues cutáneos del bíceps, tríceps, subescapular, supraespinal, abdominal y pantorrilla (mm), y circunferencia de cintura abdo-

minal (cm). A partir de las medidas anteriores se calculó índice de masa corporal (IMC), adiposidad subcutánea total y porcentaje de grasa (%GC). Se establecieron 2 grupos de intervención mediante distribución aleatoria: karate (K) y gimnasia (Gm). Se empleó pulsómetro telemétrico Polar para la toma y registro de la FC de trabajo cada 5 minutos durante la sesión completa. En el grupo K el ejercicio físico se aplicó durante 6 semanas con cargas incrementales, iniciando al 50% (semana 1 y 2) según fórmula de Karvonen, semanas 2 y 3 al 60% y concluyendo al 70% (56). Cada sesión tuvo una duración de 60 minutos incluyendo fase de calentamiento, parte medular con karate aeróbico y rutina de pesas en circuito, finalizando con ejercicios de flexibilidad. La intervención en el grupo Gm fue por 12 semanas, iniciando al 40% formula de Karvonen (semana 1-4), siguiendo al 50% (5-8) y concluyendo al 60% (9-12). Cada sesión fue de 60 minutos donde se inició con caminata ligera, parte medular con gimnasia aeróbica y concluyendo con pesas en circuito y ejercicios de flexibilidad. El procesamiento estadístico se realizó mediante software SPSS v.20. Se analizó la normalidad con

Facultad de Ciencias de la Cultura Física. Universidad Autónoma de Chihuahua.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

la prueba Kolmogorov-Smirnov y -5.41% y las HDL a aumentar de “t” de Student para la diferencia de 4.56%. Se redujo el colesterol de medias. 202.54 ± 32.93 a 185.85 ± 30.04 mg/dL (-8.24%) (p<.01), TG iniIII. RESULTADOS cial 212.08 ± 140.54 final 151.62 ± En el grupo K la edad fue de 36.54 81.10 (-28.51%) (p<.05) y el IA de ± 5.62 años, la talla de 170.59 4.93 ± 1.14 a 4.35 ± 1.12 (-11.76%) ± 6.42 cm, se redujo el peso de (p<.001). En el grupo Gm se ob100.54 ± 18.45 a 98.72 ± 18.15 servó tendencia a disminuir del kg, IMC de 34.52 ± 5.95 a 33.73 ± colesterol -20.24%, LDL -21.70%, 6.11 kg/m2 ambos con p<.000. Se TG de 268.90 ± 135.27 a 162.56 ± observó una tendencia a aumentar 85.76 mg/dL (-39.55%) (p<.05) y de la glucosa de 106.64 ± 16.47 a el IA de 5.23 ± 1.20 a 3.90 ± 1.17 113.85 ± 11.05 mg/dL; y a dismi- (-25.43%) (p<.01); las HDL aunuir en la tensión arterial sistólica (TAS) de 141.27 ± 19.86 a 130.85 ± 13.69 mmHg y la tensión arterial diastólica (TAD) de 89.91 ± 22.75 a 81.23 ± 13.04 mmHg. En el grupo Gm la edad fue de 40.60 ± 14.18 años, la talla de 171.10 ± 8.71 cm, el peso disminuyó de 88.72 ± 14.86 a 86.26 ± 13.45 kg, IMC de mentaron de 37.04 ± 7.95 a 41.41 30.50 ± 3.35 a 29.33 ± 2.66 kg/ ± 10.25 mg/dL (11.80%). * p<.05; m2 ambos con p<.05. La glucosa **p<.01; ***p<.001 se redujo de 99.80 ± 20.78 a 91.70 ± 11.27 mg/dL, la TAS de 125.50 IV CONCLUSIONES ± 6.43 a 119.50 ± 7.61 mmHg En el presente estudio se obser(p<.001) y la TAD de 79.50 ± 3.68 vó como en los pacientes con SM a 78 ± 4.21 mmHg (Figura 1). Re- el entrenamiento de resistencia

V3-N1 - 2016

HDL, LDL, colesterol total, IMC, TAS y TAD(6), demostrando que el aumento de la actividad física induce cambios positivos en el metabolismo de las lipoproteínas, disminuyendo los niveles de TG en sangre por el aumento de la actividad lipolítica. Con la regulación del metabolismo de grasa y glucosa, se incrementó la acción de la insulina reduciendo los factores de RCV, peso y TA(7). En ambos grupos se redujo significativamente 2 de los 5 componentes del SM; en el gru-

po K disminuyó significativamente el IA -11.76% y en el grupo Gm -25.43%. Se concluye que la combinación de ejercicio aerobio y un circuito de pesas, realizados de acuerdo a las directrices de ejercicio sistematizado, a intensidad moderada y con cargas incrementales, son una estrategia eficaz para la reducción de componentes del SM y antropométricos como circunferencia de cintura y %GC.

V. BIBLIOGRAFÍA 1. Kaur J. A comprehensive review on metabolic syndrome. Cardiology research and practice. 2014;2014. 2. Gutiérrez J, Rivera-Domferente a la salud cardiovascular dinámica se asocia con efectos fa- marco J, Shamah-Levy T, Vil(Tabla 1) en el grupo K se observó vorables en los factores de RCV lalpando-Hernández S, Franco A, una tendencia a disminuir de LDL como circunferencia de cintura, Cuevas-Nasu L, et al. Encuesta Nawww.conferenciasindromemetabolico.org

15


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

cional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México: Instituto Nacional de Salud Pública (MX), 2012. Psicología y Salud. 2012;25(1):111-22. 3. Epidemiología. Anuario de Morbilidad 1984-2015. Casos de enfermedad por fuente notificante 2016 [cited 2016 Junio]. Available from: http://www.epidemiologia. salud.gob.mx/anuario/html/casos_fuente.html. 4. WMA. Declaración de Helsinki de la AMM - Principios éticos para las investigaciones médicas en seres humanos 2016 [cited 2016 Junio]. Available from: http://www.wma.net/es/30publications/10policies/b3/. 5. ISAK. The International Society for the Advancement of Kinanthropometry 2016 [cited 2016 Junio ]. Available from: http:// www.isakonline.com/lang/es_ES. 6. Pattyn N, Cornelissen VA, Eshghi SRT, Vanhees L. The effect of exercise on the cardiovascular risk factors constituting the metabolic syndrome. Sports medicine. 2013;43(2):121-33. 7. Golbidi S, Mesdaghinia A, Laher I. Exercise in the Metabolic Syndrome. Oxidative Medicine and Cellular Longevity. 2012;2012:13.

16

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FRECUENCIA DE ALTERACIONES METABÓLICAS DETECTADAS EN UNA COMUNIDAD INDÍGENA DEL ESTADO DE PUEBLA Rubí Karmina Hernández Bonilla1, Martha Alicia Salgado Juarez2, Mayra Margarita Luna Juarez1 ABSTRACT: It has little knowledge about the state of health of populations living in high degree of marginalization. So it is extremely important to know the frequency of metabolic disorders by clinical laboratory tests in a population of Sierra Negra. They involved 51 subjects, determining glucose, cholesterol and triglycerides as well as a urinalysis. normoglicemia was found in 82%, for cholesterol 80% of the population, presented desirable level. Triglycerides showed high values (53%), finally urinalysis (EGO) reported Amorphous urate 14 cases (31%), calcium oxalate dihydrate 11 cases (25%) and amorphous phosphates 4 patients (9%), which which indicates that there might be disorders of metabolic type. Concluding that studies are needed routine clinical laboratory in order to detect changes to prevent long-term conditions such as type 2 diabetes or cardiovascular disease, which are a risk factor in the Mexican population. KEYWORDS: Marginalization, obesity, overweight, hypercholesterolemia, hypertriglyceridemia, type 2 diabetes, metabolic syndrome.

I. INTRODUCCIÓN os problemas de salud que han padecido las poblaciones indígenas, tales como cáncer, diabetes e hipertensión arterial, son de suma importancia ya que además de ser un grave problema de salud, generan altos costos a la población que carece de recursos económicos para enfrentarlos, por otra parte, el acceso a este tipo de comunidades resulta difícil debido al área geográfica en la que se ubican. Es por esto que se lleva a cabo un estudio, estadístico, descriptivo en la población de Piscuautla, con el objetivo de identificar posibles alteraciones, mediante pruebas de laboratorio clínico de rutina, en una población de la Sierra Negra: Piscuautla, Ajalpan Puebla.

L

II. METODOLOGÍA Se analizaron 51 muestras sanguíneas, obtenidas por punción venosa en ayuno, mediante siste-

ma de extracción al vacío (vacutainer) de individuos de entre 18 a 73 años, determinando concentraciones de glucosa, colesterol total y triglicéridos, además del análisis de 44 muestras para examen general de orina.

III. RESULTADOS Con un total de 51 participantes: 18 hombres (35%) y 33 mujeres (65%). El grupo etario oscilo en un intervalo de 18 a 73 años, sobresaliendo con un 27% los integrantes de 26 a 33 años, mientras que los individuos de 58-73 años de edad participaron en menor grado. De acuerdo a la clasificación de la Organización Mundial de la Salud1 se muestra que, la mayoría de los participantes presento sobrepeso, Obesidad Grado

I en hombres y Obesidad Grado II mayor en mujeres. (Fig. 1). En base a las referencias bibliográficas2-6, las concentraciones de glucosa para el 82% de la población, (27% hombres y 55% mujeres) se encuentra dentro de los intervalos biológicos de referencia. (Tabla 1). Esta normo-glicemia contrasta con cifras incrementadas de sobrepeso y obesidad (63%) para la población, lo cual significa que la mayor parte de los participantes no reflejan el estado metabólico real en el que se encuentran, siendo que solo el 18% presenta niveles elevados de glucosa en ayuno. El 80% de la población presentó una concentración deseable de colesterol total, mientras que 20% arrojó valores anormales mayores a 200 mg/dL. (Tabla 2). Para triglicéridos, 47% de la población presenta una concentración deseable, esto significa que un 53% de la población presenta niveles elevados de ellos, que probablemente se explica por una síntesis hepática de ácidos grasos ante un exceso de carbohidratos.7 (Tabla 3). Los cristales presentados en las muestras de estudio fueron uratos amorfos, oxalatos de calcio y fosfatos amorfos. (Tabla 4). Como se reportó anteriormente el sobrepeso

QFB, Departamento de Análisis Clínicos. Facultad de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla 2 Profesor Investigador. Departamento de Análisis Clínicos. Facultad de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla 1

www.conferenciasindromemetabolico.org

17


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

y la obesidad se presentó en alto porcentaje de la población estudiada, lo cual nos indica que pudiese haber trastornos de tipo metabólicos, ya que la presencia de cristales (uratos amorfos, oxalatos de calcio dihidratados y fosfatos amorfos) aun en mínima cantidad indican una sobresaturación en el organismo.

IV. CONCLUSIONES El estudio realizado mostró una prevalencia de sobrepeso con un 51% y obesidad del 12%. La concentración de glucosa registró 42 casos (82%) de normo-glicemia, 5 casos (10%) de intolerancia a la glucosa y 4 casos (8%) de Diabetes Mellitus tipo 2. En el metabolismo de lípidos, se identificó hipercolesterolemia en 10 casos (20%) e hipertrigliceridemia en 27 casos (28%). Los cristales reportados de manera escasa (+), fueron uratos amorfos 14 casos (31%), oxalatos de calcio dihidratados 11 casos (25%) y fosfatos amorfos 4 casos (9%). De acuerdo a los resultados obtenidos se sugiere realizar estudios más frecuentemente a este tipo de poblaciones a fin de prevenir enfermedades, puesto que estas determinaciones no son marcadores tempranos para detectar síndrome metabólico y en casos particulares dar un tratamiento, así como otorgarles información a través de campañas de salud cuya finalidad sea mejorar su situación. V. REFERENCIAS 1. Organización Mundial de la salud. Diez datos sobre la obesidad. Revisado el 2 enero de 2016 de 18

www.conferenciasindromemetabolico.org

http://www.who.int/features/ factfiles/obesity/facts/es/ 2. American Diabetes Association Standards of Medical Care in Diabetes. (2016). Diabetes Care. 39 (1). 3. Rosas Guzmán J., Calles J. Consenso de Prediabetes. Documento de Posición de la Asociación Latinoamericana de Diabetes (ALAD). 4. Prevención, Tratamiento y Control de la Diabetes Mellitus. Norma Oficial Mexicana NOM015-SSA-2010. Diario Oficial de la Federación. 5. Prevención, Tratamiento y Control de las Dislipidemias. Norma Oficial Mexicana NOM037-SSA-2012 .(2012). Diario Oficial de la Federación. 6. Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on detection, evaluation and treatment of high blood cholesterol in adults (Adult Treatment Panel III) Final report. (2002). 7. Sociedad Española de Medicina Interna. (2008). Protocolos, hipertrigliceridemias. Elsevier Doyma.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

19


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

20

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DE LA FUNCIÓN INMUNOMODULADORA DE LA NITAZOXANIDA EN CÉLULAS MONONUCLEARES DE PACIENTES CON DIABETES MELLITUS TIPO 2 Q.F.B. Mauricio Castillo-Salazar, M.S.P. Jesús A. Deloya-Villanueva, Dr. Gabriel Navarrete-Vázquez, Dra. Sara García-Jimenez, Dr. German Bernal-Fernandez. RESUMEN Introducción.En el mundo existen 415 millones de personas con diabetes y para 2040 habrá 642 millones de casos, el 90% son DM2. La respuesta inmunológica en esta enfermedad cursa por un proceso inflamatorio crónico de bajo grado con incremento de células inflamatorias. La nitazoxanida (Ntz) es una amida hibrida del ácido acetilsalicílico con actividad de amplio espectro y recientemente los salicilatos demostraron actividad antiinflamatoria inhibiendo factores de transcripción esenciales para la proliferación de células T y producción de citocinas proinflamatorias. En estudios anteriores, la Ntz demostró inhibir la producción de IL-6 en una línea de macrófagos murinos apoyando lo anteriormente mencionado. Objetivo. Determinar si la Ntz posee efecto inmunomodulador sobre células mononucleares (CMN) de sangre periférica de pacientes con DM2 controlados y no controlados en su nivel glucémico, en cultivos in vitro. Metodología. Los pacientes diabéticos fueron clasificados en controlados y no controlados, se les determinaron parámetros bioquímico-clínicos y se analizarón las subpoblaciones M1 (CD14+ CD16+ CD 163-) y M2 (CD14+ CD16+ CD163+), de monocitos/ macrófagos y linfocitos T reguladores (CD3+, CD4+, CD39+ y CD103+) por citometría de flujo, a partir de CMN. Posteriormente, las CMN se estimularón in vitro y se determinaron subpoblaciones M1, M2 y Treg postcultivo. Resultados. Pacientes controlados 29 (57%) y no controlados 22 (43%). Pacientes controlados mostraron una glucemia de 119.59 mg/dL y HbA1c de 6.35%, en contraste, los no controlados de 193.54 mg/dL y 8.21% respectivamente. Los monocitos/macrófagos M1 se expresaron en un 38% y M2 en un 0.85%. M1 fue casi 50 veces mayor que M2, mientras que para linfocitos Treg un promedio de 7.78%, mostrando una disminución en esta subpoblación con respecto a la literatura. Conclusión. Los pacientes con DM2 mostraron un aumento de la subpoblacion proinflamatoria M1 y disminución de linfocitos Treg en sangre periférica, de acuerdo al proceso inflamatorio crónico sistémico de bajo grado en estas enfermedad.

I. INTRODUCCIÓN a diabetes mellitus (DM) se caracteriza por trastornos metabólicos y defectos en la secreción y/o acción de insulina, lo que provoca la hiperglucemia. De acuerdo a la Federación Internacional de Diabetes, a nivel mundial existen 415 millones de personas con diabetes y se estima que para 2040 habrá 642 millones de casos, el 90% son DM2 (1). De acuerdo a la norma oficial mexicana NOM-

L

015 SSA 2-2010 inciso 3.10, los pacientes con DM2 se clasifican en controlados y no controlados. Los primeros son los que presenta de manera regular niveles de glicemia plasmática en ayuno (GPA) entre 70 y 130 mg/dL y hemoglobina glicosilada (HbA1c) por debajo de 7%. La respuesta inmunológica en esta enfermedad cursa por un proceso inflamatorio crónico de

bajo grado, destacando la presencia aumentada de macrófagos M1 (proinflamatorios), y disminución de los M2 (antiinflamatorios), sobreproducción de citocinas proinflamatorias como IL-1β, IL6, TNF-α y decremento de las antiinflamatorias como IL-10, diferenciación de los linfocitos T hacia clonas Th1 y Th17 y disminución de la subpoblacion de linfocitos T reguladores (Treg) encargados de regular negativamente la respuesta inmunológica (2), por lo que el empleo de moléculas que pudieran ejercer un efecto inmunomodulador podrían tener un efecto importante sobre la respuesta inmunológica en DM2. Recientemente los salicilatos han mostrado actividad antiinflamatoria a través de la inhibición de factores de transcripción como NF-kB y el factor nuclear activador de células T (NFAT), esenciales para la proliferación de células T y producción de citocinas proinflamatorias (3, 4). Así mismo, la nitazoxanida (Ntz) es una amida hibrida del ácido acetilsalicílico con actividad contra parásitos, bacterias y virus y en reportes previos se ha demostrado que la Ntz inhibe la producción de IL-6 a ni-

Facultad de Farmacia. Universidad Autónoma del Estado de Morelos.

www.conferenciasindromemetabolico.org

21


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

vel transcripcional en una línea de macrófagos murinos estimulados con liipopolisacaridos (5), apoyando lo anteriormente mencionado. Por lo que, el objetivo de este trabajo es determinar si la Ntz posee efecto inmunomodulador sobre células mononucleares de sangre periférica de pacientes con DM2 controlados y no controlados en su nivel glucémico, en cultivos in vitro.

II. METODOLOGÍA 1. Participaran pacientes diagnosticados con DM2, los cuales serán subdivididos en: pacientes diabéticos controlados y pacientes diabéticos no controlados. 2. Determinación de parámetros bioquímico-clínicos (citometría Hemática, glicemia y Hemoglobina glicosilada) y citocinas proinflamatorias (IL-1β, IL-6 y TNF-α) a partir de una muestra sanguinea. 3. Obtención de plasma y células mononucleares de sangre periférica por ficoll-hypaque. 4. Determinación de subpoblaciones M1 (pro-inflamatoria: CD14+ CD16+ CD 163-) y M2 (anti-inflamatoria: CD14+ CD16+ CD163+), de monocitos/ macrófagos y linfocitos T reguladores (CD3+. CD4+, CD39+ y CD103+), por citometría de flujo en pacientes controlados y no controlados. 5. Estimulación in vitro de CMN de pacientes controlados y no controlados con OKT3 (anticuerpo contra CD3) y nitazoxanida, marcadas con CPDF-670 para detectar la proliferación por citometría de flujo. 22

www.conferenciasindromemetabolico.org

6. Obtención de células mononucleares del cultivo y determinación de las subpoblaciones M1 y M2 de monocitos/macrófagos y linfocitos Treg por citometria. 7. Determinación de la concentración de citocinas pro-inflamatorias IL-1β, IL-6 y TNF-α en sobrenadante de los cultivos. 8. Analizar los resultados y determinar las posibles diferencias entre pacientes controlados vs no controlados.

V3-N1 - 2016

A través de citometría de flujo, se determinó la proporción de monocitos/macrófagos M1 y M2; Los monocitos/macrófagos M1 se expresaron en un 38% y para M2 de 0.85%, lo que representa una proporción de M1 casi 50 veces mayor que M2. El análisis de la subpoblación de linfocitos Treg de los pacientes se encontró un promedio de 7.78%, lo que representa una disminución de esta subpoblación en comparación con los valores de sujetos saludables reportados en III. RESULTADOS la literatura que van de 10 a 12% De la población estudia- (6, Figura 1). da (51 pacientes), la mayoría oscila entre el rango 51 y 59 años Se estandarizó el cultivo de las (33.3%) y mayor prevalencia de CMN in vitro marcando con CPDFmujeres (62.7%). Respecto a los 670 y estimulando con OKT3 (Fiestilos de vida, el 47.6% de los gura 2). pacientes refirieron el consumo de refresco, el 52.6 % realiza acti- Finalmente se correlacionaron las vidad física y el 93% de la pobla- variables, a través del coeficiente ción está bajo tratamiento con hi- de correlación de Pearson con la poglucemiantes. La media para el finalidad de conocer la asociación índice de masa corporal (IMC) es de variables y su significancia esde 28.97 Kg/m2, y el promedio de tadística. El IMC con la cantidad índice cintura-cadera (ICC) es de de monocitos de la citometría de 0.95. flujo resultó de 0.84 lo que indica El recuento diferencial mostró que una relación directamente proel número total de leucocitos de porcional entre ambas variables los pacientes fue 6,415 células/ (p=0.01). En contraste, la asociamm3; de ahí, el porcentaje de lin- ción del IMC vs linfocitos Treg de focitos fue de 36.8% y monocitos la citometría fue -0.67, lo que indide 9.47%. Respecto a los paráme- ca una relación inversamente protros bioquímico-clínicos, los pa- porcional con un valor de (p=0.1). cientes se clasificaron en controlados y no controlados 29 (57%) IV. CONCLUSIONES y 22 (43%), respectivamente. Los El análisis de subpoblaciones cepacientes controlados muestran lulares por citometría de flujo una glucemia de 119.59 mg/dL muestra incremento de la poblay HbA1c de 6.35%, en contraste, ción M1 en pacientes con DM2 los no controlados, la glucemia de asociado al estado inflamatorio 193.54 mg/dL y HbA1c de 8.21%. crónico de bajo grado caracterís-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tico de esta enfermedad. Además, la subpoblación de linfocitos Tregs responsable del mantenimiento de la homeostasis inmunológica se ve disminuida en estos pacientes.

V. BIBLIOGRAFÍA 1. Federación Internacional de Diabetes. (2015). Atlas de diabetes de la FID. 7° Edición: 9-17. 2. Guzman Flores JM, Lopez-Briones S. Celulas de la inmunidad innata y adaptativa en la dia-

betes melllitus tipo 2 y obesidad. Gaceta Medica de Mexico. 2012; 148:381-389. 3. Aceves M. et al. (2004). A new pharmacological effects of salicylates: Inhibition of NF-KB. Journal of Inmunology 173:5721-29. 4. Kopp E y Ghosh S. (2004). Inhibition of NF-KB by sodium salicylate and aspirin. Science. 265:95659. 5. Seong H, et al. (2012). Nitazoxanide suppresses IL-6 production

V3-N1 - 2016

in LPS-stimulated mouse macrophages and TG-injected mice. International Immunopharmacology. 13:23-27 6. Montoya CJ, Velilla PA, Rugeles MT. Caracterización de las células T reguladoras por citometría de flujo: estado del arte y controversias. Biomédica. 2010; 30:37-44.

www.conferenciasindromemetabolico.org

23


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

NIVELES DE GHRELINA EN EMBARAZO Y POSPARTO DE MUJERES CON DIABETES MELLITUS GESTACIONAL Y EMBARAZO CON TOLERANCIA NORMAL A LA GLUCOSA Q.F.B. Claudia Teresa Gutiérrez Escobar1, Dra. Renata Saucedo García1, Dr. Jorge Valencia Ortega1, Dr. Edgardo Puello Tamara2, Dr. Marcelino Hernández-Valencia1, Dra. Lourdes Basurto1, M. en C. Rosa Elba Galván Duarte3, Dra. Guadalupe Rico Rosillo4, Dra. Gloria Vega Robledo4 el nivel de ghrelina e insulina por radioinmunoanálisis y el nivel de glucosa, triglicéridos y colesterol por espectrofotometría. La resistencia a la insulina se evaluó utilizando el modelo homeostático HOMA RI. La variables cualitativas dicotómicas se compararon con la prueba chi cuadrada, mientras que las cuantitativas relacionadas y no relacionadas mediante las pruebas población mexicana son escasos. de Wilcoxson y U de Mann-Whitney, respectivamente. El análisis de correlación se realizó con la II. METODOLOGÍA Se realizó un estudio observacio- prueba de Spearman. nal, prospectivo, comparativo, longitudinal en el que se incluyeron III. RESULTADOS 49 mujeres embarazadas, 23 con Como se observa en el cuadro 1, la DMG y 26 con TNG. Se les tomó mayoría de las mujeres con DMG muestra de sangre venosa en el presentaban obesidad previa al tercer trimestre de embarazo y embarazo y mayor edad, factores seis semanas posparto y se midió de riesgo para este trastorno.

ABSTRACT: The prevalence of gestational diabetes mellitus (GDM) has been increasing during the past few decades in parallel to the obesity increment. Women with GDM are at high risk for developing type 2 diabetes. Recent studies have shown that ghrelin may play a role in regulating glucose metabolism and insulin sensitivity. The objective of the current study was to compare ghrelin concentration during pregnancy and postpartum between 23 women with GDM and 26 pregnant healthy controls. We also investigated the relationship between ghrelin and insulin resistance. There was no difference between groups in ghrelin levels; however, in the two groups ghrelin levels increased significantly after delivery. On the other hand, ghrelin was not associated with insulin resistance. PALABRAS CLAVE: Diabetes mellitus gestacional, ghrelina, resistencia a la insulina obesidad.

I. INTRODUCCIÓN a DMG es una de las principales complicaciones del embarazo con negativas consecuencias tanto para la madre como para el producto1. Por ello, el estudio de los mecanismos involucrados en este trastorno metabólico ha incrementado en los últimos años y se ha observado la participación de hormonas como la ghrelina. Esta hormona es secretada en el estómago y actúa principalmente en la hipófisis donde tiene una función orexigénica2. Se ha observado que la ghrelina tiene un papel en la regulación del metabolismo de glucosa y la resistencia a la insulina y que en la DMG los niveles de esta hormona se modifican no solo en el embarazo, sino también en el posparto3-8; no obstante, existen resultados inconsistentes y los estudios en

L

24

www.conferenciasindromemetabolico.org

Unidad de Investigación Médica en Enfermedades Endocrinas, Diabetes y Metabolismo, Hospital de Especialidades, CMN siglo XXI, IMSS, CDMX 2 Hospital de Ginecología y Obstetricia número 3 del Centro Médico Nacional la Raza, IMSS, CDMX 3 Unidad de Investigación en Gerontología, UNAM, CDMX 4 Unidad de Medicina Experimental, UNAM, CDMX 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

DMG o TNG en el embarazo y el posparto. No se observa una correlación entre los niveles de ghrelina y la RI; pero, si una asociación inversa de la concentración de ghrelina con el peso y el IMC en las mujeres con DMG.

En el cuadro 2 se muestra que durante el tercer trimestre de embarazo las mujeres con DMG tuvieron mayor peso, IMC, glucosa, triglicéridos e insulina que el grupo control. En el posparto, el peso, el IMC y los triglicéridos disminuyeron, mientras que los niveles de glucosa incrementaron en ambos grupos. El colesterol disminuyó únicamente en el grupo control. En este mismo periodo, la ghrelina incrementó 106% en las mujeres con DMG y 128% en el grupo control. No se encontró diferencia significativa de la RI entre los grupos en embarazo y posparto (Fig. 1). Los niveles de ghrelina no se

asociaron con la RI en el embarazo y posparto de los dos grupos de estudio; sin embargo, se encontró una asociación negativa entre ghrelina e IMC en el grupo de mu-

V. BIBLIOGRAFÍA 1. American Diabetes Association. jeres con TNG y entre ghrelina con Classification and diagnosis of diael peso de las mujeres con DMG en betes. Sec.2. In Standards of Mediel embarazo y con el IMC en el pos- cal Care in Diabetes-2015.Diabetes parto (Fig. 2). Care. 2015; 38(Suppl.1): S8–S16. 2. Aydin S. The Presence of the pep-

IV. CONCLUSIONES Los niveles de ghrelina son menores en el embarazo que en el posparto. No hay una diferencia de esta hormona entre mujeres con

tides apelin, ghrelin and nesfatin-1 in the human breast milk, and the lowering of their levels in patients with gestational diabetes mellitus. Peptides. 2010; 31: 2236-2240. 3. Riedl M, Maier C, Handisurya A, Luger A, Kautzky-Willer A. Insulin Resistence has no impact on ghrelin suppression in pregnancy. J Intern Med. 2007; 262: 458-465. 4. Cetin I, Cardellicchio M. Fisiología del embarazo: interacción materno infantil. Ann Nestlé. 2010; 68: 7-16. 5. Palik E, Baranyi E, Melczer Z, Audikovszky M, Szöcs A, Winkler G, et www.conferenciasindromemetabolico.org

25


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

al. Elevated serum acylated (biologically active) ghrelin and resistin levels associate with pregnancy-induced weight gain and insulin resistance. Diabetes res clin pract. 2007; 76: 351–357. 6. Alvarez M, González LC, Gil M, Fontans S, Romani M, Vigo E, Mallo F. Las hormonas gastrointestinales en el control de la ingesta de alimentos. Endocrinol Nutr. 2009; 56: 317-330. 7. Perez M, Montoya E. Técnicas para el estudio de la resistencia Insulínica. Una valoración crítica. Av Diabetol; 2001: 17:179-186. 8. Kojima M, Kangawa K. Ghrelin: structure and function. Physiol Rev.2005; 85: 495-522.

26

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ESTUDIO DEL ESTADO DE NUTRICIÓN CON ÍNDICE DE MASA CORPORAL Y PORCENTAJE DE GRASA EN ESCOLARES DE 6 A 10 AÑOS. LN Fesan Cruz Ceballos, D en C Joel Cerna Cortés, M en C Alin Jael Palacios Fonseca ABSTRACT Objective: To analyze the nutritional assessment with BMI and Body Fat percentage in children attending an elementary school. Methods: The study was performed in 47 children. Anthropometry was used to make the nutritional assessment, BMI was used as an indicator and Impedance measurement was performed to analyze body composition, Body Fat Percentage (BFP). Results: Obesity was identified in 27.65% and 31.91% in overweight using BMI, while using Bioelectrical impendence 65.95% of the children presented Obesity and 25.53% overweight. It was found a positive weak correlation (r=0.32) between BMI and BFP. Conclusion: Body Fat Percentage is a better and suitable option to use as an indicator of obesity than BMI to determine the nutritional assessment in School children. PALABRAS CLAVES: escolares, estado nutricional, porcentaje de grasa, IMC.

I. INTRODUCCIÓN l estado de nutrición es definido como la disponibilidad y utilización de nutrientes y energía a nivel celular (Pedraza, 2009). La buena nutrición puede cambiar fundamentalmente la vida de los niños, mejorar su desarrollo físico y mental, proteger su salud y sentar las bases de su futura capacidad reproductiva (UNICEF). Así, un estado de nutrición adecuado permite un funcionamiento óptimo de todas las funciones celulares. Cuando el aporte de nutrimentos no es adecuado ya se sea por exceso o deficiencia encontramos desnutrición y obesidad. De acuerdo a Plazas y col. (2015), los escolares tienen un periodo de crecimiento latente porque las tasas de crecimiento somático son muy estables y los cambios corporales se efectúan de una manera gradual entre los 6 y 10 años de edad. La finalidad de este trabajo es, por tanto, analizar el estado de

E

de grasa en kilogramos (MLG). Se utilizó el programa Excel versión 2010 de Microsoft Office para realizar la base de datos y analizar la información mediante estadística descriptiva como promedio y porcentajes para variables cuantitativas. Para la elaboración de gráficos se utilizó el programa estadístico Oringin versión 8.0.

nutrición y la composición corpo- III. RESULTADOS ral en escolares de una primaria. La muestra de 47 niños en edad escolar se compuso del 55.31% de niños (n=26) con edad entre II. METODOLOGÍA La muestra se compuso de un to- 8.7 ± 1.41 años y 44.68% de niñas tal de 47 escolares de entre 6 y (n=21) con edad entre 8.8 ± 1.23 10 años de edad, pertenecientes años. Las características antropoa una primaria en Villa de Álva- métricas de los escolares y la comrez, Colima. Estudio descriptivo posición corporal se muestran en transversal en el que se llevó a la Tabla 1. No se observaron difecabo una valoración del estado de rencias significativas entre niñas y nutrición y su composición cor- niños. poral. Mediante el uso de técnicas La Figura 1 muestra el estado de antropometría se valoraron de nutrición por IMC y BIA. Por las variables peso, talla y, con ello un lado, con IMC el 40.42% de la el índice de masa corporal (IMC); población presento un estado de se efectuaron según edad y sexo nutrición adecuado, mientras que y se tomaron como referencia los el 27.65% presentó obesidad y estándares de la OMS (bajo peso 31.91% sobrepeso. Por otro lado, percentil <10; normal percentil con BIA solo el 8.5% presentó un >10-<85; sobrepeso percentil 85- estado de nutrición adecuado, 94; obeso percentil >95). También mientras que el 65.95% presentó fue valorado la composición cor- obesidad. Los resultados obteporal mediante bioimpedancio- nidos en este estudio permiten metro (BIA) para las mediciones concluir la existencia de obesidad de masa grasa (MG) y masa libre en escolares tanto en niños como Facultad de Medicina, Universidad de Colima

www.conferenciasindromemetabolico.org

27


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

en niñas. En el caso del porcentaje de grasa como indicador de obesidad fue el doble que el encontrado por IMC. En este estudio, se encontró una débil correlación positiva (r=0.32) entre IMC y porcentaje de grasa (Figura 2). Otros estudios, como el desarrollado por Orta y col. (2014), demostraron una correlación positiva (r=0.8) entre IMC y BIA en escolares. Sin embargo, en este estudio no se encontró una fuerte correlación en estas variables.

IV. CONCLUSIONES El uso de porcentaje grasa como indicador de obesidad debe ser una rutina habitual en el quehacer diario del personal de la salud como indicador del estado de nutrición y no solo el IMC.

V. BIBLIOGRAFÍA Pedraza, D. F. (2009). Obesity and poverty: conceptual references for its analysis in Latin America. Saúde e Sociedade, 18(1), 103-117. Duarte, M. O., Ruelas, Y. F., López-Alcaraz, F., del Toro-Equihua, M., & Sánchez-Ramírez, C. A. (2014). Correlation between percentage of body fat measured by the Slaughter equation and bio impedance analysis technique in Mexican schoolchildren. Nutr Hosp, 29(1), 88-93.

28

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DEL CONSUMO DE ALIMENTOS Y BEBIDAS ADICIONADOS CON JARABE DE MAÍZ DE ALTA FRUCTOSA EN LOS NIVELES PLASMÁTICOS DE ÁCIDO ÚRICO, COLESTEROL Y TRIGLICÉRIDOS M.A. Pilar del Carmen Hernández-Rodríguez, M.C. Ana Bertha Torres-Reyes,Mayra Alejandra Lechuga-Portillo, Ricardo Orlando Jurado-Beltrán, M.A. Narciso Torres-Flores, D.C. Rubén Marquez-Meléndez, D.C. Blanca Estela Sánchez-Ramírez, M.C. Samuel Parra-Ruíz ABSTRACT Introduction: Recent investigations relate consumption of high fructose corn syrup (HFCS) with the incidence of different pathologies like obesity, dyslipidemia, hyperuricemia and metabolic syndrome1 Objective: To evaluate the effect of consumption of food sweetened with HFCS in plasma levels of uric acid, triglycerides and cholesterol in a population sample in Chihuahua, Chihuahua. Method: Prospective and longitudinal study, using the reference change value formula (RCV) to demonstrate the significance of the results. Results: Sample formed by 29 participants with ages between 18 and 30 years. 58.62% of them presented clinically significant changes in chemical evaluated parameters. Conclusion: Consumption of food with high fructose corn syrup can promote development of metabolic chronic disorders. KEYWORDS: Hyperuricemia, High Fructose Corn Syrup (HFCS), uric acid, cholesterol, triglycerides.

I. INTRODUCCIÓN n los últimos años, el uso de fructosa en los alimentos, ha tomado un auge importante, debido a sus propiedades organolépticas y funcionales. Ésta se agrega en muchos tipos de alimentos procesados, incluyendo los recomendados como nutritivos. La forma más empleada de este componente es como jarabe de maíz de alta fructosa (JMAF), que en comparación con la sacarosa, tiene más bajo costo de producción y la ventaja de no tener un efecto significativo en las concentraciones de glucosa en sangre, debido a que utiliza diferentes mecanismos de transporte a nivel celular. Recientes investigaciones relacionan el consumo excesivo del JMAF con la incidencia y prevalencia de enfermedades crónicas

E

como obesidad, diabetes, dislípidemias, hiperuricemias, síndrome metabólico y enfermedades cardiovasculares convirtiéndose en un problema de salud pública mundial 2,3. Fisiológicamente, la fosforilación no regulada de la fructosa hasta acetil CoA incrementa significativamente la lipogénesis de novo y síntesis de triglicéridos, causando a su vez un aumento de ácido úrico a través de la vía de degradación de purinas por la conversión de ATP en AMP y un agotamiento de fosfato inorgánico, dando como consecuencia una elevación en los valores de este parámetro, pudiendo desencadenar diferentes patologías como la gota úrica o artritis gotosa que afecta en un 90% a los

varones.4

II. METODOLOGÍA Tipo de estudio: Estudio prospectivo y longitudinal.

Muestras biológicas: Sangre venosa obtenida en tubo al vacío sin anticoagulante (7.0mL). Las muestras sanguíneas fueron obtenidas en 3 diferentes tiempos del estudio, para determinar niveles séricos de colesterol total, triglicéridos y ácido úrico, mediante procedimientos colorimétricos de punto final. Para reducir las variaciones preanalíticas, se solicitó a cada participante contar con el mismo tiempo de ayuno en cada muestreo, se empleó el mismo lote de tubos y optimizó el tiempo de aplicación del torniquete. Las muestras se procesaron utilizando el mismo lote de reactivo para cada determinación. Equipo: Analizador bioquímico automatizado Prestige 24i, marca Tokio Boeki.

Criterios de inclusión: Población abierta, de ambos sexos, entre 1830 años de edad, sin diagnóstico de

Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, México

www.conferenciasindromemetabolico.org

29


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

patologías metabólicas y dieran su autorización por escrito para participar en el proyecto, cumpliendo con los requisitos y condiciones estipuladas. Criterios de exclusión: Personas que no cumplieran con los criterios especificados para la realización de la investigación.

Método de trabajo: Muestreo por convocatoria abierta. La estimación del tamaño de muestra se calculó empleando como base el intervalo de confianza, margen de error y varianza del estudio de Stanhope y colaboradores5. Se informó a los participantes la finalidad del estudio, obteniendo su consentimiento por escrito, manejando la protección de datos personales de acuerdo a la nota de confidencialidad del Instituto Federal de Acceso a la Información y Protección de Datos (IFAI). Protocolo de muestreo: Se obtuvo una muestra sanguínea al inicio del estudio para determinar concentraciones séricas de los parámetros bioquímicos. A cada participante le fue entregada una ración para ingesta diaria, durante 12 días, de alimentos comerciales de consumo cotidiano que incluyen en su formulación jarabe de maíz de alta fructuosa: 80 gr de cereal (desayuno), 2 barras nutritivas de 24 gr. (colación matutina y vespertina) y 1 refresco de 355 mL. Se les solicitó no consumir durante ese tiempo otros alimentos endulzados con JMAF o relacionados con producción o elevación de áci30

www.conferenciasindromemetabolico.org

do úrico y lípidos como cerveza, mariscos, embutidos; se obtuvo la segunda muestra sanguínea al concluir el tiempo de consumo y la tercera muestra 7 días después.

Análisis de resultados: Se utilizaron los programas estadísticos Minitab 16.0 y Microsoft Excel 2013, empleando la prueba T de Student para identificar diferencia estadistica (p<0.05) entre los 3 muestreos. La fórmula de Harris y Fraser permitió evaluar el cambio de valores de referencia (RCV) de las determinaciones para cada participante, evidenciándose por un valor de z ≥1.656. Se consideraron los coeficientes de variación analítica y de variación intraindividual de las tablas de requisitos de calidad y de datos de especificaciones biológicas deseables de Westgard7. Los valores de referencia empleados fueron: colesterol total menor de 200 mg/dL, triglicéridos menor de 150 mg/dL y ácido úrico de 2 a 6.8 mg/dL. 8,9.

III. RESULTADOS Muestra conformada por 29 participantes, 19 mujeres (65.51%) y 10 hombres (34.48%). Se cuantificaron niveles séricos de los parámetros bioquímicos en cada muestreo (Tabla 1), sin obtener una diferencia significativa (Tabla 2). Al aplicar la fórmula para RCV, no se identificaron cambios significativos en ninguna de las comparaciones para ácido úrico, sin embargo, se observa un incremento en la concentración del mismo en 20.68% de los participantes (Tabla

V3-N1 - 2016

3). La fórmula de Harris demostró una variación significativa a la alta en colesterol total en 9 (31%) de los participantes (Tabla 4). En la comparación de los resultados de triglicéridos en sangre al inicio y al término de la ingesta de productos, se encontró que 1 persona tuvo un aumento relativo (z= 1.02) y 4 personas (14%) un incremento significativo (z ≥1.65), condición que se mantuvo en 3 de ellas hasta la semana posterior al término de la ingesta de los alimentos proporcionados. (Tabla 5). El análisis conjunto de todas las determinaciones, mostró un incremento en 17 (58.62%) de los participantes, 14 de ellos (48.27%) con aumento en 1 parámetro y 3 (10.34%) con elevación en dos de ellos; en hombres se presentó primordialmente elevación de ácido úrico, en tanto que las mujeres evidenciaron incremento en los lípidos sanguíneos. IV. CONCLUSIÓN El bajo costo de producción y las propiedades físicas, químicas y microbiales que el jarabe de maíz de alta fructuosa proporciona, lo ha ubicado como un aditivo alimentario de uso común, sin que de manera específica esté regulada la cantidad permitida, encontrándose además en una gran variedad de productos. La ingesta habitual de alimentos adicionados con este endulzante puede estar relacionado con el desarrollo de distintas enfermedades crónicas y desórdenes metabólicos.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V. BIBLIOGRAFÍA 1. Esquivel V, Gómez G. Implicaciones metabólicas del consumo excesivo de fructosa. Acta Médica Costarricense 2007;49:198-202. 2. Pérez, C.E.; Serralde, Z. E.; Meléndez, M.G. (2007). Efectos benéficos y deletéreos del consumo de fructosa. Revista de Endocrinología y Nutrición, 15:67-74. 3. Licata, M. (2013). El ácido úrico y su relación con la dieta. Recuperado el 26 de marzo de 2016, de Zona Diet. Sitio web: http:// www.zonadiet.com/salud/acidourico.htm 4. Gómez, E. E. (2009). Hiperuricemia y gota. Revista Terapéutica del Sistema Nacional de Salud. 33:110-115. 5. Stanhope, K.L., Medici, V., Bremer, A. A., Lee, V., Lam, H. D., Nunez, M. V., Havel, P. J. (2015). A dose-response study of consuming high-fructose corn syrup-sweetened beverages on lipid/lipoprotein risk factors for cardiovascular disease in young adults. The American Journal of Clinical Nutrition, Vol. 101, pp 1144-1154. 6. Guzmán D. (2010). ¿Cuándo dos exámenes seriados de laboratorio representan un cambio en el estado de salud de un paciente? Revista de Medicina de Chile 7. James Westgard (2009). CLIA Requirements Analytical Quality. Recuperado el 24 de Junio de 2016, de Westgard QC Sitio web: http://westgard.com/clia. htm 8. National Cholesterol Education Program (NCEP) Detección, evaluación, y tratamiento del colesterol sanguíneo elevado en

V3-N1 - 2016

adultos (ATP III – Adult Treatment Panel III). Actualización año 2004. 9. CENETEC. Prevención, diagnóstico, tratamiento y referencia oportuna de hiperuricemia y gota. Guía de referencia rápida. SSA216-09.

www.conferenciasindromemetabolico.org

31


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

32

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ÍNDICES ANTROPOMÉTRICOS E HIPERTENSIÓN ARTERIAL EN PACIENTES CON ARTRITIS REUMATOIDE DEL ESTADO DE GUERRERO, MÉXICO. QBP. Oscar Zaragoza-García1, Dr. José Eduardo Navarro-Zarza2, Q.B.P. Julio César Muñiz-Salgado1, QBP. Nereida Torres-Solano1, Dra. Isela Parra-Rojas1, Dra. Iris Paola Guzmán-Guzmán1 ABSTRACT. The aim of this study was to determine the prevalence of anthropometric indices of cardiovascular risk in patients with rheumatoid arthritis (RA) and its relationship with the presence of hypertension (HTA). Methodology. This study was carried out in 255 patients in the General Hospital of Chilpancingo, Guerrero, Mexico, diagnosed with RA using the ACR/EULAR 2010 criteria. All underwent anthropometric assessment to define anthropometric risk indices (WHO criteria) and pre and hypertension (JNC8 criteria). Statistical analysis was performed using the STATA v.11.0 software. Results. The prevalence of abdominal obesity was 43.8%, overweight 36.1% and obesity of 28.1%. The indices waist hip ratio (WHR) and waist height ratio (W/Ht) considered at high cardiovascular risk were showed in 53.72% and 89.2%, respectively. The 71.3% showed a high percentage of body fat (%BF, ≥35%) and 70.7% increased visceral fat (≥7%). Prehypertension and hypertension was presented in the 32.1% and 28.9% of patients. In a model adjusted for age and gender, abdominal obesity was associated with the presence of hypertension grade II (OR=3.01, p=0.05). Obesity, %BF and W/Ht were associated with the presence of prehypertension (OR=1.85, p=0.006; OR=2.57, p=0.032; OR=5.0, p=0.04, respectively). Conclusion. Anthropometric indices are associated with the presence of prehypertension and hypertension in RA patients of Guerrero State, increasing the risk to cardiovascular disease. KEYWORDS. Rheumatoid arthritis, anthropometric indices, blood pressure.

I. INTRODUCCIÓN a presencia de comorbilidades asociadas a enfermedad cardiovascular en pacientes con artritis reumatoide es elevada. El proceso inflamatorio articular, la discapacidad funcional, tratamientos farmacológicos, entre otros, favorecen cambios clínico-antropométricos relacionados con riesgo cardiovascular. El objetivo de este estudio fue determinar la prevalencia de índices antropométricos de riesgo cardiovascular en pacientes con artritis reumatoide (AR) y su relación con la presencia de hipertensión arterial.

L

II. METODOLOGÍA Se realizó un estudio transversal analítico en 255 pacientes del Hospital General de Chilpancingo, Guerrero, México, diagnosticados con AR bajo los criterios ACR/EULAR 2010 (Aletaha et al., 2010). A todos se les determinaron características antropométricas por el método de bioimpedancia eléctrica y medición de circunferencias corporales, así como valores de tensión arterial, características clínicas y de tratamiento de la enfermedad. Los índices antropo-

métricos de obesidad, ICC e ICT, fueron categorizados de acuerdo a los criterios establecidos por la OMS (Organización Mundial de la Salud), Barquera et al., 2003 y Torresani et al., 2014, respectivamente. La alteración de la tensión arterial se estableció de acuerdo a los criterios del JNC8 (Comité Nacional para la Prevención, detección, Evaluación y Tratamiento de la Hipertensión Arterial). El análisis estadístico se realizó utilizando el software STATA v.11.0. Las pruebas estadísticas utilizadas fueron descriptivas y modelos de regresión multivariado. Valores de p<0.05 fueron considerados estadísticamente significativos.

III. RESULTADOS En la población de estudio se observó un promedio de edad de 46 años, en su mayoría pacientes femeninos, con un promedio de 9.1 años de evolución de la enfermedad, con un índice de capacidad funcional HAQ-DI de incapacidad ligera (0.49±0.55) y un DAS-28 representativo de actividad moderada de la enfermedad (3.86±1.63). El 72.93% de la población refirió estar bajo tratamiento con drogas

Laboratorio de Investigación en Obesidad y Diabetes de la Unidad Académica de Ciencias Químico Biológicas. Universidad Autónoma de Guerrero. 2 Departamento de Medicina Interna del Hospital General de Chilpancingo, Guerrero, México. 1

www.conferenciasindromemetabolico.org

33


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

modificadoras de la enfermedad. En este estudio la prevalencia de obesidad abdominal fue de 43.8%, de sobrepeso y obesidad del 36.1 y 28.1%, respectivamente. Stavropoulos-Kalinoglou et al., 2011 ha señalado recientemente el uso de un Índice de Masa Corporal (IMC) <23 kg/m2 para definir normopeso y de ≥ de 28 kg/m2 para obesidad en el paciente con AR, al respecto, consideramos calcular la prevalencia obesidad que fue del 40.3%, lo que representa 10% más en comparación a la establecida por criterios OMS. En comparación con lo reportado por Ramírez-Villafaña et al., (2013), la población del presente estudio presenta mayor prevalencia de sobrepeso y obesidad, por lo que las comorbilidades asociadas a la obesidad en el paciente con AR representan un mayor riesgo a la salud en la población Guerrerense. En México, la Encuesta Nacional de Salud y Nutrición (ENSANUT) 2012 y la Encuesta de Salud y Nutrición por Entidad Federativa (ENSANUTEF) 2013 en el Estado de Guerrero, reportaron prevalencias de sobrepeso y obesidad en población adulta mayores a las encontradas en la población con AR (Gutiérrez et al., 2012; Gutiérrez et al., 2013), sin embargo considerando el criterio de %GC, la prevalencia de obesidad en los pacientes con AR es similar a la reportada en la población general y refleja que a pesar de que existe una pérdida de masa corporal, prevalece la adiposidad corporal. Con respecto a los índices ICC e ICT se observó que los pacientes 34

www.conferenciasindromemetabolico.org

presentan índices de alto riesgo, valores similares para el ICC fueron reportados por Ramírez-Villafaña et al., (2013), sin embargo en el presente estudio el ICT mostró una mayor asociación como predictor de presencia de HTA grado II. Además de que se ha descrito, la adiposidad corporal y visceral al inicio y durante el curso de la enfermedad se asocian con un peor pronóstico de la enfermedad y mayor número de comorbilidades (Ajeganova et al., 2013). La prehipertensión e hipertensión arterial se manifestó en el 32.1% y 28.9% lo cual representa una prevalencia del doble a la reportada por la ENSANUT para la entidad federativa Guerrero (Gutiérrez et al., 2012; 2013). De manera similar Guzmán-Guzmán et al., (2013) en una población adulta clínicamente sana reportaron que la prevalencia de prehipertensión y de hipertensión arterial, se asocian con la edad, género y grasa corporal. Bartels et al., (2014) reportaron una prevalencia similar de hipertensión arterial en pacientes con AR en un modelo COX ajustado, denotando la importancia del diagnóstico temprano de esta alteración clínica y su atención en los pacientes con AR. En un modelo ajustado por edad y género, la obesidad abdominal se asoció con la presencia de HTA grado II (OR=3.01, p=0.05). La obesidad, el %GC y el ICT se asociaron con la presencia de prehipertensión (OR=1.85, p=0.006; OR=2.57, p=0.032; OR=5.0, p=0.04, respectivamente). Morovic et al., (2013) reportaron una prevalencia mayor

V3-N1 - 2016

de hipertensión arterial en una población con osteoartritis y AR (73.3% vs 59.5%, respectivamente), encontrando que la edad y el IMC se asocian con la hipertensión arterial en su grupo de estudio, sin embargo en este estudio se determinó que la adiposidad general se asocia a prehipertensión y la obesidad central determinada por el perímetro de cintura a hipertensión grado II en el paciente con AR.

IV. CONCLUSIONES Los pacientes con AR del estado de Guerrero presentan índices de composición corporal asociados con la presencia de pre e hipertensión arterial en pacientes con AR, incrementando el riesgo para enfermedad cardiovascular.

V. BIBLIOGRAFÍA Ajeganova S., Andersson M. L., Hafstrom I., BARFOT STUDY GROUP. 2013. Association of obesity with worse disease severity in rheumatoid arthritis as well as with comorbidities: A long-term follow up from disease onset. Arthritis Care and Research, 65 (1); 78-87. Aletaha, D., Neogi, T., Silman, A. J., Funovits, J., Felson, D. T., Bingham, C. O., et al., 2010. Rheumatoid arthritis classification criteria: an American College of Rheumatology/European League Against Rheumatism collaborative initiative. Arthritis Rheum, 62, 2569-81. Barquera F. S., Barquera S., González-Villalpando C., Lonngi G., Rivera-Dommarco J., Velásquez C. 2003. Obesidad en el adulto. Práctica Médica Efectiva. Volumen 5


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

(2). ISSN: 1665-0506. Bartels, C. M., Johnson, H., Voelker, K., Thorpe, C., Mcbride, P., Jacobs, E. A., et al., 2014. Impact of rheumatoid arthritis on receiving a diagnosis of hypertension among patients with regular primary care. Arthritis Care Res, 66, 1281-8. Bell K., Twiggs J. and Olin B. 2015. Hypertension: The silent killer: Updated JNC-8 Guideline Recommendations. Alabama Pharmacy Association. 2015. P.4. Gutiérrez JP., Rivera-Dommarco J., Shamah-Levy T., Villalpando-Hernández S., Franco A., Cuevas Nasu L., et al., 2012. Encuesta Nacional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México: Instituto Nacional de Salud. Pública (MX), 2012. P113. Gutiérrez JP., Rivera-Dommarco J., Shamah-Levy T., Oropeza-Abúndez C., Hernández-Ávila M. 2013. Instituto Nacional de Salud Pública. Encuesta Nacional de Salud y Nutrición 2012. Resultados por entidad federativa, Guerrero. Cuernavaca, México: Instituto Nacional de Salud. Pública, 2013. P.84. Guzmán-Guzmán, I. P., Salgado-Goytia, L., Muñoz-Valle, J. F., Salgado-Bernabé, A. B., Quiroz-Vargas, I. & Parra-Rojas, I. 2013. Prehypertension in a Mexican population: influence of age, gender, and body fat. Clin Exp Hypertens, 35, 67-73. Morovic-Vergles, J., Salamon, L., Marasovic-Krstulovic, D., Kehler, T., Sakic, D., Badovinac, O., Vlak, T., Novak, S., et al. 2013. Is the prevalence of arterial hypertension in rheumatoid arthritis and osteoarthritis associated with disease?.

V3-N1 - 2016

Rheumatol Int, 33, 1185-92. Panoulas, V. F., Douglas, K. M., Milionis, H. J., Stavropoulos-Kalinglou, A., Nightingale, P., Kita, M. D., et al., 2007. Prevalence and associations of hypertension and its control in patients with rheumatoid arthritis. Rheumatology (Oxford), 46, 1477-82. Ramírez-Villafaña M., Muñoz-Rocha A. D., Torres-Zaragoza Y., Mendoza-Vázquez G., Díaz-Rizo V., Hernández-Cuervo P., et al., 2013. Asociación entre la dosis acumulada de corticosteroides y el porcentaje de masa y grasa corporal en los pacientes con artritis reumatoide. El Residente, 8 (2); 63-69. Stavropoulos-Kalinoglou, A., Metsios, G. S., Koutedakis, Y. & Kitas, G. D. 2011. Obesity in rheumatoid arthritis. Rheumatology (Oxford), 50, 450-62. Torresani M.E., Oliva M. L., Rossi M. L., Echeverría C., Maffei L. 2014. Cardiovascular risk by waistheight ratio in adult women. Actualización en Nutrición, 15 (3-9); 1-9.

www.conferenciasindromemetabolico.org

35


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA DE SÍNDROME METABÓLICO EN UNIDADES ACADÉMICAS DE LA UNIVERSIDAD AUTÓNOMA DE GUERRERO Dr. Barlandas Rendón Nicolás Rogelio Eric; Dr. Campos Hernández Eleuterio; M en C. Reyes Ríos Roxana; Dra. Hernández Nava Rocío; M. en C. Jorge Corona Luciano; M. en C. Quintana Ponce Sandra ABSTRACT Objective: To estimate the prevalence of SxM among UAGro university personnel from the City and Port of Acapulco using the criteria proposed by NCEP ATP-III. Method: A descriptive, cross-sectional study with a total of 205 individuals both men and women; socio-economic data were collected, clinical background, lifestyle, as well as if they were in drug treatment and the collection of measurements necessary to identify the SxM. Results: Was obtained a general prevalence of 26.8%, protruding the administrative staff with a 29.5% followed by the academic with 26.4% and finally the employees of Intendance with 21.1%. The SxM was expressed mostly at the age group of 50 to 59 years and also in the female sex. All patients with SxM have pre-obesity or some type of obesity and the biggest proportion of the university population presented overweight, with a 45.8%.

I. INTRODUCCIÓN l síndrome metabólico (SxM) está caracterizado por la presencia de una combinación de factores de riesgo como son: dislipidemia, hipertensión, resistencia a la insulina y obesidad central.1, 2 Los individuos con SxM tienen un riesgo elevado de desarrollar diabetes mellitus tipo 23 y enfermedades cardiovasculares (ECV). En la práctica clínica el SxM es diagnosticado por la combinación de tres o más de los siguientes factores de riesgo: obesidad central, presión sanguínea elevada, intolerancia a la glucosa, hipertrigliceridemia y bajo colesterol unido a lipoproteinas de alta densidad (cHDL).4,5, 6, 7 La prevalencia de SxM en el mundo se esta incrementando y ha sido atribuido principalmente al sedentarismo, estilo de vida y a la obesidad.8 Y se le ha relacionado estrechamente

E

36

www.conferenciasindromemetabolico.org

con el perímetro abdominal.9 Hay varias definiciones para el diagnóstico de SxM, uno propuesto por la Organización Mundial de la Salud (OMS), el tercer panel estadounidense para el Tratamiento de Adultos del Programa Nacional de Educación sobre el Colesterol (NCEP ATP-III), Grupo Europeo para el Estudio de la Resistencia a la Insulina (EGIR) y el de la federación internacional de diabetes (IDF).6,10 Sin embargo la descripción del SxM bajo los criterios de NCEP ATP-III esta considerada por ser una de las herramientas más aplicadas en la práctica clínica y epidemiológica.1, 11 Se han observado diferentes prevalencias del SxM en diferentes poblaciones de estudio que van desde 3.5% (estudiantes universitarios) hasta 58.3% (personas adultas con un promedio de 54.37 ± 7.5 años)11,12,13 La edad tam-

bién es un factor que predispone al SxM ya que el grupo de mayor edad (> 50 años) mostro las más alta prevalencia con un 46.9%.11

II. METODOLOGÍA Este estudio fue realizado en la Universidad Autónoma de Guerrero (UAGro) durante los meses de Enero 2016 a Mayo de 2016, realizándose una historia clínica y determinaciones bioquímicas de laboratorio, los cuales se realizaron en alianza estratégica con el laboratorio BIOCLIN S.A. de C.V. de la ciudad de Chilpancingo, Guerrero, México. La muestra estuvo compuesta de personal académico, administrativo y de intendencia de la UAGro de diferentes unidades académicas, se incluyó a ambos sexos quienes para participar firmaron un consentimiento informado por escrito, así como el llenado de una encuesta. Para la colección de datos se realizó la medición del peso corporal y la estatura y con ello obtener el índice de masa corporal (IMC). Se midió el perímetro de la cintura (PC) entre la cresta ilíaca anterosuperior y el reborde costal. La presión arterial fue obtenida usando un esfingomanómetro marca OMRON modelo HER-7320, después de que los participantes habían permanecido en reposo

Universidad Autónoma de Guerrero; Unidad Académica de Ciencias Naturales


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

por lo menos 5 minutos. Para las determinaciones bioquímicas se obtuvo una muestra sangre después de 12 horas de ayuno para la glucosa se colectó en un tubo gris con fluoruro de sodio para inhibir la glucólisis; y para el resto se colectó en un tubo rojo sin ningún aditivo. El estudio propuesto fue revisado y aprobado por la Dirección General de Investigación Científica de la UAGro. Los datos de los participantes fueron resguardados con forme a la Ley federal de protección de datos personales en posesión de los particulares. La definición del SxM fue de acuerdo al NCEP ATP-III, una persona es considerada con SxM si cumple tres o más criterios. Para analizar los datos todas las encuestas fueron codificadas y capturas en una hoja de cálculo de Microsoft Excel y posteriormente los datos exportados al paquete estadístico STATA versión 14. III. RESULTADOS El grupo de estudio lo constituyeron 205 empleados (57.6% femenino y el 42.4% masculino) de las diferentes unidades académicas, de los cuales el 26.8% presentó SxM. La relación observada entre el tipo de empleado y el SxM fue la siguiente: los administrativos fueron los que presentaron el mayor porcentaje con un 29.5%, los académicos con un 26.4% e intendentes con un 21.1% (Tabla 1). El grupo etario más afectado con SxM fue el de 50 a 59 años con un 46.0%, mientras que aquellos por debajo de 30 años solo representaron el 3.8% (Tabla 2). Con

V3-N1 - 2016

mujeres y finalmente la alteración en glucosa fue de manera equitativa en hombres como en mujeres. (gráfica 1). Los participantes fueron clasificados de acuerdo a su índice de masa corporal (IMC), no se encontraron individuos con un IMC <18.5, solo 21.5% normales y el resto está en grupo de sobrepeso u obesidad como se muestra en la tabla 3.

respecto al número de pacientes con SxM el 41.8% corresponde a hombres y el 58.2% a mujeres; se observó un nivel de cHDL menor al criterio del NECP ATP-III en el 34.8% en hombres y 65.2% en mujeres, triglicéridos ≥150 mg/ dL se encontraron en el 43.5% en hombres y en el 56.5% en mujeres, con respeto al PC la mayor alteración se presentó en las mujeres (68.9%) en contraste con los hombres (31.1%), con relación a los individuos con SxM que presentaron hipertensión arterial el 53.6% fueron hombres y el 46.4%

En la gráfica 2 se observa que los pacientes con SxM se encuentran ubicados preferentemente en el grupo preobesos o con algún tipo de obesidad, pero ninguno de ellos con peso normal. www.conferenciasindromemetabolico.org

37


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Respecto a los parámetros bioquímicos, se muestran los valores promedio en la tabla 4 y se puede observar una diferencia importante en glucosa, ácido úrico, triglicéridos y cHDL entre las poblaciones normal y con SxM.

IV. CONCLUSIÓN La prevalencia general obtenida entre los empleados de la UAGro fue de 26.8%, sobresaliendo el personal administrativo con un 29.5%. El SxM estuvo mayormente expresado en el sexo femenino con un 58.2%. El criterio más frecuentemente alterado fue el cHDL y los triglicéridos con un 86.3% en los empleados universitarios con SxM. En términos generales se puede afirmar que existe una alteración directamente proporcional entre el incremento de la edad y la presencia de SxM, siendo el grupo más afectado el de 50 a 59 años de edad. En este estudio todo los pacientes con SxM son preobesos o tienen algún tipo de obesidad. Cabe recalcar que la mayoría de los empleados de acuerdo a su IMC presenta sobrepeso.

38

www.conferenciasindromemetabolico.org

V3-N1 - 2016

V. BIBLIOGRAFÍA 1. Isomaa B: A major health hazards: the metabolic syndrome. Life Sciences 73:2395-411, 2003. 2. Scott CL: Diagnosis, prevention and intervention for the

P, Shaw j. Metabolic syndrome: a new world-wide definition. A consensus Statement from the International Diabetes Federation. Diabet Med 2006; 23: 469-480. 7. Eckel RH, Grundy SM, Zimmet PZ. The Metabolic Syndrome.

metabolic syndrome. American Journal of Cardiology 92 (Suppl.) 35i-42i, 2003. 3. Ford ES. Risks for all-cause mortality, cardiovascular, and diabetes associated with the metabolic syndrome: a summary of the evidence. Diabetes Care 2005; 28(7): 1769-1778. 4. Alberti KG MM, Zimmet PZ. Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 1998; 15(7): 539-553. 5. Expert panel on detection, evaluation, and treatment of high blood colesterol in adults. Executive summary of the third report of the National Cholesterol Educational Program (NCEP) expert panel on detection, evaluation, and treatment of high blood colesterol in adults (Adult Treatment Panel III). J Am Med Assoc 2001: 285(19): 2486-2497. 6. Alberti KGMM, Zimmet

Lancet 2005; 365 (9468): 14151428. 8. Campos-Mondragón MG. Obesidad y riesgo de síndrome metabólico en estudiantes de posgrado de Veracruz, México. Rev Esp Nutr Hum Diet. 2015; 19(4): 197- 203. 9. Morales Cedeño R, Castellanos González M, Benet Rodríguez M, Mass Sosa L, Mora Hernández C y Parada Arias JC. Indicadores antropométrico para determinar la obesidad, y sus relaciones con el riesgo cardiometabólico. Rev Finlay. 2015; 5(1): 12-23. 10. Zimmet P, George K, Alberti KGMM, Serrano Ríos M. Una nueva definición mundial del síndrome metabólico propuesta por la Federación Internacional de Diabetes: fundamento y resultados. Rev Esp Cardiol. 2005; 58(12): 1371-6. 11. Magalhães P, Capingana DP, Mill JG. Prevalence of the metabolic syndrome and determination of optimal cut-off values of waist circumference in university employees from Angola. Cardiovascu-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

lar Journal of Africa. 2014; 25(1): 27-33. 12. Molina GG, Ibarra Pezo J, Mosso Corral C, Muñoz Reyes S, Saéz Carrillo K, Zapata Fuentes Damaris. Capacidad predictiva de los índices antropométricos en la detección de Síndrome Metabólico en adultos chilenos. Archivos Latinoamericanos de Nutrición. 2015; 65(3): 152-157. 13. Barrimah IE, Rahman Mohaimeed A, Midhat F, Al-Shobili HA. Prevalence of Metabolic Syndrome in Qassim University. International Journal of Health Sciences, Qassim University. 2009; 3(2): 132-142. OBSERVACIONES METODO Y EQUIPO PARA LAS DETERMINACIONES BIOQUIMICAS, SE PUEDE RESALTAR QUE SE UTILIZO UN EQUIPO EVALUADO Y ACREDITADO POR LA ENTIDAD MEXICANA DE ACREDITACION

www.conferenciasindromemetabolico.org

39


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FORMACION MÉDICA A TRAVES DE LA INVESTIGACIÓN Dra. Martínez-Hernández María Guadalupe1,2, Mtra. Montes Moreno Martha2, M. C. Sánchez Rivera Graciela2, Dr. Baiza Gutman Luis Arturo1

E

n las Facultades de Medicina, la integración de la investigación científica permite que los estudiantes adquieran habilidades básicas que el alumno debe lograr durante su formación médica, siendo esencial el desarrollo de una conducta de investigación complementándose con la vivencia de investigación científica a través de su participación en proyectos de investigación. Una de las formas para desarrollar un mejor sistema de salud consiste en promover el trabajo de investigación sobre problemas relevantes. La prevalencia de la obesidad en niños se ha incrementado en nuestro país a niveles epidémicos, iniciándose en etapas tempranas, por lo que la investigación en problemas de salud, es fundamental para los estudiantes del área médica ya que ellos son uno de los principales promotores de la salud. A través de esta investigación de tipo epidemiológica - básica donde se determina la prevalencia de obesidad en escolares de primaria y la presencia de enzimas proteolíticas se pretende que los estudiantes fortalezcan y complementen su formación médica. Tomando como referencia que la alimentación y la nutrición son importantes elementos que determinan la salud y la enfermedad, el conocer cuál es el estado de nutrición de una población escolar nos 40

www.conferenciasindromemetabolico.org

permitirá tomar las medidas necesarias para promover la salud, prevenir enfermedades e incluso tratarlas evitando de ésta manera las complicaciones a las que se asocian. Por lo que establecimos incorporar a nuestros estudiantes de la carrera de Médico Cirujano a un problema de salud como es la obesidad presente en nuestro país a través de investigación epidemiológica - básica de esta pandemia, determinando así los siguientes objetivos.

I. OBJETIVO GENERAL Establecer estrategias de aprendizaje a través de la investigación de problemas de salud pública como es la obesidad, que permitan a nuestros estudiantes mejorar su formación para ser mejores promotores de la salud Objetivos particulares: Determinar la prevalencia de sobrepeso y obesidad en niños preescolares Establecer la relación entre la obesidad, sexo y edad de los preescolares. Determinaran la presencia de enzimas proteolíticas en niños previamente diagnosticados con obesidad. A través de esta investigación establecer estrategias de aprendiza1 2

je y lograr: • Fortalecer la capacidad investigativa de los estudiantes • Fomentar programas que mejoren la salud de nuestra población a través de estilos de vida saludable.

II. METODOLOGÍA Para lo cual nuestros estudiantes de Medicina de cuarto semestre de la Carrera de Médico Cirujano de la FESI, bajo nuestro asesoramiento evaluaron el índice de masa corporal (IMC) de 397 niños de la escuela primaria Jesús Reyes Heroles ubicada en el Municipio de Cuautitlán, Estado de México. EL sobrepeso y obesidad, se determinó por su índice de masa corporal (IMC) utilizando Tablas de percentiles del IMC del CDC-2000 para niños y niñas propuestas por el Hospital Infantil de México. Para la determinación del peso se utilizó una báscula, valorándose al paciente con ropa interior normal y sin zapatos. La talla o estatura se registró con los brazos extendidos rígidos, en una escala vertical, de pie y en una superficie plana, para que los talones, cadera, hombros y occipucio estén alineados en un plano vertical. Se determinó su IMC, se analizaron los datos de obesidad y sobrepeso en relación

Laboratorio de Biología del Desarrollo, Unidad de Morfofisiología, FES-IztacalaUNAM Carrera de Médico Cirujano de la FES-IztacalaUNAM


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

a la edad, sobrepeso, obesidad y sexo, mediante el análisis estadístico de ANOVA a través de la comparación de dos variables. A partir de esta población de estudio, tanto niños como niñas, sin obesidad como grupo control y con obesidad grupo problema fueron seleccionados, entre edades de 7 a 9 años, se obtuvieron muestra de plasma, se determinó la concentración de proteínas por el método de Bradford y se procedió a realizar zimografía en geles de poliacrilamida copolimerizados con gelatina para determinar la presencia de enzimas con actividad gelatinolítica, evaluándolas posteriormente por análisis densitométrico.

sobrepeso, siendo mayor el número de niñas con obesidad con relación a los niños, presentandose diferencias significativas, datos mostrados en las gráficas. Se de-

III. RESULTADOS A partir de los 371 niños correspondientes al 100%, el 70.41 presentaron obesidad, 4.81 sobrepeso, 2.1 peso bajo y 22.58 fueron normales, como se muestra en la gráfica. Analizando estos resultados y relacionandolos con la edad y el sexo de ellos se observa que su prevalencia es en edades de 7 a 9 para la obesidad y de 7 a 10 para tecto la presencia de enzimas con actividad gelatinolítica correspondientes a las metaloproteinasas MMP-9 y MMP-2. La concentración de MMP-9 se incremento significativamente con la obesidad en los niños y la concentración de la MMP-2 se ve ligeramente disminuida sin diferencias significativa, presentándose el mismo comportamiento para las niñas como se muestra en las siguientes gráficas: Al comparar la expresión de

V3-N1 - 2016

MMP-9 por sexo observamos que la concentración de esta enzima aumenta significativamente en niños, la MMP-2 también se ve incrementada. Y el aumento de la MMP-9 con respecto a la MMP-2 es significativamente mayor.

IV. CONCLUSIÓN La obesidad favorece la presencia de un estado pro-inflamatorio que puede resultar en el aumento de los niveles de estas enzimas. La participación de estudiantes de medicina en proyectos de investigación, les permitió hacer uso de técnicas y planteamiento de problemas de salud y establecer medidas de prevención a favor de la población, además este tipo de trabajo les permite desarrollar su capacidad de razonamiento diagnóstico y sensibilizarlos a una problemática médico-social, así como su vinculación real con las necesidades de salud del país. Para lograr su integración a esta realidad, la investigación es fundamental. . Estableciendo una relación entre los problemas nacionales de salud y la temática de la enseñanza. Siendo las facultades de medicina un lugar ideal para llevar a cabo programas de intervención para prevenir problemas de salud como es la obesidad en niños, ya que es el lugar natural para recibir educación acerca de estilos de vida saludables, y tratar de disminuir esta pandemia, se han sugerido que la intervención en varios ámbitos la familia, la escuela y la comunidad puede ayudar a cambiar la conducta hacia estilos de vida www.conferenciasindromemetabolico.org

41


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

saludables, con lo que sepodría te- fantil, Práctica Médica Efectiva. ner mayor éxito en la prevención México: S.S.A del sobrepeso y obesidad infantil. Es difícil cambiar los hábitos o estilo de vida y el ambiente en el cual se desarrollan los niños, se requiere de investigaciones multidisciplinarias en que se trabaje desde la familia para mejorar y promover buenos estados de salud. V. REFERENCIAS Denovan P. Begg and Woods Stephen C. Nat. Rev. Endocrinol. 9, 584–597 (2013) http://www. nature.com/doifinder/10.1038/ nrendo.2013.136 André J. Scheen and Nicolas Paquot A new paradigm for treating obesity and diabetes mellitus Nature Reviews Endocrinology 11, (2015) Barquera Simón, T. (2002). Geografía de las enfermedades asociadas con la nutrición en México. Instituto Nacional de Salud Pública, CIEAP/UAEM. Papeles de Población .No. 43, México. Endocrinología y Nutrición, Vol. 12 Núm. Calzada León, R. (2004). Prevención, diagnóstico y tratamiento de la obesidad en niños y adolescentes. Posición de la Sociedad Mexicana de Nutrición y Endocrinología, Revista de Endocrinología y Nutrición, Vol 12 Num 4 Oct - Dic Suppl 3: S143 – S147. González Guzmán, R. (2001). Estado nutricional y antropometría. Subdirección de Salud, Tlalpan. Educación Permanente en Salud, Núm. 1. México Instituto Nacional de Salud Pública y la Secretaría de Salud. (2006). Boletín Informativo: Obesidad In42

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ÁCIDO ÚRICO ¿BIOMARCADOR DE ALTERACIONES CARDIOMETABÓLICAS? LN. Kammar García Ashuin1, M. C. López Moreno Patricia2, M.C Hernández Hernández María Elena2, MC. Ortíz Bueno Angélica María2, M. C. Calderón Ibarra Elsa2, QFB. Blázquez Gutiérrez Ma. Elena2, D.C. Martínez Montaño María de Lurdez Consuelo3 ABSTRACT Study proposing to uric acid as a biomarker was performed; in a cross-sectional study of 340 samples of young adults (18-22 years), from a universe of 1,000 new students of the Faculty of Medicine (FM) BUAP participants to consider inclusion and exclusion criteria were proposed, biochemical tests were performed and categorized according to the parameters of ATP III and IMC according to OMS for adults. Considering as the presence of SM when more than three metabolic alterations according to ATP III were detected and also the presence of five or more metabolic abnormalities was investigated in the same individual. Analyses were performed in GraphPad Prism statistical software for Windows V.6, the diagnostic utility of AU was determined by an analysis of verisimilitude, with the results we conclude that uric acid statistically presents diagnostic efficacy in Sx Metabolic and when there greater than or equal to five cardiometabolic alteraration but not in the cardiovascular and atherogenic changes in the study population, where no statistical significance was observed. Suggesting to uric acid as a biomarker of cardiometabolic disorders. PALABRAS CLAVES: Síndrome metabólico, hiperuricemia, alteraciones cardiometabolicas

I. INTRODUCCIÓN n 1923, Kylin describió la asociación entre hipertensión arterial, hiperglucemia y gota. Se ha propuesto que existe asociación entre el ácido úrico y síndrome metabólico,1 estudios recientes muestran una alta relación entre ácido úrico y alteraciones cardiometabolicas,2-5 incluso otros autores enuncian que el ácido úrico puede ser considerado como un biomarcador potencial para detectar riesgo cardiometabolico,6,7 vinculándolo con enfermedades vasculares, hipertensión arterial, función renal y gota.8

E

II. METODOLOGÍA Estudio transversal. Muestra de 340 adultos jóvenes con edad de

18-22 años, de un universo de 1000 alumnos de nuevo ingreso de la Facultad de Medicina (FM) de la BUAP. Los criterios de inclusión fueron: ser estudiante de nuevo ingreso de la FM de la BUAP, contar con un ayuno de 12-14 horas, edad de 18 a 22 años, contar con el consentimiento informado. Se presentaron 370 individuos elegibles de los cuales se reclutaron 340 individuos, excluyendo a aquellos que no cumplieron con alguno de los criterios de inclusión o que presentaron muestras de suero hemolizado o lipemico. Los individuos se presentaron dentro de

las instalaciones del departamento de Bioquímica de la FM de la BUAP, donde se les realizó toma de variables antropométricas (Peso, Talla, Circunferencia de cintura), toma de muestras sanguíneas, medición de la presión arterial y elaboración de su historia clínica. Para el análisis bioquímico, se determinó glucosa, triglicéridos, colesterol total y colesterol de la lipoproteína de alta densidad (cHDL), lipoproteínas de baja densidad (cLDL), lipoproteínas de muy baja densidad (cVLDL) y ácido úrico, en un analizador VITROS DT60 II. Se realizaron los cálculos del Índice de Castelli (Colesterol total/cHDL) e Índice aterogénico (cLDL/cHDL). Se categorizaron los parámetros bioquímicos según la ATP III y el IMC de acuerdo a la OMS para adultos y se definió como hiperuricemia cuando los valores fueron mayor a 6mg/dl para mujer y mayor de 7mg/dl para hombre. Se consideró como presencia de Síndrome Metabólico cuando se detectaron más de tres alteraciones metabólicas de acuerdo a ATP III y además se investigó la presencia de cinco o más alteraciones metabólicas en un mismo individuo.

Colaborador del Departamento de Bioquímica de la Facultad de Medicina de la BUAP, Docentes del Departamento de Bioquímica de la Facultad de Medicina de la BUAP, 3 Coordinadora del Departamento de Bioquímica de la Facultad de Medicina de la BUAP, Benemérita Universidad Autónoma de Puebla (BUAP) 1 2

www.conferenciasindromemetabolico.org

43


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Las alteraciones cardiovasculares fueron positivas cuando el índice de Castelli se encontró por arriba de 4.5 y las alteraciones aterogénicas cuando el índice alergénico supero las 4 unidades. Se determinó la utilidad diagnóstica del AU por medio de un análisis de verosimilitud, obteniendo la sensibilidad, especificidad, valores predictivos positivos (VPP) y valores predictivos negativos (VPN), coeficientes de verosimilitud (CV) y probabilidades post-test positivo (PPT+) y negativo (PPT-), teniendo en cuenta la probabilidad 1:1 de presentar cada una de las alteraciones metabólicas. Se graficaron los resultados de la sensibilidad y 1- especificidad generando una curva ROC y obteniendo su área bajo la curva (AUC) y su valor de probabilidad. Los análisis se realizaron en el software estadístico GraphPad Prism v.6 para Windows. III. RESULTADOS Los resultados de cada análisis de verosimilitud entre cada una de las alteraciones metabólicas muestra al AU como un marcador poco sensible (40%, 58%, 45%, 26%, para SM, para la presencia de mayor o igual a cinco alteraciones metabólicas, alteraciones cardiovasculares y alteraciones aterogénicas respectivamente) pero muy específico (82%, 83%, 83%, 81%). Los VPP para las alteraciones cardiovasculares y aterogénicas fueron bastante bajos, 20% y 9% respectivamente, sin embargo los VPP para el Sx Metabólico y mayor o igual a cinco alteraciones me44

www.conferenciasindromemetabolico.org

tabólicas fueron bastante altas, mostrando un 69% y 78% de probabilidad de tener SM y presentar mayor o igual a cinco alteraciones metabólicas si hay hiperuricemia. Los VPN sugieren que la normo uricemia puede descartar el síndrome metabólico con una probabilidad del 58%, la presencia de mayor o igual a cinco alteraciones cardiometabólicas en un 70%, la presencia de alteraciones cardiovasculares y aterogénicas en un 94%. Los resultados de las PPT+ muestran que la probabilidad de tener SM si hay hiperuricemia incrementa en un 69%, la probabilidad de presentar mayor o igual a cinco alteraciones cardiometabólicas se incrementa a un 78% si hay hiperuricemia, la probabilidad de presentar alteraciones cardiovasculares y aterogénicas, si hay hiperuricemia, se incrementa a un 72% y 60% respectivamente. En cuanto a las PPT-, la presencia de normo uricemia disminuye la probabilidad de presentar mayor o igual a cinco alteraciones cardiometabólicas, pero la normo uricemia no mostró disminuciones significativas en ninguna otra alteración (ver cuadro 1). Las AUC fueron de un 70% y 80% para el Sx metabólico (p=0.01) y para la presencia de mayor o igual a cinco alteraciones cardiometabólicas (p<0.0001), pero para las alteraciones cardiovasculares y aterogénicas no fue significativa. (Ver figuras 1-4)

V3-N1 - 2016

áreas bajo la curva (Curva ROC) de las determinaciones de ácido úrico sérico para determinar su eficacia diagnóstica, se puede considerar su utilidad en el diagnóstico de SM y de alteraciones cardiometabólicas mayor o igual a cinco, no así en las alteraciones cardiovasculares y aterogénicas en la población de estudio, donde no se observó significancia estadística. Con lo anterior se sugiere al ácido úrico como biomarcador de alteraciones cardiometabólicas.

V. BIBLIOGRAFÍA 1. Cía Gómez, P., & Cía Blasco, P. (2005). Asociación de factores de riesgo (síndromes metabólicos). Medicina Cardiovascular. Arteriosclerosis. Millán J (ed). Masson, Barcelona, 471-83. 2. Kahn, R., Buse, J., Ferrannini, E., & Stern, M. (2005). The metabolic syndrome: time for a critical appraisal Joint statement from the American Diabetes Association and the European Association for the Study of Diabetes. Diabetes care, 28(9), 2289-2304. 3. González-Chávez, A., Elizondo-Argueta, S., & Amancio-Chassin, O. (2011). Relación entre síndrome metabólico e hiperuricemia en población aparentemente sana. Rev Med Hosp Gen Mex, 74, 132137. 4. Ogbera, A. O., & Azenabor, A. O. (2010). Hyperuricaemia and the metabolic syndrome in type 2 DM. Diabetology & metabolic syndrome, 2(1), 1. IV. CONCLUSIONES 5. Quintanilla-Valentín, A., Con base en los resultados del Aro-Guardia, P., Ángeles-Tacchino, análisis de verosimilitud y de las P., Acosta-Chacaltana, M., & Man-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

rique-Hurtado, H. (2013). .Association of elevated concentrations of uric acid and metabolic syndrome in obese adolescents, Rev Peru Med Interna, 26(2), 53 6. Rodrigues, S. L., Baldo, M. P., Capingana, P., Magalhães, P., Dantas, E. M., Molina, M. D. C. B. & Mill, J. G. (2012). Gender distribution of serum uric acid and cardiovascular risk factors: population based study. Arquivos brasileiros de cardiologia, 98(1), 13-2. 7. Guzmán-Sánchez, I., Rubio-Guerra, A. F., Vargas-Ayala, G., Núñez-Armendáriz, M., Valdez-Payan, N. H., Garrido-García, J. R., & Garro-Almendaro, A. K. (2014). Correlación entre el grado de disfunción ventricular izquierda y las concentraciones séricas de ácido úrico. Medicina Interna de Mexico, 30(3). 8. Álvarez Prats, M., Mantilla, T., & Eugenia, M. (2015). Behaviour of the uric acid in the general casuistic and in patients with peripheral vascular disease

www.conferenciasindromemetabolico.org

45


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

46

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

RELACIÓN DE LOS POLIMORFISMOS G5665T Y +138/ex1 Ins/Del A EN EL GEN EDN1 CON HIPERTENSIÓN ARTERIAL EN POBLACIÓN GUERRERENSE QBP. Ana Victoria Villalva Radilla1, QBP. Carlos Alberto Resendiz Abarca1, QBP. Aralia Berenice Salgado Bernabé1, Dr. José Francisco Muñoz Valle2, Dra. Isela Parra Rojas1, Dra. Linda Anahi Marino Ortega, Dr. Lorenzo Salgado Goytia1 ABSTRACT The arterial Hypertension, disorder characterized by increased blood strain, is regarded as the main risk factor for developing cardiovascular diseases, in 95% of cases the cause is unknown but has been attributed to the interaction of environmental and genetic. Objective: Evaluate the relationship of the G5665T polymorphisms and + 138 /ex1 Ins/Del EDN1 A gene with hypertension in guerrerense population. Material and methods: 150 adult subjects (50 cases and 100 controls) of both genders who signed a letter of informed consent were studied. arterial pressure ≥130 / 85 mmHg for cases and ≤120 / 80 mmHg for controls was considered. Genotyping the polymorphisms was performed by PCR-RFLP’s technique. Statistical analysis was performed using STATA (v.11). Results: Genotypic frequencies of SNP + 138 / ex1Ins / Del A were Ins/Ins 0% Ins/Del 10% Del/Del 90% and allele frequencies: Ins 5% and Del 95%, no connection with hypertension or biochemical parameters was found. For G5665T polymorphism genotypic frequencies in the population studied they were: G/G 43 %, G/T 51 % and T/T 6 %; and allele: 69% G and 31% T. It was found a relationship with the increase in systolic and diastolic blood pressure in individuals genotype was found genotype was found carrying the T/T. Conclusions: The T allele of SNP G5665T the EDN1 gene is associated with hypertension. KEYWORDS: Hypertension, EDN1, G5665T, +138/ex1 Ins/Del A.

I. INTRODUCCIÓN a hipertensión arterial (HTA) es una enfermedad crónica degenerativa caracterizada por la elevación sostenida de la Tensión Arterial (TA). Se estima que alrededor del 30% de la población adulta mundial la padece. En México, se ha reportado una prevalencia del 31.5%, mientras que en el estado de Guerrero es del 13.5%. Debido a su complejidad, es importante conocer si además de los factores ambientales, los polimorfismos genéticos confieren una susceptibilidad para su desarrollo, estos pueden alterar el funcionamiento o expresión

L

de las proteínas implicadas en los sistemas que regulan la TA como son el Sistema Renina Angiotensina Aldosterona (SRAA), Oxido Nitrico (NO) y Endotelinas (ETs), siendo este último, de importancia debido efecto vasoconstrictor. Se han llevado a cabo estudios en poblaciones como India, Japón y España, donde se ha logrado asociar polimorfismos del sistema de ETs con enfermedades cardiovasculares. Anteriormente, el endotelio se limitó a considerarse como un epitelio con actividad anticoa-

gulante, después se descubrió la presencia de un factor causante de la contracción del músculo liso, secretado por el endotelio vascular y más tarde se aisló una sustancia con propiedades vasoactivas, la cual se nombró endotelina (ET). Se determinó que las ETs son una familia integrada por ET 1-3, con una estructura peptídica muy similar. Los ETA se producen principalmente en las células del músculo liso vascular, de vías respiratorias, hepatocitos, neuronas, osteoblastos, melanocitos, queratinocitos, adipocitos, miocitos y en el sistema reproductor, la activación es normalmente pre-hipertensiva a través de la vasoconstricción y estimula la proliferación celular del músculo liso vascular (VSM), pero también tiene efectos significativos para aumentar la inflamación y el estrés oxidativo. En el VSM los ETA están regulados por la insulina y NO. Existe una mayor incidencia de HTA en individuos de una misma familia o grupos étnicos, lo que sugiere que tiene un origen genético, no tiene un patrón de transmisión hereditario mendeliano clásico (dominante o recesivo),

Laboratorio de Investigación de Obesidad y Diabetes. U.A.C.Q.B. Universidad Autónoma de Guerrero. Chilpancingo, Gro 2 Departamento de Biología Molecular y Genómica, C.U.C.S. U. de Guadalajara, Jal. México 1

www.conferenciasindromemetabolico.org

47


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

es decir tiene un comportamiento poligénico. Con esta investigación, se pretende conocer si existe una asociación con los polimorfismos G5665T y +138/ex1Ins/Del A en el gen de EDN1 con la HTA en población guerrerense.

ta. El análisis estadístico, se realizó con el programa STATA (V. 11). Para evaluar el efecto de los polimorfismos sobre la HTA se realizaron modelos de regresión lineal y logística, las diferencias fueron consideradas como estadísticamente significativas con un valor II. MATERIALES Y MÉTODOS de p<0.05. De estudios previos en personas con enfermedades crónicas III. RESULTADOS degenerativas, se seleccionaron muestras de ADN de individuos que presentan HTA (casos), e individuos que no presenten HTA (control), y con la determinación de variables clínico-antropométricas (edad, género, peso, talla, TAS, TAD, glucosa, colesterol y triglicéridos), se verificó la integridad del ADN. Mediante la técnica de PCRRFLP’s, se realizó la genotipificación de los SNPs G5665T y +138/ ex1Ins/Del A en el gen EDN1. Para el polimorfismo G5665T en el gen EDN1, se amplificó un fragmento de 331 Pb. mientras que para el polimorfismo +138/ex1Ins/Del A en el gen EDN1, se amplificó un fragmento de 169 pb, utilizando los iniciadores. Los productos amplificados por PCR, fueron visualizados en geles de poliacrilamida al 6% y teñidos con nitrato de plata. Los productos se sometieron a un proceso de restricción enzimática: para el polimorfismo G5665T, el producto fue sometido a restricción con la enzima Cac8I, para el Al analizar las variables clínicas y polimorfismo +138/ex1Ins/Del antropométricas entre los grupos A, se usó la enzima de restricción de estudio, se observaron diferenMseI. Los productos de las restric- cias estadísticamente significativas ciones, se visualizaron por electro- (p<0.05), en la edad, género, peso, foresis en geles de poliacrilamida IMC, glucosa, colesterol y triglicéal 6% y teñidos con nitrato de pla- ridos (datos no mostrados). El po48

www.conferenciasindromemetabolico.org

V3-N1 - 2016

limorfismo +138ex1 Ins/Del A del gen EDN1 cumple con el equilibro de Hardy Weinberg (p>0.05). Al analizar las frecuencias genotípicas y alélicas entre los dos grupos de estudio, no se observan diferencias estadísticamente significativas (p>0.05). Al comparar las variables determinadas en el grupo de estudio con los genotipos del polimorfismo +138ex1 Ins/Del A

en el gen EDN1, no se observan diferencias estadísticamente significativas (p<0.05). El polimorfismo G5665T del gen EDN1 cumplió con el equilibro de Hardy Weinberg (p>0.05). Al analizar las frecuencias genotípicas y alélicas entre


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

los grupos de estudio, en ambas frecuencias se observaron diferencias estadísticamente significativas (p<0.001), con un OR de 2.3 (I.C.95%1.3 - 3.8,) para el alelo T, y OR de 3.4 (I.C. 95% 1.13 - 10.1). (Tabla 1). Al analizar las variables determinadas en el grupo de estudio con los genotipos del SNP G5665T en el gen EDN1, solo se observan diferencias estadísticamente significativas (p<0.05) en la tensión arterial sistólica y diastólica, en individuos portadores del genotipo T/T, en comparación con los portadores de los genotipos G/T y G/G. (Tabla 2).

V3-N1 - 2016

sion: Meta-Analyses of Six Candidate Genetic Variants. Genetic Testing and molecular biomarkers, 17(10), pp. 736-742.

IV. CONCLUSIÓN El polimorfismo G5665T en el gen EDN1, se asocia con Hipertensión Arterial en la población guerrerense, siendo el alelo T el de riesgo. V. REFERENCIAS • Horinouchi, T., Terada, K., Higashi , T. & Miwa , S., 2013. Endothelin receptor signaling: new insight into its regulatory mechanisms. Journal of Pharmacological Sciences, 123(2), pp. 85-101. • Horinouchi, T., Terada, K., Higashi, T. & Miwa, S., 2013. Endothelin Receptor Signaling: New Insight Into Its Regulatory Mechanisms. Journal of Pharmacological Sciences, 123(2), pp. 85-101. • Ohkita, M., Tawa, M., Kitada, K. & Matsumura, Y., 2012. Pathophysiological Roles of Endothelin Receptors in Cardiovascular Diseases. Journal of Pharmacological Sciences, 119(4), pp. 302-313. • Zhang, C. y otros, 2013. Genetic Associations with Hyperten-

www.conferenciasindromemetabolico.org

49


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ACÚMULO DE GRASA Y SU ASOCIACIÓN CON LOS COMPONENTES DEL SÍNDROME METABÓLICO Y ACANTOSIS NIGRICANS M. en N.C. Omaña Covarrubias Arianna, M. en C. Porta Lezama Miroslava, L.N. Estrada Doniz Nancy, L.N Bustamante Mar Elizabeth, M. en N.H. Calderón Ramos Zuli y M. en N.H Peña Irecta Amanda ABSTRACT. The prevalence of chronic non-communicable diseases are increasingly, having mostly common denominator, excess weight. However, it has been observed that more excess weight distribution and excess fat mass, the real risk to the presence of the same. Among the most frequent, this insulin resistance, hypertension, dyslipidemia, this diseases are brought together in the metabolic syndrome (MS). Therefore, this study aims to assess the association between MS, acanthosis nigricans (AN), percentage of fat mass (MG) and waist circumference (CC) in adults aged 20 to 60 years of the State of Hidalgo. It is an observational study in 63 adults aged 20 to 60, in which the following variables were measured: body composition by plethysmography (BOD POD®), body mass index (BMI), CC, fasting glucose, triglycerides, HDL cholesterol , presence of AN in the neck, abdomen and groin. It was analyzed by contingency tables and the X2 test was applied with confidence level of 95% with SPSS version 20. According to BMI, the prevalence of overweight and obesity was 73%, of these, 89% have excess body fat. Taking into account the abdominal circumference, 46% showed an excess in this condition. Of the total population with abdominal obesity, 93% have the status of overweight or obese On the other hand, it was observed that the total of subjects with metabolic syndrome, more than half (52%) have excess body fat mass. With all this we can conclude that the presence of MS is higher with certain adverse health conditions. So that those who had abdominal obesity also had high BMI; and in whom he had observed simultaneously MGE SM and AN neck, abdomen and / or groin. Unlike those who had normal BMIs, MG and without the presence of AN, not since indicators were SM KEYWORDS: overweight, obesity, fat mass, metabolic syndrome and acanthosis nigricans.

I. INTRODUCCIÓN l sobrepeso y obesidad, se caracterizan por presentar un aumento de peso corporal, que resulta de la acumulación excesiva de grasa, y que actualmente representa un problema social, pero sobre todo de salud en todo el mundo. Sobre todo, por ser un factor subyacente importante en las patogénesis de varias enfermedades. Recientemente, también se ha encontrado que la obesidad se asocia con bajo grado de inflamación sistémica crónica en el tejido adiposo, situación que juega un

E 50

www.conferenciasindromemetabolico.org

papel crítico en la patogénesis de complicaciones relacionadas con la obesidad (1). Esos comportamientos propician cuatro cambios metabólicos/fisiológicos clave que aumentan el riesgo de Enfermedades Crónicas No Transmisibles: hipertensión arterial, sobrepeso/ obesidad, hiperglucemia e hiperlipidemia (2), dando origen al Síndrome Metabólico (SM). El SM es una condición clínica compleja, que se caracteriza por la Universidad Autónoma del Estado de Hidalgo

presencia de factores tradicionales y no tradicionales de riesgo cardiovascular, entre ellos se encuentran: hipertensión, obesidad abdominal, niveles bajos de colesterol HDL, hipertrigliceridemia, resistencia a la insulina o hiperglucemia en ayunas. Es uno de los problemas de salud pública más importante en el mundo, de la misma manera en México, se reporta una prevalencia del 36.8%, considerada una de las más altas del mundo (3).

II. METODOLOGÍA Estudio de tipo observacional, que incluyó 63 sujetos de ambos sexos, entre 20 a 60 años de edad. Se evaluaron indicadores antropométricos: composición corporal con técnica de plestismografía, índice de masa corporal (IMC) y circunferencia de cintura (CC) mediante técnicas estandarizadas. Indicadores bioquímicos: glucosa, triglicéridos, colesterol HDL en sangre plasmática con 8 a 10 horas de ayuno, analizada por Reflotron Plus®. También se evaluaron indicadores clínicos, tensión arterial y presencia de acantosis nigricans en cuello, abdomen e ingle. Se analizó con tablas de contingencia, aplicando la prueba Xi2 con un nivel de confianza del 95%, con el paquete estadístico SPSS versión


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

20.

Los casos de hipertensión fueron más en los hombres (26%) que en III. RESULTADOS las mujeres (15%). También desParticiparon 63 sujetos entre 20 taca que la mitad de las mujeres y 60 años de edad (43±10 años), tuvieron obesidad abdominal, y 64% fueron mujeres. El promedio los hombres el 39%. de IMC fue 27 (D.E. 3.7). La masa grasa en exceso se observó en 3 Del total de la población que tiene de cada 4 sujetos (76.2%). La obe- obesidad abdominal, 93% tienen sidad abdominal, con puntos de la condición de sobrepeso u obecorte de 88 cm para mujeres y 102 sidad (evaluada a través de IMC), para hombres, mostró que cerca pero destaca que entre los que de la mitad de la población tuvo tienen IMC normal, el 12% tienen esa condición (46%). La prevalen- obesidad abdominal. Por otro lado, cia de sobrepeso y obesidad fue de se observó que del total de los su73%, de ellos, el 89% tienen exce- jetos con síndrome metabólico, so de grasa corporal. más de la mitad (52%) tiene exceso de masa grasa corporal. En relación a la glucosa sanguínea 1 de cada 4 tuvieron prediabetes IV. CONCLUSIONES y 2% diabetes. El 43% presentó En este estudio se corrobora lo prehipertensión y 19% hiperten- que se ha demostrado consistensión. El signo clínico de acantosis temente, la utilidad del IMC como se identificó en 46% de la pobla- estimador de grasa corporal, la ción, de ellos 32% únicamente en prevalencia del sobrepeso u obecuello y 14% en cuello y abdomen sidad es similar a la del exceso de simultáneamente. El SM estuvo masa grasa corporal. Así como, la presente en 43% de la población presencia de SM en quienes tienen estudiada. grasa corporal en exceso Al analizar los datos por sexo, entre las diferencias más importantes fue la presencia de síndrome metabólico mayor en mujeres que en los hombres (60% vs 52%, respectivamente). La acantosis en cuello fue más prevalente en hombres (43.5%) que en mujeres (25%). La prediabetes se observó con mayor frecuencia en mujeres (27.5% vs 22% de hombres) y casos de diabetes solamente en hombres (4%). El 30% de los hombres tuvieron IMC compatible con obesidad, a diferencia del 12.5% de las mujeres.

V3-N1 - 2016

servarlo en cuello es más común en hombres que en mujeres.

V. BIBLIOGRAFÍA 1. Marseglia, L., Manti, S., D’Angelo, G., Nicotera, A., Parisi, E., Di Rosa, G., y Arrigo, T. (2014). Oxidative stress in obesity: A critical component in human diseases. International journal of molecular sciences, 16(1), 378-400. 2. Organización Mundial de la Salud. (2014). Enfermedades No Transmisibles. OMS. Dirección: http://www.who.int/mediacentre/factsheets/fs355/ es/. Actualización: 2015; Acceso: 06/10/2015 3. Martínez H, A., Córdova, E. J., Rosillo S, O., García O, H., Contreras C, C., Islas A, S., y Orozco, L. (2015). Association of HMOX1 and NQO1 Polymorphisms with Metabolic Syndrome Components. 10(5)

Aunque la obesidad abdominal estuvo presente en cerca de la mitad de los casos, se observó que es una condición común entre quienes tenían IMC elevado, en una relación casi 1:1, sin embargo, aún con IMC normal, también se observó obesidad abdominal en algunos casos.

Entre los participantes, las mujeres tuvieron mayor presencia de síndrome metabólico. La acantosis estuvo presente en cerca de la mitad de la población estudiada, obwww.conferenciasindromemetabolico.org

51


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DE UN PROGRAMA DE EJERCICIO AEROBIO EN EL MEDIO ACUÁTICO SOBRE EL RIESGO CARDIOVASCULAR LMH Héctor Mario De la Rosa Macías, M.C. Viviana Navarrete Miramontes, Dra Yunuen Socorro Rangel Ledezma, M.A. Pilar del Carmen Hernández Rodríguez ABSTRACT Introduction: Estrogen protects women from heart disease before menopause. The decline of female hormonal load and physical inactivity act as a trigger for diseases and disorders increasing the risk of heart disease. Objective: To determine the effect of a program of water aerobic exercise of moderate intensity in sedentary women on cardiovascular risk. Methods: A sample of 19 women of 22-57 years with cardiovascular risk factors according to NCEP (ATP III); a program of aerobic exercise was conducted in the aquatic environment with incremental loads (40-50% Karvonen formula). Before and after the program was determined: lipid profile, hip circumference, waist circumference, blood pressure, glucose, atherogenic index, BMI and weight. Results: The weight of 81.01 was reduced to 78.27 kg (-3.07%), BMI of 32.88 to 31.76 kg / m2 (-2.82%), diastolic pressure of 84.11 to 80.58 (-3.85%) all with a significance of p <.01. Hip circumference decreased from 110.64 to 106.68 (-3.49%) (p <.000) and the atherogenic risk of 4.08 to 3.73 (-7.38%) (p <.05). HDL had a tendency to increase by 7.34%. Conclusion: the exercise program reduced the weight, BMI, diastolic blood pressure, waist circumference and atherogenic risk. With a tendency to increase HDL levels and lower systolic blood pressure. PALABRAS CLAVE: acuaeróbics, perfil lipídico, índice aterogénico, HDL, IMC

I. INTRODUCCIÓN uando la mujer llega a la menopausia entre los 45-55 años, el riesgo de padecer una enfermedad cardiovascular (ECV) incrementa superando a los hombres debido a las modificaciones hormonales que la mujer sufre en su adultez(1). Cuantos más factores de riesgo tenga una persona, mayores serán sus posibilidades de padecer una enfermedad del corazón(2). En México durante el 2011 se registraron 16,190 muertes prematuras en mujeres de 30 a 69 años de edad. El 42% de estas muertes fue causa de enfermedades isquémicas del corazón, el 26% por enfermedades cerebrovasculares, el 16% enfermedades hipertensivas,

C

52

www.conferenciasindromemetabolico.org

el 5% por insuficiencia cardiaca, 2% por enfermedad reumática y 10% por otras enfermedades cardiovasculares(3). Todas esas patologías están asociadas a la inactividad física aumentando su prevalencia(4). II. METODOLOGÍA Sujetos: estudio cuasi-experimental, longitudinal con mediciones pre y post test, en una muestra de 19 mujeres sedentarias de 22-57 años de la ciudad de Chihuahua con RC de acuerdo a criterios del NCEP (ATP III). La investigación se apegó a los estatutos de la Ley general de salud en materia de investigación para la salud, y a la declaración de Helsinki. Técnicas y procedimientos: Al ini-

cio y término del programa se determinaron los valores de tensión arterial, glucosa, colesterol total (CT), lipoproteínas de alta densidad (HDL), lipoproteínas de baja densidad (LDL), lipoproteínas de muy baja densidad (VLDL) y triglicéridos (Tg); mediante estos datos se determinó el índice aterogénico (IA) y el RC con la escala de Framingham. Se tomaron las medidas antropométricas de talla, peso y circunferencias de cintura y cadera. El programa de ejercicios tuvo una duración de 10 semanas; iniciando (1-6) al 40% de la fórmula de Karvonen, de las semanas 7-10 se incrementó la intensidad al 50% manejando implementos acuáticos. Se monitoreó la frecuencia cardiaca cada 5 minutos mediante pulsómetro Polar. Las sesiones fueron 5 días a la semana con una duración de 60 minutos. Para el análisis estadístico de los resultados se efectuó en el programa SPSS versión 18.0. Para la diferencias de medias se utilizó la “t” de student. III. RESULTADOS La edad promedio de las 19 participantes fue de 43.58 ± 8.29 años y la talla de 1.57 ± .05 m. Después de la intervención el peso disminuyó de 81.01 ± 17.44 kg a 78.27 ±

Facultad de Ciencias de la Cultura Física, Universidad Autónoma de Chihuahua


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

15.50 kg (-3.07%) (p<.01) y el IMC de 32.88 ± 7.14 a 31.76 ± 6.31, con un cambio del -2.82% (p<.01). En cuanto al lipidograma se observó una reducción del CT de 191.89 ± 46.9 mg/dL a 189.44 ± 56.44 mg/dL, Tg de 237.10 ± 209.83 mg/ dL a 173.98 ± 58.45 mg/dL, LDL de 107,70 ± 50,16 mg/dL a 103.80 ± 52.03 mg/dL y las VLDL de 47.47 ± 41.93 mg/dL a 34.79 ± 11.69 mg/ dL; las HDL aumentaron de 47.32 ± 9.5 mg/dL a 50.83 ± 11.88 mg/ dL (7.34%) (p<.05). En la figura 1 se muestra el cambio porcentual del lipidograma. En referente

terial diastólica (TAD) de 84.11 ± 9.39 mmHg a 80.58 ± 8.26 mmHg (-3.85%) (p<.05) y glucosa de 110.47 ± 65,714 mg/dL a 103.65 ± 24.96 mg/dL (-6.17%). En cuanto a las medidas antropométricas, la circunferencia de cintura inicial fue de 103.81 ± 12.07 cm y final de 102.07 ±13.18 cm (-1.72%) y la circunferencia de cadera disminuyó de 110.64 ± 11.49 cm a 106.68 ± 10.66 (-3.49%) con una significancia de p<.000.

a los parámetros de salud cardiovascular (Tabla 1), el IA inicial fue de 4.08 ± .88 y final de 3.73 ± .77 (-7.38) con una p<0.05. El RC inicial fue de 1.26 ± 1.98 y final 1.26 ± 2.04 (-26.71%). La tensión arte-

jetivo fue el tratamiento y la reducción del RC en mujeres sedentarias. El programa tuvo un efecto positivo al disminuir los principales parámetros cardiovasculares por debajo de los puntos de corte para

IV. CONCLUSIONES En la presente investigación el ob-

V3-N1 - 2016

programa en el medio acuático son el incremento de metabolismo general, mejora en la circulación sanguínea, disminución de la tensión arterial gracias a la compresión del agua y la flotación, reducción del peso corporal permitiendo un rango mayor de movilidad evitando lesiones y un decremento en los niveles de colesterol debido a la resistencia en el agua (6, 7). La reducción de la glucosa, PAD, PAS, la tendencia a disminuir de la circunferencia de cadera máxima y un aumento de HDL en el presente programa fue debido a que el incremento de 10 minutos en la duración del ejercicio acrecienta los niveles de esta lipoproteína hasta 1.4 mg/dL, indicando una mejora cardiovasculares (8, 9). Los programas de ejercicio acuático de hasta 16 semanas de intensidad incremental como en el presente trabajo, son coadyuvantes en la disminución del RC y sus factores, reducen el tejido adiposo visceral y abdominal, y decrece el riesgo de padecer enfermedades metabólicas y cardiovasculares (10). La aplicación de un programa de ejercicio aerobio en el medio acuático de 10 semanas de duración con cargas incrementales, disminuye significativamente factores de RC en mujeres como el peso, TAD, el IMC y circunferencia de cadera; un aumento de las lipoproteínas HDL y una disminución del IA de -7.38%.

V. REFERENCIAS rial sistólica (TAS) disminuyó de RC propuestos por el NCEP(5) así 1. Padró L, Pelegrín A. Peri120.58 ± 8.99 mmHg a 117.88 ± como el IA. Demostrándose que menopausia y riesgo cardiovascu11.56 mmHg (-1.87%), tensión ar- los beneficios obtenidos por un lar. Medisan. 2011;15(10):1485www.conferenciasindromemetabolico.org

53


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

92. 2. Zurro M, Cano J, Gené J. Atención primaria. 7 ed. GEA consultoría editorial. SL, editor. Barcelona, España: Elsevier; 2014 2014. 1023 p. 3. Organización Panamericana de la Salud. México, Perfil Enfermedades Cardiovasculares, 2014 Washington, D.C.2014. Available from: http://www.paho.org/ hq/index.php?option=com_topics&view=rdmore&cid=7283&Itemid=40876&lang=es. 4. Jiménez A. Actividad física y enfermedades cardiovasculares. Márquez S, Garatachea N, editors. Madrid: Díaz de Santos; 2012. 299 p. 5. Expert Panel on Detection E, and Treatment of High Blood Cholesterol in Adults. Executive summary of the Third Report of the National Cholesterol Education Program (NCEP) expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult Treatment Panel III). Jama. 2001;285(19):2486. 6. Baena. Efectos de un programa de ejercicio físico acuático sobre la capacidad funcional y la calidad de vida relacionada con la salud en personas adultas sedentarias con dolor lumbar crónico: Universidad de Granada; 2013. 7. Pérez S, Lambeck J. Efectos de un programa de Ai Chi acuático en pacientes con fibromialgia. Estudio piloto. Rev Neurol. 2015;60:59-65. 8. Calderín R, Monteagudo G, Yanes M, García J, Marichal S, Cabrera E, et al. Síndrome metabólico y prediabetes. Revista Cubana de 54

www.conferenciasindromemetabolico.org

Endocrinología. 2011;22(1):52-7. 9. Katsura Y, Ueda S, Yoshikawa T, Usui T, Orita K, Sakamoto H, et al. Effects of Aquatic Exercise Training Using New Water-resistance Equipment on Trunk Muscles, Abdominal Circumference, and Activities of Daily Living in Elderly Women. International Journal of Sport and Health Science. 2011;9:113-21. 10. Di Masi F, Silveira A, Braz M, Gatica S, Borreani S, Brasil R. Efectos de un programa de aquagym en mujeres posmenopaúsicas. Revista Internacional de Medicina y Ciencias de la Actividad Física y el Deporte. 2014.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EJERCICIO AEROBIO SOBRE ANTROPOMETRÍA EN MUJERES CON SÍNDROME METABÓLICO LMH Fernanda Itzel Sánchez Muñoz, LMH Astrid Samantha Hernández Mendoza, MC Viviana Navarrete Miramontes ABSTRACT. Metabolic syndrome is a group of diseases that affect the general population by reducing the quality of life and causing premature death; this problem has increased due to genetic factors, sedentary leisure time and working life, and reduced physical labor in activities of daily living. Therefore, it is important the detection and treatment in patients with metabolic syndrome. Objective: To determine the effect of a water aerobic moderate intensity program on anthropometric measures and AI in sedentary women with metabolic syndrome. Methodology: sample of 14 sedentary women between 22 and 49 years old with SM city of Chihuahua. Before and after the program was determined: anthropometric measurements, BMI, % BF, Σ6 skinfolds and IA. Results: Significant reductions were observed on weight -3.73%, BMI -3.46%, AI -8.69%, %BF -3.65%, Σ6 -11.81%, subscapularis skinfold -8.30%, iliocrestal skinfold -26.86%, front thigh -14.70%, arm circumference relaxed -1.63%, tensioned arm -2.53%, maximum hip circumference -3.25%. A tendency to decrease on cholesterol -3.10% and HDL increased 6.77%. Conclusions: a program of aerobic exercise in the aquatic environment decreases significantly anthropometric measurements, AI (-8.69%) and cardiometabolic risk in women with MS. PALABRAS CLAVE: Acuático, Índice aterogénico, HDL, colesterol

I. INTRODUCCIÓN as enfermedades crónicas no trasmisibles (ECNT) son un obstáculo para el siglo XXI afectando el desarrollo social y económico en todo el mundo, la presencia del síndrome metabólico (SM) se relaciona con un incremento significativo del riesgo de padecer de diabetes mellitus 2 (DM2), enfermedad coronaria y enfermedad cerebrovascular, además de disminuir la calidad de vida(1). En la población adulta de México en el año 2014 la incidencia de DM2 fue de 381,099 casos, 356,712 de obesidad y 480,332 de hipertensión (HTA). En el estado de Chihuahua en este mismo grupo de edad los casos nuevos por DM2 fueron 15,162, HTA 25,861 y obesidad 20,516(2).

L

La identificación de personas con SM es un exigente moral, médico y económico que no se debe ignorar. El diagnóstico temprano de esta afección permitirá aplicar intervenciones a tiempo para propiciar cambios a estilos de vida saludable.

de la investigación para la salud y a la Declaración de Helsinki(3). Al inicio y término del programa se determinó índice aterogénico (IA) y mediante los lineamientos del ISAK(4) talla, peso, pliegues cutáneos (tríceps, subescapular, bíceps, suprailiaco, supraespinal, abdominal, muslo frontal, pantorrilla medial), circunferencias (brazo relajado, brazo flexionado y en tensión, cintura mínima, cadera máxima, pantorrilla máxima), determinando con estos datos índice de masa corporal (IMC), porcentaje de grasa corporal (%GC) y sumatoria proporcional de 6 pliegues (Ʃ6). El programa de ejercicio se trabajó las primeras 6 semanas (1-6) al 40% de la fórmula de Karvonen, las siguientes 4 (7-10) se incrementó la intensidad al 50% utilizando resistencias en muñecas, tobillos y pesas. Antes de cada sesión se determinó frecuencia cardiaca (FC) en reposo y tensión arterial (TA). Cada una de las sesiones tuvo una duración de 60 minutos, registrándose la FC cada 5 minutos mediante pulsómetro durante todo el tiempo de trabajo.

II. METODOLOGÍA Estudio longitudinal con mediciones pre y post test; se estudió muestra por conveniencia de 14 mujeres sedentarias de 22-49 años de edad con SM de la ciudad de Chihuahua. Los criterios de exclusión fueron problemas ortopédicos y alteraciones menstruales. La investi- III. RESULTADOS gación se apegó a los estatutos de La edad fue de 41.93±6.96 años la Ley general de salud en materia y talla 1.57±0.05 m, el peso disminuyó de 83.44±18.28 kg a Facultad de Ciencias de la Cultura Física, Universidad Autónoma de Chihuahua

www.conferenciasindromemetabolico.org

55


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

80.30±16.34 kg (-3.73%), IMC de 33.57±7.71 a 32.29±6.85 kg/m² (-3.46%) ambos con p<0.01. Se observó una tendencia a disminuir del colesterol de 188.64±48.90 a 180.86±48.24 mg/dL (-3.10%) y las HDL aumentaron de 47.63±10.26 a 50.73±11.85 mg/ dL (6.77%). El IA disminuyó de 3.98%±.90 a 3.57±.56 (-8.69%) significancia p<.05 (Figura 1).

cia a disminuir del pliegue tricipital de 26.92±5.66 a 24.28±4.56 mm (-7.95%), bicipital inicial 24.92±6.09 final 22.24±6.31 mm (-8.17%), supraespinal de 30.03±9.11 a 29.67±7.05 (-1.19%), abdominal de 35.50±8.02 a 33.25±7.06 (5.46%), pantorrilla medial de 27.87±8.08 a 26.45±7.61 mm (-1.24%), cintura mínima inicial 98.71±14.02 final 96.92±14.17

V3-N1 - 2016

(-7.96%) (Tabla 1). En la Tabla 2 se muestran las correlaciones más significativas entre las variables de la presente investigación.

IV. CONCLUSIONES En el presente estudio, 10 semanas de ejercicio aerobio en el medio acuático mejora notablemente los parámetros antropométricos en sujetos con SM. Observándose que el SM está relacionado con la alta cantidad de grasa corporal total y la distribución de grasa androide y ginecoide, siendo mayor en pacientes con SM que en quien no lo padece; la disminución de la cantidad de grasa en esta zona está asociada con el avance de la edad(5). Los índices de adiposidad como la densidad corporal, IMC, %GC, la distribución de grasa androide y grasa visceral tienen una En cuanto a las medidas antro- cm (-1.80%) y pantorrilla máxima correlación alta y positiva con los 5 pométricas, el pliegue subesca- de 38.90±4.17 a 35.87±8.57 cm componentes del SM. Confirmánpular disminuyó de 28.60±6.21 a 25.67±5.30 mm (-8.30%), circunferencia brazo relajado de 35.18± 3.97 a 34.57± 3.66 cm (-1.63%), brazo tensionado inicial 34.50±5.29 final 33.54±4.57 cm (-2.53%), %GC inicial 39.97±2.92 final 38.75±2.65 (-3.65%) y Ʃ6 de 184.85±34.61 a 161.49±26.84 (-11.81%) todos los anteriores con p<.05; pliegue iliocrestal de 32.51±7.34 a 23.35±6.89 mm (-26.86%), circunferencia de cadera máxima de 111.45±12.44 a 107.75±11.45 cm (-3.25%) ambos con una significancia de p<.001; muslo frontal inicial 33.42±7.18 final 28.46±7.60 mm (-14.70%) (p<.01); se mostró una tenden56

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

dose que la distribución de grasa androide y la grasa visceral como la observada en la actual investigación, son un factor importante en la patogénesis del SM y la estenosis arterial coronaria(6). Las reducciones en el %GC y masa grasa son más propensos a reducir los componentes del SM(7). El exceso de tejido adiposo visceral determinado por la circunferencia de cintura en la actual investigación, juega un papel importante en el desarrollo del perfil diabetogénico y aterogénico metabólico, a su vez es considerado un marcador de alteración del riesgo cardiometabólico(8). El puntaje alto del IA, los niveles elevados de colesterol y bajos de HDL mostrados al inicio del programa, mejoraron significativamente después de la intervención reflejando una mejora cardiovascular. Se concluye que un programa de ejercicio aerobio en el medio acuático disminuye significativamente medidas antropométricas y riesgo cardiometabólico determinado por IA (-8.69%) en mujeres con SM.

V. BIBLIOGRAFÍA 1. Bello B, Sánchez G, Campos A, Báez E, Fernández J, Achiong F. Síndrome Metabólico: un problema de salud con múltiples definiciones. Rev Méd Electrón. 2012. 2. Epidemiología DGd. Anuario de morbilidad 1984-2014 2014. Available from: http:// www.epidemiologia.salud.gob. mx/anuario/html/anuarios.html. 3. WMA. Declaracion de Helsinki de la AMM- Principios éticos para las investigaciones médicas en seres humanos. Health promotion. 2015:1. 4. ISAK. ISAK World Conference 2014 2014. Available from: http://www.isakonline.com/. 5. Kang SM, Yoon JW, Ahn HY, Kim SY, Lee KH, Shin H, et al. Android fat depot is more closely associated with metabolic syndrome than abdominal visceral fat in elderly people. PloS one. 2011;6(11):e27694. 6. Layne AS, Nasrallah S, South MA, Howell ME, McCurry MP, Ramsey MW, et al. Impaired muscle AMPK activation in the metabolic syndrome may attenuate

V3-N1 - 2016

improved insulin action after exercise training. The Journal of Clinical Endocrinology & Metabolism. 2011;96(6):1815-26. 7. Joseph LJ, Prigeon RL, Blumenthal JB, Ryan AS, Goldberg AP. Weight loss and low-intensity exercise for the treatment of metabolic syndrome in obese postmenopausal women. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences. 2011;66(9):1022-9. 8. Després J-P. Body fat distribution and risk of cardiovascular disease an update. Circulation. 2012;126(10):1301-13.

www.conferenciasindromemetabolico.org

57


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES DE RIESGO METABÓLICO EN ADOLESCENTES MENONITAS, TARAHUMARAS Y MESTIZOS CHIHUAHUENSES Stephanie Juárez Pazos, DC Ángel Licón Trillo, Irene Leal-Berumen PhD, Víctor Manuel Santana Rodríguez PhD, DC Verónica Moreno Brito, MA Pilar Hernández Rodríguez, Lic N Concepción Santiago Antonio, DC Imelda Alcalá Sánchez, Miguel Conchas Ramírez, DC Everardo González Rodríguez ABSTRACT. The aim of this study was to determine the prevalence of risk factors associated with metabolic diseases among mennonite, tarahumara and mestizo adolescents from Chihuahua Mexico. 1155 teenage students from 12-18 years old were included. Blood pressure, anthropometric measures, fasting glucose, triglycerides and cholesterol HDL were obtained to detect Metabolic Syndrome (MS). 21% of total population were overweight or obese, predominantly in tarahumara and mestizo teenagers. In general, tarahumaras had higher risk to develop MS: greater overweight, abnormal triglycerides and HDL cholesterol levels. KEYWORDS: metabolic syndrome; adolescents, tarahumara; mennonite; mestizo

I. INTRODUCCIÓN urante las últimas décadas, la prevalencia del sobrepeso y obesidad en niños y adolescentes se ha incrementado sustancialmente a nivel mundial (1). En México, de acuerdo con los resultados de la Encuesta Nacional de Salud y Nutrición 2012 (ENSANUT 2012), se estima que el 35% de los jóvenes mexicanos presenta sobrepeso u obesidad; mostrando mayor incidencia en localidades urbanas (31.9% vs. 28.8%)(2). Esta situación se asocia con un aumento de riesgo para el desarrollo de enfermedades metabólicas y cardiovasculares en la vida adulta (3). El síndrome metabólico (SM) es una entidad integrada por la coexistencia de factores de riesgo cardiovasculares, principalmente: obesidad central, hipertensión arterial (HTA), niveles de triglicéridos elevados (TG), bajas concentraciones de colesterol unido a lipoproteínas de alta densidad (c-HDL) e intolerancia a la glucosa

D

58

www.conferenciasindromemetabolico.org

(4). Las enfermedades cardiovasculares y sus factores de riesgo afectan a todos los grupos étnicos, pero existen desigualdades entre los mismos (5). Actualmente se cuenta con poca información sobre su presentación en niños y adolescentes en los grupos étnicos en México. El objetivo del presente estudio es determinar la prevalencia de factores de riesgo relacionados con enfermedades metabólicas en adolescentes de las etnias Menonita, Tarahumara y Mestiza en el Estado de Chihuahua.

II. METODOLOGÍA Estudio de tipo observacional, retrospectivo, transversal y descriptivo. Participaron adolescentes de ambos sexos entre los 12 y 18 años de edad, pertenecientes a tres grupos étnicos principales del Estado de Chihuahua y que se encontraran

inscritos a instituciones educativas de carácter público. Se informó previamente sobre el estudio a las autoridades correspondientes de las instituciones, padres de familia y alumnos; se obtuvo consentimiento informado por escrito de los padres y/o tutores para la colaboración en el estudio. La obtención y recolección de datos fue mediante brigadas realizadas por un equipo multidisciplinario de SM en los siguientes municipios: Guachochi, Cuauhtémoc, Chihuahua, Carichí, Galeana y Casas Grandes durante el periodo 20092015. La presión arterial sistólica (PAS) y diastólica (PAD) fueron tomadas de acuerdo a normas universales. Los parámetros antropométricos captados fueron peso y talla para el cálculo del índice de masa corporal (IMC) y la medición de la circunferencia de cintura. Se recolectaron muestras de sangre venosa en ayunas para determinar la glucosa, colesterol total, triglicéridos y colesterol HDL. Se clasificó a cada individuo de acuerdo a las tablas de percentil para presión arterial, circunferencia abdominal e IMC, acorde a género, edad, peso y talla (6–8). En el procesamiento estadístico de

Grupo Multidisciplinario de Estudio de Síndrome Metabólico, Universidad Autónoma de Chihuahua


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

los datos se empleó un análisis de varianza con pruebas de Tukey y la prueba de chi-cuadrada de Pearson para evaluar la prevalencia del SM y sus factores de riesgo por grupo étnico (programa estadístico Minitab 16.0).

III. RESULTADOS El total de individuos incluidos en el estudio fue de 1155, de los cuales el 15.7% fueron menonitas, el 59.7% mestizos y el 24.7% tarahumaras. La edad media de la muestra fue 13.68 ± 1.48 años; el 89.7% de los adolescentes se encontraban entre los 12 y 15 años de edad, mientras que el 10.22% entre los 16 y 18 años. La distribución de los adolescentes según el IMC fue: peso bajo, 5.3%; peso normal, 73.6%; sobrepeso, 12.8% y obesidad, 8.4%. Se observó mayor frecuencia de sobrepeso en la etnia tarahumara (15.05%) y de obesidad en los mestizos (9.47%) (p<0.001). Por lo que, la medición de circunferencia abdominal resultó superior en los tarahumaras (p=0.013). Resulta importante destacar que los niveles altos de triglicéridos y las bajas concentraciones de c-HDL fueron mayores en los tarahumaras (p<0.001), así como niveles elevados de glucosa (p<0.001) en comparación con las dos etnias restantes. Se detectó HTA en el 31.6% de los individuos, con predominio en los jóvenes menonitas (PAS: p<0.001; PAD: p=0.012). En la figura 1, se muestra la prevalencia de SM en las etnias estudiadas, de acuerdo a criterios internacionales para el diagnóstico de SM

V3-N1 - 2016

en adolescentes. El diagnóstico de SM mostró predominio en los individuos tarahumaras aplicando los criterios del NCEP-ATP III de Cook (p=0.039). Sin embargo, de acuerdo a los criterios de la IDF y del NCEP-ATP III De Ferranti, no hubo diferencias significativas entre etnias.

factores de riesgo radica en la planeación de medidas preventivas para evitar las complicaciones a edad temprana y en la vida adulta.

IV. CONCLUSIONES La presencia del SM en los adolescentes chihuahuenses estudiados mostró una tendencia similar utilizando los criterios de la IDF y del NCEP-ATP III por De Ferranti. Por otro lado, de acuerdo a los propuestos por NCEP-ATP III de Cook se encontró mayor prevalencia en los jóvenes tarahumaras, los cuales presentaron más factores de riesgo para su desarrollo, predominantemente: sobrepeso, niveles anormales de triglicéridos y bajas concentraciones de c-HDL. Los menonitas manifestaron menores indicadores de riesgo metabólico, a excepción de la presión arterial; mientras los mestizos se observaron en un nivel intermedio entre las dos etnias restantes. La importancia de identificar los

V. BIBLIOGRAFÍA 1. Wang Y, Lobstein T. Worldwide trends in childhood overweight and obesity. Int J Pediatr Obes IJPO Off J Int Assoc Study Obes. 2006;1(1):11–25. 2. Oropeza Abúndez C, Instituto Nacional de Salud Pública (Mexico). Encuesta nacional de salud y nutrición 2012: resultados nacionales [Internet]. 2013 [citado el 6 de mayo de 2016]. Disponible en: http://ensanut.insp.mx/ informes/ENSANUT2012ResultadosNacionales2Ed.pdf 3. Franks PW, Hanson RL, Knowler WC, Sievers ML, Bennett PH, Looker HC. Childhood obesity, other cardiovascular risk factors, and premature death. N Engl J Med. el 11 de febrero de 2010;362(6):485–93. www.conferenciasindromemetabolico.org

59


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

4. Zimmet P, Alberti KGM, Kaufman F, Tajima N, Silink M, Arslanian S, et al. The metabolic syndrome in children and adolescents - an IDF consensus report. Pediatr Diabetes. octubre de 2007;8(5):299–306. 5. Martin L, Oepen J, Reinehr T, Wabitsch M, Claussnitzer G, Waldeck E, et al. Ethnicity and cardiovascular risk factors: evaluation of 40,921 normal-weight, overweight or obese children and adolescents living in Central Europe. Int J Obes 2005. enero de 2015;39(1):45–51. 6. National High Blood Pressure Education Program Working Group on High Blood Pressure in Children and Adolescents. The fourth report on the diagnosis, evaluation, and treatment of high blood pressure in children and adolescents. Pediatrics. agosto de 2004;114(2 Suppl 4th Report):555–76. 7. Fernández JR, Redden DT, Pietrobelli A, Allison DB. Waist circumference percentiles in nationally representative samples of African-American, European-American, and Mexican-American children and adolescents. J Pediatr. octubre de 2004;145(4):439–44. 8. Kuczmarski RJ, Ogden CL, Guo SS, Grummer-Strawn LM, Flegal KM, Mei Z, et al. 2000 CDC Growth Charts for the United States: methods and development. Vital Health Stat 11. mayo de 2002;(246):1–190.

60

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

VARIABILIDAD CIRCADIANA DE LA PRESIÓN ARTERIAL MEDIDA CON MAPA A MÉDICOS FAMILIARES ADSCRITOS AL HGR #1 C/MF CUERNAVACA MORELOS Aguilar-Hernández, Guadalupe3,Estrada-Nájera, Adrian1, León-Mazón, Marco Antonio2; De la O- Gómez, Faustino4 BACKGROUND. The MAPA allows a more complete assessment of patients and particularly to assess what is the behavior of your circadian blood pressure curve as it allows nighttime measurements. Objective. Identify circadian blood pressure variability in family physicians HGR # 1 c / MF. Material and methods. an observational, analytical, cross-sectional study. Results. Attended by 20 family physicians, the average age was 38.9 years, with a BMI of 25.19kg / m2. The average was 7:25 a.m. night’s sleep. MAPA registration in average systolic blood pressure 107.05mmHg, a diastolic blood pressure of 68.85mmHg, with a MAP of 81mmHg, pulse pressure 38.36mmHg a 75.1 lpm FC found. Conclusion. In this study it was found that the genetic load is a risk factor for developing high blood pressure by controlling what factors modifiable cardiovascular risk is suggested. The MAP enabled us to identify patients had decreases in BP higher than expected, which implies an added risk for cardiovascular events. KEYWORDS: MAPA (ambulatory blood pressure monitoring), circadian rhythm, blood pressure, body mass index (BMI).

I. INTRODUCCIÓN os ritmos biológicos forman parte de un proceso adaptativo al entorno, fundamental para la supervivencia de las especies. 1. En el cerebro, en la región ventral del hipotálamo anterior, se encuentran un par de núcleos supraquiasmáticos, situados por encima del quiasma óptico y que son el reloj circadiano principal en los mamíferos2. Durante las primeras horas de la mañana tienen lugar alteraciones fisiológicas, como el aumento de la presión arterial, la agregación plaquetaria y la secreción de catecolaminas3. Durante el sueño nocturno ocurre un descenso fisiológico de la presión arterial (PA) del 10% al 20% (patrón dipper). Cuando el des-

L

censo es menor del 10% (patrón non dipper), relacionado con una prevalencia mayor de daño de órgano blanco y eventos cerebrovasculares. En algunos casos, desciende de manera exagerada > 20% (patrón hiper dipper), que se re¬laciona con un riesgo mayor de eventos cerebrovasculares4. Según la Organización Mundial de Salud, las enfermedades cardiovasculares (ECV) son responsables

de 16,7 millones de muertes por año. Las proyecciones para 2020 mantienen estos daños como la principal causa de muerte e incapacidad5. Es preferible analizar la FC del período nocturno, que puede considerarse basal, se ha descrito un incremento del riesgo a partir de una FC media nocturna de 64 latidos por minuto, en pacientes sin patolo¬gías o fármacos que la alteren6. El MAPA permite realizar una evaluación más completa de los pacientes hipertensos y particularmente evaluar cuál es el comportamiento de su curva circadiana de la PA7. Las ventajas del MAPA. El registro de la PA durante las 24 horas permite mejorar el diagnóstico de la HTA, así como diagnosticar situaciones con implicancia pronóstica. Entre las desventajas: Un porcentaje su realización les genera molestias importantes y el

Médico Cardiólogo, HGR con Medicina Familiar No. 1, Cuernavaca, Morelos, Médico Familiar, Unidad de Medicina Familiar No. 3, Jiutepec, Morelos, 3 Médico Residente, HGR con Medicina Familiar No. 1, Cuernavaca, Morelos, 4 Médico Residente, HGR con Medicina Familiar No.1, Cuernavaca Morelos 1 2

www.conferenciasindromemetabolico.org

61


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

costo elevado8. Importancia pronóstica de la presión arterial ambulatoria. Desde hace más de 100 años, el método para el diagnóstico y control habitual de la presión arterial ha sido el esfigmomanómetro de mercurio. Progresivamente, se ha ido reconociendo que los valores de PA, así medidos, no representan fielmente la PA real, por lo cual existe un interés progresivo en el uso del MAPA, que al efectuar múltiples mediciones durante las 24 h, puede reflejar más exactamente la PA real de un paciente.9. II. MATERIAL Y MÉTODOS Tipo de estudio: transversal, analítico, observacional. Población, lugar y tiempo de estudio: Se seleccionaran todos los médicos familiares adscritos al HGR #1 c/MF, en los meses de diciembre 2015, enero y febrero 2016. Tipo de muestra y tamaño de la muestra: Se seleccionaron 20 médicos familiares sin enfermedades crónicas que aceptaron participar en el estudio a los cuales se les colocó un monitor exclusivamente por el investigador responsable quien fue capacitado para la colocación de este por el laboratorio Novartis. III. RESULTADOS En este estudio participaron 20 médicos familiares con edad promedio fue de 38.9 años con una desviación estándar (DS) de ± 7 años, con un índice de masa corporal de 25.19 con una DS de ±3.27. Los participantes refirieron tener antecedentes de hipertensión arterial por rama materna en 62

www.conferenciasindromemetabolico.org

un 45%, por rama paterna en un 10%, mientras que el 15% refirió tener a ambos padres con dicha enfermedad. El 10% refirió tener antecedentes de enfermedades coronarias tanto maternas como paternas. Se encontró que el 20% consumen bebidas alcohólicas. El 15% de los pacientes en estudio refirieron consumir cigarrillos. El 50% de los pacientes en estudio realizan algún tipo de actividad física. Así mismo el promedio de sueño nocturno fue de 7.25 h con una desviación estándar de ± 1.29. El registro del MAPA muestra un promedio de 24 h para una presión arterial sistólica (PAS) de 107.05mmHg con una DS de ± 8.21, una presión arterial diastólica (PAD) promedio de 68.85mmHg con una DS de ± 6.88, con una presión arterial media (PAM) de 81.25mmHg con una DS de ±7.17,

V3-N1 - 2016

un promedio de presión de pulso (PP) de 38.36mmHg con una DS de ±4.12 y una frecuencia cardiaca (FC) promedio de 75.1 latidos por minuto (lpm) con una DS de ± 7.1. En la siguiente gráfica se observa el comportamiento de la PAS durante las 24 h del día, se observa que presentan descensos fisiológicos (dipper) y dos descensos mayores del 20% (hiper dipper) lo que se relaciona con un incremento en el riesgo cardiovascular. En la gráfica 2, se observa el comportamiento de la PAD en el horario de las 24 h, hay un descenso en el mismo horario que la PAS. Los pacientes entran en la categoría de dipper, sin embargo se observa un descenso mayor del 20% (hiper dipper). En el análisis multivariado de la presión arterial media, observamos que los pacientes que tuvieron antecedente familiar de


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

hipertensión arterial aumentan en promedio 3.56 mmHg la PAM en comparación con los que no tienen antecedentes.

IV. CONCLUSIONES Se observó que los antecedentes familiares de HAS pueden aumentar el riesgo de padecer hipertensión. El MAPA nos permitió identificar aquellos pacientes que tuvieron descensos de la PA mayores a los esperados. Se sugieren cambios en el estilo de vida, el control de peso ya que esto puede contribuir a la disminución del IMC y con ello lograr una disminución de las cifras tensionales durante el día, para evitar eventos cardiovasculares a mediano y largo plazo y por lo tanto evitar que las enfermedades crónicas aparezcan a temprana edad.

V3-N1 - 2016

5. Veiga JTS, Veiga JPCB, Cunha AWE, Muniz SL, Veiga JS, Maria SC. Factores de riesgo cardiovasculares en cohorte de profesionales del área médica-15 años de evolución. Arq Bras Cardiol 2010;95(3):332-338. 6. Parra CJZ, Fonseca RS. Manual de Monitoreo Ambulatorio de la Presión Arterial. Novartis. 7. Vinyoles BE, De la Figuera VWM. ¿Cómo se interpreta una monitorización ambulatoria de presión arterial? FMC. 2011;18(5):264 8. Prieto DMA. guías en el manejo de la hipertensión. Semergen 2014;40(4):2-10 9. Contreras ZE, Zuluaga MSX. Monitoreo ambulatorio de presión arterial, revista mexicana de cardiología. 2010;21(1):25

V. REFERENCIAS BIBLIOGRÁFICAS 1. Ángeles CM, Rojas GA, Escobar C. De la frecuencia cardiaca al infarto. Cronobiología del sistema cardiovascular. Revista facultada de medicina UNAM.mayjun2009;52(3):117 2. Mendoza J. Neurobiología del sistema circadiano: su encuentro con el metabolismo. Suma psicológica,2009;16 (1):86. 3. Hernandes FE, Coelho D, Missel CJR, Kumpinski Daniel. Alteraciones circadianas del sistema cardiovascular, Revista Española de Cardiología 2000;53:117-118. 4. Sociedad Argentina de Cardiología, consenso de hipertensión arterial, revista argentina de cardiología.2013;81(2):5

www.conferenciasindromemetabolico.org

63


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

TRANSCENDENCIA DE SÍNDROME METABÓLICO COMO FACTOR DE RIESGO EN PACIENTES CON CÁNCER DE MAMA Rosales Rosales María Isabel1, Serrano Garzón Esther2, Gutiérrez Román Elsa Armida2, Infante Sedano Ana Cristina4. Guzmán Pantoja Jaime Eduardo2 I. INTRODUCCIÓN no de los canceres de mayor incidencia a nivel mundial es el de seno. Según la Organización Mundial de la Salud (OMS), cada año se detectan 1.38 millones de nuevos casos y fallecen 450 mil personas por esta causa. La tase de mortalidad para 2012 incremento de 15 a 100 mil mujeres. En México la magnitud del problema se estima en el año 2020 para las mujeres de más de 25 años el riesgo de cáncer de mama alcanzara a 1 de cada 3 mujeres. En tanto Jalisco es uno de los estados con mayor presencia de cáncer de mama (45.91 de cada 100 mil). Los factores de riesgo encontramos como factores convencionales que no se pueden modificar (nuliparidad, antecedentes de 1er grado en familiares de cáncer de mama, edad, lactancia y periodo fértil). Los factores emergentes son aquellos como la obesidad, sedentarismo, hábitos socioculturales. El síndrome metabólico por definición es una serie de anormalidades metabólicas, son considerados factor de riesgo para desarrollar diabetes y enfermedad cardiovascular. En la actualidad ha tomado gran importancia por su elevada prevalencia es del 21.8% en la población mundial y varia de 6.7% en el grupo de 20 a 40 años de edad a 43.5% en los

U

64

www.conferenciasindromemetabolico.org

mayores de 60 años, sin diferenciar por sexo. La International Diabetes Federación (2005) tomando en cuenta la necesidad de una definición universalmente aceptada establece nuevos criterios en los que la obesidad central constituye un registro indispensable para el diagnóstico de síndrome metabólico, sustentando en que este tipo de

obesidad es común para cada uno de los componentes del síndrome metabólico.

II. METODOLOGÍA Grupo de estudio serán divididos en 2 grupos. Grupo 1 pacientes con diagnóstico de cáncer de mama y síndrome metabólico

Residente tercer año en medicina familiar Unidad de Medicina Familiar N.51. Especialista en Medicina Familiar. 3 Residente primer año en medicina familiar unidad de medicina familiar N.51. 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Grupo 2 paciente con diagnóstico de cáncer de mama y ausencia de síndrome metabólico. La recolección de datos se llevara a través del instrumento de recolección de datos electrónica inicial en el programa Excel versión 2010. El formato para análisis electrónico de la base de datos final será procesado por medio de software para análisis estadístico SPSS versión 20.0 prueba para Windows. Se realizara análisis descriptivo, se efectuara inferencia estadística mediante OR entre la variable dependiente e independiente.

III. RESULTADOS Se obtuvo una muestra de 68 pacientes, de los cuales 10 se eliminaron por no cumplir los criterios de inclusión, quedando un total de

58 pacientes con diagnóstico de cáncer de mama. Análisis descriptivo se obtuvo: Análisis inferencial Se encontró que las pacientes con diagnóstico de Cáncer de mama tienen 3.571 de riesgo para síndrome metabólico. El 2.096 presenta un riesgo para desarrollar hipercolesterolemia en síndrome metabólico en pacientes con cáncer de mama. Así mismo las pacientes con cáncer de mama tienen 2.733 de riesgo para desarrollar hipertrigliceridemia en síndrome metabólico.

Se encontró que las pacientes con cáncer de mama con perímetro abdominal >80 cm tienen 2.387 de riesgo para desarrollar síndrome metabólico.

V3-N1 - 2016

La presencia de diabetes mellitus en las pacientes con cáncer de mama tiene un 7.878 de riesgo para desarrollar síndrome metabólico, se encontró que el descontrol de la glucosa en pacientes con cáncer de mama presenta un riesgo de 3.571 para síndrome metabólico. La hipertensión arterial en pacientes con cáncer de mama se obtuvo un 2.452 de riesgo para desarrollar síndrome metabólico, además se analizó el descontrol de la hipertensión arterial tiene .333 de riesgo para desarrollar síndrome metabólico en pacientes con cáncer de mama. Los factores de alcoholismo, tabaquismo, nuliparidad y hormonales, no fueron significativos. IV. CONCLUSIONES El síndrome metabólico es un factor de riesgo para cáncer de mama donde es importante cuidar a nuestras pacientes antes de un diagnóstico de cáncer de mama, así como prevenir para el desarrollo de esta patología en las pacientes ya con diagnóstico. Encontramos que la presencia de diabetes mellitus en pacientes de cáncer de mama es de 1.7% de riesgo, en cambio en nuestro análisis encontramos un riesgo más alto de 7.8. La presencia de hipertensión arterial así como su descontrol es un factor predisponente para el desarrollo de síndrome metabólico en las pacientes con cáncer. En la literatura se menciona que la presión diastólica puede influir para la aparición de cáncer de mama, en nuestro resultados no encontramos diferencias entre www.conferenciasindromemetabolico.org

65


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

presión sistólica y diastólica. La presencia de descontrol de colesterol y triglicéridos pueden ser un factor de riesgo para desarrollo de síndrome metabólico en las pacientes con cáncer de mama. La evaluación de síndrome metabólico y la vinculación con el cáncer de mama, permite como médicos de primer nivel tomar medidas preventivas para que pueda influir favorablemente sobre la recurrencia del cáncer de mama.

V. BIBLIOGRAFÍA I. AGUILAR CORDERO, M.ª J. et al. Factores de riesgo como pronóstico de padecer cáncer de mama en un estado de México. Nutr. Hosp. [online]. 2012, vol.27, n.5, pp. 1631-1636. ISSN 0212-1611. II. Romero Figueroa María del Socorro, Santillán Arreygue Leopoldo. “Frecuencia de factores de riesgo de cáncer de mama”. Ginecol Obstet Mex 2008; 76 (11): 667-72. ISSN-0300-9041. III. Lizarzaburu Robles Juan Carlos; “Metabolic síndrome: concept and practical application”. An Fac med. 2013; 74 (4): 315-20 IV. Ortiz Mendoza Carlos Manuel, De la Fuente-Vera Tania Angélica. “Obesidad y componentes del síndrome metabolico en mujeres mexicanas supervivientes al cáncer”; Rev Med Inst Mex Seguro Soc. 2014; 52 (5): 588-93 V. Herrera González Norma Estela, Pantoja Gómez Gabriel. “Sedentarismo, obesidad y cáncer de mama: factores de riesgo para una vía común”. Rev Esp Med Quir 66

www.conferenciasindromemetabolico.org

2014;19:251-257. Volumen 19. Núm. 2, abril- junio 2014. VI. Basilio Francisco, Berg Gabriela; “Relación entre el cáncer de mama y el síndrome metabólico”. Revista de Endocrinología Ginecología y Reproductiva. Pág. 13-18. VII. Vargas- Hernández Víctor Manuel, Moreno- Eutimio Mario Adán. “Resistencia a la insulina, síndrome metabolico, diabetes mellitus y carcinogénesis mamaria”. Rev Hosp Jua Mez 2014; 81(1): 37-49.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PARTICIPACIÓN DE LA CICLOOXIGENASA-1 EN EL DAÑO VASCULAR RENAL EN UN MODELO EXPERIMENTAL DE DIABETES. UN ANÁLISIS DE LA EVOLUCIÓN DE LA DIABETES Dra. Patricia Castro-Moreno1, M.C. Víctor Manuel Eroza Aparicio2, Dr. Maximiliano Ibarra Barajas1 ABSTRACT: Diabetes is a worldwide health problem, it is a metabolic disorder that leads to multiple changes, such as enzymatic modifications, micro, macrovascular complications and renal failure. Cyclooxygenase-1 (COX1) is the rate limiting enzyme in prostanoids synthesis from arachidonic acid, which regulate the tone of the vascular wall, but their synthesis and function are altered during diabetes. The aim was determine whether COX-1 is involved in the deterioration of renal vascular function during evolution of diabetes. We used male Wistar rats 200-250 g, diabetes was induced with streptozotocin (STZ), rats were kept free evolution for 1, 2 and 4 weeks. The glycemia in each group and the vasopressor effect to phenylephrine in the presence and absence of a specific COX-1 inhibitor in isolated kidney from control rats and STZ 1, 2 and 4 weeks were determined. STZ rats showed hyperglycemia (> 500 mg / dl) 72h post-induction until the end experiment. Hyperglycemia increased renal mass index. The perfusion pressure (p.p) to phenylephrine decreased in diabetic rat kidneys (1 week) increased at 2 weeks and was unchanged at 4 weeks. The specific COX-1 inhibition decreased contraction to phenylephrine in control kidneys, while in diabetic kidney was increased to 1 week of hyperglycemia. In control kidneys two weeks, selective COX-1 inhibition did not modified vasopressor effect to phenylephrine, but it increased in diabetic kidneys. At 4 weeks, the inhibition of the enzyme did not affect contractile response to phenylephrine in control kidneys, but slight decrease in phenylephrine-induced effect in diabetic kidneys was observed. The data suggest that at early stages of diabetes, COX-1 participates in the release of vasodilator prostanoids which opposes the increase in perfusion pressure in the kidney, due to damage to the vasculature by hyperglycemia. However, in advanced stages of diabetes the mechanism is reversed and metabolites from COX-1 appear to contribute to increased tone vascular renal. PALABRAS CLAVE: Diabetes, Estreptozotocina (STZ), Daño vascular renal, ciclooxigenasa-1.

I. INTRODUCCIÓN a diabetes es una de las mayores emergencias de salud global del siglo 21. Esta patología se refiere a un padecimiento de etiología heterogénea asociada a un desorden metabólico, se identifica por hiperglicemia crónica, resultado de la deficiencia y/o defecto de la acción de la insulina, desbalance del metabolismo de carbohidratos, lípidos y proteínas (Crane et al. 2013,Kirke et al. 2014,Lee et al. 2014).

L

Los niveles elevados de glucosa en la sangre pueden conducir a enfermedades graves que afectan al corazón, los vasos sanguíneos y los riñones. Siendo la diabetes la principal causa de la enfermedad cardiovascular y renal. La enfermedad renal crónica (nefropatía); es causada por el daño a los vasos

sanguíneos pequeños, lo que puede hacer que los riñones sean menos eficientes, o fallen en conjunto (IDF_Atlas 2015). El daño renal crónico durante la diabetes tiene múltiples mecanismos que contribuyen a su progreso, como genes de alta susceptibilidad, las citocinas (TGF-β1), el estrés oxidativo, la angiotensina II y los cambios hemodinámicos renales (Dronavalli et al. 2008, Ziyadeh 2004), estos últimos comprenden la activación de sistemas vasoactivos como el sistema renina angiotensina, el aumento de la actividad de la vía de las ciclooxigenasas, lo que aumenta la presión sistémica e intraglomerular y favorece el daño renal. La vía de las ciclooxigenasas incluye las isoformas COX-1 y COX-2, enzimas limitantes en la ruta oxidativa del ácido araquidónico que, producen la prostaglandina H2, el precursor de los prostanoides primarios como el tromboxano y la prostaciclina (Smith et al. 2000, Thuresson et al. 2001). En el riñón los prostanoides participan como moduladores fisiológicos de la hemodinámica microvascular, li-

Unidad de Biomedicina. Facultad de Estudios Superiores Iztacala. Universidad Nacional Autónoma de México, Tlalnepantla, Estado de México. 2 Escuela de Posgrado en Sanidad Naval. Universidad NAVAL.Ciudad de México. 1

Proyecto financiado por PAPIIT IN221615 y FESI-DIP-PAPCA 2014-37

www.conferenciasindromemetabolico.org

67


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

beración de renina, reabsorción de sal, agua tubular y mantenimiento del flujo sanguíneo (Harris 2000, Harris 2006). La actividad de las COX´s aumenta por alteraciones del volumen intravascular (Harris 2006), sus metabolitos se han relacionado con alteraciones estructurales y funcionales en enfermedad inflamatoria glomerular y tubulo-interstical (Dinchuk et al. 1995, Feng et al. 1993, Klahr y Morrissey 1998, Langenbach et al. 1995, Morham et al. 1995). La síntesis de las prostaglandinas se incrementa en la inflamación, en los estados patológicos como la DM, el síndrome metabólico, la hipertensión, por tanto son mediadores locales del daño celular y orgánico (Harris 2000). Por ello en este trabajo investigamos el papel de la COX-1 en la desregulación del tono vascular intrarrenal durante la diabetes, ya que existe controversia si existe o no alteración de la COX-1 en el riñón durante la diabetes. Fang y colaboradores en 1997 no reportan diferencias en la expresión de mRNA de COX-1 en el riñón, pero si en otros órganos como retina ocular, lo que demuestra que los cambios de mRNA de la COX-1 en ratas diabéticas son órganos específicos y sugiere que las alteraciones en el metabolismo de prostanoides puede, en parte, explicarse por alteración en la expresión de COX1 (Fang et al. 1997). De la misma manera, en un estudio realizado en cultivos de macrófagos provenientes de pacientes diabéticos no se encuentran diferencias en la expresión del mRNA de COX-1 68

www.conferenciasindromemetabolico.org

(Verma et al. 2015). Aunque si se ha reportado alteraciones en la expresión de la proteína COX-1 en diferentes zonas del riñón (Kotnik et al. 2005). De manera interesante, Zhu en 2014 demostró en arterias aortas y renales de ratones diabéticos, que la COX-1 es un importante contribuyente a la síntesis de prostaciclina (PGI2) endotelial, lo que provoca actividad vasoconstrictora durante la diabetes. Así, la deficiencia de COX-1 previene o atenúa la hipertensión en ratones diabéticos (Zhu et al. 2014). II. METODOLOGÍA Se utilizaron ratas Wistar macho de 200-50g, se indujo la diabetes con una dosis única de estreptozotocina 65mg/kg (Sigma S.A) vía intraperitoneal (I.P). Se permitió la evolución de la diabetes (1, 2, 4 semanas). A los grupos control se administró el vehículo (amortiguador de citratos 50mM, pH de 4.5). Después de 72 horas de la inducción y al final de cada tiempo se midió la glucosa en sangre. Sólo las ratas con valores de glucosa >400 mg/dl se consideraron diabéticas. Al final de cada tiempo, las ratas se anestesiaron con pentobarbital sódico (60 mg/kg I.P.), y través de una laparotomía abdominal, se realizó una disección en planos para aislar el riñón derecho y se perfundió, con solución de Krebs por la arteria renal. La presión de perfusión (P.P.), se estabilizó y se construyó una curva a fenilefrina (0.031-100 nmoles). En otro riñón se construyó la curva a fenilefrina en presencia del inhibidor selectivo de la COX-1 (SC560 3.1x10-7M

V3-N1 - 2016

Cayman®). Al final los riñones se pesaron y se calculó el índice de masa renal.

III. RESULTADOS Las ratas inducidas con STZ presentaron hiperglicemia (500mg/ dl) desde las 72 horas. Durante la hiperglicemia de 1 semana, la presión de perfusión a fenilefrina disminuye respecto a las ratas normoglicémicas, quizá por un mecanismo que favorece le respuesta vasodilatadora frente a un estimulo contráctil. Fenómeno que puede mediado por los productos sintetizados por la COX-1. A las 2 semanas de diabetes la respuesta a fenilefrina en riñón se incrementó y a las 4 semanas no se modificó. Al inhibir selectivamente la COX1 en los riñones normoglicémicos correspondientes a 1 semana disminuyó considerablemente la p.p, lo que puede ser explicado por la liberación de prostanoides vasoconstrictores, mientras en riñones de ratas diabéticas parece haber un mecanismo opuesto, donde se liberan prostanoides vasodilatadores, ya que la inhibición de la COX-1 incrementa la respuesta a fenilefrina. En ratas de dos y cuatro semanas de diabetes la inhibición de COX-1 provocó un desplazamiento de la curva a la izquierda, lo que indica la participación de prostanoides liberados de la isoforma COX-1. IV. CONCLUSIONES Los datos sugieren que en etapas tempranas de la diabetes, la COX-1 parece participar en la liberación de prostanoides vasodilatadores


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

que se opone a mecanismos que incrementan la presión de perfusión en el riñón, quizá por el daño producido en la vasculatura del órgano por la hiperglicemia. Sin embargo en etapas avanzadas de la diabetes el mecanismo se revierte y los metabolitos provenientes de COX-1, ahora contribuye al daño renal crónico.

V. REFERENCIAS 1. Crane J.M., Murphy P., Burrage L. et al. (2013). «Maternal and perinatal outcomes of extreme obesity in pregnancy.» J Obstet Gynaecol Can35(7): 606-611. 2. Dinchuk J.E., Car B.D., et al (1995). «Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II.» Nature378(6555): 406-409. 3. Dronavalli S., Duka I. y Bakris G.L. (2008). «The pathogenesis of diabetic nephropathy.» Nat Clin Pract Endocrinol Metab4(8): 444452. 4. Fang C., Jiang Z. y Tomlinson D.R. (1997). «Expression of constitutive cyclo-oxygenase (COX-1) in rats with streptozotocin-induced diabetes; effects of treatment with evening primrose oil or an aldose reductase inhibitor on COX1 mRNA levels.» Prostaglandins Leukot Essent Fatty Acids 56(2): 157-163. 5. Feng L., Sun W., Xia Y., et al (1993). «Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression.» Arch Biochem Biophys307(2): 361-368. 6. Harris R.C. (2000). «Cyclooxygenase-2 in the kidney.» J Am Soc Nephrol11(12): 2387-2394.

7. Harris R.C. (2003). «Interactions between COX-2 and the renin-angiotensin system in the kidney.» Acta Physiol Scand177(4): 423427. 8. Harris R.C. (2006). «COX-2 and the kidney.» J Cardiovasc Pharmacol47 Suppl 1: S37-42. 9. Imig J.D. (2006). «Eicosanoids and renal vascular function in diseases.» Clin Sci (Lond)111(1): 21-34. 10. International Diabetes Federation. IDF Diabetes, 7 ed. Brussels, Belgium: International Diabetes Federation, 2015. http://www. diabetesatlas.org 11. Kirke A.B., Evans S.F. y Walters B.N. (2014). «Gestational diabetes in a rural, regional centre in south Western Australia: predictors of risk.» Rural Remote Health14(3): 2667. 12. Klahr S. y Morrissey J.J. (1998). «The role of growth factors, cytokines, and vasoactive compounds in obstructive nephropathy.» Semin Nephrol18(6): 622632. 13. Kotnik P., Nielsen J., Kwon T.H., Krzisnik C., Frokiaer J. y Nielsen S. (2005). «Altered expression of COX-1, COX-2, and mPGES in rats with nephrogenic and central diabetes insipidus.» Am J Physiol Renal Physiol 288(5): F1053-1068. 14. Langenbach R., Morham S.G., et al(1995). «Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration.» Cell83(3): 483-492. 15. Lee J.H., Jin M., et al (2014). «Diet control to achieve eugly-

V3-N1 - 2016

cemia induces significant loss of heart and liver weight via increased autophagy compared with ad libitum diet in diabetic rats.» Exp Mol Med46: e111. 16. Morham S.G., Langenbach R., et al (1995). «Prostaglandin synthase 2 gene disruption causes severe renal pathology in the mouse.» Cell83(3): 473-482 17. Smith W.L., DeWitt D.L. et al (2000). «Cyclooxygenases: structural, cellular, and molecular biology.» Annu Rev Biochem69: 145182. 18. Thuresson E.D., Lakkides K.M., et al. (2001). «Prostaglandin endoperoxide H synthase-1: the functions of cyclooxygenase active site residues in the binding, positioning, and oxygenation of arachidonic acid.» J Biol Chem276(13): 10347-10357. 19. Zhu N., Liu B., Luo W., Zhang Y., Li H., Li S. y Zhou Y. (2014). «Vasoconstrictor role of cyclooxygenase-1-mediated prostacyclin synthesis in non-insulin-dependent diabetic mice induced by high-fat diet and streptozotocin.» Am J Physiol Heart Circ Physiol 307(3): H319-327.

www.conferenciasindromemetabolico.org

69


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

SÍNDROME METABÓLICO EN DERECHOHABIENTES DE 25 A 50 AÑOS DE EDAD ADSCRITOS AL HOSPITAL GENERAL REGIONAL No. 1 DE CUERNAVACA MORELOS De la O-Gómez Faustino1, Toledano-Jaimes Cairo David2, Reyes-Medina Omar3, Martínez-Martínez Mónica Viviana4 ABSTRACT. Metabolic syndrome is considered an important element in the current epidemic of diabetes and cardiovascular diseases due to morbidity and premature mortality that could generate complications and unbalancing, the health budgets of many developed countries or developing such as if Mexico. In this context and through prospective population studies have shown that the presence of metabolic syndrome in no diabetic increases twice the risk of cardiovascular disease and five times the risk of developing diabetes compared with people without the syndrome. This paper shows the results of an investigation conducted in 2015, to determine the frequency of metabolic syndrome in patients of 25 to 50 years of the UMF-No. 1 IMSS of Cuernavaca, Morelos. KEY WORDS: Metabolic Syndrome

I. INTRODUCCIÓN l síndrome metabólico es considerado un elemento importante en la epidemia actual de diabetes y de enfermedades cardiovasculares, debido a la morbilidad y mortalidad prematuras que pudieran generar sus complicaciones, desequilibrando así, los presupuestos sanitarios de muchos países desarrollados o en vías de desarrollo como es el caso de México. En este contexto y a través de estudios poblacionales prospectivos se ha demostrado que la presencia de síndrome metabólico en personas no diabéticas incrementa dos veces el riesgo de enfermedad cardiovascular y cinco veces el riesgo de desarrollar diabetes en comparación con personas sin este síndrome.1,2,3 En pleno siglo XXI las enfermedades cardiovasculares, diabetes mellitus y la obesidad son algu-

E

70

www.conferenciasindromemetabolico.org

nos de los principales problemas de salud pública.4,5 En el mundo cada cuatro segundos ocurre un infarto agudo de miocardio y cada cinco segundos un evento vascular cerebral, eventos que pueden ser considerados consecuencias del síndrome metabólico a largo plazo, por lo que el síndrome metabólico es un trastorno complejo con un alto costo socioeconómico.6,7 El presente estudio tuvo con objetivo general identificar la frecuencia de síndrome metabólico en derechohabientes de 25 a 50 años que acuden a la consulta de medicina familiar de la UMF No. 1 de Cuernavaca, Morelos.

II. METODOLOGÍA El estudio realizado fue de tipo descriptivo, transversal, de 180 derechohabientes de 25 a 50 años, aparentemente sanos, que acudieron a la consulta de Medicina Familiar, durante el periodo julio – septiembre del 2015, previa solicitud al comité de ética y firma de consentimiento informado por la población participante. Se utilizó un cuestionario para obtener datos personales, mediciones somatométricas, estudios bioquímicos, alimentación y actividad física, determinando el perfil de síndrome metabólico de los derechohabientes seleccionados de acuerdo a los criterios de la Federación Internacional de Diabetes y el Panel III de Tratamiento de Adultos del Programa Nacional de Educación sobre el Colesterol. Se realizó un análisis descriptivo de los resultados y se calcularon diferencias estadísticas a través de la prueba T de Student y Chi cuadrado.

Maestro en Ciencias Biomédicas, Médico Cirujano, Residente de Medicina Familiar. Hospital General Regional /MF No. 1 IMSS. Cuernavaca Morelos. 2 Profesor investigador, Facultad Farmacia Universidad Autónoma del Estado de Morelos. Cuernavaca, Morelos. 3 Ingeniero Bioquímico. Instituto Tecnológico de Zacatepec. Zacatepec de Hidalgo, Morelos. 4 Profesor Titular de la Especialidad de Medicina familiar. Hospital General Regional /MF No. 1. Cuernavaca Morelos. 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

III. RESULTADOS La población final estudiada estuvo conformada por 180 pacientes de los cuales 41.11% fueron hombres y 58.89% mujeres, con una media de edad de 35.67 ± 7.71 años. La frecuencia de síndrome metabólico fue del 15.56%. Los componentes del síndrome metabólico identificados reportaron una frecuencia mayor de circunferencia abdominal (49.44%), hipertrigliceridemia (25.56%) y cifras elevadas de presión arterial (15.56%). IV. CONCLUSIONES La frecuencia de síndrome metabólico en la población estudiada fue menor a lo reportado en otras UMF del IMSS del país, e incrementó en pacientes con dieta no saludable y sedentarismo. La identificación temprana de factores de riesgo podría modificar el desarrollo de enfermedad cardiovascular aterosclerótica y diabetes por lo que se requieren estudios de investigación subsecuentes. V. BIBLIOGRAFÍA 1. GARCÍA-GARCÍA, E., LA LLATA-ROMERO, D., KAUFERHORWITZ, M., TUSIÉ-LUNA, M. T., CALZADA-LEÓN, R., VÁZQUEZ-VELÁZQUEZ, V.,& SOTELO-MORALES, J. (2008). La obesidad y el síndrome metabólico como problema de salud pública: Una reflexión. Salud pública de México, 50(6), 530-547. 2. GRUNDY, S. M. (2006). Metabolic syndrome: connecting and reconciling cardiovascular and diabetes worlds. Journal of the

V3-N1 - 2016

American College of Cardiology, 47(6), 1093-1100. 3. ROJAS-MARTÍNEZ, R., AGUILAR-SALINAS, C. A., JIMÉNEZ-CORONA, A., GÓMEZ-PÉREZ, F. J., BARQUERA, S., & LAZCANO-PONCE, E. (2012). Prevalence of obesity and metabolic syndrome components in Mexican adults without type 2 diabetes or hypertension. salud pública de méxico, 54(1), 7-12. 4. FERNÁNDEZ-BERGÉS, D., CONSUEGRA-SÁNCHEZ, L., PEÑAFIEL, J., CABRERA DE LEÓN, A., VILA, J., FÉLIX-REDONDO, F. J., & MARRUGAT, J. (2014). Metabolic and Inflammatory Profiles of Biomarkers in Obesity, Metabolic Syndrome, and Diabetes in a Mediterranean Population. DARIOS Inflammatory Study. Revista Española de Cardiología (English Edition). 5. FERNANDEZ-BERGES D, FELIX-REDONDO FJ, LOZANO L, PEREZ-CASTAN JF, SANZ H, et al. (2011) [Prevalence of metabolic syndrome estimated with the new World Health Organization recommendations. The HERMEX study. Gac Sanit 25:519–524. 6. GRAU M, ELOSUA R, CABRERA DE LEON A, GUEMBE MJ, BAENA-DIEZ JM, et al. (2011) [Cardiovascular risk factors in Spain in the first decade of the 21st Century, a pooled analysis with individual data from 11 population-based studies: the DARIOS study]. Rev Esp Cardiol 64: 295–304. 7. KASSI E, PERVANIDOU P, KALTSAS G, CHROUSOS G (2011) Metabolic syndrome: definitions and controversies. BMC Med 9: 48. www.conferenciasindromemetabolico.org

71


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

DETERMINACIÓN DEL FACTOR DE RIESGO CARDIOVASCULAR Y NIVELES DE ADIPOCITOCINAS EN JÓVENES UNIVERSITARIOS CON SOBREPESO Y OBESIDAD Mederos-Torres C1, 2, Uvalle- Navarro RL1, 2, 2, Díaz-Burke Y2, García-Zápien AG2, Viveros-Paredes JM2, Barrón-Castillo R2 Hernández-Herrera C2, Pérez-Martínez I3 y López-Roa RI2 ABSTRACT. Metabolic syndrome (MetS) is the joint of risks factors that predisposes the development of cardiovascular disease (CVD). Currently, this pathology has increased among young people. Obesity is a main triggering for the MetS. The purpose of this work was to identify the young students with an increased cardiovascular risk (CVR) and those with MetS, quantify the different cytokines that may contribute in the development of those pathologies and finally to determine associations between cytokines and each parameter that defines MetS. Methodology: the sample consists of 67 students between 18 and 25 years old with BMI≥25 kg/m2. Anthropometric measures were taken along with a blood sample. For the determination of cardiovascular risk (CVR), we used the Triglyceride/HDL ratio (TG/HDL). It was established as a high CVR ≥2.5 for women and ≥3.5 for men. The levels of proteins PAI-1, leptin, resistin and visfatin were quantified using ELISA technique, with the kit Bio-Plex Pro™. Results: the prevalence of cardiovascular risk in the studied population is 68.6%, CVR was higher in women than men. We found significantly higher levels of PAI-1 in the group with MetS. By correlating the levels of PAI-1 with each MetS parameters, it was found a meaningful association among PAI-1 levels and the waist circumference, r=0.4634, p<0.0001****. PALABRAS CLAVE: factor de riesgo cardiovascular, síndrome metabólico, adipocitocinas, jóvenes universitarios, obesidad y sobrepeso.

I. INTRODUCCIÓN l síndrome metabólico (SM), es un conjunto de todos los factores de riesgo que predisponen al desarrollo de enfermedades cardiovasculares (ECV), como el infarto al miocardio y los accidentes cerebrovasculares. Se sabe que las personas con SM aumentan dos veces la probabilidad de desarrollar una ECV (1). Actualmente las ECV, son la principal causa de muerte en el mundo y se ha observado una tendencia a su aumento en población joven (2). La obesidad es uno de los principales desencadenantes del SM, recientemente varios grupos de investigación reconocen a los

E 72

www.conferenciasindromemetabolico.org

individuos jóvenes entre 18-25 años como un “grupo vulnerable” por sus estilos de vida poco saludables que conducen al sobrepeso y la obesidad (3,4). Por otro lado, dentro de lo los parámetro descritos por la ATPIII para el diagnóstico del SM se encuentran el estado pro-trombótico como uno de los principales disparadores de las ECV y que se correlaciona con los niveles de la proteína inhibidora del plasminógeno-1 (PAI-1) y por otro lado, un estado pro-inflamatorio resultado del desequilibrio entre adipocitocinas anti-inflama-

torias como la leptina, la resistina y pro-inflamatorias como la visfatina(5). Por lo anterior en este trabajo nos propusimos identificar a los jóvenes universitarios con un mayor riesgo cardiovascular (RCV) así como aquellos con SM, cuantificar los diferentes mediadores solubles que contribuyen en el desarrollo de estas patologías y finalmente determinar asociaciones significativas entre los diferentes mediadores solubles con cada una de las variables que definen al SM.

II. METODOLOGÍA La muestra consistió en 67 estudiantes de la licenciatura en Químico Farmacobiólogo del CUCEI de la Universidad de Guadalajara, previa firma del consentimiento informado. El rango de edad de la población de estudio fue de 18 a 25 años con un IMC≥25 kg/m2. Se les tomaron las medidas antropométricas así como una muestra de sangre con un ayuno de 12 horas para la obtención de suero. Para la determinación del RCV, utilizamos el índice Triglicéridos/ HDL- colesterol (TG/HDL) que es un recurso de fácil determinación y ha demostrado ser un predictor

Posgrado en Ciencias Médicas, Universidad de Colima; Departamento de Farmacobiología CUCEI, Universidad de Guadalajara; 3 Facultad de Ciencias Químicas, Universidad de Zacatecas. 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

independiente de eventos cardiovasculares, se establecieron como factor de RCV elevado ≥2.5 y ≥3.5 para mujeres y hombres respectivamente. Para el diagnóstico del SM se tomaron los parámetros establecidos por la ATPIII, los individuos se clasificaron en dos grupos con SM y sin SM. Los niveles de las proteínas: PAI-1, leptina, resistina, y visfatina se determinaron mediante ELISA en la plataforma Multiplex, con el kit Bio-Plex Pro™ Diabetes Assays (BIO-RAD). La estadística descriptiva fue reportada como promedio ± desviación estándar y analizada con la prueba t-student para datos paramétricos y de U-Mann Whitney para datos no paramétricos. Para los ensayos de correlación utilizamos la prueba no paramétrica de Spearman.

pocitocinas, en donde predomina un ambiente proinflamatorio en el grupo con SM. Al correlacionar los niveles de PAI-1 con los diferenres parámetros del SM, encontramos una asociación significativa entre los niveles de PAI-1 y la circunferencia de cintura, r=0.4634, p <0.0001****.

IV. CONCLUSIONES • Encontramos una prevalencia de RCV elevado del 68.6%, siendo más frecuente esta condición en las mujeres, lo que las predispone desde edades tempranas al desarrollo de alguna ECV. • Encontramos un aumento significativo de los niveles de PAI1 en el grupo con SM, lo que com-

V3-N1 - 2016

prueba que el componente aterogénico se encuentra exacerbado en el grupo de jóvenes con SM. • Encontramos una tendencia al desequilibrio entre las adipocitocinas pro y anti-inflamatorias en el grupo de jóvenes con SM. • Encontramos una correlación directa y significativa de los niveles de PAI-1 con la obesidad abdominal (CA). Este componente del SM puede ser revertido con un cambio de hábitos saludables (dieta y ejercicio), lo que puede disminuir también el RCV. V. BIBLIOGRAFÍA 1. Cornier M-A, Dabelea D, Hernandez TL, Lindstrom RC, Steig AJ, Stob NR, et al. The metabolic

III. RESULTADOS La prevalencia combinada del RCV en la población estudiada fue del 69%, el RCV elevado fue más frecuente en mujeres que en hombres.

Nosotros encontramos niveles significativamente elevados de PAI1 en el grupo de individuos con SM. Existe una tendencia al desbalance en la concentración de adiwww.conferenciasindromemetabolico.org

73


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

syndrome. Endocr Rev. diciembre de 2008;29(7):777–822. 2. González-Gómez FJ, Pérez-Torre P, DeFelipe A, Vera R, Matute C, Cruz-Culebras A, et al. Stroke in young adults: Incidence rate, risk factors, treatment and prognosis. Rev Clin Esp. el 10 de junio de 2016; 3. Poobalan A, Aucott L. Obesity Among Young Adults in Developing Countries: A Systematic Overview. Curr Obes Rep. marzo de 2016;5(1):2–13. 4. Poobalan AS, Aucott LS, Precious E, Crombie IK, Smith WCS. Weight loss interventions in young people (18 to 25 year olds): a systematic review. Obes Rev Off J Int Assoc Study Obes. agosto de 2010;11(8):580–92. 5. Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults. Executive Summary of The Third Report of The National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, And Treatment of High Blood Cholesterol In Adults (Adult Treatment Panel III). JAMA. el 16 de mayo de 2001;285(19):2486–97.

74

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CORRELACIÓN DEL ÍNDICE DE ADIPOSIDAD VISCERAL CON LOS DATOS DE DISTRIBUCIÓN CORPORAL OBTENIDOS MEDIANTE EL SISTEMA DE ABSORCIOMETRÍA DE RAYOS X DE ENERGÍA DUAL LN. Martínez Muñoz Ilse Yessabel1, QFB. Correa Padilla Trinidad1, PhD Santillán Benítez Jonnathan Guadalupe3, PhD Camarillo Romero María del Socorro2, Dra. Domínguez Zárate Gemma1, PhD Montenegro Morales Laura Patricia1, PhD Camarillo Romero Eneida del Socorro1, PhD Garduño García José de Jesús1,4 ABSTRACT Background: The aim of the study was to correlate the visceral adiposity index (VAI) with different types of adipose tissue and lean mass measured by dual-energy X ray absorptiometry (DXA). Methods: A prospective cross-sectional research, VAI was calculated in a young women sample, at the same time body composition was assessed by using DXA. Results: 40 women, 18±.55 years with 23.66±.3.55 Kg/m2 were included, the VAI main value was .80±.57. Body fat composition and VAI was correlated statistically significance. Conclusion: VAI is a visceral adipose tissue subrogated indicator that could be useful for clinical practice. KEYWORDS: visceral adipose tissue, visceral adiposity index

I. INTRODUCCIÓN n México el 83% de las mujeres adultas presentan obesidad abdominal, estando presente en 6 de cada 10 mujeres de entre 20 y 29 años (1). El exceso en la acumulación de tejido adiposo visceral está ligada al riesgo cardiovascular aumentado, síndrome metabólico y diabetes tipo 2 (2), siendo el principal responsable de los mecanismos que contribuyen a la presencia de resistencia a la insulina, perfil aterogénico e hipertensión arterial sistémica incluso en personas con peso normal (3). Algunos de los métodos para la cuantificación del tejido adiposo visceral son la tomografía computalizada, la resonancia magnética y la absorciometría de rayos X de energía dual (DXA), los cuales son los estándares de oro, no obstante, su uso en la práctica clínica e investigación científica es limitado (3, 4).

E

Por otra parte, recientemente se dio a conocer al VAI, el cual es una fórmula matemática para estimar la disfunción de la adiposidad visceral asociada al riesgo cardiometabólico (5) y ha sido considerado como el mejor indicador subrogado para su medición (6) con adecuado valor clínico predictivo del síndrome metabólico (7). El objetivo del presente estudio fue correlacionar el VAI con diferentes tipos de tejido adiposo y masa muscular determinados a través del sistema DEXA. II. METODOLOGÍA Diseño de estudio y Sujetos del estudio: Estudio transversal y prospectivo en el cual se incluye-

ron a mujeres jóvenes, con una edad comprendida entre 18 y 20 años, pertenecientes a la Universidad Autónoma del Estado de México. No incluimos a mujeres embarazadas, fumadoras o con previo diagnóstico de enfermedades crónico degenerativas. Mediciones: Se realizaron las mediciones antropométricas con una previa estandarización, obteniendo estatura, peso corporal y circunferencia de cintura. Se midió la presión arterial considerando el promedio de dos mediciones. Biomarcadores: Con ayuno previo de 12 horas, se recolectaron 10 ml de sangre por venopunción. Posteriormente, se determinó la concentración de glucosa, triglicéridos, colesterol total, colesterol HLD, colesterol LDL y triglicéridos. Cálculo del VAI: El VAI fue determinado utilizando el modelo matemático establecido para mujeres el cual es el siguiente: VAI= [ { (CC) / (36.58) + (1.89 X IMC) } X (TG/0.81) X (1.52/HDL) ] *CC: Circunferencia de cintura;

Centro de Investigación en Ciencias Médicas, Universidad Autónoma del Estado de México, Cuerpo Académico Salud del Universitario 2 Centro de Investigación en Ciencias Médicas, Universidad Autónoma del Estado de México, Cuerpo Académico Biomedicina 3 Facultad de Química de la Universidad Autónoma del Estado de México 4 Hospital General Regional No. 251 Instituto Mexicano del Seguro Social 1

www.conferenciasindromemetabolico.org

75


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

IMC: Índice de masa corporal expresado en Kg/m2; TG: Triglicéridos expresados en mmol/L; HDL: Colesterol HDL expresado en mmol/L Determinación de Composición Corporal: Se determinó la composición corporal, a través del sistema DXA con el equipo de Densitometría Ósea-Lunar de marca General Electric Healthcare MR, con el mínimo de ropa y sin objetos metálicos portados, con la indicación de inhalar y mantener la respiración unos segundos para limitar el movimiento al tomar la imagen. Implicaciones éticas: Se consideró la declaración de Helsinki, así como los preceptos de la Ley General de Salud en Materia de Investigación para la Salud. Es un proyecto aprobado por del Comité de Ética e Investigación del CICMED y se obtuvo la carta de IV. CONCLUSIONES El VAI es un indicador subrogaconsentimiento informado. do del tejido adiposo visceral que puede ser utilizado en la práctica III. RESULTADOS Se enrolaron a 40 mujeres con clínica. El presente estudio deuna edad promedio de 18±.55 muestra que existe una buena coraños y un índice de masa corpo- relación del Índice de adiposidad ral de 23.66±.3.55 Kg/m2. Las ca- visceral con la distribución grasa racterísticas basales se describen de mujeres jóvenes, obtenida meen la tabla 1. Se calculó en VAI y diante uno de los estándares de se obtuvo un valor promedio de oro para la medición de la compo.80±.57. Existe una correlación es- sición corporal. Además de ser un tadísticamente significativa entre indicador de fácil acceso que toma el VAI y los componentes corpo- en cuenta componentes antroporales de distribución grasa como métricos y bioquímicos. se muestra en la tabla 2. V. BIBLIOGRAFÍA 1. Encuesta Nacional de Salud y Nutrición 2012 Resultados Nacionales México2012 [cited 2015 28 de agosto]. Available from: 76

www.conferenciasindromemetabolico.org

V3-N1 - 2016

http://ensanut.insp.mx/doctos/ ENSANUT2012_Nutricion.pdf 2. Farb MG, Gokce N. Visceral adiposopathy: a vascular perspective. Hormone molecular biology and clinical investigation. 2015;21(2):125-36. 3. Du T, Yu X, Zhang J, Sun X. Lipid accumulation product and visceral adiposity index are effective markers for identifying the metabolically obese normal-weight phenotype. Acta Diabetologica. 2015;52(5):855-63. 4. Direk K, Cecelja M, Astle W, Chowienczyk P, Spector TD, Falchi M, et al. The relationship between DXA-based and anthropometric measures of visceral fat and morbidity in women. BMC Cardiovascular Disorders. 2013;13(1):1-13.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

5. Amato MC, Giordano C, Galia M, Criscimanna A, Vitabile S, Midiri M, et al. Visceral Adiposity Index: A reliable indicator of visceral fat function associated with cardiometabolic risk. Diabetes Care. 2010;33(4):920-2. 6. Chen C, Xu Y, Guo Z-r, Yang J, Wu M, Hu X-s. The application of visceral adiposity index in identifying type 2 diabetes risks based on a prospective cohort in China. Lipids in health and disease. 2014;13(1):1-8. 7. Bozorgmanesh M, Hadaegh F, Azizi F. Predictive performance of the visceral adiposity index for a visceral adiposity-related risk: Type 2 Diabetes. Lipids in health and disease. 2011;10(1):1-9.

www.conferenciasindromemetabolico.org

77


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

LA FUNCIÓN DE LA CÉLULA BETA EN FAMILIARES DE PRIMER GRADO DE PACIENTES CON DIABETES TIPO 2 Ricardo Pérez-Fuentes1,2, Mauricio Rosano Barragan1 Guadalupe Ruiz-Vivanco1,2,3, Enrique Torres-Rasgado1, M. Elba Gonzalez-Mejia1, Leonardo M. Porchia2, Blanca G. Báez-Duarte1 RESUMEN. Introducción: Estudios previos sugieren que la progresión a partir de una tolerancia normal a la glucosa a una diabetes tipo 2 (DT2) franca, podría asociarse a un deterioro gradual de la función de la célula β. Objetivo: Evaluar la función de la célula β por medio del modelo Homeostasis Model Assessment (HOMAβ), y de sensibilidad a la insulina (HOMAIR) y correlacionar con parámetros metabólicos, antropométricos y clínicos en 136 individuos en riesgo de DT2. Resultados.136 individuos se clasificaron en 7 grupos. G1 Normales, G2, Hiperinsulinémicos (HI) G3, HI Hipertrigliceridémicos: HOMAIR<3.8; G4, Resistentes a la insulina (RI): HOMAIR >3.8;G5; Prediabéticos: (PTGO >140 <200 mg/dL)G6; Dx reciente DT2 y G7 DT2 (NOM 015). Evaluación de la función HOMAβ. En G1,2,3 y 4 se encontró incremento progresivo de la función,(HOMAβ) Comparados con G1, G2 presentan aumento de HOMAβ=p<0.001), sin RI (HOMAIR= 2.73+0.48), disminuyendo en el G3, con HI sin RI (HOMAIR=2.88+0.45). El nivel más alto se observa en el G4 (HOMAβ (591.29+401.05) (p<0.001) y RI (HOMAIR=7.32+4.72), la función, declinó en G5, (HOMAβ=166.58+121.29 (p<001) G6 HOMAβ=145.61+96.15) asociado a RI (HOMAIR=8.29+4.65) (p=0.0001), y G7 HOMAβ =120.45+120.56) (p=0.001), (HOMAIR=8.42+8.41) (Fig. 1) Conclusiones. Considerados en conjunto los resultados sugieren que el deterioro progresivo de la función de la célula β en FPG-PD, se caracteriza inicialmente por hiperfunción de la célula β (HOMAβ) la cual eventualmente declina asociado a incremento a la resistencia a la insulina (HOMAIR) que conduce a la aparición de disglicemia en sujetos en riesgo de DT2 KEYWORDS. Type 2, diabetes, HOMAβ, HOMAIR

I. INTRODUCCIÓN a diabetes tipo 2 (DT2) se caracteriza fundamentalmente por un deterioro progresivo, casi inevitable del control metabólico, lo cual conduce eventualmente al desarrollo de complicaciones vasculares crónicas (1,2), que condicionan la calidad de vida del paciente diabético y representan una onerosa carga para las instituciones de salud (3). Defectos en la función de la célula β y disminución a la sensibilidad de las actividades biológicas de la insulina, son las alteraciones fisiopatológicas principales, responsables del deterioro progresivo del control

L 78

www.conferenciasindromemetabolico.org

metabólico en el paciente diabético (4). La presencia de disfunción de la célula β, definida como la pérdida de la capacidad secretora de insulina en respuesta a las concentraciones extracelulares de glucosa, ha sido claramente identificada en los pacientes diabéticos (5). De hecho, uno de los hallazgos más importantes del estudio United Kingdom Prospective Diabetes Study (UKPDS) fue la confirmación de la naturaleza progresiva de la DT2 que conduce al paciente diabético al deterioro del control

glucémico a pesar del empleo de fármacos antidiabéticos inicialmente eficaces (6). Este deterioro del control metabólico se encontró asociado a una declinación de la función de la célula β, sin cambios apreciables en la sensibilidad a la insulina (7). Similares observaciones se encontraron en el Belfast Diet Intervention Study (BDI-S), en el cual el deterioro progresivo del control glucémico estuvo asociado a un deterioro progresivo de la función de la célula β (8).Por otra parte estudios clínicos posteriores realizados en diferentes grupos étnicos han establecido que la progresión a partir de una tolerancia normal a la glucosa a una diabetes tipo 2 franca resulta de un deterioro gradual de la función de la célula β en presencia de resistencia a la insulina (9). Asimismo, se ha observado que al momento de realizar el diagnóstico de DT2, los sujetos presentan una función β-celular disminuida hasta un 50% acompañada de una reducción de la masa de células β, comparados con individuos sanos no diabéticos (10). Estos datos sugieren que el inicio de la disfunción de la célula β que conduce a descontrol metabólico

1Facultad de Medicina, BUAP, 2Laboratorio de Investigación en Fisiopatología de Enfermedades Crónicas, CIBIOR, IMSS. 3Doctorado en Ciencias Biológicas, UATx


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

en el paciente diabético, podría no solamente ser esencial en la progresión de la DT2, sino que podría estar presente muchos años antes del diagnóstico de la enfermedad y ser determinante en los eventos que preceden a la pérdida de la homeostasis de la glucosa que condiciona la aparición de la DT2. La identificación temprana en sujetos en riesgo, de alteraciones tempranas en la función de la célula β podrían ofrecer alternativas de tratamiento oportuno y específico que permitan incidir sobre la evolución de la enfermedad en sujetos en riesgo (11). Partiendo de la premisa de que la DT2 es un continuum, que ofrece un rasgo hereditario, la hipótesis de trabajo propone que la disfunción progresiva de la célula β, ocurre de manera temprana en individuos en riesgo de DT2. II. SUJETOS Y MÉTODOS Estudio transversal, prospectivo que incluyó familiares en primer grado de pacientes diabéticos (n=136) rango 15-62 años, Caracterización clínica. Se evaluaron clínica, antropométrica y Bioquímicamente: Prueba de tolerancia a la glucosa oral (PTGO) niveles de insulina y glucosa en ayuno (GA), índice de HOMAIR y HOMA , hemoglobina glucosilada (Hb1Ac), colesterol HDL, LDL, TGC: La Función de la célula β; HOMA beta y HOMA-IR evaluadas por el modelo HOMAβ =insulina de ayuno>11μU/dL y HOMAβ >100% (28, 29). HOMA–IR<3.8 (27, 28). Estadística. Se realizó con el programa SPSS 11, Chicago, IL),dife-

rencias entre grupos se evaluaron con ANOVA y t de Student. La Correlación simple se estimó con el coeficiente de correlación de Pearson. El nivel de significancia estadística p<0.05.

III. RESULTADOS De acuerdo con las evaluaciones 136 individuos se clasificaron en 7 grupos. G1 Normales, (n=35, edad 32.43+9.67 años. G2, Hiperinsulinémicos (HI) (n=11, 29.79+8.19 años);G3, HI Hipertrigliceridémicos: (n=21, 34.05+7.22 años) (IMC > 30), PC > 90 cm; HOMAIR < 3.8;G4, Resistentes a la insulina (RI): (n=29, 32.38+8.98 años) HOMAIR >3.8;G5 Prediabéticos: (n=26, 43.23+9.20 años (PTGO >140 <200 mg/dL)G6: Dx reciente DT2: (n=13, 47.46+10.8 años)NOM-015; G7 DT2 (n=46, 56.87+12.09 años). Evaluación de la función HOMAβ. En los G 1, 2, 3 y 4 se encontró incremento progresivo de la función,(HOMAβ) Comparados con G1, G2 presentan aumento de HOMAβ=p<0.001), sin RI (HOMAIR= 2.73+0.48), disminuyendo en el G3, con HI sin RI (HOMAIR=2.88+0.45) con aumento significativo de triglicéridos (p=0.003).El nivel más alto de la función se observa en el G 4 (HOMAβ (591.29+401.05) (p<0.001) y RI (HOMAIR=7.32+4.72), el incremento de la función, declinó en G 5, 6 y 7) (Fig 1). En G5 disminuyó significativamente (HOMAβ=166.58+121.29 (p<001) continuando G 6 HOMAβ=145.61+96.15) asociado a RI (HOMAIR=8.29+4.65) (p=0.0001)

V3-N1 - 2016

G7 HOMAβ =120.45+120.56) (p=0.001), (HOMAIR=8.42+8.41) (Fig 1) IV. CONCLUSIONES En el presente estudio se muestra que la evaluación de la función de la célula β en sujetos en riesgo y la identificación temprana de alteraciones en la función de la célula B, podrían permitir monitorear la progresión de la enfermedad y facultar el desarrollo el desarrollo de estrategias de prevención temprana, pertinentes y específicas en poblaciones en riesgo de la DT2. Asimismo respecto al debate sobre si la RI precede a la hiperinsulinemia o si ésta precede a la RI en el desarrollo de la enfermedad, con los datos obtenidos en este estudio se muestra que la hiperinsulinemia se presenta con mucha antelación a la presentación de la RI.

V. BIBLIOGRAFÍA 1. The DCCT. Research Group: The effect of intensive diabetes treatment on the development and progression of long-term complications in insulin-dependent diabetes mellitus: the Diabetes Control and Complications Trial. N Engl J Med. 1993;329:977-986. 2. Zimmet P, Albertti KGMM, Shaw J. Global and Societal Implications of the Diabetes Epidemic. Nature 2001;414:782-787. 3. Wild S, Roglic G, Green A, Sicree R, King H. Global Prevalence of Diabetes: Estimates for the Year 2000 and Projections for 2030. Diabetes Care 2004; 27(5):10471053. 4. Gerich JE. Contributions www.conferenciasindromemetabolico.org

79


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

of Insulin-Resistance and Insulin Secretory Defects to the Pathogenesis of Type 2 Diabetes Mellitus. Mayo Clin Proc. 2003;78:447-56. 5. Kahn SE. The importance of the beta-cell in the pathogenesis of type 2 diabetes mellitus. Am J Med. 2000;108 Suppl 6a:2S-8S. 6. U.K. prospective diabetes study 16. Overview of 6 years’ therapy of type II diabetes: a progressive disease. U.K. Prospective Diabetes Study Group. Diabetes. 1995;44(11)1258. 7. Mattews DR, Cull CA, Stratton IM, Colman RR, Turner RC. UK Prospective Diabetes Study (UKPDS) Group. UKPDS 26: Sulphonylurea Failure in Non-Insulin-Dependent Diabetic Patients Over Six Years. Diabet Med 1998;15:297303. 8. Levy J, Atkinson AB, Bell PM, McCance DR, Hadden DR. Beta-cell deterioration determines the onset and rate of progression of secondary dietary failure in type 2 diabetes mellitus: the 10-year follow-up of the Belfast Diet Study. Diabet Med. 1998;15(4):290-296. 9. Jensen CC, Cnop M, Hull RL, Fujimoto WY, Kahn SE; American Diabetes Association GENNID Study Group. Beta-cell function is a major contributor to oral glucose tolerance in high-risk relatives of four ethnic groups in the U.S. Diabetes. 2002;51(7):2170-2178. 10. Bohannon NJ. Treating dual defects in diabetes: insulin resistance and insulin secretion. Am J Health Syst Pharm. 2002;59 Suppl 9:S9-13 11. Pimenta W, Korytkowski M, Mitrakou A, Jenssen T, Yki-Jar80

www.conferenciasindromemetabolico.org

vinen H, Evron W, Dailey G, Gerich J Pancreatic beta-cell dysfunction as the primary genetic lesion in NIDDM. Evidence from studies in normal glucose-tolerant individuals with a first-degree NIDDM relative. JAMA. 1995;273(23):18551861.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

MEDICIÓN POR ECOGRAFÍA BASADO EN RADIOFRECUENCIA DEL GROSOR INTIMA MEDIA CAROTIDEO Y SU CORRELACIÓN CON FACTORES DE RIESGO CARDIOVASCULAR Y COMORBILIDADES EN PACIENTES CON AMPUTACIÓN DE MIEMBRO INFERIOR SECUNDARIO A NECROBIOSIS DIABÉTICA Alavéz Santiago Dalila1, Zavala Ramírez Juana2, Sahagún Olmos Roberto Carlos3, Hernández Díaz Cristina4, Ferrusquia Toriz Diana Laura5, Gutiérrez Marwin5, Ruiz Hurtado María del Carmen6, Dergal Carreto Maria de Lourdes6, Sanjuan Rivas Luis Jesús7 ABSTRACT. Introduction: Cardiovascular disease (CVD) is the leading global cause of death, and diabetes (DM) is one of its major risk factors; lower limb amputation (LEA) is about 10 times higher for diabetic than for nondiabetic individuals. Carotid intima-media thickness (cIMT) is a surrogate marker of CVD, and this can be increased in subjects with DM and LEA. There are no published studies that evaluate cIMT, risk factors and comorbidities in this population. Purpose: Evaluate carotid intima-media thickness, risk factors and comorbidities in patients with lower limb amputation secondary to diabetic foot. Design: Descriptive, cross-sectional study, non-probabilistic sampling. Methods: We recruited 40 patients with LEA secondary to diabetic foot treated in the cardiac rehabilitation program at the National Institute of Rehabilitation; 5 were excluded. Medical history, cIMT and biochemical parameters were obtained. An exploratory analysis for the detection of capture errors was performed on the database, its integrity was assessed and a descriptive analysis of the variables was performed. Results: Of the 35 patients included, 11.4% (n = 4) were female, aged 61.83 ± 9.1 years old, 77.1% (n = 27) with amputation above the knee, 32.1 ± 40.5 months of amputation after DM diagnosis, an average of 700.14 ± 1780.33µ of cIMT was recorded; 97.1% (n = 34) were former smokers, 65.7% (n = 23) with hypertension, 48.6.7% (n = 17) with dyslipidemia, 45.7% (n = 16) in chronic kidney disease stage 2 and most were either overweight or obese 60% (n = 21). Conclusions: About 37% of the patients had increased thickness in this sample, according to the conventional parameters, however, there are no values reported for the radio-frequency based measurements, so the results may be underestimated. It is necessary to continue the study, increasing the sample size and female sex representation and control values with this method to obtain more conclusive results. It is necessary to continue the study, increasing the sample size and the values of female representation and control with this method for more conclusive results. KEYWORDS: diabetes mellitus, amputación, carotid intima-media thickness, cardiovascular risk factors.

I. INTRODUCCIÓN as enfermedades cardiovasculares son la principal causa de muerte en los países occidentales (1) y la diabetes (DM) es una de sus principales factores de riesgo; la amputación de las extremidades inferiores (AEI) es aproximadamente 10 veces mayor para los diabéticos que en personas no diabéticas (2). La base común de este grupo de enfermedades es la ateroesclerosis, un proceso inflamatorio-degenerativo crónico producido por la acumulación de lípidos, células inflamatorias, que se produce en las arterias se tamaño medio y grande, que se caracteriza por engrosamiento asimétrico de la íntima (3-5). Los factores de riesgo cardiovascular (CV) son aquellos signos biológicos, estilos de vida o hábitos adquiridos que indican una mayor predisposición, de modo independiente de enfer-

L

Médico Especialista en Medicina de Rehabilitación, Alta Especialidad en Rehabilitación Cardiaca, Hospital General de Alta Especialidad. Médico Especialista en Medicina de Rehabilitación, M.A. de Hospitales y Salud Publica, Servicio de Rehabilitación Cardiaca 3 Médico Especialista en Medicina de Rehabilitación, Alta Especialidad en Rehabilitación Cardiaca, Maestría en Ciencias Médicas, División de Rehabilitación Geriátrica y Cardiorrespiratoria. 4 Laboratorio de Ultrasonido Musculoesquelético y Articular, Médico Especialista en Reumatología, Maestría en Ciencias Médicas 5 Dirección de Investigación. 6 Médico Especialista en Medicina de Rehabilitación, En curso de Alta Especialidad en Rehabilitación Cardiaca, INR 7 Médico Especialista en Cardiología Clínica, Instituto Nacional de Rehabilitación. 1 2

www.conferenciasindromemetabolico.org

81


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

mar, son Diabetes Mellitus tipo 2 (DM2), Hipertensión Arterial Sistémica (HAS), dislipidemia, obesidad, sedentarismo y tabaquismo, comorbilidades, estadio de la función renal, hiperuricemia y antecedente de enfermedad coronaria (6). Existen procedimientos de imagen vascular no invasivos como medida sustitutiva de desarrollo de la enfermedad ateroesclerótica siendo uno el Grosor Intima Media (GIM) carotideo útil para identificar a los pacientes con alto riesgo CV, siendo este un método seguro, no invasivo y validado (3,7). La presencia de placas y grado de estenosis se caracterizan de acuerdo con el consenso de Mannheim en 2006, en donde la enfermedad de arteria carotidea se clasifico en 4 categorías: 1. GIM <0.9mm, 2 GIM >0.9mm, 3. presencia de placas en la arteria carotidea que condicione estenosis menos del 50 % y 4. Presencia de placas carotideas con estenosis mayor al 50% (8). Con niveles por arriba del valor límite, los factores de riesgo pueden progresar de manera exponencial la aparición de la enfermedad cardiovascular (9,10). La HAS, DM2 y alteración en los lípidos juegan diferentes papeles en la formación de la placa y el desarrollo de la enfermedad CV. Se ha descrito que los pacientes con DM2 muestran un aumento significativo del GIM carotídeo (11), se ha confirmado el impacto de los múltiples factores de riesgo CV en diferentes grupos de población (12,13).

82

www.conferenciasindromemetabolico.org

II. OBJETIVO Evaluar la existencia de una correlación entre el GIM carotídeo por ecografía basado en radiofrecuencia con factores de riesgo CV y comorbilidades en pacientes con amputación de miembro inferior secundario a necrobiosis diabética. III. METODOLOGÍA Se incluyeron individuos con amputación de miembro inferior secundario a necrobiosis diabética que acudieron a la consulta externa del servicio de rehabilitación cardiaca del Instituto Nacional de Rehabilitación (INR), se realizó recolección de datos para obtener historia clínica, datos sociodemográficos, factores de riesgo CV y comorbilidades. Se realizó la medición del grosor intima media carotidea por Ecografía basado en radiofrecuencia. Es un Estudio transversal y de correlación; el muestreo se realizó de manera no probabilística y de casos consecutivos; se analizaron las bases de datos para valorar su integridad y pertinencia de los registros, se realizó estadística descriptiva y se resumió la información en tablas y gráficos; para analizar la correlación entre variables continuas se utilizó el coeficiente de correlación de Pearson y para valorar la influencia global de los factores de riesgo cardiovascular en las variables dependientes GIM carotidea, se utilizó un modelo de regresión lineal múltiple, con estrategia hacia atrás. Se contrastaron medias entre Grosor íntima media sexo, nivel de amputación,

V3-N1 - 2016

y comorbilidades. Se utilizó rango intercuartílico para establecer el tiempo de evolución de la amputación. Análisis de varianza de una vía utilizando ANOVA donde no se encontró diferencia estadísticamente significativa entre los factores de riesgo y comorbilidades y la medición del Grosor intima media carotidea.

IV. RESULTADOS Se reclutaron 35 individuos, cuyas características sociodemográficas fueron; 88.6% (n=31) del sexo masculino; escolaridad primario en un 25.7% (n=9) y un 11.4% (n=4) con nivel licenciatura; 54.3% (n=19) eran desempleados. En cuanto a características de la enfermedad; el lado de amputación que predomino fue el izquierdo con un 54% (n=19) y solo 2 con amputación bilateral; un 77% (n=27) presentaron un nivel de amputación por arriba de rodilla, 20% (n=7) por debajo de rodilla y solo uno tipo Syme; en cuanto a las comorbilidades y factores de riesgo observados 65.7% (N=23) tenían Hipertensión Arterial Sistémica, 48% (n=17) dislipidemia, 97.1% (n=34) sedentarios y un 80% (n=28) eran fumadores. El estadio de la función renal de acuerdo a la KDO que predomino fue estadio 1 y 2 en un 45.7 %(n=16) y 31.4% (n=11) respectivamente. De acuerdo al Índice de Masa Corporal predominaron clasificación normal 40% (n= 14) y sobrepeso 42.9 % (n= 15). Se encontró una correlación con una r=0.668 y una p= 0.00 con significancia estadística para perímetro abdo-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

minal e Índice de Masa Corporal, perímetro abdominal y frecuencia cardiaca basal con r =0.522 y una p=0.001, se observó una r=0.483 y p=0.004 entre Tensión Arterial Sistólica basal y niveles séricos de Triglicéridos. El rango intercuartilico para el tiempo de evolución de la amputación fue de 22 meses, medianas de; glucosa sérica de 112 mg/dL, creatinina sérica 1.0mg/ dL, VLDL sérico de 24.7 mg/dL, triglicéridos séricos de 120mg/dL respectivamente. Las mediciones de Grosor intima media carotidea fue mayor en las mujeres y de estas el lado derecho tuvo una media de 748.82µ, mientras que para los hombres una media de 677µ. V. CONCLUSIONES Las mediciones del Grosor intima media carotidea fue mayor del lado derecho. No se encontró una relación estadísticamente significativo entre los factores de riesgo cardiovascular, comorbilidades y la medida del Grosor intima media carotidea. Falta representatividad del sexo femenino, falta control de pacientes sanos y aumento del tamaño de la muestra para hacer más representativo los resultados y tener mayor rigor científico. VI. BIBLIOGRAFÍA 1. World Health Organizattion, Global Atlas on cardiovascular disease prevention and control. Ginebra: OMS; 2011. 2. Ziegler-Graham K, MacKenzie EJ, Ephraim PL, Travison TG, Brookmeyer R. Estimating the prevalence of limb loss in the United States: 2005 to 2050. Arch Phys

Med Rehabil. 2008;89(3):422-9. 3. Grau M, Subirana I, Agis D, Ramos R, Basagaña x, Martí R, et al. Carotid intima-media thickness in the Spanish population: reference ranges and association with cardiovascular risk factors. Rev Esp Cardiol, 2012; 65(12):108693. 4. Van den Oor, S, Sijbrands E, L. ten Kate G, Van Klaveren D, Van Domburg R, F.W. van der Steen A, F.L. Schinkel, A. Carotid intima-media thickness for cardiovascular risk assessment: Systematic review and meta-analysis. Atherosclerosis xxx ,2013; 1e11 5. Diaz A. Fisiopatología de la ateroesclerosis. Acta Neurol Colomb 2010; 26(2): 4-15. 6. O´Donnell CJ, Elosua R. Cardiovascular risk factors. Insights from Framingham Heart Study. Rev Esp Cardiol 2008; 61(3):299310. 7. Barth J, An update on carotid ultrasound measurement of intima-media thickness. Am J Cardiol;21, 2002;89, 4, (1): 32–38 8. Lijie R, Jingjing C, Jie L, Weiping L, Zhonghua S. Impact of Cardiovascular Risk Factors on Carotid Intima-Media Thickness and Degree of Severity: A Cross-Sectional Study PLOS ONE, 4, 2015 9. Niu L, Zhang Y, Qian M, Meng L, Xiao Y, Wang Y, Liu X, Zheng R, Zheng H. Impact of Multiple Cardiovascular Risk Factors on Carotid Intima-Media Thickness and Elasticity PLoS One 2013; 8(7). 10. Kannel WB, Contributions of the Framingham Study to the conquest of coronary arte-

V3-N1 - 2016

ry disease. Am J Cardiol. 1988; 15;62(16):1109-12 11. Yapei Y, Xiaoyan R, Sha Z, Li P, Xiao M, Shuangfeng C, Lexin W, Lianqun C. Clinical Significance of Arterial Stiffness and Thickness Biomarkers in Type 2 Diabetes Mellitus: An Up-To-Date Meta-Analysis. Med Sci Monit 2015; 21:2467-2475 12. Yuan C, Lai CW, Chan LW, Chow M, Law HK, Ying M., Cumulative effects of hypertension, dyslipidemia, and chronic kidney disease on carotid atherosclerosis in Chinese patients with type 2 diabetes mellitus. J Diabetes Res 2014. 13. Simon A, Megnien JL, Chironi G. The value of carotid intima-media thickness for predicting cardiovascular risk. Arterioscler Thromb Vasc Biol. 2010; 30(2):182-5.

www.conferenciasindromemetabolico.org

83


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EL POLIMORFISMO 894G>T EN EL GEN NOS3 Y SU RELACIÓN CON PREHIPERTENSIÓN EN POBLACIÓN GUERRERENSE QBP. Barrientos Noriega Rubén1, LN. Astudillo López Constanza C1, Dra. Parra Rojas Isela1, Dr. Muñoz Valle José Fco2, Dra. García Zapién Alejandra Gpe3, Dr. Salgado Goytia Lorenzo1, QBP. Salgado Bernabé Aralia B1 ABSTRACT. Vasorelaxation is impaired during prehypertension. The most important vasodilator endothelium, nitric oxide is produced by an enzyme encoded in gene NOS3. The NOS3 894G> T polymorphism can alter nitric oxide production and thus increase blood pressure. Objective. Assess whether the 894G> T polymorphism in eNOS gene, is associated with prehypertension in population of the State of Guerrero. Methodology. They were selected 109 cases with SBP 120- 139 mmHg and/ or DBP 80- 89 mmHg and 271 controls with SBP <120 and DBP <80 mmHg, all with age range 18-30 years, originating in the State of Guerrero. They were genotyped by PCR-RFLP. Results. In analyzing the genotype frequencies between groups, significant differences between genotypes G/G and G/T (p <0.05) and allele frequencies were observed in T allele was associated with prehypertension (OR = 2.654, 95% CI 1.386 - 5.052; p = 0.001). Conclusion. Individuals carrying the T allele polymorphism 894G>T have increased risk of hypertension. PALABRAS CLAVE: Polimorfismo genético, 894G>T, eNOS, gen NOS3, prehipertensión.

I. INTRODUCCIÓN l 50% de muertes a nivel mundial es atribuida a el incremento de la presión arterial entre 115-140 mmHg, denominada prehipertensión (Williams et al., 2009). En México, se ha reportado una prevalencia de prehipertensión del 37.5% (Rodríguez-Ramírez et al., 2015). En el Estado de Guerrero, la prevalencia de prehipertensión fue de 26.5%, según lo reportado por GuzmánGuzmán et al. (2013). La prehipertensión es una fase preclínica, en la que los individuos presentan una presión arterial sistólica entre 120 y 139 mmHg y/o una presión arterial diastólica entre 80 y 89 mmHg, favoreciéndose así un mayor riesgo para desarrollar hipertensión (Pickering et al., 2005). La prehipertensión ha sido relacionada con daño a órganos,

E

84

www.conferenciasindromemetabolico.org

tales como hipertrofia ventricular izquierda, aterosclerosis temprana y calcificación arterial coronaria (Bajpai et al., 2014; Pletcher et al., 2008). Además, conlleva a la disfunción endotelial, debido a que la capacidad de reparación endotelial in vivo por las células progenitoras de endotelio se encuentra alterada, incrementando la senescencia celular del endotelio y disminuyendo así la producción del óxido nítrico (Giannotti et al., 2010). El óxido nítrico (ON) es un radical libre endógeno, importante en la homeostasis vascular (Forstermann & Munzel, 2006). Fisiológicamente, regula la vasorelajación de endotelio, además participa en la eliminación de radi-

cales superóxido y en la inhibición de: agregación plaquetaria, adhesión leucocitaria y proliferación de las células musculares lisas (Ignarro et al., 1987; Benjamin et al., 1991; Kubes et al., 1991). La enzima óxido nítrico sintasa endotelial (eNOS) sintetiza al óxido nítrico a partir de L-arginina. El gen que codifica a la eNOS se localiza en 7q36 e incluye 26 exones, abarcando 21 kb del genoma (Marsden et al., 1993). Actualmente, hay más de 1,450 polimorfismos validados en la base de SNP (NCBI, 2016). De ellos, el SNP 894G>T en el gen NOS3, es el más estudiado en la asociación con hipertensión. El SNP 894G>T (exón 7) ocasiona la sustitución de ácido glutámico (Glu) por ácido aspártico (Asp) en la posición 298 de la eNOS. En células endoteliales y de corazón en humanos, se ha demostrado que la proteína eNOS que contiene Asp, está sujeta a escisión proteolítica, produciéndose dos fragmentos proteicos (Tesauro et al., 2000), provocando así la reducción de la biodisponibilidad de la enzima eNOS catalíticamente activa (Casas et al., 2006). El propósito de este estudio es evaluar si el polimorfismo 894G>T en el gen de la eNOS, está asociado con

Laboratorio de Investigación de Obesidad y Diabetes. U.A.C.Q.B. Universidad Autónoma de Guerrero. Chilpancingo, Guerrero. 2 Departamento de Biología Molecular y Genómica, C.U.C.S. U. de Guadalajara, Jalisco 3 Departamento de Farmacología. C.U.C.E.I.U. de Guadalajara, Jalisco 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

la prehipertensión en población tió de 109 individuos casos y 271 guerrerense. controles. Al comparar ambos grupos, el género, presión sistólica, II. METODOLOGÍA diastólica, IMC, glucosa, colesterol En este estudio de casos y y triglicéridos, mostraron diferencontroles, participaron 380 indi- cias estadísticamente significatividuos originarios del Estado de vas (p <0.05) (Tabla 1). Guerrero, entre 18 y 30 años de En la población, para el polimoredad. De acuerdo a los criterios fismo 894G>T se presentaron los del JNC7 (Pickering et al., 2005), se genotipos G/G y G/T con una freseleccionaron 109 casos con PAS cuencia del 90 y 10%, respecti120- 139 mmHg y/o PAD 80- 89 vamente. Las frecuencias alélicas mmHg y los 271 controles con PAS fueron 95 y 5%, para el alelo G y <120 y PAD <80 mmHg. Mediante T, respectivamente. Al analizar las la técnica de Miller modificada, se frecuencias genotípicas y alélicas les extrajo ADN de sangre periféri- entre grupos, se observaron dica, se determinaron las concentra- ferencias significativas entre los ciones séricas de colesterol total, genotipos G/G y G/T (p<0.05), y triglicéridos y glucosa. La geno- el alelo T se asoció con la prehitipificación se realizó mediante pertensión (RM= 2.654, IC 95% PCR-RFLPs, cada reacción de PCR 1.386- 5.052; p= 0.001) (Tabla 2). consistió de 200 µM de MgCl2, Este polimorfismo esta en equili250 µM de dNTPs, 0.2 mM de cada brio de Hardy-Weinberg. iniciador, 0.25 U de Taq DNA Poli- Al analizar la relación de las caracmerasa (Invitrogen, Waltham, MA, terísticas clínicas y bioquímicas USA) y ~100 ng de ADN genómi- con los genotipos del SNP 894G>T, co, en un volumen final de 10 µL, la presión sistólica, la presión usando los iniciadores: sentido 5’ diastólica y el IMC, mostraron difeCATGAGGCTCAGCCCCAGAA 3’ y rencias estadísticamente significaantisentido 5’ AGTCAATCCCTTTG- tivas (p <0.05) (Tabla 3). GTGCTCAC 3’. El programa de amplificación fue 95°C /5 min, (95°C IV. CONCLUSIONES /30 s, 55°C /30 s, 72°C /30 s) x 30 - La prehipertensión se asociclos, 72°C /3 min en el termo- ció con el genotipo G/T y el alelo ciclador Veriti 96-Well (Applied T del polimorfismo 894G>T en Biosystems, Carlsbad, CA, USA). La población del Estado de Guerrero. restricción se realizó con BfuCI a - El género, IMC, glucosa, co37°C, los fragmentos visualizados lesterol y triglicéridos se asocian fueron de 206 pb para el alelo G, con la prehipertensión en poblay de 119 y 87 pb para el T. Para el ción del Estado de Guerrero. análisis estadístico se usó el software Stata 11. V. BIBLIOGRAFÍA Bajpai, J. K., A, P. S., A, K. A., A, K. D., III. RESULTADOS Garg, B. & Goel, A. (2014). Impact La población de estudio consis- of prehypertension on left ventri-

V3-N1 - 2016

cular structure, function and geometry. Journal of Clinical and Diagnostic Research 8, BC07-10. Benjamin, N., Dutton, J. A. & Ritter, J. M. (1991). Human vascular smooth muscle cells inhibit platelet aggregation when incubated with glyceryl trinitrate: evidence for generation of nitric oxide. British Journal of Pharmacology, 102, 847-50. Casas, J. P., Cavalleri, G. L., Bautista, L. E., Smeeth, L., Humphries, S. E. & Hingorani, A. D. (2006). Endothelial nitric oxide synthase gene polymorphisms and cardiovascular disease: a HuGE review. American Journal of Epidemiology, 164, 921-35. Forstermann, U. & Munzel, T. (2006). Endothelial nitric oxide synthase in vascular disease: from marvel to menace. Circulation, 113, 1708-14. Giannotti, G., Doerries, C., Mocharla, P. S., Mueller, M. F., Bahlmann, F. H., Horvath, T., et al. (2010). Impaired endothelial repair capacity of early endothelial progenitor cells in prehypertension: relation to endothelial dysfunction. Hypertension, 55, 1389-97. Guzmán-Guzmán, I. P., Salgado-Goytia, L., Munoz-Valle, J. F., Salgado-Bernabe, A. B., Quiroz-Vargas, I. & Parra-Rojas, I. (2013). Prehypertension in a Mexican population: influence of age, gender, and body fat. Clinical & Experimental Hypertension, 35, 67-73. Ignarro, L. J., Buga, G. M., Wood, K. S., Byrns, R. E. & Chaudhuri, G. (1987). Endothelium-derived relaxing factor produced and released from artery and vein is www.conferenciasindromemetabolico.org

85


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

nitric oxide. Proceedings of the National Academy of Sciences 84, 9265-9. Kubes, P., Suzuki, M. & Granger, D. N. (1991). Nitric oxide: an endogenous modulator of leukocyte adhesion. Proceedings of the National Academy of Sciences 88, 4651-5. Marsden, P. A., Heng, H. H., Scherer, S. W., Stewart, R. J., Hall, A. V., Shi, X. M., et al. (1993). Structure and chromosomal localization of the human constitutive endothelial nitric oxide synthase gene. Journal of Biological Chemistry, 268, 1747888. NCBI 2016. dbSNP. National Center for Biotechnology Information. Pickering, T. G., Hall, J. E., Appel, L. J., Falkner, B. E., Graves, J., Hill, M. N., et al. (2005). Recommendations for blood pressure measurement in humans and experimental animals: part 1. Circulation, 111, 697-716. Pletcher, M. J., Bibbins-Domingo, K., Lewis, C. E., Wei, G. S., Sidney, S., Carr, J. J., et al. (2008). Prehypertension during young adulthood and coronary calcium later in life. Annals of Internal Medicine, 149, 91-9. Rodríguez-Ramírez, M., Simental-Mendia, L. E., Gonzalez-Ortiz, M., Martinez-Abundis, E., Madero, A., Brito-Zurita, O., et al. (2015). Prevalence of Prehypertension in Mexico and Its Association With Hypomagnesemia. American Journal of Hypertension, 28, 1024-30. Tesauro, M., Thompson, W. C., Rogliani, P., Qi, L., Chaudhary, P. P. & Moss, J. (2000). Intracellular processing of endothelial nitric oxide synthase isoforms associated with 86

www.conferenciasindromemetabolico.org

differences in severity of cardiopulmonary diseases: cleavage of proteins with aspartate vs. glutamate at position 298. Proceedings of the National Academy of Sciences 97, 2832-5. Williams , J. S., Brown , S. M. & Conlin , P. R. (2009). Blood-Pressure Measurement. New England Journal of Medicine, 360, e6.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA DE DIABETES GESTACIONAL Y FACTORES DE RIESGO ASOCIADOS, EN LA JURISDICCIÓN SANITARIA VIII DE SECRETARÍA DE SALUD DEL ESTADO DE GUANAJUATO MEyAS Lorena García Rangel1, 2, Dra. Adriana Dávalos Pérez1, Dra. Luxana Reynaga Ornelas1, Dr. Francisco Ernesto González Bravo1 ABSTRACT. Aim: To determine the prevalence of Gestational Diabetes (DG) and associated risk factors in the Sanitary District VIII of the State of Guanajuato period January to December 2012. Methodology: observational, analytical, cross, prolective study, total universe of pregnant women attending 55 units of 5 municipalities of Sanitary District VIII Ministry of Health of Guanajuato period January-December 2012 were chosen not probabilistically 6504 who were screened for DG (vo 50 g of glucose and 1 hour later capillary sample for glucose), the suspected underwent Curve glucose Tolerance according to Carpenter and Coustan criteria. Results: 6504 23.88 ± 6.23 pregnant age (12 to 47 years) were studied, the prevalence DG was 3.18%. 57.9% have at least a history of risk for DG. The presence of DG in previous pregnancy, have more than 25 years of age, overweight / obesity, previous macrosomic product and have relatives with diabetes are risk factors for pregnant women to suffer DG, giving from 1.05 to 4.85 times more likely to be exposed relative to women without these risk factors. The municipality is most prevalent Silao. Conclusions: The prevalence of DG in the Jurisdiction VIII is 3.18%, the factors that confer risk of suffering are: presence of DG in previous pregnancy, have more than 25 years of age, overweight / obesity, macrosomia product prior and having a family DM, more than half have at least a history of risk for DG. screening to allow early diagnosis and timely treatment is necessary.

I. INTRODUCCIÓN a Diabetes Gestacional (DG) definida como cualquier grado de intolerancia a los hidratos de carbono que se inicia o se detecta por primera vez durante el embarazo1 representa un problema de salud, de alto costo y de graves consecuencias para el feto. La Asociación Americana de Diabetes calcula que la DG ocurre en aproximadamente 7% de todos los embarazos en Estados Unidos, lo que equivale a más de 200,000 casos anuales2. La DG es la complicación metabólica más frecuente del embarazo ya que afecta a más del 10% de las

L

mujeres embarazadas mayores de 25 años3 y representa el 90% de los casos de Diabetes asociada al embarazo. Puede desaparecer al término del embarazo o persistir como intolerancia a la glucosa o diabetes clínica4. II. METODOLOGÍA Objetivo general: Determinar la Prevalencia de Diabetes Gestacional (DG) y factores de riesgo asociados, en la Jurisdicción Sanitaria VIII de la Secretaría de Salud del Estado de Guanajuato en el perio1 2

do de enero –diciembre 2012. Se llevó a cabo un estudio observacional, analítico, transversal, prolectivo, con universo de trabajo el total de embarazadas atendidas en las 55 unidades de los cinco municipios de la Jurisdicción Sanitaria VIII, de la Secretaría de Salud del Estado de Guanajuato: Manuel Doblado, Purísima, San Francisco del Rincón, Silao y Romita, en el periodo de enero-diciembre del 2012. De éstas se eligieron de manera no probabilística a 6504 que fueron tamizadas para Diabetes Gestacional, no se incluyeron a las que contaban con Diagnóstico de Diabetes Mellitus tipo 1 y tipo 2 previo al embarazo. Durante el primer contacto de la embarazada con la unidad de salud se aplicó un cuestionario diseñado ex profeso con el propósito de determinar los factores de riesgo para Diabetes Gestacional, también se les realizó tamizaje para Diabetes Gestacional la cual consistió en una carga de 50 g de glucosa (Desxtroxol) vía oral y 1 hr posterior a esta carga se tomó una muestra de glucosa capilar. De acuerdo a los valores del tamizaje, se clasificaron de acuerdo a

Universidad de Guanajuato, División de Ciencias de la Salud, Secretaría de Salud Guanajuato

www.conferenciasindromemetabolico.org

87


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

estos criterios y se procedió de la siguiente manera: Tamiz Negativo sin Factores de Riesgo: glucosa menor de 120 mg/ dl, sigue en control prenatal normal en la unidad de salud. Tamiz Negativo y con Factores de Riesgo: glucosa menor de 120mg/ dl, se realizó nuevo tamiz a las 2428 SDG. Tamiz Sospechoso: glucosa mayor de 120 mg/ dl y hasta 199 mg/ dl, se justifica la solicitud de Curva de Tolerancia a la Glucosa (CTGO), la cual se realizó en las cabeceras municipales. Tamiz Positivo: Glucosa mayor a 200 mg/dl, se envía la paciente a la Clínica de Diabetes de las cabeceras municipales para su seguimiento y control. Todas las pacientes sospechosas fueron enviadas a realización de CTGO a las cabeceras municipales. Para la CTGO se realizaron 4 tomas de sangre periférica de la siguiente manera: muestra basal en ayuno (0 min); posteriormente se dió una carga de glucosa de 100 gr y se tomaron tres muestras más a los 60, 120 y 180 min. Se estableció diagnóstico de DG con dos valores alterados de acuerdo a Criterios de Carpenter y Coustan: 0 minutos: 95 mg/dl, 60 minutos 180 mg/dl, 120 minutos 155 mg/dl, 180 minutos 140 mg/dl. Se obtuvo información de pacientes positivas a DG por dos vías: positivas a Tamiz de DG y positivas a CTGO. Las participantes que se identificaron como positivas a DG fueron canalizadas a la clínica de Diabetes Gestacional, ubicada en cada municipio y que cuenta con 88

www.conferenciasindromemetabolico.org

ginecólogo, nutriólogo y psicólogo. Los datos fueron analizados con estadística descriptiva, expresándose en media±desviación estándar para las variables cuantitativas y en frecuencias y porcentajes para las categóricas. Se obtuvieron medidas de riesgo y asociación, X2, Riesgo Relativo (RR), Intervalo de Confianza al 95%, de 0.05. Consideraciones éticas.- Estudio apegado a normas internacionales y de acuerdo al Reglamento de la Ley General de Salud en México en materia de investigación en salud, Artículo 17, se clasifica como investigación de riesgo mínimo, se llevaron a cabo procedimientos rutinarios, las participantes firmaron consentimiento informado por escrito, se guardó estricta confidencialidad de los datos y se refirió a segundo nivel a las identificadas con hiperglucemia y DG para su adecuado tratamiento, el proyecto fue evaluado y avalado por el comité local.

III. RESULTADOS Se estudiaron un total de 6504 embarazadas con 23.88± 6.23 años de edad (rango 12 a 47 años), de 55 unidades en los municipios de Manuel Doblado, Purísima, Romita, San Francisco del Rincón y Silao de la Jurisdicción Sanitaria VIII. Las mujeres tenían en promedio 2.21±1.46 gestas (1-14), el promedio de partos fue 0.81±1.26 (0-13), el promedio de abortos 0.17±0.48 (0-5), el promedio de cesáreas 0.24±0.55 (0-4). Durante el embarazo el 1.28% cursó con bajo peso, 46.27% normopeso, 32.79% sobrepeso y

V3-N1 - 2016

19.88% obesidad. El 58.10% tiene al menos un antecedente de riesgo para Diabetes Gestacional. Las embarazadas refirieron lo siguiente: haber tenido un óbito en embarazos previos 0.75%, haber tenido un recién nacido mayor de 4 kilos 2.71%, muerte neonatal temprana anterior 0.83%, hijo con malformaciones congénitas en embarazo anterior 0.62%, aumento de más 15 kg en embarazos anteriores 4.78%, familiares con DMII 45.97% y haber presentado DG en embarazo anterior 2.34%. Anterior al embarazo el 3.28% presentó bajo peso, 54.07% normo peso, el 27.37% sobrepeso y el 15.50% obesidad en cualquier grado. El tamizaje arrojó 107 positivas, 3031 sospechosas y 3366 negativas a DG. El grupo de edad con mayor proporción de tamizajes positivos fue el de 30-47 años. A todas las embarazadas con tamiz sospechoso se les realizó CTGO, obteniendo 100 resultados positivos; municipio de Manuel Doblado 4 casos, Purísima 19, Romita 14, San Francisco del Rincón 23 y Silao 40. El total de casos positivos fue de 207, tanto por tamizaje como por CTGO. La prevalencia de DG identificada en la Jurisdicción Sanitaria VIII fue de 3.18 %. Al análisis con medidas de riesgo y asociación (cuadro 2), se muestra que tener antecedente de DG en embarazo anterior le confiere a la mujer 2.96 veces más posibilidades de padecer DG (RR= 2.96 IC al 95% 1.81-4.85), mientras que las mujeres de más de 25


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

años de edad tienen desde 2.2 hasta 3.78 veces más posibilidades de padecer DG (RR=2.89, IC 2.2-3.78), en este mismo sentido otros factores de riesgo asociados fueron el sobrepeso/obesidad, tener familiares con DM II y haber tenido previamente un recién nacido de más de 4 kg de peso. El resto de variables evaluadas no estuvieron asociadas estadísticamente. IV.

DISCUSIÓN Y CONCLUSIONES • La prevalencia de DG en la Jurisdicción Sanitaria VIII es del 3.18 %, similar a las reportadas en otros estados de la República Mexicana (entre 3 y 14%) 5,6,7 y en los Estados Unidos (1-14 %).8 • Es importante considerar que las metodologías para el diagnóstico de DG difieren entre estudios. • El municipio de Silao contribuyó con la más alta prevalencia de DG 3.46 %. • Al igual que estudios anteriores9,10,11, nuestros resultados confirman que la DG es más frecuente en mujeres mayores de 25

años de edad. • La presencia de DG en embarazo anterior, tener más de 25 años de edad, el sobrepeso/obesidad, producto macrosómico previo y tener familiares con DM son factores de riesgo en las embarazadas para padecer DG, confiriéndole desde 1.05 hasta 4.85 veces más posibilidades de padecerla en relación con las mujeres sin estos factores de riesgo, resultados similares a los reportados por otros autores10 reportando además a la multiparidad12. • Es de resaltar que en esta muestra estudiada más de la mitad de las embarazadas, el 58.10 % (3771) tiene al menos un factor de riesgo establecido para Diabetes Gestacional. • Es sumamente necesario el tamizaje a todas las embarazadas que permita un diagnóstico precoz, así como el tratamiento oportuno a las ya diagnosticadas con DG. • Es pertinente resaltar la importancia del seguimiento de las pacientes con DG y su reclasificación entre la semana 6-8 pos-

V3-N1 - 2016

parto; ya que un alto porcentaje tiene el riesgo de desarrollar DG en el próximo embarazo y predisposición en el futuro cercano de desarrollar Diabetes Mellitus tipo 2. • Y desde luego es imprescindible el seguimiento de los recién nacidos hijos de embarazadas con DG, debido al riesgo de desarrollar alteraciones metabólicas a temprana edad que generan improntas para la vida adulta, incluso en estadíos previos a DG pero ya con alteraciones del metabolismo de la glucosa13.

V. BIBLIOGRAFÍA 1.- King H, Aubert RE, Herman WH. Global burden of diabetes, 1995-2025. Diabetes Care 1998;21:1414-1431. 2.- American Diabetes Association. Position Statement. 2003. Gestational Diabetes Mellitus. Definition, Detection, and Diagnosis. Diabetes Care; 26:S103-S105. 3.-Secretaría de Salud, ed (2008) (en español). Programa de acción específico 2007-2012. Diabetes Mellitus (1ª edición). México: Sewww.conferenciasindromemetabolico.org

89


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

cretaría de Salud. ISBN 978-607460-042-1. http://www.cenave. gob.mx/progaccion/diabetes.pdf. Consultado el 17 de agosto de 2012. 4.- Forsbach Sánchez G, González Obele F, Villanueva Cuellar Ma, Tamez Pérez HE, Rocha Márquez J. Impacto del nuevo criterio de Diabetes Gestacional en la estimación de la prevalencia Rev Invest Clin 2003; 55:507-10. 5.- Forsbach, G., JJ Contreras-Soto, G Fong, G Flores, and O Moreno 1988. Prevalence of gestational diabetes and macrosomic newborns in a Mexican population. Diabetes Care;11:235-238. 6.- Ramírez M. Diabetes mellitus gestacional. Experiencia en una institución de tercer nivel de atención. Ginecol Obstet Mex 2005;73:484-491 7.- Herring SJ, Oken E, Rifas-Shiman SL, Rich-Edwards JW, Stuebe AM, Kleinman KP et al. Weight gain in pregnancy and risk of maternal hyperglycemia. Am J Obstet Gynecol 2009;201(1):61.e1-7. 8.- Coustan DR. 1995. Gestational diabetes. En: Harris MI, Cowie CC, Stern MP, Boyko EJ, Reiber GE, Bennett PH eds. Diabetes in America. 2a ed. Baltimore, Md: National Institutes of Health;703-717. 9.- Saldana TM, Siega-Riz AM,Adair LS, Suchindran C. The relationship between pregnancy weight gain and glucose tolerance status among black and white women in central North Carolina. Am J Obstet Gynecol 2006;195:1629-1635. 10.- Gutiérrez Gutiérrez H, Carrillio Iñiguez N, Pestaña Mendoza S, Santamaria Ferreira P. Pacientes 90

www.conferenciasindromemetabolico.org

embarazadas: experiencia institucional. Ginecol Obstet Mex 2006; 74:187-92. 11.- Kim C, Newton KM, Knopp RH. Gestational diabetes and the incidence of type 2 diabetes: a systematic review. Diabetes Care 2002;25:1862-1868. 12.- Peiffer Vanina Alejandra, Grisel Riquelve Maria, Cueto Juan Francisco, Taborda Marcela Fernanda. Prevalencia de factores de riesgo en pacientes embarazadas con DMG y pregestacional en el Hospital Rio Gallego Argentina periodo 2006-2010. 13.- Dávalos Pérez Adriana, Malacara Hernández Juan Manuel, Garay Sevilla Ma. Eugenia, Prediabetes durante el embarazo y su efecto en las condiciones metabólicas de sus recién nacidos, 2016, manuscrito en trámite de publicación.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EVALUACIÓN DE LA CALIDAD DE VIDA EN PACIENTES CON OBESIDAD SEVERA PROGRAMADOS PARA CIRUGÍA BARIÁTRICA Y POST OPERADOS CON CUESTIONARIO B.A.R.O.S Y SF-36 Albarrán Sánchez A1, Ramírez Rentería C2, Ferreira Hermosillo A1, Rodríguez Pérez V3, Bosco Garate I4, Molina Ayala M1 I. INTRODUCCIÓN l 32.4% de la población adulta en México tiene sobrepeso, sin embargo hay poca información respecto a pacientes con obesidad severa.1-2.La cirugía bariátrica es el único tratamiento que logra reducir peso a corto y largo plazo, además de controlar enfermedades asociadas a la obesidad3, sin embargo, aún se cuestionan sus beneficios en la calidad de vida. El incremento en el índice de masa corporal (IMC) se asocia con menor calidad de vida comparado con sujetos sanos4-5 y se desconoce si existen mejorías en nuestra población después de la cirugía bariátrica que ayuden a justificar esta intervención. El cuestionario BAROS es un instrumento sencillo, rápido de aplicar, validado y específico para pacientes po soperados de cirugía bariátrica que considera pérdida de peso, aspectos de calidad de vida y co-morbilidades. 6-7Favretti, reporta resultados de buenos a excelentes en 48% de la población, mientras que 8Velasquez Zambrano registró resultados excelentes en el 31.7% antes de los 6 meses postoperatorios y 42.9% excelente a los 3 años. 9 El SF-36 es un instrumento de medición de calidad de vida de

E

uso común y es útil al hacer mediciones seriadas. Con calificaciones que van de 0 a 100, ha demostrado que antes de cirugía la media es de 49.9 puntos y a los 6 meses se eleva a 60.8 puntos llegando a 87.8 posterior a un año.10 La clínica de obesidad del Hospital de Especialidades CMN Siglo XXI atiende a pacientes con obesidad severa candidatos a cirugía bariátrica, teniendo una de las poblaciones más grandes con obesidad a nivel mundial, los resultados en nuestro país pueden originar conocimiento generalizable a otras poblaciones. II. OBJETIVOS Describir los resultados en calidad de vida de los pacientes con obesidad severa de la clínica de Obesidad del Hospital de Especialidades UMAE SXXI con el cuestionario SF-36 en pacientes candidatos a cirugía bariátrica, así como en los pos operados y con el cuestionario BAROS en los posoperatorios.

III. MATERIAL Y MÉTODOS Pacientes que acudieron a la Clínica de Obesidad entre febrero 2015

y febrero 2016. Previo consentimiento informado se aplicaron los cuestionarios correspondientes y se realizó la antropometría. Los resultados fueron analizados con el programa SPSS v 16 y se reportaron con medianas y rangos intercuartílicos (RIC). Se utilizaron pruebas no paramétricas para el análisis de resultados y se consideraron como significativos los resultados con p<0.05. Tipo de estudio:Estudio transversal analítico.

IV. RESULTADOS Se evaluaron 172 pacientes, la edad fue de 45.5 años (RIC 37-51), 81.4% mujeres, el peso inicial fue de 142 en hombres y 125 kg en mujeres. El IMC inicial fue de 48 kg/m2 (44.4-53.6), el 57% tenían un IMC de 40-49.9, 31.1% IMC de 50- 59.9% (súper obesidad) y 9% un IMC mayor a 60 kg/m2 (súper súper obesidad). Del total, 145 pacientes eran pos operadoS. El plan nutricional previo logró una reducción del peso pre-quirúrgico de 126 a 108 kg(p<0.001) y el último peso registrado fue 79 kg (67-93).

Clínica de Obesidad. Servicio de Endocrinología. Hospital de Especialidades, CMN S.XXI, IMSS. UIM en Endocrinología Experimental, Hospital de Especialidades, CMN S.XXI, IMSS 3 Facultad de Psicología. Universidad Nacional Autónoma de México 4 Unidad de Investigación de Inmunología. Hospital de Especialidades, CMN S.XXI, IMSS 1 2

www.conferenciasindromemetabolico.org

91


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

En el SF-36, los aspectos físicos y mentales basales resultaron entre 50 y 60 puntos, estando por debajo de la población general sana, sin diferencias entre diferentes estratos de IMC ni entre géneros. Las diferencias surgieron al comparar pre y posoperatorios principalmente en aspectos físicos. Tabla 1La mejoría es significativa entre los primeros 3 a 12 meses pero no progresan después. Los valores finales son menores que los de la población general. Tabla 2 En el cuestionario B.A.R.O.S, el 98.5% tiene resultado bueno, muy bueno y excelente. Grafico 1.El 68.7% presentaron mejoría de comorbilidades. El exceso de peso perdido es de bueno a excelente y correlaciona con la calificación (r=0.421 p< 0.001), sin embargo no ocurre mejoría en el aspecto sexual. V. DISCUSIÓN Los resultados obtenidos en este estudio indican una mejoría en la calidad de vida de los pacientes operados de cirugía bariátrica, la cual se puede apreciar desde los primeros meses de ser operados. La mejoría se estabiliza después del primer año aunque no parece llegar al nivel de la población general. El SF-36 presentó mejoría en el aspecto físico y no así en lo mental al comparar las determinaciones pre y post operatorias, mientras que el BAROS reporta resultados excelentes en la mayoría de los casos operados. Los autores consideran que estos resultados están asociados también a la mejoría física relacionada con el exceso de peso perdido, mientras que 92

www.conferenciasindromemetabolico.org

los aspectos sociales, mentales y sexuales no tienen tanta mejoría. Esto permite suponer que estos cuestionarios y los pacientes deben ser evaluados a mayor profundidad por un equipo de salud mental o posiblemente deban ser complementados por otros estudios e intervenciones que permitan lograr un incremento de la calidad de vida por lo menos al esperado para la población general, sin embargo, estos resultados de calidad de vida son similares a los hallazgos en otras enfermedades crónicas, en donde la mejoría del cuadro no supone curación e indica un efecto residual que puede afectar diversos aspectos en el funcionamiento de los pacientes. V. CONCLUSIONES La calidad de vida de los pacientes con obesidad severa mejora después de la cirugía bariátrica al ser medida por los cuestionarios BAROS y SF-36. A pesar de los beneficios rápidos y persistentes, los pacientes no logran regresar al nivel reportado por la población general, lo que puede tener trascendencia en otras áreas de salud a largo plazo.

VI. BIBLIOGRAFÍA 1. Obesity and overweight. 2015 Updated January 2015; Fact sheet N°311:[Disponible en:http:// www.who.int/mediacentre/factsheets/fs311/en/. 2.Barquera, S., et al., [Prevalence of obesity in Mexican adults 20002012]. Salud Publica Mex, 2013. 55 Suppl 2: p. S151-60 3. Barrera-Cruz, A., A. Rodri-

V3-N1 - 2016

guez-Gonzalez, and M.A. Molina-Ayala, [The current state of obesity in Mexico].Rev Med Inst Mex Seguro Soc, 2013. 51(3): p. 292-9. 4. Rivas, A.O., S. Sierra, M., Evaluación de la calidad de vida en pacientes sometidos a cirugía de obesidad mórbida.Medicina Universitaria, 2009. 11(45): p. 243246. 5.Chang, C.Y., et al., Health-related quality of life in adult patients with morbid obesity coming for bariatric surgery.Obes Surg, 2010. 20(8): p. 1121-7. 6. Pampillon, N.R., C. Pagano, C. Aguirre-Ackerman, M. Almada, MJ. Fantelli, L. Andreoni, M., Consenso Argentino de Nutrición en Cirugía Bariátrica.Actualización en Nutrición, 2011. 12(2). 7.Puzziferri, N., et al., Three-year follow-up of a prospective randomized trial comparing laparoscopic versus open gastric bypass. Ann Surg, 2006. 243(2): p. 181-8. 8. Favretti, F., et al., Bariatric analysis and reporting outcome system (BAROS) applied to laparoscopic gastric banding patients.Obes Surg, 1998. 8(5): p. 500-4. 9. Velásquez-Zambrano, J.M.-F., A. Pulgar-Emiliani, MI. Araujo-Zarate, PI. Salazar-Mestre, CJ., Evaluación de la calidad de vida en pacientes obesos y cirugía bariátrica.Revista Ciencias Biomédicas, 2014. 5(1): p. 79-87.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

93


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

INTERACCIÓN DEL CONSUMO DE SAL CON POLIMORFISMOS EN EL CANAL EPITELIAL DE SODIO Y SU RELACIÓN CON PRESIÓN ARTERIAL ALTA EN POBLACIÓN GUERRERENSE QBP. Lizeth Alejandra Vega Hilario1, QBP. Aralia Berenice Salgado Bernabé1, QBP. Rubén Barrientos Noriega, L.N. Cecilia Astudillo López, Dr. José Francisco Muñoz Valle2, Dra. Isela Parra Rojas1, Dra. Alejandra Guadalupe García Zapién3, Dr. Lorenzo Salgado Goytia1 ABSTRACT: The SNPs of the epithelial sodium channel (ENaC) have been evaluated in population studies and intervention where there has been related to high blood pressure. This study aims to determine the association of sodium intake with SNP G> T (rs4073291) of the gamma subunit by PCR-RFLP and the survey frequency of food consumption to determine sodium intake and potassium. Our study group showed a high intake of sodium and low potassium intake. The distribution of genotypic frequencies for the SNP were 30% T/T, 55% T/G, 15% G/G, allelic frequencies were T 58% and G 42%, the frequencies were in Hardy-Weinberg equilibrium. Genotype G/G was associated with high blood pressure (OR = 3.5, IC95% 1.5-7.8, p <0.001), increased SBP (p = 0.03) and high sodium intake (OR = 5.22, IC95% 2.15-12.65, p <0.001). The polymorphism was found associated with elevated blood pressure, which we could indicate that our population has a risk of developing hypertension when risk genotype and consume high amounts of sodium. PALABRAS CLAVE: Canal epitelial de sodio (ENaC), hipertensión, polimorfismo G>T (rs4073291, consumo de sal

I. INTRODUCCIÓN a pre hipertensión se define como la elevación de la presión arterial que va de un rango (120-139/80-89 mmHg) (Giles et al., 2009), es la etapa previa de la hipertensión. La hipertensión arterial, se da por una disfunción endotelial (DE) con la ruptura del equilibrio entre los factores relajantes y vasoconstrictores del vaso sanguíneo (Wagner, 2010), es una enfermedad progresiva y compleja, donde interaccionan factores genéticos y ambientales (Doaei y Gholamalizadeh, 2014). La prevalencia en adultos de la pre e hipertensión son altas (Isezuo et al., 2011). (Isezuo et al., 2011). En México es de 30.8% (Barquera et al., 2010) y en el estado de Guerrero es de 13.5% de

L

94

www.conferenciasindromemetabolico.org

filtrado glomerular en donde están implicados los transportadores de sodio y canales de agua o acuaporinas, situados a lo largo de la nefrona (Esteva-Font et al., 2007). Genes implicados en la regulación de la presión arterial (Sanada et al., 2011), han sido asociados con hipertensión y/o sensibilidad a sal. Los genes que codifican para las subunidades el canal epitelial de sodio (por sus siglas en inglés ENaC) (Felder et al., 2013), constituyen el paso crítico limitante para la regulación del volumen del fluido extracelular, balance electrolítico y la presión arterial a largo plazo (Shehata, 2009). El polimorfismo T>G (rs4073291) de la subunidad Υ, en el gen SCNN1G, el alelo G se ha asociado con hipertensión en población coreana y japonesa (Jin y cols. 2010). Por esto, el objetivo de este estudio fue determinar la asociación del consumo de sal con el SNP G>T (rs4073291) de las subunidad gamma, del canal epitelial de sodio con la presión arterial alta en población joven Guerrerense.

acuerdo a lo reportado por ENSANUT 2012 (Olaiz et al., 2006). La regulación de la presión sanguínea es compleja e involucra niveles anatómicos, genéticos y moleculares (Cruz-Mérida, A. et al., 2004) Los ajustes principales, se llevan a cabo a nivel renal e involucran importantes sistemas reflejos y hormonales, los cuales regulan la excreción de agua y sal (Cardinali et al., 2010). Los riñones son los encargados de mantener la osmolaridad extracelular y el volumen plasmático. (Rossier and Schild, 2008), esto mediante las nefronas encargadas de la absorción de II. METODOLOGÍA sodio y agua, procedentes del ultra

Laboratorio de Investigación de Obesidad y Diabetes. U.A.C.Q.B. Universidad Autónoma de Guerrero. Chilpancingo, Gro 2 Departamento de Biología Molecular y Genómica, C.U.C.S. U. de Guadalajara, Jal. México 3 Departamento de Farmacología. C.U.C.E.I.U. de Guadalajara, Jal. México 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

En este estudio se seleccionaron 298 individuos entre 19-22 años, originarios del estado de Guerrero, clasificados de acuerdo a los criterios de la JNC 7, 95 personas con presión alta (120-139/80-89 mm/Hg) y 203 con una presión <120/80 mm/Hg. Se les determinó el peso (kg), el índice de masa corporal (IMC), el porcentaje de agua (analizador de la composición corporal MC 780 U “TANITA”), la talla con estadímetro portátil (Seca 240, Hamburgo, Alemania) y la presión arterial con el esfingomanómetro digital (HEM-712C, Omron). Se aplicó un cuestionario para evaluar el consumo de sodio y potasio (software Nutrimind, 2012). Todos firmaron el consentimiento informado. Se les determinó glucosa, colesterol, triglicéridos, con kits comerciales (Spinreact), en equipo semi-automatizado Mindray B-200. Mediante la técnica de Miller modificada, se obtuvo ADN de leucocitos de sangre periférica (Miller et al., 1988). Por la técnica de PCRRFLPs, se identificó el polimorfismo G>T (rs4073291) del gen SCNN1G, con las siguientes condiciones: Iniciador sentido 5’-AGG AGG CTT CCA AGC TTA TGA TG; Anti sentido 5’-TAG CAT CAT TTT GAT GGT GTT C. La mezcla de reacción se realizó en un volumen final de 10 µl, se adicionó 0.5µl de cada iniciador, 250 µM de dNTP’s, 0.4 µM MgCl2, 0.1 U de Taq DNA polimerasa, buffer de PCR 10X (Invitrogen, Waltham, MA, USA) y 100 ng de ADN. La amplificación se llevó a cabo con las siguientes condiciones: desnaturalización inicial

94°C 5’, 30 ciclos para la amplificación de desnaturalización 95°C 30’’, alineamiento 57°C 30”, extensión 72°C 30” y extensión final a 72°C 5’, (termociclador Veriti 96-WellApplied Biosystems, Carlsbad, CA USA), obteniendo un producto de 167 pb, se sometió a restricción con la enzima BfaI (New England Biolabs, Beverly, MA, USA) a 37°C por 3 hrs, generando un patrón de restricción para el genotipo T/T, 139 pb; G/T, 165, 139 pb y 165 pb para G/G. La detección del patrón de restricción, se visualizó en geles de poliacrilamida al 6% teñido con nitrato de plata. III. RESULTADOS

V3-N1 - 2016

Los individuos fueron categorizados de acuerdo a los criterios de la JNC7. De los parámetros analizados (clínicos, bioquímicos y nutricionales) el peso, talla, IMC, glucosa, colesterol y la presión arterial sistólica, diastólica, tuvieron diferencias estadísticamente significativas (p< 0.05).Tabla 1. En la evaluación del consumo de sodio, potasio y el porcentaje de hidratación, se observan diferencias estadísticamente significativas (p<0.05) en el género, mientras que para el porcentaje de hidratación, se observa una hidratación mayor en los hombres con relación a las mujeres. Tabla 2. En el análisis de las frecuencias

www.conferenciasindromemetabolico.org

95


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

genotípicas y alélicas del polimorfismo G>T (rs4073291) del gen SCNN1G, se observan diferencias estadísticamente significativas (p<0.05), observándose un OR de 1.7 para el alelo G y OR de 3.5 para el genotipo G/G. Tabla 3. La interacción de los genotipos del polimorfismo G>T (rs4073291) del gen SCNN1G con los parámetros clínicos y bioquímicos, mostró que para el genotipo G/G la presión arterial sistólica, fue más elevada en los portadores de este genotipo en comparación con los del genotipo T/T. Tabla 4. Se hizo un modelo de interacción del consumo de elevado de sodio y los genotipos del polimorfismo y se observó que las personas portadoras del genotipo T/G tienen un OR 2.30; IC95% (1.08-4.92); p=0.03 y los portadores del genotipo G/G un OR= 5.22; IC 95% (2.15-12.65); p<0.001.Tabla 5.

96

www.conferenciasindromemetabolico.org

IV. CONCLUSIONES El consumo bajo de potasio en nuestra población podría estar teniendo impacto en la alta tasa de casos de hipertensión. El alto consumo de sal y ser portador del alelo G, podría ser un factor de riesgo importante para el desarrollo de la hipertensión Los portadores del genotipo G/G y T/G, tendrán un mayor riesgo de desarrollar hipertensión aunado a un consumo elevado (>5000 mg/ día) de sodio.

V. BIBLIOGRAFÍA Barquera, S., Campos-Nonato, I., Hernández-Barrera, L., Villalpando, S., Rodríguez-Gilabert, C., Durazo-Arvizú, R., Aguilar-Salinas, C.A., 2010. Hypertension in Mexican adults: results from the National Health and Nutrition Survey 2006. Salud Pública México 52 Suppl 1, S63–71. Büsst, C.J., 2013. Blood pres-

V3-N1 - 2016

sure regulation via the epithelial sodium channel: From gene to kidney and beyond. Clin. Exp. Pharmacol. Physiol. 40, 495–503. doi:10.1111/1440-1681.12124 Cardinali, D.P., Dvorkin, M.A., Iermoli, R.H., 2010. Best and Taylor bases fisiológicas de la práctica médica. Editorial Médica Panamericana, Buenos Aires (Argentina. Cruz-Mérida, A., León-Hernández, F., Hernández y Hernández, H., 2004. Regulación normal de la presión arterial sistémica. Rev. Médica Cardiol. Volumen 15, pp 30 – 41 M. Doaei, S., Gholamalizadeh, M., 2014. The association of genetic variations with sensitivity of blood pressure to dietary salt: A narrative literature review. ARYA Atheroscler. 10, 169–174. Esteva-Font, C., Torra Balcells, R., Fernández-Llama, P., 2007. Transportadores de sodio y aquaporinas: ¿futuros biomarcadores renales? Med. Clínica 129, 433–437. doi:10.1157/13110477 Felder, R.A., White, M.J., Williams, S.M., Jose, P.A., 2013. Diagnostic tools for hypertension and salt sensitivity testing: Curr. Opin. Nephrol. Hypertens. 22, 65–76. doi:10.1097/MNH.0b013e32835b3693 Giles, T.D., Materson, B.J., Cohn, J.N., Kostis, J.B., 2009. Definition and Classification of Hypertension: An Update. J. Clin. Hypertens. 11, 611–614. doi:10.1111/j.17517176.2009.00179.x Guyton, A.C., Hall, J.E., 2011. Tratado de fisiología médica. Elsevier Health Sciences Spain, London. Isezuo, S.A., Sabir, A.A., Ohwovorilole, A.E., Fasanmade, O.A., 2011.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Prevalence, associated factors and relationship between prehypertension and hypertension: a study of two ethnic African populations in Northern Nigeria. J. Hum. Hypertens. 25, 224–230. doi:10.1038/jhh.2010.56 Jin, H.-S., Hong, K.-W., Lim, J.E., Hwang, S.-Y., Lee, S.-H., Shin, C., Park, H.K., Oh, B., 2010. Genetic Variations in the Sodium Balance-Regulating Genes &lt;i&gt;ENaC&lt;/i&gt;, &lt;i&gt;NEDD4L&lt;/i&gt;, &lt;i&gt;NDFIP2&lt;/i&gt; and &lt;i&gt;USP2&lt;/i&gt; Influence Blood Pressure and Hypertension. Kidney Blood Press. Res. 33, 15– 23. doi:10.1159/000275706 Miller, S. A., Dykes, D. D., Polesky, H. F., 1988. A simple salting out procedure for extracting DNA from human nucleated cells 16, 3. Olaiz, G., Mexico, Instituto Nacional de Salud Pública (Mexico) (Eds.), 2006. Encuesta nacional de salud y nutrición 2006, 2. ed. ed. Instituto Nacional de Salud Pública : Secretaría de Salud, Cuernavaca, Morelos, México. Sanada, H., Jones, J.E., Jose, P.A., 2011. Genetics of Salt-Sensitive Hypertension. Curr. Hypertens. Rep. 13, 55–66. doi:10.1007/ s11906-010-0167-6 Shehata, M.F., 2009. Regulation of the epithelial sodium channel [ENaC] in kidneys of salt-sensitive Dahl rats: Insights on alternative splicing. Int. Arch. Med. 2, 28. doi:10.1186/1755-7682-2-28 Then, K.L., Rankin, J.A., 2004. Hypertension: a review for clinicians. Nurs. Clin. North Am. 39, 793–814. doi:10.1016/j.cnur.2004.07.002

V3-N1 - 2016

Wagner-Grau P., 2010. Fisiopatología de la hipertensión arterial. An Fac med. 71(4), 225–9. Zhang, W., Li, N., 2011. Prevalence, Risk Factors, and Management of Prehypertension. Int. J. Hypertens. 2011, 1–6. doi:10.4061/2011/605359

www.conferenciasindromemetabolico.org

97


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES DE RIESGO ASOCIADOS AL DIAGNÓSTICO DE SÍNDROME DE APNEA E HIPOPNEA OBSTRUCTIVA DEL SUEÑO EN PACIENTES ADULTOS DE LA UNIDAD DE MEDICINA FAMILIAR 2 DEL IMSS PUEBLA Dra. Caro Arenas María Reina Jocelyn1, Dr. Toledo Estrada Javier 2, M.E Ramirez Dueñas Luz Karina 3 RESUMEN Objetivo: Determinar los factores de riesgo en adultos de la población estudiada de la UMF 2 implicados en el diagnóstico temprano de SAHOS, ya que existen escasos datos sobre factores de riesgo para SAHOS en población Mexicana. Material y métodos: Estudio descriptivo, observacional, transversal, prospectivo realizado de febrero - noviembre del 2012, muestra por conveniencia, obtenida en consulta externa de medicina familiar, en ambos turnos; criterios de inclusión: sobrepeso (IMC >25). obesidad (IMC >30), hipertensión arterial, somnolencia diurna, antecedente de ser roncador, apneas nocturnas; posterior al consentimiento informado se aplicaron los instrumentos: Escala de Somnolencia excesiva de Epworth, Test Simplificado para SAHOS y Escala de Mallampati, se analizan los datos con programa estadístico SPSS 17.0 y se utilizo estadística descriptiva Resultados y conclusiones: Muestra 126 personas, 50 hombres (39.7%) y 76 mujeres (60.3%), rangos: de edad 23-88 años media 55.3, peso de 65 a 135 kg media 89, talla de 1.39 a 1.82 mts, de ellos 41 con antecedentes de diabetes, 2 con glucosa anormal en ayuno, 1 con Diabetes gestacional en el último embarazo, 1 prediabético, 83 hipertensos, 1 con preeclampsia, 55 con dislipidemia,17 tabaquismo activo, 2 tabaquismo pasivo, 6 cardiopatía diagnosticada, IRC 1, síndrome metabólico 1, LES 1, hipotiroidismo 1. A diferencia de lo descrito en la literatura internacional sobre SAHOS que es más frecuente en varones encontramos mayor incidencia en mujeres de la población estudiada, Los pacientes estudiados tenían presentes más de un factor de riesgo; 30.1% 5 factores, 23.8% 6 factores, 16.6% 7 factores y solo 7.9% tuvo 8 factores, así como un grado leve de somnolencia excesiva (45.2%); presentaban hipertensión (67.5%) y obesidad (93.6%) al mismo tiempo. PALABRAS CLAVE: Obesidad, Apnea del sueño, Somnolencia, Escala de Epworth, Test simplificado de SAHOS, Mallampati

I. INTRODUCCIÓN a obesidad es un problema de salud en México, y también la causa principal para desarrollar SAHOS, patología poco conocida por la mayoría de médicos de primer contacto y subdiagnosticada, confundida con enfermedades como EPOC, Bronquitis crónica y diagnosticada tardíamente, cuando ya se presentan complicaciones cardiovasculares clasicas descritas ya desde 1976 así como metabóli-

L 98

www.conferenciasindromemetabolico.org

cas tal y como se describió en el síndrome z por wilcox y cols en 1998(12), así un 40% de los pacientes con SAHOS tiene también criterios de síndrome metabólico. El Síndrome de apnea hipopnea obstructiva del sueño (SAHOS) se define como un síndrome de apneas obstructivas durante el

sueño, que posee signos y síntomas específicos. Entre los signos principales están las apneas caracterizadas por el cese del flujo respiratorio mínimo 10 segundos y más de 1 minuto (7), que ocurren en cualquier etapa del sueño; las hipoapneas se definen por el cierre parcial de la vía aérea, acompañadas de un descenso en los niveles de oxígeno (desaturación) y fragmentación del sueño. Los ronquidos son otro signo importante como componente en este síndrome. El síntoma principal es la somnolencia diurna excesiva y los trastornos secundarios en la atención y la memoria. (7) La causa de este síndrome es la obstrucción mecánica de las vías respiratorias altas que se sitúa en la orofaringe y/o hipofaringe, su etiología suele ser multifactorial. Así, las apneas e hipopneas ocurren debido a un colapso inspiratorio de la faringe favorecido por la pérdida del tono muscular de los músculos faríngeos, durante el sueño. El SAHOS es un trastorno cada vez más frecuente que acompaña a la epidemia actual de obesidad, y tiene gran impacto sobre los sis-

Medico Especialista en Medicina Familiar UMF 28 IMSS, DF. Titular del Servicio de Neumología en HGZ No.20, IMSS, Puebla. 3 Directora del centro de investigación educativa y formación docente CIEFD IMSS 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

temas de salud; en Estados Unidos por ejemplo se gastan hasta 3.4 billones de dólares anules sólo en servicios médicos por esta enfermedad, además, origina pérdidas indirectas económicas por ausentismo laboral y entre un 7-10 por ciento más riesgo de presentar un accidentes de tráfico. (7) Estudios epidemiológicos internacionales estiman que el 2-4% de la población general de mediana edad y hasta el 20% de los mayores de 65 años padecen la enfermedad y que más de 7 millones de personas presentan factores de riesgo para padecerla. (25) En la ciudad de México, a través del test simplificado para SAHOS y poligrafía respiratoria se estimó una prevalencia de SAHOS de 2.2% en mujeres y 4.4% en hombres. Dicha estimación aumenta de manera exponencial al incrementar el índice de masa corporal (IMC), llegando a ser casi del 10% en sujetos con IMC mayor a 40 kg/m2. El SAHOS es más frecuente en varones y se relaciona con la obesidad, principal factor de riesgo para desarrollar SAHOS identificado en México, así se observo en una serie de encuestas representativas implementadas por la SSA y el INSP en las que se detectaron prevalencias elevadas en sobrepeso y obesidad; de acuerdo a la ENSANUT 2006, la prevalencia de sobrepeso y obesidad ha aumentado un 12% en los últimos seis años, por lo menos hay una prevalencia del 50% de la población adulta, y la obesidad por si sola se encuentra presente en el 20-30%, con mayor incidencia en México en mujeres

que en hombres. (7) Cuando se sospecha el SAHOS el diagnostico de certeza de esta enfermedad es el gold estándar la polisomnografia sin embargo en el primer nivel de atención no se cuenta con este auxiliar diagnostico; situación que retrasa aun más la identificación temprana y el tratamiento oportuno de esta patología. Por lo anterior es necesario difundir los instrumentos clínicos que están al alcance de cualquier medico, como el test clínico simplificado para SAHOS, la escala de somnolencia diurna de Epworth, la escala de mallampati, la circunferencia del cuello y los factores de riesgo ampliamente descritos en la literatura médica sobre SAHOS (que nos ofrecen una sensibilidad del 90 % y una especificidad del 60 %), lográndose una certeza medica conveniente II. MATERIAL Y MÉTODOS Se realizo estudio un descriptivo, observacional, transversal, prospectivo de febrero - noviembre del 2012, muestra por conveniencia, obtenida en consulta externa de medicina familiar. Criterios de inclusión: sobrepeso (IMC >25). obesidad (IMC >30), hipertensión arterial, somnolencia diurna, antecedente de ser roncador, referencia de apneas nocturnas asi como comorbilidades asociadas, se aplicaron los instrumentos: Escala de Somnolencia diurna de Epworth, que presenta una sensibilidad del 90 % y una especificidad del 63%, que valora el grado de somnolencia excesiva diurna, consta de 8 items, y cada pregunta se califica

V3-N1 - 2016

con un valor de 0-3,la suma de estos califica la severidad de somnolencia excesiva diurna, un puntaje de 8-11 somnolencia leve, 12-15 somnolencia moderada, 16 o mas somnolencia severa. El Test clínico simplificado para SAHOS valora la circunferencia del cuello en cms, antecedente de HAS, roncopatia y apneas referidas o presenciadas, entre más elevado es el puntaje más probable es el diagnostico, si el paciente padece hipertensión 4 puntos, no=0 puntos, ronca =3 puntos no = 0 puntos, deja de respirar si=3 puntos no= 0 puntos, así el resultado es sumado al valor en cms de la circunferencia de cuello. Finalmente la Escala de Mallampati utilizada en anestesiología como predictivo de intubación difícil, tiene utilidad en el paciente consospecha de SAHOS (10) debido a las modificaciones anatómicas que los individuos presentan al tener riesgo incrmentado de colapso u oclusión de la via aérea al dormir, asi los grados 3 (se observa paladar blando y base de la uvula) o 4 (se observa paladar duro y el resto queda fuera de visión), son los mayormente implicados como riesgo para SAHOs. Criterios de Inclusión: Sobrepeso (IMC>25), obesidad (IMC>30), referencia de apneas nocturnas, somnolencia diurna, antecedente de ser roncador, antecedente de Hipertensión arterial, aceptación de participación en el estudio. Criterios de exclusión: depresión en tratamiento, consumo de fármacos para conciliar el sueño, antecedentes de narcolepsia, que realicen trabajo nocturno, alterawww.conferenciasindromemetabolico.org

99


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

ciones craneofaciales como labio paladar hendido, diagnostico de Enfermedad de Alzheimer. Se analizaron los datos con programa estadístico SPSS versión 17.0 y utilizandose estadística descriptiva. III. RESULTADOS Y CONCLUSIONES Se obtuvo una muestra 126 personas, 50 hombres (39.7%) y 76 mujeres (60.3%), rangos: de edad 23-88 años media 55.3, peso de 65 a 135 kg media 89, talla de 1.39 a 1.82 mts, de ellos 41 con antecedentes de diabetes, 2 con glucosa anormal en ayuno, 1 con Diabetes gestacional en el último embarazo, 1 prediabético, 83 hipertensos, 1 con preeclampsia, 55 con dislipidemia,17 tabaquismo activo, 2 tabaquismo pasivo, 6 cardiopatía

diagnosticada, IRC 1, síndrome metabólico 1, LES 1, hipotiroidismo 1. A diferencia de lo descrito en la literatura internacional sobre SAHOS que es más frecuente en varones encontramos mayor incidencia en mujeres. Los pacientes estudiados tenían presentes más de un factor de riesgo; 30.1% 5 factores, 23.8% 6 factores, 16.6% 7 factores y solo 7.9% tuvo 8 factores, así como un grado leve de somnolencia excesiva (45.2%); presentaban hipertensión (67.5%) y obesidad (93.6%) al mismo tiempo. El peso de los pacientes se encontró entre los 64kg y los 147kg,118 pacientes tenían algún grado de obesidad y solo 8 tenían sobrepeso, con respecto a la circunferencia de cuello 85 pacientes tenían un valor de 40-49cms, y 9 un valor de 50-

V3-N1 - 2016

59cms, valor que entre mas alto es mucho mayor es el riesgo de padecer SAHOS. Con respecto a la edad la edad de los pacientes encuestados oscilaban entre 23 y 88 años con una media de 55.3 años que concuerda con lo descrito en la literatura internacional en la cual el sahos es más frecuentes en mayores de 40 años, Con respecto al grado de somnolencia un 15.1% tuvo somnolencia moderada y y solo un 5.6 % somnolencia comparado con la prevalencia de somnolencia en la encuesta del INER que tuvo un 16%. El objetivo del estudio se cumplió ya que se logro el screening de los principales factores de riesgo para desarrollar SAHOS en los pacientes de la población estudiada y asi se canalizaron oportunamente a un segundo nivel para complementación diagnostica y control de sus comorbilidades de forma temprana. Finalmente dentro de las causa del retraso en el diagnostico del SAHOS identificadas, además del desconocimiento de la existencia de la enfermedad por parte del personal médico se detecto la inexistencia de guías de práctica clínica latinoamericanas que difundan los datos clínicos principales del SAHOS. Durante la aplicación de los instrumentos clinicos se detecto la no aceptación de los pacientes el hecho de ser obeso o paciente roncador. IV. BIBLIOGRAFÍA 1.- Castillo C. J.Utilidad diagnostica de un cuestionario de sueño y de la escala de somnolencia de Epworth en el SAHOS. Rev Chil Neuro-Psiquiat 2009; Vol. 47, Num.3, pág.

100

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

215-221 2.- Calvo C.E.Sindrome de Apnea/ Hipopnea Obstructiva del sueño SAHOS en Guias Clinicas 2005(Madrid); 5 (29), pag 1-7. 3.- Duran C. J.SAHOS en Consenso Nacional Sobre el síndrome de Apneas Hiponeas del sueño. Archivos de Bronconeumologia, 2005, vol.41, extraordinario 4, pag 3-48. 4.- Fishman P.A. Sindromes de Apnea del sueño en Neumologia de Fishman, Doyma, 2ª Ed. 1991, Vol. 2, cap 83, pag 1249-1259 5.- West B. J. Intercambio Gaseoso en Fisiopatología Pulmonar de West, Ed. Panamericana, Bogota, 2ª. Ed. 1990, Pag 30-32 6.- Alva y Pérez J. L. Consecuencias metabólicas y cardiovasculares del síndrome de apnea obstructiva del sueño Med Int Mex 2009;25(2):116-28 7.- Rico M. F. Obesidad presente y futuro en La Neumologia en la encrucijada de la modernidad, CMN la Raza, Mexico, 2010, pag 35-59. 8.- Carillo A. J. SAHOS en población adulta. Neumol Cir torax, 2010, vol. 69, No.2, pag. 103-115. 9.- Torre B. L. Riesgo Cardiovascular en Adultos con SAHOS. Gac Méd Méx, 2008, Vol. 144, No. 4, pag 323- 332. 10.- Covarrubias G. A. El SAHOS y su importancia en el Perioperatorio. Rev Med Inst Mex Seguro Soc, 2007, 45 (4), pag 371-380 11.- Castorena M. A. Pros y contras de la simplificación de los métodos diagnósticos en adultos con apnea obstructiva del sueño. Rev Inst Nal Enf Resp Mex, 2008, Vol.21, Núm

V3-N1 - 2016

ción pulmonar. Arch Bronconeu2, pag 131-141. 12.- Alva y P. J. Consecuencias me- mol. 2004, Vol.40, (Supl num 5), tabólicas y cardiovasculares del pag. 27-31 síndrome de apnea obstructiva del sueño, Med Int Mex, 2009, Vol. 25, Num 2, pag. 116-128. 13.- Valencia F. M. Apnea del sueño en el paciente obeso. Revista de Endocrinología y Nutrición, 2001, Vol. 9, Num. 2, pag 97-102 14.- Hirshkowitz M. Clinical and Laboratory Assessment of Sleep-Related Breathing Disorders. Sleep Med Clin 1 , 2006, pag. 449–460 15.- Epstein L. J. Clinical Guideline for the Evaluation, Management and Long-term Care of Obstructive Sleep Apnea in Adults.Journal of Clinical Sleep Medicine, 2009, Vol.5, Num. 3, pag 263-276. 16.- Montserrat J.M. Nuevos aspectos patogénicos en el síndrome de apneas e hipopneas durante el sueño (SAHOS). Arch Bronconeumol, 2004, vol. 40, (Supl 6), pág. 27-34 17.- Meza V. M. Otras consecuencias de los trastornos del dormir. A propósito de los accidentes vehiculares. Rev Inst Nal Enf Resp Mex, 2005,Vol18, Num 2, Pag. 162-169 18.- Consenso Nacional Sobre El Síndrome De Apneas-Hipopneas Del Sueño (SAHS). Definición y concepto, fisiopatología, clínica y exploración del SAHOS, Arch Bronconeumol, 2005, vol 41, Supl 4, pag. 12-29 19.-. Kushida, C. A Practice Parameters for the Indications for Polysomnography and Related Procedures: An Update for 2005, SLEEP, 2005, Vol. 28, Num. 4, pag. 499-521. 20.- De Lucas R. P. Obesidad y funwww.conferenciasindromemetabolico.org

101


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

DISMINUCIÓN EN LOS NIVELES DE INSULINA E IR- HOMA EN RATAS OBESAS TRATADAS CON JUGO DE ALOE VERA D. en C. Ruth Nohemí Domínguez Fernández1, D en C. Leticia Manuel Apolinar2, Med. Martínez Arana Ana María1, L.N. Rocío Jaqueline Sánchez Duran1, Gibran Rodriguez Morales1, Daniela López Martínez1 de 360 especies diferentes, pertenece a la familia de las liláceas, posee múltiples propiedades principalmente las relacionadas a sus actividades terapéuticas, como acción emoliente, cicatrizante, coagulante, hidratante, antialérgica, desinfectante, antiinflamatoria, hipoglucemiante, astringente y laxante2, 3, 4,. Se han hecho estudios utilizando modelos in vivo con ratones ya que estos representan un modelo único en cuanto a las características esenciales de los humanos5. Es probable que pueda haber una acción sinérgica entre la base de los polisacáridos y otros componentes en algunas de las actividades biológicas observadas6, Es por ello que el presente estudio tiene por objetivo mostrar el efecto del jugo de Aloe vera como alimento funcional diabetes, de las cuales la resisten- sobre “insulina, IR-homa” en ratas cia a la insulina, es una condición sprague dawley obesas. metabólica central en la etiopatogenia del síndrome metabólico1. II. METODOLOGÍA Unas de las alternativas para com- Modelo experimental. Las ratas esbatir la obesidad y sus comorbili- tuvieron en condiciones estándar dades ha sido el uso de alimentos de bioterio, con alimentación ad lifuncionales, como el nopal, chía, bitum (alimento a libre demanda). sábila, entre otros. El Aloe vera (L.) Las hembras serán sincronizadas Burm. f, o coloquialmente llamada para la cruza con los machos, para sábila es una planta con alrededor la gestación y fueron separadas

ABSTRACT. Obesity and overweight has reached epidemic characters worldwide, more than one billion adults are overweight and at least 300 million of them are obese. Comorbidities of this disease are most known among them are hypertension, cancer, dyslipidemia and diabetes, of which insulin resistance is a central metabolic condition in the pathogenesis of metabolic syndrome. One of the alternatives to combat obesity and its comorbidities has been the use of funtional food, such as nopal, chia and Aloe vera among others. That why the aim of this study was show the effect of Natural Aloe vera juice on «insulin and IR-homa» in obese rats. Rats were taken under standard vivarium, at 3 months of age were divided into 3 groups: control (C); and the Ob group was divided into management Natural Juice (NJ) and processed juice (PJ). From the third month of age, the body weight of the control group (263 g + 17) and obese group (306 g + 31) with a value of significance (p <0.02) was obtained. Determining levels of IR-HOMA and insulin was performed from the first month old and monitoring were made in the different study groups during the next two months consecutively. Finally insulin decreased in both females and males mice 10 + 2 24.5 + 2 uUI and uUI was obtained respectively, in the obese group treated with Aloe vera juice Natural (Ob + JN). As for IR - HOMA again found a decrease in this index in both females and males mice 1.8 + 0.2 and 4.3 + 0.2 respectively in the obese group treated with Natural Juice (JN) unlike the treated group with Juice Processing (JP). A significant decrease was observed in the insulin resistance demonstrating that the natural juice has a better effect in reducing levels HOMA-IR, both males and females mice. With these studies the effectiveness of Natural Aloe vera Juice as a functional food was found, as it can contribute to improving the health status in patients with insulin resistance, obese and/or with diabetes. PALABRAS CLAVE: Aloe vera, alimento funcional, IR-HOMA, insulina, ratas obesas.

I. INTRODUCCIÓN a obesidad y el sobrepeso ha alcanzado caracteres de epidemia mundial, más de mil millones de personas adultas tienen sobrepeso y de ellas al menos 300 millones son obesas, de acuerdo a la OMS ésta enfermedad se caracteriza por un exceso de tejido adiposo y de origen multifactorial. Las comorbilidades de esta enfermedad son sumamente conocidas, entre ellas se encuentran la hipertensión, cáncer, dislipidemias y

L 102

www.conferenciasindromemetabolico.org

1

Centro Interdisciplinario de Ciencias de la Salud Unidad Milpa Alta

2

Centro de Investigación en Endocrinología del Centro Médico Nacional Siglo XXI -IMSS


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

cada hembra en su propia jaula conformando los grupos experimentales: el grupo 1 será el grupo control (C); grupo 2 con una dieta hipercalórica postnatal (Ob). Al nacimiento de las crías se registró el peso del nacimiento y hasta los 3 meses de edad. A los 21 días del destete de los grupos de estudio, el grupo 2 (Ob) será alimentado con dieta alta en carbohidratos (hipercalórica) 30% de sacarosa. El grupo control C es alimento purina 5008 es alimento con formulación y nutrición constante, certificado con la norma ISO-9002. A los 3 meses de edad se dividió en 3 grupos: control (C); y el grupo Ob se divido en administración de Jugo Natural (JN) y jugo procesado (JP). Tratamiento en ratas obesas con Aloe vera, determinación de e IR - HOMA. Se utilizó el jugo natural (100%) y preparado (50%) de Aloe vera (barbadensis Miller), de la empresa Flor de Aloe proveniente del estado de Puebla, se almacenó en refrigeración a 4°C previo a su utilización. Se administró vía oral el jugo natural (4 ml en 4 mg/kg) y preparado (2mg/kg). La determinación de los niveles de IR-HOMA e insulina se realizarón a partir del primer mes de edad y se monitorearon en los diferentes grupos de estudio durante los siguientes dos meses de manera consecutiva los animales deberán de estar en ayuno de 8 hrs. Considerando una hiperglucemia con niveles altos (>100mg/dl). La curva de tolerancia de la glucosa se llevó con administrando de glucosa de 2g/Kg de peso, seguido del tratamiento d aloe vera JN y JP; el moni-

toreo se efectuó durante dos horas cada 30 minutos. Se realizó la medición mediante un glucómetro. La determinación de los niveles de IR-HOMA y glucosa se efectuará practicando un pequeño corte transversal en la punta de la cola para obtener una gota de sangre. III. RESULTADOS En la Grafica 1 se muestra la disminución de IR – HOMA en hembras (1.8 + 0.2) en el grupo obeso tratado con Jugo Natural de Aloe vera (Ob + JN), a diferencia de grupo obeso tratado con el jugo Procesado (Ob + JP). En la Tabla 1. Se observa la una mayor disminución de insulina en las hembras (10 + 2 uUI) en el grupo obeso tratado con Jugo Natural (JN), a diferencia del grupo obeso tratado con el Jugo Procesado (JP) En la Grafica 2 se muestra la disminución de IR – HOMA en machos (4.3 + 0.2) en el grupo obeso tratado con Jugo Natural de Aloe vera (Ob + JN), a diferencia de grupo obeso tratado con el jugo Procesado (Ob + JP). En la Tabla 2. Se observa la una mayor disminución de insulina en machos (24.5 + 2 uUI) en el grupo obeso tratado con Jugo Natural (JN), a diferencia del grupo obeso tratado con el Jugo Procesado (JP). IV. CONCLUSIONES En este estudio realizado con un modelo animal se observó una importante disminución en la resistencia a la insulina comparando al grupo control obeso, con el grupo obeso al que se le administro jugo natural de Aloe vera, demostran-

V3-N1 - 2016

do que el jugo natural tiene una mayor efecto en la disminución en los niveles de IR-HOMA, tanto en ratones machos como en hembras. Con estos estudios preliminares se puede comprobar la efectividad de la sábila como un alimento funcional, ya que puede contribuir al mejoramiento del estado de salud en el ser humano.

V. BIBLIOGRAFÍA 1. Eshun, K. y He, Q. (2004). Aloe vera: A valuable ingredient for the food, pharmaceutical and cosmetic industries-A review. Critical Reviews in Food Science and Nutrition 44, 91-96. 2. Vega, G.A.; Miranda, M.; Aranda, M.; Henriquez, K.; Vergara, J.; Tabilo-Munizaga, G. & Perez-Won, M. (2011a). Effect of high hydrostatic pressure on functional properties and quality characteristics of Aloe vera gel (Aloe barbadensis Miller). Food Chemistry, 129:1060–1065. 3. Keshavarzi Z, Rezapour TM, Vatanchian M, Zare Hesari M, Nabizade Haghighi H, Izanlu M, Sabaghian M, Shahveisi K. The effects of aqueous extract of Aloe vera leaves on the gastric acid secretion and brain and intestinal water content following acetic acid- induced gastric ulcer in male rats. Avicenna J Phytomed, 2014; 4 (2): 137-143. 4. Suvitayavat, W. C., Sumrongkit C., Thirawarapan, S. y Bunyapraphatsara, N., (2004). Effects of Aloe preparation on the histamine-induced gastric secretion in rats. Journal of Ethnopharmacology 90, 239-247. www.conferenciasindromemetabolico.org

103


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

5. OMS “Obesidad y Sobrepeso”. Nota descriptiva 311. (2012). Disponible en http://www.who. int/mediacentre/factsheets/ fs311/es/ 6. Yongchaiyudha, S., Rungpitarangsi, V., Bunyapraphatsara, N., Chokechaijaroenporn, O. (1996). Antidiabetic activity of Aloe vera L juice. Clinical trial in new cases of diabetes mellitus. Phytomedicine. 3: 241-243.

104

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

DETERMINACIÓN DE NIVELES DE CITOQUINAS CIRCULANTES EN SUJETOS CON CÁNCER DE MAMA A DIFERENTES IMC I.Q.I. Luis Eduardo Suárez–Nájera1, D. en C. José Jorge Chanona–Pérez1, M. en C. Marco Antonio Castro–Reyes2, D. en C. Mauricio Salcedo–Vargas3, D. en C. Leticia Manuel– Apolinar4, M. en C. Leticia Damasio–Santana4, Dr. David Israel García–Ruíz5, D. en C. Alejandra Valdivia–Flores6 ABSTRACT. Breast cancer (BC) and obesity are conditions associated with biochemical and hormonal changes in persons which present those diseases. Due to it is known that obesity is a risk factor for BC development, a comparative study was performed to known the levels of cytokines associated with obesity and metabolic syndrome (adiponectin, resistin and TNF–α), in adult Mexican women diagnosed with BC at different BMI. Results showed that some cytokines levels were independent to BMI for BC subjects. KEYWORDS: Breast cancer, BMI, adiponectin, TNF alpha, resistin

I. INTRODUCCIÓN l CaMa es una de las neoplasias más comunes que, a nivel mundial, ocupa actualmente el primer lugar en mortalidad femenina por causas relacionadas a tumores malignos (1). En México, de acuerdo con datos internacionales (2), se registraron, en 2013, un total de 5,337 decesos en mujeres de todas las edades, lo cual implica un promedio de una muerte cada hora y media, mientras que las incidencias reportadas por éste tipo de cáncer fueron de 13,987 casos en 2009 (3). Por otro lado, se sabe la obesidad que es un factor de riesgo para la aparición y desarrollo del CaMa. Entre las razones por las cuales se considera que existe una relación entre la obesidad y el desarrollo del CaMa, se menciona la regulación de citoquinas del tejido adiposo hacia el cuerpo. Entre algunas de las citoquinas que son secretadas por el tejido adiposo durante la obesidad, y la evolución de síndrome

E

metabólico, se encuentran la adiponectina, la resistina y el factor de necrosis tumoral alfa (TNF–α). En México, la información entre obesidad, analizada en función al nivel de citoquinas circulantes, y CaMa, está comenzando a analizarse. Con base en lo anterior, se efectuó un estudio comparativo entre los niveles de las citoquinas circulantes, anteriomente mencionadas, para un grupo de mexicanos adultos con CaMa a diferentes índices de masa corporal (IMCs).

fueron captadas por el Servicio de Ginecología del Hospital de Oncología del Centro Médico Nacional Siglo XXI (CMNSXXI). Determinación de citoquinas circulantes Se determinaron, mediante técnica de ELISA indirecta en plasma y la posterior elaboración de las respectivas curvas de concentración, los niveles de adiponectina, resistina y TNF–α circulantes en muestras sanguíneas provenientes de las mujeres del grupo de estudio. Las muestras fueron tomadas tras ayuno de 8 a 10 horas. Análisis Estadístico Para el análisis de información, se empleó estadística descriptiva, pruebas de normalidad y un análisis de varianza unifactorial entre grupos de una vía (One–Way ANOVA). La significancia estadística fue aceptada a p<0.05. Todas las pruebas se efectuaron mediante el uso del software SigmaPlotTM v.13.0 (SYSTAT Software Inc., Estados Unidos).

II. METODOLOGÍA Sujetos Los materiales biológicos para este estudio se obtuvieron, previa firma del consentimiento informado, de muestras sanguíneas de 18 (n=18) mexicanas adultas con III. RESULTADOS Y DISCUSIÓN diagnóstico de CaMa, las cuales

IPN, Escuela Nacional de Ciencias Biológicas, Departamento de Ingeniería Bioquímica IPN, Centro Interdisciplinario de Ciencias de la Salud, Unidad Milpa Alta 3 Laboratorio de Oncología Genómica, Hospital de Oncología del CMNSXXI 4 UIEE, Hospital de Especialidades del CMNSXXI 5 Servicio de Cirugía Oncológica, Hospital de Oncología del CMNSXXI 6 Instituto Politécnico Nacional, SIP-DI-DOPI. 1 2

www.conferenciasindromemetabolico.org

105


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

De forma general, las mujeres con CaMa promediaron una edad de 60.4 años (± 9.5 años), mientras que el análisis ELISA mostró que los niveles medios de las citoquinas circulantes fueron de 12.21 ng/mL (± 2.16 ng/mL) para adiponectina, de 16.98 ng/mL (± 3.54 ng/mL) para resistina y de 10.30 pg/mL (± 10.89 pg/mL) para TNF–α. Los valores de resistina y TNF–α obtenidos, para las mujeres del estudio, fueron menores que los reportados en la literatura para personas normopeso, y para personas con obesidad, sin presencia de cáncer (4, 5). Por su parte, los valores de adiponectina obtenidos mostraron ser similares a los reportados en la literatura para mujeres con alto riesgo para desarrollo de CaMa (6). Adicionalmente, al efectuar un análisis de los niveles de adiponectina, resistina y TNF–α, por IMC (Tabla 1), se determinó que no existe una diferencia estadística entre grupos para cada citoquina. Lo anterior sugiere que el CaMa tiene el potencial de modificar, aparentemente por sí solo, la expresión de las citoquinas de estudio independientemente del

106

www.conferenciasindromemetabolico.org

estado nutricio de las personas.

IV. CONCLUSIONES Se pudo determinar que no existió correlación alguna entre el IMC y los niveles de las citoquinas estudiadas para mujeres que presentaron CaMa. Un estudio más detallado que considere la expresión de adiponectina, resistina y TNF–α en tejido, es necesario para tener una mayor comprensión sobre el porqué dichas citoquinas parecen ser independientes del IMC en personas con CaMa. V. AGRADECIMIENTOS Ésta investigación ha sido financiada a través de los proyectos individuales 20164790, 20150397 y 20161632 del Instituto Politécnico Nacional.

VI. BIBLIOGRAFÍA 1. Benson J R, Jatoi I, (2012). The global breast cancer burden. Futur Oncol, 8(6):697–702. 2. WHO Cancer Mortality Database [Internet]. World Health Organization. International Agency for Research on Cancer. France. 2015 [cited 2016 Jun 29] Available

V3-N1 - 2016

from: http://www-dep.iarc.fr/ WHOdb/WHOdb.htm 3. Boletín Epidemiológico, Sistema Nacional de Vigilancia Epidemiológica, Sistema único de Información, Número 26, Volumen 30, Semana 26 [Internet]. Secretaría de Salud. Mexico. 2013 [cited 2016 Apr 4]. Available from: http://www.epidemiologia.salud. gob.mx/doctos/boletin/2013/semanas/sem26/pdf/edit2613.pdf 4. Arican O, Aral M, Sasmaz S, Ciragil P, (2005). Serum levels of TNF–α, IFN–γ, IL–6, IL–8, IL–12, IL–17, and IL–18 in patients with active psoriasis and correlation with disease severity. Mediators of inflammation, 2005(5):273–279. 5. Sun CA, Wu MH, Chu CH, Chou YC, Hsu GC, Yang T, et al., (2010). Adipocytokine resistin and breast cancer risk. Breast Cancer Res Treat, 123:869–876. 6. Macis D, Gandini S, Guerrieri–Gonzaga A, Johansson H, Magni P, Ruscica M, et al., (2012). Prognostic effect of circulating adiponectin in a randomized 2×2 trial of low–dose tamoxifen and fenretinide in premenopausal women at risk for breast cancer. Journal of clinical oncology, 30(2):151–157. 7. WHO Global Database on Body Mass Index [Internet]. World Health Organization. Switzerland. 2006 [cited 2016 Jun 29] Available from: http://apps.who.int/bmi/ index.jsp?introPage=intro_3.html


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CORRELACIÓN DE CORTISOL Y SENSIBILIDAD A LA INSULINA EN SUJETOS DEL CENTRO DE MÉXICO MASS Guadalupe Ruiz Vivanco1,2,3, DC Blanca G. Báez Duarte2, DC Enrique Torres Rasgado2, DC Leonardo M. Porchia3, DC. M. Elba González Mejia2, DC Jorge Rodríguez Antolín4, DC Ricardo Pérez Fuentes2,3 ABSTRACT. Metabolic syndrome (MS) is a global health problem, by its association with cardiovascular disease and diabetes. Previous studies reported an overexpression of the enzyme 11β-HSD1 in adipocytes of obese subjects. There is an association between the concentrations of cortisol and insulin resistance (IR), suggesting overactivity of the pituitary-adrenal axis in MS. Cortisol has also been linked to the severity of certain clinical measures in subjects with type 2 diabetes (T2D). The Insulin sensitivity (IS) has an early indicator for SM and DT2. The association of IS to cortisol, has been little studied. The aim of this work was determinate the relationship between cortisol serum levels and IS. 264 subjects were anthropometric, clinical and metabolically characterized. The diagnosis of MS was by the ATP III criteria, modified. Cortisol quantified by chemiluminescence assay. The 59.84% are SM+ with anthropometric and metabolic parameters significantly higher, and decreased HOMA IS. Subjects with MS had 20.8 ± 4.3 mg / dl vs 17.8 ± cortisol 4.4 mg / dl of the MS- (p <0.05). There is a negative correlation between the concentration of cortisol and SI (-0.221, p <0.05). KEY WORDS: Metabolic syndrome, Cortisol, Insulin sensitivity

I. INTRODUCCIÓN l síndrome metabólico (SM), definido como un conjunto de factores de riesgo de enfermedad cardiovascular, incluyendo obesidad general o central, resistencia a la insulina (RI), disglicemia, dislipidemia y presión arterial alta1; es considerado un problema de salud pública a nivel mundial2. La prevalencia en México varía de 36.8 a 49.8 %, según nos criterios del ATP III o la IDF, respectivamente3, por arriba incluso de países desarrollados4. La IDF ha incluido al eje pituitario-adrenal, dentro de los factores hormonales que deben ser investigados en SM5. El cortisol es el principal glucocorticoide secretado por la corteza suprarrenal, la enzima 11β-HSD1 convierte la cortisona inactiva en

E

cortisol6, ésta enzima se expresa principalmente en hígado y tejido adiposo visceral y subcutáneo, también se ha encontrado en glándulas suprarrenales, ovario, placenta y células dendríticas7. El cortisol, tiene efectos antagonistas a la insulina. Durante la hipoglucemia esta hormona se secreta, restaurando los niveles de glucosa en sangre mediante la estimulación de la liberación de glucosa desde el hígado (gluconeogénesis) y la inhibición de la captación de glucosa en los tejidos periféricos8. Estudios en humanos han demostrado que sujetos obesos sobre expresan a la enzima 11β-HSD1 en tejido graso en comparación

con los no obesos; promoviendo la acumulación de más tejido adiposo metabólicamente activo9. Cuando el cortisol es hipersecretado en forma crónica, pueden producirse secuelas fisiológicas deletéreas. Niveles elevados de esta hormona podrían producir resistencia a la insulina e hiperglucemia; y podría, jugar un papel importante en el desarrollo y severidad de SM y Diabetes Tipo 2 (DT2). 10,11,12. La sensibilidad a la insulina (SI) ha demostrado ser un indicador, para la detección temprana de SM y DT213,14. Considerando lo anterior, el presente trabajo se propuso evaluar los niveles de cortisol sérico en sujetos con SM.

II. METODOLOGÍA Se diseñó un estudio analítico, transversal y prolectivo para determinar relación entre los niveles de cortisol sérico y la SI. 264 sujetos de la ciudad de Puebla, de ambos géneros en edades comprendidas entre los 18 a 60 años se caracterizaron antropométrica (peso, talla, Índice de Masa Corporal IMC con la báscula electrónica Tanita TBF215; y el Perímetro de Cintura PC se midió con una cinta seca 201),

Doctorado en Ciencias Biológicas, UATx Facultad de Medicina, BUAP 3 Laboratorio de Investigación en Fisiopatología de Enfermedades Crónicas, CIBIOR, IMSS 4 Centro Tlaxcala de Biología de la Conducta, UATx 1 2

www.conferenciasindromemetabolico.org

107


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

clínica (encuesta clínica y medición de PA, con un baumanómetro digital Omron HEM7113) y metabólicamente (GA, Insulina, TGC, HDL, métodos automatizados, HOMA-IR y HOMA-β, utilizando el programa informático modelo HOMA 2, disponible en www.OCDEM.ox.ac.uk). La Sensibilidad a la Insulina se determinó con QUICKI= 1/ (log Ins + log GA mg/dL). Se cuantificaron los niveles de cortisol por ensayo de quimioluminiscencia inmuno absorbente en suero. Análisis estadístico: SPSS v12.

A Villegas-Tovar R. de la DGB, BUAP. RVG Becario CONACyT: 231637. Este trabajo tuvo apoyo de la VIEP, BUAP, clave RUVG-SAL15-I y RUVG-SAL16-I. Los autores declaran que no existe conflicto de intereses que pudiera afectar negativamente la imparcialidad de este trabajo.

III. RESULTADOS Los criterios para diagnóstico de SM encontrados se muestran en el cuadro 1. Los niveles de cortisol sérico fueron significativamente más altos en SM+ (Fig. 1). Se encontró una correlación inversa entre la concentración de Cortisol y la SI -0.221 (p<0.05), lo cual concuerda con los hallazgos de Adam TC y cols. en adolescentes latinos en EU15. Además, se ha descrito que esta correlación es independiente de la grasa corporal16.

IV. CONCLUSIONES La SI es una de las alteraciones metabólicas iniciales en SM y DT2. En este estudio se mostró la relación de la SI con la concentración de Cortisol. La presencia de una disminución de la SI con elevación de las concentraciones de cortisol sérico podría exacerbar el descontrol metabólico en riesgo de desarrollar SM y sus complicaciones. Agradecimientos

108

www.conferenciasindromemetabolico.org

V. BIBLIOGRAFÍA 1. Cornier MA, Dabelea D, Hernandez TL, et al. The metabolic syndrome. Endocr Rev. 2008; 29: 777–822. 2. Grundy SM. Metabolic Syndrome Pandemic. Arterioscler Thromb Vasc Biol. 2008; 28: 629-

V3-N1 - 2016

636. 3. Rojas R, Aguilar-Salinas CA, Jiménez-Corona A, et al. Metabolic syndrome in Mexican adults: results from the National Health and Nutrition Survey 2006. Salud Pública Méx. 2010; 52( Suppl 1): S11-S18. 4. O´Neil S, O´Driscoll L. Metabolic syndrome: a closer look at the growing epidemic and its associated pathologies. Obesity Reviews. 2015; 16: 1-12. 5. International Diabetes Federation, The IDF consensus worldwide definition of the Metabolic Syndrome. IDF Communications. Brussels, Belgian. 2006. 6. Scheen AJ, Beck E. L’enzyme11β-HSD1: une nouvelle cible potentielle pour le traitement du diabète de type 2 et des maladies métaboliques liées à l’obésité. Rev Diabète Obésité. 2013; 8:2-4. 7. Baudrand BR, Arteaga UE, Moreno GM. El tejido graso como modulador endocrino: Cambios hormonales asociados a la obesidad. Rev Med Chile. 2010; 138: 1294-1301. 8. Khani S, Tayek JA. Cortisol increases gluconeogenesis in humans: its role in the metabolic syndrome. Clinical Science. 2001; 101: 739–747. 9. Mariniello B, Ronconi V, Rilli S, et al. Adipose tissue 11beta-hydroxysteroid dehydrogenase type 1 expression in obesity and Cushing’s syndrome. Eur J Endocrinol. 2006; 155: 435- 41. 10. Paredes S, Ribeiro L. Cortisol: the villian in Metabolic Syndrome? Rev Assoc Med Bras, 2014; 60(1): 84-92.)


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

11. Anagnostis P, Athyros VG, Tziomalos K, et al. The Pathogenetic Role of Cortisol in the Metabolic Syndrome: A Hypothesis. J Clin Endocrinol Metab. 2009, 94(8): 2692–2701) 12. Oltmanns KM, Dodt B, Schultes B, et al. Cortisol correlates with metabolic disturbances in a population study of type 2 diabetic patients. European Journal of Endocrinology. 2006; 154: 325–331. 13. Baez-Duarte BG, Sanchez-Guillen Mdel C, Perez-Fuentes R, et al. Beta-cell function is associated with metabolic syndrome in Mexican subjects. Diabetes Metab Syndr Obes. 2010; 3: 301e309. 14. Pérez-Fuentes R, BaezDuarte B, Zamora-Ginez I, et al. Early Decrease of Insulin Sensitivity in Offspring of Individuals with Type 2 Diabetes. The Mexican Diabetes Prevention Study. Archives of Medical Research. 2014; 45: 217-222. 15. Adam TC, Hasson RE, Ventura EE, et al. Cortisol is negatively associated with insilin sensitivity in overweight latino youth. J Clin Endocrinol Metab. 2010; 95: 4729–4735. 16. Holt H, Wild S, Postle A, et al. Cortisol clearance and associations with insulin sensitivity, body fat and fatty liver in middleaged men. Diabetologia. 2007; 50: 1024–1032.

www.conferenciasindromemetabolico.org

109


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CORRELACIÓN ENTRE EL ÍNDICE CARDIOVASCULAR Y RESISTINA EN PACIENTES CON DISGLICEMIA M.P.S.S. Dania Guadalupe Solis Cano1, D en C. Leonardo M. Porchia2, D en C. Martha Elba Gonzalez Mejia3, M.A.S.S. Guadalupe Ruiz Vivanco2, 3, 4, D en C. Enrique Torres Rasgado3, D en C. Ricardo Pérez Fuentes2, 3 ABSTRACT. Background: Resistin is associated with elevated inflammatory cytokines, such as TNF, IL-6 and C-reactive protein, thus indicating a possible predictor of cardiovascular disease. Objective: To determine the correlation between Resistin and Cardiovascular Disease Risk (CVR) in Patients with dysglycemia. Subjects and Methods: One hundred eighty-three patients from the Family Medicine Unit #2 in the city of Puebla, Mexico were included in this cross-sectional study. The subjects’ anthropometric, clinical, and biochemical profile [fasting plasma glucose, 2h post-prandial glucose, HbA1c, high-density lipoprotein (HDL), total cholesterol (TC), and triglycerides (TGC)] was assessed. Resistin levels were determined by ELISA. Subjects were separated into Normoglycemic (NGT), prediabetic (PT2D), or Diabetic Patients (T2D) based on the American Diabetes Association recommendations. CVR was determined by the Castelli Index (COL/HDL) and the cardiovascular risk (TGC/HDL). Associations between variables were determined by calculating Spearman’s rho ( ). Results: No correlation was observed between resistin and CVR. However, when the subjects were stratified by glycemic control, there was a weak positive correlation for PT2D ( =0.20, p<0.05 for both indices) and a moderate negative correlation for T2D ( =-0.44 and =-0.28 for the cardiovascular risk and Castelli indices, respectively, p<0.05). Conclusions: Here, we demonstrate a dual nature between resisitin and CVR that was dependent on glycemic status of the subject. For T2D, there was a benefit for elevated resistin levels, whereas for PT2D, there was an increase risk of developing cardiovascular disease, which the mechanism remains unknown. KEYWORDS: Prediabetes, Type 2 Diabetes, Resisitin, Cardiovascular Risk

I. INTRODUCCIÓN a Diabetes Tipo 2 (DT2) es la primera causa de morbi-mortalidad en nuestro país debido a las complicaciones microvascuares y macrovasculares que presenta esta enfermedad 1. Los estudios realizados en humanos reportan que cerca del 90% de los pacientes con DT2 son obesos lo cual sugiere un probable nexo entre la obesidad y el desarrollo de DT2 2 que es atribuido a un estado metabólico definido como Resistencia a la Insulina (RI) donde se afecta la secreción y/o acción de la insulina sobre el me-

L 110

www.conferenciasindromemetabolico.org

tabolismo de la glucosa 3. Por otra parte se reconoce que el adipocito no sólo almacena energía en forma de triglicéridos sino que también es un órgano endócrino, productor y secretor de adipocinas 4 como la resistina, también llamada Factor secretor del adipocito (ADSF) o Zona inflamatoria (FIZZ3) 5. La resistina no solo se secreta por el adiposito si no tambien por varias celulas del sistema inmune, lo que

nos indica el papel que tiene esta citoquina en diferentes enfermedades inflamatorias cronicas como en la diabetes 6. Por lo que este trabajo tuvo el objetivo de determinar la correlación entre Resistina y el indice Cardiovascular (ICV) en pacientes con disglicemia.

II. MATERIAL Y MÉTODOS Se incluyó a 183 pacientes del UMF-2-LIFEC-CIBIOR de Puebla. Se caracterizaron antropométrica y metabolicamente, incluyendo; índice de masa corporal (IMC), glucosa de ayuno (GA), tolerancia oral a la glucosa (TOG), HbA1c, insulina (Ins), triglicéridos (TGC), Colesterol Total (CT), VLDL, LDL, HDL. Se conformaron 3 grupos de estudio: Grupo 1; normoglucemicos (NG), Grupo 2. Pacientes Prediabéticos (PDT2), Grupo 3; Pacientes diabéticos tipo 2 (DT2) de acuerdo a la ADA. El riesgo de desarrollar enfermedades cardiovasculares se calculo por medio de dos indice, el indice cardiovascular (ICV) con la formula: TGC/HDL-C con un punto de corte de >3 7; y el índice de Castelli COL/HDL con un punto de corte de >5 1. A estos

Licenciatura en Medicina, Universidad Popular Autónoma del Estado de Puebla; Programa de Servicio Social en el SNS modalidad en investigación en salud. 2 Laboratorio de Investigación en Fisiopatología de Enfermedades Crónicas, Centro de Investigación Biomédica de Oriente, IMSS. 3 Facultad de Medicina de la Benemérita Universidad Autónoma de Puebla, 4 Doctorado en Ciencias Biológicas, Universidad Autónoma de Tlaxcala. 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

grupos de estudio se les determinaron los niveles séricos de resistina mediante un ensayo inmunoenzimático (ELISA). Los resultados obtenidos se analizarón mediante el programa SPSS. III. RESULTADOS

p<0.05). Por otro lado, hubo una asociación negativa entre la resistina y el indice cardiovascular (COL/HDL) ( =-0.44 p<0.05) en pacientes PDT2 y DT2 ( =-0.28, p<0.05).

En la figura 1 se observa que los niveles de resistina no cambiaron significativamente, mientras que los indices de castelli (COL/HDL) y (TGC/HDL) aumentaron. No se encontró asociación significativa en la población total ni en los pacientes normoglucemicos. Sin embargo, se mostró una asociación positiva entre resistina y el índice de Castelli en paciente PDT2 ( =0.20 p<0.05) y de igual forma en los pacientes DT2 ( =0.20,

IV. CONCLUSIÓN Los resultados muestran una naturaleza dual entre resistina y el índice cardiovascular que es dependiente del estado glucémico del sujeto. Por lo que se sugiere realizar mas estudios para determinar el mecanismo fisiopatológico de la resistina asociada a riesgo cardiovascular o con bien con relación alguna otra enfermedad concomitante que pudiera estar causando este efecto.

V3-N1 - 2016

V. BIBLIOGRAFÍA 1. Ebong IA, Goff DC, Jr., Rodriguez CJ, Chen H, Sibley CT, Bertoni AG. Association of lipids with incident heart failure among adults with and without diabetes mellitus: Multiethnic Study of Atherosclerosis. Circ Heart Fail. 2013;6(3):371378. 2. Nieva-Vazquez A, Perez-Fuentes R, Torres-Rasgado E, Lopez-Lopez JG, Romero JR. Serum resistin levels are associated with adiposity and insulin sensitivity in obese Hispanic subjects. Metab Syndr Relat Disord. 2014;12(2):143148. 3. Ferreira-Hermosillo A, Molina-Ayala M, Ramirez-Renteria C, et al. Inflammatory Cytokine Profile Associated with Metabolic Syndrome in Adult Patients with Type 1 Diabetes. J Diabetes Res. 2015;2015:972073. 4. Al Hannan F, Culligan KG. Human resistin and the RELM of Inflammation in diabesity. Diabetol Metab Syndr. 2015;7:54. 5. Al-Suhaimi EA, Shehzad A. Leptin, resistin and visfatin: the missing link between endocrine metabolic disorders and immunity. Eur J Med Res. 2013;18:12. 6. Devanoorkar A, Kathariya R, Guttiganur N, Gopalakrishnan D, Bagchi P. Resistin: a potential biomarker for periodontitis influenced diabetes mellitus and diabetes induced periodontitis. Dis Markers. 2014;2014:930206. 7. Marotta T, Russo BF, Ferrara LA. Triglyceride-to-HDL-cholesterol ratio and metabolic syndrome as contributors to cardiovascular risk in overweight patients. Obesity (Silver Spring). 2010;18(8):1608-1613.

www.conferenciasindromemetabolico.org

111


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

NIVELES DE AMILINA EN SUJETOS CON SÍNDROME METABÓLICO D. en C. Torres-Rasgado Enrique1, M. en C. Pulido-Pérez Patricia2, M.A.S.S. Ruiz-Vivanco Guadalupe1, D. en C. Baez-Duarte Blanca Guadalupe1, D. en C. Gonzalez-Mejia Martha Elba1, D. en C. Leonardo M Porchia2, D. en C. Pérez-Fuentes Ricardo1,2 ABSTRACT. Background: Metabolic syndrome (MS) is defined by the presence of a number of disorders that increase the risk of developing cardiovascular disease and type 2 diabetes. Its pathogenesis has not been fully elucidated, but there are signs that suggest the involvement of amylin this process. Objective: To quantify amylin levels in patients with metabolic syndrome. MATERIALS AND METHODS: 367 subjects of UMFNo.2 IMSS met the selection criteria were designed. They took blood pressure (BP) and evaluated anthropometric and metabolically. ATP-III was used to diagnose MS. Amylin levels were measured by millipore kit and the results were analyzed by SPSS software of. RESULTS: Our results show that 56.7% presented SM. Amylin levels were significantly higher in patients with MS (+) than SM (-) (10.4 ± 7.7 vs 7.7 ± 4.5, pg/L; p <0.01). CONCLUSION: The level of amylin in subjects diagnosed with MS is raised above the level of subjects without MS, suggesting their involvement in the development of complications of metabolic syndrome. PALABRAS CLAVE: Amylin, IAPP, Metabolic Syndrome.

I. INTRODUCCIÓN l síndrome metabólico (SM), definido por la presencia de obesidad central, hipertensión arterial y alteraciones en el metabolismo de lípidos y carbohidratos [1,2], representa un serio problema de salud pública [2-4]. Para su diagnóstico se han propuesto varios criterios, sin embargo, lo más aceptados son los que dicta the National Cholesterol Education Program Adult Treatment Panel III (NCEP:ATPIII) [4]. Los mecanismos que intervienen en el desarrollo de las complicaciones del SM no han sido dilucidados completamente, pero se han implicado varios fenómenos en el proceso; entre ellos podemos mencionar la resistencia a la insulina (RI) a nivel hepático, adiposo y muscular, un estado de desequilibrio entre los factores prooxidantes y antioxidantes, y factores

E

112

www.conferenciasindromemetabolico.org

dietéticos tales como el alto consumo en ácidos grasos trans, aminoácidos de cadena ramificada, etanol y fructosa, que al ser metabolizados dan como resultado productos nocivos para el organismo [5,6]. La amilina (IAPP, islet amyloid polypeptide) es un polipéptido de 37 aminoácidos secretado a la par que la insulina por la célula β pancreática. Se sabe que, a concentraciones farmacológicas, la amilina tiene efecto sobre la regulación del equilibrio energético. Asimismo, regula el apetito a través de una vía central que disminuye el vaciamiento gástrico [7-9]. Aunque no se ha logrado demostrar la repercusión clínica de estos efectos, se piensa que la amilina

podría participar en la regulación de los nivel de glucosa en el torrente sanguíneo [10]. Además de los efectos fisiológicos, también se han descrito efectos patogénicos de la amilina sobre la célula β. Esto sucede cuando, bajo ciertas circunstancias, las moléculas de amilina forman sustancia amiloide al autoagregarse. Se ha identificado a la secuencia 24-28 glicina-alanina-isoleucina-leucina-serina (GAILS) como la responsable de la capacidad amiloidogénica de la amilina [8-10]. Una vez depositada la sustancia amiloide en la célula β, ésta induce la apoptosis de la misma a través de la expresión del receptor de muerte celular Fas y FADD [10]. Se ha asociado a la amilina en la fisiopatogenia de la DT2 [9], así como inflamación crónica de baja intensidad por su asociación con proteína C reactiva e IL-6 [9]. Existe correlación positiva entre los niveles de triglicéridos y los niveles plasmáticos de amilina en sujetos obesos [10]. Todas estas condiciones están presentes en el SM, por lo que se ha propuesto que la amilina juega un papel importante en el desarrollo de las complicaciones del SM. El Objetivo del trabajo fue determinar los niveles

Facultad de Medicina de la Benemérita Universidad Autónoma de Puebla Laboratorio de Investigación en Fisiopatología de Enfermedades Crónicas, Centro de Investigación Biomédica de Oriente, UMF-2, IMSS 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

de amilina en pacientes con sín- (GA), tolerancia oral a la glucosa drome metabólico. (TOG), ácido úrico (AU), triglicéridos (TGC), Lipoproteina de alta II. MATERIALES Y MÉTODO densidad (HDL)). Finalmente se Se diseñó un estudio descriptivo realizó la medición de amilina con las siguientes características: utilizando el kit de millipore y se observacional, transversal, pros- analizaron los resultados utilizanpectivo y unicéntrico; donde la do estadística descriptiva (media población a estudiar fue una mues- y desviación estándar) por medio tra de 367 pacientes evaluados en del programa estadístico SPSS. las instalaciones del Laboratorio de Fisiopatología de Enferme- III. RESULTADOS dades Crónicas (LIFEC) del Centro de Investigación Biomédica de Oriente (CIBIOR) en la Unidad Médico Familiar número 2 (UMF-2) del IMSS en Puebla. Se conformaron 2 grupos; uno con Síndrome Metabólico (SM(+)) y otro sin Síndrome Metabólico (SM(-)) por medio NCEP ATP-III con valores de PCI ajustados por Zimmet et al. para la población mexicana; estos son: PA ≥ 130/85 mmHg, GA ≥ 100 mg/dL, TG ≥ 150 mg/dL, HDL en hombres < 40 y en mujeres < 50 mg/dL, PCI ≥ 90 en hombres y en mujeres ≥ 80 cm. Se caracterizaron clínicamente mediante la aplicación de interrogatorios clínicos y la medición de la presión arterial. La caracterización antropométrica se llevó a cabo mediante mediciones antropométricas (índice de masa corporal (IMC), perímetro de cintura (PCi), perímetro de cadera (PCa), porcentaje de grasa corpo- Los pacientes con SM(+) presentaral (%GC), masa grasa (MG) y masa ron todos los parámetros significamagra (MM)). Posteriormente se tivamente mas altos que los SM(-). caracterizó metabólicamente a los En el Gráfico 1 se muestran los pacientes participantes, esto me- niveles de amilina, los cuales fuediante la toma de una muestra san- ron estadísticamente mayor en los guínea con ayuno de 12 horas que pacientes con SM(+) vs SM(-) (9.4 permitió evaluar sus parámetros ± 0.9 vs 7.9 ± 1.1 pg/L. p < 0.01; metabólicos (glucosa en ayuno U-Mann Whitney).

V3-N1 - 2016

IV. CONCLUSIONES Nuestros resultados muestran un aumento de los niveles de amilina en los sujetos con SM, lo que sugiere su participación en la patogénesis del SM. Sin embargo se requieren estudios prospectivos para dilucidar la fisiopatología de la amilina en el SM.

V. REFERENCIAS 1. Cornier MA, Dabelea D, Hernández TL, Lindstrom RC, Steig AJ, Stob NR, Van-Pelt RE, Wang H, Eckel RH. The Metabolic Syndrome. Endocr Rev. 2008 Dic; 29(7):777-822. 2. Aguilar-Salinas CA, Rojas R, Gómez-Pérez FJ, Valles V, Ríoswww.conferenciasindromemetabolico.org

113


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Torres JM, Franco A, Olaiz G, Rull JA, Sepúlveda J. High prevalence of metabolic syndrome in Mexico. Arch Med Res. 2004 Ene; 35(1):7681. 3. Hutcheson R, Rocic P. The Metabolic Syndrome, Oxidative Stress, Environment, and Cardiovascular Disease: The Great Exploration. Exp Diabetes Res. 2012. doi:10.1155/2012/271028. 4. Westermark P, Andersson A, Westermark GT. Islet amyloid polypeptide, islet amyloid, and diabetes mellitus. Physiol Rev. 2011; 91:795-826. 5. Luca S, Yau WM, Leapman R, Tycko R. Peptide Conformation and Supramolecular Organization in Amylin Fibrils: Constraints from Solid State NMR. Biochemistry. 2007 Nov; 46(47):13505-13522. 6. Wiltzius JJW, Sievers SA, Sawaya MR, Eisenberg D. Atomic strutures of IAPP (amylin) fusions suggest a mechanism for fibrillation and the role of insulin in the process. Protein Sci. 2009; 18:1521-1530. 7. Yanemoto IT, Kroon GJA, Dyson HJ, Balch WE, Kelly JW. Amylin Proprotein Processing Generates Progressively More Amyloidogenic Peptides that Initially Sample the Helical State. Biochemistry. 2008 Sept; 47(37):99009910. 8. Zhang S, Liu H, Yu H, Cooper. Fas-Associated Death Receptor Signaling Evoked by Human Amylin in Islet β-Cells. Diabetes. 2008 Feb; 57:348-356. 9. Jhamandas JH, MacTavish D. β-Amyloid protein (Aβ) and human amylin regulation of apop114

www.conferenciasindromemetabolico.org

totic genes occurs through the amylin receptor. Apoptosis. 2012; 17:37-47. 10. Hou X, Sun L, LimZ, Mou H, Yu Z, Li H, Jiang P, Yu D, Wu H, Ye X, Lin X, Le Y. Associations of Amylin with Inflammatory Markers and Metabolic Syndrome in Apparently Healthy Chinese. PLoS ONE. 2011 Sept; 6(9):e24815.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CARACTERIZACIÓN DE SUBPOBLACIONES CELULARES ASOCIADAS AL PROCESO INFLAMATORIO DE PACIENTES CON DIABETES MELLITUS TIPO 2 M.S.P. Jesús A. Deloya-Villanueva1; Q.F.B. Mauricio Castillo-Salazar1; Dra. Sara García-Jiménez1, Dr. Miguel Angel Sánchez Alemán2; M. en IBB Rosario Leyva-Meza1; Dr. Germán Bernal-Fernández1 RESUMEN Introducción. La diabetes mellitus (DM) es una enfermedad crónico-degenerativa que cursa por hiperglucemia, y defectos en la secreción y/o acción de la insulina. En el mundo existen 415 millones de personas con DM y se estima que en 2040 habrá 642 millones de casos, de los cuales el 90% son DM tipo 2 (DM2). La respuesta inmunológica es fundamental en esta enfermedad ya que cursa con un proceso inflamatorio crónico sistémico de bajo grado por la presencia de macrófagos M1 (proinflamatorios), sobreproducción de citocinas como IL-1β, IL-6, TNF-α y linfocitos Th1 y Th17. Objetivo. Cuantificar las subpoblaciones celulares de monocitos/macrófagos, linfocitos T reguladores (Treg) y la producción de citocinas pro-inflamatorias de pacientes con DM2. Metodología. Los pacientes diabéticos se clasificaron en controlados y no controlados, previo consentimiento informado, se determinaron parámetros bioquímico-clínicos, y se analizarón las subpoblaciones M1 (CD14+ CD16+ CD 163-) y M2 (CD14+ CD16+ CD163+), de monocitos/ macrófagos y linfocitos Treg (CD3+, CD4+, CD39+ y CD103+) por citometría de flujo, a partir de células mononucleares (CMN). Posteriormente, las CMN se estimularon in vitro y se determinaron subpoblaciones M1, M2 y Treg post-cultivo. Resultados. Pacientes controlados 29 (57%) y no controlados 22 (43%). La glicemia y HbA1c de controlados fue de 119.59 mg/dL y de 6.35% respectivamente, en contraste, con los no controlados de 193.54 mg/dL y 8.21%. Los monocitos/macrófagos M1 se expresaron en un 38% y M2 en un 0.85%. Los primeros se expresan casi 50 veces más que los M2, mientras que el promedio de linfocitos Treg fue de 7.78%; se observa una disminución en esta subpoblación acorde a la literatura. Conclusiones. En DM2, predomina el fenotipo M1 respecto al M2 y disminución de linfocitos T reg característico del proceso inflamatorio crónico sistémico de bajo grado por el que cursa esta patología. PALABRAS CLAVE: diabetes, inflamación, monocitos, linfocitos T,

I. INTRODUCCIÓN a (DM) cursa por hiperglucemia, trastornos metabólicos y defectos en la secreción y/o acción de la insulina. La FID reporta 415 millones de pacientes con DM; y para 2040 serán 642 millones. El 90% son casos de DM2(1). La NOM-015 SSA 2-2010, para la prevención, tratamiento y control de la DM inciso 3.10, clasifica a los pacientes con DM2 en controlados y no controlados.

L

Los primeros presentan niveles de glicemia plasmática en ayuno (GPA) entre 70 y 130 mg/dL y hemoglobina glicosilada (HbA1c) por debajo de 7% (2). En esta enfermedad se observa la sobreproducción de citocinas proinflamatorias como IL-1β, IL-6, TNF-α e IFN-γ, resistencia a la insulina (3). El tejido adiposo de pacientes con

DM2 presenta un incremento de macrófagos proinflamatorios denominados M1, productores de citocinas como TNF-α e IL-6, en contraste los individuos sanos expresan un fenotipo de macrófagos antiinflamatorios denominados M2, que actúan mediante un mecanismo dependiente de citocinas antiinflamatorias (4). En DM2, varios estudios reportan una disminución de los linfocitos Treg, los cuales suprimen la respuesta inmunológica (5).

II. METODOLOGÍA 1.-Selección y sensibilización de la población derechohabientes del IMSS con diagnóstico previo de DM2. 2.-Se obtuvo una muestra sanguínea, previo consentimiento informado, para determinar glucosa, HbA1c y clasificar a los pacientes con DM2 controlados y no controlados, también se utilizó para el hemograma y la separación de CMN por ficoll-hypaque para citometría de flujo y cultivo. 3.-Las CMN se marcaron y se analizaron las subpoblaciones de monocitos M1 (proinflamatorios CD14+, CD16+ y CD 163-) y M2

1

Facultad de Farmacia, Universidad Autónoma del Estado de Morelos

2

Centro de Investigación Enfermedades Infecciosas del Instituto Nacional de Salud Pública,

www.conferenciasindromemetabolico.org

115


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

(antiinflamatorios CD14+, CD16+ y CD163+) y linfocitos Treg (CD3+, CD4+, CD39+ y CD103+) por citometría de flujo. 4.-Estimulación de CMN in vitro con anticuerpos monoclonales OKT3 para determinar proliferación celular, mediante el marcaje con CPDF- 670. 5.-Obtención de células mononucleares del cultivo y determinación de las subpoblaciones M1 y M2 de monocitos/macrófagos y linfocitos Treg por citometría de flujo.

III. RESULTADOS De la población estudiada (51 pacientes), la mayoría oscila entre 51 y 59 años de edad (33.3%); mayoritariamente son mujeres (62.7%). Respecto a los estilos de vida, el 52.6 % realiza actividad física; En promedio el índice de masa corporal (IMC) es de 28.97 Kg/m2, y el promedio de índice cintura-cadera (ICC) es de 0.95. El promedio de leucocitos totales en el hemograma fue 6,415 células/mm3; la media de linfocitos y monocitos fue de 36.8% y 9.47%, respectivamente. Respecto a los parámetros bioquímico-clínicos, los pacientes se clasificaron en controlados y no controlados 29 (57%) y 22 (43%), respectivamente. Los pacientes controlados muestran una glucemia de 119.59 mg/dL y HbA1c de 6.35%, en contraste, los no controlados, la glucemia de 193.54 mg/dL y HbA1c de 8.21%. El porcentaje de monocitos/macrófagos; M1(38%) y M2(0.85%) mediante citometría de flujo, lo cual representa una 116

www.conferenciasindromemetabolico.org

proporción de M1 casi 50 veces mayor respecto a M2. (fig.1A) El análisis de la subpoblación de Linfocitos T reg muestra un promedio de 7.78%; lo que indica una disminución de éstas células en comparación con sujetos saludables, reportados en la literatura que van de 10 a 12% (fig. 1B).

V3-N1 - 2016

Se estandarizó el cultivo de las CMN in vitro marcando con CPDF-670 y estimulando con OKT3 (Figura 2). Por último se correlacionaron las variables, a través del coeficiente de correlación lineal de Pearson, y su significancia estadística. El IMC con el porcentaje de monocitos de la citometría de


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

flujo resultó de 0.84 lo que indica una relación directamente proporcional entre ambas variables (p=0.01). En contraste, la asociación del IMC vs linfocitos Treg de la citometría fue -0.67, lo que indica una relación inversamente proporcional con un valor de (p=0.1). (Tabla 1).

IV. CONCLUSIONES El análisis de las subpoblaciones celulares por citometría de flujo es congruente con los reportes previos ya que existe una elevación de la población M1 en pacientes con DM2, y la disminución de linfocitos T reguladores. Existe una proliferación del 25% de CMN al ser estimuladas con OKT3 producto de la estimulación de las células. Para el análisis de resultados se utilizó el coeficiente de correlación de Pearson , para conocer la asociación de variables y su significancia estadística. El IMC vs monocitos de la citometría de flujo fué de 0.84, lo que indica una relación directamente proporcional entre ambas variables (p=0.01). En contraste, la asociación del IMC vs linfocitos Treg de la citometría fue -0.67, lo cual indica una relación inversamente proporcional con un valor de p=0.1.

V3-N1 - 2016

3.- Guzman Flores JM, Lopez-Briones S. Celulas de la inmunidad innata y adaptativa en la diabetes melllitus tipo 2 y obesidad. Gaceta Medica de Mexico. 2012; 148:381-389. 4.- James Kraakman M, James Murphy A. Macrophage Polarization in Obesity and Type 2 Diabetes: Weighing Down Our Understanding of Macrophage Function?. Front Immunol. 2014; 5: 470. 5.-Montoya CJ, Velilla PA, Rugeles MT. Caracterización de las células T reguladoras por citometría de flujo: estado del arte y controversias. Biomédica. 2010; 30:37-44.

V. BIBLIOGRAFÍA 1.-Federación Internacional de Diabetes. (2015). Atlas de diabetes de la FID. 7° Edición: 9-17. 2.-NORMA Oficial Mexicana NOM015-SSA2-2010, Para la prevención, tratamiento y control de la diabetes mellitus. DOF: 23/11/2010

www.conferenciasindromemetabolico.org

117


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

RELACIÓN DEL HADV-D36 CON LA RESISTENCIA A LA INSULINA Y NIVELES DE ADIPOCINAS EN PERSONAS OBESAS QBP. Dulce E. Silva Silverio1, QBP. Jorge A. Ocampo Galeana1, MC. Teresa Domínguez Reyes1, QBP. Adriana O. Cástulo Arcos1, QBP. Brianda Noriega Bautista1, Dr. José F. Muñoz Valle2, Dr. Lorenzo Salgado Goytia1, Dra. Isela Parra Rojas1. ABSTRACT Recently it has been reported that human HAdV-D36 infection is able to reduce insulin resistance increasing glucose uptake in adipose tissue, skeletal muscle and liver through an up-regulation of the Ras/PI3K signalling pathway. Furthermore, it is suggested that this virus can improve insulin sensitivity by regulating the levels of some adipokines; studies in different populations where it has been determined the seropositivity for this virus have found an increased blood levels of adiponectin and leptin levels decreased, but the relationship with resistin is unknown. Objective: To analyse the relationship between insulin sensitivity with leptin, adiponectin and resistin levels in obese people with and without HAdV-D36. Material and methods: It was determined the presence of HAdV-D36 in 61 serum samples from obese individuals originating from Chilpancingo, Guerrero. Levels of glucose, insulin, leptin, adiponectin and resistin were also measured. Results: Obese HAdV-D36 positive had significantly lower levels of glucose and insulin and a lower risk of developing insulin resistance, although a relation of levels of adipokines with insulin resistance in HAdV-D36 positive individuals was not found. Conclusion: The results suggest that obese HAdV-D36 positive people have lower risk of insulin resistance.

I. INTRODUCCIÓN a inflamación en el tejido adiposo es uno de los mecanismos que inducen resistencia a la insulina en los individuos con obesidad. Esta respuesta inflamatoria es mediada por la activación de vías de señalización que responden a estrés celular, el cual puede ser originado por una acumulación excesiva de nutrientes, lipólisis y gluconeogénesis que pueden inducir disfunción mitocondrial, estrés de retículo endoplasmático y estrés oxidativo (Kwon and Pessin, 2013). La inflamación en el tejido adiposo también es mediada por algunas adipocinas, las cuales se pueden clasificar de acuerdo a su efecto en la respuesta inflamatoria en adipocinas pro-inflamato-

L

118

www.conferenciasindromemetabolico.org

rias y anti-inflamatorias (Ouchi et al., 2012). En este sentido se sabe que la disfunción de los adipocitos inducida por la obesidad provoca una disminución en los niveles de adiponectina (adipocina anti-inflamatoria) y un incremento en las concentraciones de leptina y resistina (adipocinas pro-inflamatorias), por lo que la resistencia a la insulina podría ser en parte el resultado de un desbalance en la expresión de estas adipocinas (Latoch et al., 2016). El rápido aumento en la prevalencia de obesidad en los últimos años ha llevado a un incremento en la investigación

sobre los factores genéticos y ambientales que la originan o contribuyen en su desarrollo, esto con el fin de prevenir o tratar a esta enfermedad y a sus complicaciones. Recientemente se ha sugerido que el Adenovirus humano 36 del grupo D (HAdV-D36) podría jugar un papel importante en el desarrollo de obesidad en humanos, aunque esto aún no ha sido comprobado (Ponterio and Gnessi, 2015). La capacidad del HAdV-D36 para inducir obesidad también puede mejorar el control glucémico a través de la sobre regulación de una vía independiente de la señal de la insulina Ras/PI3K, la cual resulta en un incremento en la captación de glucosa por los transportadores GLUT1 y GLUT4 en tejido adiposo, músculo esquelético e hígado disminuyendo la secreción de glucosa en este último, además también se ha reportado que promueve un incremento en la secreción de adiponectina por el tejido adiposo y atenúa la esteatosis hepática (Dhurandhar, 2013; (Krishnapuram et al., 2011). Por otro lado también se ha reportado que el HAdV-D36 disminuye los niveles de colesterol, triglicéridos y lep-

Laboratorio de Investigación en Obesidad y Diabetes, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero. 2 Instituto de Investigación en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara. 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tina en plasma (Atkinson et al., 2005; Van Ginneken et al., 2009). Considerando que el HAdV-D36 disminuye la resistencia a la insulina se esperaría que los individuos obesos infectados tuvieran niveles incrementados de adiponectina y una menor concentración de los niveles de leptina y resistina en plasma. Por lo que el objetivo de este estudio fue analizar la relación de la sensibilidad a la insulina con los niveles de leptina, adiponectina y resistina en personas obesas con y sin HAdV-D36.

V3-N1 - 2016

Resistin ELISA de Aviscera Bios- personas obesas positivas para cience, el procedimiento se realizó HAdV-D36 tienen menor riesgo de de acuerdo a las especificaciones presentar resistencia a la insulina. del fabricante. V. REFERENCIAS III. RESULTADOS Atkinson, R.L., Dhurandhar, N.V., Primero se realizó una compa- Allison, D.B., Bowen, R.L., Israel, ración del índice HOMA y las B.A., Albu, J.B., Augustus, A.S., concentraciones de insulina de 2005. Human adenovirus-36 is acuerdo al grado de obesidad que associated with increased body presentaron los participantes en- weight and paradoxical reduccontrando diferencias estadística- tion of serum lipids. Int. J. Obes. mente significativas (p<0.05) en 2005 29, 281–286. doi:10.1038/ ambos parámetros, se puede ob- sj.ijo.0802830 servar que el grado de obesidad Dhurandhar, N.V., 2013. Insues proporcional al índice HOMA lin sparing action of adenoy las concentraciones de insulina virus 36 and its E4orf1 protein. (Cuadro 1). Al comparar el índice J. Diabetes Complications 27, HOMA y las concentraciones de 191–199. doi:10.1016/j.jdiainsulina entre los individuos posi- comp.2012.09.006 tivos y negativos al HAdV-D36, se Krishnapuram, R., Dhurandhar, encontró que los individuos posi- E.J., Dubuisson, O., Kirk-Ballard, H., tivos tuvieron un valor del índice Bajpeyi, S., Butte, N., Sothern, M.S., HOMA y niveles de insulina signifi- Larsen-Meyer, E., Chalew, S., Bencativamente menores en compara- nett, B., Gupta, A.K., Gre ción con los individuos negativos (Cuadro 2). Al realizar el análisis de asociación del índice HOMA con la positividad al HAdV-D36 se encontró que los individuos positivos tienen un menor riesgo de desarrollar resistencia a la insulina (OR=0.07; p=0.004) en comparación con los negativos, ajustado por edad y sexo (Cuadro 3). También se realizó un análisis de asociación de la resistencia a la insulina con las concentraciones séricas de leptina, adiponectina y resistina, sin encontrar diferencias estadísticamente significativas (Cuadro 4).

II. METODOLOGÍA En el presente estudio se analizaron 61 muestras de suero de individuos obesos adultos originarios de Chilpancingo, Gro., que se obtuvieron de un biobanco en el Laboratorio de Investigación en Obesidad y Diabetes, de la Universidad Autónoma de Guerrero. A todos los participantes se les determinó la presencia del HAdV-D36 utilizando el kit Human Adenovirus 36 (HAdV-D36) de abbexa, niveles de glucosa utilizando el espectrofotómetro automatizado Mindray B5200, niveles de insulina utilizando el kit comercial Human Insulin ELISA de Life technologies. Para determinar la resistencia a la insulina se calculó el índice HOMA a partir de sus niveles de glucosa e insulina. También se midieron las concentraciones de algunas adipocinas (leptina, adiponectina y resistina) por ensayo inmunoenzimático, utilizando los kits comerciales Human Adiponectin ELISA de BioVendor, Human Lep- IV. CONCLUSIÓN tin ELISA de BioVendor y Human Los resultados sugieren que las

www.conferenciasindromemetabolico.org

119


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

120

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

SNP EN GENES DE LA VÍA ANTIOXIDANTE NRF2-ARE ASOCIADOS A SÍNDROME METABÓLICO: DISTRIBUCIÓN EN MESTIZOS DE CHIHUAHUA, MÉXICO Samantha Fierro-Sáenz1, Emilio J. Córdova3, Everardo González-Rodríguez2, Joel Domínguez-Viveros2, Stephanie Juárez-Pazos1, Alejandra González-Rodríguez1, Irene Leal-Berumen1, Ángel Licón Trillo1, Ruth Lechuga-Valles2, Verónica Moreno-Brito1 ABSTRACT: Presence of polymorphisms in genes that codes for proteins involved in antioxidant pathway NRF2/ARE have been associated with metabolic syndrome. In this study the allelic and genotypic distributions of SNP NRF2 -617C/A (rs6721961), -653G/A (rs35652124), NQO1 609C/T (rs1800566) and GCLC -129C/T (rs17883901) were analyzed. SNP genotyping assays were performed by TaqMan®. The most frequent alleles were: rs672196: 82% for the C allele; rs3562124: 56% for A allele; rs1800566: 66% for the T allele and rs17883901 93% for C allele. The four greater SNP genotype frequencies were 69% for rs6721961 homozygote CC; 36% rs35652124 homozygote AA; 47% rs1800566 heterozygote CT; and 87% rs17883901 homozygote CC. The four polymorphisms showed Hardy-Weinberg equilibrium (p>0.05). This study will help understand the relationship between SNP with metabolic syndrome related diseases in our population. KEYWORDS: allele frequencies, genotype frequencies, SNP, NRF2, NQO1, GCLC.

I. INTRODUCCIÓN n México se ha reportado una prevalencia de síndrome metabólico (SM) del 50% en individuos mayores de 16 años.1 Actualmente el síndrome metabólico se define por la presencia de obesidad abdominal, hipertrigliceridemia, hipertensión, hiperglucemia y niveles bajos de lipoproteína de alta densidad (HDL-c),2 considerándose factores de riesgo mayores en el desarrollo de diabetes tipo 2 y enfermedades cardiovasculares (ECV), las cuales representan la principal causa de muerte a nivel mundial según la Organización Mundial de la Salud.3 Se ha considerado al estrés oxidativo como uno de los principales factores metabólicos que conducen a la aparición y progresión de SM.4

E

Uno de los mecanismos de defensa antioxidante más importantes a nivel celular es la vía KEAP1/ NRF2/ARE. En presencia de especies reactivas de oxigeno (ERO), la proteína citosólica Nrf2 se disocia de su inhibidor Keap1, promoviendo su migración al núcleo celular, en donde se une a los elementos de respuesta antioxidante (ARE, por sus siglas en inglés) presentes en la región promotora de genes que codifican a proteínas con funciones antioxidantes, tales como el gen NQO1 que codifica la enzima NADPH-quinona oxidorreductasa y los genes GCLC y GCLM que codifican las subunidades catalítica y moduladora de la enzima glutamato-cisteína ligasa.5 Se ha de-

mostrado que la presencia de polimorfismos en el gen NRF2 o en los genes antioxidantes está implicada en cambios en su expresión y en la función de las proteínas que codifican. Los polimorfismos de un solo nucleótido (SNP) -617C/A (rs6721961) y -653G/A (rs35652124) en la región promotora del gen NRF2 han mostrado tener un efecto en la transcripción del gen y por lo tanto bajos niveles de la proteína.6, 7 Distintos estudios han reportado que el rs6721961 se asocia con presión arterial elevada8 y diabetes,6 mientras que el rs35652124 se ha relacionado con niveles significativamente bajos de HDL.9 Para los genes antioxidantes regulados por la proteína Nrf2, se han descrito el SNP -609C/T (rs1800566) en el gen NQO1 que muestra asociación con hipertrigliceridemia y niveles bajos de HDL-c en individuos con SM;10 y el SNP -129C/T (rs17883901) en el gen GCLC que puede incrementar la activación o disfunción endotelial inducida por estrés oxidativo, lo que conduce a eventos aterotromboticos.11.

Facultad de Medicina y Ciencias Biomédicas Facultad de Zootecnia y Ecología de la Universidad Autónoma de Chihuahua. Chihuahua 3 Instituto Nacional de Medicina Genómica (INMEGEN) México 1 2

www.conferenciasindromemetabolico.org

121


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

La distribución de estos polimorfismos ha sido estudiada a través de distintos grupos raciales como los caucásicos, afroamericanos, asiáticos e hispanos. En México un país con amplia variabilidad genética entre subpoblaciones mestizas, solo se ha generado información para grupos mestizos del centro del país, sin embargo, no existen datos de estos polimorfismos en poblaciones del norte de México. En este trabajo se analizaron las frecuencias alélicas y genotípicas de los SNP´s NRF2 -617C>A (rs6721961), -653G>A (rs35652124), NQO1 609C>T (rs1800566) y GCLC -129C>T (rs17883901) en una población mestiza del Noroeste de México, particularmente en el estado de Chihuahua. II. METODOLOGÍA Se obtuvieron 148 muestras de sangre total de individuos voluntarios mestizos estudiantes de la Facultad de Medicina y Ciencias Biomédicas de la Universidad Autónoma de Chihuahua. Las muestras sanguíneas fueron obtenidas por la técnica de venopunción por el sistema Vacutainer®, con previa firma de consentimiento informado por parte de los participantes. Para la obtención de DNA genómico se utilizó el Kit de extracción “Master Pure™ DNA Purification Kit” de Epicentre an Illumina® Company de acuerdo a las especificaciones del proveedor. La concentración y la pureza de ADN se cuantificaron en un espectrofotómetro tipo Nanodrop 2000 (Thermo Fisher Scientific). 122

www.conferenciasindromemetabolico.org

Los polimorfismos NRF2 -617C>A (rs6721961), -653G>A (rs35652124), NQO1 609C>T (rs1800566) y GCLC -129C>T (rs17883901) fueron genotipificados por medio de ensayos TaqMan® utilizando el equipo 7900HT Fast Real-Time PCR system (Applied Biosystems). Se determinaron las frecuencias alélicas y genotípicas en la población estudiada; Por medio de la prueba de exacta de Fisher se probó el posible desequilibrio Hardy-Weinberg utilizando el software FINETTI (TF Wienker and TM Strom, unpublished data, http://ihg.gsf.de/cgi-bin/ hw/hwa2.pl); posteriormente, en poblaciones ya estudiadas se probaron las posibles diferencias en las frecuencias alélicas con el estadístico de chi cuadrada.

III. RESULTADOS En la tabla 1 se presentan las frecuencias alélicas y genotípicas de los cuatro polimorfismos a través de la población de estudio, el análisis permitió observar que están en equilibrio de Hardy-Weinberg (p>0.05), lo cual puede indicar que estas poblaciones no han sido afectadas por efectos que alteren las frecuencias en las poblaciones; dado la estructura se esperaría posibles efectos de deriva genética o selección. Para el gen NRF2, las frecuencias alélicas del polimorfismo rs6721961 fueron del 82% para el alelo C y 18% del alelo A, mientras que para el polimorfismo rs3562124 fueron de 44% para el alelo G y 56% para el alelo A; los genotipos C/C

V3-N1 - 2016

y G/A fueron los más frecuentes en la población. En el gen NQO1 el polimorfismo rs1800566 presento mayor frecuencia del alelo T (66%) y de genotipos heterocigotos C/T (47%). Para el gen GCLC el polimorfismo rs17883901 mostró resultados extremos en el que la frecuencia alélica del alelo C fue del 93%, mientras que la frecuencia genotípica de los homocigotos fue del 87% C/C y 1% T/T. Haciendo un análisis comparativo de los genes estudiados, se muestran en la tabla 2 las frecuencias alélicas y genotípicas de otras poblaciones mestizas del centro de México y en poblaciones caucásicas, afroamericanas, asiáticas e hispanas. En caso del rs6721961 C/A del gen Nrf2 observamos que el alelo C es el más frecuente en todas las poblaciones, haciendo énfasis que los resultados en mestizos del noroeste de México (82.1%) son similares a los reportados previamente en mestizos del centro del país (80.7%) e individuos caucásicos (88.6%). El genotipo homocigoto CC resulto ser el frecuente en todas las poblaciones, identificando en nuestra población (68.9%) valores similares a los reportados para mestizos del centro (64.2%). Las frecuencias alélicas del rs35652124 G/A en Nrf2 varían de forma significativa entre poblaciones mestizas mexicanas, la población mestiza del centro de México mostro una frecuencia del alelo G más elevada (57.1%) que la estudiada (49.3%), contrario al alelo A (42%) vs (56%) respectivamente, esta diferencia sugiere que la distribución del este SNP


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

podría variar a lo largo del país entre sub-poblaciones mestizas, sin embargo, nuestra población de estudio presenta una similitud con la población asiática (41.9%), interesantemente esta similitud se pierde cuando se analiza las frecuencias genotípicas G/G, G/A y A/A con respecto a este grupo racial. Con respecto a la frecuencia del alelo T del rs1800566 del gen NQO1 en las muestras de mestizos del noroeste fue una de las más altas (66.2%), a diferencia de las otras poblaciones que presentan de forma general frecuencias alélicas bajas, sugiriendo una alta heterogenicidad de la distribución del alelo T entre poblaciones. A nivel de frecuencias genotípicas se puede observar una similitud en la distribución de los heterocigotos C/T entre nuestra población de mestizos con la del centro del país y poblaciones asiáticas. Finalmente, los resultados del polimorfismo rs17883901 para el gen GCLC, muestran en general frecuencias alélicas y genotípicas muy similares entre las distintas poblaciones. IV. CONCLUSIÓN El presente estudio muestra las distribuciones alélicas y genotípicas de los polimorfismos relacionados a SM en los genes antioxidantes NRF2, NQO1 y GCLC en una población mestiza del noroeste de México. Todos los SNP´s analizados estuvieron en equilibrio Hardy-Weinberg. Las distribuciones encontradas entre grupos raciales para cada SNP mostraron que los descritos en NRF2 son si-

milares a los grupos mestizos del centro de México. Con respecto al SNP en NQO1 las distribuciones fueron muy diversas entre los distintos grupos raciales y muy similares para el gen GCLC. El presente estudio establece las bases para el desarrollo de trabajos dirigidos a los efectos metabólicos de estos polimorfismos en nuestra población.

V. BIBLIOGRAFÍA 1. Salas, R., del Mar Bibiloni, M., Ramos, E., Villarreal, J. Z., Pons, A., Tur, J. A., & Sureda, A. (2014). Metabolic syndrome prevalence among Northern Mexican adult population. PloS one, 9(8), e105581. 2. World Health Organization. (2016). World health statistics 2016. World Health Organization. 3. Rubio, M. A., Moreno, C., & Cabrerizo, L. (2004). Guías para el tratamiento de las dislipemias en el adulto: Adult Treatment Panel III (ATP-III). Endocrinología y Nutrición, 51(5), 254-265. 4. Uruno, A., Yagishita, Y., & Yamamoto, M. (2015). The Keap1– Nrf2 system and diabetes mellitus. Archives of biochemistry and biophysics, 566, 76-84. 5. Nguyen, T., Nioi, P., & Pickett, C. B. (2009). The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. Journal of Biological Chemistry, 284(20), 1329113295. 6. Jiménez-Osorio, A. S., González-Reyes, S., García-Niño, W. R., Moreno-Macías, H., Rodríguez-Arellano, M. E., Vargas-Alarcón, G., Zuñiga, J., Bar-

V3-N1 - 2016

quera, R. & Pedraza-Chaverri, J. (2016). Association of Nuclear Factor-Erythroid 2-Related Factor 2, Thioredoxin Interacting Protein, and Heme Oxygenase-1 Gene Polymorphisms with Diabetes and Obesity in Mexican Patients. Oxidative medicine and cellular longevity, 2016. 7. Marzec, J. M., Christie, J. D., Reddy, S. P., Jedlicka, A. E., Vuong, H., Lanken, P. N., Amplenc, R., Yamamoto, M., Yamamoto T., Cho, H.Y. & Kleeberger, S. R. (2007). Functional polymorphisms in the transcription factor NRF2 in humans increase the risk of acute lung injury. The FASEB Journal, 21(9), 2237-2246 8. Shimoyama, Y., Mitsuda, Y., Tsuruta, Y., Hamajima, N., & Niwa, T. (2014). Polymorphism of Nrf2, an antioxidative gene, is associated with blood pressure and cardiovascular mortality in hemodialysis patients. Int. J. Med. Sci, 11, 726-731. 9. Shimoyama, Y., Mitsuda, Y., Hamajima, N., & Niwa, T. (2014). Polymorphisms of Nrf2, an antioxidative gene, are associated with blood pressure in Japanese. Nagoya journal of medical science, 76(1-2), 113-120. 10. Martínez-Hernández, A., Córdova, E. J., Rosillo-Salazar, O., García-Ortíz, H., Contreras-Cubas, C., Islas-Andrade, S., Revilla-Monsalve, C., Salas-Labadía, C. & Orozco, L. (2015). Association of HMOX1 and NQO1 polymorphisms with metabolic syndrome components. PloS one, 10(5), e0123313. 11. Koide, S. I., Kugiyama, K., Sugiyama, S., Nakamura, S. www.conferenciasindromemetabolico.org

123


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

I., Fukushima, H., Honda, O., Yoshimura, M. & Ogawa, H. (2003). Association of polymorphism in glutamate-cysteine ligase catalytic subunit gene with coronary vasomotor dysfunction and myocardial infarction. Journal of the American College of Cardiology, 41(4), 539545.

124

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DEL CONSUMO DE FIBRA DE NOPAL Y PARÁMETROS DE SÍNDROME METABÓLICO EN PACIENTES CON OBESIDAD MCP. Alma Azucena Arenas López1, M. en C. Marco Antonio Castro Reyes1, D. en C. Alejandra Valdivia Flores2 ABSTRACT Several studies have found association between consumption of nopal supplements and other components, and reducing anthropometric and biochemical parameters in patients with obesity and prediabetes1. The aim of this study is to determine the effectiveness of nopal fiber intake in nutritional and biochemical parameters in adults. The sample consisted of 28 individuals, divided into 2 groups, of which 18 received 10 grams of fiber and 10 placebo, complementing the intervention with diet and exercise. Parameters metabolic syndrome at baseline, 4 and 8 weeks of treatment were measured. The group consuming fiber nopal (group A) had a statistically significant decrease in waist circumference (6.257%, p <0.05), waist-tohip ratio (6.813%, p <0.003), total cholesterol (15.03%, p < 0.05) and uric acid (18,329%, p <0.05) unlike the group B consumed placebo. PALABRAS CLAVE: fibra de nopal, Síndrome Metabólico, adultos, Obesidad

I. INTRODUCCIÓN l nopal es un alimento que contiene proteínas, fibra soluble e insoluble, antioxidantes como los flavonoides, carotenos, ácido ascórbico y es bajo en calorías; por lo cual se considera un alimento funcional; así como un probiótico y prebiótico. Desde 1964 se ha estudiado su efecto en diversos parámetros metabólicos con diferentes especies de la cactácea y en distintas formas de preparación. Los estudios que relacionan el consumo de nopal y los parámetros séricos y antropométricos en humanos son limitados y no concluyentes. De encontrar la relación existente entre estas variables, avanzaremos en el tratamiento nutricional en el paciente con obesidad; por lo cual el presente estudio pretendió determinar la relación que existe entre el consumo de fibra de nopal y parámetros del Síndrome Me-

E

tabólico en pacientes adultos con Obesidad.

II. METODOLOGÍA Se integró una muestra de 28 trabajadores que presentaran obesidad del Colegio de Bachilleres 6 “Vicente Guerrero”. Se realizó una historia clínica y un examen físico que incluyó la evaluación del estado nutricio. Se usó un plicómetro para calcular el porcentaje de masa grasa y se comparó con el resultado por bioimpedancia. Se dividió la muestra de participantes en dos grupos. El grupo A se le asignó el consumo de 10 gr de fibra de nopal encapsulada y al grupo B consumió placebo. La intervención de ambos grupos fue: plan nutrimental hipocalórico dividido en quintos que constaba de un menú semanal, receta de ejercicio aeróbico con las especifica1 2

Instituto Politécnico Nacional, CICS UMA Instituto Politécnico Nacional, DI-DOPI

ciones de las guías actuales al cabo de 8 semanas. La fibra de nopal fue proporcionada por INMA Industrializadora de Nopal Milpa Alta, SPR de RL de CV. Se realizó una evaluación del estado nutricio en 3 tiempos para la obtención de datos: tiempo 0 ó inicial, tiempo 1 (a las 4 semanas de intervención) y tiempo 2 (8 semanas de intervención). Se entregó una bitácora de ejercicio donde registraron el ejercicio y los minutos realizados. Para clasificar a los parámetros de los participantes de ambos grupos; se utilizaron los criterios de la Federación Internacional de Diabetes, 2005. Se aplicó estadística descriptiva mediante medidas de tendencia central y dispersión para el análisis de base de datos. Se determino usar la prueba de t de Student para comparar el comportamiento de las variables, con el paquete estadístico SPSS v. 22 (Illinois, USA).

III. RESULTADOS Y DISCUSIÓN Como se observa en la tabla 1, al comparar el tiempo 0 (semana 0) y el tiempo 2 (semana 8), se observaron cambios entre ambos grupos en el porcentaje de masa grasa por bioimpedancia (-6.549% vs 0.62%) y triglicéridos (-11.639%

www.conferenciasindromemetabolico.org

125


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

vs 6.645%). Se encontraron diferencias significativas entre los grupos en los parámetros de circunferencia de cintura (-6.257%), índice cintura-cadera (-6.813%), colesterol total (1-15.03%) y ácido úrico (-18.329%); mientras que en el grupo control mostró una tendencia en disminución de circunferencia de cintura y disminución significativa de índice cintura-talla (9.924%, p<0.05), así como en ácido úrico (-20.19%, p< 0.05). Hubo tres parámetros que aumentaron en ambos grupos: tensión arterial sistólica (1.219%, 4.662%), tensión arterial diastólica (1.196%, 2.127%) y glucosa en ayunas (11.338%, 2.901%). Los parámetros metabólicos del grupo

126

www.conferenciasindromemetabolico.org

A que tuvieron un comportamiento similar al placebo durante la intervención programada fueron la glucosa, triglicéridos y el índice triglicéridos/glucosa, a diferencia de lo que reportan estudios previos donde se usó un bolo de 400 mg y 1gr de nopal deshidratado en pacientes con dislipidemia y obesidad, como reporta Godard, 2010 2 y Muñoz en el 2014.8 No se observó una disminución estadísticamente significativa del porcentaje de masa grasa corporal con los métodos usados; así como en la tensión arterial; como se presentó en pacientes con pre-diabetes en los que se ha utilizado 3 gr de Litramine, como lo observó Uebelhack y Chong Pee Wing en 2014. 4,6

V3-N1 - 2016

De igual forma, no registramos descenso en las cifras de tensión arterial y porcentaje de masa grasa como se describe el metaanálisis realizado por Onakpoya IJ, en 2015.3 El descenso estimado en el índice de cintura-talla fue mayor en el grupo placebo debido a mayor apego a la intervención (219.205±82.42 minutos/semana/ejercicio, 94.52% seguimiento de dieta); caso contrario que no se obtuvo con el grupo que consumió fibra de nopal (158.75±76.357minutos/semana/ejercicio, 76.33% seguimiento de dieta). Por otro lado, los estudios previos de Guevara-Cruz7 en 2012 donde se usaron suplementos, se describe disminución estadísticamente si-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

gnificativa de triglicéridos, peso e índice de masa corporal; los cuales no se presentaron en este estudio. Los suplementos usados por Guevara-Cruz en 2012, fueron hechos a base de un porcentaje de nopal en conjunto de otros alimentos funcionales; por lo cual los efectos pueden ser atribuidos al resto de los componentes de dichos suplementos. IV. CONCLUSIÓN La administración de fibra de nopal por un intervalo de 8 semanas disminuye los valores de circunferencia de cintura, índice cintura-cadera, colesterol total y ácido úrico. Cabe mencionar que se debe seguir investigando el impacto de los diversos derivados del nopal en parámetros del Síndrome Metabólico para evaluar el beneficio clínico de este alimento. V. AGRADECIMIENTOS Se agradece el financiamiento a los proyectos SIP 2016-1632 y SIP 2015-0397 por parte del Instituto Politécnico Nacional.

VI. TRABAJOS CITADOS 1. López-Romero P. The effect of nopal on postprandial blood glucose, incretins, and antioxidant activity in Mexican patients with type 2 diabetes after consumption of two different composition breakfasts. J AcadNutr Diet.2014 Nov; 114(11):1811-8. 2. Godard MP. Acute blood glucose lowering effects and longterm safety of Opuntia supplementation in pre-diabetic males and females. J Ethnopharmacol.2010

V3-N1 - 2016

Aug 9;130(3):631-4. 3. Onakpoya IJ. The effect of cactus pear (Opuntiaficus-indica) on bodyweightand cardiovascular risk factors: a systematic review and meta-analysis of randomized clinical trials. Nutrition. 2015May;31(5):640-6. 4. Uebelhack, Ralf. Effects of Cactus Fiber on the Excretion of Dietary Fat in Healthy Subjects: A Double Blind, Randomized, Placebo-Controlled, Crossover Clinical Investigation. Current TherapeuticResearch76(2014)39–44 5. Grube Barbara. A natural fiber complex reduces body weight in the overweight and obese: a double blind, randomized, placebo-controlled study. Obesity, 2012;109 (4) 561-567 6. Chong Pee Wing. A Review of the efficacy and safety of litramine IQP-G-002AS, and Opuntiaficus-indica derived fiber for weight management. Jour Alt Med. 2014; 56: 2312-2317. 7. Guevara-Cruz, Martha. A Dietary Pattern Including Nopal, Chia Seed, Soy Protein, and Oat Reduces Serum Triglycerides and Glucose Intolerance in Patients with Metabolic Syndrome J.Nutr.2012vol.142no. 1 64-69. 8. Muñoz, Luisa. Efecto de la administración oral de nopal deshidratado sobre el perfil de lípidos en individuos con dislipidemia y sobrepeso/obesidad. ReIbCi, 2014 vol. 1 no.1. 149-159

www.conferenciasindromemetabolico.org

127


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DEL CONSUMO DE NOPAL SOBRE PARÁMETROS DE SÍNDROME METABÓLICO EN JÓVENES CON OBESIDAD M. en C. Marco Antonio Castro-Reyes1, LN. Jocelyn Madrigal-Acevedo2, D. en C. José Jorge Chanona-Pérez2, D. en C. Leticia Manuel Apolinar3, D. en C. Alejandra Valdivia-Flores4 ABSTRACT. In Mexico, according to ENSANUT 2012, overweight and obesity in individuals over age 20 is reported in 7 of every 10 inhabitants reflecting a serious public health problem. Material and methods. A selection of young people was performed with a body mass index (BMI) ≥ 30 and ≤ 39.9 to which they took anthropometric measurements, blood pressure and a blood sample for the determination of glucose, triglycerides and high-density lipoprotein-cholesterol. Participants were divided into two groups. The first group with 22 members were asked to consume 10.5 g/ day nopal fiber for four weeks. The control group consisted of 12 members. At the end of the four weeks of intervention they were again carried out anthropometric, biochemical and blood pressure measurements. The results obtained indicate that small decreases can be observed by comparing the initial values with respect to the final values in the variables analyzed and only in the case of SBP and DBP significant differences were obtained. Conclusion: The use of fiber nopal contributes to the regulation of blood pressure and may influence the level of blood glucose and other biochemical variables as lipid profile, in young obese. PALABRAS CLAVE: nopal, síndrome metabólico, jóvenes, obesidad

I. INTRODUCCIÓN n México, de acuerdo a cifras de la ENSANUT 2012, el sobrepeso y la obesidad en individuos mayores de 20 años esta reportada en 7 de cada 10 habitantes, lo cual refleja un grave problema de salud pública. Asimismo se ha reportado una alta prevalencia de lípidos plasmáticos por encima de lo normal en estudiantes universitarios (1). Baer et al 1997, indican que un incremento en el consumo de fibra dietética resulta en descenso de la energía metabólica que puede ser atribuida a la reducción de la digestión de lípidos de la dieta (2). Sin embargo, parece ser que existen diferencias en la fijación de lípidos dependiendo de las propiedades de los diferentes tipos de fibras (3). El nopal se ha utilizado para el mane-

E

128

www.conferenciasindromemetabolico.org

jo de la diabetes en México debido a que ésta cactácea puede tener múltiples efectos sobre el metabolismo, de tal manera que regula la glucosa plasmática, lípidos, colesterol total, lipoproteínas de alta densidad (HDL) y los niveles de lipoproteínas de baja densidad-colesterol (LDL-col). Por lo que el objetivo del presente trabajo fue evaluar el efecto del consumo de fibra de nopal en polvo sobre parámetros de síndrome metabólico en jóvenes con obesidad. II. METODOLOGÍA Se realizó una selección de jóvenes de ambos géneros, sin patologías en curso y con un índice de masa Instituto Politécnico Nacional, CICS-UMA Instituto Politécnico Nacional, ENCB 3 UIEE, HE del CMNSXXI del IMSS 4 Instituto Politécnico Nacional, SIP-DI-DOPI 1 2

corporal (IMC) ≥ 30 y ≤ 39.9 de la población universitaria del CICS UMA a los cuales, una vez firmado el consentimiento informado, se les tomaron medidas antropométricas de peso, talla, circunferencia de cintura y circunferencia de cadera para obtener el IMC e Índice Cintura-Cadera (ICC). Se les tomó una muestra sanguínea para la determinación de glucosa, triacilglicéridos y lipoproteínas de alta densidad-colesterol (HDL-col) sérica. Se registró la tensión arterial sistólica (TAS) y tensión arterial diastólica (TAD) ese mismo día. El primer grupo con 22 integrantes se les pidió llevar a cabo el consumo de 10.5 gr/día de fibra de nopal en polvo encapsulado durante cuatro semanas. La fibra de nopal en polvo y encapsulado fue donada por la empresa Industrializadora de Nopal Milpa Alta, S.P.R.D.R.L. de C.V. (INMA). El consumo diario se dividió en tres tiempos de acuerdo al periodo de alimentación del participante y en cada periodo se consumió 3.5 gr de fibra de nopal. El grupo control estuvo conformado por 12 integrantes. Se les pidió no cambiar su estilo de vida y en caso de que hubiesen registrado alguna enfermedad, tomado al-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

gún tratamiento farmacológico, usar suplementos o complementos alimenticios, presentado hipo o hiperglicemia fueron excluidos de la intervención. Al finalizar las cuatro semanas de intervención se les volvió a realizar las mediciones antropométricas y bioquímicas. Se sistematizaron los datos obtenidos para calcular medidas de tendencia central y de dispersión, se hicieron pruebas de normalidad y de comparación de medias por t de Student. III. RESULTADOS Se registraron datos de 34 jóvenes universitarios con los cuales se obtuvo que la edad media fue de 20.8±1.5 años de los cuales 22 fueron del género femenino que representa el 65%. El peso medio para los casos fue de 93.68 kg mientras para los controles fue de 89.78 kg. No se encontraron diferencias estadísticamente significativas entre los dos grupos al inicio de la intervención (Tabla 1). De los 22 estudiantes participantes en el

grupo de intervención finalizaron el tratamiento de cuatro semanas solo 17 mientras del grupo control los 12 participantes concluyeron el mes de prueba. Los resultados que se obtuvieron después de la intervención indican que solo se

V3-N1 - 2016

pueden observar pequeñas disminuciones comparando los valores iniciales con respecto a los valores finales y solo en el caso de la TAS y TAD se obtuvieron diferencias significativas entre el inicio y final de la intervención (Tabla 2). La

(4). La fibra de nopal utilizado en este trabajo era de cladodas largas con una edad promedio de 7 meses. La disminución de 27. 7 mg /dL en sus niveles de triacilglicéridos plasmáticos que se registra en

disminución de 3.95 mg/dL de la glicemia al final del tratamiento no es estadísticamente significativa. Esta pequeña diferencia es posible que sea debido a la edad de las cladodas con que fue elaborada la fibra de nopal en polvo. Un reporte previo señala que existen semejanzas en las propiedades de cladodas pequeñas y medianas mientras que con respecto a las cladodas largas presentan diferencias en el contenido de fibra, absorción de agua, tumefacción y viscosidad, quizá por ello puede afectar la respuesta a la hipoglucemia, ya que la harina de nopal pequeño y mediano indujeron una reducción de la glucosa postprandial en 23.6 y 46 % en relación al control (p‹0.05) mientras que las cladodas largas no tuvieron un efecto significativo

los participantes al final del tratamiento que estuvieron consumiendo nopal en polvo tampoco es significativa estadísticamente aunque existen reportes como un estudio realizado en 18 pacientes, que registraron hipercolesterolemia moderada con valores de colesterol plasmático entre 200 y 300 mg/dL, que se dividieron en 2 grupos de los cuales a uno se le administró 9 gr/día de extracto de nopal y al otro placebo. Los resultados indican que el grupo que recibió el extracto de nopal registró una tendencia a disminuir el LDL-colesterol (-8%) y triglicéridos (-10%) y un aumento del HDL-colesterol (+7%) y apolipoproteína AI (+4%) sin alcanzar una diferencia significativa pero el colesterol total (6%), apolipowww.conferenciasindromemetabolico.org

129


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

proteína B (-11%) y glucosa (12%) mostraron diferencias significativas (p‹0.05). Estos resultados sugieren que la administración de 9 gr/día de extracto aislado de nopal mejora el perfil lipídico de de pacientes con hipercolesterolemia moderada, pero posiblemente se necesitan mayores dosis para observar un beneficio clínico (5). Los efectos en la disminución de la TAD y TAS, lo cuales fueron significativos estadísticamente, pueden deberse a que hubo una disminución del IMC y se ha asociado que una disminución de IMC podría disminuir la tensión arterial sistémica. IV. CONCLUSIÓN La utilización de fibra de nopal en polvo usada contribuye a la regulación de la presión arterial y podría influir en el nivel de glucosa en la sangre así como en otras variables bioquímicas, como el perfil lipídico, en los jóvenes con obesidad.

V. AGRADECIMIENTOS Ésta investigación ha sido financiada a través del proyecto individual 20151738, 20150397 y 20154790 del Instituto Politécnico Nacional. VI. TRABAJOS CITADOS 1. González Sandoval CE, Díaz Burke Y, Mendizabal-Ruiz AP, Medina Díaz E, Morales JA. Prevalencia de obesidad y perfil lipídico alterado en jovenes universitarios. Nutr. Hosp. 2014; 2(29): p. 315 321. 2. Baer DJ, Rumpler WV, George C. Dietary fibre decreases the metabolizable energy content 130

www.conferenciasindromemetabolico.org

and digestibility of mixed diets fed to humans. Journal of Nutrition. 1997; 127(4): p. 579-586. 3. Tucker LA, Thomas KS. Increasing total fiber intake reduces weight and fat gains in women. Journal of Nutrition. 2009; 139(3): p. 576 - 581. 4. Nuñez López M, Paredes López O, Reynoso Camacho R. Funtional and hypoglycemic properties of nopal cladodes (o. ficus-indica) at different maturity stages using in vitro and in vivo test. J. Agric. Food Chem. 2013; 46(61): p. 10981 - 10986. 5. Torres Tamayo M, Trejo González A, Posadas Sánchez R, Zamora González J, Ichazo Cerro MS, Meave González A, et al. Extracto del extracto de nopal sobre lípidos y lipoproteínas en hipercolesterolemia moderada. Rev. Med. del IMSS. 2001; 6(39): p. 491 - 499.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FENOTIPO PROINFLAMATORIO DE CÉLULAS T EN SANGRE PERIFÉRICA DE JÓVENES CON SÍNDROME METABÓLICO Dra. Inés Matia-García1, Dra. Rosana Pelayo-Camacho2, Dr. Eduardo Vadillo-Rosado2, Dr. José Francisco Muñoz-Valle3, Dr. Lorenzo Salgado-Goytia1, QBP. Aralia Berenice Salgado-Bernabé1, Dra. Isela Parra-Rojas1 ABSTRACT. The aim of this study was to determine the subpopulations of helper T lymphocytes (Th) in young with and without metabolic syndrome (SM). Methodology. We recruited a total of 100 young, 18 to 30 year old, 77 without SM and 23 with SM from the state of Guerrero, Mexico. Anthropometric, clinical and biochemical characteristics were determined. Peripheral blood mononuclear cells were obtained and Th cells and Th1 and Th2 cells (intracellular staining of cytokines IFN-ɣ and IL-4) were determined by flow cytometry. The diagnosis of SM was made according to the criteria of the International Diabetes Federation (IDF). Statistical analysis was performed using the software STATAv.11.1. Results. Subjects with SM had a higher number of CD3-CD4int, CD3intCD4int, CD3+CD4+IFN-ɣ+ and CD3+CD4intIFN-ɣ+ T cells than in subjects without SM. Subjects with 1, 2, 3 and ≥4 metabolic abnormalities had higher number of CD3+CD4+, CD3+CD4+IFNɣ+, CD3-CD4intIFNɣ+ and CD3intCD4intIFNɣ+ T cells compared to those without any metabolic abnormality. Subjects with normal-weight had increased number of CD3+CD4+ and CD3+CD4+IFNɣ+ T cells in subjects with 1 or more abnormalities compared to those without metabolic abnormalities. Furthermore, subjects with normal-weight who present abdominal obesity and altered levels of triglycerides and LDL had a higher number of CD3+CD4+ and CD3+CD4+IFNɣ+ T cells. The number of CD3-CD4int, CD3intCD4int and CD3intCD4intIFNɣ+ T cells were correlated with higher waist circumference, systolic pressure, glucose and triglycerides. Conclusion. Subjects with SM show an increase of Th and Th1 circulating cells, and metabolic abnormalities, such as abdominal obesity and dyslipidemias, can contribute to the increase of these cells in subjects with normal-weight, which suggests that the state of chronic inflammation seen obesity is also associated with the components of SM. KEYWORDS: Metabolic syndrome, T lymphocytes, inflammation.

I. INTRODUCCIÓN n diversos estudios se muestra que la obesidad y el aumento de tejido adiposo, especialmente en la región abdominal, se asocian con la resistencia a la insulina (RI), homeostasis de la glucosa alterada y con sus comorbilidades tales como diabetes tipo 2 (DMT2), síndrome metabólico (SM) y enfermedad cardiovascular [1-2]. La inflamación de bajo grado en la obesidad, se considera el producto de un sistema inmune innato activado, lo que desencadena la infiltración de células infla-

E

matorias, tales como macrófagos, neutrófilos, células dendríticas y linfocitos, dando lugar a alteraciones cualitativas y cuantitativas de la fracción del estroma vascular del tejido adiposo blanco [35]. La contribución del sistema inmune adaptativo a la obesidad y SM, en particular las células T, ha sido poco estudiada. Sin embar-

go, estudios recientes indican que la obesidad no solo se caracteriza por un aumento de la activación de células inmunes circulantes del sistema inmune innato [6], sino también del adaptativo. Viardot et al., reportaron en sujetos obesos mórbidos con DMT2 que la restricción calórica con modesta pérdida de peso reduce notablemente el número de células Th1 pro-inflamatorias, con poco efecto sobre el número de células Th2 [7]. Considerando los antecedentes mencionados, el objetivo de este trabajo fue determinar las subpoblaciones de linfocitos T cooperadores (Th) en jóvenes con y sin SM.

II. METODOLOGÍA Se realizó un estudio en 100 jóvenes guerrerenses de 18 a 30 años de edad, 50 con peso normal y 50 con obesidad. El diagnóstico de SM se hizo de acuerdo a los criterios de la Federación internacional de Diabetes (FID), se detectaron 23 jóvenes con SM y 77 no lo presentaron. Se les determinaron sus características antropométricas, clínicas y bioquímicas. Se obtuvieron las células mononucleares

Laboratorio de Investigación en Obesidad y Diabetes, Facultad de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero 2 Unidad de Investigación Médica en Enfermedades Oncológicas, Hospital de Oncología, Centro Médico Nacional Siglo XXI, IMSS, México 3 Instituto de Investigación en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara 1

www.conferenciasindromemetabolico.org

131


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

(CMNs) de sangre periférica y se determinaron linfocitos T cooperadores (Th) CD3CD4, linfocitos Th1 y Th2 (tinción intracelular de citocinas IFN-ɣ e IL-4) por citometría de flujo de 3 colores (FACSCanto II, BD Biosciences) y los datos fueron analizados con el software FlowJo V. 7.6.1. El análisis estadístico se realizó utilizando el software STATAv.11.1. Las pruebas estadísticas utilizadas fueron Mann-Whitney y correlación de Spearman, considerando las diferencias significativas con valor de p<0.05.

III. RESULTADOS Las características antropométricas y bioquímicas de los jóvenes con y sin SM se muestran en la tabla 1. La prevalencia de SM en el grupo de peso normal fue de 6% y 40% en el grupo con obesidad. En este estudio, se reportan 6 subpoblaciones de células Th: CD3+CD4+, CD3+CD4-, CD3+CD4int, CD3CD4int, CD3intCD4-, CD3intCD4int en CMNs de jóvenes con y sin SM. Los jóvenes con SM presentan un mayor número de células T CD3CD4int (p=0.01) y CD3intCD4int (p=0.02), así como de células Th1 CD3+CD4+IFN-ɣ+ (2326 vs 1472 células/mL, p=0.02), y CD3+CD4intIFN-ɣ+ (1149 vs 444 células/mL, p=0.007) en comparación con los jóvenes sin SM (figuras 1 a-b). No se observaron diferencias significativas en la cuenta de las células Th2 en los jóvenes con y sin SM (figura 1 c); pero cuando se realizó la comparación del porcentaje de células Th2 entre grupos, los jóvenes con SM tuvieron menor porcentaje de células 132

www.conferenciasindromemetabolico.org

Th2 C3+CD4-IL4+ (1.27 vs 1.82%, p=0.04) en comparación con los que no presentaron SM (datos no mostrados). Se realizó la comparación de todas las subpoblaciones de células Th, Th1 y Th2 de acuerdo al número de alteraciones metabólicas en la población total, solo se observó el incremento significativo en el número de células CD3+CD4+, CD3+CD4+IFNɣ+, CD3-CD4intIFNɣ+ y CD3intCD4intIFNɣ+ en jóvenes que presentan 1, 2, 3 y ≥4 alteraciones metabólicas en comparación con los jóvenes que no presentan ninguna alteración metabólica (Figura 2). Al realizar la comparación en jóvenes con y sin obesidad, los jóvenes con peso normal tuvieron un incremento en el número de células CD3+CD4+ en jóvenes con 3 alteraciones (p=0.02) y CD3+CD4+IFNɣ+ en jóvenes con 1 (p=0.02) y 3 (p=0.03) alteraciones, en comparación a los que no presentan alteraciones metabólicas (Figura 3a). Como todos los jóvenes con obesidad presentaron alteraciones metabólicas, se observó una tendencia al incremento de células CD3+CD4+ en jóvenes con 1 alteración y CD3+CD4+IFNɣ+ en jóvenes con 2 o más alteraciones, pero no es significativo (Figura 3b). También, se determinaron las alteraciones metabólicas relacionadas con el incremento de las células, los jóvenes con peso normal tuvieron un incremento en las células T CD3+CD4+, en los que tienen niveles de triglicéridos >150 mg/ dl, LDL >100 mg/dl y las dislipidemias con otras alteraciones como

V3-N1 - 2016

Tg+HDL, Obe+Col+LDL, Glu+HDL+LDL y Tg+LDL+HTA; y las células Th1 CD3+CD4+IFNɣ+, en los que presentan obesidad abdominal y niveles de triglicéridos >150 mg/dl. En los jóvenes con obesidad tanto el número de células T CD3+CD4+ y Th1 CD3+CD4+IFNɣ+, son similares en las alteraciones metabólicas, sólo estas últimas se encuentran incrementadas en los jóvenes con Obe+Glu+LDL (Datos no mostrados). Las células CD3CD4int CD3intCD4int y CD3intCD4intIFNɣ+, se correlacionaron con mayor circunferencia de cintura, presión sistólica, glucosa y triglicéridos en la población total (tabla 2). IV. CONCLUSIÓN Este estudio muestra que los jóvenes con SM tienen con SM tienen un incremento de células T CD3CD4 circulantes que se polarizan hacia el fenotipo Th1 proinflamatorio, y alteraciones metabólicas, como la obesidad abdominal y las dislipidemias, pueden contribuir en el incremento de estas células, en jóvenes con peso normal. Estos resultados confirman que la obesidad y los componentes del síndrome metabólico pueden relacionarse con un fenotipo proinflamatorio determinado en sangre periférica. V. BIBLIOGRAFÍA 1. Despres JP, Lemieux I, Bergeron J, Pibarot P, Mathieu P, Larose E, et al. Abdominal Obesity and the Metabolic Syndrome: Contribution to Global Cardiometabolic Risk. Arterioscler Thromb


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

Vasc Biol. 2008; 28(6): 1039-1049. 2. Nishimura S, Manabe I, Nagai R. Adipose tissue inflammation in obesity and metabolic syndrome. Discov Med. 2009; 8(41): 55-60. 3. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL and Jr. Ferrante AW. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest. 2003; 112(12): 1796-1808. 4. Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, et al. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Invest. 2003; 112(12): 18211830. 5. Chmelar J, Chung KJ, Chavakis T. The role of innate immune cells in obese adipose tissue inflammation and development of insulin resistance. Thromb Haemost. 2013; 109(3): 399-406. 6. Poitou C, Dalmas E, Renovato M, Benhamo V, Haiduch F, Abdennour M, et al. CD14dimCD16+ and CD14+CD16+ monocytes in obesity and during weight loss: relationships with fat mass and subclinical atherosclerosis. Arterioscler Thromb Vasc Biol.2011; 31(10): 2322-2330. 7. Viardot A, Lord RV, Samaras K. The Effects of Weight Loss and Gastric Banding on the Innate and Adaptive Immune System in Type 2 Diabetes and Prediabetes. J. Clin Endocrinol Metab. 2010; 95(6): 2845-2850.

www.conferenciasindromemetabolico.org

133


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

134

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

POLIMORFISMOS G-6A EN EL GEN AGT E I/D EN EL GEN ECA Y SU RELACIÓN CON HIPERTENSIÓN ARTERIAL M.C. Jorge Barrera Alcocer1,Dra. Isela Parra Rojas1, Dr. José Francisco Muñoz Valle2, Dra. Alejandra Guadalupe García Zapién3,QBP. Aralia Berenice Salgado Bernabé1,Dra. Ines Matia Garcia1,Dr. Lorenzo Salgado Goytia1 ABSTRACT. Objective: Analyze the association of polymorphisms G-6A in the Angiotensinogen (AGT) gene and I/D in the Angiotensin Converting Enzyme (ACE) gene with hypertension in a population of Guerrero State. Materials and Methods: By PCR-RFLP assay was genotyped 141 normotensive and 55 hypertensive.They were evaluated clinical-biochemical parameters (weight, BMI, SBP, DBP, triglycerides, total cholesterol and glucose). The Hardy-Weinberg were calculated and considered as statistically significant a value of p<0.05. Results: In the variables Age, Gender, Weight, Height, BMI, Glucose, Triglycerides and Total Cholesterol statistically significant differences between the study groups are observed. The individuals with genotype G/A of polymorphisms G-6A the AGT gene showed statistically significant differences with high levels SBP (p<0.02). For I/D polymorphism in the ACE gene, significant differences (p<0.05) was observed in genotype and allele frequencies between the study groups Conclusion: The polymorphism I/D of the ACE gene was associated with arterial hypertension in population of the State of Guerrero. KEYWORDS: Hypertension, Renin Angiotensin Aldosterone System, Polymorphism, Angiotensinogen, Angiotensin Converting Enzyme.

I. INTRODUCCIÓN a hipertensión arterial es una enfermedad crónica que se caracteriza por un incremento de los valores de la presión sanguínea. Para el National Cholesterol Education Program-Adult Treatment Panel III (NCEP-ATP III), los valores para hipertensión son ≥130/85 mmHg (Rodríguez-Ortiz et al., 2016). Ésta, es una enfermedad multifactorial, se ha reportado que algunos polimorfismos en genes que codifican para componentes proteicos del Sistema Renina Angiotensina Aldosterona, pueden contribuir en el desarrollo de la enfermedad (Zaman et al., 2002). En un estudio realizado en una población caucásica, se reportó que el polimorfismo G-6A, se asocia con

L

HTA primaria (OR=2.2;IC95% 1.49-3.3) (Sudhir et al., 2010). Otro polimorfismo que consiste en la presencia o ausencia de una secuencia Alu de 287 pb, en el intrón 16 (rs4646994) del gen de la Enzima Convertidora de Angiotensina (ECA) y se ha reportado al alelo D, como de riesgo en población china, taiwanesa y caucásica, asociándola con el incremento de los niveles circulantes de ECA en individuos con hipertensión. En otro estudio, realizado en población Saudí reportó que el alelo D se asocia con hipertensión arterial (OR=4.8;IC95% 1.1–21.2) (Ali et al., 2012). El objetivo de este

trabajo fue analizar la asociación de los polimorfismos G-6A gen del Angiotensinógeno (AGT) e I/D del gen de la Enzima Convertidora de Angiotensina (ECA) con hipertensión arterial.

II. METODOLOGÍA El presente estudio, se llevó a cabo en un total de 196 muestras de ADN de pacientes, los cuales firmaron un consentimiento informado, para los casos la presión arterial fue ≥130/85 mmHg de acuerdo con el NCEP-ATP III, y los controles una presión arterial de 90-119/6079 mmHg. La genotipificación del polimorfismo I/D del gen ECA, se determinó por PCR. Para la genotipificación del polimorfismo G-6A, se realizó mediante PCR-RFLPS, utilizando la enzima BstN I y la visualización de los productos se determinó mediante electroforesis en geles de poliacrilamida al 6%, teñidos con nitrato de plata. Se determinaron las frecuencias alélicas y genotípicas, el análisis estadístico se realizó con Sofware STATA 11.0. Ambos polimorfismos se encuentran en Equilibrio de Hardy-Weinberg. Se consideró un valor estadísticamente significativo cuando p<0.05. Los Residuos

Laboratorio de Investigación de Obesidad y Diabetes. U.A.C.Q.B. Universidad Autónoma de Guerrero. Chilpancingo, Gro. 2 Departamento de Biología Molecular y Genómica, C.U.C.S. U. de Guadalajara, Jal. México, 3 Departamento de Farmacología. C.U.C.E.I.U. de Guadalajara, Jal. México 1

www.conferenciasindromemetabolico.org

135


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Peligrosos Biológico Infecciosos vas (p<0.05), en el peso, IMC, PAS, según la Norma Oficial Mexicana PAD, glucosa y triglicéridos, entre NOM-087-ECOL-SSA1-2002 los portadores del genotipo I/I vs. los portadores de los genotipos III. RESULTADOS I/D y D/D. (Tabla 5). Al analizar las variables clínico-bioquímicas entre los grupos IV. CONCLUSIONES de estudio, se observaron diferen- * El genotipo G/A del SNP cias estadísticamente significati- G-6A del gen AGT, se asoció con la vas (p<0.05) con el género, peso, Presión Arterial Sistólica en poblaIMC, glucosa, triglicéridos y coles- ción del Estado de Guerrero, terol total. Donde los hipertensos * El genotipo homocigoto I/I presentaron valores mayores en y el alelo I en el polimorfismo I/D comparación con los normoten- del gen ECA, se asociaron con HTA sos (Tabla 1). En la tabla 2, se en población del Estado de Guermuestran las frecuencias genotípi- rero. cas y alélicas del polimorfismo G-6A del gen AGT, sin que se obser- V. BIBLIOGRAFÍA ven diferencias estadísticamente 1. Ali A, Alghasham A, Ismail significativas (p>0.05), entre los H, Dowaidar M, Settin A. (2012). grupos de estudio. Al analizar las ACE I/D and eNOS E298D gene variables clínico-bioquímicas con polymorphisms in Saudi subjects los genotipos del polimorfismo with hypertension. Journal Renin G-6A en el gen AGT, se observa- Angiotensin Aldosterone System. ron diferencias estadísticamente 14(4):348-53. significativas (p<0.05) en los por- 2. Rodríguez-Ortiz, et al. tadores del genotipo G/A, presen- (2016). Assessment of two diffetando niveles más altos de Presión rent diagnostic guidelines criteria Arterial Sistólica, en comparación (National Cholesterol Education con los portadores de los genoti- Adult Treatment Panel III [ATP III] pos G/G y A/A. (Tabla 3). Al ana- and International Diabetes Fedelizar las frecuencias genotípicas y ration [IDF]) for the evaluation of alélicas del polimorfismo I/D en metabolic syndrome remission in el gen ECA, se observan diferen- a longitudinal cohort of patients cias estadísticamente significati- undergoing Roux-en-Y gastric vas (p<0.001). El genotipo I/I y el bypass. Surgery. 159.4:1121-1128. alelo I, se asocian con hipertensión 3. Sudhir J, Andrej T, Braharterial (OR=5.0; IC95% 2.1-11.9; maraju M. et al (2010). Transgep<0.001), (OR=2.4; IC95% 1.4-3.8; nic Mice with −6A Haplotype of p<0.001), respectivamente (Tabla the Human Angiotensinogen Gene 4). En el análisis de las variables Have Increased Blood Pressure clínico-bioquímicas con los ge- Compared with −6G Haplotype. notipos del polimorfismo I/D del The Journal of Biological Chegen ECA, se observaron diferen- mistry. 285, 41172-41186. cias estadísticamente significati- 4. Zaman, M.A., Oparil, S., Cal136

www.conferenciasindromemetabolico.org

V3-N1 - 2016

houm, D.A. (2002). Drugs targeting the renin-angiotensin aldosterone system. Nature Reviews Drug Discovery. 1:621-636.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

137


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

138

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ASOCIACIÓN DE LA SEROPOSITIVIDAD PARA ADENOVIRUS 36 CON OBESIDAD ABDOMINAL, NIVELES SÉRICOS DE CITOCINAS Y ALTERACIONES METABÓLICAS Dra. Linda A. Marino-Ortega1, QBP. Jorge A. Ocampo-Galeana1, QBP. Nayeli E. Sánchez-Casiano1, QBP. Ilse A. Gutiérrez-Pérez1, QBP. Sayuri López-Carranza1, QBP. Mayra Tapia-Antaño1, QBP. Aralia B. Salgado-Bernabé1, Dr. José F. Muñoz-Valle2, Dra. Natividad Castro-Alarcón1, Dr. Lorenzo Salgado-Goytia1, Dra. Isela Parra-Rojas1 ABSTRACT Aim: To analyzed the association of Adv-36 seropositivity with abdominal obesity, serum levels of cytokines and alterations in biochemical parameters. Material and methods: One hundred ninety-eight adults were recruited, of which 122 adults had abdominal obesity and 76 adults not the presented, with an age range of 1855 years. Body composition analysis was performed to all participants, as well as, measuring the levels of triglycerides, total cholesterol, HDL-c, LDL-c and glucose. An enzyme-linked immunosorbent assay (ELISA) to determine serum levels of cytokines (IL-4, IL-15 and MIF) and the qualitative determination for Adv-36 seropositivity in serum samples was used. Results: The prevalence of Adv-36 seropositivity was 43.1% in adults without abdominal obesity and 56.9% in those who had abdominal obesity, though it not association of Adv-36 seropositivity with abdominal obesity was found. The association of Adv-36 seropositivity with decreased serum levels of triglycerides, LDL-c and HDL-c, and increased serum concentrations of IL-4 was found. Conclusion: Adv-36 seropositivity is associated with low levels of triglycerides, LDL-c and HDL-c, and slight increase of concentrations of IL-4 in the adult population studied. KEYWORDS: abdominal obesity, Adv-36, IL-4, IL-15, MIF

I. INTRODUCCIÓN a obesidad es una enfermedad que se considera como un estado de inflamación crónica de bajo grado, debido a la producción anormal de hormonas y citocinas (Nielsen et al., 2013). En la obesidad, el exceso de tejido adiposo puede distribuirse por todo el cuerpo o puede concentrarse especialmente en determinadas regiones, cuando el exceso de grasa se acumula de forma preferente en la cavidad abdominal, hablamos de obesidad abdominal, lo cual resulta en un incremento del tamaño de la cintura y una mayor ganancia de peso (Myers JL, 2012). De acuerdo con la Encues-

L

ta Nacional de Salud y Nutrición (ENSANUT) en el 2012 en México, la prevalencia de obesidad abdominal fue del 74% (82.8% mujeres y 64.5% hombres) (ENSANUT, 2012). En 2001, Dhurandhar propuso el término «infectobesidad», con el cual describía que existía la posibilidad de que un componente infeccioso pudiera participar en la etiología de la obesidad (Dhurandhar, 2001). Debido a esto, se ha descrito que los adenovirus

contribuyen al desarrollo de la obesidad, específicamente adenovirus 36, el cual se ha asociado con el aumento en la adiposidad y paradójicamente con la disminución en los niveles séricos de colesterol y triglicéridos en pollos, ratones y primates (Trovato et al., 2009, So et al., 2005). Estudios in vitro, en cultivos celulares de adipoblasto (3T3-L1) sugieren que Adv-36, pudiera alterar la diferenciación del adipocito. Debido a que se ha observado que las células infectadas con Adv-36 se diferenciaron más rápido y acumulan más triglicéridos, en comparación con las células control. Proponiendo así, que Adv-36 afecta a los adipocitos directamente, provocando una hipertrofia e hiperplasia de células grasas (Vangipuram et al., 2004).

II. METODOLOGÍA Se incluyeron en el estudio 198 adultos de 18 a 55 años de edad, de los cuales se integraron dos grupos: 76 fueron adultos sin obesidad abdominal y 122 con obesidad abdominal de acuerdo a los

Laboratorio de Investigación en Obesidad y Diabetes, Unidad Académica de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero. Chilpancingo, Guerrero, México. 2 Departamento de Biología Molecular y Genómica, Centro Universitario de Ciencias de la Salud, Instituto de Investigación en Ciencias Biomédicas, Universidad de Guadalajara. Guadalajara, Jalisco, México. 1

www.conferenciasindromemetabolico.org

139


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

criterios de la Federación Internacional de Diabetes. A todos los participantes, se les realizó un análisis de composición corporal por impedancia bioeléctrica, presión arterial y medición de parámetros bioquímicos como glucosa, colesterol, triglicéridos, HDL-c y LDL-c. La identificación de la seropositividad para Adv-36, así como la medición cuantitativa para los niveles séricos de las citocinas IL-4, IL-15 y MIF, se realizó mediante ELISA (Ensayo de Inmunoabsorción Ligado a Enzima). El análisis estadístico de los resultados se realizó utilizando el programa STATA v.11.1.

III. RESULTADOS En el presente estudio se incluyen 198 adultos guerrerenses, de los cuales 145 (73.2%) fueron mujeres y 53 (26.8%) hombres. Al realizar la comparación de los grupos estudiados, se observaron diferencias en cuanto a la edad y género. Los adultos con obesidad abdominal, presentan mayores medidas de composición corporal, presión arterial, incremento de los niveles de glucosa, colesterol y triglicéridos, pero una disminución en las concentraciones séricas de IL-4, en comparación con los adultos que no presentan obesidad abdominal. Al realizar el análisis en los grupos de estudio de acuerdo a la seropositividad para Adv-36, se encontró que las personas positivas presentan menor edad, disminución en los niveles de triglicéridos, LDL-c y disminución de HDL-c (solo en las mujeres), además presentan mayores concentraciones séricas 140

www.conferenciasindromemetabolico.org

de IL-4 con respecto a las personas seronegativas (Cuadro 2). La prevalencia de seropositividad para Adv-36, fue del 43.1% en personas sin obesidad abdominal y el 56.9% presentaban obesidad abdominal. Finalmente, al realizar el análisis de la frecuencia de las alteraciones en los parámetros estudiados de acuerdo a la seropositividad para Adv-36, se observó que en las personas seropositivas observan niveles bajos de HDL-c, el 47.7% LDL-c ≥ 100 mg/dl y aunque no es estadísticamente significativo, el 43.1% presentó concentraciones séricas de IL-4 >1.24 pg/ml (Cuadro 3).

V3-N1 - 2016

Erikstrup C, Fischer CP, Plomgaard P, Mounier R, et al. Association between interleukin-15 and obesity: interleukin-15 as a potential regulator of fat mass. J Clin Endocrinol Metab. 2008 Nov;93(11):4486-93. 5. So PW, Herlihy AH, Bell JD. Adiposity induced by adenovirus 5 inoculation. Int J Obes (Lond). 2005 Jun;29(6):603-6. 6. Trovato GM, Castro A, Tonzuso A, Garozzo A, Martines GF, Pirri C, et al. Human obesity relationship with Ad36 adenovirus and insulin resistance. Int J Obes (Lond). 2009 Dec;33(12):1402-9. 7. Vangipuram SD, Sheele J, Atkinson RL, Holland TC, IV. CONCLUSIÓN Dhurandhar NV. A human adeLa prevalencia de seropositividad novirus enhances preadipocyte para Adv-36, fue mayor en las per- differentiation. Obes Res. 2004 sonas con obesidad abdominal y May;12(5):770-7. esta infección puede estar asociada con la variabilidad en el perfil de lípidos y de las citocinas. V. BIBLIOGRAFÍA 1. Dhurandhar NV. Infectobesity: obesity of infectious origin. J Nutr. 2001 Oct;131(10):2794S-7S. 2. Gutiérrez JP, Rivera-Dommarco J, Shamah-Levy T, Villalpando-Hernández S, Franco A, Cuevas-Nasu L, et al. Encuesta Nacional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México: Instituto Nacional de Salud Pública (MX), 2012. 3. Myers JL, Allen JC. Nutrition and inflammation: insights on dietary pattern, obesity, and asthma. American Journal of Lifestyle Medicine. 2012:14-7. 4. Nielsen AR, Hojman P,


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

141


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

142

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DEL CONSUMO DE UNA GALLETA ENRIQUECIDA CON VAINA DE CACAO SOBRE EL PERFIL CARDIOMETABÓLICO Y LA MICROBIOTA INTESTINAL: PRUEBA DE CONCEPTO Gaitán-Concepción Lucía1, Cervantes-Riquelme Lorena1, Espinosa-Morales Braulio1,Martínez-Sánchez Froylan David1, Sierra-Puente Diego1, Velasco-García María Fernanda1, Domínguez-Rangel Jorge Armando1, Fierro-Gómez Arely1, Peña-Barreto Adán2, Vázquez-López Rosalino3, Hernández-Ortega Martha Mercela3, Ceballos-Reyes Guillermo Manuel3, Gutiérrez-Salmeán Gabriela3 ABSTRACT Introduction: An association between gut microbiota and different indicators of the cardiometabolic profile exists. Diverse studies have reported that bioactive substances of cocoa are capable of modulating those indicators; nevertheless, there is lack of evidence about functional food. Objectives: Evaluate the effects of a panification product enriched with cocoa pod extract on the cardiometabolic profile and gut microbiota of healthy subjects. Materials and methods: A proof of concept was performed, including healthy subjects between 20-25 years old, who consumed two times a day, for four weeks, a panification product enriched with cocoa pod. Biochemical tests, anthropometric measures and gut microbiota analysis were realized before, during and at the end of the study. Results: Any statistically significant value was obtained (basal vs. final), but a decrease trend was observed in the values of the cardiometabolic risk, particulary in the abdominal circumference and the trigliceridemia. Conclusions: Despite of not obtaining a statistically significant value, the present study confirms the effects previously reported of bioactive substances of cocoa - when they are managed in isolated form - but, in this case, as a functional food. KEYWORDS: cocoa, cardiometabolic profile, gut microbiota

I. INTRODUCCIÓN l riesgo cardiovascular (RCV) se define como la probabilidad de que un evento clínico de esta índole ocurra a una persona en un tiempo determinado(1,2). Los factores de riesgo (FR) que aportan alrededor de un 90% al RCV mundialmente son dislipidemias, hipertensión arterial (HAS), diabetes mellitus (DM), obesidad y sedentarismo, entre otros.(1,3,5). Para definir el riesgo cardiometabólico (RCM) se suman también alteraciones como insulino resistencia (IR), hiperglucemia, obesidad central (OC) y síndrome metabólico (SM) (6,7). El SM es una serie de anormalidades consi-

E

deradas conjuntamente FR para desarrollar DM y aumentar el RCM (8). La fisiopatología se basa principalmente en la IR y la OC (8). La grasa visceral acumulada secreta adipocinas, que favorecen estados proinflamatorios y protrombóticos, y a su vez contribuyen al desarrollo de IR, hiperinsulinemia, alteración en la fibrinólisis y disfunción endotelial (8). Existe una relación importante entre la microbiota intestinal (MI),

la salud general de un individuo y su perfil cardiometabólico (6,9). Se ha descrito que la MI tiene efectos sobre el desarrollo de OC, DM y aumento del RCM (10). Se conoce que en general la MI está compuesta por 4 filos principales, Bacteroidetes, Firmicutes, Actinobacteria y Proteobacteria; siendo el marcador de RCM más importante, la relación entre las primeras dos (9). El cacao contiene moléculas bioactivas que intervienen en el metabolismo de la glucosa, los lípidos y son modificadores del RCV y RCM (11). Entre ellas, los polifenoles (siendo el más abundante la epicatequina), procianidina y metilxantinas como la cafeína y la teobromina (11,12). Estudios observacionales han descrito que el consumo de cacao modifica el RCM mostrando cambios notorios en la presión arterial (PA), función endotelial, sensibilidad a la insulina y lípidos en plasma (11).

Estudiante de pregrado Químico Bacteriólogo Parasitólogo 3 Doctor en Ciencias Instituciones participantes: Facultad de Ciencias de la Salud, Universidad Anáhuac México Norte Laboratorio de Investigación Integral Cardiometabólica, SEPI-ESM, Instituto Politécnico Nacional 1 2

www.conferenciasindromemetabolico.org

143


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

II. METODOLOGÍA Se realizó un ensayo clínico (prueba de concepto) incluyendo seis voluntarios clínicamente sanos, en relación 1:1 (hombre:mujer), de 20-25 años de edad, sin intolerancia o alergia al cacao y que hubiesen firmado una carta de consentimiento informado. Los sujetos consumieron, dos veces al día durante cuatro semanas, una galleta (5 g de peso neto) enriquecida con vaina de cacao, cuyo aporte energético era de 15 kcal y contenido fenólico equivalente a 23 mg de ácido gálico. Como indicadores del perfil cardiometabólico, se determinó la ircunferencia abdominal (CA), fuerza de agarre manual, valores séricos de glucosa (GlucS), triglicéridos (TG) y colesterol total (CT). La MI fue tipificada antes, durante y al final del estudio. El análisis estadístico se realizó mediante t-Student pareada, para los resultados bioquímicos, de medidas antropométricas y de fuerza. La tipificación de la microbiota se presenta como frecuencias relativas. III. RESULTADOS Se evaluó el perfil cardiometabólico basal (i.e, antes del tratamiento), a la segunda y cuarta semana, registrando el peso y CA, fuerza muscular y PA (Figuras 1-3); se determinó GlucS, TG y CT (Figuras 4-5). En esos mismos tiempos, se tipificó la MI –a partir de una muestra de heces-, agrupándola de acuerdo a sus filos (Figura 6).

144

www.conferenciasindromemetabolico.org

IV. CONCLUSIONES A pesar de no obtener una diferencia estadísticamente significativa, el presente estudio cumple con el objetivo de una prueba de concepto pues confirma los efectos previamente reportados para las sustancias bioactivas del cacao –particularmente en relación al metabolismo de lípidos, así como la presión arterial- pero, en este caso, como parte de un alimento funcional. En cuanto a la MI, se observó una tendencia positiva en términos de incremento de Bacteroidetes y Actinobacterias en la fase inicial del protocolo; por su parte, los Firmicutes y Proteobacterias se mantuvieron sin cambio durante la primer semana aunque, para el final del estudio, también incrementaron.

V. BIBLIOGRAFÍA 1. Alcocer LA, Lozada O, Fanghänel G, Sánchez-Reyes L, Campos-Franco E. Estratificación del riesgo cardiovascular global. Comparación de los métodos Framingham y SCORE en población mexicana del estudio PRIT. Cir Cir 2011;168-74. 2. Levenson JW, Skerrett PJ, Gaziano JM. Reducing the global burden of cardiovascular disease: the role of risk factors. Prev Cardiol 2002 Fall;5(4):188-99. 3. Detección y Estratificación de factores de riesgo cardiovascular. México: Secretaría de Salud, 2010. 4. González-Pier E, Guitérrez Delgado C, Stevens G, Barraza-Llórens M, et. al. Definición de prioridades par alas inter-

V3-N1 - 2016

venciones de salud en el Sistema de Protección Social en Salud de México. Salud Pública de México 2007;49:S38-51. 5. Davis W, Colagiuri S, Davis T. Comparison of the Framingham and United Kingdom Prospective Diabetes Study cardiovascular risk equations in Australian patients with type 2 diabetes from the Fremantle Diabetes Study. Medical Journal of Australia 2009;191:4748. 6. Brunzell JD, Davidson M, Furberg CD, Goldberg RB, et al. Lipoprotein Management in Patients With Cardiometabolic Risk. JACC 2008;51(15): 1512-24. 7. Klein S, Allison DB, Heymsfield SB, Kelley DE, Leibel RL, Nonas C, Kahn R. Waist Circumference and Cardiometabolic Risk: A Consensus Statement from Shaping America’s Health: Association for Weight Management and Obesity Prevention; NAASO, The Obesity Society; the American Society for Nutrition; and the American Diabetes Association. OBESITY 2007;15 (5): 1061-67. 8. Lizarzaburu JC. Síndrome metabólico: concepto y aplicación práctica. An Fac med 2013; 74(4): 315-20. 9. Jandhyala SM, Talukdar R, Subramanyam C, Vuyyuru H, Sasikala M, Reddy DN. Role of the normal gut microbiota. World J Gastroenterol 2015;21(29):8787-803. 10. Tremaroli V, Bäckhed F. Functional interactions between the gut microbiota and host metabolism. Nature 2012;489:242-49. 11. Stellingwerff T, Godin JP, Chou CJ, Grathwohl D, Ross AB,


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

Cooper KA, Williamson G, Actis-Goretta L. The effect of acute dark chocolate consumption on carbohydrate metabolism and performance during rest and exercise. Appl. Physiol. Nutr. Metab. 2014;39: 173-182. 12. Ottaviani JI, Balz M, Kimball J, Ensunsa JL, Fong R, Momma TY, et al. Safety and efficacy of cocoa flavanol intake in healthy adults: a randomized, controlled, double-masked trail. Am J Clin Nutr 2015;102:1425-35. 13. Dower JI, Geleijnse JM, Gijsbers L, Zock PL, Kromhout D, Hollman PC. Effects of the pure flavonoids epicatechin and quercetin on vascular function and cardiometabolic health: a randomized, double-blind, placebo-controlled, crossover trial. Am J Clin Nutr 2015;101:914-21. 14. Russo R, Lucchesi D, Longo VG, Gabriele M, Penno G, Pucci L. Nutraceuticals and cardiovascular risk: potential role of EPCs modulation. Stem Cell Transl Investig 2015; 2: e949. 15. Marchesi JR, Adams DH, Fava F, et al. The gut microbiota and host health: a new clinical frontier. Gut 2016;65:330-39. doi:10.1136/gutjnl- 2015-309990

www.conferenciasindromemetabolico.org

145


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

146

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

SÍNDROME METABÓLICO Y SUS FACTORES DE RIESGO EN UNA POBLACIÓN TABASQUEÑA M en C. Jorda Aleiria Albarrán Melzer1, M. E. M Rebeca Estrella Gómez1, M. en C. Crystell Guadalupe Guzmán-Priego1, Est. Alejandra Hernández Galicia1 ABSTRACT Metabolic syndrome refers to the co-occurrence of elevated plasma glucose, excess abdominal fat, high blood pressure and dyslipidemia. The ObjectiveTo determine the risk factors of metabolic syndrome in the adult population attending for the first time a health center in the Ejido JoséMaríaPino Suárez in the municipality of Centro, Tabasco. Observational, transversal, prospective, descriptive study design, convenience sample of 42 subjects who attended for the first time the Health Center Ejido José María Pino Suárez in the period April-September 2013. Results Age of 33.24 ± 10.3 in a range that goes from 15 to 60 years old, 81% (n = 34) of them are female, body mass index 29.9 ± 6.2 within a range of 19.5 to 45.47, identifying 47.6% (n = 20) within the obese study group, 28.6% (N = 12) with normal weight and 23.8% (n = 10) overweight. Conclusion The risk factors identified in Tabasco population are not isolated and are not the main cause of consultation, guiding our thinking that the pathological condition of overweight and obesity is normal in the local understanding with marked tendency to bad food habits and physical inactivity, resulting in delayed diagnosis of chronic diseases associated with SM as diabetes mellitus, hypertension and dyslipidemia KEYWORDS: Obesity, Dyslipidemia, diabetes

I. INTRODUCCIÓN índrome metabólico (SM) incluye la presencia obesidad central y dos o más factores como: trigliceridemia, con disminución de lipoproteínas de alta densidad, aumento de la presión arterial e incremento de la glucemia de acuerdo a una herramienta diagnóstica de la Federación Internacional de Diabetes (Zimmet, Alberti, George, & Serrano Ríos, 2005). SM es definido por un grupo de factores de riesgo metabólicos como obesidad, hipertensión e insulino resistencia (Harding, Sooriyakumaran, Anstey, Adams, Balkau, Briffa &Magliano, 2015), en otras palabras se refiere a la presencia de glucosa elevada en sangre, exceso de grasa abdominal, presión sanguínea eleva-

S

da y dislipidemia (Chen, Wendel, Birkholz, Vallone, Coleman, & Mahajan, 2015). Los factores asociados a la presencia de SM: a) Obesidad visceral exceso de tejido adiposo favorece la liberación de ácidos grasos no esterificados predisponiendo a la acumulación de grasa ectópica en hígado, musculo y tejido visceral (Rivas, 2012) b) Resistencia a la insulina, definida por la incompetencia de la insulina para conseguir control de glucosa en sangre que se acompaña con hiperinsulinemia, c) Dislipidemia aterogénica caracterizada por una elevación de la concentración sérica de triglicéridos y por una disminución de la concentración sérica de Lipoproteínas de Alta Densi1

Universidad Juárez Autónoma de Tabasco

dad (HDL), d) Hipertensión (Bello, Sánchez, Ferreira, Báez, Fernández & Achiong, 2012). Los mecanismos fisiopatológicos que explican la presencia de SM implica alteraciones en el metabolismo glucolipídico, estados proinflamatorios y protrombóticos vinculado a la resistencia a la insulina (Laclaustra Gimeno, Bergua Martínez, Pascual Calleja, & Casasnovas Lenguas, 2005). Lo anterior nos indica que existe un panorama de salud pública desalentador por el marcado incremento de enfermedades crónico degenerativas que repercuten en economía, productividad de va de orden local a lo general motivo por el cual determinar los factores de riesgo de síndrome metabólico en la población adulta que acude por primera vez al centro de salud en el ejido José María Pino Suárez del municipio del Centro, Tabasco, nos puede revelar un panorama de lo que está sucediendo en el estado. II. METODOLOGÍA Se realizó un estudio cuantitativo con un diseño observacional, transversal, prospectivo, descriptivo. Se estudió una muestra no probabilística obtenida por conveniencia de 42 sujetos que acudieron por primera vez a consulta

www.conferenciasindromemetabolico.org

147


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

al Centro de Salud del Ejido José María Pino Suárez en el periodo abril-septiembre de 2013. Las variables fueron datos demográficos, índices antropométricos, parámetros bioquímicos, signos vitales. En lo que corresponde a datos demográficos se analizó edad y sexo del paciente de manera cuantitativa y categórica nominal obtenida a través de anamnesis, los índices antropométricos: peso y talla se midieron a través de bascula de palanca calibrada y estadímetro respectivamente, se calculó el índice de masa corporal según la formula peso/talla2 y se clasificó según lo indicado en la Norma Oficial Mexicana Servicios Básicos de Salud. Promoción y educación para la salud en materia alimentaria. Se realizó análisis de estadístico a través del Software Estadístico Minitab®

III. RESULTADOS Se estudió una muestra de 42 sujetos que acudieron a consulta por primera vez a la unidad de primer nivel localizada en el ejido Pino Suárez del municipio del Centro donde se obtuvo una media de edad de 33.24±10.3 años de edad, que se encuentran en un rango que va de 15 a los 60 años de edad, de los cuales el 81% (n=34) son de sexo femenino. En el grupo se encontró al 47.6% (n=20) grupo de estudio con obesidad, 28.6% (N=12) con normopeso y 23.8% (n=10) sobrepeso, de los cuales solo el 19% (n=8) realiza alguna actividad física. El 7.1% (n=3) tuvo alteración de tensión arterial y se encontró una media de 119.5±54.6 148

www.conferenciasindromemetabolico.org

mg/dL de glucosa en ayuno, de los cuales el 50% (n=21) son de sexo femenino, con sobrepeso u obesidad e hiperglucemia en ayuno. Conclusión Los factores de riesgo como la presencia de sobrepeso en nuestra población es preocupante ya que se asocia con una gran cantidad de patologías crónicas de difícil tratamiento, altos costos y pronostico desalentador.

IV. REFERENCIAS 1. Barquera, S., Campos-Nonato, I., Hernández-Barrera, L., Pedroza, A., & Rivera-Dommarco, J. A. (2013). Prevalencia de obesidad en adultos mexicanos, 20002012. Salud Pública de México, 55, S151-S160. 2. Bello, B., Sánchez, G., Ferreira, A. C., Báez, E. G., Fernández, J., & Achiong, F. (2012). Síndrome Metabólico: un problema de salud con múltiples definiciones. Revista Médica Electrónica, 34(2), 199213. 3. Chen, J. J., Wendel, L. J., Birkholz, E. S., Vallone, J. G., Coleman, A. L., Yu, F., & Mahajan, V. B. (2015). The metabolic syndrome and severity of diabetic retinopathy. Clin Ophthalmol, 9, 757764. doi: 10.2147/OPTH.S80355 4. Díaz, Ó. A., & Hernández, M. E. C. (2012). Prevalencia del síndrome metabólico en pacientes con síndrome coronario agudo. Archivos de Medicina de Urgencia de México, 4(2). 5. Harding, J., Sooriyakumaran, M., Anstey, K. J., Adams, R., Balkau, B., Briffa, T., Magliano, D. J. (2015). The metabolic syndrome

V3-N1 - 2016

and cancer: Is the metabolic syndrome useful for predicting cancer risk above and beyond its individual components? Diabetes Metab, 41(6), 463-469. doi: 10.1016/j. diabet.2015.04.006 6. Laclaustra Gimeno, M., Bergua Martínez, C., Pascual Calleja, I., & Casasnovas Lenguas, J. A. (2005). Síndrome metabólico. Concepto y fisiopatología. Revista Española de Cardiología Suplementos, 5(4), 3D-10D. doi: http:// dx.doi.org/10.1016/S11313587(05)74114-5 7. Pajuelo, J., & Sánchez, J. (2007). El síndrome metabólico en adultos, en el Perú. Paper presented at the Anales de la facultad de medicina. 8. Rivas, J. P. G. (2012). Síndrome metabólico¿ queda espacio para este concepto. Rev Venez Endocrinol Metab, 10(1), 20-27. 9. Romero-Martínez, M., Shamah-Levy, T., Franco-Núñez, A., Villalpando, S., Cuevas-Nasu, L., Gutiérrez, J. P., & Rivera-Dommarco, J. Á. (2013). Encuesta Nacional de Salud y Nutrición 2012: diseño y cobertura. Salud Pública de México, 55, S332-S340. 10. Villegas, A., Botero, J. F., Arango, I. C., Arias, S., & Toro, M. M. (2003). Prevalencia del síndrome metabólico en El Retiro, Colombia. Iatreia, 16, 291-297. 11. Zimmet, P., Alberti, M., George, K., & Serrano Ríos, M. (2005). Una nueva definición mundial del síndrome metabólico propuesta por la Federación Internacional de Diabetes: fundamento y resultados. Revista española de cardiología, 58(12), 1371-1376.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ALTERACIONES DE PESO, DISLIPIDEMIAS Y DIABETES UN RIESGO PARA SÍNDROME METABÓLICO EN TENOSIQUE TABASCO M. E. M Rebeca Estrella Gómez1, M en C. Jorda Aleiria Albarrán Melzer1, M. en C. Crystell Guadalupe Guzmán-Priego1, Est. Oscar Manuel Focil Gómez1 ABSTRACT Excess body weight (overweight and obesity) is currently recognized as one of the most important public health challenges in the world, the rapidity of its increase and negative effect that has on the health of the population that suffers from it. Today, Mexico ranks second in worldwide prevalence of obesity in the adult population which represents a very important challenge for the health sector. A descriptive, transversal, study with an epidemiological approach in search of the number of people with overweight, obesity, and lifestyle, in a group of 50 people who were your inquiry for the first time in its corresponding Tenosique, Tabasco Health Center. In order to identify complications related to obesity and propose solutions to improve the quality of life in these patients and prevent in the future. KEYWORDS: overweight Obesity, Tabasco

I. INTRODUCCIÓN l exceso de peso corporal (sobrepeso y obesidad) es reconocido actualmente como uno de los retos más importantes de salud pública en el mundo, dada su magnitud, la rapidez de su incremento y el efecto negativo que ejerce sobre la salud de la población que lo padece.( Hussain y Bloom, 2011) El sobrepeso y la obesidad incrementan significativamente el riesgo de padecer enfermedades crónicas no trasmisibles (ECNT), mortalidad prematura y el costo social de la salud, además de que reducen la calidad de vida. Se estima que 90% de los casos de diabetes mellitus tipo 2 son atribuibles al sobrepeso y la obesidad. En América Latina esta epidemia trasciende las fronteras socioeconómicas y aqueja por igual a ricos y pobres, así como a personas de todas las edades. (Mitchell NS y colaboradores, 2011). La obesidad constituye uno de los mayores

E

problemas de salud pública en el mundo. Se ha documentado que es resultados de factores genéticos y ambientales y su presencia se asocia con el desarrollo de enfermedades crónicas. Por mucho tiempo identificada con la ausencia de voluntad y autocontrol, ahora es reconocida por la comunidad médica como un problema de salud pública, como una epidemia mundial una enfermedad seria y crónica con una variedad de causas subyacentes y un número relevante de condiciones asociadas que conducen a mayor morbilidad y mortalidad que la población general como diabetes mellitus y las dislipidemias que nos llevan a presentar complicaciones de origen cardiovascular (Luckie y colaboradores, 2009) Los aumentos en las prevalencias de obesidad en México se encuentran entre las más rápidas documentadas en el plano 1

Universidad Juárez Autónoma de Tabasco

mundial. Aun que se ha documentado que el aumento de prevalencia de sobrepeso y obesidad en los adultos mexicanos ha venido declinando en los últimos años, debe señalarse que esta prevalencia se encuentra entre los más altos del mundo. Pues un gran problema de salud pública en México es el aumento de peso, pues 7 de cada 10 adultos presentan sobrepeso y que de estos la mitad presenten obesidad. Por lo tanto es de vital importancia ahondar en el conocimiento de los efectos que el consumo exagerado de estas bebidas produce a nivel metabólico. (Gutiérrez y colaboradores, 2012).

II. METODOLOGÍA El presente es un estudio descriptivo transversal (prospectivo), con un enfoque epidemiológico. 553 Pacientes que acudan al Centro de Salud del poblado Usumacinta del municipio de Tenosique, Tabasco y que no hayan sido diagnosticados previamente con diabetes mellitus tipo 2, ni dislipidemias o que estuvieran sometiéndose a tratamiento que pudiera alterar los niveles de glucosa, colesterol y triglicéridos en el periodo Agosto 2013-Julio 2014. Se utilizó estadística descriptiva como medias, desviación estándar, porcentajes.

www.conferenciasindromemetabolico.org

149


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Los datos fueron procesados usan- nado con la alteración de glucosa do software estadístico apropiado en ayunas así como dislipidemias (Excel). como lo menciona la literatura, los cuales son factores para presentar III. RESULTADOS diabetes e hipertensión arterial. La muestra final fue de 50 pacientes de los cuales el 70% se en- IV. CONCLUSIÓN contró con alteraciones en el peso. Es indiscutible que un problema De los pacientes con alteraciones de esta magnitud requiere de la nutricionales se encontró que el participación de todos los sectores 83% correspondían al sexo feme- de la sociedad y de programas nino y solo el 17% al sexo mascu- multisectoriales para su adecualino, lo que demuestra que son las da prevención y control. Para ello mujeres las que están siendo más es necesario: diseñar programas afectadas por esta pandemia. Re- de prevención que influyan en la sultados que se relacionan con la adopción de hábitos de alimentaEncuesta Nacional de Salud y Nu- ción y actividad física saludable. trición 2012 donde menciona que la proporción es mayor entre las V. BIBLIOGRAFÍA mujeres que en los hombres. De 1. Alegría, E., Castellano, J., los resultados del estilo de vida de Alegría y Barrero A. Obesidad, los pacientes con sobrepeso y obe- síndrome metabólico y diabetes: sidad el 85% No realiza ejercicio, implicaciones cardiovasculares y el 8.57% fuma y también el 8.57% actuación terapéutica Rev Esp Carpresenta alcoholismo, lo que nos diol. ;61:752-64, 2009. indica que este tipo de alteraciones 2. Barquera, S., Nonato, I., está directamente relacionada con Hernández, L,, Pedroza, A, y Riveun estilo de vida inadecuado. De ra, J. Prevalencia de obesidad en los pacientes con sobrepeso y obe- adultos mexicanos, 2000-2012. sidad se encontró que el 85.2 % Revista Salud Publica Mex ;55, no realizan ninguna actividad Físi- 2013 ca y solo el 14.2% si la realiza, es 3. Barquera, S., Rivera, J., preocupante porque sabemos que Campos, I., Hernández, L., Santos, la falta de actividad es un factor de C. y Durán, E., et al. Bases técnicas riesgo para presentar alteraciones del Acuerdo Nacional para la Salud en el peso. De los pacientes con Alimentaria. Estrategia contra el sobrepeso y obesidad se encon- sobrepeso y la obesidad. México, tró que el 20% presentaba altera- DF: Secretaría de salud. 2010. ciones de glucosa con un promedio 4. Gutiérrez, J., Rivera, J., Shade 107.36, el 22.85% en coleste- mah, T., Villalpando, S., Franco, A. y rol con un promedio de 176 y el Cuevas, L. et al. Encuesta Nacional 51.42 % de estos pacientes pre- de Salud y Nutrición. Resultados sentaban triglicéridos con 180 gr/ Nacionales. Cuernavaca, México: dl. , lo que indica que la obesidad y Instituto Nacional de Salud Públiel sobrepeso es un factor relacio- ca; 2012. 150

www.conferenciasindromemetabolico.org

V3-N1 - 2016

5. Hussain, S., Bloom, S. The pharmacological treatment and management of obesity. Postgrad Med. 123:34-44, 2011. 6. Luckie, A., Cortes, F. e Ibarra, S. . Obesidad: trascendencia y repercusión medico –social. Revista de especialidades médicoquirúrgicas; 14(4):191-201, 2009. 7. Meaney, A. Factores de riesgo cardiovascular en una población urbana de clase media mexicana. El Estudio de Lindavista. Los datos de referencia. Arch Cardiol Mex. 2013 Oct-Dic; 83 (4): 249-56. doi: 10.1016 / j.acmx.2013.05.002. Epub 2013 8. Mitchell, N., Catenacci, V., Wyatt, H. y Hill, J. Obesity: overview of an epidemic. Psychiatr Clin North Am. 34:717-32, 2011. 9. Moyer, V. Preventive Services Task Force. Screening for and management of obesity in adults: U.S. Preventive Services Task Force recommendation statement. Ann Intern Med.;157:373-78, 2012


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DE UN PROGRAMA DE EJERCICIO AEROBIO ACUÁTICO SOBRE COMPONENTES DEL SÍNDROME METABÓLICO LMH Astrid Samantha Hernández Mendoza, LMH Fernanda Itzel Sánchez Muñoz, MC Viviana Navarrete Miramontes ABSTRACT Introduction: As the years go through, sedentary women are likely to develop metabolic syndrome due to increasing obesity and diabetes; which is not a single disease but the association of health problems that can appear simultaneously or sequentially in the same subject. Objective: To determine the effect of a water aerobic program of moderate intensity, on components of the metabolic syndrome in sedentary women. Material and Methods: A sample of 14 sedentary women between 22 and 49 years old with SM city of Chihuahua. Before and after the program was determined: blood pressure, glucose, triglycerides, high-density lipoprotein and abdominal waist and hip circumference. Results: the weight was reduced of 81.01±17.44 to 78.27±15.50kg (p < 0.01); initial 82.86±9.13 final 78.57±7.70mmHg (p <0.01); TAS of 120.00±8.77 to 116.71±10.97mmHg; glucose 112.86±72.69 to 105.31±28.52mg/dL; triglycerides of 243.95±227.33 to 175.48±56.78mg/dL; initial maximum hip circumference 111.45±12.44 final 107.75±11.45cm (p < 0.000), abdominal waist 104.45±13.27 to 103.17±14.32cm, and increased HDL of 47.63±10.26 to 50.73±11.85mg/dL (p<0.05). Conclusions: the exercise program reduced weight, diastolic blood pressure, maximum hip circumference and increases HDL; ending with a 42.85% reduction of the components of metabolic syndrome in participants. PALABRAS CLAVE: Acuaerobics, obesidad, hipertensión, triglicéridos, glucosa

I. INTRODUCCIÓN onforme transcurren los años las mujeres sedentarias están expuestas a desarrollar síndrome metabólico (SM) debido al incremento de obesidad y diabetes mellitus (DM). En ambos sexos la frecuencia aumenta linealmente con la edad, la mujer supera al hombre al llegar al final del periodo fértil sobre las enfermedades cardiovasculares (ECV) elevándose la prevalencia de SM(1). En México en la población adulta de 20 a 49 años de edad existe una prevalencia de sobrepeso y obesidad mayor en mujeres (73.0%) que en hombres (69.4%) (2). En el año 2014 en el estado de Chihuahua se registró una prevalencia de obesidad de 40.10% de

C

la población femenina de 20 a 44 años y 11.76% de 45 a 49 años(3). El sedentarismo, un índice de masa corporal (IMC) alto y la inactividad física desencadenan en la población mexicana enfermedades crónicas como sobrepeso y obesidad, aumentado el riesgo de padecer SM(4).

II. METODOLOGÍA Estudio cuasi-experimental, longitudinal con mediciones pre y post test. Muestra por conveniencia de 14 mujeres sedentarias de 22-49 años de edad con SM de la ciudad de Chihuahua. Los criterios de exclusión fueron problemas ortopédicos y alteraciones menstruales.

La investigación se apegó a los estatutos de la Ley general de salud en materia de la investigación para la salud y a la Declaración de Helsinki(5). Al inicio y término del programa se cuantificaron tensión arterial sistólica (TAS) y diastólica (TAD), glucosa, triglicéridos (Tg) y lipoproteínas de alta densidad (HDL); mediante los lineamientos del ISAK(6) se midió estatura, peso, circunferencia de cadera máxima y cintura abdominal. El programa de ejercicios se trabajó en las primeras 6 semanas (1-6) al 40% de la fórmula de Karvonen, las siguientes 4 (7-10) se incrementó la intensidad al 50% utilizando resistencias en muñecas, tobillos y pesas. Cada una de las sesiones duró 60 minutos, registrándose la frecuencia cardiaca cada 5 minutos mediante pulsómetro durante todo el tiempo de trabajo.

III. RESULTADOS La media de edad fue de 41.93±6.96 años y talla 1.57±.05 m, el peso disminuyó de 83.44±18.28 kg a 80.30±16.34 kg (-3.73%) (p<0.01). La TAD disminuyó de 82.86±9.13 a 78.57±7.70 mmHg (-4.86%) (p<0.01), la TAS de 120.00±8.77 a 116.71±10.97 mmHg (-3.68%) y glucosa de

Facultad de Ciencias de la Cultura Física, Universidad Autónoma de Chihuahua

www.conferenciasindromemetabolico.org

151


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

112.86±72.69 a 105.31±28.52 mg/ dL (-6.68%). Los Tg disminuyeron de 243.95±227.33 a 175.48±56.78 mg/dL (-5.61%) y las HDL aumentaron de 47.63±10.26 a 50.73±11.85 mg/dL (6.77%) (p<0.05). La circunferencia de cintura abdominal disminuyó de 104.45±13.27 a 103.17±14.32 cm (-1.27%) y la circunferencia de cadera máxima inicial de 111.45±12.44 final 107.75±11.45 cm (-3.24%) (p<0.000). Los resultados anteriores se muestran en la tabla 1. En la tabla 2 se muestran las correlaciones más significativas de la presente investigación; se observó una correlación alta y positiva al inicio del programa entre los niveles de Tg y glucosa de 0.867 (p<0.000), así como en peso y glucosa de 0.666 (p<0.004). Al término se observó correlaciones entre el peso y glucosa de 0.703 (p<0.002) y entre cadera máxima y glucosa de 0.706 con p<0.002.

IV. CONCLUSIONES La atención al SM comprende la reducción de sus causas como obesidad e inactividad física, y el tratamiento de los factores de riesgo asociados mediante la modificación de los estilos de vida. En la presente investigación se observó una reducción significativa del peso, circunferencia de cadera máxima y una tendencia a disminuir la circunferencia de cintura abdominal; los beneficios de estos cambios gracias al desarrollo del ejercicio físico es reducir los factores de riesgos aterogénicos, el desarrollo de DM, hipertensión (HTA) y dislipidemia; así como el incrementar la capacidad funcional medida como VO2 entre el 5 y 20%(7,8). En el estudio actual la TAS y TAD disminuyeron siendo la última significativa por lo que es de suma importancia regular los valores de la TA, al ser la HTA una enfermedad crónica no trasmisible y causa

V3-N1 - 2016

de muerte en mujeres. Se observó una correlación alta y positiva entre los niveles elevados de Tg y la glucosa elevada antes de iniciar el programa de ejercicio aeróbico acuático determinando que la hipertrigliceridemia se asocia con la resistencia a la insulina; por lo que la tendencia a disminuir de ambas variables y el aumento significativo de las HDL después de la intervención, indican una mejora metabólica al incrementarse la trasportación del colesterol de los tejidos del cuerpo hacia el hígado previniendo enfermedades cardiovasculares(9,10). La aplicación del programa de ejercicio aerobio acuático reduce significativamente peso, TAD y circunferencia de cadera máxima. Promueve la disminución de circunferencia abdominal, TAS, glucosa y Tg. Y aumenta significativamente los valores de lipoproteínas HDL mejorando la salud cardiovascular. Finalizando con una reducción del 42.85% de los componentes del SM en las participantes. V. BIBLIOGRAFÍA 1. Fernández D, Félix F, Lozano L, Pérez J, Sanz H, Cabrera A, et al. Prevalencia de síndrome metabólico según las nuevas recomendaciones de la OMS. Estudio HERMEX. Gaceta Sanitaria. 2011;25(6):519-24. 2. Gutierrez J, Rivera J, Shamah T, Villalpando S, Franco A, Cuevas L, et al. Encuesta Nacional de Salud y Nutrición 2012. Instituto Nacional de Salud Pública. 2012:200.

152

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

3. Epidemiología DGd. Anuario de morbilidad 1984-2014 2014. Available from: http:// www.epidemiologia.salud.gob. mx/anuario/html/anuarios.html. 4. Savino P. Obesidad y enfermedades no transmisibles relacionadas con la nutrición. Rev Colomb Cir. 2011;26(3):180-95. 5. WMA. Declaración de Helsinki de la AMM- Principios éticos para las investigaciones médicas en seres humanos. Health promotion. 2015:1. 6. ISAK. ISAK World Conference 2014. Available from: http:// www.isakonline.com/. 7. Pérez S, Díaz G. Circunferencia de la cintura en adultos, indicador de riesgo de aterosclerosis. Revista Habanera de Ciencias Médicas. 2011;10(4):441-7. 8. Tibana R, Navalta J, Bottaro M, Vieira D, Tajra V, de Oliveira A, et al. Effects of eight weeks of resistance training on the risk factors of metabolic syndrome in overweight/obese women-“A Pilot Study”. Diabetology & metabolic syndrome. 2013;5(1):1. 9. Nieto OA, García DM, Jiménez JA, Landázuri P. Efecto del ejercicio en subpoblaciones de lipoproteínas de alta densidad y en la presión arterial. Rev Salud Pública. 2013;15(1):12-22. 10. Wooten J, Phillips M, Mitchell J, Patrizi R, Pleasant R, Hein R, et al. Resistance exercise and lipoproteins in postmenopausal women. International journal of sports medicine. 2011;32(1):7.

www.conferenciasindromemetabolico.org

153


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CEO: VALIDACIÓN DE UN PROGRAMA DE EJERCICIO ONLINE PARA NIÑOS CON DIABETES LMH Tania Griselda Ortiz Santana, LMH Erick Iván Recio Hernández, Dra. Yunuen Socorro Rangel Ledezma, MC Viviana Navarrete Miramontes ABSTRACT Introduction: Physical exercise is an effective therapeutic tool to prevent and treat obesity, as well as to reduce the associated metabolic alterations. Objective: validate a web page designed for dosing of exercise for children with obesity and diabetes from 6 to 12 years, through the use of devices with internet access. Method: the evaluation of the web page was carried out through a satisfaction survey applied to a sample of students and teachers from Human Motricity, where parameters such as context, design and usability are described. Results: regard to the commitment of the programmer with the improvement of the quality of life of children with obesity and diabetes obtained a score of 93.3%, respect to recommend this page result was 93.3% approval 4.4& average grade and 2.2% of non-conformity. Conclusion: according to the results of the study it is concluded that the online exercise program is effective dosage of physical activity to children with obesity and diabetes obtaining satisfactory levels of compliance. Currently is null the existence of pages dedicated to the dosage of physical activity in Latin America, so the use of CEO is an important factor to consider.

I. INTRODUCCIÓN ctualmente las personas tienen un estilo de vida sedentario el cual ha generado un ambiente obesogénico(1). A causa del fuerte cambio sociocultural es más frecuente que los niños y adultos prefieran realizar actividades como ver televisión, pasar tiempo en redes sociales o en internet. Se perdió el interés por las actividades recreativas, culturales y deportivas que impliquen más movimiento corporal(2, 3). El sedentarismo es un factor de riesgo para el desarrollo de enfermedades metabólicas como la diabetes mellitus (DM)(4, 5).En el tratamiento integral de la DM el ejercicio físico es una estrategia que ofrece beneficios como: control glucémico, nivel de glucosa sanguínea en ayuno, perfil de lípi-

A

154

www.conferenciasindromemetabolico.org

dos y reduce los factores de riesgo metabólico como la resistencia a la insulina y el control de peso aportando además una disminución de masa grasa, factor importante en la prevención de la DM en individuos de alto riesgo(6). México ocupa el primer lugar a nivel mundial en obesidad infantil según la Encuesta Nacional de Salud y Nutrición (ENSANUT) 2012, en el país el 71.9% de la población sufre de sobrepeso u obesidad, con una prevalencia de 5.3% en niños menores de 5 años y de 26.2% en niños de 5 - 11 años de edad. Un 60% de la población no realiza actividad física (AF) para tener beneficios en la salud, el estilo de vida sedentario se caracteriza por actividades con bajo gasto energé-

tico <1.5 METS sin tomar en cuenta dormir, como el uso de computadora y el desplazarse en coche, estas actividades se realizan en posición sentado o decúbito sin un gasto energético significativo (7) . Los niños son considerados personas dependientes de la tecnología, debido a esto se han suscitado investigaciones sobre la influencia de los dispositivos conectados a internet en la vida de los niños; cada día se dedica más tiempo al ocio y menos tiempo a la AF cotidiana(3). Un sitio web es una recopilación de páginas conectadas por determinado número de hipervínculos al cual se accede mediante enlaces de hipertexto o hipervínculos enlazadas a un dominio de internet en la web o World Wide Web (WWW)(8). La estructura del sitio debe constar: objetivos, estructura y diseño, página de inicio, páginas de las principales secciones y secundarias, menús de navegación, tipos de usuarios, posicionamiento en buscadores, gestión de las palabras clave y apariencia, y diseño gráfico(9). Los sitios web se adaptan a las necesidades de la población ya que cada día utiliza más la tecnología para realizar de forma más sencilla sus actividades de la vida coti-

Facultad de Ciencias de la Cultura Física, Universidad Autónoma de Chihuahua


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

diana(10). Las ventajas son por ejemplo la posibilidad de comunicación, el entorno cooperativo, desarrollo de habilidades; y entre las desventajas esta la información poco confiable y el tiempo invertido para localizar información navegando en la web; convirtiéndose así en un importante instrumento para el aprendizaje y la formación intelectual, profesional y personal(11). II. METODOLOGÍA El estudio se realizó mediante una investigación de acción participativa (IAP), se generó una encuesta de satisfacción en relación a las funciones de la página donde los sujetos tuvieron una interacción como expertos investigadores del tema. El rango de las encuestas era del 1 – 10; donde 10 es “máxima conformidad”, 9 – 7 “conformidad”, 6 – 5 “calificación Media”, 4 – 1 “Inconformidad”. Se calificaron los siguientes parámetros: contenido, diseño usabilidad. El estudio se realizó en las instalaciones de la Facultad de Ciencias de la Cultura Física (FCCF) de la Universidad Autónoma de Chihuahua. El programa fue evaluado por una muestra de estudiantes y docentes de la FCCF; con conocimientos de aplicación de actividad física a niños con obesidad y DM. Los criterios de exclusión: haber desacreditado alguna materia a lo largo de la licenciatura o no desear participar. III. RESULTADOS Los porcentajes se estratificaron en “estado de máxima conformi-

V3-N1 - 2016

dad”, “conformidad”, “calificación media” e “inconformidad”. Los resultados obtenidos en las categorías de máxima conformidad y conformidad se compactaron. Con respecto a si la página está comprometida con la mejora de la calidad de vida de los niños con obesidad y DM fue un 93.3% de estado de conformidad y un 6.7% de IV. CONCLUSIÓN calificación media (Gráfica 1). En De acuerdo a los resultados del presente estudio se llegó a la conclusión que la creación y validación de CEO es eficaz para la dosificación de la AF enfocada a niños con obesidad y DM. Para la aplicación web se creó un programa de ejercicio sustentado en asrelación al programa de ejercicio y pectos fisiológicos, anatómicos y las necesidades fisiológicas de las procesos corporales; además se personas a quienes va dirigido, los relacionó el IMC con edad y género resultados reflejaron un 93.3% de determinando el percentil y así doconformidad, 2.2% de calificación sificar efectivamente la AF según media y 4.5% de estado de incon- las necesidades de la población a formidad (Gráfica 2). El resultado la cual el programa está orientado. Se concluye, de acuerdo a los resultados del piloteo exploratorio realizado para la validación, el 93.3% fue de calificación de alto grado de satisfacción con respecto al diseño visual y funcional del programa. Actualmente es nula la existencia de páginas dedicadas a la dosificasobre qué tan satisfecho se en- ción de AF en latino América, por cuentra con la calidad, funciona- lo que la utilización de CEO es un lidad y contenido de la página se factor importante a considerar. obtuvo un resultado de 91.1% de conformidad, 6.7% de calificación V. BIBLIOGRAFÍA media y 2.2% de inconformidad 1. OMS. Obesidad y Sobrepe(Gráfica 3). so USA: OMS; 2015 [cited 2015 Enero]. Available from: http://www. who.int/mediacentre/factsheets/ fs311/es/. 2. Gutiérrez, Rivera D, Shamah L, Villalpando H, Franco, Cuewww.conferenciasindromemetabolico.org

155


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

vas N, et al. ENSANUT. 2012. 3. Sánchez JMP, Vizuete AA, Camino MM, Ortega RM. Actividad física y sedentarismo como moduladores de la situación nutricional. Nutrición Hospitalaria. 2015;32(s01):20-2. 4. Lazenby R. F. Fisiopatología, editor. Ciudad de México: Manual Moderno; 2012. 897 p. 5. Tebar J, Escobar F. La Diabetes Mellitus en la Práctica Clínica Panamericana E, editor. D.F. México2009. 6. Mancilla R, Torres P, Álvarez C, Schifferli I, Sapunar J, Díaz E. Ejercicio físico interválico de alta intensidad mejora el control glicémico y la capacidad aeróbica en pacientes con intolerancia a la glucosa. Revista médica de Chile. 2014;142(1):34-9. 7. Hernández, Gutiérrez, Reynoso, Noverón. Diabetes mellitus in Mexico: Status of the epidemic. salud pública de méxico. 2013;55:s129-s36. 8. Berners-Lee T, Cailliau R, Groff J-F, Pollermann B. World-Wide Web: the information universe. Internet Research. 2010;20(4):461-71. 9. Sánchez, Pastor. Bases para un diseño Web integral a través de la convergencia de la accesibilidad, usabilidad y arquitectura de la Información. Scire: representación y organización del conocimiento. 2010;16(1):65-80. 10. García Laborda J. Cambios en los estilos de aprendizaje inducidos por el uso de la web social. 2015. 11. Rial A, Gómez P, Braña T, Varela J. Actitudes, percepciones y 156

www.conferenciasindromemetabolico.org

uso de Internet y las redes sociales entre los adolescentes de la comunidad gallega (España). anales de psicología. 2014;30(2):642-55.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DE LA SUPLEMENTACIÓN DE EDULCORANTES NATURALES Y ARTIFICIALES SOBRE EL PERFIL HISTOMORFOLÓGICO Y DISTRIBUCIÓN DEL TEJIDO ADIPOSO EN RATONES BALB/C L.N BC. Sosa–García1, Dr. FB.Pliego–Rivero2, Dr. R. Oros–Pantoja3, Dra. ML.Basurto–Acevedo4, C. García– Reza5 RESUMEN I. INTRODUCCIÓN l incremento del tejido adiposo tiene relación con el consumo indiscriminado de los edulcorantes no calóricos.

E

grupo control agua.

V. CONCLUSIÓN Los edulcorantes sucralosa y sacarosa aumentaron el teijodo mesenterico; el tejido gonadal aumento por el consumo de stevia sp y sacarosa. El tejido inguinal incremento en el grupo inguinal.

II. OBJETIVO Describir el efecto de los edulcorantes no caloricos sobre la acu- PALABRAS CLAVE: Edulcorantes mulación de grasa total en las ca- artificiales no calóricos, obesidad, vidades: inguinal, mesenterico y tejido adiposo. gonadal en ratones BALB/c. III. MATERIAL Y MÉTODOS Estudio experimental, en 24 ratones BALB/c, se formaron 4 grupos: 6 Stevia sp, 6 sucralosa, 6 sacarosa y 6 agua. Durante 6 semanas se administro el edulcorante, posteriormente se realizarón disecciones del tejido adiposo y se cuantifico por medio de una báscula análitica. Para la comparación en grupos se utilizo U de Mann-Whitney y Kruskal-Wallis. IV. RESULTADOS El tejido adiposo mesentérico fue mayor en el grupo sacarosa, seguido sucralosa y agua; menor en el grupo Stevia sp., (p=0.04). Por lo tanto, el tejido gonadal fue mayor en Stevia sp. El tejido inguinal fue similar entre sucralosa, Stevia sp, sacarosa en comparación con el

Licenciada en Nutrición por la Facultad de Medicina de la Universidad Autónoma del Estado de México 2 PhD. Profesor-investigador de la Facultad de Medicina de la Universidad Autónoma de Estado de México, Líder del Cuerpo Académico Neurociencias 3 PhD. Profesor-investigador de la Facultad de Medicina de la Universidad Autónoma del Estado de México 4 PhD. Investigadora del Instituto Mexicano de Seguridad Social, adscrita al departamento de Endocrinología 5 Doctora en Enfermería. Profesora-investigadora de la Facultad de Enfermería y Obstetricia de la Universridad Autónoma del Estado de México, Líder del Cuerpo Académico Enfermería y Cuidado a la Salud 1

www.conferenciasindromemetabolico.org

157


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

VIABILIDAD DE UN MATERIAL DIDÁCTICO LLAMADO «EL RELOJ DIABÉTICO T2» EN PACIENTES DIABÉTICOS TIPO II González-Ledesma JJ1,4, Ochoa JA1, Ávila-Serrato S3, Molina-García A2, Zúñiga-Vega R1, Rodríguez-González E1, García-Avellaneda E1, Ruiz-Herrejón SP1 RESUMEN: En la actualidad existes un sinfín de materiales didácticos que ayudan a la orientación de hábitos alimenticios y de salud, como lo es el Plato del Bien Comer, La Jarra del Buen Beber, entre otros, pero ninguno en el país está enfocado directamente al paciente diabético tipo 2, también ninguno cuenta con los tres pilares fundamentales del bienestar (Correcta alimentación, Actividad física y descanso adecuado) en los diferentes materiales didácticos. PALABRA CLAVE: DIABETES MELLITUS TIPO 2, MATERIAL DIDÁCTICO, HÁBITOS ALIMENTICIOS Y DE SALUD

I. INTRODUCCIÓN l diseño de esta investigación es de paradigma cualitativo con enfoque interpretativo. El propósito de este trabajo fue determinar la utilidad de El Reloj Diabético T2, para fomentar hábitos de alimentación saludable y estilos de vida saludables. Utilizando como referencia los tres pilares del bienestar; (Correcta alimentación, Actividad Física y Descanso). Se logró un cambio significativo en la conducta alimentaria y de salud.

E

II. METODOLOGÍA Orientar a los pacientes del Centro de Salud Apatzingán con Diabetes Mellitus tipo 2 del Grupo de Ayuda Mutua, para generar hábitos alimentarios correctos, mediante la creación de un material didáctico, fusionando la NOM-015-SSA, los tres pilares del bienestar y un sencillo reloj de pared. Se aplicó dos cuestionarios con 10 preguntas las cuales fueron elaboradas de acuerdo a las necesidades de la investigación. (60 hojas) antes y después del experimento, también 158

www.conferenciasindromemetabolico.org

con apoyo de 15 flayers y 15 relojes, duración de la comprobación 3 meses, aplicadas a los pacientes del Centro de Salud Apatzingán del Grupo de Ayuda Mutua con Diabetes Mellitus tipo 2, todo esto para demostrar la viabilidad del material didáctico a este tipo de pacientes. Las preguntas fueron enfocadas tanto el tipo de hábito alimentario que tenía el paciente, como los hábitos de actividad física y horas de descanso.

III. RESULTADOS La utilidad del Reloj Diabético T2, apoyo visualmente y didácticamente cual sería el tratamiento alternativo para la Diabetes Mellitus tipo 2 demostrados mediante la aplicación de la encuesta la cual, indicó al final del experimenta que les ayudaba en la toma de decisiones al observar el reloj. Finalmente se pudo demostrar un cambio significativo en la conducta alimentaria y de salud. Se reforzaron los hábitos alimentarios saludables así como la actividad física, dándole además relevancia al descanso.

IV. CONCLUSIONES Con el Reloj Diabético T2 se orientó a los pacientes del Centro de Salud Apatzingán, de tal mane-

Secretaría de Salud en Michoacán Comisión Estatal para la Protección Contra Riesgos Sanitarios Michoacán 3 Universidad de Guanajuato 4 Sociedad Internacional de Nutriólogos en México SOCINUM A.C. 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ra que este material didáctico pudiera ser viable que todos los pacientes del país lo tengan a manera de plan alimenticio y se indique en los centros de atención como una promoción de la salud integral. Se pretende replicar en los diferentes Centros de Salud que pertenecen a la Jurisdicción Sanitaria No. 1 Morelia. Con un mayor número de pacientes con diabetes y así posicionar este material como el mejor del país adaptándolo a cada región, facilitando su viabilidad

V. BIBLIOGRAFÍA 1. Cabezuela, G., & Frontera, P. (2007). Enséñame a Comer. Santiago, Chile: EDAF. 2. NORMA Oficial Mexicana NOM-015-SSA2-2010, Para la prevención, tratamiento y control de la diabetes mellitus. 3. Argueta Villamar, Arturo, Leticia M. Cano Asseleih y María Elena Rodarte. Atlas de las plantas de la Medicina Tradicional Mexicana. Tomo I. México: Instituto Nacional Indigenista y Biblioteca de la Medicina Tradicional Mexicana, 1994. 4. Mahan, L. K. (2001). Nutrición y dietoterapia de Krause (Décima edición ed.). McGRAW-HILL.

www.conferenciasindromemetabolico.org

159


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FIBER-BYPASS® FIBRA DIETÉTICA PARA EL CONTROL GLICÉMICO EN DIABETES MELLITUS TIPO II González-Ledesma JJ1,4, Ochoa JA1, Ávila-Serrato S3, Molina-García A2, Zúñiga-Vega R1, Rodríguez-González E1, García-Avellaneda E1, Ruiz-Herrejón SP1 tico de Diabetes Mellitus Tipo II, con una evolución de no más de 10 años de evolución de ambos sexos. La muestra poblacional de conveniencia (no probabilística) se obtendrá del 10% de estos 303 pacientes obtenidos del Sistema de Información en Salud (SIS) de Cubos, de la Secretaría de Salud Michoacán, del centro de salud en el municipio de Apatzingán, Michoacán. Representando un total redondeado de 30 pacientes que se dividirán en 2 grupos de 15 pacientes. Se indicara un consumo tratamiento farmacológico de este del compuesto de fibra de 30g/día, síndrome metabólico es de por diferido en 3 tomas de 1 cucharavida, y pretende controlar las ma- da (10g) c/8hrs. nifestaciones clínicas y prevenir complicaciones. Desafortunada- • Criterios de Inclusión mente, para muchos pacientes no 1) Edad 30-70 años. se logra, los fármacos utilizados 2) Sexo indiferente. son costosos y presentan efectos 3) Ocupación indiferente. adversos importantes. La pobla- 4) Glicemias por arriba de 160mg/ ción mexicana tanto de zonas ru- dl. rales como urbanas, utiliza trata- 5) Tener <10 años de evolución de mientos alternativos (herbolaria) la enfermedad. combinado con fármacos, para mejorar signos y síntomas genera- • Criterios de Exclusión: dos por la diabetes. 1) Impedimentos físicos.

RESUMEN: Existen en la actualidad diferentes tratamientos Alopáticos enfocados al controlar los niveles glicémicos, sin embargo existen tratamientos menos invasivos sin efectos secundarios, como lo es, la herbolaria. Que la medicina moderna, aún sigue en la experimentación, cuando debería ser la primera opción al paciente diagnosticada con diabetes mellitus tipo 2. Este trabajo de investigación aporta conocimiento encaminadas al tratamiento con una mezcla de fibra dietética controlando los niveles glicémicos del paciente diabético. Por lo anteriormente mencionado se desarrolló una alternativa para el tratamiento del diabético, un producto alimenticio de fibra soluble e insoluble (FIBER-BYPASS®) el cual se le realizó un estudio bromatológico previo al tratamiento del paciente, cuidando la sinergia de la mezcla. En la investigación realizada se concluyó que una fibra dietética de (20gr a 30gr/ día) soluble e insoluble, en el perfil glicémico de 15 pacientes diabéticos del Centro de Salud Apatzingán del Grupo de Ayuda Mutua, con duración de tres meses, produce una mejora significativa en los niveles de glicemia en ayunas y postprandial. PALABRA CLAVE: DIABETES MELLITUS TIPO 2, FIBRA DIETÉTICA, NIVEL GLICÉMICO

I. INTRODUCCIÓN ntre las principales patologías del siglo XXI, se encuentra la Diabetes Mellitus que comprende un grupo heterogéneo de enfermedades sistémicas crónicas de causa desconocida con grados variables de predisposición hereditaria y la participación de diversos factores ambientales que afectan el metabolismo intermedio de los hidratos de carbono, proteínas y grasas que se asocian fisiopatológicamente en la cantidad, cronología de secreción y/o en la acción de la insulina. Estos defectos traen como consecuen- II. METODOLOGÍA • Presentación del procia una elevación anormal de la Pacientes que acuden al Centro de ducto terminado (etiqueta) glucemia después de cargas están- Salud de Apatzingán, con diagnós- Conformación de la formula “FIdar de glucosa, incluso en ayunas conforme existe mayor descom- 1 Secretaría de Salud en Michoacán pensación de la secreción de in- 2 Comisión Estatal para la Protección Contra Riesgos Sanitarios Michoacán sulina. (NOM-015-SSA2-1994). El 34 Universidad de Guanajuato

E

Sociedad Internacional de Nutriólogos en México SOCINUM A.C.

160

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

BER- BYPASS” (Imagen 1) Debiendo conformar una relación de fibra soluble insoluble de 3 a 1 para fines prácticos del proyecto que hagan posible su eficacia al mejorar su capacidad de absorción y adsorción y así mismo obtener los resultados esperados, se deberá obtener el gramaje adecuado de cada producto para que coincida con el porcentaje de fibra siguiente: 75% soluble, 25% insoluble. De acuerdo a los requerimientos que nos marca la NOM-015 para disminuir las glucemias en pacientes con DM-2, se buscara modificar los ingredientes de la mezcla para guardar la relación efectiva de 3 a 1; soluble insoluble. III. RESULTADOS se observó lo siguiente, • En este estudio participaron 30 diabéticos, de los cuales existe mayor representación del sexo femenino, 27 pacientes diabéticas. • Las edades de los Diabéticos estudiados están desde los 42 a 65 años. • De acuerdo a la valoración del IMC de los y las Diabéticos estudiados la mayoría de ellos 25 pacientes se encuentra con sobrepeso y obesidad. • Gran parte de diabéticos en número de 24 tiene una circunferencia de cintura superior a lo recomendado. • Del tratamiento aplicado a los pacientes diabéticos se pudo observar diferencias significativas tanto de la glucosa basal; experimental y control: los que si consumieron fibra (experimental) tu-

vieron la glucosa basal de 116mg/ dl glucosa basal y postprandial 136mg/dl grupal, mientras que los pacientes que no consumieron fibra salubre e insoluble (control) tuvieron 155mg/dl glucosa basal y postprandial 228mg/dl grupal, a la doceava semana de estudio. Por lo tanto se concluye que la fibra dietética (FIBER-BYPASS®) añadida a la dieta de los pacientes diabéticos, si produce una mejora significativa en los niveles de glicemia en ayunas y postprandial.

IV. CONCLUSIONES Del tratamiento aplicado a los pacientes diabéticos se pudo observar diferencias significativas tanto de la glucosa basal; experimental y control: los que si consumieron fibra (experimental) tuvieron la glucosa basal de 116mg/dl glucosa basal y postprandial 136mg/dl grupal, mientras que los pacientes que no consumieron fibra salubre e insoluble (control) tuvieron 155mg/dl glucosa basal y postprandial 228mg/dl grupal, a la doceava semana de estudio. Por lo tanto se concluye que la fibra dietética (FIBER-BYPASS) añadida en dieta de los pacientes diabéticos si produce una mejora significativa en los niveles de glicemia en ayunas y postprandial. Se considera replicar este trabajo en un mayor número de pacientes del Centro de Salud de Morelia, agregando un estudio de laboratorio más, La Hemoglobina Glucosilada, para determinar los niveles de glucosa en sangre en los últimos tres meses.

V3-N1 - 2016

V. BIBLIOGRAFÍA 1. American Diabetes Association (ADA). Diabetic retinopathy. Clinical practice recomendations. Diabetes Care 2000; 23 (Supl 1) 73-76. 2. NORMA Oficial Mexicana NOM-015-SSA2-2010, Para la prevención, tratamiento y control de la diabetes mellitus. 3. Instituto Mexicano del Seguro Social [IMSS] (2010). Diabetes tipo I. Documento revisado el 29 de septiembre de 2010 de: http://www.imss.gob.mx/salud/ Diabetes/Diabetes_tipo_1.htm 4. IMSS (2010). Diabetes tipo II. Documento revisado el 29 de septiembre de 2010 de: http:// www.imss.gob.mx/salud/Diabetes/Diabetes_tipo_2.htm. 5. Organización Mundial de la Salud (2010). Día Mundial de la Diabetes. Documento revisado el 27 de septiembre de 2010 de: http://www.worlddiabetesday. org/es.

www.conferenciasindromemetabolico.org

161


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CONOCIMIENTO DEL PROTOCOLO DE ATENCIÓN PARA UN PACIENTE HIPERTENSO EN UN TRATAMIENTO ODONTOLÓGICO María Fernanda Yáñez Acosta1, Yannette Concesa Velázquez Jiménez2, Bianca Brizeida Espinoza Gómez3, Tonantzin Ramos Camacho3, María José Chávez Arciniega3 ABSTRACT: This article evaluated the level of knowledge that the dental surgeon degree professionals, in the region of Tepatitlán de Morelos, Jalisco, about the proper handling of hypertensive patients within the dental practice. PALABRAS CLAVES: paciente hipertenso, presión arterial, manejo dental, anestésico, signos y síntomas, manifestación oral.

I. INTRODUCCIÓN a OMS (Organización Mundial de la Salud, Ginebra 1978), describe la hipertensión arterial, como la fuerza que ejerce la sangre contra las paredes de los vasos (arterias) al ser bombeada por el corazón. Cuanto más alta es la tensión, más esfuerzo tiene que realizar el corazón para bombear la sangre a todo el cuerpo. Por eso, es de suma importancia la valoración de los pacientes con patología cardiovascular, previa a la realización de procedimientos odontológicos. En la Encuesta Nacional de Salud y Nutrición,2012 (ENSANUT), menciona la prevalencia actual de HTA en México es de 31.5% (IC 95% 29.8-33.1), siendo esta más alta en adultos con obesidad (42.3%; IC 95% 39.4-45.3) que en adultos con índice de masa corporal (IMC) normal (18.5%; IC 95% 16.221.0), y en adultos con diabetes (65.6%; IC 95% 60.3-70.7) que sin esta enfermedad (27.6%, IC 95% 26.1-29.2). Además, durante la ENSANUT 2012 se pudo observar que del 100% de adultos hipertensos 47.3% desconocía que padecía HTA.

L

162

www.conferenciasindromemetabolico.org

Debido al número elevado de personas que presenta hipertensión arterial, es de gran importancia que el profesional en Odontología conozca el manejo adecuado de este tipo de paciente. San Martin C., et. al. (2001), menciona la importancia en el manejo odontológico de identificar al paciente hipertenso antes de empezar un tratamiento dental, ya que el estrés y la ansiedad asociada con nuestros procedimientos pueden alzar la presión arterial a niveles peligrosos, lo cual podría resultar en un accidente cerebrovascular o un infarto al miocardio. Dentro de las manifestaciones orales para la identificación del paciente hipertenso mencionadas por Iglesias A., (2013), podemos encontrar el dolor reflejado hacia el ángulo izquierdo de la mandíbula en muchas ocasiones ha sido el primer indicador de cardiopatía coronaria, el hecho de que desaparece con el reposo, permite

sospechar el diagnóstico; otra manifestación encontrada en este tipo de pacientes es la hiposalivación por el empleo de cardiorreguladores como los bloqueadores B adrenérgicos, de igual manera se pueden presentaran cambios en tejidos blandos. Como manifestaciones secundarias que pudieran presentarse, encontramos las reacciones liquenoides, hiperplasia gingival por el uso de bloqueadores de los canales de calcio, úlceras aftosas, lengua negra, lesiones que semejan pénfigo o penfigoide, edema angioneurótico, eritema multiforme, urticaria y sialadenitis. De acuerdo al anestésico a utilizar en el paciente hipertenso, Guzmán L, Castellanos L,(2003), hacen mención a las amidas, como la lidocaína (xylocaína) y mepivacaína (carbocaína) como el grupo farmacológico más importante, debido a la rapidez con que se manifiestan sus propiedades y a los pocos casos de alergia que se han reportado. Guzmán L, Castellanos L. (2003) sugiere la adición de vasoconstrictores como la epinefrina en

Especialista en Odontopediatría. Maestra en Educación en el área de Docencia e Investigación. Profesor de Tiempo Completo. Centro Universitario de los Altos. Universidad de Guadalajara. 2 Maestra en Estomatología Pediátrica. Técnico Académico y Profesor de Asignatura. Centro Universitario de los Altos. Universidad de Guadalajara. 3 Alumna de la Licenciatura en Cirujano Dentista. Centro Universitario de los Altos. Universidad de Guadalajara. 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

concentraciones de 1:100,000 a bliografías citadas. 1:250,000 logrando un incremento considerable en la duración de sus efectos al uso de anestésico para el paciente hipertenso controlado. II. METODOLOGÍA Se realizó un estudio de tipo observacional, descriptivo, comparativo y transversal. Donde el universo de estudio, estuvo constituido por 37 profesionales de la Licenciatura Cirujano Dentista, en la región de Tepatitlán de Morelos, Jalisco. El tipo de muestra fue no probabilístico. Al llevar a cabo dicha investigación, fue necesario tomar en cuenta criterios de exclusión en donde se especificó que fueron excluidas todas aquellas personas que no cumplieron con los criterios requeridos para llevar a cabo la investigación, así como también todos aquellos profesionales no pertenecientes a dicha licenciatura. Sin embargo dentro de los criterios de inclusión se tomó en cuenta a los profesionales de la Licenciatura Cirujano Dentista, pertenecientes a la región de Tepatitlán de Morelos, Jalisco. El principal objetivo de esta investigación fue evaluar el nivel de conocimiento sobre el manejo del paciente hipertenso por parte del profesional de la Licenciatura Cirujano Dentista. III. RESULTADOS De acuerdo a los resultados obtenidos en las encuetas, se tomaron en cuenta aquellas preguntas donde el resultado obtenido fue más relevante en cuanto a las bi-

www.conferenciasindromemetabolico.org

163


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

IV. CONCLUSIÓN De acuerdo a los resultados obtenidos creemos que es imprescindible que como profesionales en el área de odontología ofrezcamos a nuestros pacientes hipertensos tratamientos de calidad, teniendo dominio del conocimiento sobre el manejo adecuado de este tipo de pacientes y de esta manera evitar posibles complicaciones y negligencias dentro de la consulta odontológica. Consideramos que los profesionistas del área de la salud cualquiera que esta sea, estamos obligados a seguir actualizándonos y adquirir conocimientos nuevos para poder brindar a nuestros pacientes una atención de calidad. V. BIBLIOGRAFÍA • San Martín C, Hampel H, Villanueva J. (2001). Manejo Odontológico del Paciente Hipertenso. Revista dental de chile, 92, 34.). • Alven J, Arreaza I,.

164

www.conferenciasindromemetabolico.org

(06/06/2005). Manejo odontológico del paciente hipertenso. Acta Odontológica Venezolana, 45, no 1, 8. • Castellanos JL, Díaz L, Gay Z. Medicina en Odontología. Manejo dental de pacientes con enfermedades sistémicas. 2ª Ed México; Manual Moderno: 2002: 1-10. • Díaz L, Castellanos J, Zárate O, (2003). Selección de los anestésicos locales adecuados para los pacientes hipertensos. Marzo-Abril 2003, de medifgraphic Sitio web: http://www. medigraphic.com/pdfs/adm/od2003/od032h.pdf • Jesús A y Arreaza I. Manejo odontológico del paciente hipertenso. Acta odontol. venez [online]. 2007, vol.45, n.1 [citado 201606-16], pp. 120-124 . Disponible en: <http://www.scielo.org.ve/ scielo.php?script=sci_arttext&pi =S0001-63652007000100024&lng=es&nrm=iso>. ISSN 00016365. • Almazán D Oliver R. Luna C, Guerrero F, Cornejo M.. (2012). efecto del trataiento endodontico en el paciente hipertenso. 2012, de medigraphic Sitio web: http:// www.medigraphic.com/pdfs/ adm/od-2013/od131g.pdf • Iglesias A. (2013). Factores de riesgo odontológico en pacientes médicamente comprometidos registrados en un centro de atención primaria de odontología del servicio galego de saúde – sergas. 2014, de bistrem Sitio web: http://dspace.usc.

V3-N1 - 2016

es/bitstream/10347/10011/1/ rep_617.pdf • http://www.medigraphic. com/pdfs/imi/imi-2009/imi092i. pdf • García L, Sevilla V, Salinas, Altamirano H. (2007). Nivel de conocimiento de los estudiantes de cuarto y quinto año de la Facultad de Odontología acerca del manejo del paciente hipertenso. 2009, de universidad Autonoma de Nicaragua Sitio web: http://riul.unanleon.edu.ni:8080/jspui/bitstre am/123456789/2774/1/210551. pdf • Alfonso K, Achiong F, Achiong M, Achiong A, , Fernández A, Delgado Lenia,. (2011). Factores asociados al hipertenso no controlado. Revista Médica Electrónica, 33(3), 278-285. Recuperado en 20 de junio de 2016, de http://scielo.sld.cu/ scielo.php?script=sci_arttext&pi =S1684-18242011000300004&lng=es&tlng=es. • Muñoz L, Narváez C. (2012). pH Salival, Capacidad Buffer, Proteínas Totales y Flujo Salival en Pacientes Hipertensos Controlados Usuarios de Diuréticos. International journal of odontostomatology, 6(1), 11-17. Recuperado en 20 de junio de 2016, de http://www.scielo.cl/ scielo.php?script=sci_arttext&pid =S0718381X2012000100002&lng=es&tlng=pt.10.4067/ S071881X2012000100002.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FRECUENCIA DE SÍNDROME METABÓLICO EN PACIENTES ATENDIDOS EN CESSA TEHUACÁN EN PRIMER SEMESTRE DEL 2016 Valdez García J.A., Abad C. T., Contreras P. I.1, Mota P. G., Tlapa S. Ma. E.2, Gallardo C.E.3 RESUMEN. En el desarrollo del síndrome metabólico se ha observado que los factores de riesgo como los malos hábitos alimenticios y el sedentarismo favorecen el desarrollo de sobrepeso, obesidad, Diabetes mellitus (DM), Hipertensión arterial y por consiguiente el Síndrome metabólico (SM). De ahí la importancia del presente trabajo de investigación; de tipo transversal, descriptico y clínico, realizado con una muestra de 470 pacientes que acudieron durante el primer semestre de 2016 al CESSA de Tehuacán, Pue., En el Análisis de la muestra (470 pacientes) encontramos a 238 pacientes con las enfermedades que integran el SM. 161 menores de 60 años y 77 mayores de esa edad, y de ambos géneros. PALABRA CLAVE. Síndrome metabólico, dislipidemias y obesidad

I. INTRODUCCIÓN l síndrome metabólico (SM), también llamado síndrome de resistencia a la insulina, síndrome plurimetabólico y síndrome cardiometabólico, se refiere a la coexistencia en un mismo individuo de al menos tres de los siguientes indicadores: obesidad central, hipertensión arterial, triglicéridos elevados, concentraciones bajas de colesterol, lipoproteínas de alta densidad y elevación de la glucosa. De acuerdo a los criterios de la OMS existirá un SM) si observamos los siguientes criterios; intolerancia a la glucosa, DM-tipo 2 o resistencia a insulina, junto a las siguientes entidades nosológicas; Hipertensión arterial igual o mayor a 140/90 mmHg, dislipidemia definida por cifras igual o mayores a 150 mg/dl, descenso del colesterol y obesidad central o visceal y microalbuminuria. (1) La diabetes mellitus (DM) es un grupo de enfermedades metabóli-

E

cas caracterizadas por hiperglucemia secundaria a un defecto absoluto o relativo en la secreción de insulina, que se acompaña, en mayor o menor medida, de alteraciones en el metabolismo de los lípidos y de las proteínas, lo que conlleva una afectación microvascular y macrovascular que afecta a diferentes órganos como ojos, riñón, nervios, corazón y vasos. La DM es un síndrome heterogéneo en el que existe una alteración común que la define: la elevación de la glucemia.(2) La prevalencia de diabetes mellitus en la Ciudad de México es elevada y sin duda representa un problema importante de salud. La prevalencia está condicionada por la incidencia y la letalidad. En la medida que disminuye la letalidad de una enfermedad la prevalencia aumenta, pero de forma directa

también se incrementa en la medida que la ocurrencia aumenta. En México se ha documentado un descenso gradual y progresivo de la letalidad por diabetes La diabetes se está convirtiendo rápidamente en la epidemia del siglo XXI y en un reto de salud global. Estimaciones de la Organización Mundial de la Salud indican que a nivel mundial, de 1995 a la fecha casi se ha triplicado el número de personas que viven con diabetes, con cifra actual estimada en más de 347 millones de personas con diabetes. (3)

La asociación entre Hipertensión arterial, intolereancia a la glucosa, trastornos en el metabolismo de los lípidos y resistencia a la insulina se conoce desde hace mucho tiempo; Neubauer en 1910 se refería a la asociación causal entre Hipertensión Arterial y DM, más adelante en 1921 Kilin y Gregorio Marañón publicaron dos artículos “Hipertensión arterial y Diabetes mellitus”. Más reciente Avogaro y Crepaldi(1960-70) propusieron que la asociación de HAS- DM y la obesidad en personas recibiera el nombre de síndrome “Plurimetabólico”, en 1984 se demostró que las complicaciones cardiovas-

Prof. e Investig. Fac.-Med-BUAP, Lic en Enf. y Medica adscritas a CESSA-Tehuacan., 3 Est. de Med.-BUAP. 1 2

www.conferenciasindromemetabolico.org

165


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

culares eran frecuentes tanto en diabéticos recién diagnosticados como en aquellos con larga evolución. (4). La diabetes mellitus ha mostrado un comportamiento epidémico en México desde la segunda mitad del siglo pasado. En la actualidad, México es uno de los países con mayor ocurrencia de diabetes mellitus en el mundo. La diabetes es actualmente la primera causa de mortalidad en México y su tendencia muestra un incremento progresivo en los últimos años. (5)

La diabetes es un claro ejemplo de la transición epidemiológica que vive el país, así como de la transición de la atención a la salud. La Ciudad de México concentra 12% de las defunciones por diabetes en hombres en el país y su tasa de mortalidad ajustada por edad es la segunda más alta en el país (123.0 por 100 000 personas en 2008) (6). La prevalencia (proporción de la población que padece de la enfermedad) es variable en distintas comunidades, siendo muy alta en algunos grupos étnicos como indígenas norte americanos y polinésicos. Por lo que se refiere a la población de adolescentes, el diagnóstico previo de diabetes reportó alrededor de 155 000 individuos en este rango de edad que ya han sido diagnosticados con diabetes.

criterios de “Harmonizingthemetabolic síndrome”, se realiza con la presencia de tres de 5 componentes prouestos: Incremento de la circunferencia abdominal; Elevación de triglicéridos; mayores o igual a 150 mg/dl., Disminución del colesterol HDL; menos de 40 mg en hombres o menos de 50 mg en mujeres, o en tratamiento con efecto sobre el HDL, elevación de la Tensión Arterial; mayor o igual a 130/85 mmHg. Y elevación de la glucosa en ayunas mayor o igual a 100 mg/dl.. Los nuevos criterios diagnósticos propuestos por la Asociación Americana de Diabetes (ADA) y por un comité asesor de la Organización Mundial de la Salud (OMS) han facilitado la detección temprana de los trastornos en la tolerancia a los hidratos de carbono. Se incluyó en la nueva clasificación una etapa de «normoglucemia» que para la DM2 podría estar caracterizada por la presencia del síndrome metabólico, aunque éste sólo se puede considerar como un factor de riesgo. (7)

V3-N1 - 2016

Se ha estimado que la esperanza de vida de individuos con diabetes se reduce entre 5 y 10 años. La prevención del desarrollo de la diabetes puede ser altamente costo-efectiva: modificaciones en estilos de vida, en particular en la dieta y actividad física, así como evitar el tabaquismo, pueden retrasar la progresión de la diabetes. No obstante, su costo-efectividad depende de su implementación a escala poblacional, en particular en países con elevado riesgo de diabetes. (9)

El sobrepeso y la obesidad se han descrito como factores asociados de forma directa con la DM., Vázquez y cols., encontraron un 43% de sobrepeso y un 35% de obesidad en la población adulta derechohabiente del Instituto Mexicano del Seguro Social, con una media de 39.5 años de edad. Mientras que Garza y cols., encontraron que la prevalencia de sobrepeso y obesidad fue del 41.4%. Los principales factores de riesgo encontrados por López y cols. y que se presentaron en más del 25% de la población adulta fueron sobrepeso, obesidad y sedentarismo, cercano a este porcentaje fue el tabaquismo y la hiperglucemia. Estos factores de riesgo, de acuerdo a los reportes, serían suficientes para que en corto plazo se pueda desarrollar diabetes tanto en el grupo con antecedentes y sin antecedentes de DM.

Toda persona que tiene familiares diabéticos debe: Evitar el sobrepeso‚ disminuir el consumo de azúcar ‚ evitar el consumo excesivo de carbohidratos y grasas ‚ aumentar el consumo de alimentos ricos en fibra como frutas, verduras y leguminosas,tomar como mínimo 8 vasos de agua ‚ Practicar actividad física siguiendo las indicaciones médicas‚ mantener un control mé- Se ha observado que la frecuenEl diagnostico del síndrome me- dico anual. cia de DM es de dos a cuatro veces tabólico según la unificación de mayor en las personas poco ac166

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tivas. En estudios prospectivos realizados recientemente se ha comprobado que la actividad física se asocia con un menor riesgo de contraer diabetes. La actividad física regular aumenta la sensibilidad a la insulina y mejora la tolerancia a la glucosa. Además, la actividad física tiene efectos beneficiosos sobre los lípidos sanguíneos, la presión arterial, el peso y la distribución de la grasa corporal, es decir, sobre los factores de riesgo del “síndrome metabólico”, y en consecuencia se puede también prevenir las enfermedades cardiovasculares y las complicaciones de la diabetes mellitus (10). Se estima que más del 50 % de los pacientes padecen HTA en el momento del diagnóstico de la DM. Ambas enfermedades interactúan, e incrementan, por tanto, el riesgo de mortalidad por afección vascular. La HTA es uno de los factores principales en la patogenia de la lesión de los macro y micro vasos en los pacientes con trastornos de tolerancia a la glucosa, presente en el 70 % de los diabéticos con enfermedad cardiovascular, y específicamente en el 45 % de los que presentan isquemia coronaria. Se estima que entre el 30 y el 75 % de las complicaciones de la DM pueden ser atribuidas al incremento de la presión arterial. (11)

Estudios epidemiológicos han asociado la hipertensión arterial a diversas características socio demográficas (franja etárea, grupo étnico, nivel socioeconómico), consumo de alcohol, ingestión de

sodio, estrés, diabetes, obesidad y sedentarismo. Algunos factores de riesgo (tabaquismo y dislipidemias) pueden interactuar con la presión arterial y aumentar el riesgo de desarrollo de enfermedades cardiovasculares.

V3-N1 - 2016

mismo se observó en el grupo de los mayores de 60 años; 56 Fem. contra 21 masculinos, otro punto a considerar es que en el Centro de Servicios de Salud procuran mantener estables a pacientes con SM o en Complicaciones por DM.

III. CONCLUSIÓN Actualmente la mayoría de las consultas otorgadas por el sector salud; se deben a pacientes con DM-2, y se ha observado un aumento de casos nuevos a más temprana edad. Por ello en los servicios de urgencias se presentan casos de pacientes en Estado hiperosmolar no cetósico por un inadecuado control glucémico. Tal vez por ello se ha encontrado que la mayoría de pacientes atendidos con DM y complicaciones crónicas como el Sindrome Metabólico sigue aumentando de manera importante tal como lo describimos en los resultados asi como su reII. RESULTADOS visión sistematica y vigilancia del El objetivo de nuestra inves- tratamiento en sus casas. tigación fue estudiar a pacientes con diagnostico de síndrome me- IV. REFERENCIAS tabólico (SM), por lo cual basamos BIBLIOGRÁFICAS la misma en el control clínico y 1.- Pineda C. A., “Síndrome meestadístico del SM, observados en tabólico; definición, historia y criel CESSA de Tehuacán, En el Análi- terios”: rev- Colombiana de Medisis de la muestra (470 pacientes) cina: 2008;39(11):96-106. encontramos a 238 pacientes con 2.- Wacher Rodarte N. “Epidelas enfermedades que integran el miología del Sind. Metabólico”, SM. 161 pacientes menores de 60 Rev..Gaceta Médica de México años y 77 mayores de esa edad, y 2009;145(5): 384-391. de ambos géneros. Sin embargo 3.- CASTILLO JORGE. (Nov. 2012). nos llamó la atención la existencia Diabetes Mellitus, primera causa de una mayor cantidad de casos en de muerte de poblanos. Rev. Local el género femenino que casi tripli- Intolerancia, 1-3. co al masculino menor de 60 años; 4.-Nam Han Cho, David Whiting, et 120 mujeres contra 41 hombres, lo al. (2013). ATLAS de la DIABETES Desde 1980 aparecieron varios trabajos de investigación sobre el SM y se basaron en la asociación causal entre DM, e Hipertensión Arterial (HA), aunque el mejor estudio Epidemiológico que brindó mejores evidencias sobre la existencia del SM, fue el Herart Study de San Antonio, en el cual se demostró la prevalencia de Obesidad, DM, HA, Hipertrigliceridemia e Hipercolesterolemia, y su importancia radícó en comparar las cifras de cada parámetro de laboratorio analizado; la cuales fueron mayores a las observadas anteriormente. (12).

www.conferenciasindromemetabolico.org

167


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

de la FID. noviembre de 2015, de Federación Internacional de Diabétes Sitio web: 5.- Mauricio Hernández-Ávila, et. al . (2013). Diabetes mellitus en México. Noviembre de 2015, de Scielo Sitio web: 6.-Alfaro J, Simal A. et al. (2012). Tratamiento de la diabetes mellitus. noviembre 2015, de Información Terapéutica del Sistema Nacional de Salud Sitio web. 7.-Venables M, Jeukendrup A. Physical inactivity and obesity: links with insulin resistance and type 2 diabetes mellitus. Diabetes Metabolic Resid. Rev. 2009; 25 (Suplem. 1):S18–S23. 8.- Yanes M, Yanes M, et al. Algunas consideraciones sobre la hipertensión arterial en la Diabetes Mellitus tipo 2. Revista Cubana de Medicina General Integral. 2009; 25(3):113-120. 9.- Miquetichuc F, Brandão P, et al. Hipertensión Arterial y su Correlación con algunos Factores de Riesgo en Ciudad Brasileña de Pequeño Tamaño. Arq. Brasileña Cardiología, 2010; 95(4): 502-509. 10.- González L, Cabrera A, et al. Algunas variables relacionadas con la hipertensión arterial en una población venezolana de Colinas de los Rosales. MEDISAN 2011; 15(7):925-933. 11.- Sepúlveda L. Sedentarismo, Ejercicio y Corazón. Cardiología Clínica 2009; 25(2):79-82. 12.- Wacher Rodarte N., “Epidemiología del síndrome metabólico”, Rev. Gaceta Médica de México 2009; 145 (5):384-391.

168

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EL TEJIDO ADIPOSO VISCERAL ESTÁ CORRELACIONADO CON LA CONDICIÓN CARDIORRESPIRATORIA Y LA COMPOSICIÓN CORPORAL DE LA CONDICIÓN FÍSICA RELACIONADA CON LA SALUD OBTENIDA A TRAVÉS DE LA BATERÍA ALPHA-FIT LN. Martínez Muñoz Ilse Yessabel1, QFB. Correa Padilla Trinidad1, PhD Santillán Benítez Jonnathan Guadalupe3, PhD Camarillo Romero María del Socorro2, Dra. Domínguez Zárate Gemma1, PhD Montenegro Morales Laura Patricia1, PhD Camarillo Romero Eneida del Socorro1, PhD Garduño García José de Jesús1,4 ABSTRACT Background: The aim of the study was to correlate the health-related fitness and visceral adipose tissue. Methods: A prospective cross-sectional research, which ALPHA-FIT test battery for adults aged 18-69 years old was performed, at the same time visceral adipose tissue was obtained through dual-energy X ray absorptiometry (DXA). Results: 40 women, 18±.55 years old and body mass index of 23.66±.3.55 Kg/m2 were enrolled. A statistically significant correlation between adipose tissue volume and mass and BMI (Body mass index), waist circumference and VO2máx were shown. Conclusion: Visceral adipose tissue has a correlation with body composition and cardiorespiratory fitness. . KEYWORDS: visceral adipose tissue, health-related fitness.

I. INTRODUCCIÓN n casi un cuarto de siglo, la prevalencia de peso excesivo ha aumentado de forma alarmante en nuestro país(1), situación predisponente para presentar un perfil de riesgo cardiometabólico elevado en la vida temprana de la población joven(2). Existe una correlación positiva entre el Índice de Masa Corporal (IMC) y el riesgo cardiometabólico, sin embargo, la acumulación de tejido adiposo visceral está ligada en mayor medida al riesgo cardiovascular, síndrome metabólico y diabetes tipo 2(3). El sistema DXA es una técnica de imagen que provee medidas cuantitativas del tejido adiposo subcutáneo y visceral, siendo considerada como estándar de oro(4, 5). La disminución de los niveles de actividad física es un factor que

E

incrementa la exposición a la obesidad, así, los comportamientos sedentarios están ligados a su desarrollo, mantenimiento y consecuencias(6). A través de la condición física relacionada con la salud es posible identificar rasgos o capacidades asociadas con el riesgo de desarrollar enfermedades y otras condiciones relacionadas con el sedentarismo. Por lo anterior, ha sido propuesta como una medida integradora de las principales funciones musculoesqueléticas , endocrinometabólicas y psiconeurológicas que participan al realizar actividad física. La batería

ALPHA-FIT es útil para determinar el nivel de condición física relacionado con la salud (7, 8). El objetivo del presente estudio fue correlacionar a los componentes de la condición física relacionada con la salud a través de la batería ALPHA-FIT para adultos de 18 a 69 años con el tejido adiposo visceral determinado con sistema DXA. II. METODOLOGÍA Diseño y sujetos del estudio: El presente estudio fue aprobado por el Comité de Ética e Investigación del Centro de Investigación en Ciencias Médicas, de la Universidad Autónoma del Estado de México, tiene un diseño transversal y prospectivo en el cual participaron 40 mujeres universitarias, con una edad comprendida entre 18 y 20 años, de quienes se obtuvo la carta de consentimiento informado. Se excluyeron a mujeres embarazadas, fumadoras o con enfermedades crónico degenerativas diagnosticadas previamente.

Centro de Investigación en Ciencias Médicas, Universidad Autónoma del Estado de México, Cuerpo Académico Salud del Universitario 2 Centro de Investigación en Ciencias Médicas, Universidad Autónoma del Estado de México, Cuerpo Académico Biomedicina 3 Facultad de Química de la Universidad Autónoma del Estado de México, 4 Hospital General Regional No. 251 Instituto Mexicano del Seguro Social 1

www.conferenciasindromemetabolico.org

169


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Mediciones: Con previa estandarización, se obtuvo la medición de estatura, peso corporal, circunferencia de cintura y presión arterial, se calculó el índice de masa corporal en Kg/m2. Determinación de Tejido adiposo visceral: Fue medido con el equipo de Densitometría Ósea-Lunar de marca General Electric Healthcare MR a través del sistema DXA, con el mínimo de ropa y sin objetos metálicos portados, con la indicación de inhalar y mantener la respiración unos segundos para limitar el movimiento al tomar la imagen. Evaluación de la condición física relacionada con la salud: Se utilizó la batería de pruebas ALPHA-FIT para adultos de 18 a 69 años, siguiendo el protocolo de ejecución sugerido por el manual (7). Posteriormente, se estimó el consumo máximo de oxígeno (VO2máx) través de la siguiente fórmula: 116.2 – 2.89 x tiempo – 11 x FC – 0.14 x edad – 0.39 x IMC Tiempo: duración de la marcha en minutos y segundos; FC: frecuencia cardiaca a la llegada (pulsaciones/min); IMC: Índice de Masa corporal (Kg/m2); Edad: años III. RESULTADOS La muestra estuvo compuesta por 40 mujeres con una edad promedio de 18±.55 años, las características basales se muestran en la tabla 1. La tabla 2 muestra que el IMC, la circunferencia de cintura y el VO2máx tienen una correlación estadísticamente significativa con el volumen y la masa de tejido adi170

www.conferenciasindromemetabolico.org

V3-N1 - 2016

poso visceral determinados con el sistema DXA.

IV. CONCLUSIONES En este estudio se observó que existe una adecuada correlación entre el volumen y masa del tejido adiposo visceral y los componentes de composición corporal y cardiorrespiratoria de la condición física relacionada con la salud medida con la batería ALPHA-FIT. Ya ha sido documentado que la condición cardiorrespiratoria evaluada con el VO2máx es el principal componente de la condición física relacionada con la salud y el predictor

más potente de morbimortalidad, además de que manera deficiente constituye un factor de riesgo cardiovascular importante, por encima del sobrepeso y obesidad, de hecho se ha propuesto como determinante de la resistencia a la insulina y síndrome metabólico, asimismo, los factores de riesgo a la salud antes mencionados, le han sido atribuidos al tejido adiposo visceral(3, 8). Cabe resaltar que en nuestro estudio ambos se correlacionaron significativamente.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V. BIBLIOGRAFÍA 1. Encuesta Nacional de Salud y Nutrición 2012 Resultados Nacionales México2012 [cited 2015 28 de agosto]. Available from: http://ensanut.insp.mx/doctos/ ENSANUT2012_Nutricion.pdf 2. Burgos MS, Reuter CP, Possuelo LG, Valim ARdM, Renner JDP, Tornquist L, et al. Obesity parameters as predictors of early development of cardiometabolic risk factors. Ciência & Saúde Coletiva. 2015;20:2381-8. 3. Farb MG, Gokce N. Visceral adiposopathy: a vascular perspective. Hormone molecular biology and clinical investigation. 2015;21(2):125-36. 4. Du T, Yu X, Zhang J, Sun X. Lipid accumulation product and visceral adiposity index are effective markers for identifying the metabolically obese normal-weight phenotype. Acta Diabetologica. 2015;52(5):855-63. 5. Direk K, Cecelja M, Astle W, Chowienczyk P, Spector TD, Falchi M, et al. The relationship between DXA-based and anthropometric measures of visceral fat and morbidity in women. BMC Cardiovascular Disorders. 2013;13(1):1-13. 6. Gidding SS. Cardiovascular risk factors in adolescents. Current treatment options in cardiovascular medicine. 2006;8(4):269-75. 7. Suni J, Husu P, Rinne M. Fitness fot Health: The ALPHA-FIT Test Battery for Adults Aged 18692009 29 de septiembre de 2015. 8. Mayorga V MR, Rodríguez E. Relación entre la capacidad cardiorrespiratoria y el rendimiento en los tests de condión física rela-

V3-N1 - 2016

cionada con la salud incluidos en la bateria ALPHA en niños de 1012 años. Cultura Ciencia y Depote. 2013;8(22):41-7.

www.conferenciasindromemetabolico.org

171


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PÁGINA WEB DE CONSULTAS GEOGRÁFICAS A LA BASE DE DATOS DE LA ENSANUT Biól. Bernardo Serrano-Estrada1,2, Biól. Edith A. Andres-Cruz2, Dra. Itzell Gallardo-Ortiz3, Dr. J. Rafael Jiménez-Flores3, Dr. A. René Mendez-Cruz3, Dr. Rafael Villalobos-Molina3, Dr. Miguel Murguía-Romero2,3 ABSTRACT The MEXANUT database (www.mexanut.abacoac.org) integrates anthropometric and blood pressure data from the health national surveys: ENSA 2000, ENSANUT 2006 and 2012, and it could be consulted freely in Internet. We have added to the query interface a tool to perform geographical queries. It can be consulting by clicking on the map to display a summary of the prevalence by BMI classes on a specific Mexican State, or it can be apply filters to display a map with the States in colors depending on the prevalence range. KEYWORDS: Geographical queries, Relational databases, Medical Informatics, Obesity

I. INTRODUCCIÓN uestro grupo de trabajo, el Grupo Multidisciplinario de Investigación en Salud y Rendimiento Académico (GMISARA), ha investigado por más de ocho años la salud de jóvenes universitarios de primer ingreso, encontrando una prevalencia de Síndrome Metabólico entre el 11% y 13%, dependiendo de la generación. Otro hecho que merece atención es que cerca del 70% de los jóvenes tienen una o más alteraciones del Síndrome Metabólico: bajo colesterol HDL y obesidad central, son las más prevalentes. Esos hallazgos nos llevaron a investigar más a fondo el problema en México, por lo que nos dimos a la tarea de analizar los datos de las Encuestas Nacionales de Salud: la ENSA 2000 y las ENSANUT 2006 y 2012 (Gutiérrez et al. 2013). Uno de los productos de ese análisis fue la base de datos MEXANUT (Andres-Cruz et al. 2015), una base de datos relacional que inte-

N

172

www.conferenciasindromemetabolico.org

gra información antropométrica y de presión arterlal obtenida de tres encuestas nacionales y que se puede consultar libremente en internet: www.mexanut.abacoac. org. Esta base de datos contiene información de tres encuestas (2000, 2006 y 2012) y puede consultarse de manera integral. La página web MEXANUT provee una interfaz de consulta que despliega los datos en tablas de acuerdo a restricciones o filtros que el usuario especifica. Sin embargo, aún no contenía herramientas que facilitaran su consulta geográfica, que permitiera, por ejemplo, la visualización de la información en el mapa del territorio de la República Mexicana. El objetivo de este trabajo fue desarrollar una interfaz de consulta geográfica para la página web MEXANUT que integra la información antropométrica y de presión arterial de tres encuenSERES Sistemas Especializados ABACo, A.C. 3 FES Iztacala, UNAM 1 2

tas nacionales de salud.

II. MÉTODO Se diseñó una interfaz para consulta geográfica de la base de datos que considera dos tipos de consultas: 1) consultas del mapa a los datos, y 2) consultas de los datos al mapa. En el primer caso, se despliega un mapa de la República Mexicana con división política estatal, y el usuario da click sobre alguna entidad federativa para obtener un resumen de los datos sobre prevalencia de la condición de peso. En el segundo caso, el usuario especifica filtros y el resultado muestra los rangos de las prevalencias con diferentes colores en el mapa. III. RESULTADOS Consultas de los datos al mapa geopolítico El usuario especifica filtros como: clase de IMC, rango de edad, sexo, encuesta (2000, 2006 o 2012; Figura 1), y al ejecutar la consulta se muestra el mapa con diferentes colores según rango de prevalencia (Figura 2). Consultas por Entidad Federativa


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

La información desplegada al dar click sobre un estado, se despliega por clases de IMC y por grupos de edad. El usuario puede cambiar el esquema de clasificación de agrupamiento de las edades, por ejemplo, en tres clases: 18-40 años de edad, 41-60, o >60 (Figura 3); o bien elegir el esquema de 9 clases agrupadas por décadas de edad.

V3-N1 - 2016

PARTE DE ESTE TRABAJO SE DESARROLLÓ CON EL SOPORTE DE LOS PROYECTOS UNAM-DGAPA-PAPIME-PE207516 Y UNAMDGAPA-PAPIIT-IN219915.

IV. CONCLUSIONES El sistema de consultas geográficas integrado en la página MEXANUT (www.mexanut.abacoac.org), provee una manera eficaz de conocer con mayor detalle el probelma de la obesidad a nivel nacional y cómo la prevalencia se descompone a través de los diferentes estados de la República.

V. BIBLIOGRAFÍA Andres-Cruz EA, Serrano-Estrada B, Jiménez-Flores JR, Villalobos-Molina R, Murguía-Romero M. 2015. Base de datos integral de tres encuestas nacionales de salud: Análisis del cambio de prevalencia de obesidad como ejemplo de uso. Revista de la Conferencia Científica Anual Sobre Síndrome Metabólico. 2(1); ISSN 2395-8103. Gutiérrez JP, Rivera-Dommarco J, Shamah-Levy T, Villalpando-Hernández S, Franco A, Cuevas-Nasu L, Romero-Martínez M, Hernández-Ávila M. 2013. Encuesta Nacional de Salud y Nutrición 2012. Resultados nacionales. 2a. ed. Cuernavaca, México: Instituto Nacional de Salud Pública (MX), 2013.

www.conferenciasindromemetabolico.org

173


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

174

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

175


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

IMPACTO DE UN PROGRAMA DE EJERCICIO SOBRE LA SALUD CARDIOVASCULAR Y LA CALIDAD DE VIDA DE PACIENTES CON AMPUTACIÓN DE MIEMBRO INFERIOR SECUNDARIA A NECROBIOSIS DIABÉTICA. ESTUDIO PILOTO Vázquez Lara Santoyo Guillermina Alicia1, Sahagún Olmos Roberto Carlos2, Zavala Ramírez Juana3, Pérez Molina María del Rosario4, Dalila Alavez Santiago5, Maria de Lourdes Dergal Carreto6, María del Carmen Ruíz Hurtado6, Luis Jesús Sanjuan Rivas7 ABSTRACT Background. In Mexico, 2% of people living with diabetes mellitus have had a lower limb amputation. The relationship between DM and an increased incidence of cardiovascular disease is well established. Regular exercise has proven benefits in cardiovascular risk factors management, increases maximum oxygen uptake and improves disability and quality of life perception. Methodology. Stress testing and application of quality of life questionnaires WHOQOL -BREF questionnaire and perception of disability WHODAS - II was performed before and after an exercise program in subjects (n=5) with diagnosis of lower limb amputation due to diabetic necrobiosis. Results. Two subjects withdrew from the study, three subjects concluded the evaluation. After the exercise program, the stress testing evidenced increase in maximum oxygen uptake (VO2), METs and Watts achieved. We also obtained lower disability perception and improved quality of life satisfaction. Conclusions. The program proposed in this pilot study has shown that it can potentially improve functional capacity, biochemical parameters and disability and quality of life perception. KEY WORDS: cardiac rehabilitation, exercise, amputation, diabetes mellitus, quality of life

I. INTRODUCCIÓN ctualmente se estima que hay 382 millones de personas con diabetes mellitus en el mundo.2 En México, el 9.2% de la población tiene este diagnóstico, ubicándolo en el 6° lugar a nivel mundial.2,3 De acuerdo a la Organización Mundial de la Salud, 7 de cada 10 amputaciones se realizan en personas con diabetes; en México el 2% (128,000) de estas han sufrido amputaciones secundarias a diabetes. Esto impacta negativamente en la salud global y en la adquisición de discapacidad de los sujetos, ocasionando un deterioro significativo en la ca-

A 176

www.conferenciasindromemetabolico.org

lidad de vida.1 La principal causa de muerte en los sujetos que viven con diabetes mellitus tipo 2 son las enfermedades cardiovasculares, lo cual es secundario a un proceso de ateroesclerosis acelerada, consecuencia de alteraciones en la estructura y función del endotelio vascular.4,5 Se ha reportado fatiga y baja capacidad al ejercicio en estos individuos, con un deterioro en la capacidad para realizar acti-

vidades de la vida diaria y disminución en la percepción de calidad de vida.6,7 La realización de ejercicio físico de forma regular tiene efectos benéficos sobre factores de riesgo cardiovascular, fuerza muscular, funcionalidad, consumo de oxígeno y función endotelial.8,9 Se ha reportado mejoría en la salud cardiovascular después de un programa de entrenamiento con ejercicio aeróbico en pacientes con amputación traumática del miembro inferior, sin embargo, no se ha reportado un programa de entrenamiento dirigido a mejorar la salud cardiovascular tomando en cuenta la calidad de vida en personas con amputación de miembro inferior secundaria a necrobiosis diabética.1,3,10-13. II. METODOLOGÍA Estudio cuasi-exprimental, prospectivo y analítico; se reclutaron pacientes con diagnóstico de amputación de miembro inferior se-

Alta Especialidad en Rehabilitación Cardíaca, IMSS Maestría en Ciencias Médicas, Instituto Nacional de Rehabilitación 3 Maestría en Administración de Hospitales y Salud Pública, Instituto Nacional de Rehabilitación 4 Licenciatura en terapia física, Instituto Nacional de Rehabilitación 5 Alta Especialidad en Rehabilitación Cardíaca, Hospital Naval General De Alta Especialidad 6 Alta Especialidad en Rehabilitación Cardíaca, Instituto Nacional de Rehabilitación 7 Especialista en Cardiología Clínica, Instituto Nacional de Rehabilitación 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

cundaria a necrobiosis diabética. Se realizó una valoración inicial para valorar criterios de inclusión; aquellos que los cumplieron se les invitaron a participar en el estudio. Se explicaron los objetivos, características y riesgos del mismo e ingresaron aquellos que aceptaron y firmaron la carta de consentimiento informado. Se inició programa de ejercicio de 6 semanas de duración, frecuencia de 3 veces por semana en sesiones de 45 minutos. Antes y después del programa se realizó: perfil lipídico y glucosa en sangre, prueba de esfuerzo y se aplicaron los cuestionarios WHOQOL-BREF para calidad de vida y el cuestionario WHODAS-II de 36 ítems para percepción de discapacidad. Se evaluó la integridad de la base de datos, se realizó estadística descriptiva y se describieron en tablas las características sociodemográficas, de enfermedad y variables de desenlace de cada uno de los sujetos de estudio. III. RESULTADOS Se reclutaron 5 sujetos que cumplieron con los criterios de inclusión, 2 fueron eliminados (1 por datos de isquemia durante la prueba de esfuerzo y otro por no haber completado las sesiones de ejercicio). Los participantes (n=3) fueron de sexo masculino, con una edad promedio de 60.6 años en un rango entre 50–68 años; todos con amputación de miembro pélvico izquierdo, el nivel de amputación fue: 1 transtibial y 2 transfemoral. El promedio de tiempo transcurrido tras la amputación

fue alrededor de 1 año, y el tiempo de evolución promedio de la DM fue de 11 años. Al finalizar el programa de ejercicio se observó en la prueba de esfuerzo final una mejoría en el consumo máximo de oxígeno (VO2), METs y Watts alcanzados; tendencia a la mejoría en los niveles de colesterol total, colesterol-HDL y colesterol-LDL. Los participantes reportaron una menor percepción de la discapacidad y mejor calidad de vida al final del programa de ejercicio. No se registró mejoría en el resto de los parámetros bioquímicos.

IV. DISCUSIÓN Posterior a la realización del programa de ejercicio hubo mejoría de los parámetros estudiados en la prueba de esfuerzo, tales como: consumo máximo de oxígeno, METs y Watts o potencia realizada, todo esto llevando a una mejor clase funcional. Lo anterior concuerda con lo reportado en la literatura que ha estudiado a poblaciones distintas a la nuestra. La tendencia a la disminución de los niveles plasmáticos de colesterol total, HDL y LDL en la mayoría de los pacientes se presenta según lo reportado en la literatura, sin embargo, no se observó mejoría en los niveles de glucosa y triglicéridos posiblemente debido a la falta de asesoramiento nutricional y control dietético durante la realización del programa de ejercicio. La mejoría en la percepción de discapacidad y calidad de vida concuerda con lo reportado en la literatura, donde se señala que el ejercicio realizado de forma regu-

V3-N1 - 2016

lar puede ayudar a liberar tensión, ansiedad, depresión e ira, lo que aumento el bienestar mental y físico de los individuos.

V. CONCLUSIONES El programa planteado en el presente pilotaje mostró el potencial de mejorar en esta población la capacidad funcional, parámetros bioquímicos, percepción de discapacidad y calidad de vida. En la actualidad no existe ningún estudio donde se reporte el impacto de un programa de ejercicio sobre estos parámetros en esta población. Se necesitan reclutar más pacientes para aumentar el tamaño de la muestra, tener representatividad del sexo femenino y de diferentes edades, diferentes niveles de amputación, tiempo de evolución de diabetes mellitus y así obtener resultados concluyentes. También es necesario el asesoramiento nutricional y el control dietético en estos sujetos.

VI. BIBLIOGRAFÍA 1. Hernández-Ávila M, Gutiérrez JP, Reynoso-Noverón N. Diabetes mellitus en México. El estado de la epidemia. Salud Pública de Mex. 2013; 55(2):S129-S136. 2. Federación Internacional de Diabetes. Atlas de la Diabetes IDF. 6° ed. 2013. 3. Gutiérrez JP, Rivera-Dommarco J, Shamah-Levy T, Villalpando-Hernández S, Franco A, Cuevas-Nasu L, et al. Encuesta Nacional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México: Instituto Nacional de Salud Pública (MX), 2012. www.conferenciasindromemetabolico.org

177


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

4. Sena CM, Pereira AM, Seica R. Endothelial Dysfunction – A major mediator of diabetic vascular disease. Biochimica et Biophysica Acta. 2013; 1832: 2216-2231. 5. Moon-Hyon H, Sangho K. Type 2 diabetes: Endothelial dysfunction and exercise. J Excerc Nutr Biochem. 2014; 18(3): 239-247. 6. Fernández JM, Fuentes-Jiménez F, López Miranda J. Función endotelial y ejercicio físico. Rev Andal Med Deporte. 2009; 2(2): 61-69. 7. Gómez-Marcos M, Recio-Rodríguez J, Rodríguez-Sánchez E, Patino-Alonso M, Magallon-Botaya R, et al. Carotid Intima-Media Thickness in Diabetics and Hypertensive Patients. Rev Esp Cardiol. 2011;64(7):622-625. 8. Fang Z, Sharman J, Prins J, Marwick T. Determinants of Exercise Capacity in Patients with Type 2 Diabetes. Diabetes Care. 2005; 28(7): 1643-1648. 9. Sanders C, Marwick T, Pashkow F, Harvey S, Thomas J, Lauer M. Importance of estimated functional capacity as a predictor of all-cause mortality among patients referred for exercise thallium single-photon emission computed tomography: report of 3,400 patients from a single center. J Am Coll Cardiol. 1997; 30(3):641-648. 10. Myers J. Exercise and Cardiovascular Health. Circulation. 2003; 107:e2-e5. 11. Leon A, Franklin B, Costa F, Balady G, Berra K, Stewart K, et al. Cardiac Rehabilitation and Secondary Prevention of Coronary Heart Disease. Circulation. 2005; 111:369-376. 12. World Health Organization Ge178

www.conferenciasindromemetabolico.org

neva. WHOQOL-BREF Introduction, administration, scoring and generic version of the assessment. Field Trial Version. December 19. 13. Vázquez-Barquero JL, Herrera S, Vázquez E, Gaite L. Cuestionario para la Evaluación de Discapacidad de la Organización Mundial de la Salud (World Health Organization Disability Assessment Schedule II).

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

RELACIÓN DE LA SOMATOMETRÍA Y EL TIEMPO DE GESTACIÓN DEL RECIÉN NACIDO DE ACUERDO AL ESTADO DE NUTRICIÓN DEL PADRE Dra. Edith Patricia Rios-González1, M.C. Marco Antonio Castro-Reyes2, D.C. Alejandra Valdivia-Flores3 ABSTRACT It is documented that there is a maternal influence on the future condition of chronic diseases and particularly obesity in the product. It has been reported that the weight of parent influences the weight of the children in infancy and puberty, so the goal of this project is to determine whether there is any relationship between the weight of the father and newborn weight and gestation time . Conducted a cross sectional study in which weight and height data of both parents and the newborn were documented , plus the baby’s gestational age according to the scale of capurro was recorded. The results showed that there is no correlation between the variables studied. KEY WORDS: obesity, newborn , nutritional status, father.

I. INTRODUCCIÓN iversos estudios indican que el padecimiento de la obesidad inicia desde la concepción implicando la participación de ambos progenitores. Es sabido que el estado de nutrición de la madre influye sobre su producto, en primer lugar, porque pueden aparecer complicaciones durante el embarazo y el parto, después, porque el producto puede presentar macrosomia y un corto tiempo de gestación y por otro lado, el producto puede ser susceptible a sufrir durante su desarrollo y hasta la vida adulta de sobrepeso y enfermedades crónicas como la obesidad, la diabetes mellitus, la hipertensión arterial y enfermedades cardiovasculares (2). En México aún no se cuenta con un control de salud adecuado para la mujer embarazada y llevar un seguimiento de su estado de nutrición prenatal y durante el embarazo, por lo que se está obser-

D

vando un descontrol en el peso y las enfermedades relacionadas con esté. Siendo la que más afecta a nuestro país, la obesidad, causando morbi-mortalidad materno infantil. Los estudios acerca de la influencia del estado de nutrición en la presencia de macrosomia, obesidad y el tiempo de gestación son limitados. Estudios en animales indican que no hay cambios significativos en el periodo neonatal (3). Mientras que en humanos se ha observado que influye más en el estado de nutrición del niño durante la primera infancia que en el periodo fetal y neonatal. Dichos antecedentes ponen de manifiesto la necesidad de determinar si pudiera existir una influencia epigenética del estado de nutrición del padre al momento de su concepción sobre la somatometría del Hospital Materno Pediátrico Xochimilco Instituto Politécnico Nacional, CICS UMA 3 Instituto Politécnico Nacional 1

recién nacido y el tiempo de gestación materna para contribuir con el conocimiento de la epigenética de la obesidad.

II. MATERIAL Y MÉTODOS Los sujetos de estudio, 44 padres, 44 madres y 44 neonatos; se captaron, previa firma del consentimiento informado de madres y padres de los neonatos al momento del internamiento para la atención del parto en el Hospital Materno Pediátrico Xochimilco. La evaluación antropométrica del recién nacido se registró de su historia clínica hecha por el médico pedíatra, mientras que la evaluación antropométrica, peso y talla de los padres para determinar el IMC y clasificar su estado nutrición, de acuerdo a la OMS, se realizó al momento del ingreso. Para el análisis estadístico, se empleó estadística descriptiva y anova con el programa SPSS v 22.

III. RESULTADOS Y DISCUSIÓN Las características generales de los padres se muestran en la tabla 1. Se registraron 44 parejas, donde las mujeres presentan una edad promedio de 23.75±5.67 años, con

2

www.conferenciasindromemetabolico.org

179


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

un peso actual de 67.29±8.73 y un peso habitual de 56.10±12.04 kg, su respectivo IMC para cada estado se muestran en la tabla 1. La muestra presenta un IMC correspondiente a normopeso. El peso medio gestacional ganado fue de 11.49± 5.37. En el caso de los pa-

de IMC se encuentran en la tabla 1, sin embargo, a pesar de ser valores normopeso, se encuentran cercano a los límites de sobrepeso. En el caso de los recién nacidos, hubo más varones (52.27%) que mujeres, con un peso promedio de 2997.5±344.29 kg y una talla de

dre, la edad fue de 27.18±7.2 años con un peso actual de 69.27±12.42 kg y un peso habitual de 66.90 ± 11.17 kg, lo que denota un aumento de peso, sus respectivos valores

49.65+-2.01 cm, los cuales se encuentran cercanos al valor medio. De acuerdo a la escala de capurro, solo el 2.27% fueron nacidos pretérmino (Tabla 2). Para tratar de

V3-N1 - 2016

ver si existe alguna relación entre el peso del padre con el peso del recién nacido y el tiempo de gestación se realizaron diferentes correlaciones (figura 1), sin embargo no se mostró alguna correlación significativa. De manera simultánea se realizaron los mismos análisis con la madre. En la literatura se encuentra documentado la influencia que tiene el peso y el IMC, el padecimiento de diabetes gestacional sobre el peso del neonato y la presencia de macrosomia (Leonard Sa 2016), lo que ha llevado a estudiar la influencia del peso del padre en el sobrepeso de los niños, particularmente en edades de 7 a 13 años, se ha observado que el IMC de los niños correlaciona con el IMC de los padres y es dependiente del género (Koomanaee S 2016,Wan 2015), cabe mencionar que en este punto se trata también de la influencia del estilo de vida. Por otro lado, se ha reportado que la ganancia de peso en el embarazo afecta el perfil lipídico de la madre pero no del bebe y que el IMC pregestacional materno afecta los dos perfiles lipídicos (producto y mamá) (Cinelli, 2016). IV. CONCLUSIONES No se encuentran asociaciones estadísticamente significativas entre el peso del padre con el peso del neonato ni con la edad gestacional, probablemente la relación se debe a la influencia del entorno. V. TRABAJOS CITADOS 1. – Berdasco G. Antonio. Evaluación del estado nutricional del adulto mediante la antropomé-

180

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

(2016). Influence of Maternal Obesity and Gestational Weight Gain on Maternal and Foetal Lipid Profile. Nutrients 15;8(6).

tria, Revista Cubana Aliment Nutr 2002;16(2): 146-152. 2.- Vickers M.H. La programación de desarrollo y la transmisión transgeneracional de la obesidad, Ann Nutr Metab 2014; 64(suppl 1):26–34 3.- Yang S, Zhou A, Xiong C, Yang R, Bassig BA, Hu R, et al., (2015). Parental Body Mass Index, Gestational Weight Gain, and Risk of Macrosomia: a Population-Based Case-Control Study in China. Paedriatic Perinat Epidemiol, 29(5):462-71. doi: 10.1111/ ppe.12213. 4. Leonard SA, Petito LC, Rehkopf DH, richie LD, Abrams B (2016).

Weight gain in pregnancy and child weight status from birth to adulthood in the United States. Pediatr Obes, 2016 Jun 28. doi: 10.1111/ ijpo.12163. 5.- Koomanaee S, Tabrizi M, Naderi N, Hassaszadeh R, Boloky M, Dalili S. (2016). Parental Anthropometric Indices and Obesity in Children. Acta Med Iran, 54(4):270-5. 6.- Wan Y, Xu R, Feng H, Zhou Y, Zhang X, Lu L, et al. (2015) Is parental body weight related with their children’s overweight and obesity in Gao Hang Town, Shanghai?, 24(3):509-14. 7. Cinelli G, Fabrizi M, Ravá L, Ciofi Degli, Vernocchi P, Vallene C, et al, www.conferenciasindromemetabolico.org

181


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FRECUENCIA DE SÍNDROME METABÓLICO E HIPERURICEMIA Y SU ASOCIACIÓN CON EL CONSUMO CALÓRICO, EN LOS TRABAJADORES DE TURNO DIURNO VS NOCTURNO EN UN HOSPITAL COMUNITARIO DEL CENTRO DE MÉXICO Jáuregui-Villava Montserrat1,2, Preciado–Puga Mónica del Carmen3, Daniela Beatriz Muñoz López3, Elia Lara Lona2,3, Ana Lilia González Yebra3 RESUMEN: Según ENSANUT 2012 la prevalencia de SM en la población adulta en México fue del 41%. La rotación por turnos laborales al que se someten los trabajadores de salud, provoca alteraciones en el ritmo circadiano y la concentración de hormonas que controlan el apetito, además de un mayor riesgo nutricional de padecer estados de sobrepeso, incrementando la prevalencia de Síndrome Metabólico e hiperuricemia. Metodología: Se realizó un estudio exploratorio, comparativo, descriptivo y transversal, en el personal de salud de un hospital del centro de México; con el objetivo de comparar los componentes del SM en los trabajadores del turno nocturno (TN) vs diurno (TD), así como su correlación con la ingesta calórica diaria. Resultados: Se evaluaron un total de 30 pacientes, 20 TN y 10 TD. Encontramos una diferencia estadísticamente significativa en los Triglicéridos (190.4 ± 99.2 vs 115.5 ± 87.6) p=0.0434, la TAS (124 ± 6.6 vs 114.8 ± 13.1) p= 0.046 y la glucosa sérica en ayuno (94.3 ± 11.7 vs 82.3 ± 10) p =0.0064 comparando ambos turnos. Los componentes alterados del SM con mayor prevalencia en ambos turnos laborares (TN vs TD), fueron la circunferencia de cintura (80 vs 90%) y el HDL (90 vs 70%). Se encontró correlación positiva de las Kcal consumidas por día y la circunferencia de cintura (r= 0.709, p= 0.022) en el grupo con SM utilizando correlación de Sperman. No encontramos significancia estadística utilizando una prueba de Chi2 entre el turno en el cual laboraban los pacientes y la presencia del SM (χ2 = 1.2, p= .273) Conclusiones: Los trabajadores del TN tuvieron una mayor frecuencia de SM, un mayor consumo de calorías por día y una mayor circunferencia de cintura. En ambos turnos se presentaron alteraciones en los componentes del SM relacionados con la ingesta calórica. El SM es un problema de salud pública que nos obliga a fortalecer las estrategias de prevención para evitar la presencia de las complicaciones del mismo a un bajo costo disminuyendo el gasto público por incapacidades y atención médica de las complicaciones del este. PALABRAS CLAVE: Síndrome Metabólico, Componentes del Síndrome metabólico Hiperuricemia.

I. INTRODUCCIÓN l ritmo actual de crecimiento de las organizaciones, obliga a mantener los servicios y los procesos productivos de manera continua; el sector salud, cuenta con sistemas de trabajo nocturnos lo cual trae consigo ciertas implicaciones tales como: alteración en el ritmo circadiano, variaciones

E 182

www.conferenciasindromemetabolico.org

en la concentración de insulina y leptina ( hormonas que controlan el apetito) y un mayor riesgo nutricional de padecer estados de sobrepeso y obesidad; lo aunado a un conjunto de alteraciones metabólicas provocando mayor preUniversidad del Valle de Atemajac ISAPEG 3 Universidad de Guanajuato 1 2

valencia de síndrome metabólico y estados de fatiga que contribuyen a niveles reducidos de actividad física, además es un como factor de riesgo para eventos mortales.1.2 Recientes estudios sugieren que personas que trabajan a turnos con un sistema rotativo pueden desarrollar anormalidades importantes en sus respuestas hormonales y metabólicas postprandiales, después de un cambio abrupto de turno por lo que habrá una mayor resistencia insulínica y respuestas alternadas de lípidos al tomar comidas por la noche al inicio del turno nocturno.3 .4, 5. El ausentismo laboral puede verse aumentado en estos pacientes como se evidencia en un estudio realizado en Bélgica que demostró que los hombres con mayores valores de circunferencia cintura, mostraban un incremento en los periodos de ausencia laboral y mayores costos en las incapacidades por todas las causas de enfermedad general. 6 En otro estudio se encontró que una persona activa se incapacita en promedio 1.23 días al año, una persona laboral lo hace 2.8 días al


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

año, y una persona sedentaria 4.35 días / año.7 En términos económicos, durante el periodo 2000-2008 los costos directos de enfermedades atribuidas al sobrepeso y la obesidad se incrementaron en un 61%, alcanzándose la cifra de 42,246 millones de pesos, lo que representa el 33.2% del gasto público federal en materia de servicios de salud.8 El Síndrome Metabólico (SM) es considerado un problema de salud pública por ser una de las causas principales de morbilidad y mortalidad a nivel mundial tiene un impacto devastador por las grandes pérdidas en años de vida saludable, calidad de vida, incapacidad laboral, costos económicos.9 De acuerdo a la ENSANUT 2012, la prevalencia de síndrome metabólico en México es de 41%, en la población adulta (>20 años de edad) Por lo menos el 31.5 de los adultos mexicanos cuentan con hipertrigliceridemia, y solo el 3.8% ha sido diagnosticada. 10-11 La coexistencia de tres o más de estos factores son necesarios para integrar el diagnóstico. Según la clasificación del IDF (Federación Internacional de Diabetes) los criterios a tomarse en cuenta para hacer el diagnóstico de SM son: Hipertensión Arterial >130/80 mm/ Hg, Triglicéridos >150 mg/dl, colesterol HDL mujeres <50 mg/dl y hombres < 40 mg/dl, circunferencia de cintura: hombres >90 cm y mujeres >80 cm, así como glucosa central en ayuno > 100 mg/dl. 12 No se ha establecido un punto de corte adecuado para la circunferencia de la cintura de la población

V3-N1 - 2016

mexicana, debido a las diferencias significativas en la altura y la composición corporal en comparación con los caucásicos y los otros grupos étnicos. Sin embargo, la última definición de la IDF para síndrome metabólico recomienda un punto de corte inferior para la población de Centroamérica y Sudamérica. Además, un importante análisis de sensibilidad en población mexicana mostró que el punto de corte de las IDF tenía una mejor sensibilidad para la detección de la diabetes, la hipertensión y el síndrome metabólico, en comparación con el punto de corte AHA.10 Los estudios en diferentes poblaciones muestran que la hiperuricemia se relaciona con la presencia de SM. Esta alteración se ve mediada por la hiperinsulinemia, obesidad e hipertensión arterial. Así también, se ha comprobado la participación del ácido úrico en la fisiopatología del SM, al asociarse significativamente con cuatro de sus componentes, lo que sugiere su empleo como un marcador colateral de las alteraciones involucradas. 13-16 De aquí la importancia de realizar un estudio donde se conozca la frecuencia de SM e hiperuricemia y su relación con la ingesta alimentaria, en adultos con vida laboral activa sometidos a turnos matutinos y turnos nocturnos.

mo calórico, en los trabajadores de tuno matutino vs nocturno del Hospital Comunitario Juventino Rosas, Gto. Se evaluaron un total de 30 personas y no se incluyeron a mujeres que estuvieran embarazadas. Se midió la presión arterial por duplicado con baumanómetro digital marca OM ROM, después de 5 minutos de reposo reportándose el promedio. El peso corporal midió utilizando una báscula marca SECA ®. La talla se tomó con el estadímetro marca SECA ® y la circunferencia abdominal flexómetro marca SECA ®. Se tomó una muestra de 5 ml de sangre para las determinaciones del HDL, Triglicéridos, glucosa y ácido úrico, después de un ayuno de 10 utilizando máquinas Cobar Integra 400 plus, mediante química húmeda. La evaluación dietética se hizo por medio de un recordatorio de 24 horas utilizando réplicas de alimentos para estimar el tamaño de las porciones al igual que utensilios de cocina. Se calculó el consumo calórico y de macro nutrimentos utilizando el programa NutriKcal® reportándose en Kcal totales consumidas por día y % de macro nutrimentos. Todos los participantes firmaron una carta de consentimiento informado previa explicación del procedimiento y el protocolo fue aprobado por el comité de invesII. METODOLOGÍA tigación del Hospital Comunitario Se realizó un estudio exploratorio, de Juventino Rosas. comparativo, descriptivo y transversal, cuyo objetivo fue comparar III. RESULTADOS las frecuencias de síndrome me- Se estudiaron un total de 30 patabólico, hiperuricemia y el consu- cientes, 10 del turno diurno y 20 www.conferenciasindromemetabolico.org

183


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

del SM relacionados con la ingesta calórica. El SM es un problema de salud pública que nos obliga a fortalecer las estrategias de prevención para evitar la presencia de las complicaciones del mismo. Fortalecer la educación nutricional con los pacientes con SM o componentes del mismo alterados, pueden modificar su diagnóstico a un muy bajo costo, disminuyendo el gasto público por incapacidad y atención médica de las complicaciones.

del turno nocturno, 21 del sexo femenino y 9 del sexo masculino. Con un promedio de edad de 34.5 ± 6 años. (tabla 1). Se encontró una frecuencia de SM utilizando los criterios de IDF de 10 casos de la población total estudiada (33.3%). De los cuales solo 2 son del turno diurno (20%) y 8 del turno nocturno (40%). Los componentes del síndrome metabólico con prevalencia más alta fueron circunferencia de cintura (86.6%), HDL (76.7%), y la prevalencia de hiperuricemia en ambos grupos resultó igual (20%). Por medio de una prueba de Correlación de Sperman encontramos correlación positiva del consumo de Kcal /día con la circunferencia de cintura (r=.5781, p= 0.001), triglicéridos (r= .4238, p= 0.029), TAS (r=o.3982, p=0.029) y el ácido úrico (0.3756, p= 0.041) y una 184

www.conferenciasindromemetabolico.org

correlación negativa con el HDL (r= -.4470, p = 0.013) en el grupo total (n=30). En el grupo con SM encontramos correlación positiva de las Kcal /día y la circunferencia de cintura (r= 0.7093, p= 0.022). No encontramos significancia estadística utilizando una prueba de Chi2 entre el turno en el cual laboraban los pacientes y la presencia del SM (χ2 = 1.2, p= .2733) ni en el consumo calórico por día y el turno en el que laboraban (χ2 = 28, p= .41). IV. CONCLUSIONES En el presente estudio encontramos que los pacientes que laboran en turno nocturno tuvieron una mayor frecuencia de SM, un mayor consumo de calorías por día y una mayor circunferencia de cintura. En ambos turnos se presentaron alteraciones en los componentes

V. BIBLIOGRAFÍA 1. Deschamps PA., Olivares RS., De la Rosa ZK, Asunsulo DA.(2011) Influencia de los turnos de trabajo y las guardias nocturnas en la aparición del Síndrome Burnout en médicos y enfermeras.Med Segur Trab (Internet);57:224-241. 2. Serra ML.(2013). Trabajo en turnos, privación de sueño y sus consecuencias clínicas medico legales. Rev. Med. Clin. Condes; 24(3): 442-451. 3. Franco HL., Bravo SR., Sánchez LC., Romero E., Rodríguez MA., Barriga IC. Cubero JJ. (2012). Análisis nutricional y hábitos alimentarios en personal sanitario con turnos rotatorios. Rev. Esp Nutr Comunitaria; 18(1):200-204 4. Ruiz DM., Cifuentes MM., Segura BO., Chavarria SP., Sanhueza RX.(2010). Estado nutricional de trabajadores bajo turnos rotativos o permanentes. Rev. Chile Nutr; 37(4): 446-454. 5. Fernández RM., Bautista CI., Bello LL., Hernández BL, Sánchez VA., Serra ML.(2004). Valoración nutricional de trabajadores


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

sanitarios expuestos a turnicidad en Canarias. Nut. Hosp; 19(5):286 – 291. 6. Francisco AC. (2012). Jornadas de trabajo extenso y guardias nocturnas en médicos residentes. Consecuencias para la salud y afrontamiento. Fundamentos en humanidades;12(2): 205217. 7. Martínez-López, E.,Saldarriaga-Franco, J. F. (2008). Inactividad Física y Ausentismo en el Ámbito Laboral. Revista De Salud Pública; 10(2), 227-238. 8. Reyes CA., (2013). Proyecto ¨Centro de promoción de la Salud del Norte de México. Recuperado de: http://alamo.colson.edu. mx:8085/sitios/CESS/091020_ frutosTrabajo/frutos_archivos/ Reyes2013_InformeSobreEnfermedades.pdf 9. Cárdenas –Villareal V., Vargas-Estrada M., Hernández GM., Flores-Peña Y., Cerda- Flores R. (2011). Identificación de componentes del síndrome metabólico en pacientes mexicanos hospitalizados por síndrome isquémico coronario agudo: una herramienta para la prevención. Enferm Intensiva; 23(1):32-38. 10. Pedroza-Tobias A., TrejoValdivia B., Sánchez-Romero L., Barquera S. (2014). Classification of metabolic syndrome according to lipid alterations: analysis from the Mexican National Health and Nutrition Survey 2006; BMC Public Health 14(1056): 1-9. 11. Aguilar Salinas , C., Rojas, R., Gómez , P. F., Valles, V., Ríos , T. J., & Franco, A. (2004). High prevalence of metabolic syndrome in

V3-N1 - 2016

Mexico . Arch Med Res , 76-81. 12. Alberti K., Eckel HR., Grundy MS., Zimmet ZP., Cleeman IJ., Donato AK., et al. (2009) Harmonizing the Metabolic Syndrome A Joint Interim Statement of the International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity; circ.ahajournals.org 120:1640-1645. 13. Campos-Mondragón M., Oliart-Ros R., Méndez-Machado F., Angulo-Guerrero O. (2010) Síndrome Metabólico y su correlación con los niveles séricos de urea, creatinina y ácido úrico en adultos de Veracruz. Rev Biomed; 21:6775. 14. Chen L., et al. (2007) Relationship between hyperuricemia and metabolic syndrome. J Zhejiang Univ Sci; 8(8):593-598 Doi: 10.1631/jzus.2007.B0593. 15. González –Chávez A., Elizondo-Argueta S., Amancio-Chassin O.(2011). Relación entre síndrome metabólico e hiperuricemia en población aparentemente sana. Rev. Med Hosp Gen Méx; 74(3):132-137. 16. De Oliveira A., Hermana HM., Guedes CP., Bressan J., Azevedo NA., Cardoso DE., José NA.(2014) The impact of serum uric acid on the diagnostic of metabolic syndrome in apparently healthy Brazilian middle-aged men. Nutr Hosp;30(3):562-569

www.conferenciasindromemetabolico.org

185


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES DE RIESGO ASOCIADOS A PERIODONTITIS EN EL PACIENTE OBESO L.O. Valdovinos Díaz Rene1, CMF. Perera Lezama Rubén F1, L.O. Ramírez Colín Víctor Manuel1, L.O. Cervantes Rivera José Manuel1, D.C. Valdivia Flores Alejandra2, Dr. Zerrweck López Carlos3, Santiago Dorantes Diana4 ABSTRACT Obesity is a multifactorial disease, being the main eating disorder in Mexico. And also brings various health problems to other diseases. Periodontitis is an inflammatory disease that affects the gum, bone, cementum and periodontal ligament multifactorial etiology. A descriptive, cross-sectional study was conducted in the service of the Integral Clinic of Surgery for Obesity and Metabolic Diseases, General Hospital Tláhuac, Mexico City, with the aim of identifying periodontal alterations and their prevalence in adult patients with obesity and risk factors that condition. In the data analysis the prevalence of patients with periodontal defined alterations. Among the results is 50% with BMI type III (40 to 49.9), 30% with type IV (High to 50) and 20% with type II (35 to 39.9). 50% have a plaque index between 11 to 20 teeth affected, it was observed that 70% have plaque and gingivitis associated with only a little over 40% presented periodontitis in a different stadium, among other factors. KEY WORDS: Obesity, periodontitis, gingivitis, periodontal disease, risk factors

I. INTRODUCCIÓN a obesidad se puede definir como una alteración de la estructura corporal, caracterizada por un exceso de tejido adiposo, que implica un peligro para la salud; su etiología representa una interacción entre genética, metabolismo de la dieta, niveles de actividad física y consumo de alimentos altamente calóricos, entre otros. Se le considera el desorden nutricional más común en América, y es un factor de riesgo significativo para diversas enfermedades sistémicas en la edad adulta como hipertensión, diabetes mellitus, ateroesclerosis, enfermedades cerebrovasculares, así como cardiovasculares. 1 Por otro lado, la enfermedad periodontal es principalmente una condición inflamatoria inducida por patógenos dados de la de la acumulación de placa dentobac-

L

186

www.conferenciasindromemetabolico.org

teriana en la superficie de los dientes. Es una condición de alta prevalencia en todo el mundo y representa un importante problema de salud pública. Hay diferentes manifestaciones clínicas de condiciones periodontales, tales como gingivitis, una inflamación aguda del tejido blando y la periodontitis como tal, una forma inflamatoria más severa de la enfermedad periodontal, la cual es irreversible. 2 La inflamación es un factor que tienen en común estas dos enfermedades. Los adipocitos del tejido adiposo producen citocinas inflamato¬rias, entre las que se encuentra el factor de necrosis tumoral alfa (TNF−α), la interleucina 6 (IL−6) y hormonas como leptina y adiponectina. Otra razón por

la que la inflamación se presenta en la obe¬sidad es debido a una respuesta a la hipoxia en áreas de depó-sitos de grasa; a medida en que la masa grasa se incrementa, la red vascular es insuficiente para mantener la normoxia y se estimula la angiogénesis. 2-3 La alimentación juega un papel muy importante como factor de riesgo, las personas con obesidad por lo general cuentan con una dieta muy alta y excesiva en ácidos grasos saturados, estos principalmente los encontramos en productos de origen animal, a excepción del pescado y mariscos. Los ácidos grasos saturados provocan inflamación y por tanto su efecto es negativo en caso de periodontitis o gingivitis, el consumo de alcohol y tabaco aumenta la predisposición debido a los efectos negativos que tienen sobre el periodonto.3 El objetivo del presente trabajo fue determiner la prevalencia de periodontitis en pacientes con obesidad. II. MATERIAL Y MÉTODO Se realizó un estudio descriptivo, trasversal en el servicio de la clínica integral de cirugía para la obesidad y enfermedades metabólicas, del hospital general de Tláhuac,

Instituto Politécnico Nacional plantel CICS UMA Instituto Politécnico Nacional DI-DOPI 3 Director de la Clínica de Obesidad General de Tláhuac, Cirujano Gastrointestinal y Bariatra 4 Alumna BEIFI de la carrera de Odontología del Instituto Politécnico Nacional plantel CICS UMA 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

en la delegación Tláhuac, Ciudad de México, en el periodo comprendido de Febrero a Julio de 2015, con el propósito de identificar la periodontitis en pacientes adultos con obesidad y los factores de riesgo que la condicionan. El universo del estudio lo conformaron 50 individuos que tenían un IMC (índice de masa corporal) (kg/ m2) mayor a 30,00, los cuales acudieron a realizarse el examen médico para consulta en la clínica de obesidad con el propósito de ser sometidos a control de peso y cirugía (bypass gástrico). Fueron excluidos pacientes embarazadas, menores de edad o con enfermedades autoinmunes. Los individuos fueron pesados y se realizo toma de presión arterial por el servicio de la clínica de obesidad, posteriormente se efectuó la inspección clínica de los ya diagnosticados como obesos, tomando medidas de cintura y cuello, se les entregó una historia clínica de llenado básico con variables propias del individuo y características sociodemográficas, se hizo la exploración clínica intraoral para el examen periodontal básico, con el uso de tabletas reveladoras de placa, espejo intraoral, pinza y sonda milimetrada de Williams, haciéndose el llenado de hoja de registro de datos, diseñados para la presente investigación. Se revisó la cantidad y distribución de la placa dentobacteriana e inflamación gingival, así mismo la profundidad de las bolsas periodontales y pérdida de inserción clínica, recesión gingival y presencia de cálculo para determinar periodontitis. Se registra-

ron rubros de movilidad dental, frecuencia de cepillado, ausencia dental, entre otros más. El análisis de los datos se llevó a cabo con el paquete SPSS 22 para Windows y Excell para Windows.

III. RESULTADOS El rango de edad de los participantes fue de 19 a 60 años, 70% correspondió al género femenino y 30% al género masculino. El 50% de los pacientes se encuentra con IMC tipo III (40 a 49.9), 30% con tipo IV (Mayor a 50) y 20% con tipo II (35 a 39.9). En cuanto a higiene bucal el 54% realiza el cepillado dental 2 veces al día, sin embargo, cuando se les pidió que mostrarán su técnica de cepillado ésta era deficiente. Más del 50% tiene mal posición dental y un 82% cuenta con algún tipo de ausencia dental. La caries dental estuvo presente en un 96% de los pacientes, en donde la mayoría tenía de 6 a 10 piezas cariadas. El 50% tiene un índice de placa dentobacteriana entre 11 a 20 piezas afectadas; 68% presentó cálculo, que presidía en zona lingual; se observó que el 70% presentaba gingivitis dentro de los cuales algunos presentaban ya periodontitis. En total sólo un 46% mostró padecer cierto grado de periodontitis en diferente estadio, la mayoría de estos pacientes tenían un IMC tipo III y IV. Dentro del porcentaje de consumo de tabaco sólo el 32% de la muestra era fumador, sobre este porcentaje el 43.7% tenía periodontitis, no hubo relevancia dentro de los resultados de consumo de alcohol.

V3-N1 - 2016

IV. DISCUSIÓN El riesgo de padecimiento periodontal es elevado en pacientes con factores de riesgo como la obesidad o el síndrome metabólico. Los elevados niveles de proteína C reactiva, el factor de necrosis tumoral alfa (TNF-α) y de interleucina 6 (adipoquinas) representan factores de riesgo de enfermedad periodontal.4 Estos marcadores inflamatorios se relacionan con un aumento del riesgo de enfermedad coronaria, hipertensión arterial y diabetes mellitus, aunque la relación también es inversa, debido a que las enfermedades sistémicas pueden acelerar la afección periodontal.5-6 En efecto se comprobó que la inflamación dada por la obesidad juega un papel crucial en la cavidad oral, repercutiendo en un 70% por gingivitis encontrada. No obstante, de las personas diagnosticadas con periodontitis no todas tenían alteraciones sistémicas. Existen diversos factores que pueden incrementar el riesgo a padecer periodontitis además de las alteraciones sistémicas; dentro de estos factores podemos encontrar el porcentaje de pérdida ósea, ausencia dental, compromiso de bifurcación, número y distribución de dientes remanentes, posición de los dientes en relación al arco, dientes impactados, factores anatómicos dentales, condiciones patológicas y factores protésicos restaurativos mal ajustados.6 Encontramos que más de la mitad de la muestra presenta algún tipo de malposición dental, la mayoría de tipo giroversión; algunos otros contaban con prótesis o implantes, www.conferenciasindromemetabolico.org

187


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

dientes remanentes sin cuidado, así como algún tipo de ausencia dental, que con base en la literatura podrían dar indicios de enfermedad periodontal debido a un acúmulo mayor de placa dentobacteriana. La determinación del factor riesgo desencadenante de una enfermedad es el primer paso en la resolución de la misma, al identificar los factores determinantes se contribuirá con el diagnóstico oportuno, envío al nivel de atención que corresponda y un plan de tratamiento preventivo eficaz. La pluripatología puede estar presente en la obesidad y como resultado de ésta comorbilidad la ingesta farmacológica es elevada y con frecuencia significa la administración de varios medicamentos de forma simultánea de lo cual conlleva patología oral concomitante en muchos casos. V. CONCLUSIONES Las periodontitis y la obesidad están asociadas cercanamente y son enfermedades crónicas altamente prevalecientes con coincidencias en su fisiopatología. Es posible que las alteraciones periodontales puedan servir como indicadores en el diagnóstico y tratamiento de las enfermedades que puede desencadenar la obesidad. Considerando la relación entre obesidad y periodontitis se puede concluir que la asociación entre estas dos existe, con una relación estrecha dada por mecanismos que desafortunadamente aún no se conocen en su totalidad de forma directa en el medio bucal, los factores que pue188

www.conferenciasindromemetabolico.org

den contribuir a su desarrollo pueden variar de un individuo a otro. VI. BIBLIOGRAFÍA 1.- Aranda ML, García VFS, Alarcón PM Obesidad y enfermedad periodontal Rev Mex Periodontol 2012; 3 2.- Domínguez García MV, Huitrón Bravo G, Mendoza A.A. La reacción inflamatoria en la fisiopatogenia de la obesidad Centro de Investigación en Ciencias Médicas, UAEM. México 3.- Revista Latinoamericana de Hipertensión. Vol. 7 - Nº 1, Periodontal disease associated with inflammatory conditions in the metabolic síndrome 2012 4.- Khosravi R, Ka K, Huang T, Khalili S, Nguyen BH, Nicolau B, et al. Tumor necrosis factor-α and interleukin-6: potential interorgan inflammatory mediators contributing to destructive periodontal disease in obesity or metabolic syndrome. Mediators Inflamm. 2013 [citado 22 mar 2014] 2013(728987): 6. 5.- Peña Lage Margarita, Manresa Reyes Luisa, Rodríguez Legrá Elaine. Enfermedad periodontal y síndrome metabólico. CCM [revista en la Internet]. 2014 Jun [citado 2016 Ene 11] ; 18(2): 324-326. 6.- Botero Z Leticia, Vélez L María Eugenia, Alvear E Fanny Stella. Factores del pronóstico en periodoncia. Rev Fac Odontol Univ Antioq [serial on the Internet]. 2008 June [cited 2016 Jan 22] ; 19( 2 ): 69-79. Available from:

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

INGESTA DIETÉTICA, OBESIDAD Y SOBREPESO EN PACIENTES CON SÍNDROME METABÓLICO Esmirna A. Acosta Navarro1, Alejandro Rodríguez González2, María Aurora Maravilla Domínguez3 ABSTRACT SUMMARY. Introduction. The SxMetabólico is a joint metabolic disorders that increase the risk of CVD and where diet plays a significant role in the control of metabolic abnormalities. Methodology: The objective of this study was to determine the biochemical characteristics of the controlled subjects and their dietary intake of macronutrients and fiber and contrast with the uncontrolled subjects. Results: Significant differences in values of HDL cholesterol, serum glucose, triglycerides, body mass index, waist circunfewrencia were found. However, no differences in macronutrient intake were found. KEY WORDS: Metabolic syndrome, diet, macronutrients, obesity

I. INTRODUCCIÓN a prevalencia de síndrome metabolico (SxMet) se encuentra en constante incremento como consecuencia del aumento de obesidad. La creciente atención en el SxMet radica en que se ha demostrado su asociación con el desarrollo de morbimortalidad cardiovascular. 2 En México, en la población adulta (20 a 69 años), hay más de 35 millones con sobrepeso y obesidad. Es bien conocido que aquellos grupos poblacionales que han mostrado mayor tendencia a desarrollo de obesidad y DM2, como los indios Pima, africano-americanos y méxico-americanos, no sólo comparten factores genéticos, sino también étnicos, como el entorno cultural, de estilo de vida y socioeconómico. Es un padecimiento que se acompaña de una serie de complicaciones y requiere, por ende control y tratamiento de por vida.31 Se considera que el sobrepeso y la obesidad son problemas de salud pública, tanto en

L

los países desarrollados como en los de América Latina. De acuerdo con ENSANUT, 2006, 39% de la población adulta mexicana tiene sobrepeso y otro 30% obesidad. La prevalencia de sobrepeso es mayor en varones (42.5%) que en mujeres (37.4%), mientras que la de obesidad es más alta en las mujeres (34.5%) que en los hombres (24.2%). Si se suman, estas prevalencias dan cifras de 71.9% de sobrepeso y obesidad en sujetos mayores de 20 años.22 Existe buena evidencia que asocia la obesidad central o superior al Riesgo cardiovascular y metabólico, por su alta relación con grasa visceral. La obesidad se sigue considerando el componente central en el origen de SxMet.31 Creciente evidencia enfatiza el papel de un patrón dietético saludable junto con la actividad física, como la terapia de primera línea para reducir los

factores de riesgo metabólicos (1). La dieta del Mediterráneo, la dieta dash, la dieta paleolítica, la dieta vegetariana, todas ella son patrones dietéticos que se caracterizan por una ingesta elevada de frutas y verduras, ingesta mínima de comida procesada, alta ingesta de alimentos cultivados localmente, poca o ninguna ingesta de carne roja y consumo moderado de carnes blancas (pescado o pollo), así como ingesta de alimentos con alto contenido de grasas omega 3 o en suplemento, e ingesta de raíces, todas ellas en contraposición a las dietas occidentalizadas que se caracterizan por un gran consumo calórico, altas cargas glucémicas, gran contenido de grasas y carnes y un exceso en la ingesta de fructuosa adicionada. Situada en el Noroeste del País, la región de la Comarca Lagunera es una zona semidesértica, considerada desde 2013 a la fecha (2016-Julio), una de las regiones más violentas del país, lo que limita la disponibilidad y accesibilidad de alimentos y bienestar general. Según ENSANUT 2012, en los Estados de Coahuila y Durango (donde se localiza la Comarca Lagunera), se alcanzan las mayores prevalencias de sobrepeso y obesidad. Tomando

Pasante de Servicio Social, Licenciatura de Nutrición, FACSA., GP/UJED Estudiante semestre 10. Licenciatura de Medicina, FACSA., GP/UJED. 3 Profesor, Facultad de Ciencias de la Salud. (FACSA) GP, Dgo. Universidad Juárez del Estado de Durango (UJED) 1 2

www.conferenciasindromemetabolico.org

189


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

en consideración los antecedentes previos el objetivo de este trabajo fue determinar la prevalencia de sobrepeso y obesidad así como la calidad de la alimentación en una población de sujetos con SxMet.

de los sujetos estaban presentes los 5 anormalidades, el 55.17% (n=16) exhibió 4 anormalidades y el 13.8% (n=4) de la población exhibió tres anormalidades. En la tabla 1, se muestran los valores promedio de las variables componentes del SxMet y también las ingestas promedio de macronutrientes, en sujetos controlados y no controlados. En este estudio, se encontraron diferencias significativas en los valores séricos de Colesterol-HDL, glucosa, triglicéridos, circunferencia de la cintura e IMC entre los sujetos controlados y los no controlados. Sin embargo, no se enconiitraron diferencias significativas entre los grupos en la ingesta de macronutrientes.

II. METODOLOGÍA Con diseño de encuesta se evaluaron los datos de 29 sujetos con SxMet que durante 2014 fueron atendidos en la UNEME-EC. Los datos clínicos obtenidos de los expedientes electrónicos fueron aquellos que integran el síndrome metabólico y también los datos de dieta correspondientes a la ingesta dietética. Los macronutrientes fueron calculados a partir de los recordatorios de 24 h de acuerdo al Sistema de Equivalentes de la población mexicana. IV. CONCLUSIONES La ingesta de macronutrientes no III. RESULTADOS mostró diferencias significativas En este estudio participaron 29 entre el grupo de sujetos contropacientes con SxMet, la edad pro- lados y no controlados, sin embarmedio y DE del grupo fue de 55.4 go, puede observarse en los suje± 7.2 años. De estos 29 pacientes: tos controlados una disminución 6 fueron hombres (21%) y 23 en la ingesta de carbohidratos y mujeres (79%). La prevalencia de una mejor ingesta de proteínas y anormalidades en estos sujetos en fibra comparados con los sujetos relación con el número de com- no controlados ponentes del SxMetabólico fue la siguiente: en el 31% (n=9) de los V. BIBLIOGRAFÍA sujetos estaban presentes los 5 Barquera, S. (2012). Obesidad Resultados: En este estudio parti- en adultos: los retos de la cuesta ciparon 29 pacientes con SxMet, la abajo. Centro de Investigacion en edad promedio y DE del grupo fue salud y nutrición . de 55.4 ± 7.2 años. De estos 29 pa- Organización Mundial de la Sacientes: 6 fueron hombres (21%) y lud. (Septiembre de 2015). Re23 mujeres (79%). La prevalencia cuperado el 16 de Mayo de 2016, de anormalidades en estos suje- de http://www.who.int/features/ tos en relación con el número de qa/82/es/ componentes del SxMetabólico OLAIZ-FERNANDEZ, G. (2007). fue la siguiente: en el 31% (n=9) Diabetes mellitus en adultos mexi190

www.conferenciasindromemetabolico.org

V3-N1 - 2016

canos: resultados de la Encuesta Nacional de Salud 2000. Salud pública Méx [online] , 331-337. José Ángel Córdova-Villalobos, M. E.-M.-E. (2008). Las enfermedades crónicas. salud pública de méxico / vol. 50, no. 5 . Perez, A. B. Dietas Normales y Terapeuticas sexta edición.Mexico DF: Mc Gray Hill Education. Grundy S.M., Cleeman J.I., Daniels S.R., Donato K.A., Eckel R.H., Franklin B.A., Gordon D.J., Krauss R.M., Savage P.J., Smith S.C., Jr., et al. Diagnosis and management of the metabolic syndrome: An American Heart Association/National Heart, Lung, and Blood Institute scientific statement. Curr. Opin. Cardiol. 2006;21:1–6. doi: 10.1097/01. hco.0000200416.65370.a0. Tarantino G. Hype or Reality: Should Patients with Metabolic Syndrome-related NAFLD be on the Hunter-Gatherer (Paleo) Diet to Decrease Morbidity? J Gastrointestin Liver Dis. 2015 Sep;24(3):359-68. doi: 10.15403/ jgld.2014.1121.243.gta. Choi SH, Choi-Kwon S. The effects of the DASH diet education program with omega-3 fatty acid supplementation on metabolic syndrome parameters in elderly women with abdominal obesity. Nutr Res Pract. 2015 Apr;9(2):150157. http://dx.doi.org/10.4162/ nrp.2015.9.2.150 Garcia M, Bihuniak JD, Shook J, Kenny A, Kerstetter J, Huedo-Medina TB. The Effect of the Traditional Mediterranean-Style Diet on Metabolic Risk Factors: A Meta-Analysis. Nutrients. 2016;8(3):168. doi:10.3390/nu8030168.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

RELACIÓN DEL ÍNDICE TG/HDL CON FACTORES DE RIESGO CARDIOVASCULAR EN SUJETOS APARENTEMENTE SANOS D.C. Blanca Guadalupe Baez Duarte1, D.C. Irma Zamora Ginez1, D.C. Adriana Nieva Vázquez1, Lic. Marión Pearl Cobian1, D.C. Ricardo Pérez Fuentes1,2, M.C. Rosendo Briones Rojas3 ABSTRACT Cardiovascular diseases (CVD) are the leading cause of death worldwide. For people at risk for these diseases early detection is critical. Most CVD can be prevented by acting on the factors of cardiovascular risk (CVR), these include traditional (hypertension, obesity, dyslipidemia) and emerging (glucose intolerance, triglycerides (TG), fasting glucose) factors. The TG/high-density lipoprotein (HDL) index has been proposed recently to estimate the CVR in different types of populations; however, it is necessary to deepen its association with risk factors mentioned to strengthen its application in clinical practice. The aim of the study was to determine the relationship of traditional and emerging CVR factors with the TG/HDL index in apparently healthy population. Observational, comparative and prospective study was designed in IMSS and University Hospital of Puebla population. Subjects were clinical, biochemical and anthropometrically characterized. Study groups were formed: 1) subjects without CVR, index TG/HDL≤3 and 2) subject with CVR, index TG/HDL>3. Statistical analysis was performed with SPSS v.22. The results showed that subjects CVR group had a metabolic imbalance and high levels of traditional and emerging CVR factors compared to the group without CVR. The TG/HDL index significantly correlated with all the CVR factors (p ≤ 0.05), except with age. Therefore, this study suggested that this index can be regarded as criterion indicating metabolic disorders largely related to CVD. KEYWORDS: index TG / HDL, cardiovascular disease, cardiovascular risk factors.

I. INTRODUCCIÓN as enfermedades cardiovasculares (ECV) son la principal causa de muerte en todo el mundo, siendo responsables en el año 2012 de un total de 31% del total de muertes1 y en México del 25%.2 Para las personas con alto riesgo cardiovascular (RCV) debido a la presencia de uno o más factores de riesgo, son fundamentales la detección precoz y el tratamiento temprano.1 Un factor de RCV es una característica biológica o una conducta que aumenta la probabilidad de padecer o morir de una ECV en los individuos que la presentan.3 Se han identificado una serie de factores de RCV que

L

actuarían como inductores de la formación de la placa de ateroma, entre ellos se encuentran los llamados “tradicionales”, como son la hipercolesterolemia, disminución de la lipoproteína de alta densidad (HDL), la hipertensión, la edad y el género, entre otros.4,5 Por otra parte, han surgido nuevos factores de RCV, o “emergentes”, como son apolipoproteínas, triglicéridos (TG), glucemia en ayuno alterada e intolerancia a la glucosa, entre otros.3 Por otro lado, un nuevo

índice ha sido propuesto para estimar el RCV. Este índice se calcula a partir de dividir los niveles de TG entre los niveles de HDL (índice TG/HDL) y ha sido utilizado en diferentes tipos de poblaciones, como son: sujetos con alto riesgo para enfermedad coronaria,6 sujetos con diabetes tipo 2 (DT2)7, sujetos con síndrome metabólico,8 pacientes con enfermedad coronaria arterial.9 En todos estos estudios, el índice TG/HDL fue un predictor independiente de ECV. Además de lo anterior, este índice ha sido evocado como un indicador clínico sencillo de RCV, al estimar partículas LDL pequeñas, densas y altamente aterogénicas, así como al predecir la rigidez arterial y eventos cardiovasculares agudos en sujetos adultos con DT2,7 sujetos sanos sin diabetes,10 en adultos jóvenes y adolescentes con obesidad.11 Tomando en consideración la información antes mencionada y que la relación de este índice con factores de RCV tradicionales y emergentes no ha sido reportada previamente, el presente estudio tuvo como objetivo: determinar la relación de factores de RCV tradicionales y emergentes

Facultad de Medicina, Benemérita Universidad Autónoma de Puebla (BUAP) Centro de Investigación Biomédica de Oriente (CIBIOR) del Instituto Mexicano del Seguro Social (IMSS) 3 Hospital Universitario de Puebla de la BUAP 1 2

www.conferenciasindromemetabolico.org

191


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

con el índice TG/HDL en población aparentemente sana.

II. METODOLOGÍA Se realizó un estudio transversal comparativo y observacional. Se llevó a cabo en población derechohabiente de la Clínica No. 2 del IMSS y del Hospital Universitario pertenecientes a la Facultad de Contaduría y Arquitectura de la BUAP. Los sujetos se caracterizaron clínica-antropométrica y bioquímicamente (historia clínica, presión arterial, peso corporal, estatura, índice de masa corporal (IMC), circunferencia de cintura, insulina de ayuno, glucosa de ayuno y glucosa a las 2 h de la prueba de tolerancia oral a la glucosa (Glc-POTG), TG, colesterol total, LDL y HDL, a través de técnicas rutinarias de laboratorio clínico de la Clínica No.2 del IMSS y del Hospital Universitario de la BUAP). Se formaron los grupos de estudio: 1) grupo con RCV, índice TG/HDL > 3 y 2) grupo sin RCV, índice TG/HDL ≤ 3. Los datos se presentaron como medias ± DE. Se consideró una p ≤ 0.05 como significativa. El análisis ción de los géneros entre cada gruestadístico se llevó a cabo a través po fue diferente, teniendo mayor del programa SPSS v.22. número de hombres el grupo con RCV (107 mujeres y 136 mujeres) III. RESULTADOS en comparación con el grupo sin En el estudio participaron 473 suRCV (163 mujeres y 67 hombres; jetos, de los cuales 270 fueron mup ≤ 0.05). Por otro lado, los vajeres y 203 hombres, los cuales se lores de presión arterial diastólica dividieron en dos grupos: 1) grupo (PAD) y sistólica (PAS) fueron difesin RCV (n = 230) y 2) grupo RCV rentes entre los grupos de estudio (n = 243). La edad promedio de (grupo sin RCV 72.4 ± 9.8 y 111.2 ± ambos grupos de estudio no fue di12.3 mmHg vs. grupo con RCV 75.9 ferente entre ellos (grupo sin RCV ± 10.1 y 116.9 ± 13.6 mmHg, res40.3 ± 12.5 vs grupo con RCV 41.9 pectivamente; p ≤ 0.05). ± 11.9 años; p > 0.05). La proporEn el cuadro 1 se muestran las ca192

www.conferenciasindromemetabolico.org

racterísticas antropométricas y bioquímicas de los grupos de estudio, en donde se puede observar que el grupo con RCV tiene valores mayores de todas las variables analizadas en comparación al grupo sin RCV (p ≤ 0.05). El análisis de correlación entre el índice TG/ HDL con los factores de RCV tradicionales y emergentes se muestra en el cuadro 2, en donde se observa que con la única variable que no mostró correlación fue con la edad.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

IV. CONCLUSIÓN Los resultados de este estudio muestran que los sujetos del grupo con índice TG/HDL > 3 presentan un desequilibrio metabólico y un mayor RCV en comparación a los sujetos con índice TG/HDL ≤ 3. Además, este estudio demuestra que el índice TG/HDL correlaciona tanto con los factores de RCV tradicionales como emergentes, por lo que se sugiere que este índice puede considerarse como un marcador que indica alteraciones metabólicas que están ampliamente relacionadas con el SM, la DT2 y las ECV. Además, debido a su fácil cálculo e interpretación la utilización de este índice en la práctica clínica permitiría una rápida detección de los sujetos en RCV.

V. BIBLIOGRAFÍA 1. OMS. Enfermedades Cardiovasculares. Nota descriptiva. En: http://www.who.int/mediacentre/factsheets/fs317/es/. Accesado: Enero 25 de 2015. 2. OMS. Noncommunicable Diseases (NCD) Country Profiles. En: http:// www.who.int/ nmh/countries/mex_en.pdf?ua=1. Accesado: Junio 16 de 2014. 3. Terrados N, Valcárcel G, Venta R. Los nuevos factores de riesgo cardiovascular y la actividad física. Apunts Med Esport. 2010;45:201208. 4. Expert Panel on Detection, evaluation and Treatment of high blood cholesterol in Adults. Executive summary of the third report of the national cholesterol education program. JAMA. 2001;285:248697.

V3-N1 - 2016

5. Feryala C, Tarán M, Báez MC, and young adults. Pediatrics. Scribano MP, Balceda A, Moya M. 2013;131:e1082-e1090. Rol protagónico de nuevos biomarcadores asociados al riesgo cardiovascular. Sumario. 2013;42:1-10. 6. Da Luz PL, Favarato D, Faria-Neto JR Jr, Lemos P, Chagas AC. High ratio of triglycerides to HDL-cholesterol ratio predicts extensive coronary disease. Clinics. 2008;63:427-432. 7. Boizel R, Benhamou PY, Lardy B, Laporte F, Foulon T, Halimi S. Ratio of triglycerides to HDL cholesterol is an indicator of LDL particle size in patients with type 2 diabetes and normal HDL cholesterol levels. Diabetes Care. 2000;23:e1679-e1685. 8. Frohlich J, Dobiasova M. Fractional esterification rate of cholesterol and ratio of triglycerides to HDL-cholesterol are powerful predictors of positive findings on coronary angiography. Clin Chem. 2003;49:1873-1880. 9. Baez-Duarte BG, Sánchez-Guillén MC, Pérez-Fuentes R, Zamora-Gínez I, León-Chávez BA, Revilla-Monsalve C, et al. B-cell function is associated with metabolic syndrome in Mexican subjects. Diabetes Metab Syndr Obes. 2010; 3:1e9. 10. Maruyama C, Imamura K, Teramoto T. Assessment of LDL particle size by triglyceride/HDL-cholesterol ratio in non-diabetic, healthy subjects without prominent hyperlipidemia. J Atheroscler Thromb. 2003;10:186-191. 11. Urbina EM, Khoury PR, McCoy CE, Dolan LM, Daniels SR, Kimball TR. Triglyceride to HDL-C ratio and increased arterial stiffness in children, adolescents www.conferenciasindromemetabolico.org

193


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES DE RIESGO EN DIABÉTICOS TIPO 2 QUE INFLUYEN EN EL CONTROL GLUCÉMICO EN LA UMF 51 Mora-Hernández Celina1, Llerenas-Parra Dinora Judith2, Serrano-Garzón Esther3, Frías-Mora Rigoberto4 RESUMEN. a Diabetes Mellitus afecta cerca de 8-10% de la población mundial y constituye una de las primeras causas de consulta en los servicios de cuidado primario. Aproximadamente 97 % de los casos corresponden a Diabetes tipo 2, considerada el tercer problema de salud pública más importante en el mundo. Los factores de riesgo como hipertensión, tabaquismo, obesidad, estrés y desinformación, así como la dinámica familiar está relacionado al descontrol metabólico; y su incidencia es mucho menor si se abordan desde una perspectiva que incluya el problema en el contexto familiar, puesto que las alteraciones de la vida familiar son capaces de provocar desequilibrio emocional y descompensación en el estado de salud de las personas. Existen evidencias documentadas de que, cuando una persona presenta algún tipo de enfermedad crónica como diabetes o hipertensión, la evolución y respuesta al tratamiento depende en buena medida del funcionamiento de la familia. El interés por el estudio sistemático y científico de la familia se debe en gran medida al enfoque ecológico del proceso de salud y enfermedad con el cual el individuo deja de ser visto como ente exclusivamente biológico y cobran

L

194

www.conferenciasindromemetabolico.org

interés los factores psicológicos y sociales, muchos de los cuales se generan en la propia familia y afectan de una u otra forma la salud del individuo. Algunos estudios destacan el papel preponderante de la familia, e incluso afirman que la mayoría de los enfermos crónicos recibe y prefiere los cuidados y el apoyo de esta fuente más que de cualquier otra. En el control del paciente diabético intervienen variables psicosociales que influyen en las fluctuaciones de la glucemia. El paciente percibe su enfermedad como un factor que atenta contra la estabilidad de su familia y a menos que el ambiente familiar cambie para apoyarlo, gradualmente declina su nivel de adherencia terapéutica. La Diabetes es una enfermedad crónico degenerativa, con pronóstico poco favorable entre la población mexicana, pues en ella influyen factores tanto sociales y heredo familiares que pueden favorecer la aparición de este padecimiento en la población. La Organización Mundial de la Salud (OMS), estima que a nivel mundial, existen 250 millones de personas con esta enfermedad y considera que más de 300 millones están

en riesgo de presentarla; además plantea que 95% del tratamiento de un paciente diabético recae directamente en él. Además de ser la principal causa de atención médica en consulta externa y una de las principales de hospitalización. La presencia de Diabetes tipo 2 implica la existencia de un antecedente heredofamiliar, mismo que, puede ser favorecida por hábitos alimenticios inadecuados, sedentarismo y sobrepeso. Se considera un problema de salud pública a nivel mundial, el aumento de las personas afectadas por Diabetes Mellitus 2 se debe a varios factores: • El crecimiento de la población • El envejecimiento de la población, la diabetes es más común en personas mayores; sin embargo debido a diferencias demográficas, en países ricos la diabetes predomina arriba de los 60 años y en los países en vías de desarrollo la edad está entre los 40 y 60 años. • La urbanización, asociada a cambios alimentarios y de un estilo de vida más sedentario • La epidemia de obesidad, derivada de mayor prosperidad y

Residente de Segundo grado de Medicina Familiar Médico Familiar egresada 3 Coordinador Clínico de Educación e Investigación en Salud, Unidad de Medicina Familiar No. 51, Guadalajara, Jalisco, IMSS 4 Coordinador Clínico de Educación e Investigación en salud UMF 52, Guadalajara, Jalisco, IMSS. 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

reducción de la actividad física. América Latina no es la excepción, estimándose que de 13.3 millones de pacientes con diabetes en el año 2000 esta cifra aumentarán a unos 33 millones para el año 2030 lo que representa un incremento de 148%. En caso de México, se estima de 6.8 millones de afectados aumentara a 11.9 millones con un incremento de 175%. II. OBJETIVO Evaluar los Factores de riesgo en Diabéticos tipo 2 que influyen en el control glucémico en la UMF 51.

III. MATERIAL Y MÉTODOS Se realizó un estudio con diseño analítico transversal retrospectivo, el universo fueron Diabéticos tipo 2, que acudieron a cita por consulta externa de Medicina Familiar de la UMF 51, en el año 2012-2013 un total de 229 pacientes del cual se formaron 2 grupos de pacientes diabéticos tipo 2 controlados= 79, descontrolados 159. Se obtuvo información por expedientes electrónicos glucemias, presión arterial, colesterol, IMC, triglicéridos. Los criterios de inclusión son pacientes con Diabetes Mellitus tipo 2 más de 1 año mayores de 18 años. Las variables se les realizo estadística descriptiva, con medidas de tendencia central así como para la variable dependiente: serán el control glucémico y variable independiente son los factores de riesgo: colesterol, presión arterial, IMC, triglicéridos; utilizando Chi Cuadrada y medidas de asociación OR. Para las variables intervinientes como gé-

nero, estado civil, escolaridad tipo cualitativas se utilizara inferencia con X2 y la edad como variable escolaridad se utilizara U de Mann Witnhey.

IV. RESULTADOS El género femenino (64%, n=146) a comparación del masculino (36%, n=83), con una p=0.023 siendo estadísticamente significativo y una OR 1.94. El control de triglicéridos se muestra controlados (61.6%, n=141) y descontrolados (38.4%, n=88), con una p= 0.008, estadísticamente significativo, con OR 2.18. En control de presión arterial los pacientes controlados (94.3%, n=216) y descontrolados (5.7%, n=13), con un p= 0.014, siendo estadísticamente significativo, con OR 1.08. Las demás variables socio demográficas y factores de riesgo no obtuvo significancia estadística. En ninguna variable hubo diferencia entre grupos. V. CONCLUSIONES En relación a la edad se obtuvo como media de 64 años y mediana de 65 años, la distribución de género el sexo femenino fue de mayor porcentaje, siendo estadísticamente significativo, el estado civil represento en mayor porcentaje estar casado, la escolaridad la primaria represento el mayor porcentaje, el control de colesterol represento un gran porcentaje en buen control del mismo, el control de triglicéridos los pacientes se encontraron en buen control del mismo siendo esto estadísticamente significativo, el índice de masa corporal demostró la Obesidad como

V3-N1 - 2016

mayor prevalencia, el control de la presión arterial se encontró en buen control en mayor porcentaje, siendo esto estadísticamente significativo. El tiempo de evolución de la DM2 fueron los pacientes de más de 10 años de evolución en mayor porcentaje. A pesar de encontrar 3 variables estadísticamente significativo como fue el género, el control de triglicéridos y el control de la presión arterial, que si influyen en el control glucémico, mas no represento esto diferencia entre grupos. Esto concluye que las variables si influyen en el control glucémico, mas no hay diferencia entre grupos, ya que tanto el grupo 1 controlados y grupo 2 descontrolados, obtuvieron porcentajes similares en la prevalencia de estas variables. Se comprueba la hipótesis nula donde si existen factores de riesgo que influyen en control glucémico.

VI. BIBLIOGRAFÍA 1. Estadísticas a propósito del día mundial de la diabetes. INEGI. 2010. 2. Guía de Práctica Clínica (GPC). Diagnóstico y tratamiento de Diabetes Mellitus tipo 2. Actualización 2012. 3. Lacre, A, Peralta, C. Tamizaje de Diabetes Mellitus tipo 2 en atención primaria. AMC, 2008: 48 (1), 4. Prevalencia de diabetes Mellitus tipo 2 y factores asociados en la población geriátrica en un hospital general de norte de México. Gaceta Médica de México. 2012;148l 5. American Diabetes Assowww.conferenciasindromemetabolico.org

195


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

ciation. Executive Summary: Standards of Medical Care in Diabetes 2013. Diabetes Care. 2013;36 (1):S4-S10. 6. Salcedo, R.A, Alba, GB et al. Genero y control de diabetes Mellitus tipo 2 en pacientes del primer nivel de atención. Rev Med Inst Mex Seguro Soc 2008; 46 (1): 7381. 7. Campos NI, González CA, Barquera S. Factores de riesgo cardiovascular asociados a obesidad y descontrol glucémico en adultos con diabetes mellitus. Rev Med Hosp Gen Méx 2012;75(1):14-23. 8. Barrot, P.J, González, SA. Actualización de los principales problemas de salud. Diabetes Mellitus tipo 2. AMF. 2013. 9. Shani, M, et al. Characteristics of Diabetics with poor glycemic control who achieve good control. JABFM. 2008. 10. Alba, LE, Bastidas, C. Prevalencia de control glucémico y factores relacionados en pacientes con Diabetes Mellitus tipo 2 del Hospital Universitario de San Ignacio, Bogotá, Colombia. Gac Méd Méx. 2009: 145 (6). 11. Hernandez RA, Elnecavé OA, Huerta UN, et al. Análisis de una encuesta poblacional para determinar los factores asociados al control de la diabetes mellitus en México. Salud Pública de México. 2011: 53 (1). 12. Mejía, MJ. Asociación de factores de riesgo con el descontrol metabólico de Diabetes Mellitus, en pacientes de la clínica Oriente del ISSSTE. Revista de Especialidades Médico-Quirúrgicas. 2007: 12 (2). 196

www.conferenciasindromemetabolico.org

13. Rodriguez MA, Cañas AO, Mina DM. La edad como factor de riesgo cardiovascular en pacientes diabéticos en la Región Costa de Chiapas, México. Higiene y Sanidad Ambiental. 2013:13 (4). 14. Méndez LD. Disfunción Familiar y control del paciente diabético tipo 2. Rev Med IMSS 2004; 42 (4): 281-284. 15. Concha, TM. Funcionalidad Familiar en pacientes diabéticos e hipertensos compensados y descompensados. Theoria, 2010: 19 (1). 16. Reyes, S, Ortega, K, et al. Funcionalidad familiar y estilos de vida saludables. Asentamiento humano Nuevo Paraíso distrito de Pativilca, 2009. Rev. Aporte Santiaguino. 2010; 3(2): 214-221. 17. Guerrero AM, Padierna LJ. Descontrol metabólico en diabetes tipo 2. Factores del paciente y del médico. Rev Med Inst Mex Seguro Soc 2011; 49 (4): 419-424. 18. Avila JL, Ceron OD, Ramos HR, et al. Asociación del control glicémico con el apoyo familiar y el nivel de conocimientos en pacientes con diabetes tipo 2. Rev Med Chile 2013; 141: 173-180.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA DE SOBREPESO Y OBESIDAD EN ADOLESCENTES Y SU RELACIÓN CON EL DESARROLLO PUBERAL Dra. Ileana Patricia Hernández Salinas1,2, Dra. Raquel Goytia Acevedo1, Dra. María Aurora Maravilla Domínguez1 ABSTRACT Background: There is evidence that subjects with greater weight, begin their pubertal development in earliest stages of life, compared to those subjects of the same sex, but with less weight. Objective: To determine the prevalence of overweight and obesity in adolescents aged 11 to 15 years and correlated to Tanner stages. Methodology: A Cross-sectional study in 333 subjects aged range of 11 to 15 years, of which BMI was obtained and correlated with Tanner stage. Results: The combined prevalence of overweight and obesity was 45%, 34% and 27% for Tanner I, II and III, respectively. Conclusions: A minor Tanner stage is associated with higher rates of overweight and obesity. KEYWORDS: overweight, obesity, BMI, Tanner.

I. INTRODUCCIÓN ctualmente las enfermedades crónico-degenerativas se encuentran entre las causas principales de muerte en nuestro país. Estas altas tasas de morbi-mortalidad coinciden con el rápido incremento de las tasas de sobrepeso y obesidad. (1) El índice de masa corporal (IMC), es el indicador antropométrico más práctico para realizar el diagnóstico de sobrepeso u obesidad. (2) A lo largo de los últimos 150 años la pubertad se ha ido iniciando a edades cada vez más tempranas (3), este adelanto puberal se ha atribuido al incremento en la prevalencia de obesidad. Por ello, se ha propuesto la existencia de un peso crítico como determinante del desarrollo y mantenimiento de la pubertad. (4) Los cambios en los caracteres sexuales secundarios son categorizados en cinco estadios siguiendo el sistema de Tanner, (4), esta escala asigna una madurez sexual desde I (prepube-

A

ral), hasta V (adulto), siendo II, III, IV fases evolutivas. (3) Dado que el inicio de la pubertad se asocia a un incremento del peso y que en la actualidad se estima que la prevalencia de sobrepeso y obesidad ha incrementado afectando a sujetos cada vez más jóvenes, nosotros nos propusimos evaluar la relación entre el sobrepeso y la obesidad medidas con el IMC en una población adolescente y relacionarla con el estadio puberal.

número de registro L2013-06-01. El IMC se clasificó utilizando una tabla normativa percentil de IMC internacional para niños y adolescentes ajustada para el sexo y la edad (5,6). El IMC de los sujetos se consideró bajo si estaba por debajo de la percentila 74; normal, entre las percentilas 75 a 89; sobrepeso, entre las percentilas 90 a 96; y obesidad por encima de la percentila 96. Los 5 estadio de Tanner se agruparon de la siguiente manera: Tanner I, (agrupo a los estadios I y II; Tanner II incluyó a los estadios III y IV y finalmente Tanner III, se integró por Tanner V. Los estadios de Tanner se asignaron arbitrariamente a cada sujeto considerando exclusivamente su edad y sexo. Para el sexo masculino un sujeto fue considerado Tanner I si su edad era ≥11 y ≤ 12.9 años, Tanner II si su edad era ≥ 13 y ≤14.9 años o Tanner III si su edad era ≥ 15 años. Para el sexo femenino un sujeto fue considerado Tanner I si su edad era ≥10 y 11.9 años, Tanner II si su edad era ≥ 12 y ≤ 13.9 años o Tanner III si su edad era ≥ 14.

II. METODOLOGÍA Se realizó un análisis secundario de un estudio diseñado para reconocer la prevalencia de sobrepeso y obesidad en adolescentes de educación media. Se analizaron datos de peso, talla y edad. El protocolo fue aprobado por el comité III. RESULTADOS de investigación de la Universidad Se analizaron a 333 sujetos Juárez del Estado de Durango Fa(100%), con una edad promedio cultad de Ciencias de la Salud con y DE de 12.95 ± 0.69 años; de los 1

Profesor Universidad Juárez del Estado de Durango. Facultad de Ciencias de la Salud

2

Hospital General de Gómez Palacio, Durango, SSA

www.conferenciasindromemetabolico.org

197


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

cuales 168 sujetos fueron del sexo masculino (51%) y 165 fueron del sexo femenino (49%). El IMC promedio del grupo completo fue de 21.49 kg/m², ubicándose 21 (6%) sujetos en bajo peso; 195 (59%) sujetos en peso normal; 81 (24%) sujetos en sobrepeso y 36 (11%) sujetos en obesidad. En este estudio 65 (20%) sujetos fueron clasificados en Tanner I; 213 (64%) sujetos en estadio Tanner II y en el estadio Tanner III se encontraron 55 (16%) sujetos. En el Estadio I, la distribución del IMC fue la siguiente: 36 (55%) sujetos fueron normales, el IMC promedio y DE fue de 18.95 ± 1.33 kg/ m²; 13 (20%) sujetos exhibieron sobrepeso, con un IMC promedio y DE de 23.28 ± 0.80 kg/m²; 16 (25%) sujetos mostraron obesidad, con un IMC promedio y DE de 28.47 ± 3.61 kg/m². En el Estadio II, 16 (8%) sujetos exhibieron bajo peso, con IMC promedio y DE de 15.46 ± 0.64kg/m²; 124 (58%) sujetos fueron normales, con un IMC promedio y DE de 19.34 ± 1.60 kg/ m²; 56 (26%) sujetos cursaban con sobrepeso con un IMC promedio y DE de 24.49 ± 1.40 kg/m²; y 17 (8%) sujetos exhibieron obesidad, con un IMC promedio y DE de 29.40 ± 2.44 kg/m². En el estadio III, 5 (9%) sujetos presentaron bajo peso, con un IMC promedio y DE de 15.60 ± 0.86 kg/m²; 35 (64%) sujetos fueron normales, con un promedio de IMC y DE de 20.37 ± 1.75 kg/m²; 12 (22%) sujetos mostraban sobrepeso, con un IMC promedio y DE de 26.20 ± 1.35 kg/m²; 3 (5%) sujetos se exhibieron obesidad, con un IMC prome198

www.conferenciasindromemetabolico.org

dio IMC y DE de 31.03 ± 2.70 kg/ m². En la tabla 1 se muestran las categorías de IMC de acuerdo a su estadio de Tanner y en la Gráfica 1, se muestran las categorías de IMC en cada Estadio de Tanner. Los porcentajes de sobrepeso y obesidad en Tanner I fueron de 45%, en Tanner II de 34% y en Tanner III de 27%. IV. CONCLUSIONES Un menor estadio de Tanner se asocia con porcentajes de sobrepeso y obesidad mayores.

V. BIBLIOGRAFÍA 1. Lopez-Alarcon MG, Rodríguez-Cruz M. Epidemiology and genetics of overweight and obesity. Mexico in the world context. Bol Med Hosp Infant Mex. 2008; 65: 421-430. 2. Piazza N. La circunferencia de cintura en niños y adolescentes. Arch. Argent. Pediatr. 2005; 103(1): 5-6. 3. Hidalgo-Vicario M.I, Guemes-Hidalgo M. La tormenta hormonal del adolescente. Sietedias medicos. aulamayo. 2013: 1-10. 4. Barrio-Castellanos R, Carcavilla-Urqui A, Martín-Frías M. Pubertad precoz y retrasada. Inf Ter Sist Nac Salud. 2006; 30(4): 95-107. 5. Cole TJ, Flegal KM, Nicholls D, Jackson A. Body mass index cut off to define thiness in children and adolescents: international survey. BMJ 2007; 1-8. 6. Cole TJ, Bellizzi MC, Flegal KM, Dietz WH. Establishing a standard definition for child overweight and obesity worldwide: international survey. 2000; 320: 1-6

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

199


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

MALNUTRICIÓN POR DEFICIT Y POR EXCESO EN ESCOLARES DE ORIGEN ME’PHAA DEL ESTADO DE GUERRERO QBP. Marisol Zeferino-Sanchez1, Dr. Eneas Alejandro Chavelas-Adame1, Dra. Natividad Castro-Alarcón2, Dra. Amalia Vences-Velázquez2, Dra. Isela Parra-Rojas2, Dra. Iris Paola Guzmán-Guzmán2 ABSTRACT. The aim of this study was to determine the nutritional status of school children Me’phaa from Guerrero, Mexico. Methods. A cross-sectional study was carried out in a population of 221 children of Me’phaa origin from Guerrero. The nutritional status was defined by Waterlow criteria and WHO guidelines (height/ age, weight/age). Statistical analysis was performed using STATA v.12.0 software. Results. The prevalence of malnutrition by deficit (undernutrition) was 64%, mainly of type worsened chronic. The prevalence of malnutrition by excess (overweight and obesity) was showed in 15% of the children, in a ratio of girls to boys 2:1. Conclusion. Although the social programs implemented in indigenous population, the prevalence of malnutrition by deficit is high in school-age children Me’phaa. Poverty favors the consumption the foods low cost and energy-dense, increasing the prevalence of overnutrition in ethnic groups. KEYWORDS: Malnutrition, school children, population Me’phaa.

I. INTRODUCCIÓN os problemas nutricionales asociados a la carencia o exceso son frecuentes en la población mexicana, encontrando ambos panoramas en el mismo país, región, localidad, grupo étnico, género, etc. En la región sur de México, se encuentran localizadas etnias indígenas con pobreza extrema y elevada prevalencia de desnutrición. El estado de Guerrero cuenta con cuatro principales grupos étnicos; Tlapaneco (Me´phaa), Mixteco, Náhuatl y Amuzgo. La pobreza, el poco acceso a alimentos nutritivos, la carencia de servicios básicos y el bajo grado de escolaridad se relacionan con la alta prevalencia de desnutrición, así como también la comercialización de alimentos de bajo valor nutricio y alto contenido calórico se relaciona con la presencia de obesidad en la población indígena. El objetivo de este estudio fue deter-

L

200

www.conferenciasindromemetabolico.org

minar el estado nutricio en niños en edad escolar de origen Me’phaa del estado de Guerrero.

II. METODOLOGÍA Se realizó un estudio de tipo transversal en una población de 221 niños en edad escolar; 106 (47.65%) niños y 115 (52.04%) niñas, de origen Me’phaa del Estado de Guerrero. El estado nutricional de los menores se evaluó mediante los criterios de Waterlow. Utilizando como referencia las guías de interpretación combinada de la OMS (Talla/Edad, Peso/Edad). El análisis estadístico se realizó empleando el software STATA v12.0. Valores de p<0.05, fueron considerados estadísticamente significativos.

III. RESULTADOS El promedio de edad en los escolares fue de 10 años (6-12 años), con una talla, peso e IMC promedio de 1.28 mts, 26.7 kg, y 16.6 kg/ m2, respectivamente. Se encontró una prevalencia de mal nutrición por déficit de 64%, predominando la desnutrición de tipo crónica agudizada. La prevalencia de desnutrición encontrada en la población Me’phaa es mayor a la reportada en la encuesta nacional de salud y nutrición por entidad federativa e incluso mayor a la reportada en otros grupos étnicos de Sudamérica (Avila,1990. Monarrez y Martínez, 2000, Domarco, et al, 2001, Huaman y Valladares 2006). Bustos en el 2009, refiere que una población con mayor vulnerabilidad social presenta el doble de probabilidad de padecer desnutrición y disminuye la prevalencia de obesidad. La prevalencia de malnutrición por exceso (sobrepeso y/u obesidad) fue de 15%, en una proporción de 2:1 en niñas vs niños. Delgado et al en el 2015, observó en escolares chilenos, una prevalencia mayor de desnutrición y sobrenutrición en niñas. Diferente a nuestro estudio, Villalobos et al en el 2012, en

Unidad Académica de Ciencias Químico Biológicas. Universidad Autónoma de Guerrero UAGro CA-120 Unidad Académica de Ciencias Químico Biológicas. Universidad Autónoma de Guerrero 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

una población de la etnia indígena Wayuú de Venezuela, encontró un mayor grado de desnutrición en niñas y un porcentaje mayor de sobrenutrición en niños. La prevalencia de mal nutrición se asocia a diversos factores sociodemográficos y socioculturales, que pueden ser determinantes en la prevalencia reportada para cada grupo poblacional.

IV. CONCLUSIONES A pesar de los programas sociales implementados en población de origen indígena, existe una prevalencia elevada de mal nutrición por déficit en la población infantil en edad escolar de origen Me´phaa del Estado de Guerrero, así como también el acceso a alimentos hipercalóricos de bajo costo incrementa la prevalencia de mal nutrición por exceso. La malnutrición por déficit y por exceso afecta a la población en pobreza y condiciona su crecimiento, desarrollo y presencia de comorbilidades en etapas tempranas de la vida o vida adulta.

V. BIBLIOGRAFÍA Gutiérrez JP, et al. Encuesta Nacional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México: Instituto Nacional de Salud. Pública (MX), 2012. P113. Gutiérrez JP. Instituto Nacional de Salud Pública. Encuesta Nacional de Salud y Nutrición 2012. Resultados por entidad federativa, Guerrero. Cuernavaca, México: Instituto Nacional de Salud. Pública, 2013. P.84. Huamán, L. Estado Nutricional Y

V3-N1 - 2016

Características del Consumo Alimentario de la Población Aguaruna. Amazonas, Perú 2004. Rev Perú Med Exp Salud Pública 2006. 23,1. Bustos, P. et al. Poverty and indigenous origin as risk factors of nutritional problems among children who enroll in school. Salud pública de México, 2009. 51(3), pp.187– 93. Dommarco, JÁR. et al. Evidencia para la política pública en salud Desnutrición en México : intervenciones hacia su erradicación. ENSANUT Encuesta Nacional de Salud y Nutrición 2012, p.4. Pedro Delgado Floody, et al. Niveles de obesidad, glicemia en ayuno y condición física en escolares chilenos Nutr Hosp. 2015;31(6). Ramos-Arellano LE, et al. Body fat distribution and its association with hypertension in a sample of Mexican children. J Investig Med, 2011. 59(7), pp.1116–1120. Villalobos-colina, et al. Situación Nutricional y Patrones Alimentarios de Niños Indígenas en Edad Escolar de la Etnia Wayuú. Antropodo, 2012. 28, pp.87–95. Chávez, Z.C. et al. Alta prevalencia de desnutricion en la poblacion infantil indígena mexicana. Encuesta nacional de nutrición 1999. Revista Española de Salud Publica, 2003. 77(2), pp.245–255. Latinoamericana, S. Cambios En La Situacion Nutricional De Mexico 1990- 2000 Indice de Riesgo Nutricional por Municipio. 2003.

www.conferenciasindromemetabolico.org

201


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES DE RIESGO ASOCIADOS A COMORBILIDADES PERINATALES EN MUJERES CON DIABETES GESTACIONAL QBP. Ilse Adriana Gutiérrez-Pérez1, Dr. Julio Cesar García-Polanco2, Dr. Adiel Molina-Bello2, M en C. Cesar Alberto Morales-Aponte1, Dra. Mónica Ramírez-Ruano1, Dra. Iris Paola Guzmán-Guzmán1 ABSTRACT. The aim of this study was determined the presence of risk factors associated to perinatal morbidities in women with Gestational Diabetes Mellitus (GDM). Methodology. Study carried out in 93 pregnant women with an age 6.5 ± 31.5 years, diagnosed and treated at the Hospital de la Madre y el Niño Guerrerense (HMNG) of Chilpancingo, Guerrero, Mexico. The clinical expedient was analyzed and sociodemographic characteristics and management obstetric were determined. Statistical analysis was performed using STATA software v.12.0. Results. In this study hypertensive disease during pregnancy was associated with diet+metformin treatment (OR = 3.33, p = 0.029) and poor hygiene (OR= 2.7, p=0.03), while that preeclampsia with to family history of hypertension (OR = 6.25, p=0.008). In neonates the main factors associated with fetal death were the presence of maternal hyperglycemia ≥130 mg/ dL (OR =11.5, p=0.03), bleeding volume > 500 mL (OR= 6.21 p=0.01), glycosuria (OR = 4.95, p=0.05) and maternal BMI <27 kg/m2. Conclusion. Risk traditional factors and metabolic parameters and clinic are associated with the presence of perinatal morbidities in women with GDM. KEYDWORDS: Risk factors, gestational diabetes, perinatal morbidity.

I. INTRODUCCIÓN a DMG es una enfermedad crónica y degenerativa que ocurre durante el embarazo y predispone el riesgo de complicaciones materno-fetales. Además, la presencia de factores presentes en las gestantes condiciona al estado de salud del neonato. El objetivo de este estudio fue determinar la presencia de los factores asociados a comorbilidades perinatales en mujeres con DMG.

L

II. METODOLOGÍA Se realizó un estudio transversal que incluyó a 93 mujeres gestantes con una media de edad de 31.5±6.5 años, diagnosticadas con DGM y atendidas en el Hospital de la Madre y el Niño Guerrerense (HMNG), de Chilpancingo, Guerrero, México. Se analizaron los ex202

www.conferenciasindromemetabolico.org

pedientes clínicos de las pacientes atendidas durante el periodo 2014-2015, obteniendo características sociodemográficas, clínico-metabólicas y de tratamiento, así como las comorbilidades peritales que se presentaron. El análisis estadístico se realizó utilizando el software STATA v.12.0. Valores de p<0.05 fueron considerados estadísticamente significativos.

clamsia fue el antecedente familiar de hipertensión (OR=6.25, p=0.008). Rowan et al., (2008) reportaron que el uso de la metformina en pacientes con DGM no causa complicaciones materno-fetales, sin embargo, en el presente estudio el tratamiento de dieta+insulina resultó protector para el desarrollo de enfermedad hipertensiva del embarazo y preclamsia. En los neonatos los principales factores asociados con óbito fetal fueron la presencia de hiperglicemia materna ≥130 mg/dL (OR=11.5, p=0.03), presencia de un volumen de sangrado >500 mL (OR= 6.21 p=0.01), glucosuria (OR= 4.95, p=0.05) e IMC materno <27kg/ m2. Con referente a los hallazgos presentados en este estudio, de manera similar Cusimano et al., (2014) reportaron que algunas complicaciones en pacientes con DMG son la intoleracia a la glucosa, preclamsia, embarazo pretérmino e hipertensión, así como la presencia de síndrome metabólico. Por lo que estos factores pueden condicionar la salud del binomio madre-neonato.

III. RESULTADOS En este estudio se observó que los factores de riesgo asociados a enfermedad hipertensiva del embarazo son el tratamiento con dieta+metformina (OR=3.33, IV. CONCLUSIÓN p=0.029) y mala higiene (OR=2.7, Factores tradicionales de riesgo p=0.03), mientras que para preLaboratorio de Investigación en Obesidad y Diabetes de la Unidad Académica de Ciencias Químico Biológicas. Universidad Autónoma de Guerrero 2 Hospital de la Madre y el Niño Guerrerense de Chilpancingo, Guerrero, México 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

y clínico-metabólicos en mujeres con DMG se asocian con la presencia de comorbilidades perinatales, por lo que es importante su consideración en el manejo del embarazo para disminuir la comorbilidad en el binomio madre-neonato. V. BIBLIOGRAFÍA Cussimano M. C., Pudwell J., Roddy M., et al., 2014. The matemal Health Clinic: an initiative for cardiovascular risk identification in women with pregnancy related complications. Am J Obstetric Gynecol, 210:438.e1-9. San Martín-Herrasti J. M., Alcázar-Álvarez L. S., Serrano-Berrones M. A., Tirado-Chávez J., Castro-Herrera G. A. 2014. Metformina y diabetes gestacional. Rev Esp Med Quir, 19: 347-355. Rowan J. A., Haya W. M., Gao W., Battin M. R., Moore M. P. 2008. Metformin versus insulin for the treatment of gestational diabetes. N Engl J Med, 358: 2003-2015

www.conferenciasindromemetabolico.org

203


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES RELACIONADOS AL ESTADO DE NUTRICIÓN EN LOS ALUMNOS DE INGRESO A LA CARRERA DE MÉDICO CIRUJANO DE LA FACULTAD DE ESTUDIOS SUPERIORES ZARAGOZA. UNIVERSIDAD NACIONAL AUTÓNOMA DE MÉXICO M.C. Gabriela Barajas Duran, Dra. María Luisa Ponce López, Mtra. Irma Araceli Aburto López RESUMEN Los problemas de malnutrición en nuestro país son factores determinantes para enfermedades crónicas. El objetivo del estudio fue. Identificar los principales factores de riesgo, antecedentes familiares, patológicos y estilos de vida que modifican el estado nutricional en los alumnos de ingreso a la carrera de médico cirujano de la Facultad de estudios superiores Zaragoza UNAM. . Material y métodos. Se realizó un estudio descriptivo, trasversal, observacional en 310 jóvenes de 17 a 22 años que ingresaron a la Carrera de Médico Cirujano de la Facultad de Estudios Superiores Zaragoza. UNAM, 2016. Se realizo una historia clínica, mediciones antropométricas con parámetros de referencia de la OMS. Resultados: Los antecedentes heredofamiliares presentes fueron a hipertensión arterial, la diabetes mellitus tipo 2 y a la obesidad en 5%, los personales patológicos obesidad 43%, reflujo esofagogastrico 38%, insuficiencia venosa periferica con 8%, enfermedad tiroidea 6% y 4% con hipertension arterial. El IMC, muestra normal (el 65%), con desnutricion 5% de la poblacion (2.5%) para ambos sexos ) sobrepeso al 19%, predominio el sexo femenino ya que ocupa el 11% y el 8% el sexo masculino, obesidad grado 1 con el 10% (6% mujeres y 4% hombres) y 1% obesidad grado 2. Realizan actividad fisica en forma ocasional y tiene una dieta regular. Conclusiones. Prevenir los problemas de malnutricion en etapas de la vida a temprana edad podria indidir los la aparcion de enferemedades cronica. PALABRAS CLAVE: estado de nutricion, malnutricion, obesidad

I. INTRODUCCIÓN os problemas de nutrición en el mundo. Al respecto, se ha reportado que dos terceras partes de la población a escala mundial habitan en lugares donde la obesidad se relaciona con otras enfermedades que causan la muerte, y se ha referido que el 44% de la mortalidad por diabetes está asociada con la obesidad, el 23% con cardiopatías isquémicas y la existencia de una variabilidad de entre el 7%, mientras que el 41% se relaciona con diferentes tipos de cánceres. De acuer¬do con información de la Organización Mu-

L 204

www.conferenciasindromemetabolico.org

ndial de la Salud (OMS, 2008), tan sólo con el aumento del Índice de Masa Corporal (IMC= Peso/Talla2) se incrementa la probabilidad de muerte asociada a enfermedades no transmisibles 5. La malnutrición proteinoenergetica (MPE), l carencia de vitamina A, los trastornos por carencia de yodo (TCY) y las anemias nutricionales-sobre todo por carencia de hierro- son los problemas nutriconales ás serios y de mayor prevalencia en México 1, 5. México y la nutrición

Esto va en función de la zona geográfica: ya que en los estados del sureste hay desnutrición y en el norte del país existe sobrepeso y obesidad; de las zonas de desarrollo: ya que en el campo existe desnutrición y en la ciudad se da el sobrepeso y obesidad del origen étnico; nuestros hermanos indígenas presentan los niveles más altos de desnutrición mientras que en aquellos individuos que no son indígenas por origen presentan sobrepeso u obesidad 3,4. Al respecto, los datos más recientes sobre el estado de nutrición de la población mexicana provienen de la Encuesta Nacional de Salud y Nutrición 2012, muestra que el grupo de los adolescentes, en los cuales el pro¬blema de la obesidad se ha agudizado hasta alcanzar a 1 de cada 10. En los adultos, 7 de cada 10 padecen sobrepeso y obesidad 1, 2. Los factores principales a los cuales se atribuyen las causas de mal nutrición han sido el aumento en el consumo de alimentos hipercalóricos, ricos en gra¬sas, sal y azúcar y pobres en vitaminas, minerales y fibra; así como el descenso en la ac¬tividad física originado por los modelos de urbanización y sedentarismo

Universidad Nacional Autónoma de México. Facultad de Estudios Superiores Zaragoza


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

de la población. Ello, sin dejar de lado algunos factores genéticos que la originan 4. Está establecido que si ambos padres son obesos el riesgo para la descendencia será de 69 a 80 %; cuando solo uno es obeso será 41 a 50 % y si ninguno de los 2 es obeso el riesgo para la descendencia será solo del 9 %. Se ha demostrado que mecanismos neurohormonales, epigenética, y microbiológicos pueden influir en el riesgo para la obesidad mediante la interacción con factores socioambientales 14, 15,16, 17. Para conocer el estado nutricional de una población, podemos recurrir a los indicadores directos e indirectos; los indicadores directos evalúan a los individuos y los indirectos permiten sospechar la prevalencia de problemas nutricionales 7,8 . El objetivo de este estudio fue Identificar los principales factores de riesgo, antecedentes familiares, patológicos y estilos de vida que modifican el estado nutricional en los alumnos de ingreso a la carrera de médico cirujano de la Facultad de Estudios Superiores Zaragoza de la Universidad Nacional Autónoma de México II. MATERIAL Y MÉTODOS Se realizó un estudio descriptivo, trasversal, observacional en 310 jóvenes de 17 a 22 años que ingresaron a la Carrera de Médico Cirujano de la Facultad de Estudios Superiores Zaragoza UNAM, 2016. Las variables se estudio; Independientes: Antecedentes heredofamiliares, antecedentes personales patológicos, hábitos de alimentación, actividad física.

Variables Dependiente: Estado de nutrición (Composición corporal La determinación del estado de nutrición de los fue por medio de técnicas antropométricas: peso, talla, índice cintura, índice cintura/ cadera y perímetro muñeca. Se realizó examen físico antropométrico utilizando como patrón de referencia los de la Organización Mundial de la Salud para índice de masa corporal e índice cintura,. Se considero para la recolección de información un cuestionario correlacionado con la historia clínica individual donde se consideraron antecedentes clínicos, signos vitales, antropometría, frecuencia de actividad física y frecuencia de alimentación. Previa estandarización para la toma de mediciones y aplicación del cuestionario, apegándose a las normas oficiales para este efecto. Previo consentimiento informado.

III. RESULTADOS La población estudiada comprendió (n=146) 63% y (n=84)37% hombres con un total de 230 alumnos, es estos resultados nos muestran el predominio del sexo femenino ertenecen dentro del rango de los menores de 20 años de edad, el 9% de los alumnos entre los rangos de 21-22 años de edad, y tan solo el 5% correspondentes a 19 alumnos son mayores de 23 años. Se encontró que entre los factores heredofamiliares relacionados al estado nutricional de los alumnos se encuentran entre los primeros lugares y encabezando la lista tenemos a tres muy comunes

V3-N1 - 2016

morbilidades en la actualidad: la hipertensión arterial, la diabetes mellitus tipo 2 y a la obesidad todas ellas correspondiéndoles dentro de nuestro estudio el 5 % referido de los alumnos, en segundo lugar nos refieren la presencia de insuficiencia venosa periférica y cáncer ambas con un 3%, siguiendo con infarto al miocardio, enfermedad tiroidea y reflujo gastroesofágico con un 2 %, y por último el antecedente de cálculo biliar al cual le corresponde el 1 %.(gráfico l) Entre los factores personales patologicos que se encontraron en primer lugar a la obesidad encabezando la lista con un 43%, seguido de la presencia de reflujo gastroesfagico con un 38%, en 3er lugar a la insuficiencia venosa periferica con 8%, enfermedad tiroidea 6% y por último 2 alumnos correspondiente al 4% con hipertension arterial. (gráfico ll) El IMC, muestra que la poblacion en estudio se encuentra dentro del rango de normal (el 65%), con desnutricion afectando al 5% de la poblacion (2.5%) para ambos sexos ) dentro de sobrepeso la cual corresponde al 19%, del cual hay predominio el sexo femenino ya que ocupa el 11% y el 8% el sexo masculino, parametros alarmantes es decir obesidad grado 1 con el 10% (6% mujeres y 4% hombres) y una cifra de un 1% obesidad grado 2 .(gráfico lll) Para la circunferencia muñeca se observo el 67%, siendo dentro de la constitucion clasificada como pequeña, el 25% correspondiente a constitucion mediana y por úlwww.conferenciasindromemetabolico.org

205


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

timo el 8% dentro del rango de constitución grande, relacionando nuevamente el predominio por las mujeres dentro todos los rangos. Los resultados de la circunferencia cintura la población 12% en riesgo elevado. Según los resultados dados por los encuestados, podemos decir que más de la mitad (53%) realiza de manera ocasional alguna actividad física, seguido de un 9% quien realiza casi siempre y un 3% siempre, sin embargo, observamos que el 35% no realiza ninguna, siendo esta cifra alarmante, ya que sabemos que la actividad física es un factor directo que modifica el estado nutricional. (gráfico IV) Los hábitos alimenticios de los alumnos, la ingesta de frutas y verduras en su dieta en 24 hrs fue el 26%, continuando con bebidas azucaradas19%, cereales y tubérculos con 16% , alimentos de origen proteico como carnes y huevo en un 14%, el resto se encuentra divido entre leche y derivados con el 9% al igual que con el consumo de grasas 9%, leguminosas 6%, y el 1% dentro de los alimentos clasificados como otros. IV. CONCLUSIONES 1) Entre los factores heredofamiliares principales fueron la hipertensión arterial, la diabetes mellitus tipo 2, obesidad y por último el antecedente de cáncer. 2) .Entre los antecedentes personales patologías por frecuencia la obesidad, seguido de la presencia de reflujo gastroesofágico, insuficiencia venosa periférica, enfermedad tiroidea y por ultimo 206

www.conferenciasindromemetabolico.org


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

con hipertensión arterial. 3) El estado de nutrición fue normal en la mitad de la población estudiada la población estudiada y la anormalidad se distribuyo ente los con sobrepeso y obesidad y desnutridos. Con predominio en sexo femenino, seguido de sobrepeso en el mismo y obesidad en grupo masculino, siendo presente la desnutrición en ambos grupos. 4) Mas de la mitad de los alumnos encuentados realizan de manera ocasional alguna actividad fisica.. 5) En general los hábitos alimenticios de los alumnos de la población estudiada son regulares pero conocen los principios relacionados al tema. 6) El atender los problemas de malnutrición en etapas temprana de la vida puede incidir en la prevención de enfermedades crónica de manera oportuna.

V. REFERENCIAS BIBLIOGRÁFICAS 1) Gutiérrez JP, Rivera DJ, Shamah LT, Villalpando HS, Franco A, Cuevas NL, et al. Encuesta Nacional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México. Instituto Nacional de Salud Pública.2012. 2) Shamah LT, Amaya CM, Cuevas NL. Desnutrición y obesidad: doble carga en México.rdu.2015; 16(5):1-14. 3) Jiménez AA, Gaona PE, Mejía RF, Gómez AL, Méndez GH, Flores AM. Consumption of fruits and vegetables and health status of Mexican children from the

National Health and Nutrition Survey 2012.Salud Pública Méx. 2014;56(2):103-112. 4) Black RE, Allen LH, Bhutta ZA, Caulfield LE, Onis MD,Ezzati M. Maternal and child undernutrition: global and regional exposures and health consequences. Lancet.2008;371: 243-260. 5) OMS (2003a). Informe sobre la salud en el Mundo 2003: forjemos el futuro. Ginebra, Organización Mundial de la Salud. OMS 6) National of Health Institute (NIH). [en línea].USA: National Heart, Lung and Blood Institute; ¿Qué riesgos implican el sobrepeso y la obesidad para la salud?. [citado 26 septiembre de 2012].Disponible en: www.nhlbi.nih.gov/ health spanish/health-topics/temas/obe/risk.html 7) Sarría A, Bueno M. Exploración del estado nutricional en el niño. Tratado de Endocrinología Pediátrica. 2a ed. Madrid. Díaz de Santos; 1997. 1135-1156. 8) Castillo HJ, Zenteno CR. Valoración del estado nutricional. Revista Médica de la Universidad Veracruzana. 2004; 4 (2): 29-35. 9) Gallardo WI, Buen AL. Mala nutrición en estudiantes universitarios de la Escuela de Dietética y Nutrición del ISSSTE. Rev Med UV. 2011: 6-11. 10) Gómez F. Desnutrición. Salud pública de México.2003;45(4):s576-s582. 11) Lopez A. Evaluación nutricional. Buenos Aires: Facultad de Medicina. Cátedra de Evaluación Nutricional.; 2015. 12) Díaz A, Gómez R. Alimentación, consumo y salud. Funda-

V3-N1 - 2016

ción La Caixa, 2008 13) Gracia AM. Qué y cuánto comer: tomando medidas frente a las sociedades obesogénicas. Salud colectiva. 2009; 5(3):363-376. 14) Lujan SA, Piat GL, Ott RA, Abreu GI. Obesidad infantil, la lucha contra un ambiente obesogénico. Revista de Posgrado de la VIa Cátedra de Medicina. 2010;(197):19-24. 15) Chavarria AS. Definición y criterios de obesidad. Nutrición Clínica.2002;5 (4):236-240. 16) Farre RR. Evaluación del estado nutricional (dieta, composición corporal, bioquímica y clínica). Manual práctico de nutrición y salud.2014:109-118 17) Latham MC. Nutrición humana en el mundo en desarrollo. FAO.2003;(29):58-83.

www.conferenciasindromemetabolico.org

207


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES DE RIESGO ASOCIADOS A INFARTO AGUDO A MIOCARDIO Y EVENTO VASCULAR CEREBRAL EN PACIENTES CON DIABETES MELLITUS 2 UMF 51 Yazmin Maria Bermudez Lopez1, Claudia Esqueda Guadalajara2, Esther Serrano Garzon3, Elsa Armida Gutiérrez Roman4 RESUMEN I. ANTECEDENTES a Enfermedad Cardiovascular (ECV) es un problema grave de salud pública, por ser la primera causa de morbimortalidad en todo el mundo. Cada año mueren más personas por ECV que por cualquier otra causa. Se calcula que en 2008 murieron por esta causa 17,3 millones de personas, lo cual representa un 30% de todas las muertes registradas en el mundo. 7,3 millones de esas muertes se debieron a la cardiopatía coronaria, y 6,2 millones a los Accidentes Vasculares Cerebrales (AVC). La OMS indica que a nivel mundial existen más de 366 millones de personas con diabetes el 8.3% de la población mundial. En México las enfermedades cerebrovasculares, isquémicas del corazón y la diabetes se encuentran entre las principales causas de muerte en todos los estados. La diabetes por si sola se considera un factor de alto riesgo cardiovascular, que aunado a otros factores generan las primeras 5 causas de muerte y hospitalizaciones. Las complicaciones cardiovasculares atribuibles a la arterioesclerosis son responsables del 70 a 80% de todas las causas de muerte en los

L

208

www.conferenciasindromemetabolico.org

diabéticos. Además que gran parte del presupuesto se destina a esta enfermedad, las complicaciones y secuelas que produce. En muchos estudios se ha confirmado que si se controlan los otros factores de riesgo cardiovascular, además de la glucemia en pacientes con diabetes, esto disminuye la incidencia de eventos isquémicos.

II. MATERIAL Y MÉTODOS Se realizó un estudio transversal analítico, en la UMF 51 del IMSS Guadalajara, Jalisco, con una muestra de 172 pacientes con diabetes mellitus 2, de los cuales se buscó quienes presentaron enfermedad cardiovascular (infarto agudo al miocardio y evento vascular cerebral) y los que no han presentado la enfermedad. Se revisaron el expediente electrónico para conocer qué factores de riesgo se asocian a que presenten IAM o EVC, incluyendo datos sociodemográficos como son sexo, edad, ocupación y estado civil. Se realizó estadística descriptiva para todas las variables y X2 para las variables dependiente e independientes. Dentro de los cri-

terios de inclusión fueron ser diabéticos tipo 2, ambos géneros, ser de 40 años o mas, con más de 10 años de evolución. III. RESULTADOS El total de la muestra fue de 172 pacientes con diabetes mellitus tipo 2, con rango de edad de 40 a 70 años. El 87% no presenta enfermedad cardiovascular y el 13% si la presenta De los cuales 9 presentaron IAM y 14 EVC. Se encontró significancia estadística en la asociación de enfermedad cardiovascular con edad con una p de .010, hipertensión arterial con un p de .020 y triglicéridos con p 0.027 las cuales fueron significativas ya que él valo de p fue de (.05)Se encontró que se tiene mayor probabilidad de presentar enfermedad cardiovascular siendo del sexo femenino, obeso, presentar colesterol mayor a 200 mg/dl, triglicéridos mayores a 150 mg/dl, así como tener menos de 10 años de evolución de la diabetes mellitus 2, independientemente de su control glucémico.

Residente de primer año en Medicina Familiar Unidad de medicina familiar Núm. 51, IMSS, Guadalajara, Jalisco. Médico Familiar de base en Unidad de medicina familiar Núm. 51, IMSS, Guadalajara, Jalisco. Médico Familiar de base, Medicina de Urgencias. Coordinadora de Educación e Investigación en Salud, UMF 51, IMSS Médico familiar de base en Unidad de medicina familiar Núm. 51, IMSS, Guadalajara, Jalisco


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

IV. CONCLUSIONES Al realizar el estudio, se observa lo que se menciona en otros estudios realizados, que no solo es importante el control estricto de la glucemia para evitar que se presente un evento cardiovascular, sino que es de suma importancia controlar los otros factores que están presentes en nuestros pacientes como lo son la hipertensión arterial, hipercolesterolemia, hipertrigliceridemia, obesidad, para evitar o retrasar que se presente un infarto agudo a miocardio o evento vascular cerebral. Se observa que al tener más tiempo de evolución de la diabetes mellitus 2 se presenta más control en los enfermos, tal vez porque ya se han concientizado con respecto a su enfermedad, esto podría ser la pauta para realizar más estudios al respecto.

V. BIBLIOGRAFÍA 1. Global status report on noncommunicable diseases 20102011. Alwan A, World Health Organization, Geneva 2011. pp 176. 2. Guía de Práctica Clínica. Detección y Estratificación de factores de riesgo cardiovascular. México: Instituto Mexicano del Seguro Social, 2011.

www.conferenciasindromemetabolico.org

209


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CALIDAD DE LA ALIMENTACIÓN EN NIÑOS DE 12 A 47 MESES DEL CENTRO DE DESARROLLO INFANTIL EN GÓMEZ PALACIO, DURANGO Adriana Lara Solís1, Mariana Icazbalceta Saavedra2, Dra. Ileana Patricia Hernández Salinas3,4, Dra. María Aurora Maravilla Domínguez3 ABSTRACT Introduction: A healthy feeding in the childhood is essential for an optimal growth and development of the child. Objective: Evaluate the impact of the feeding quality in the Development Children Center over the children nutritional state. Methodology: Using a cross-sectional study W/H percentile data of 66 children were evaluated and related with the feeding quality evaluation offered in the Development Children Center. Carbohydrates, proteins and fats percentages were based on the Mexican Food System Equivalents. Results: It was found that 79% (n=52) of the population was inside the normal limits, while the 15% (n=10) showed an overweight risk; and both moderate undernourishment and obesity risk showed a result of 3% (n=2), respectively. An evaluation of the menu showed a high carbohydrate (60%) and sugar (20%) content, a low protein content (< 10%) and approximately 10% of the content were fats. Conclusions: 21% of the population shows a bad nutrition state and the feeding quality was not the required. KEY WORDS: healthy feeding, weight, height, Development Children Center (CENDI), Mexico

I. INTRODUCCIÓN a presente investigación tuvo pretendió conocer si la calidad de la alimentación en el Centro de Desarrollo Infantil (CENDI), del fraccionamiento San Antonio de Gómez Palacio, Durango., cumple con las leyes de una alimentación saludable para el desarrollo y crecimiento de los niños en esta etapa de la vida. El periodo que trascurre entre el nacimiento y los primeros seis años de vida es importante para el crecimiento y desarrollo físico y mental del niño, y actúa de manera irreversible afectando cada etapa subsecuente de la vida¹ Una buena alimentación en la infancia es indispensable para que el crecimiento y desarrollo del pequeño sean óptimos, implica cambios somáticos

L

210

www.conferenciasindromemetabolico.org

y funcionales como resultado de la interacción de factores genéticos y del medio ambiente del individuo.²•⁷ El cuidado del niño de cero a dos años en el proceso de alimentación es el más vulnerable a la desnutrición, la enfermedad o la muerte.² Por otra parte, la obesidad es actualmente un importante problema para la salud de los niños en América del Norte y en algunos sectores de la población de América latina, aunque el principal problema sigue siendo la desnutrición más que la nutrición excesiva.³ En el nivel nutricional de un individuo, la carencia o el

exceso son serios riesgos para la salud⁴ El estado nutricional refleja la salud y nivel de vida de sus habitantes.⁵ En 2006, en México la prevalencia de sobrepeso y obesidad en preescolares fue de 7.8 %, y se incrementó a 9.7 % en 2012; en el norte del país se incrementó de 5 a 12 %. La obesidad infantil amenaza el crecimiento, el desarrollo y el bienestar de los niños.⁶ Las alteraciones nutricias más frecuentes de los infantes en nuestro medio son hábitos dietéticos incorrectos asociados a escasos recursos económicos y a baja nutrición por poca accesibilidad. Muchos niños a esa edad ingieren más calorías de las necesarias, lo que explicar el aumento de la prevalencia de obesidad en esta etapa; en términos generales, el crecimiento corporal del preescolar requiere un aporte calórico suficiente para sus necesidades metabólicas, crecimiento y actividad física. En promedio, su demanda calórica oscila entre 110 a 90 Kcal/Kg/día. Una alimentación equilibrada distribuye la obtención del aporte energético; el 50 % de la alimentación corres-

Pasante Licenciatura en Nutrición. Facultad de Ciencias de la Salud, GP, Dgo. Universidad Juárez del Estado de Durango 2 Estudiante 8vo semestre de la Licenciatura en Nutrición. FACSA, GP, Dgo. UJED 3 Profesor. FACSA., GP UJED 4 Responsable de APEO del Hospital General de Gómez Palacio, Dgo. 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

ponda a hidratos de carbono, 15 % por proteínas y 35 % a expensas de grasas. Considerando la limitación económica de muchas familias, pueden sugerirse alternativas; el aporte de proteínas de origen animal puede obtenerse de vísceras como el hígado, corazón o riñón cuyo costo es menor. El aporte de vegetales verdes es indispensable para la nutrición y puede ser por quelites o nopales, calabazas, entre otros. Los requerimientos nutricionales en el pre-escolar son mayores debido a la actividad física, el crecimiento y a mantener un estado de salud normal.

II. METODOLOGÍA Se acudió al CENDI ubicado en el fraccionamiento San Antonio en Gómez Palacio Durango. Se solicitó carta de consentimiento informado escrito y a los niños se les preguntó si querían ser medidos, ninguno puso objeción. Se tomaron de mediciones antropométricas (talla, peso, circunferencia de cintura, IMC, y otros como fecha de nacimiento, edad en años y sexo. Para la medición del peso se utilizó una báscula electrónica de litio de la marca TAYLER con una capacidad mínima de peso de 10 kg y una capacidad máxima de 150 kg, para la medición de circunferencia de cintura se utilizó una cinta métrica cuyas mediciones se tomaron en cm. Al iniciar la toma de mediciones se pidió quitar el exceso de ropa en los niños que pudiera interferir en el peso, incluyendo los zapatos, previamente se comprobó el adecuado funcionamiento de la báscula y

V3-N1 - 2016

su exactitud. Para analizar la calidad de los menús se obtuvo una copia del menú mensual ofrecido y se calcularon los porcentajes de carbohidratos, proteínas y grasas basándose en el sistema mexicano de equivalentes.

riesgo de sobrepeso; y en ambos: riesgo de desnutrición moderada a grave y en riesgo de obesidad se encontró un 3 % (n=2), respectivamente. Cuando se calcularon los porcentajes de los nutrientes proporcionados a los niños, el cálculo reveló un porcentaje de carbohidratos

Se incluyó un total de 66 sujetos, de los cuales el 60 % (n=40) fueron niños; la edad promedio y DE del grupo fue 2.76 ± 0.67 años; la edad promedio y DE de los niños fue de 2.74 ± 0.65 años y de las niñas fue de 2.71 ± 0.79 años. El peso promedio y DE del grupo fue de 13.93 ± 2.57 kg; el peso promedio y DE de los niños fue de 14.07 ± 2.79 kg el de las niñas fue de 13.69 ± 0.79 kg. Mientras que la talla promedio y desviación estándar del grupo fue 91.6 ± 7.72 cm; la talla promedio y DE para los niños fue de 91.56 ± 8.75 cm; el de las niñas fue 91.65 ± 5.84 cm, sin diferencia entre sexos. Cuando se contrastaron los valores de peso y talla en las tablas normativas percentilares de P/T, en la población estudiada se encontró que 79 % (n=52) de la población estaba dentro de los límites normales, mientras que un 15 % (n=10) exhibió un posible

equivalente a 60%, azúcares equivalentes hasta un 20%, proteínas en menos del 10% y un contenido de grasas aproximado a 10%.

III. RESULTADOS

IV. CONCLUSIONES 1.- Un alto porcentaje (21%) de los sujetos analizados esté en riesgo de malnutrición. 2.- La alimentación proporcionada en CENDI, del fraccionamiento San Antonio de Gómez Palacio, Durango., no cumple con las leyes de una alimentación saludable.   V. BIBLIOGRAFÍA 1 Instituto nacional de estadísticas, geografía e informática: xı censo general de población y vivienda, 1990.Mexico, DF.1991. 2 Hurtado E, Gittelsohn J. Factores sociales y culturales que influyen en el proceso de alimentación del niño en América Latina y el Caribe. En O’ Donnell A, Bengoa JM, Turún www.conferenciasindromemetabolico.org

211


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

B, Caballero B y col.,editores. Nutrición y alimentación del niño en los primeros seis años de vida .OPS/OMS: Washington ,1997: 391-422. 3 Eveleth PB, Micozzi MS. Antropometría en el niño y enfermedades crónicas en el adulto. En: Cusminsky M, editor. Crecimiento y desarrollo. Hechos y tendencias. Organización Panamericana de la Salud, Pub.cient, 1988; 510:210249. 4 Sepúlveda-Amor J, Lezana MA, Tapia-Conyer R, Valdespino JL col. Estado Nutricional de los preescolares y las mujeres en México: resultados de una encuesta nacional probabilística. Gac Med Mex 1990; 126(3):203-225. 5 González-Richmond JA. La antropometría en la evaluación del estado nutricional. Bol Med Hosp Inf Mex 1985; 42(3):207-212. 6 Instituto nacional de estadísticas, geografía e informática: xı censo general de población y vivienda, 1990.Mexico, DF.1991 7 Carmen del Rosario Pascal Serna. “Factores condicionantes de la desnutrición del pre-escolar de 1 a 4 años en el policlínico de Jauja”. En Tesis. UPCH. 1998. 8 Dra. Tovar S., Dr. Navarro J., Dr. Fernández M., Evaluación del estado nutricional en niños, conceptos actuales, consultado: 22/09/2012. 9 Cortez, R. (2002) La nutrición en niños de edad preescolar, centro de investigación, Universidad del Pacifico, Perú. Consultado: 04710/2012. 10 Alimentos sanos. Asociación Española de Pediatría en atención primaria. Bueno M., Sarria A., Pé212

www.conferenciasindromemetabolico.org

rez –González J.M. nutrición en pediatría 2ª Edición Ergón, 2003. 11 Pereira da Cunha Sousa Prevalence of stunting and overweight/ obesity among Brazilian children according to different epidemiological scenarios: systematic review and meta-analysis. Sao Paulo Med. J. vol.134 no.3 São Paulo May./June 2016. 12 Gutiérrez JP, Rivera-Dommarco J, Shamah-Levy T, Villalpando-Hernández S, Franco A, Cuevas-Nasu L, Romero-Martínez M, Hernández-Ávila M. Encuesta Nacional de Salud y Nutrición 2012. Resultados Nacionales. Cuernavaca, México: Instituto Nacional de Salud Pública (MX), 2012.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA DE SOBREPESO Y DESNUTRICIÓN EN NIÑOS DE UN CENTRO DE DESARROLLO INFANTIL DE GÓMEZ PALACIO, DURANGO Mariana Icazbalceta Saavedra1, Adriana Lara Solís2, Ileana Patricia Hernández Salinas3,4, María Aurora Maravilla Domínguez3 ABSTRACT. Introduction: The undernourishment and the obesity are now all over the Mexican territory increasing the need to promote a healthy and well-balanced diet for all groups of ages, especially in children. Objective: The aim of this study was to determine the risk prevalence of an under or overweight according to the height from children´s weight and height data in the Development Children Center in Gomez Palacio, Durango. Methodology: A cross-sectional study was used in the Development Children Center (CENDI) in Gomez Palacio, Durango. A 66 children population anthropometric (weight, height and BMI) and personal (day of birth, age in years and gender) data was evaluated. The weight and height measurements were expressed in kg and cm respectively. Results: The data of the 66 children was analyzed, with an average age of 12 to 47 months, 60% (n=40) of the children were male. According to the children’s weight and height, it was observed that the 79% of the population was inside the percentile charts normal limits, a 15% showed an overweight possible risk, a 3% for each stratum is in moderate to serious undernourishment and obesity risk respectively. Conclusion: This study showed a high prevalence for overweight (15%) in 12 to 47 month old children, unlike the prevalence for obesity and undernourishment, which was 3% for each stratum. KEY WORDS: Undernourishment, overweight, obesity, prevalence, healthy diet, Development Children Center (CENDI), Mexico.

I. INTRODUCCIÓN a desnutrición y la obesidad se extienden a lo largo de todo el territorio mexicano, manifestando la necesidad de promover una dieta saludable y equilibrada que cumpla con todas las leyes de la alimentación en todos los grupos de edad, especialmente en los niños para evitar futuros problemas de malnutrición por déficit o exceso y afectar directamente el rendimiento escolar e interpersonal del niño. Una alimentación saludable durante la infancia es básica para un correcto crecimiento y desarrollo físico-mental y para lograr una vida

L

sana, útil y productiva en la edad adulta.1 En el nivel nutricional de un individuo la carencia (desnutrición) o el exceso (obesidad), constituyen serios riesgos para la salud. En 1996, la encuesta nacional de alimentación en medio rural mexicano reportó que el 42.8 % de los niños < de cinco años tenía algún grado de desnutrición según la relación peso para la edad, y el

55.9% de esta población tenía déficit de talla.2 En 2006, en México la prevalencia de sobrepeso y obesidad en preescolares fue de 7.8 %, y se incrementó a 9.7 % en 2012; en el norte del país se incrementó dramáticamente de un 5 a 12 %. La obesidad infantil amenaza el crecimiento, el desarrollo y el bienestar de los niños. Los niños entre 0 y 5 años de edad, son un grupo de gran vulnerabilidad, las consecuencias más importantes de una nutrición insuficiente influyen directamente sobre el desarrollo psicomotor, privándoles de una competencia equilibrada frente a niños con un adecuado estado nutricional.3 El objetivo de este estudio, fue determinar a partir del peso y la talla las prevalencias de riesgo de una deficiencia o aumento de peso en relación a la talla en un CENDI.3 II. METODOLOGÍA Se realizó un estudio con diseño Transversal en niños de 12 a 47 meses de edad del Centro de Desarrollo Infantil (CENDI), ubicado

Estudiante 8vo semestre de la Licenciatura en Nutrición. Facultad de Ciencias de la Salud, Gómez Palacio, Durango, GP, Dgo. Universidad Juárez del Estado de Durango, Gómez Palacio, Durango 2 Pasante Licenciatura en Nutrición. Facultad de Ciencias de la Salud, Gómez Palacio, Durango, GP, Dgo. Universidad Juárez del Estado de Durango, Gómez Palacio, Durango 3 Profesor. Facultad de Ciencias de la Salud, Gómez Palacio, Durango, GP, Dgo. Universidad Juárez del Estado de Durango, Gómez Palacio, Durango 4 Evaluadora Externa de Lactancia Materna, Responsable de APEO del Hospital General de Gómez Palacio, Dgo. 1

www.conferenciasindromemetabolico.org

213


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

en el fraccionamiento de San Antonio, en Gómez Palacio, Durango. Se solicitó autorización a las autoridades y a todos los padres o tutores y se les explicó la naturaleza del estudio y se solicitó carta de consentimiento informado. Al momento de las mediciones a todos los niños se les preguntó si querían participar. Ninguno de los niños negó querer participar. Se obtuvieron las medidas antropométricas de los sujetos, estos expresados en kg y cm (peso, talla e IMC) así como sus datos personales (fecha de nacimiento, edad en años y sexo). Para medir el peso se utilizó una báscula electrónica de litio de la marca TAYLER con una capacidad mínima de peso de 10 kg y una capacidad máxima de 150 kg, y para la obtención de talla se utilizó un tallímetro de pared, los cuales antes de las toma de mediciones se ubicaron en un lugar específico en el que se tomarían, la báscula se colocó en una superficie plana, horizontal y firme. Para la toma de mediciones y con la ayuda de la maestra encargada, se le quito el exceso de ropa a los niños, tales como suéteres, chamarras o abrigos, también se les pidió a los niños que se quitaran los zapatos. Se colocó al niño al centro de la báscula, en una posición erguida con los hombros abajo, los talones juntos y las puntas separadas siempre asegurándose que el niño tuviera los brazos a los costados sin ejercer presión, con la cabeza firme y la vista de frente a un punto fijo, evitando que el niño se moviera. Para la toma de la talla se colocó a los niños de una manera 214

www.conferenciasindromemetabolico.org

recta y firme con los pies rectos, los talones juntos y puntas separadas en ángulo de 45° deslizando la escuadra del tallímetro de arriba hacia abajo hasta topar la cabeza y tomar la medición en cm. La población se clasifico en 3 grupos por categoría de edad, la primer categoría fue de niños de 12 a 23 meses de edad (n=8), la segunda categoría de edad fue de niños de 24 a 35 meses de edad (n=29) y la tercer categoría de edad fue de niños de 36 a 47 meses de edad (n=29).

V3-N1 - 2016

tante en obesidad. Finalmente en la tercera categoría de edad (niños de 36 a 47 meses de edad), se encontró que 83 % (n=24) estaban en normopeso, 3 % (n=1) exhibió desnutrición moderada a grave y el 14 % (n=4) fue clasificado en posible riesgo de sobrepeso. En la gráfica 1 se muestran los resultados conjuntos de P/T de toda la población

IV. CONCLUSIONES 1. 79% de la población fue clasificado con peso normal para la talla. 2. La prevalencia de sobrepeso en esta población fue de 15% y 3% III. RESULTADOS Se estudiaron 66 niños de 12 a 47 de obesidad 3. No se observaron meses de edad divididos en tres sujetos en riesgo de bajo peso. grupos por categoría de edad. De acuerdo al peso y la talla de los niños, se observó que el 79% de la población se encuentra dentro de los límites normales de P/T considerados por las tablas normativas percentilares, un 15% exhibió un posible riesgo de sobrepeso, un 3% respectivamente para cada estrato se encuentra en riesgo de desnutrición moderada-grave o en riesgo de obesidad. Los resultados de P/T por categoría de edad muestran que en la primera categoría (niños de 12 a 23 meses de edad) el 76 % (n=6) se encontró con normopeso, el 12 % (n=1) exhibió desnutrición moderada a grave, y el 12 % (n=1) se encontró en posible riesgo de sobrepeso. La segunda categoría de edad (niños de 24 a 35 meses de edad) mostró que el 76 % (n=22) se encontró en normopeso, el 17 % (n=5) con posible riesgo de sobrepeso y el 7 % (n=2) res-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

I. BIBLIOGRAFÍAS 1. Daza HC,Peña M.La situación alimentaria y nutricional de los niños ,menores de 6 años en la región de América latina y el Caribe .En O’ Donnell A, Bengoa JM, Turún B, Caballero B y col.,editores. Nutrición y alimentación del niño en los primeros seis años de vida. OPS/OMS: Washington,1997; 1-26. 2. Pereira da Cunha SousaPrevalence of stunting and overweight/obesity among Brazilian children according to different epidemiological scenarios: systematic review and meta-analysis. Sao Paulo Med. J. vol.134 no.3 São Paulo May./June 2016. 3. Estudio Multicéntrico del Patrón de Crecimiento de la OMS Foods and Bull.Vol.25, N1, S3-S4, 2004

www.conferenciasindromemetabolico.org

215


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EFECTO DEL EJERCICIO AERÓBICO SOBRE PERFIL DE LÍPIDOS EN POBLACIÓN ESTUDIANTIL DE LA FACULTAD DE CIENCIAS QUÍMICAS EN CHIHUAHUA, CHIHUAHUA Tania Neftaly Orduño-Martínez1, Irma Delia Jiménez-Flores1, M.A. Pilar del Carmen Hernández-Rodríguez1, M.C. Ana Bertha Torres-Reyes1, M.A. Narciso Torres-Flores1, M.C. Carmen Myriam De La O-Contreras1, M.C. Tania S. Siqueiros-Cendón1, M.C Jesús Rodríguez-Zapien1, D.C. Imelda Guadalupe Alcalá-Sánchez1 ABSTRACT Introduction: Hypercholesterolemia is a severe problem of public health, leading to cardiovascular diseases that are the main cause of morbidity and mortality in the country. It is demonstrated that physical activity reduces coronary risk factors, modifying the levels of plasma lipoproteins that provide a number of benefits to active people.1 Objective: To demonstrate the effects of aerobic exercise on serum lipid profile and anthropometric parameters. Materials and methods: Experimental study, enforced to 20 participants of a 3-month aerobic exercise program, doing anthropometric and biochemical assessments at the beginning and at the end of the intervention. Results: We concluded there is a significant change on serum triglycerides and Castelli index, linked to a rise in levels of HDL cholesterol. KEYWORDS: HDL cholesterol, exercise, Metabolic Syndrome, Castelli index

I. INTRODUCCIÓN l Síndrome Metabólico (SM) se ha definido como la asociación de varios factores de riesgo (dislipidemias, hiperglucemia, hipertensión, etc.) precursores de enfermedad cardiovascular arteriosclerótica. Las enfermedades cardiovasculares se ubican dentro de los principales problemas de salud que enfrenta la sociedad mexicana actual, siendo la mayor causa de muerte en el país; existen factores fundamentales tales como el sedentarismo y las dietas con alto contenido en grasas que favorecen su desarrollo.2 Actualmente, el ejercicio físico constituye uno de los pilares para la prevención y/o tratamiento de padecimientos cardiovasculares.3 En virtud a esto, la Secretaría de Salud y diversos organis-

E

216

www.conferenciasindromemetabolico.org

mos públicos, se encuentran en constante búsqueda de estrategias periódicas de prevención, desarrollando programas encaminados a promover la actividad física. Así tenemos el “Programa Nacional de Activación Física Ponte al Cien” propuesto por la Comisión Nacional de Cultura Física y Deporte (CONADE) en escuelas de distintos niveles, consistente en realización de 45 minutos de ejercicio diario4; el programa PREVENISSSTE, que establece realizar 30 minutos de ejercicio, tres veces por semana o el PREVENIMSS, que contempla sesiones 10 a 40 minutos durante cinco días de la semana.5 Estos programas tienen como finalidad inmediata promover la salud, mejorar la actividad física y eliminar 1 2

los riesgos cardiovasculares asociados a la presencia de un perfil lipídico elevado, lo que ha mostrado buenos resultados. De acuerdo a la ENSANUT 2012, la prevalencia de sobrepeso y obesidad en adultos mostró una reducción del 2 % anual en el período 2000-2006, ubicándose en un nivel inferior al 0.35% en 2012. 6 La situación más favorable desde el punto de vista de protección frente a estas enfermedades, es que a través del ejercicio, los triglicéridos se transforman en ácidos grasos que se utilizarán como fuente energética, incrementando a su vez los niveles séricos de colesterol HDL y disminuyendo los del colesterol LDL, demostrándose así una correlación negativa con procesos de lesiones arterioscleróticas tempranas en adolescentes y adultos jóvenes.7 II. METODOLOGÍA Muestras biológicas y equipos: 1) Sangre venosa obtenida en tubo al vacío con gel de polímero de 7mL. 2) Analizador bioquímico automatizado Prestige 24i, marca Tokio Boeki; sensor de bioimpedancia marca Tanita modelo TBF-

Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Chihuahua, México Facultad de Derecho, Universidad Autónoma de Chihuahua, Chihuahua, México


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

310-GS (Pro BodyCompositionAnalyzer). Criterios de Inclusión: Estudiantes de la Facultad de Ciencias Químicas pertenecientes al grupo de “Fisiología del Deporte”, con edad comprendida entre 18-23 años, de ambos sexos que otorgaron su consentimiento por escrito de participación en el proyecto. Criterios de Exclusión: Estudiantes con impedimento para realizar actividad física. Plan de Intervención: El programa contempló 2 tipos de actividades: 1) práctica de ejercicio aeróbico regular y de moderada intensidad: trotar, flexores de tronco, elevadores del hombro, extensores de rodilla y plantiflexores. 2) sesiones de práctica física acuática. Se aplicó 2 veces por semana (1 día cada actividad), con duración de 1 hora y media por sesión, durante 3 meses (24 sesiones). En cada sesión se incluyeron 10 min de calentamiento, 5 min de enfriamiento y estiramiento post-sesión. Método de Trabajo: Se informó a los estudiantes la finalidad del proyecto, obteniendo consentimiento de participación por escrito. Se proporcionaron las indicaciones para presentarse en fecha y hora para cada análisis. Se aplicó encuesta de datos personales, protegiendo los mismos de acuerdo a la nota de confidencialidad del Instituto Federal de Acceso a la Información y Protección de Datos (IFAI). Se obtuvieron datos antropométricos y de bioimpedancia pre intervención: índice de masa corporal (IMC), peso, masa grasa, masa magra y niveles de hidrata-

ción. Se obtuvo una muestra sanguínea para determinación de niveles séricos de colesterol total, triglicéridos, colesterol HDL, en analizador automatizado Prestige 24i. Se calcularon los valores de LDL y VLDL (fórmula de Friedwald) y el Índice de Castelli. Se realizó la segunda valoración postintervención, 3 meses después, evaluando las mismas variables. Análisis estadístico: Se determinaron cambios estadísticamente significativos entre las mediciones obtenidas pre y postintervención aplicando la prueba T de Student; para evaluar los cambios clínicamente significativos de los parámetros bioquímicos por individuo, se consideraron los coeficientes de variación biológica (CVB) y analítica (CVA) de las bases de datos del Dr. James Westgard8 para el cálculo del cambio de valor de referencia (reference change value o RCV) mediante la Fórmula de Harris y Fraser, expresando significancia por un valor de z≥1.65 9.

V3-N1 - 2016

Muestra conformada 20 jóvenes (8 hombres, 12 mujeres). Se determinaron y compararon los datos de las evaluaciones antropométricas y bioquímicas, para obtener el valor de significancia estadística (p < 0.05) (Tablas 1 y 2). A pesar de que el valor de “p” es elevado, se observa una disminución en el valor promedio de IMC, en porcentaje y masa grasa, así como un incremento en la masa magra y el nivel de hidratación. El valor de “p” se encuentra en el límite de significancia para la concentración de colesterol HDL, que fue mayor en la evaluación postintervención; se observa también una disminución en valores de triglicéridos y en Índice de Castelli. En el análisis de datos mediante la fórmula de Cambio de Valores de Referencia para cada participante, se observa modificación favorable para 4 personas en niveles de Colesterol total (Tabla 3), 7 para Colesterol HDL (Tabla 4) y 7 para Triglicéridos (Tabla 5).

III. RESULTADOS

www.conferenciasindromemetabolico.org

217


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

IV. CONCLUSIÓN El ejercicio actúa como un verdadero hipolipemiante produciendo mejoras en la calidad de vida y una reducción en la mortalidad cardiovascular; los cambios favorables producidos por el ejercicio se asocian más directamente al gasto energético que a la intensidad del ejercicio; explicando así, las modificaciones de los niveles plasmáticos de lipoproteínas. La práctica de actividad física permitió una disminución en el IMC (indicador simple de la relación entre peso y talla) utilizado frecuentemente para identificar sobrepeso, lo que propicia a una menor probabilidad de padecer obesidad ligada a enfermedades cardiovasculares, complicaciones neurológicas, genitourinarias, dermatológicas y trastornos musculo esquelética. Según lo demostrado en nuestra 218

www.conferenciasindromemetabolico.org

investigación, la práctica de actividad física de intensidad moderada durante 60-90 minutos al menos 2 días a la semana, puede dar resultados favorables. Es así que se sugiere incorporar la práctica de ejercicio aeróbico dentro de las actividades cotidianas.

V. BIBLIOGRAFÍA 1. Encuesta Nacional de Salud y Nutrición 2012, Fecha de recuperación: Junio 19, 2016. Sitio web: http://ensanut.insp.mx/ informes/ENSANUT2012ResultadosNacionales.pdf 2. F. J. Tebar, Escobar Jiménez (2009), La Diabetes Mellitus en la práctica clínica, Madrid, España, Editorial Panamericana. 3. Dosil Díaz (2003) Ciencias de la Actividad Física, España, Editorial Síntesis. 4. CONADE, Estrategia para educar a la población en materia

V3-N1 - 2016

de régimen alimentario, actividad física y salud, denominado “Evaluación de la Capacidad Funcional. Fecha de recuperación: Junio 22, 2016. Sitio web: http://www.conade.gob.mx/minisitio/paginas/ ponteal100.pdf 5. Comisión Nacional de Cultura Física y Deporte, Fecha de recuperación: Junio 19, 2016. Sitio web: http://activate.gob.mx/ Documentos/Manual%20Activacion%20Fisica%20Escolar.pdf 6. Barrera-Cruz, A., Rodríguez-González, A., & Molina-Ayala, M. A. (2013). Escenario actual de la obesidad en México. Rev Med Inst Mex Seguro Soc,51(3), 292-299. 7. Serra Grima (2004). Prescripcion de ejercicio físico para la salud. Barcelona, España. Editorial Paidotribo. 8. James Westgard (2009). CLIA Requirements Analytical Quality. Fecha de recuperación: Junio 24, 2016, de Westgard QC Sitio web: http://westgard.com/ clia.htm 9. Guzman, A. M. (2010). ¿Cuándo dos exámenes seriados de laboratorio representan un cambio en el estado de salud de un paciente. Rev Med Chile,138, 780-783. Sitio web: http://www. scielo.cl/scielo.php?pid=S003498872010000600018&script=sci_arttext&tlng=pt


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FRECUENCIA DE DIABETES MELLITUS., HIPERTENCIÓN ARTERIAL Y DISLIPIDEMIAS EN PACIENTES QUE ACUDIERON A CESSA TEHUACÁN EN EL PRIMER SEMESTRE DEL 2016 Lic Enf. Guadalupe Mota Pioquinto1, Dra. Ma. Elena Tlapa Soto2, Dr. Jesús A. Valdez García2, Est.Enf. Ana Yasmín Carrera S.3, Priscilla M. Castro Martínez3 RESUMEN: El Objetivo del presente estudio de investigación sobre Diabetes mellitus, hipertensión arterial y dislipidemias en pacientes que acudieron al CESSA de Tehuacán, Puebla, fue el analizar la prevalencia de la de DM con otras enfermedades como la Hipertensión arterial las dislipidemias y la obesidad, así como su frecuencia no solo en cantidad sino también su ocurrencia de ellas en la mayoría de esas personas, observadas durante el primer semestre de 2016, La DM fue la enfermedad de mayor prevalencia ya que se presentó en todos los pacientes atendidos los cuales fueron 470, en orden descendente se observó a las dislipidemias presente en 205 pacientes y en tercer orden a la hipertensión arterial. PALABRAS CLAVES: Dislipidemias, obesidad, diabetes mellitus-2 y CESSA.

I. INTRODUCCIÓN a Diabetes Mellitus (DM) invariablemente lleva a un importante riesgo de enfermedad cardiovascular (ECV) tanto por sí sola como combinada con otros factores de riesgo como la Hipertensión Arterial Sistémica (HAS) y la Dislipidemia, el resultado final es que las personas con DM. tienen entre 2 y 4 veces más riesgo de ECV que la población general y entre un 50 y un 80% de las personas con DM mueren por ECV. (1,2,3) Los factores inherentes al progreso (envejecimiento, obesidad y estilos de vida poco saludables) favorecen el aumento gradual tanto de la diabetes como de las enfermedades cardiovasculares. En la actualidad, se acepta que las intervenciones sobre el estilo de vida en la población general, junto con la detección, el control y la monitorización de los factores de

L

riesgo, son los pilares principales de la prevención de las enfermedades cardiovasculares. (4)

La obesidad es una enfermedad crónica multifactorial fruto de la interacción entre genotipo y ambiente. Esta enfermedad afecta a un gran porcentaje de la población en México sin distinción de géneros y condiciones sociales. La obesidad aumenta sustancialmente no sólo el riesgo de DM y de enfermedad cardiovascular, sino también en ciertos tipos de cáncer y otras enfermedades altamente prevalentes, de tal manera que ha convertido a la obesidad en la segunda causa de mortalidad prematura y evitable, después del hábito al tabaco (8) .

Un informe reciente de la Organización Mundial de la Salud indica una asociación entre el aumento de peso, obesidad abdominal, sedentarismo y desarrollo de DM tipo 2.

Estudios realizados en el Reino Unido, Japón, Finlandia y Alemania han informado de una reducción en el riesgo relativo para el desarrollo de DM.2 de entre 15 y 60% con un aumento de la actividad física diaria. Además, algunos investigadores mostraron que un aumento en el índice de masa corporal (IMC) aumenta drásticamente el riesgo relativo para el desarrollo de DM-2, mientras que la inactividad física en las personas de peso normal tuvo un efecto muy atenuado. La combinación de los datos llegaron a la conclusión que aquellos individuos con un IMC ≥ 30 kg/m2, las personas con niveles bajos de actividad física y una regulación alterada de la glucosa son 30 veces más probables de desarrollar DM tipo 2 que el tener peso normal. Un hallazgo similar fue reportado por Weinstein et al. Donde observaron y siguieron a 37,878 mujeres durante un pro-

Centro de Estudios Superiores de Sán Ángel, México Investigador, Benemérita Universidad Autónoma de Puebla 3 Estudiante de Enfermería 1 2

www.conferenciasindromemetabolico.org

219


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

medio de 6.9 años. Llegaron a la conclusión de que tanto el IMC y la inactividad física fueron factores determinantes de la incidencia de DM2, pero la magnitud de la asociación con el IMC fue mayor que con la inactividad física (7,8).

ticado por encuestas. Existen otros padecimientos de origen metabólico que se asocian con la DM y probablemente se relacionen con resistencia a la insulina; tal es el caso de la HAS y la obesidad. Enfermedades y trastornos que hacen necesario buscar fórmulas que incorporen a los sectores público, social y privado en el combate de este problema creciente, antes de que rebase al sistema, se dispare la frecuencia de ellas, lograr su solución o atención médica de una manera eficiente y efectiva.

Se señala que la prevalencia de Hipertensión Arterial en las personas con DM es considerablemente mayor comparada con los no diabéticos. Estas 2 enfermedades coexisten frecuentemente, incluso se conoce que la HTA puede preceder por varios años a la aparición de la DM 2. II. MATERIAL Y MÉTODOS El tipo de estudio-investigación: Se estima que más del 50 % de los fue descriptivo, longitudinal y pacientes que padecen HTA en clínico. el momento del diagnóstico de la La población sujeta al estudio DM. Ambas interactúan, e incre- fueron pacientes con diagnóstimentan, por tanto, el riesgo de co de DM, dislipidemias e HA, en mortalidad por afección vascular. pacientes adultos mayores de 20 años, que acudieron al CESSA de La HTA es uno de los factores prin- Tehuacán Puebla el periodo del 1º cipales en la patogenia de la lesión de Enero de 2016 al 30 de Junio de de los macro y micro vasos en los 2016.. pacientes con trastornos de la tolerancia a la glucosa, presente en De acuerdo a los criterios de seel 70 % de los diabéticos con en- lección los pacientes de nuestro fermedad cardiovascular, y especí- estudio; serán por grupos de edad, ficamente en el 45 % de los que y género, enfermedad y complicapresentan isquemia coronaria. Se ción estima que del 30 al 75 % de las complicaciones de la DM pueden III. RESULTADOS ser atribuidas al incremento de la En nuestro estudio partimos con presión arterial. una muestra de 470 pacientes de ambos géneros, pacientes que La DM ha ido en aumento en toda fueron atendidos en el CESSA DE la población de 20 a 69 años, sin Tehuacán, Puebla en el periodo embargo, aproximadamente solo comprendido del 1 de Enero al 30 un 70% de quienes la padecen se de Junio de 2016.,los cuales fueron saben portadores de las misma, el divididos en 2 grupos por edades; resto de personas se han diagnos- uno de 20 a 59 años y otro de 60 220

www.conferenciasindromemetabolico.org

V3-N1 - 2016

y mas años. El grupo de 20 a 59 años comprendió a 311 pacientes y el grupo de 60 y más a 159 personas de ambos géneros. Del total de pacientes analizamos que todos padecían DM= 470 casos, 194 con HA, y 271 con dislipidemias, y sorprendentemente un mayor No. De pacientes con obesidad 235 casos en ambos géneros pero con mayor cantidad de ocurrencia en mujeres, ejemplo 332 Fem. con DM y hombres 138 casos con Dislipidemias. IV. CONCLUSIONES Después de realizar el análisis de este grupo de personas; podemos concluir que la Diabetes Mellitus se observó en todos los pacientes seguida por la obesidad y las dislipidemias y en menor cantidad de ocurrencia la Hipertensión arterial, además la generación de estas enfermedades ocurre en la etapa más productiva de estas personas (20 a 59 años), razón científica que nos lleva a concluir que el estrés, los estilos o costumbres de alimentación y preocupaciones de la “vida cotidiana” influyen de manera concreta en la generación de las enfermedades antes mencionadas. V. REFERENCIAS BIBLIOGRÁFICAS

1.- López P, Rey J, et al. Epidemia de Diabetes Mellitus Tipo 2 en Latinoamerica, Rev. de Medicina (Bogotá) 2010; 32(4)308-321.

2.- Valdés S, Rojo G, et al. Evolución de la prevalencia de la diabetes tipo 2 en población adulta españo-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

la. Rev. Médica-Clínica de Barcelona. 2007; 129(9):352-5. 3.- Gil E, Zorrilla B, et al. Prevalencia de diabetes mellitus y factores de riesgo cardiovascular en la población adulta de la Comunidad de Madrid: estudio PREDIMERC. Gaceta Sanit. 2010; 24(3):233– 240. 4.- Quirantes A, López M, et al. Estilo de vida, desarrollo científico-técnico y obesidad. Revista Cubana de Salud Pública. 2009; 35(3). 5.- Moreno L, Limón D. Panorama general y factores asociados a la diabetes. Rev. Fac. Med. UNAM 2009; 52(5):219-223. 6.- Escolar A. Determinantes sociales frente a estilos de vida en la Diabetes Mellitus de tipo 2 en Andalucía: ¿la dificultad para llegar a fin de mes o la obesidad? Gaceta Sanitaria. 2009; 23(5):427–432.

7.- Rubio M, Salas J. et al. Consenso SEEDO 2007 para la evaluación del sobrepeso y la obesidad y el establecimiento de criterios de intervención terapéutica. Rev. Espobes 2007; 5(3):135-175. 8.-Regla I, Molena C, et al. Risk factors in patients with type 2 diabetes mellitus. Rev Latino-am Enfermagem 2008; 16(2):238-44. 9.- López H, Pérez R, et al. “Factores de riesgo y hábitos alimentarios en personas de 25 a 35 años, con y sin antecedentes de DM-2”, Rev. Respyn 2011; 12(2).

www.conferenciasindromemetabolico.org

221


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ASOCIACIÓN DE AMILINA Y MARCADORES BIOQUÍMICOS EN UNA POBLACIÓN AMBULATORIA CON SÍNDROME METABÓLICO DE LA UMF NO. 23 DEL IMSS García Ángeles Brenda Grétel1, Sánchez Alemán Miguel Ángel2, Toledano Jaimes Cairo David1, Ávila Jiménez Laura3, García Jiménez Sara1 RESUMEN El Síndrome Metabólico (SM) es una prioridad en salud debido a la alta incidencia de enfermedades cardiovasculares (ECV) y Diabetes Mellitus tipo 2 (DM2). Los factores implicados en el desarrollo del SM son la edad, las condiciones genéticas y un estilo de vida inadecuado, considerando la inactividad física y el alto consumo de alimentos hipercalóricos como grasas saturadas, e hidratos de carbono como importantes factores de riesgo, en consecuencia, la resistencia a la insulina y la obesidad son los desencadenantes principales de este Síndrome. La amilina es un polipéptido de 37 aminoácidos co-secretado con la insulina por células pancreática en conjunto con la insulina, existe una fuerte asociación con el SM, independientemente de los factores de riesgo establecidos, como la obesidad y la resistencia a la insulina. El papel de la amilina en la obesidad y el SM no ha sido estudiado en la población mexicana, por lo cual, los resultados obtenidos de la presente investigación servirán para aportar nuevos conocimientos al entorno, mediante la caracterización bioquímica y antropométrica de la población de estudio y su correlación con la amilina como factores de riesgo para desarrollar enfermedades cardiovasculares y Diabetes Mellitus tipo 2. Objetivo: Correlacionar los niveles de amilina en suero con los marcadores bioquímicos y antropométricos en una población con Síndrome Metabólico. Sujetos y métodos: Se reunieron 76 pacientes de la Unidad de Medicina Familiar No. 23 del IMSS que reúnen los criterios de ATP III para SM, a los cuales se les realizó la toma de medidas antropométricas, toma de muestra sanguínea y aplicación del cuestionario de estilos de vida. Se pidió que cada uno de los participantes firmara la carta de consentimiento informado. Se realizó la determinación del perfil de lípidos (colesterol total, triglicéridos, c-HDL), glucosa, hemoglobina glucosilada, el proceso de la amilina e insulina, está en proceso. A cargo del programa computacional SPSS V. 20, se realizó el análisis estadístico de los datos obtenidos. Resultados: El 86.8% de la población tiene sobrepeso y/o obesidad, el 81.6% tiene una circunferencia de cintura por arriba de lo indicado por la ATP III, el 77.6% de la población tiene concentraciones disminuidas del colesterol HDL, así como, el 61.8% tiene concentraciones de triglicéridos por encima de los 150 mg/dl. Conclusión: Al seguir en proceso el estudio y no contar con las concentraciones de amilina e insulina, no se puede establecer la correlación de amilina con los parámetros bioquímicos, antropométricos y de estilo de vida, por lo que sólo se lleva a cabo la caracterización de la población. PALABRAS CLAVE: Amilina, Síndrome metabólico, Resistencia a la insulina, obesidad

Universidad Autónoma del Estado de Morelos Instituto Nacional de Salud Pública 3 Instituto Mexicano de Seguridad Social 1 2

222

www.conferenciasindromemetabolico.org

I. INTRODUCCIÓN l síndrome metabólico (SM) es un conjunto de anormalidades metabólicas consideradas como un factor de riesgo para desarrollar algún tipo de enfermedad cardiovascular y/ o diabetes. Este conjunto de anormalidades, en combinación de factores genéticos y factores de riesgo como alteración de estilo de vida (la sobrealimentación y la inactividad o disminución de actividad física), contribuyen a las dos características clínicas centrales, es decir, la obesidad y la resistencia a la insulina central (IR). [1] La prevalencia del Síndrome Metabólico varía según factores como género, edad, etnia y es ubicado entre el 15- 40 %, siendo mayor en la población de origen hispano. [2] En México, la Encuesta Nacional de Salud y Nutrición del 2012, no reporta una prevalencia de Síndrome Metabólico, sin embargo se consideran los criterios de diagnóstico de manera individual, considerando a la obesidad abdominal con una prevalencia del 73.9%, el diagnóstico previo de Diabetes Mellitus con un 9.2%, hipercolesterolemia del 13% e hipertensión arterial del 32%. [3] Por otra parte, en el estado de Morelos se reporta una preva-

E


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

lencia de obesidad abdominal del 69.6%, para el diagnóstico previo de Diabetes Mellitus es del 8.9%, hipercolesterolemia del 14.1% e hipertensión arterial con una prevalencia del 13.4%. [4] La amilina es un polipéptido de 37 aminoácidos, es aislada inicialmente de los depósitos de amiloide en los islotes pancreáticos de pacientes con diabetes tipo 2; es secretada con la insulina por las células B en respuesta a la estimulación de glucosa, ácidos grasos libres y la ingesta de alimentos; juega un papel importante en el control del balance energético, inhibiendo la ingesta de alimentos mediante la promoción de la saciedad del hambre. [5] El IAPP se deriva de un péptido precursor más grande, el pro-IAPP (67 aminoácidos) y escinde proteolíticamente en los extremos N- y C- terminal por las funciones de pro-hormonas convertasas 1/3 y 2 dentro del gránulo secretor de las células beta como el gránulo maduro. [6] Estos procesos se producen en las células beta pancreáticas, y, por tanto la amilina es secretada junto con la insulina en una relación 20 a 1 molar de insulina con amilina. [7] Al ser la amilina una hormona excretada por el páncreas en conjunto con la insulina, existe una fuerte asociación con el síndrome metabólico, relacionado a los factores de riesgo establecidos, como la obesidad, marcadores inflamatorios y la resistencia a la insulina. [5] El péptido soluble se encuentra normalmente en la circulación a una concentración de 5-15 pmol/l y al igual que el péptido C (pero no

insulina) se excreta por el riñón. La relación de moléculas similares a la insulina e IAPP, sería con más precisión con el péptido C de la insulina. [6]

II. METODOLOGÍA Se trata de un estudio analítico, descriptivo, en donde se reunieron a 76 pacientes de del servicio de Atención Farmacéutica de la U. M. F. No. 23 del IMSS que cumplen con los criterios de la ATP III para el diagnóstico de Síndrome Metabólico. Se informó a los pacientes el alcance del estudio mediante la firma de la carta de consentimiento informado, igualmente se pidió contestar un cuestionario de estilos de vida. Se realizó la toma de medidas antropométricas y toma de muestra sanguínea para determinar concentraciones séricas de triglicéridos, colesterol total, colesterol HDL, así como hemoglobina glucosilada y amilina. Se llevó a cabo el análisis estadístico a cargo del programa computacional SPSS V. 20. III. RESULTADOS La población del servicio de Atención Farmacéutica de la U. M. f. No. 23 del IMSS, fue clasificada por género, de un total de 76 pacientes, 48 corresponden al género femenino, equivalente al 63% de la población y 28 pacientes del género masculino equivalente al 37%. Tomando como base el cuestionario aplicado a la población, el 92.1% de la población no tiene el hábito de fumar, el 25% refiere beber alcohol y de ellos, sólo el 73.7 % indica que lo hace una vez

V3-N1 - 2016

al año. El 60.5% indica hacer ejercicio, sin embargo sólo el 93.5% refiere hacerlo por más de 30 min diario; por el contrario, el 46.1% de la población indicó permanecer sentado por más de tres horas. En base a los datos obtenidos en el tamizaje antropométrico, se observa que el 86.8% de la población tiene un IMC por arriba de los 25 kg/m2, de los cuales el 40 % tiene sobrepeso y el 47% obesidad. Referente a los criterios diagnósticos de ATP III para Síndrome Metabólico, se encontró que el 39.5% de la población tiene hiperglucemia con una media de glucosa es de 110.7 mg/dl ±50.6, el 61.8% tiene hipertrigliceridemia con una media de 140.9 mg/dl ±64.6, los datos refieren que el 15.8% de la población tiene hipercolesterolemia con una media de 163.4 mg/dl ± 34.9; la hemoglobina glicosilada indica que el 68.4 % de la población es diabético no controlado, obteniendo una media del 8.1% ± 2.4. IV. CONCLUSIONES Al seguir en proceso el estudio y no contar con las concentraciones de amilina e insulina, no se puede establecer la correlación de amilina con los parámetros bioquímicos, antropométricos y de estilo de vida; sin embargo se ha establecido de manera clara la caracterización de la población, encontrando que el 86.8% de la población tiene sobrepeso y/o obesidad, mostrando tener hábitos saludables, que reflejado en no fumar y bebes, así como hacer ejercicio por más de 30 min al día. Se encontró que el www.conferenciasindromemetabolico.org

223


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

39.5% de la población de estudio tiene concentraciones de glucosa por arriba de los 110 mg/dl, sin embargo la hemoglobina glucosilada muestra que el 68.4% de la población es diabético no controlado.

V. BIBLIOGRAFÍA 1. O’Neill, S., O’Driscoll, L. (2015). Metabolic syndrome: a closer look at the growing epidemic and its associated pathologies. Obesity reviews. 16(1), 1–12. 2. Rosalba Rojas MC. Metabolic syndrome in Mexican adults. Results from the National Health and Nutrition Survey 2006. Salud Pública de México. 2010; 52 (1): S11-S18 3. Barquera Simón et. al., Encuesta Nacional De Salud Y Nutrición 2012, Resultados Nacionales, Adultos, Instituto Nacional De Salud Pública, 2012; Pag: 91-116. 4. Barquera Simón et. al., Encuesta Nacional De Salud Y Nutrición 2012, Resultados Por Entidad Federativa, Adultos, Instituto Nacional De Salud Pública, 2012; Pag: 44-61 5. Xinwei, H., Liang, S., Zongmeng, L., Haiwei, M., Zhijie, Y., Huaixing, L., Peizhen, J., Danxia, Y., Hongyu, W., Xingwang, Y., Xu, L., Yingying, L. (2011). Associations of Amylin with Inflammatory Markers and Metabolic Syndrome in Apparently Healthy Chinese. Plos one. 6 (9), 1-8. 6. Clark A, et. al., Islet amyloid: a complication of islet dysfunction or an aetiological factor in Tipe 2 diabetes? Diabetología. 2004; 47: 157-169. 224

www.conferenciasindromemetabolico.org

7. Pillary K, et al., Amylin Uncovered: A Review on the polypeptide Responsible for Type II Diabetes. BioMed Research International. 2013; 1-

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

INDICENCIA DE SÍNDROME METABÓLICO EN POBLACIÓN MEXICANA CON TRASPLANTE RENAL Y SU IMPACTO EN LA FUNCIÓN DEL INJERTO Mora-Hernández Celina1,2,4 Jorge Andrade-Sierra2,3,4, Enrique Rojas-Campos2, Ernesto G. Cardona-Muñoz4, Luis A. Evangelista-Carrillo3, Eduardo González-Espinoza3,Salvador Mendoza-Cabrera3, Orozco-Jiménez Alejandro3, Benjamín Gómez-Navarro3, José I. Cerrillos-Gutierrez2,3, Miguel Medina-Perez3, Basilio Jalomo3, Juan J. Nieves3, Pazarín-Villaseñor Leonardo2, María Carmen Alvarado-Velarde3, Diana Soria3, Francisco Monteón3, Alfonso M. Cueto-Manzano2 RESÚMEN: El Síndrome Metabólico (SM) es conjunto de factores de riesgo cardiovascular que se ha visto asociado con disminución de la función renal y aumento en la morbilidad-mortalidad. Nuestro objetivo fue identificar en nuestra población la incidencia de SM a largo plazo y su impacto en la función del injerto en receptores de trasplante renal. Material y métodos: Se realizó una cohorte prospectiva, realizada en receptores de trasplante renal con un seguimiento de 3 años (01/04/2009 al 31/03/2010). No fueron incluidos pacientes con Diabetes Mellitus y SM antes del trasplante, receptores de segundo o tercer TR y quienes no aceptaron participar. Se utilizaron los criterios del NCEP-ATP III ajustados a población hispana. En el análisis estadístico se utilizaron desviaciones estándar, medianas y rangos para variables cuantitativas; proporciones y porcentajes para variables cualitativas, prueba de T de student y U de Mann Whitney para variables cuantitativas independientes; X2 y prueba exacta de Fisher para el análisis univariado; Anova para el análisis multivariado PALABRAS CLAVE: Síndrome metabólico, trasplante renal, función renal

I. INTRODUCCIÓN umerosas causas pueden condicionar la pérdida de un trasplante renal, destacando la muerte del paciente con injerto funcional como una de las principales.1-4 La enfermedad cardiovascular es causante de muerte en hasta la tercera parte de receptores renales (30-44%) y en el mayoría de casos ocurre con injerto funcional.1-3,5,6 De igual forma la disfunción crónica del injerto (DCI), puede asociarse a dislipidemia, hipertensión, diabetes, número y severidad de los episodios de rechazo agudo e incluso toxicidad por el uso de inmunosupresores que condicionan nefropatía esclerosante del injerto (NEI).4,7,8 Algunos de estos

N

factores están relacionados con la presencia de SM, factor de riesgo para morbi-mortalidad cardiovascular en TR.9-11 En México se registran prevalencias de hasta 26%13 y la Encuesta Nacional de Salud (ENSA) estima que 30% de la población mayor de 20 años tiene obesidad y mayor riesgo para el desarrollo de SM.14 En TR la prevalencia de SM varía de acuerdo a la población y al tiempo de evolución del trasplante, variando de 23% hasta 64% con incremento conforme el

paso del tiempo pos-trasplante. 21 22,25-27 II. METODOLOGÍA DISEÑO DEL ESTUDIO: Cohorte prospectiva realizada en pacientes mayores de 16 años derechohabientes del IMSS trasplantados de riñón quienes recibieron cualquier tipo de inmunosupresión en el período comprendido del 01/04/2009 al 31/03/2010 en el HE de la UMAE, CMNO. Los pacientes fueron seguidos por 36 meses, fueron evaluados anualmente y divididos en el estudio de acuerdo al grado de exposición al Síndrome Metabólico: nunca expuestos, en 1 y en 2 o 3 evaluaciones (SM persistente). Todos los pacientes con presencia de diabetes mellitus o SM antes del trasplante, receptores de segundo o tercer TR y aquellos que no aceptaron participar no fueron incluidos en el estudios ya aquellos pacientes con pérdida del injerto en los primeros 3 meses posteriores al TR fueron eliminados.

Residente de Segundo grado de Medicina Familiar de la Unidad de Medicina Familiar No. 51, IMSS 2 Unidad de Investigación Médica de Enfermedades Renales 3 Departamento de Nefrología y Unidad de Trasplantes de Órganos Hospital de Especialidades CMNO IMSS 4 Departamento de Fisiología. Centro Universitario de Ciencias de la Salud. Universidad de Guadalajara. Guadalajara, Jalisco 1

www.conferenciasindromemetabolico.org

225


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Se registraron los siguientes datos clínicos, bioquímicos y antropométricos basales y al seguimiento: fecha del trasplante, tiempo de isquemia fría y caliente, biopsia tiempo cero, dosis de inmunosupresores de inducción y de mantenimiento, determinación de insulina total en ayuno, índice HOMA, microalbuminuria y la función renal con 3 métodos (depuración de creatinina en orina de 24 horas, cálculo con la fórmula de MDRD y Nankivell), fecha de diagnóstico de rechazo agudo, tipo y dosis de tratamiento anti-rechazo, número y severidad de rechazo(s) del injerto (clasificación histopatológica de Banff).64,65 Finalmente se registró la fecha de pérdida del injerto e inicio de la terapia sustitutiva de la función renal (diálisis peritoneal o hemodiálisis) así como fecha y causa de defunción del paciente. ANALISIS ESTADISTICO: Una muestra de 97 pacientes fue calculada con análisis de proporciones asumiendo que nuestra población a estudiar corresponde a un solo grupo poblacional (expuestos al trasplante), con un nivel de significancia de 5% y un poder del 80%. Los datos se muestran como media ± desviación estándar o números y porcentajes. La t de Student y pruebas de χ2 se utilizaron para las comparaciones entre los grupos. La supervivencia del injerto se evaluó mediante Kaplan-Meier y las comparaciones mediante la prueba de Log-rank, el modelo de riesgo proporcional de Cox se utilizó para evaluar el efecto de las variables de exposición sobre los 226

www.conferenciasindromemetabolico.org

porcentajes de sobrevida del injerto y del paciente. Los análisis estadísticos se realizaron con el software SPSS®, v17.

III. RESULTADOS Ese estudio incluyo 192 pacientes receptores de un primer trasplante renal, de la división de nefrología y trasplante del hospital de especialidades CMNO del IMSS. Las características sociodemográficas fueron: edad 25±9, masculino 139(71%), femenino 53(29%), meses en diálisis 20±16, meses del trasplante 38±3, edad del donador 38±10, género del donador: masculino 132(69%), femenino 60(31%), peso 59±13kg, IMC 21.7±13, TAS 137±13mmHg, TAD 83±9mmHg. A los 36 meses de seguimiento se compararon las variables clínicas y bioquímicas entre aquellos pacientes que desarrollaron SM y aquellos que no lo desarrollaron, obtuvimos significancia estadística en aquellos pacientes que a los 3 años de seguimiento desarrollaron SM, presentaron un mayor peso e IMC (sobrepeso y obesidad), elevación de la TAS, TAM, circunferencia de cintura, glucosa y alteraciones en el perfil de lípidos, hiperinsulinemia en ayuno y un índice de HOMA más elevado, creatinina sérica elevada. Observamos un incremento a 22% en la Incidencia de SM a los 36 meses del trasplante renal, comparada con la incidencia de SM a los 6 meses que fue de 20%, a los 12 meses de 13%y a los 24 meses fue del 4%. Comparamos la prevalencia de SM entre aquellos pacientes que

V3-N1 - 2016

desarrollaron SM durante los primeros 12 meses pos- trasplante (temprano) 34%, aquellos que lo desarrollaron posterior a los 12 meses pos- trasplante (tardío) 23% y aquellos que Nunca desarrollaron SM 43%. Realizamos un análisis para predecir el SM comparando las variables clínicas y bioquímicas pre trasplante, a los 6,12, 24 y 36 meses, de acuerdo al tiempo de exposición al SM, encontramos que aquellos pacientes que desarrollaron SM temprano son los que en el pre-trasplante presentan un mayor peso, mayor IMC, circunferencia de cintura y triglicéridos más elevados, comparados con aquellos que nunca desarrollaron SM. A los 36 meses de seguimiento de nuestra cohorte, los pacientes con peso, IMC y TAS más elevados, disminución de HDL, aumento triglicéridos y el índice de HOMA, fue observado en aquellos pacientes que desarrollaron SM temprano, en comparación con aquellos que nunca lo desarrollaron. La elevación de la TAS y el colesterol, disminución de HDL, aumento de LDL y triglicéridos, se presentó en los pacientes con SM temprano y no en los de SM tardío. Resulta de interés que además se encontró que la insulina total en ayuno cuando se comparó con aquellos pacientes que desarrollaron SM tardío vs aquellos que lo desarrollaron de manera temprana y aquellos con SM temprano vs todos fue estadísticamente significativa. La función renal calculada (MDRD y Nankivell) mostró una impor-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tante disminución desde los primeros 6 meses posteriores al trasplante, para un posterior aumento a partir de los 24 meses en aquellos pacientes que desarrollaron SM temprano Se realizó un análisis de regresión multivariado, encontrando a la circunferencia de cintura a los 12 meses y el índice de HOMA a los 36 meses como variables predictoras de SM a largo plazo, entendiendo por esto que aquellos pacientes con obesidad central determinada por circunferencia de cintura >102 cm en hombres y >88 cm en mujeres (según los criterios del ATP III) y un Índice de HOMA elevado, predicen el desarrollo de SM a largo plazo.

IV. CONCLUSIONES La incidencia de SM fue diferente durante los 3 años de seguimiento, a los 6 meses 20%, 12 meses 13%, 24 meses 4% y 36 meses 22%; la prevalencia fue del 34% en SM tempano, 23% en SM tardío y 43% sin SM. 70 pacientes de la muestra (47%) presentaron SM alguna vez durante los 3 años de seguimiento. La exposición a SM también fue diferente ya que los que nunca presentaron SM fueron 63 (43%) los que lo presentaron en una o 2 de las evaluaciones fueron 68 (47%) y los que lo presentaron de manera persistente fueron 15 (10%). El SM afectó la función en aquellos pacientes que desarrollaron SM temprano. En la proteinuria no hubo diferencias entre los grupos. Una mayor circunferencia de cintura a los 12 meses pos-trasplante y un mayor índice de HOMA a los

36 meses pos-trasplante, son variables predictoras de SM a largo plazo. Es necesario considerar los trastornos de sensibilidad a la insulina en la etapa pre-trasplante como parte de la vigilancia del receptor en riesgo de desarrollar SM. Por último, es necesario hacer énfasis en cuanto a la importancia del seguimiento del paciente en el pos-trasplante tardío (posterior a los 12 meses), debido a los resultados encontrados en nuestro seguimiento, es a partir de esta fecha, cuando se presenta la mayor incidencia de sobrepeso y obesidad, así como mayores alteraciones metabólicas, por ende mayor incidencia y prevalencia de SM a largo plazo. Todo esto con la finalidad de promover cambios en el estilo de vida, apego a un régimen alimenticio adecuado, apego al tratamiento médico y las citas médicas y nutricionales periódicas para evaluar la funcionalidad del injerto y del paciente y sus implicaciones metabólicas que conlleva el pos-trasplante tardío. V. REFERENCIAS BIBLIOGRÁFICAS 1. Wolfe RA, Ashby VB, Milford EL. Comparison of mortality in all patients on dialysis, patients on dialysis awaiting transplantation, and recipients of a first cadaveric transplant. N Engl J Med 1999; 341: 1725–1730 2. Oniscu GC, Brown H, Forsythe JLR. Impact Of Cadaveric Renal Transplantation On Survival In Patients Listed For Transplantation. J Am Soc Nephrol 2005; 16: 1859–1865.

V3-N1 - 2016

3. Oniscu CG, Brown H, Forsythe JLR. How great is the survival advantage of transplantation over dialysis in elderly patients?. Nephrol Dial Transplant 2004; 19: 945-951. 4. McDonald SP, Russ GR. Survival of recipients of cadaveric kidney transplants compared with those receiving dialysis treatment in Australia and New Zealand, 1991–2001 Nephrol Dial Transplant 2002; 17: 2212–2219. 5. Hariharan S, Johnson CP, Bresnahan et al: Improved graf survival after renal transplantation in the United States: 1988-96. N Engl J Med: 2000; 342: 605-612. 6. Arend SM, Mallat MJ, Westendorp RJ. Patient Survival After Renal Transplantation; More Than 25 Years Follow-Up. Nephrol Dial Transplant 1997; 12:1672– 1679. 7. Ojo AO, Hanson JA, Wolfe RA. Long-Term Survival In Renal Transplant Recipients With Graft Function. Kidney Int 2000; 57:307– 313. 8. El-Zoghby ZM, Stegall MD, Lager DJ, et al. Identifying Specific Causes of Kidney Allograft Loss. Am J Transplant. 2009; 9: 527-535. 9. Cosio FG, Hickson LJ, Griffin MD. Patient survival and cardiovascular risk after kidney transplantation: The challenge of diabetes. Am J Transplant 2008;8:593-599. 10. Vanrenterghem YF, Claes K, Montagnino G, et al. Risk factors for cardiovascular events after successful renal transplantation. Transplantation 2008; 85:209. 11. Matas AJ, Human A, Gilligham KJ, et al. Five preventable www.conferenciasindromemetabolico.org

227


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

causes of kidney graft loss in the 1990s: A single center analysis. Kidney Int 2002;62: 704–714. 12. Pirsch JD, Miller J, Deierhoi MH. A comparison of tacrolimus (FK506) and cyclosporine for immunosuppression after cadaveric renal trasplantation: FK 506 Kidney Transplant Study Group. Transplantation. 1997;63(7):97783. 13. Cueto-Manzano et al: Risk Factor for long-ter graft loss in kidney transplantation: Experience of a Mexican single-center. Revista de investigación clínica 2001; 54: 492-496. 14. Rike AH, Mogilishetty G, Alloway RR, Succop P, Roy-Chaudhury P, Cardi M, Kaiser TE, Thomas M, Woodle ES: Cardiovascular risk, cardiovascular events, and metabolic syndrome in renal transplantation: comparison of early steroid withdrawal and chronic steroids. Clin Transplant 2009; 22:229-335. 15. Rike A, Mogilishetty G, Alloway R, Succop P, Roy-Chaudhury P, Cardi M, Kaiser T, Thomas M, Steve Woodle E. Cardiovascular risk, cardiovascular events, and metabolic syndrome in renal transplantation: comparison of early steroid withdrawal and chronic steroids. Clin Transplant 2008; 22: 229-235. 16. Lorenzo C, Hunt KL, Williams K, Haffner SM. The National Cholesterol Education Program– Adult Treatment Panel III, International Diabetes Federation, and World Health Organization Definitions of the Metabolic Syndrome as Predictors of Incident Cardiovascular Disease and Diabetes. 228

www.conferenciasindromemetabolico.org

Diabetes Care 2007; 30:8-13. 17. Courivaud Cecile, Kazory A, Simula-Faivre D, Chalopin JM, Duclou D. Metabolic Syndrome and Atherosclerotic Events in Renal Transplant Recipients. Transplantation. 2007; 83(12):1577-1581 18. Zimmet P, et al. Una nueva definición mundial del Síndrome Metabólico propuesta por la Federación Internacional de Diabetes: Fundamento y resultados. Rev. Esp. Cardiología. 2005;58:13711376. 19. The National Cholesterol Education Program (NCEP) Expert panel. Executive Summary of the Third report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III). 2001. Washington M; D.C; US Government Printing Office. 20. Arango Alvarez JJ: Protección renal y microalbuminuria en el síndrome metabólico. Acta Médica de Colombia 2005;30: 146149. 21. Alberti KG, Zimmet PZ: Definition, diagnosis, and classification of diabetes mellitus and its complications. Diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 2006;15: 535-536. 22. Hernández D, Torres A: Alteraciones del metabolismo de la glucosa tras el trasplante renal: Análisis de la evidencia. Nefrología Sup Ext 2010; 1 (2): 3-10. 23. Olaiz-Fernández G, Rivera-Dommarco J. Encuesta Nacional

V3-N1 - 2016

de Salud y Nutrición 2006. Cuernavaca, México: Instituto Nacional de Salud Pública, 2006. 24. Cornier Marc-Andre, Dana Dabelea, Teri L.Hernandez et al. The Metabolic síndrome. Endocrine Reviews, December 2008, 29(7):777-822. 25. Lorenzo C, Okoloise M, Williams K, Stern MP, Haffner SM 2003 The metabolic syndrome as predictor of type 2 diabetes: the San Antonio Heart Study. Diabetes Care 26:3153–3159 26. Aguilar-Salinas CA, Rojas R, Gomez-Perez FJ, Valles V, RiosTorres M, Franco A, Olaiz G, Rull JA, Sepulveda J 2004 High prevalence of metabolic syndrome in Mexico. Arch Med Res 35:76–81.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

RELACIÓN DEL ÍNDICE HOMA-IR CON PERIODONTITIS EN SUJETOS APARENTEMENTE SANOS L.E. Dan Jahel Peralta Prado1, D.C. Blanca Guadalupe Baez Duarte1, D.C. Irma del Carmen Zamora Ginez1, D.C. Eduardo Monjaraz Guzmán2, M.E.I. Olivia Marín Santillan3, L.E. Paulina Romero Jara1, Lic. Chrystopherson Gengyny Caballero Lopéz4 ABSTRACT Periodontitis (PD) is a disease affecting the periodonto and is present in more than 50% of the Mexican population. Insulin Resistance (IR) is a genetic disorder or acquired insulin action and is calculated using the evaluation of homeostasis insulin resistance (HOMA-IR) index. Different studies suggested that IR is related to the presence of obesity and there is still controversy about the relationship of the IR with the development of PD. The aim of this study was to determine the relationship between IR and PD in apparently healthy subjects. In the study participated the staff of 2 BUAP’s faculties. They were characterized anthropometric, biochemical and clinically. The PD diagnosis was performed by the Carlos et al index. The HOMA-IR index was calculated by formula glycemia (mg / dL) × insulin (mU / mL) / 405. Two study groups were formed (without and with PD) and were subdivided in subjects with and without overweight/obesity (OW/OB). Statistical analysis was performed with SPSS version 22. In the study participated 117 subjects (29 without PD y 88 with PD). No differences between groups in anthropometric and biochemical characteristics were found; but there were in insulin levels (p≤0.05). By subdividing the study groups were found that the group with PD and OW/OB had the highest values of HOMA-IR index and insulin levels (p≤0.05). Therefore, it is concluded that subjects with PD were more IR when OW/OB was present, which was reflected by compensatory hyperinsulinemia present. KEYWORDS: Periodontitis, HOMA-IR index, insulin resistance, obesity

I. INTRODUCCIÓN a periodontitis (PD) es una enfermedad crónica inflamatoria común, que afecta a los tejidos de soporte dental (periodonto), conduciendo a la pérdida progresiva de hueso alveolar, gingiva, ligamento de sostén y si no es tratada, se exfolian los dientes afectados.1 En la PD se ha observado que cambia el medio interno a causa de la translocación bacteriana (presencia de metabolitos como lipolisacáridos) y por mediadores de inflamación. Para determinar la PD, se utilizó el índice de Carlos y col.2, 3

L

La RI se define como un trastorno bioquímico-molecular caracterizado por la disminución de la sensibilidad a la acción metabólica de la insulina sobre la captación de glucosa por las células de los tejidos muscular esquelético y adiposo, una disminución en la producción hepática de glucógeno y aumento en la producción hepática de glucosa.4,5,6 La RI es raíz fisiopatológica de algunas enfermedades como son la diabetes tipo 2 (DT2) y la hipertensión arterial;

además está presente en individuos con intolerancia a la glucosa e incluso en el 25% de sujetos delgados aparentemente sanos con tolerancia normal a la glucosa.4 Las causas de la RI pueden ser genéticas o adquiridas, sin embargo sus mecanismos son poco comprendidos; en culturas occidentales los factores de riesgo para el desarrollo de RI más comunes son la edad, vida sedentaria y la obesidad.7 Para la evaluación de la RI se eligió el índice HOMA-IR, por tener buena correlación con mediciones complejas como lo es el estándar de oro (Clamp euglicémico-hiperinsulinémico).8 Diferentes estudios han reportado que la inflamación originada por la presencia de la PD influye en el control glucémico de los pacientes con diabetes y podría tener influencia en el origen de la RI en sujetos sanos. Sin embargo, su relación es bidireccional y no está bien esclarecida.4, 9 El objetivo de este estudio fue determinar la relación entre el índice HOMA-IR y la PD en sujetos aparentemente sanos.

Facultad de Medicina, Benemérita Universidad Autónoma de Puebla (BUAP) Instituto de Fisiología, BUAP 3 Facultad de Estomatología, BUAP. Hospital Universitario HUBUAP 1 2

www.conferenciasindromemetabolico.org

229


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

II. METODOLOGÍA El estudio fue observacional, comparativo y transversal, y en el cual participó personal académico y administrativo de la Facultad de Contaduría y Arquitectura de la BUAP. Los sujetos fueron caracterizados clínica, bioquímica y antropométricamente. Posteriormente se diagnosticó la PD según el índice de Carlos y col., y se conformaron los grupos fue: 1) Sin PD y 2) Con PD. Posteriormente se subdividió a la población en sujetos con y sin sobrepeso/obesidad (SOB). Se calculó el índice HOMA-IR con la fórmula glucosa en ayuno (mg/dL) × insulina en ayuno (µU/mL)/405. Para el análisis estadìstico se utilizó el paquete SPSS v.22. III. RESULTADOS En este estudio participaron 117 sujetos que cumplieron con los criterios de selección, los cuales se dividieron en dos grupos: 29 sujetos sin PD y 88 con PD, el grupo sin PD presentó de manera significativa una edad menor (39.8 ± 7.3 años) en comparación con el grupo con PD (45.2 ± 10.6 años, p ≤ 0.05). Participaron 65 mujeres y 52 hombres, no siendo diferente la proporción entre los grupos de estudio (grupo sin PD 20 mujeres y 9 hombres; grupo con PD 45 mujeres y 43 hombres, p > 0.05). En el cuadro 1 se muestran las características antropométricas y bioquímicas de los grupos de estudio. No se encontró diferencia en la presencia de sobrepeso y obesidad entre ambos grupos de estudio (p > 0.05). La única variable cuyos niveles fueron diferentes 230

www.conferenciasindromemetabolico.org

entre los grupos de estudio fue la insulinemia (p ≤ 0.05). Posteriormente al subdividir a los grupos de estudio en sujetos sin y con SOB, se encontró en el grupo con PD y con SOB mayores valores del índice HOMA-IR y niveles de insulina en comparación a los demás subgrupos (Cuadro 2). Por otro lado, se observó una correlación significativa entre la PD y el índice HOMA-IR (rho = 0.1766, p = 0.05); sin embargo, al ajustar por IMC la correlación fue no significativa (rho = 0.1305, p = 0.1645). IV. CONCLUSIONES En este estudio se encontró que los niveles de insulina en el grupo con PD fueron mayores que en el

grupo sin PD. Además, se encontró que el grupo con PD y con SOB presentó los niveles de insulina y valores del índice HOMA-IR mayores con respecto a los otros subgrupos. Estos resultados sugieren que las alteración en la producción de insulina (hiperinsulinemia) y en su función (RI), podrían deberse a la alteración en la señalización de insulina o mensajeros moleculares presentes, tanto en periodontitis como en obesidad. Por lo que, se sugiere que ambos trastornos, contribuyen al desarrollo de la RI. V. BIBLIOGRAFÍA 1. - Palm E., Demirel I., Bengtsson T., Khalaf H. The role of toll-like and protease-activated receptors


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

in the expression of cytokines by gingival fibroblasts stimulated with the periodontal pathogen Porphyromonas gingivalis. Elsevier journal. 2015. Ago 24 (9). 2.-Carlos JP, Wolfe MD and Kingman A: The Extent and Severy Index: A simple method for use in epidemiologic studies of periodontal disease. J Clin Periodontol 1986; 13: 500-505 3.-Botero J., Kuchenbecker C., Duque A., Jaramillo A., Contreras A., Periodontal disease in children and adolescents of Latin America. John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. Periodontology 2000. 2015. Vol. 67, 34–57 4.- Consenso Mexicano de Resistencia a la Insulina y Síndrome Metabólico. Asociación Nacional de Cardiólogos de México, A.C. Revista Mexicana de cardiología. Enero-Marzo, 1999 10(1):3 5.- Martinez A., Maldonado J., López M. Métodos diagnósticos de la resistencia a la insulina en la población pediátrica. Bol Med Hosp Infant.2011.68(5):397-404 6. - Galgani J.,Ravussin E. Postprandial whole-body glycolysis is similar in insulin-resistant ad insulin-sensitive non-diabetic humans. HHS Public Diabetología.2015 Mar, 16. 55 (3):737-742. 7.- Baez-Duarte BG., Zamora I., Cortés Celso., Bilbao T., Cebada J., Galicia S.,et al.Sensibilidad a la insulina y síndrome metabólico. RCAN. Vol. 24. Número 1 2014 Enero – Junio.140-149 8.- Carrasco F., Galgani J., Reyes M. Síndrome de resistencia a la insulina. Estudio y manejo. REV.MED.

V3-N1 - 2016

CLIN. CONDES - 2013; 24(5)827837. 9. – Islam A., Se o M., Lee YS., and Moon SS., Association of periodontitis with insulin resistance, β-cell function, and impaired fasting glucose before onset of Diabetes. Endocrinology Journal. 2015 Jun,17 03(50) 1-8

www.conferenciasindromemetabolico.org

231


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

INFLUENCIA DEL CONSUMO DE ÁCIDOS GRASOS SATURADOS, FIBRA Y AGUA, SOBRE LOS COMPONENTES DEL SÍNDROME METABÓLICO EN JÓVENES OBESOS LN. Constanza Cecilia Astudillo-López1, QBP. Aralia Berenice Salgado-Bernabé1, Dra. Inés Matia-García1, QBP. Lizeth Alejandra Vega-Hilario1, QBP. Rubén Barrientos-Noriega1, Dra. Luz Elena Ramos-Arellano1, Dr. José Francisco Muñoz-Valle2, Dr. Lorenzo Salgado-Goytia1, Dra. Isela Parra-Rojas1 ABSTRACT. The objective of this study was to analyze the differences in nutrient intake between metabolically healthy obese youth (MHO) and metabolic syndrome (MS). Methodology. This study included 100 obese young people 18 to 29 years old in the State of Guerrero, Mexico, 68 MHO and 32 obese patients with MS. All participants, were determined anthropometric, clinical and biochemical characteristics. MS diagnosis was made according to the NCEP-ATP III. To assess the nutritional composition of the diet, it was used a frequency questionnaire food consumption, analyzed in a software Nutrimind, 2013 (Mexico). For statistical analysis, the STATAv 12.1 software was used. Results. The prevalence of MS was 71.9% in men. Men with MS, have higher CC and greater caloric intake in relation to the men MHO. The group SM presents higher BMI, SBP, DBP and low HDL levels and high consumption of saturated fatty acids (SFA) and a lower intake of fiber and water, compared to MBOs. In the linear regression analysis, it was found that an intake of SFA> 18g tends to increase the CC, and fiber consumption <29g decreases HDL levels. In conducting the analysis adjusting for BMI, gender and physical activity, it shows that consumption SFA> 18g, fiber <29g and water <1,500ml increases the CC, PAS and triglycerides, and fiber intake <29g lowers levels of HDL. Conclusion. In a group of university students with obesity, the prevalence of MS was higher in men and associated with the consumption of SFA, fiber and water. KEYWORDS. Metabolic syndrome, metabolically healthy obese, saturated fatty acids, fiber, water

I. INTRODUCCIÓN a obesidad se define como una acumulación anormal o excesiva de grasa, que puede no ser perjudicial para la salud1, pero en muchos casos, se relaciona con distintas comorbilidades, una de ellas puede ser el síndrome metabólico (SM). Las personas con obesidad, no siempre presentan todos los componentes del SM, por ello es importante dilucidar las características que protegen a algunos pacientes obesos contra alteraciones metabólicas2. Se creó el concepto de ObMS, en la cual los individuos no presentan altera-

L 232

www.conferenciasindromemetabolico.org

ciones metabólicas, sin embargo, recientes estudios han propuesto considerar al ObMS, cuando no presenta SM bajo los criterios del ATPIII3,4. Tanto la obesidad, como el SM tienen una etiología multifactorial y una de las características más importantes, son los factores ambientales, de los cuales la dieta juega un papel primordial5,6, por lo tanto consideramos importante analizar las diferencias entre el consumo de nutrientes en ObMS y

obesos con SM.

II. METODOLOGÍA Se realizó un estudio en 100 jóvenes guerrerenses con obesidad (IMC ≥30kg/m2) de 18 a 29 años de edad. El diagnóstico de SM se hizo de acuerdo a los criterios del NCEP-ATPIII (National Cholesterol Education Program Adult Treatment Panel III)7, se detectaron 68 ObMS y 32 obesos con SM. Se determinaron las características antropométricas, clínicas y bioquímicas a todos los participantes. Para evaluar la composición nutricional de la dieta, se utilizó un cuestionario de frecuencia de consumo de alimentos8, el cual fue analizado en el software Nutrimind, 2013 (México). Para la evaluación de la actividad física, se utilizó la versión corta del cuestionario internacional de actividad física9. El análisis estadístico, se realizó utilizando el software STATAv 12.1. Las pruebas estadísticas utilizadas fueron X2, Mann Whitney y se realizaron modelos de regresión lineal, considerando las diferencias significativas con valor

Laboratorio de Investigación en Obesidad y Diabetes, Facultad de Ciencias Químico Biológicas, Universidad Autónoma de Guerrero 2 Instituto de Investigación en Ciencias Biomédicas, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara 1


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

de p<0.05.

III. RESULTADOS En la tabla 1, se muestran las características clínicas y bioquímicas de la población estudiada, se observan diferencias significativas (p>0.05) entre género, siendo mayormente los hombres quienes presentan SM (71.9%), además los hombres con SM presentan mayor CC (113 vs 106 cm, p=0.01), así como una mayor ingesta de energía total (3014 vs 2667kcal, p=0.009), que en los hombres ObMS, respectivamente. El grupo con SM presenta mayor IMC, PAS, PAD y niveles bajos de HDL en comparación a los ObMS (p=<0.05). Con respecto a la ingesta de nutrientes, se observó que el grupo con SM tiene un mayor consumo de AGS y una menor ingesta de fibra y agua en comparación a los ObMS. En la tabla 2, se muestra el análisis de regresión lineal para evaluar el efecto de la ingesta elevada de AGS y el bajo consumo de fibra y agua sobre los componentes del SM, donde se observa que la ingesta de AGS >18g tiende a incrementar la CC en 6.59 cm (p=0.04) y el consumo de fibra <29 g disminuye los niveles de HDL hasta -11.34 md/ dL (p=0.001). También, se realizó el análisis ajustando por IMC y género (modelo 1) y otro ajustado por IMC, género y actividad física (modelo 2), en ambos modelos se observa que el consumo de AGS >18g, fibra <29 g y agua <1,500 ml incrementa la CC, PAS y triglicéridos, y el consumo de fibra <29 g disminuye los niveles de HDL.

www.conferenciasindromemetabolico.org

233


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

IV. CONCLUSIONES En un grupo de jóvenes universitarios con obesidad, la prevalencia de SM fue mayor en los hombres y se encontró relacionado con el consumo de ácidos grasos saturados, fibra y agua.

V. BIBLIOGRAFÍA 1. Organización Mundial de la Salud (OMS). (2015). Nota informativa nº311. http://www.who.int/ mediacentre/factsheets/fs311/ es/ 2. Bluher, M. (2010). The distinction of metabolically ‘healthy’ from ‘unhealthy’ obese individuals. Curr Opin Lipidol; 21: 38–43 3. Primeau, V; Coderre, L; Karelis, AD; et al. (2011). Characterizing the profile of obese patients who are metabolically healthy Characterizing the profile of obese patients who are metabolically healthy. International Journal of Obesity; 35, 971-981 4. Gomez-Ambrosi, J; Silva, C; Galofre, JC; et al. (2012). Body mass index classification misses subjects with increased cardiometabolic risk factors related to elevated adiposity. Int J Obes (Lond);36:286–294 5. Breen, C; Ryan, M; McNulty, B; Gibney, MJ; Canavan, R; O’Shea, D. (2014). High saturated-fat and low-fiber intake: a comparative analysis of nutrient intake in individuals with and without type 2 diabetes. Nutrition & Diabetes. (4). 6. Appel, LJ; Sacks, FM; Carey, VJ; Obarzanek, E; Swain, JF; Miller, ER; et al. (2005). Effects of protein, monounsaturated fat, and carbohydrate intake on blood pres234

www.conferenciasindromemetabolico.org

sure and serum lipids: results of the OmniHeart randomized trial. JAMA, 294(19): 2455-2464. 7. Executive Summary of The Third Report of The National Cholesterol Education Program [NCEP] Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults [Adult Treatment Panel III]. JAMA 2001; 285:24862497. 8. Gutiérrez, JP; Rivera-Dommarco, J; Shamah-Levy, T; Villalpando-Hernández, S; Franco, A; Cuevas-Nasu, L; Romero-Martínez, M; Hernández-Ávila, M. (2012). Cuestionario de frecuencia de consumo adolescentes-adultos (>12 años de edad). Herramienta utilizada en Encuesta Nacional de Salud y Nutrición. INSP, (MX). 9. Guidelines for Data Processing and Analysis of the International Physical Activity Questionnaire (IPAQ)– Short Form. (2005). [www.ipaq.ki.se].

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA DEL SÍNDROME METABÓLICO Y SUS COMPONENTES EN PACIENTES CON DIABETES Meza-Guillén Daniela1, Silva-Tinoco Rubén2, Canela-Mayoral José2, Rodríguez-Lagunés Lourdes2, Merchak-Carmona Emilio2, Puertos-Tavares Jennifer2, Rangel-Alcantara Miriam2, Hernández-Diego Julio2, Juárez-Rojas Juan3, Vázquez-Noriega Carlos2, Aguilar-Pérez Elsa2, León-García Enrique2 I. INTRODUCCIÓN a diabetes es un problema creciente de salud a nivel mundial. Datos publicados por la Federación Internacional de Diabetes muestran que la prevalencia de diabetes mellitus tipo 2 (DM2) en México, se encuentra entre las primeras 10 de todo el mundo y esto es importante ya que en 2010 se estimó que los costos para el cuidado de la enfermedad ascendieron a 3.43 billones de dólares; además de reducir la expectativa de vida en 5-10 años. Por otro lado, el síndrome metabólico (SM), también altamente frecuente en nuestra población (50%), es un agrupamiento de factores de riesgo que incluyen obesidad abdominal, intolerancia a la glucosa, hipertensión arterial sistémica y dislipidemia caracterizada por valores bajos del colesterol de las lipoproteínas de alta densidad (C-HDL) y altos de triglicéridos. Tanto la DM2 como el SM han mostrado ser factores de riesgo determinantes e independientes en la aparición de enfermedad cardiovascular; ejerce efectos sinérgicos en la patogénesis y la progresión de esta enfermedad, lo que resulta en una alta prevalencia de eventos cardiovasculares en sujetos con DM2 y SM. El objetivo del presente trabajo fue investigar la prevalen-

L

cia de síndrome metabólico y sus componentes en pacientes con DM2 con buen control y con mal control glucémico.

II. METODOLOGÍA Se incluyeron 203 pacientes de ambos géneros, con diagnóstico previo de DM2 y sin complicaciones derivadas de la enfermedad. Se definió control glucémico inadecuado a cifras de hemoglobina glucosilada (HbA1c) > 7.0%. Considerando que la población estudiada tiene el diagnóstico de DM2, la presencia de síndrome metabólico se definió con la presencia de obesidad más cualquiera de los otros tres componentes que pueden formar parte del síndrome metabólico (hipertensión arterial sistémica, hipertrigliceridemia y/o niveles de HDL-Colesterol bajo) acorde a la definición de la Federación Internacional de Diabetes. Los criterios del SM utilizados fueron: circunferencia de cintura ≥ 80 para mujeres y ≥ 90 para los hombres; diagnóstico de hipertensión arterial; triglicéridos ≥ 150mg/dL y C-HDL < 50 para mujeres ó < 40 para hombres.

III. RESULTADOS En la tabla se describen las características generales de la población. La prevalencia de síndrome metabólico fue de 79.3% (27.3% con tres componentes, 34.3% con 4 componentes y 17.7% con 5 componentes). La prevalencia de síndrome metabólico fue mayor en el grupo de pacientes con mal control glucémico (82.4% vs 64.5%; p = 0.023). Las prevalencias de los componentes del síndrome metabólico fueron: triglicéridos elevados 61.4%, Colesterol-HDL 58.4% e hipertensión arterial sistémica (50%). IV. CONCLUSIONES Los resultados del presente trabajo muestran una elevada prevalencia de SM en pacientes con DM2. La prevalencia del síndrome es mayor entre los pacientes con mal control glucémico. Lo anterior resalta la complejidad clínica de atender a pacientes con diabetes que además tienen síndrome metabólico, con objeto de reducir la aparición de complicaciones asociadas a estas dos entidades.

Maestra en Ciencias de la Salud, Licenciada en Nutrición y Educadora en Diabetes. Centro Especializado en el Manejo de la Diabetes de la Ciudad de México, Servicios de Salud Pública CDMX. 3 Instituto Nacional de Cardiología Ignacio Chávez 1 2

www.conferenciasindromemetabolico.org

235


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V. BIBLIOGRAFÍA 1. Alberti KG, Eckel RH, Grundy SM, et al. Harmonizing the metabolic syndrome: a joint interim statement of the International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity. Circulation 2009;120:1640-5. 2. Athyros VG, Mikhailidis DP. High incidence of metabolic syndrome further increases cardiovascular risk in patients with type 2 diabetes. Implications for everyday practice. J Diabetes Complications 2016;30:9-11. 3. Kaur J. A comprehensive review on metabolic syndrome. Cardiol Res Pract 2014;2014:943162. 4. Bhatti GK, Bhadada SK, Vijayvergiya R, et al. Metabolic syndrome and risk of major coronary events among the urban diabetic patients: North Indian Diabetes and Cardiovascular Disease Study-NIDCVD-2. J Diabetes Complications 2016;30:72-8. 5. Lee EA, Gibbs NE, Martin J, et al. Improving Care in Older Patients with Diabetes: A Focus on Glycemic Control. Perm J 2016;20(3). 6. Flores-Hernández S, Saturno-Hernández PJ, Reyes-Morales H, Barrientos-Gutiérrez T, Villalpando S, Hernández-Ávila M. Quality of Diabetes Care: The Challenges of an Increasing Epidemic in Mexico. Results from Two National Health Surveys (2006 and 2012). PLoS One 2015;10:e0133958. 236

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

GRUPOS DE AYUDA MUTUA, ESTRATEGIA PARA EL TRATAMIENTO DE LAS ENFERMEDADES CRÓNICO DEGENERATIVAS: IMPACTO DE LA ORIENTACIÓN NUTRICIONAL Mtra. en S.F.C. Grisel Barrios Rodríguez1, Dr. en E.P. Alberto Salgado Valdés2 Mtra. en A. Floristela Luna Hernández3, Mtra. en I.A Blanca Gabriela Cuevas González4 I. INTRODUCCIÓN as enfermedades crónico-degenerativas son los padecimientos que predominan entre la población de edad adulta y constituyen las principales causas de la mortalidad general1. La Diabetes tipo 2 y la hipertensión arterial son padecimientos de larga duración, la persona afectada puede vivir mucho tiempo con la enfermedad y ésta evoluciona progresivamente. En estos padecimientos la prevención primaria y secundaria tiene un impacto en la calidad de vida. Datos de la Encuesta Nacional de Salud y Nutrición 2006 (ENSANUT 2006) muestran que la prevalencia de diabetes a nivel nacional es de 32.7% y de hipertensión arterial de 30.8%, mientras que la prevalencia general de hipercolesterolemia es de 26.5% con 28.8% correspondiente a mujeres y 22.7% a hombres2, en edad adulta. La ENSANUT 2012 reporta que el 9.1% de la población tiene diabetes mellitus tipo 2 presentando un incremento del 59.6% con respecto a la ENSA 2000. Por otra parte, hay 22.4 millones de adultos mexicanos con hipertensión arterial.3 La situación laboral es una condición que determina el estado de salud de la población adulta. En los últi-

L

mos años se han producido cambios en el diseño y las exigencias del trabajo por lo que el estrés se ha hecho más frecuente dentro de los trabajadores convirtiéndose en un posible riesgo de trastornos somáticos y mentales4. Las enfermedades crónicas afectan la productividad de los individuos y su capacidad de generar ingresos3 y, por otra parte, al aumentar la morbi-mortalidad se incrementa la demanda de los servicios de salud de alto costo5, lo cual incrementa la inversión del capital nacional en los servicios de salud y tratamientos para las personas que sufren estos padecimientos. La evidencia científica sugiere que la historia natural de las enfermedades crónicas no está determinada por un deterioro biológico producido por el envejecimiento sino por factores ambientales modificables como son: el sedentarismo, tabaquismo, sobrepeso u obesidad, consumo excesivo de sal y alcohol3; de ahí la importancia de identificar los factores de riesgo que influyen en

la prevalencia de éstas enfermedades. El estado nutricional es resultado de un sistema de balance determinado por la relación entre el consumo de nutrimentos y el gasto de los mismos6. La Encuesta Nacional de Enfermedades Crónicas (ENEC1993) mostró que la prevalencia de obesidad en adultos era de 21.5%7, mientras que con datos de la Encuesta Nacional de Salud (ENSA 2000) se observó que 24% de los adultos la padecían8. En la ENSANUT 2006 se encontró que alrededor del 70% de la población adulta, de entre los 30 a 60 años, tiene sobrepeso y obesidad2. El aumento en la prevalencia de obesidad en los últimos nueve años es alarmante por su marcado papel en el aumento del riesgo de padecer enfermedades crónicas que provocan la muerte a edades tempranas y pérdida de años de vida saludable. Por lo que urgen medidas gubernamentales e institucionales que intervengan en la estructuración e implementación de programas de salud en nutri-

Profesora de Tiempo Completo de la Unidad Académica Profesional Acolman, Universidad Autónoma del Estado de México. Nutrióloga. Instituto de Salud del Estado México 2 Coordinador de la Unidad Académica Profesional Acolman, Universidad Autónoma del Estado de México 3 Profesora de Tiempo Completo de Unidad Académica Profesional Acolman, Universidad Autónoma del Estado de México 4 Profesora de Tiempo Completo en la Unidad Académica Acolman, Universidad Autónoma del Estado de México. 1

www.conferenciasindromemetabolico.org

237


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

ción que se encaminen al conocimiento de la alimentación y al mejoramiento de la calidad de vida de los adultos. Existe evidencia de que las intervenciones nutricionales son de gran utilidad para ayudar a prevenir la de las enfermedades crónico-degenerativas por medio de educación sobre hábitos saludables9. Dichas intervenciones son efectivas cuando ayudan al cambio de los patrones de alimentación y ejercicio. Se ha observado que las estrategias simples pero efectivas pueden reducir el riesgo de enfermedades crónico-degenerativas. La educación nutricional y de actividad física son herramientas claves para el cambio de estilo de vida y los cambios en el estilo de vida llevan a cambios significativos a lo largo del tiempo 10,11. Por todo lo anteriormente descrito este proyecto muestra la evaluación y monitoreo de prevalencia de sobrepeso y obesidad, así como de diabetes e hipertensión arterial en adultos que integran los Grupos de Ayuda Mutua (GAM) de los Centros de Salud Urbanos “Pirules” (Cuidándonos vivimos mejor), “Impulsora” (Libertad) y “Aurora” (Milagro de Amor) de la Jurisdicción Nezahualcóyotl y la influencia de los hábitos alimentarios, la actividad física y los conocimientos nutricionales en dicho estado de nutrición, así como conocer el impacto de la educación nutricional y las recomendaciones de actividad física sobre el estado de nutrición y salud de dicha población. Es así es como el presente proyecto intenta un acercamiento a este sector de la población que permitirá 238

www.conferenciasindromemetabolico.org

estudiar los hábitos y comportamientos alimentarios que alteran el estado nutricional y de salud de los adultos, aportando más información al tema.

II. OBJETIVOS GENERALES 1. Evaluar la prevalencia de sobrepeso y obesidad y las determinantes de este estado nutricional en adultos que integran los Grupos de Ayuda Mutua. 2. Analizar la influencia de la orientación nutricional en el estado de nutrición. 3. Crear un taller de alimentación, en colaboración de un chef, para el aprendizaje de la elaboración de menús saludables tomando en consideración la economía, cultura y educación nutricional que se le proporcione a la población. III. METODOLOGÍA Población y tamaño de muestra La población de estudio la constituyó pacientes que integran los Grupos de Ayuda Mutua de los Centros de Salud Urbanos “Pirules”, “Impulsora” y “Aurora” de la Jurisdicción Nezahualcóyotl; siendo un total de 71 pacientes de edad adulta.

V3-N1 - 2016

so y la obesidad en adultos. Para diagnosticar a los pacientes como obesos o con sobrepeso se utilizó los puntos de corte propuestos por la Secretaria de Salud 12.

Recolección y análisis de datos Los datos fueron recolectados de Octubre a Diciembre de 2015. Se midió el peso con una báscula de plataforma de 150 kg de capacidad de carga, que incluye un estadímetro para la medición de talla se midió con división de 1mm y un rango de medición de 1 a 2 metros. Se pesó a los sujetos de estudio sin zapatos, erguidos y manteniendo inmóviles sus brazos paralelos al eje corporal. Se midió su talla en la misma posición 13. Se les midió la circunferencia de cintura para valorar el riesgo cardiovascular utilizando los puntos de corte propuestos por el Instituto Mexicano de Seguro Social (IMSS) 14. Se utilizó una cinta flexible con división de 1 mm y un rango de medición de 2 m. Se realizó una encuesta para conocer los hábitos alimentarios de los pacientes y su nivel de actividad física y se evaluaron sus conocimientos nutricionales dándole a cada paciente un paquete de imágenes de distintos alimentos los cuales debía clasificar en los diversos grupos que según el valorara dándole nombres a los conjuntos que formase, así como las características que le atribuyen a cada grupo que designaron.

Diseño de estudio Se realizó un estudio longitudinal para conocer la prevalencia de sobrepeso y obesidad entre los pacientes que acuden a dicho centro de salud y la asociación con sus hábitos alimentarios, actividad física y sus conocimientos nutricionales. Se utilizó el Índice de Masa Corpo- Descripción de la intervención ral [IMC= peso (kg)/ talla (m) al En base a los resultados se realizó cuadrado] para medir el sobrepe- el diagnóstico nutricional de los


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

pacientes y el tratamiento de cada persona se realizó mediante un cálculo dietético y se manejó con sistema de equivalentes considerando la presencia de alguna patología. Se proporcionó un formato de equivalentes en donde se señalan las raciones recomendadas de cada grupo de alimentos para que lo vayan analizando y se comenzó a trabajar en aquellos hábitos que les son más sencillos modificar haciéndoles hincapié en que el tratamiento es gradual y los cambios corporales van a ser poco a poco. Se implementaron secciones de ejercicio para promover la actividad física, asimismo se les hizo recomendaciones, aquellas personas que no podían asistir a las secciones de ejercicio, y se les proporcionaban opciones según sea el caso. Se planea tomar posteriores evaluaciones para conocer las variaciones en sus medidas antropométricas y sus hábitos de alimentación para poder hacer los cambios pertinentes y revalorar las metas nutricionales. Análisis estadístico Se utilizó el programa estadístico SPSS versión 20.0 para el procesamiento de los datos y Excel de Windows para la realización de gráficos que representen las características de la población de estudio.

IV. RESULTADOS En la tabla 1 se muestran las características generales de la población, en ella se puede observar que de los 71 pacientes atendidos

el 84.5% son mujeres y 15.49% hombres, el rango de edad más frecuente es de 18 a 59 años de edad (56.33%). Al calcular el IMC se notó que sólo el 9.855 se encontraba en condiciones normales; mientras que el 90.13% presentaba tanto sobrepeso como obesidad (18.30% y 71.83%, respectivamente). Al indagar sobre su actividad física el 22.53% practica algún tipo de ejercicio. En cuanto a la prevalencia de enfermedades crónico-degenerativas, la diabetes presentó el 64.63 y la hipertensión arterial, 35.36%. En las figuras 1, 2, 3 y 4 se muestra los cambios obtenidos de las variables de peso, circunferencia de cintura, niveles de glucosa y presión arterial, comparando los promedios, obtenidos en cada GAM de cada centro de salud del mes de Octubre, y contrastándolo con los promedios obtenidos en el mes de Diciembre. En cuánto al peso corporal se muestra una diferencia, comparada con el inicio de la orientación alimentaria, de 3.7, 4.5 y 7.42% de los centros de salud Pirules, impulsora y aurora, respectivamente. En lo que se refiere a la circunferencia de cintura, se presentó una disminución de 2.59, 4.48 y 12.58 cm., respectivamente. Los niveles de glucosa y presión arterial también tuvieron una diferencia significativa comparada con los promedios iniciales, concluyendo con un promedio final de 118.4 mg/dl, 127.1 mg/dl y 138.222mg/dl y, 118.4 / 77.5 mmHg, 127.6 / 81.5 mmHg y 119.54 / 74.08 mmHg, respectiva-

V3-N1 - 2016

mente, para cada GAM. V. DISCUSIÓN Y CONCLUSIONES El nutriólogo es la figura clave en el equipo de nutrición comunitaria donde interactúa junto con otros profesionales como médicos, enfermeros, trabajadores sociales, docentes de las distintas etapas de la enseñanza, sociólogos, antropólogos y psicólogos, entre otros, para intervenir en los distintos contextos en los que interactúa la población, sobre todo en el seno familiar, en el colegio o institutos. El individuo se encuentra influenciado por factores que van desde los puramente biológicos, hasta los ecológicos, económicos, políticos e ideológicos, y es por ello que el planteamiento de cualquier campaña de educación nutricional supone debe contemplar a los mismos por lo que la información nutricional transmitida ha de ir acompañada de una serie de técnicas y métodos que faciliten el cambio de actitud tanto en niños, jóvenes y adultos, teniendo en cuenta los condicionantes que intervienen en las elecciones alimentarias.16,17 Por lo anterior, los comportamientos y los estilos de vida nos son asuntos exclusivamente individuales e íntimos, los estilos de vida no se reducen a decisiones individuales, sino que dependen de los límites impuestos por el entorno físico, socio-cultural, e influenciados directamente por sus medios económicos. De acuerdo a lo reportado por Burnet et al.11 con respecto a que las estrategias sobre recomendaciones de consumo de alimenwww.conferenciasindromemetabolico.org

239


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tos adecuados pueden ayudar a mantener la salud y prevenir enfermedades, encontramos que la orientación nutricional otorgada a los pacientes de los Grupos de Ayuda Mutua tuvo un impacto muy significativo en las personas, las cuales comenzaron a reducir su peso adoptando el plan de alimentación que se les otorgó o haciendo ligeros cambios en su estilo de vida, asimismo con ayuda de la implementación de actividad física. El 98.59% de los pacientes con intervención nutricional tuvo una modificación en su peso corporal y sus niveles de glucosa y presión arterial, lo que hace suponer que existió un impacto en la orientación brindada; aunque sólo se tomó en cuenta una diferencia significativa a aquellos sujetos que tuvieron una variación mayor de ± 1 kg. Foster et al. señalan que el tratamiento conductual es necesario para que los individuos desarrollen una serie de habilidades que les permitan mantener un peso saludable. Mencionan que este tratamiento va más allá de ayudar a las personas a identificar qué deben cambiar; se debe de ayudar a identificar cómo deben cambiar 18, esto se observa al relacionar el conocimiento nutricional con el estado de nutrición destacando que aquellos con sobrepeso u obesidad presentaron los más altos niveles de conocimiento sobre nutrición. Con el tratamiento conductual las personas aprenden a identificar señales que están vinculadas con la ingesta de alimentos y se re240

www.conferenciasindromemetabolico.org

fuerza la adopción de conductas positivas. El tratamiento incluye el automonitoreo, el establecimiento de metas (el QUÉ) y la solución de problemas (el CÓMO). Se ha visto que con este tipo de tratamiento puede haber una pérdida de peso de entre 8 y 10% en 6 meses18. Se han encontrado otros estudios en los que se dieron asesorías a mujeres obesas en uno de tres grupos: 1) asesoría individual; 2) asesoría grupal; 3) asesoría grupal con terapia conductual, observándose que todos los grupos perdieron peso, no obstante sólo los grupos 1 y 3 mantuvieron la pérdida de peso a un año 19. En este proyecto más allá de dar el manejo individual de cada individuo que requiere pérdida de peso se deba emplear en conjunto con la orientación grupal, de ahí la base de la conformación de los GAM, contemplando manejo conductual para obtener un mayor impacto nutricional para aumentar la motivación y el logro de metas de los pacientes sobre todo en la población adulta ya que son ellos los que inculcan los hábitos de alimentación en la población infantil y adolescente los cuales ya se ven influenciados por las inadecuadas conductas adquiridas. Una limitación del estudio es que a los pacientes no se les tomo en cuenta datos de bioimpedancia eléctrica, lo que hubiera dado información más acertada sobre el cambio de composición corporal de los mismos. Además los resultados cualitativos aportan más acerca de posibles cambios en algunos hábitos de los participantes. Es necesario también saber qué impacto tienen

V3-N1 - 2016

las guías que indican la importancia de una alimentación adecuada y dan a conocer cómo debe ser un plan de alimentación saludable20 para poder implementar programas eficientes y sea posible contribuir a mejorar el estado de salud de la población adulta y a la prevención de enfermedades crónico - degenerativas. Por otra parte, la participación en el primer concurso “Por un menú saludable” permitió que las personas aterrizaran los conocimientos nutricionales adquiridos en la elaboración de sus alimentos de acuerdo a su(s) patología(s), con ayuda de un chef que los oriente en su preparación y así lograr una alimentación variada, suficiente, equilibrada y balanceada para lograr un buen estado de salud. Dados los resultados obtenidos es imprescindible que un chef conforme parte del grupo multidisciplinario para tener un mejor impacto en la salud de la población. VI. REFERENCIAS BIBLIOGRÁFICAS 1. Secretaria de Salud. Programa de Acción: Enfermedades Cardiovasculares e Hipertensión Arterial. México, 2010: 13-36. 2. Olaiz-Fernández G, Rivera- Dommarco J, Shamah-Levy T, Rojas R, Villalpando-Hernández S, Hernández-Ávila M, Sepúlveda-Amor J. Encuesta Nacional de Salud y Nutrición 2006. Cuernavaca, México: Instituto Nacional de Salud Pública, 2006: 75-100. 3. INSP. (2012). Encuesta Nacional de Salud y Nutrición 2012. México. Disponible en: http://ensanut.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

insp.mx/ 4. Sauter, S. et al. Factores psicosociales y de organización. En: Enciclopedia de Salud y seguridad ocupacional. 4ª edición. Madrid, 1998: 34.1-34.68. 5. Ávila-Curiel A, Shamah T, Chávez A, Galindo C. Resultados de la Encuesta Urbana de Alimentación Nutrición en la Zona Metropolitana de la Ciudad de México 2002. Estratos socioeconómicos bajos. Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, 2003: 63. 6. Casanueva E. ¿Qué alimentos compran los capitalinos? Cuadernos de Nutrición, 2010: 10(6): 9-15. 7. Secretaria de Salud, Dirección General de Epidemiología. Encuesta Nacional de Enfermedades Crónicas, 1993. México, D.F.; SSA, 1993: 1-29. 8. Rivera Dommarco J, Shamah Levy T, Villalpando Hernández S, González de Cossio T, Hernández Prado B, Sepúlveda J. Encuesta Nacional de Nutrición 1999. Estado nutricio de niños y mujeres en México. Cuernavaca, Morelos, México: Instituto Nacional de Salud Pública, 2001:73. 9. Department of health and human services. Centers for Disease Control and Prevention. Public health strategies for preventing and controlling overweight and obesity in school and worksite settings: A report on recommendations of the Task Force On Community Preventive Services Morbidity and Mortality Weekly Report Recommendations and Reports October 7, 2015 / Vol. 54 / No. RR-10.

10. Ross P, Walter C, Greenwald P, Alberts D, Bernstein L, et al. Nutrition and physical activity and chronic disease prevention: Research strategies and recommendations. Journal of the National Cancer Institute 2012; 96 (17). 11. Burnet D, Elliott L, Quinn M, Plaut A, Schwartz M, et al. Preventing diabetes in the clinical setting. J gen intern med 2012; 21:84–93. 12. NOM-174-SSA1-1998. Manejo Integral de la Obesidad. Disponible en: http://bibliotecas.salud. gob.mx/gsdl/collect/nomssa/index/assoc/HASHeba1.dir/doc.pdf 13. Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán. Manual de antropometría. 14. Instituto Mexicano del Seguro Social (IMSS). México, 2008. Disponible en: http://www.imss.gob.mx/Nutricion/Circunferencia_cintura.htm 15. Navas L J. La educación nutricional: una herramienta imprescindible. Escuela Universitaria de Nutrición Humana y Dietética de la Universidad Católica San Antonio de Murcia (UCAM); 2005. Disponible en: http://www.educaweb. com/EducaNews/interface/asp/ web/NoticiesMostrar.asp?NoticiaID=698&SeccioID=1054 16. Sánchez E. Importancia de la educación nutricional. Departamento de Calidad de ARAMARK; 2015. Disponible en: http://www.educaweb.com/EducaNews/interface/asp/web/NoticiesMostrar.asp?NoticiaID=698&SeccioID=1054 17. Hitateguy I. ¿Cómo educar en la adquisición de hábitos alimentarios saludables? Licenciada en

V3-N1 - 2016

Nutrición (Uruguay; 2013. Disponible en: http:// www.educaweb. com/EducaNews/interface/asp/ web/NoticiesMostrar.asp?NoticiaID=698&SeccioID=1054 18. Foster GD, Makris AP, Bailer BA. Behavioral treatment of obesity. Am J Clin Nutr 2005;82 (suppl):230S–5S. 19. National Institutes of Health. Clinical Guidlines on the identification, evaluation, and treatment of overweight and obesity in adults. USA. 2008. pp 44-48, 77-83. 20. United States Departament of Agriculture, Unites Sates Departament Of Health and Human Services. Nutrition and your health: Dietary guidelines for Americans. USA, 2005.

www.conferenciasindromemetabolico.org

241


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

242

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

www.conferenciasindromemetabolico.org

243


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

CAMBIOS EN EL PESO TOTAL DE TEJIDO GRASO INDUCIDOS POR LA INFECCIÓN DE TAENIA PISIFORMIS EN CONEJOS MACHO CON SOBREPESO Arias-Hernández David, M.C.1, Hallal-Calleros Claudia, Dra.1, Domínguez-Roldán Rosa, M.C.1, Flores-Pérez FI, Dr.1

tos de grasa visceral (Antic et a., 1999, Zhao et al., 2007). Hasta donde tenemos conocimiento, no existen estudios sobre el efecto que un parásito céstodo pueda tener en el metabolismo de lípidos en los conejos. En este trabajo se evaluó el efecto de la infección experimental con huevos de T. pisiformis sobre la distribución de los depósitos de grasa en soni, se observó una reducción en conejos alimentados con una dieta el tamaño de los adipocitos, mejor obesogénica. absorción de glucosa periférica y mejor sensibilidad a la insulina II. METODOLOGÍA (Hussaarts et al., 2015). Los au- Animales: Los conejos fueron tratores concluyeron que la infección tados bajo los criterios estableparasitaria crónica protege contra cidos en la NOM-062-ZOO-1999. los trastornos metabólicos, y que Se utilizaron 16 conejos macho la parasitosis por nemátodos tiene adultos de la raza Nueva Zelanda efectos preventivos y terapéuticos con un peso de 3.4±0.2 kg., divicontra el desarrollo de la obesidad didos aleatoriamente en cuatro y sobre características asociadas grupos: 1. Conejos sin infectar alia la disfunción metabólica en ra- mentados con una dieta de mantenimiento (Testigo), 2. Conejos tones (Yang et al., 2013). En estudios en conejos se ha des- infectados con huevos de Taenia crito que dietas con elevada can- pisiformis (T. pisiformis) alimentidad energética o altas en grasa tados con una dieta de manteniconducen a obesidad y a resisten- miento (Infectados), 3. Conejos cia a la insulina, ocasionando daños sin infectar alimentados con una cardiovasculares y renales, y en dieta obesogénica (OB), 4. Conejos particular, conejos alimentados ad infectados con huevos de T. pisilibitum con dietas altas en grasas, formis alimentados con una dieta son inducidos a la obesidad rápi- obesogénica (OB Infectados). Los damente aumentando los depósi- conejos se mantuvieron en jaulas

ABSTRACT Parasitic infections affect various functions in their hosts, including metabolic functions. In mice infected with certain nematodes it has been referred a lower body weight gain and reduced adipose tissue mass, associating them with improved glucose metabolism. It has been proposed that chronic parasitic infection protects against metabolic disorders, and that nematode infections have preventive and therapeutic effects against development of obesity and metabolic disorders, in mice. In this work, we evaluated the effect of experimental infection with T. pisiformis eggs on the distribution of fat deposits in rabbits fed with an obesogenic diet. Preliminary results show that infection with Taenia pisiformis eggs induces an increase in the weight of fatty deposits in overweight rabbits. PALABRAS CLAVE: Taenia pisiformis, obesidad, infección parasitaria, tejido graso

I. INTRODUCCIÓN as infecciones parasitarias afectan diversas funciones en sus hospederos como son la conducta, la reproducción, la respuesta inmunitaria y el metabolismo (Hallal-Calleros et al., 2013, Maizels et al., 2004). Con respecto a cambios en el metabolismo, se ha referido que la infección con el parásito Nippostrongylus brasiliensis en ratones alimentados con dieta alta en grasa, se observó una menor ganancia de peso corporal y menor masa de tejido adiposo, asociándolo con un mayor metabolismo de la glucosa. En los animales infectados disminuyó la esteatosis hepática, la expresión de enzimas lipogénicas, e indujo cambios en el perfil de las hormonas metabólicas (Yang et al., 2013). En otro trabajo, ratones alimentados con una dieta obesogénica e infectados experimentalmente con el helminto Schistosoma man-

L

244

www.conferenciasindromemetabolico.org

1

Facultad de Ciencias Agropecuarias, Universidad Autónoma del Estado de Morelos


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

individuales de metal y se les proporcionó agua a libre acceso. Dietas: La dieta de mantenimiento (grupos 1 y 2) consistió en 180 g/ día de alimento comercial en pellet para conejo adulto (Ganador®, Malta Cleyton, México) con un porcentaje de proteína mínima de 16%, grasa de 3% y fibra de 17% (NRC, 1997). La dieta obesogénica (grupos 3 y 4) fue una base de la dieta comercial de mantenimiento a la que se le adicionó un 5% de aceite de soya y 5% de grasa de cerdo, y fue proporcionada ad libitum (Antic et al., 1999). Ambas dietas se suministraron durante 8 semanas previas a la infección y durante todo el experimento. Peso corporal y consumo de alimento: El peso corporal se midió utilizando una balanza digital, y el consumo de alimento se midió colocando una cantidad conocida de alimento y pesando el remanente después de 24 horas. Ambos parámetros se midieron de manera semanal desde el inicio del experimento. Infección: Después de 8 semanas bajo los regímenes dietéticos correspondientes, los conejos de los grupos 2 y 4 se tranquilizaron con 5-10 mg/kg de Xilacina por vía IM, y se inocularon con 3,200 huevos de T. pisiformis por vía oral utilizando una sonda estéril. Contenido de tejido adiposo: A los 63 días post infección, los animales se sacrificaron de forma humanitaria con una sobredosis de pentobarbital sódico (90mg/Kg) con previa tranquilización con Xilacina (5mg/kg), se diseccionó y se pesó el tejido adiposo peri-re-

V3-N1 - 2016

nal, del omento y mesenterio y del tejido subcutáneo de las regiones inguinal y inter escapular (Zhao et al., 2007).

los grupos testigo e infectados se registró un peso de 3.38±0.22 Kg y 3.46±0.27 Kg, respectivamente (Figura 1). A la necropsia observamos que el peso del tejido graso corporal en los animales bajo dieta

El peso corporal de los conejos alimentados con la dieta obesogénica, aumentó en un 25% con respecto a los animales alimentados con la dieta de mantenimiento a las 8 semanas (P<0.0001). Esta diferencia de peso entre los grupos se mantuvo hasta el final del experimento, registrándose un peso final de 4.45±0.22 Kg en el grupo OB y de 4.3±0.27 Kg en el grupo de OB infectados, mientras que en

obesogénica es un 0.4 veces mayor que el de los animales alimentados con dieta de mantenimiento, pero en los animales obesos que fueron infectados con huevos de Taenia pisifomis el aumento en el peso del tejido graso fue de 1.8 veces (figura 2), (P=0.009).

III. RESULTADOS

IV. CONCLUSIONES La infección con huevos de T. pisiformis induce un aumento en el www.conferenciasindromemetabolico.org

245


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

Xu, K., Yang, P., Fan, Liu, E. 2007. Diet-induced central obesity and insulin resistance in rabbits. J V. BIBLIOGRAFÍA Antic, V., Tempini, A., Montan, Anim Physiol Anim Nutr. 92:105J.P. 1999. Serial Changes in Car- 111. diovascular and Renal Function of Rabbits Ingesting a High-Fat, High-Calorie Diet. Am J Hypertens. 12:826–829. Hallal-Calleros, C., Morales, M.J., Morales. M.J., Vázquez, M.J.A., Hoffman, K.L., Nieto, R.A., Flores. P.F.I. 2013. Hormonal and behavioral changes induced by acute and chronic experimental infestation with Psoroptes cuniculi in the domestic rabbit Oryctolagus cuniculus. Parasit Vectors. 6:361. Hussaarts, L., García, T.N., van Beek, L., Heemskerk, M.M., Haeberlein, S., van der Zon, G.C., Ozir-Fazalalikhan, A., Berbée, J.F.P., van Dijk, K.W., van Harmelen, V., Yazdanbakhsh, M., Guigas, B. 2015. Chronic helminth infection and helminth-derived eggantigens promote adipose tissue M2 macrophages and improve insulin sensitivity in obese mice. The FASEB Journal. 29:1-13. Maizels, R.M., Balic, A., Gomez-Escobar, N., Nair, M., Taylor, M.D., Allen, J.E. 2004. Helminth parasites--masters of regulation. Immunol. Rev. 201:89–116. Yang, Z., Grinchuk, V., Smith, A., Qin, B., Bohl, J., Sun, R., Notari, L., Zhang, Z., Sesaki, H., Urban, J.F., Shea-Donohue, T., Zhaoa, A. 2013. Parasitic Nematode-Induced Modulation of Body Weight and Associated Metabolic Dysfunction in Mouse Models of Obesity. Infection and Immunity. 81(6):1905–1914. Zhao, S., Chu, Y., Zhang, C., Lin, Y., peso de los depósitos grasos.

246

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

EVALUACIÓN DEL ESTADO NUTRICIONAL Y GRADO DE CONTROL METABÓLICO EN PACIENTES GERIÁTRICAS CON OBESIDAD Y DIABETES MELLITUS MC de la Salud García Rojas Vazquez Luisa1, DC Biol Partida Hernández Guadalupe1, M en NC Trujano Ramos Alfredo2, M en C Gallegos Martínez José2, Esp. Biomed. Arreola Ortiz Francisco3 I. INTRODUCCIÓN l grupo de adultas mayores, se considera por los expertos como uno de los más vulnerables por padecer problemas nutricionales y de otro tipo. [1] Además el estado nutricional se asocia a otros factores que lo condicionan, como el proceso fisiológico del envejecimiento, las alteraciones metabólicas y alimentarias propias de enfermedades crónicas y la comorbilidad subyacente. También el deterioro de la capacidad funcional y otras situaciones psicosociales y económicas que mantienen. [2] Las pacientes geriátricas participantes con obesidad y Dm2, presentan “riesgo nutricional” además del descontrol metabólico reflejado por hipercolesterolemia, hipertrigliceridemia y cifras fuera de meta de la hemoglobina glucosilada. Se hace necesario continuar con estudios en esta población debido a que, aunado a la problemática de la enfermedad crónica se dice que hay coincidencia con alteraciones demenciales y fragilización.

E

II. METODOLOGÍA Estudio transversal y clínico. Esta investigación se realizó con pacientes ambulatorias de la tercera edad que contaran con el dia-

gnostico de obesidad y diabetes mellitus atendidas en la Clínica de Nutrición y Endocrinología del Hospital la Mujer de Morelia en Michoacán en el periodo de febrero 2013 – abril 2015. Se evaluó peso corporal, talla, y se aplicó el cuestionario Mini Nutritional Assessment (MNA) [3] para establecer el estado nutricional en las adultas mayores. Así mismo las metas de control metabólico se establecieron de acuerdo a la Guía ADA 2015. Old Adults. [4] Se tomó glucemia en ayuno, %HbA1c y colesterol, triglicéridos. Los diagnósticos se consideraron como “en meta” y “fuera de meta”. Para conocer los rasgos básicos de la población examinada se detallaron mediante un análisis univariante, las características medidas en la población utilizando cuadros de frecuencia y gráficos, en el caso de las variables cualitativas y medias en el de las cuantitativas.

III. RESULTADOS Se analizaron los resultados de 63 mujeres de la tercera edad, con obesidad y Dm2. El promedio de edad fue de 65.3 + 5.08 años. La escolaridad fue de nivel “básico”,

la mayoría pertenece a la “clase baja”, el estado civil predominante fue “casada” y con ocupación al “hogar” De acuerdo al cuestionario MNA. Y por la clasificación establecida, se puede observar que la mayoría de las pacientes geriátricas se encuentran en “riesgo de malnutrición”. Se observó que las adultas mayores con Dm2 presentan descontrol metabólico, caracterizado por hiperglucemia, %HbA1c elevado, hipercolesterolemia e hertrigliceridemia. Además al correlacionar dicho descontrol con el estado nutricional, la concentración de triglicéridos, en su clasificación “fuera de meta” y el “riesgo nutricional” se encontraron diferencia estadísticamente significativa.. También se pudo observar que el descontrol metabólico estaba presente, mostrando tendencia en aquellas que presentaron “riesgo nutricional”. (cuadro 2)

Facultad de Ciencias Médicas y Biológicas “Dr. Ignacio Chávez”. Universidad Michoacana de San Nicolás de Hidalgo. Morelia, Michoacán. México 2 Hospital de la Mujer, SSA Morelia, Michoacán. México 3 Centro de Educación y Atención Médica en Diabetes (CEYAMED). Morelia, Michoacán. México 1

www.conferenciasindromemetabolico.org

247


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

estado nutricional, ya que el riesgo nutricional está presente y puede ser determinante en la evolución de dichas enfermedades crónico-degenerativas. V. REFERENCIAS 1 Serra Rexach JA y Cuesta Triana F. Valoración geriátrica integral. En: SEMPE y SEGG, editores. Valoración nutricional en el anciano. Recomendaciones prácticas de los expertos en geriatría y nutrición. 2007, pp. 41-62. 2 Tena Davila MC y Serrano Garijo P. Malnutrición en el anciano. En: Salgado Alba A, Guillen Llera, F y Ruiperez Cantera I. editores. Manual de Geriatría. 3a ed, reimp. 2007. Barcelona: Elsevier Doyma, SL. 2002, pp. 731-40. 3 Vellas B, Villars H, Abellan G, et al. Overview of the MNA- Its History and Challenges. J Nut Health Aging 2006; 10: 456-465. 4 ADA (American Diabetes Association) Standards of medical care in diabetes 2015. Old Adult. Diabetes Care 2015; 38(1):S1-S93

IV. CONCLUSIONES Se puede afirmar que en las pacientes geriátricas con Obesidad y Dm2 no cuentan con el control metabólico adecuado de acuerdo a las 248

www.conferenciasindromemetabolico.org

Guías de manejo terapéutico específicas para este grupo de edad. Por lo que es necesaria la verificación continua de los parámetros metabólicos y de los que reflejan el


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

RELACIÓN ENTRE VARIABLES METABÓLICAS Y DE COMPOSICIÓN CORPORAL EN JÓVENES UNIVERSITARIAS M.N. J. Adán Ortega González1, MN. A. Aintzane Fernández de Gamboa1, M.C. Marcela Vélez Pliego1, D.C. Tania Bilbao Reboredo1, D.C. Irma Zamora Ginez1, P.F. Carlos Amador Sánchez2 ABSTRACT Introduction: The adoption of inappropriate eating behaviors at the beginning of college life favors the development of certain diseases such as metabolic syndrome. Objective: To study the relationship between variables of body composition and serum glucose, basal insulin, lipids, HOMA-IR in college women. Methodology: 29 students of the degree in Clinical Nutrition BUAP. Age: 18 years. Evaluation of body composition by the ISAK (2012) methodology. BMI, WHR, WHI, BF and FFM Biochemical evaluation: Glucose, insulin, triglycerides, total cholesterol, HDL-C and LDL-C, and HOMA-IR index. Results. 27.2% of the sample were overweight or obese with cardiovascular and metabolic risk. Excess adipose tissue in 44.8%. HOMA-IR index was found altered in 17%. The HDL-C values were found increased (p <0.02). Weight, waist circumference and high BF were associated with higher insulin levels (r = 0.435; p <0.001) and HOMA-IR (r = 0.4051, p <0.001). Conclusions: Even with the predominance of normal weight in the students was observed that there are risk factors for developing metabolic syndrome. The BF, the fat pads and waist circumference and hip, showed strong association with insulin and HOMA-IR index. KEYWORDS: Insulin resistance, body composition, metabolic syndrome and Students

I. INTRODUCCIÓN l estilo de vida de los jóvenes en la etapa universitaria se caracteriza por cambios de hábitos alimentarios e inactividad física que condicionan su estado nutricional y de salud a mediano plazo. Los hábitos de vida se desarrollan desde la infancia y se arraigan en la adolescencia, etapa en la que muchos jóvenes inician en la universidad. (Fabro y col, 2011). Los cambios de vida principales son el domicilio familiar, consumo de alimentos densos en energía y menos nutrientes, alteración de horarios de comida, aumento de estrés, e incluso consumo de tabaco y alcohol, entre otras sustancias nocivas (Macedo-Ojeda et al, 2008; Beltrán, 2012). Según ENSANUT (2012), en el estado de Puebla el 40.7% de los

E

adolescentes que inician la vida universitaria presentan sobrepeso y obesidad, caracterizado por la presencia de grasa corporal en la región abdominal, que a su vez está asociada con alteraciones metabólicas como glucosa en ayuno alterada, resistencia a la insulina, diabetes tipo 2 y dislipidemias, lo cual propicia el desarrollo de síndrome metabólico. Se ha demostrado que alteraciones en los indicadores anteriores contribuyen al desarrollo de lesiones precoces de aterosclerosis y diabetes tipo 2 en las primeras décadas de vida (Oliveira et al. 2004; Von Bernhardi et al. 2010). Por estas razones, este trabajo tuvo como objetivo estudiar la re1 2

lación entre variables de composición corporal y la concentración sérica de glucosa, insulina basal, lípidos, HOMA-IR en estudiantes universitarias.

II. METODOLOGÍA Estudio observacional de tipo analítico y transversal. Muestra: 29 estudiantes de primer año de licenciatura en Nutrición Clínica, Facultad de Medicina, BUAP. Edad promedio: 18,86 ± 1,30 años. Evaluación de la composición corporal. Mediciones antropométricas según la metodología ISAK (2012): estatura, peso, panículos cutáneos: tricipital (PT), bicipital (PB), subescapular (PSE), supra iliaco (PSI); perímetro de brazo (PBr), perímetro de cintura (PCi) y de Cadera (PCa). Se calculó índice de masa corporal (IMC) según fórmula de Quetelet (1989); riesgo cardiovascular: índice cintura-cadera (ICC); riesgo metabólico: índice cintura-estura (ICE), % de grasa corporal (GC) según la fórmula de Durnnin y Womersley (1974); masa libre de grasa (MLG) por la diferencia del peso menos la GC. Evaluación bioquímica. A través de una muestra sanguínea de 12 horas de ayuno, obtenida de la vena antecubital, determinándose:

Facultad de Medicina, Benemérita Universidad Autónoma de Puebla. Universidad Anáhuac Puebla

www.conferenciasindromemetabolico.org

249


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

glucosa basal, insulina basal, triglicéridos, colesterol total, colesterol ligado a lipoproteína de alta densidad (c-HDL) y colesterol ligado a lipoproteína de baja densidad (c-LDL). Se calculó, el índice de resistencia insulínica Homeostasis Model Assessment-Insulin Resistance (HOMA-IR) por la fórmula: (Insulinemia (uU/mL) x Glucemia (mmol/L) )/22.5 Análisis estadístico: programa SPSS versión 22. III. RESULTADOS Evaluación de la composición corporal. Según los resultados por el IMC, se encontró sobrepeso y obesidad grado 1 en el 17.2% (n=5) y 10% (n=3) de las estudiantes respectivamente. El resto mostraron ser normopeso. Los panículos adiposos, mostraron diferencia significativa (p<0.05) para el PSE y PSI en relación a las referencias establecidas por Durnnin y Womersley (1974). Ambas con predominio hacia el exceso. El PCi solo se encontró aumentado en los pacientes obesos. El riesgo cardio-vascular (ICC) y el riesgo metabólico (ICE) se observó en el 27.2 % de las estudiantes que no son normopeso, no habiendo diferencia significativa entre estudiantes con sobrepeso y estudiantes obesas (p>0.05). El PBr se encontró por debajo de la media recomendada. El 44.8% de las estudiantes mostró exceso de tejido adiposo medido como porcentaje de GC, siendo este valor independiente a la clasificación por el IMC. El Cuadro 1 muestra los resultados de las características antropométricas de la pobla250

www.conferenciasindromemetabolico.org

V3-N1 - 2016

ción. En la evaluación bioquímica (Cuadro 2) no se encontraron valores alterados, en glucosa, insulina, triglicéridos, colesterol total y LDL. El índice HOMA-IR se halló alterado en 5 estudiantes. Los valores de c-HDL se encontraron aumentados respecto a las recomendaciones (p<0.02). Los cuadros 3 y 4 muestran las correlaciones de más fortaleza estadística entre las variables de composición corporal y bioquímicas. El peso y el PCa son las medidas que correlacionaron mayormente con la insulina y el índice HOMA-IR. Aunado a ello se observó que el PCi y los panículos medidos están asociados también a insulina y a resistencia a la insulina medida por HOMA-IR, siendo el PT el de mayor correlación (r=0,490; p<0,001). Se observó que la GC elevada tiene relación con los mayores niveles de insulina (r=0,435; p<0,001) y HOMA-IR (r=0,4051; p<0,001). Estos resultados indican que la resistencia a la insulina se debe monitorear en los estudiantes con mayor GC, independientemente al IMC.

IV. CONCLUSIÓN Aun con el predominio del normopeso se evidencio que el IMC solo no es un buen predictor de la grasa corporal. Los factores de riesgo para el desarrollo de síndrome metabólico son el exceso de grasa corporal, los panículos adiposos, los perímetros de cintura y cadera por presentar


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

una fuerte asociación respecto a las concentraciones de insulina y el índice HOMA-IR.

V. REFERENCIAS 1. Irazusta A, Hoyos C, Díaz E, Irazusta J, Gil J, Gil S. Alimentación de estudiantes universitarios. Osasunaz. Cuadernos de Ciencias de la Salud 2007; 8: 7-18. 4. Montero A, Úbeda N y García A. Evaluación de los hábitos alimentarios de una población de estudiantes universitarios en relación con sus conocimientos nutricionales. Nutrición Hospitalaria. 2006;21(4):466-73. 2. Keskin M, Kurtoglu S, Kendirci M, Atabek ME, Yazici C. Homeostasis model assessment is more reliable than the fasting glucose/insulin ratio and quantitative insulin sensitivity check index for assessing insulin resistance among obese children and adolescents. Pediatrics. 2005; 115 (4):500-503. 3. Blomgarden ZT. Third Annual World Congress on the insulin resistance syndrome. mediators, antecedents, and measurement. Diabetes Care 2006; 29:1700-06.

www.conferenciasindromemetabolico.org

251


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

LA INVISIBILIDAD DE LA OBESIDAD EN LOS REGISTROS HOSPITALARIOS 2015 Lara Lona Elia1, Magos Vázquez Francisco2, Preciado Puga Mónica del Carmen3, Ramírez Cuellar Marlene Denisse4, Mosqueda Martínez María del Refugio4, Atilano Fuentes Lila Nayeli4, Ramírez Barba Ector Jaime5 ABSTRACT: Obesity , despite identifying themselves as public health problem in Mexico , not evidenced in routine information systems . Cases of obesity in any of its types are rendered invisible by the presence of other pathologies. The review of the database of hospital discharges Guanajuato General Hospital is presented . 5,318 cases were analyzed , one third presented a type of obesity by BMI, 125 cases were morbidly obese, but only 3 were recording this condition in coding initial diagnosis but was not evident at discharge PALABRAS CLAVE: Obesidad, codificación, registros

I. INTRODUCCIÓN s sabido que la obesidad es un problema de salud pública para el que México se ha pronunciado, ya sea en la agenda de salud o en la agenda política, al grado de realizar una Norma Oficial Mexicana. Se han mejorado encuestas que identifican la prevalencia del sobrepeso y la obesidad en todo el país y que tienen representatividad estatal, sin embargo, los sistemas de información, son un elemento débil que requiere ser revisado. El registro y la codificación de la obesidad no son temas sensibles para los profesionales de la salud, ya que pareciera ser un código poco útil para la programación de recursos.

E

III. METODOLOGÍA Se utilizó la base de datos de egresos hospitalarios del año 2015 del Hospital General de Guanajuato. Se incluyeron variables de edad, sexo, peso, talla, IMC (kg/m2) diagnóstico inicial, afección principal, causa básica de defunción. Se incluyeron pacientes mayores de 18 años. Se tomó el IMC para clasificar la obesidad según criterios de la OMS. Estadística descriptiva.

fue de 158.67 cm ± 8.64. Se registraron 100 defunciones. El 38.8% se clasificaron con Sobrepeso o Pre Obeso, el 31.5% con Normo Peso, el 21.1% con Obesidad Grado I o moderada, el 6.3% con Obesidad Grado II o severa y el 2.4% (125 casos) con Obesidad Grado III o mórbida. Casi una tercera parte (29.71%) de los egresos tuvieron algún tipo de obesidad. No hubo registros de obesidad en afección principal ni como causa básica en los casos de defunción. Se registraron 3 casos cuyo diagnóstico inicial fue de obesidad mórbida (E 668 de CIE 10), cuya afección principal al egreso fue bronquitis no especificada, cálculo de conducto biliar e hipertensión gestacional Tabla 2. En los 1,580 casos con algún tipo de obesidad, los grupos de edad con mayor proporción fueron de 25 a 34 años con 34. 75%, de 18 a 24 años con 26.27% y de 35 a 44 con un 14.62%. Gráfico 1.

IV. RESULTADOS Durante el año 2015 hubo 5, 318 egresos hospitalarios de pacientes mayores de 18 años de los cuáles 1,021 fueron hombres (19.2%) y 4,297 mujeres (80.8%). Tabla 1. V. CONCLUSIONES El promedio de edad fue de 36.26 A pesar de que una tercera parte años ± 17.91, el rango fue de 18 a de los egresos hospitalarios tuII. OBJETIVO 104 años. El peso promedio fue de vieron algún tipo de obesidad por El Objetivo de esta revisión es re- 70.08 kg ± 13.57, la talla promedio IMC, y en especial 125 casos tusaltar la inexistencia de los registros de obesidad en los egresos hospitalarios a pesar de existir 1 Maestra en Salud Pública con énfasis en Bioestadística y Sistemas de Información Universidad Guanajuato pacientes con obesidad en sus di- de 2 Cirujano General, Sub-especialista en Endoscopía, Hospital General de Guanajuato 3 ferentes grados. Doctora en Ciencias Médicas, Universidad de Guanajuato 4 5

252

www.conferenciasindromemetabolico.org

Estudiante de Medicina, Universidad de Guanajuato Cirujano General, Universidad de Guanajuato


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

Nacional de Excelencia Tecnológica. Guía de Práctica Clínica IMSS 046-08. Prevención, Diagnóstico y Tratamiento del Sobrepeso y obesidad exógena.

vieron obesidad mórbida, únicamente en 3 hubo registro de este padecimiento en la codificación de diagnóstico inicial pero no quedó evidenciado al momento del egreso. En el discurso, la obesidad es un problema importante pero no queda asentado en los sistemas de información, lo que permite suponer el gran sub registro. Es necesario realizar análisis más profundos que permitan identificar la calidad de la información.

sity in the United States. JAMA, October 27, 1999—Vol 282, No. 16 • Barquera, Simón, et al. Prevalencia de obesidad en adultos mexicanos, ENSANUT 2012. salud pública de méxico / vol. 55, suplemento 2 de 2013. • Diario Oficial de la Federación. NORMA Oficial Mexicana NOM-008-SSA3-2010, Para el tratamiento integral del sobrepeso y la obesidad • Moreno G., Manuel, DEFINICIÓN Y CLASIFICACIÓN DE VI. BIBLIOGRAFÍA LA OBESIDAD REV. MED. CLIN. • Allison, David B., et al. An- CONDES - 2012; 23(2) 124-128. nual Deaths Attributable to Obe- • Secretaría de Salud. Centro

www.conferenciasindromemetabolico.org

253


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

IMPLEMENTACIÓN DE UN PROGRAMA DE INTERVENCIÓN EDUCATIVA PARA REDUCIR EL SOBREPESO Y LA OBESIDAD EN ESTUDIANTES DE LA FACULTAD DE FARMACIA DE LA UAEM Q.B.P. Jenny Juarez-Espinosa1, Dr. Miguel Ángel Sánchez-Alemán2, Dra. Gabriela Mendoza-Madrigal3, Dra. Celeste Martínez Ramírez3, M.A.R. Eduardo Quintin-Fernandez4, Dra. Sara García-Jiménez1 RESUMEN Introducción. La obesidad está definida como un estado patológico que se caracteriza por un exceso o una acumulación excesiva y general de grasa en el cuerpo, es considerada un problema de salud pública en México. Este es un factor de riesgo para el desarrollo de diabetes tipo 2, hipertensión arterial, dislipidemias, enfermedades cardiovasculares. Evidencia demuestra que los factores que incrementan el riesgo de sobrepeso y obesidad son inactividad física y el sedentarismo. Objetivo. Implementar un programa de intervención educativa multidisciplinaria en alumnos de la Facultad de Farmacia de la UAEM. Metodología. Se realizó una invitación abierta a todo el alumnado para participar en el proyecto. Las mediciones que se realizaron fueron las siguientes: una encuesta para conocer sus antecedentes familiares y hábitos, mediciones antropométricas y toma de muestra sanguínea, El programa de intervención educativa fue diseñado por distintos profesionales de la salud en las siguientes disciplinas: nutrición, psicología, bioquímica clínica y actividad física. Se estableció un tema por sesión educativa enfocada a lograr el cumplimiento del objetivo principal de este proyecto y un objetivo propio por disciplina. La implementación del programa intervención se realizó durante 5 meses con un total de 16 sesiones. Resultados. La población fue de 79 participantes. El rango de edad es de 18-26 años, entre los cuales el 31.6% y el 10.1 presento sobrepeso y obesidad respectivamente. El 46.8% ya presentaba obesidad central y un 50% un índice de cintura-cadera alto siendo un elevado riesgo para enfermedades cardiovasculares. En el perfil de bioquímico se encontró que el 7.6% tiene una glucosa elevada, el 12.4% tiene triglicéridos altos, y el 54.4%, de la población presenta un HDL disminuido. Conclusión. La implementación de un programa de intervención educativa multidisciplinaria demuestra la importancia de este tipo de estudios, ya que en base a los resultados obtenidos hemos podido determinar una tendencia al alta de sobrepeso y obesidad, así como también otras alteraciones metabólicas. PALABRAS CLAVE: Sobrepeso, Obesidad, Síndrome metabólico, Intervención

I. INTRODUCCIÓN ctualmente, la obesidad es considerada en México un problema de salud pública, debido a su magnitud y trascendencia; por esta razón, los criterios para su manejo deben orientarse a la prevención, la detección temprana, el tratamiento integral y el control del creciente número de pacientes que presentan esta

A 254

www.conferenciasindromemetabolico.org

enfermedad. La obesidad está definida como un estado patológico que se caracteriza por una acumulación excesiva y general de grasa en el cuerpo1. La obesidad es una epidemia ahora reconocida como uno de los problemas de salud más

importantes que enfrenta el mundo hoy en día.2 La obesidad está asociada causalmente con la pérdida de salud, este es un factor de riesgo para el desarrollo de diabetes tipo 2, hipertensión arterial, dislipidemias, enfermedades cardiovasculares, entre otras3. De acuerdo a la última encuesta Nacional de Salud y Nutrición 2012 (ENSANUT 2012) 7 de cada 10 adultos presentan sobrepeso y de estos la mitad presentan obesidad4. La evidencia directa demuestra que los factores que incrementan el riesgo de sobrepeso y obesidad son la inactividad física y el sedentarismo, el consumo de alimentos con alta densidad energética y el consumo de bebidas azucaradas, el gran tamaño de las porciones, los alimentos con alto índice glicémico y la elevada frecuencia en la ingesta de alimentos que se consumen entre comidas. La actividad física regular, el consumo de alimentos con baja densidad energética (especialmente altos en fibras dietéticas) y vegetales con bajo contenido de almidón juegan un papel funda-

Facultad de Farmacia. Universidad Autónoma del Estado de Morelos Instituto Nacional de Salud Pública 3 Escuela de nutrición. Universidad Autónoma del Estado de Morelos 4 Escuela ciencias de ciencias del deporte. Universidad Autónoma del Estado de Morelos 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

mental en la protección del riesgo de aumento excesivo de peso y sus consecuencias5. De acuerdo con esto, resulta indispensable en la evaluación y tratamiento de la obesidad, la participación de un equipo multidisciplinario integrado por psicólogos, nutriólogos, médicos y activadores físicos, que permitan obtener un diagnóstico y un tratamiento que incluya aspectos médicos y nutricionales, como la evaluación de los trastornos mentales asociados, así como la educación para el paciente y su familia. Por tal motivo, el objetivo de este trabajo es Implementar un programa de intervención educativa multidisciplinaria en jóvenes escolarizados de la Facultad de Farmacia de la UAEM, en Cuernavaca, Morelos. II. METODOLOGÍA Fue un estudio longitudinal de intervención. Se hizo una invitación abierta al alumnado de la facultad de farmacia de la UAEM a participar en dicho programa de intervención. A los participantes se les solicito firmaran un consentimiento informado, se aplicó un cuestionario de riesgos a la salud, se realizaron mediciones antropométricas tales como: estatura y peso para determinar el Índice de Masa Corporal (IMC), circunferencia de cintura, circunferencia de cadera y presión arterial. Se realizaron determinaciones bioquímicas como glucosa, triglicéridos, colesterol total y HDL. El programa de intervención educativa fue diseñado por profesionales de distintas áreas de la sa-

lud, los cuales se orientan en las siguientes disciplinas: nutrición, psicología, química clínica y actividad física. Cada uno estableció un tema por sesión educativa obteniendo 4 sesiones por disciplina y un total de 16. Para cada sesión se estableció un objetivo a cumplir durante este proyecto, teniendo como base sus propios parámetros de medición. El programa fue considerado para 5 meses de intervención educativa e incluyó sesiones grupales con una duración aproximada de 30-45 minutos.

III. RESULTADOS Se obtuvo una población final de 79 participantes, en donde el rango de edad es de 18-26 años, siendo el promedio de edad de 20.6 años. El 25.3% de los participantes fueron hombres. Y de acuerdo al cuestionario aplicado, los participantes refirieron que el 49.4% considera su estado de salud como buena y el 16% tiene un familiar directo con algún padecimiento (hipertensión, diabetes u obesidad). De los considerados “hábitos nocivos” el 13.9% fuma, el 30.4% consume alcohol y más del 50% consume refresco, en cuanto a actividad física se reporta que el 53.2% la considera escasa. El IMC muestra que el 41.7% de la población tiene sobrepeso u obesidad; cifra cercana al porcentaje que nos reporta la ENSANUT 2012. La circunferencia de cintura que es un indicador de obesidad central y de acuerdo a los parámetros que nos proporciona Federación Internacional de Diabetes (FID) el 46.8% de la población tiene obesi-

V3-N1 - 2016

dad central. En la medición del índice de cintura-cadera, los resultados indican que el 50.7% de la población tiene un riesgo alto de padecer una enfermedad cardiovascular debido a la acumulación excesiva de grasa en el tejido adiposo. Y respecto a la presión arterial solo 4 individuos presentaron presión elevada. Para el perfil de bioquímico se realizaron pruebas de los siguientes analitos: glucosa, colesterol HDL y triglicéridos, encontrando que el 7.6% tiene una glucosa elevada, el 12.4% tiene triglicéridos altos, y por último el 54.4% presenta un HDL por debajo de los valores de referencia, todo esto de acuerdo a los valores de referencia indicados por la FID. Ya con los resultados obtenidos, se tomaron los criterios de la FID para determinar el porcentaje de individuos que presentan síndrome metabólico, siendo este de 8.9 %. Debido a que se trata de una población joven con orientación a ciencias de la salud, se debe considerar como un resultado alarmante ya que el 41.7% de la población tiene como mínimo un componente del síndrome metabólico y el 26.6% tiene dos componentes, siendo de esperarse a corto plazo cursen por síndrome metabólico y sus consecuencias. IV. CONCLUSIONES La implementación de un programa de intervención educativa multidisciplinaria demuestra la importancia de este tipo de estudios, www.conferenciasindromemetabolico.org

255


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

ya que en base a los resultados obtenidos hemos podido determinar una tendencia al alta de sobrepeso y obesidad, así como también otras alteraciones metabólicas. Además, es importante tener en cuenta que nuestra población es considerada joven y con una orientación educativa hacia ciencias de la salud, lo que hace fundamental el aplicar este tipo de pruebas en poblaciones donde existe mayor riesgo como métodos preventivos.

V. BIBLIOGRAFÍA 1. Organización mundial de la salud. Página oficial: www.who.int (Consultada: 20 de junio 2015) 2. http://www.worldobesity. org/ (consultada el 23 de junio 2015) 3. Manzur Fernando, Alvear Ciro, adipocitos, obesidad visceral, inflamación y enfermedad cardiovascular. Revista colombiana de cardiologia.2010. Vol 17: 207-213. N.5 4. Barquera Simón, Campos Nonato Ismael, Hernández Barrera Lucía, Pedroza Andrea, Sobrepeso y obesidad en adultos., ENSANUT. 2012. Salud pub. Méx. 2012; vol.: 56-57. 5. Rivera Dommarco Juan Ángel, Perichart Perrera Otilia. Determinantes de la obesidad: marco conceptual y evidencia científica. Obesidad en México: recomendaciones para una política de estado. México: UNAM, dirección general de publicaciones y fomento editorial, 2012. Pág. 45.

256

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

DETERMINACIÓN DE HIPERURICEMIA COMO FACTOR DE RIESGO DESENCADENANTE DE SÍNDROME METABÓLICO EN ESTUDIANTES UNIVERSITARIOS M. C. Ortiz Bueno Angélica María1, M.C Hernández Hernández María Elena1, MC. López Moreno Patricia1, QFB. Calderón Ibarra Elsa1, QFB. Blázquez Gutiérrez Ma. Elena1, LN. Kammar García Ashuin2, D.C. Martínez Montaño María de Lurdez C3 ABSTRACT The relation between the uric acid and the metabolic syndrome has been evaluated in pediatric populations and of major adults, nevertheless there are few studies realized in populations of young university students with unhealthy life styles. The aim of the present study was to analyze the hiperuricemia as a no traditional predictive factor of risk of SM and other metabolic disorders in the young people who is studying the first four-month period of the Medicine career in BUAP. There was realized a transverse study and were included 338 young adults between 18-22 years old, to whom were taken anthropometric measures (Weight, Size, Waist Circumference), measurement of the blood pressure, development of medical history and blood sampling that helped to determinate glucose, triglycerides, entire cholesterol and cholesterol of the high density lipoproteins (HDLc), low density (LDLc), and uric acid. The statistical analysis of the obtained information included risk analysis by means of a reason of squares (OR), chi square of Mantel-Haenszel and measurements of population impact as the fraction etiologic population and the fraction etiologic in the exposed ones. The results showed that in patients with hiperuricemia, the risk of presenting SM is of almost three times more and of six times more as for the risk of presenting 5 or more metabolic alterations with regard to patients with normouricemia. It proposes to consider to be a factor of not traditional risk at the high uric acid levels seric in young adults exposed to unhealthy life styles. PALABRAS CLAVES Síndrome Metabólico, Hiperuricemia, Normouricemia, Factor de riesgo

I. INTRODUCCIÓN l Síndrome Metabólico (SM) es el resultante de una combinación de factores de riesgo como aumento del Índice de Masa Corporal (IMC), niveles de colesterol y glucosa, todos estos relacionados con la prevalencia de enfermedades crónico degenerativas como diabetes mellitus tipo II y sus complicaciones, sobrepeso y obesidad, resistencia a la insulina, hipertensión arterial y enfermedad cardiovascular1; así como de factores asociados al estilo de vida poco saludables como son la

E

sobrealimentación, la ausencia de actividad física y la tensión prolongada 2. En un estudio realizado a adultos mayores de 20 años en Estados Unidos se encontró que la prevalencia más alta de SM corresponde a la población Mexico-americana con un 33.9% contra 23.7% del resto de la población 3. Las investigaciones realizadas en la pobla-

ción joven mexicana de algunos componentes del SM, han estimado una prevalencia en jóvenes con sobrepeso y obesidad de hasta el 39% 4. A pesar de que los factores de riesgo clásicos para SM ya han sido descritos y tienen su participación elucidada, algunos estudios han propuesto otras alteraciones metabólicas también asociadas al SM en la adultez, como es la hiperuricemia. Existen estudios donde se considera a la hiperuricemia como componente del SM en niños, encontrando una frecuencia alta de niveles elevados de ácido úrico en 53% del grupo analizado 5. También se ha reportado el hallazgo de un incremento de la prevalencia de SM con el aumento de los niveles de hiperuricemia de hasta el 70% en un grupo de personas con las concentraciones séricas más elevadas de ácido úrico6, además de que se ha documentado que los valores elevados de ácido úrico sérico pueden ser factor de riesgo cardiovascular y renal 7. Es importante señalar que los factores de riesgo descritos

Docentes del Departamento de Bioquímica de la Facultad de Medicina de la BUAP Pasante del Departamento de Bioquímica de la Facultad de Medicina de la BUAP 3 Coordinadora del Departamento de Bioquímica de la Facultad de Medicina de la BUAP 1 2

Institución de Procedencia: Benemérita Universidad Autónoma de Puebla

www.conferenciasindromemetabolico.org

257


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

para el SM a edades tempranas y que aparecen progresivamente, pueden prevalecer hasta la edad adulta, predisponiendo a quienes los presentan a desarrollar enfermedades metabólicas asociadas a este síndrome, por lo anterior, el objetivo del presente trabajo fue analizar a la hiperuricemia como un factor de riesgo no tradicional predictivo de SM y otras alteraciones metabólicas en los jóvenes que cursan el primer cuatrimestre de la carrera de Medicina y que están expuestos a estilos de vida poco saludables.

II. METODOLOGÍA Estudio transversal realizado en el departamento de Bioquímica de la Facultad de Medicina de la BUAP. Se incluyeron 338 adultos jóvenes con edad de 18-22 años, de un universo de 1000 alumnos del primer cuatrimestre de la licenciatura en Medicina. Se consideraron como criterios de inclusión: ser estudiante del primer cuatrimestre, ayuno de 12-14 horas y contar con el consentimiento informado. Se realizo toma de medidas antropométricas (Peso, Talla, Circunferencia de cintura), medición de la presión arterial, elaboración de historia clínica y obtención de muestras sanguíneas a las que se les determinó glucosa, triglicéridos, colesterol total y colesterol de las lipoproteínas de alta densidad (HDLc), baja densidad (LDLc), así como de ácido úrico, en un analizador VITROS DT60 II. La categorizaron de los parámetros bioquímicos fue de acuerdo a la ATP III4 y el IMC de acuerdo a la OMS para 258

www.conferenciasindromemetabolico.org

adultos5. Se determinó SM cuando se detectaron más de tres alteraciones metabólicas y además se investigó la presencia de cinco o más alteraciones metabólicas en un mismo individuo. Se realizaron análisis de riesgo por medio de una razón de momios (OR), buscando el riesgo de presentar SM o ≥5 alteraciones metabólicas) en la presencia de hiperuricemia. Se probó la significancia estadística por medio de un análisis en chi cuadrado de Mantel-Haenszel. A su vez se obtuvieron medidas de impacto poblacional como la fracción etiológica poblacional y la fracción etiológica en los expuestos. Los anteriores análisis se realizaron en el paquete estadístico GraphPad Prism v.6 para Windows.

V3-N1 - 2016

sentan hiperuricemia, el control de esta podría disminuir en 64% de presentar SM y 86% de presentar 5 o más alteraciones metabólicas (Cuadro 2).

IV. CONCLUSIONES Los jóvenes con hiperuricemia mostraron tres veces más riesgo de presentar hipercolesterolemia y SM, así como seis veces más de presentar cinco o más alteraciones metabólicas respecto a los normouricémicos. Estos hallazgos en el grupo de estudio resultan relevantes, ya que se propone considerar como un factor de riesgo no tradicional a los niveles altos de ácido úrico sérico en jóvenes adultos expuestos a estilos de vida poco saludables, que permita predecir el desarrollo de alteraciones metabolicas y sus repercusiones III. RESULTADOS en la calidad de vida de los estuLos análisis estadísticos reali- diantes de la facultad de medicina zados (Cuadro 1) mostraron que de la BUAP. en pacientes con hiperuricemia, el riesgo de presentar SM es de casi V. BIBLIOGRAFÍA 3 veces más que en pacientes con 1. Valdés, L. D. C. R., & Cabrenormo uricemia (OR=2.8, IC: 1.2- ra, J. B. R. Prevalencia de Síndrome 6.5, p=0.01); en cuanto al riesgo Metabólico y factores predispode presentar 5 o más alteraciones nentes asociados, en alumnos de metabólicas es 6 veces más en nuevo ingreso a la Universidad aquellos individuos con hiperuri- Veracruzana región Xalapa en cemia a diferencia de los pacientes el período agosto 2008-febrero con valores normales de ácido úri- 2009. Resultados preliminares de co (OR=7.1, IC: 3-16.8, p<0.0001). los alumnos del área técnica. Las medidas de impacto poten- 2. Álvarez Gasca, M. A., cial sugieren que el control de la Hernández Pozo, M. D. R., Jiméhiperuricemia puede prevenir el nez Martínez, M., & Durán Díaz, Á. 26% de los nuevos casos del SM (2014). Estilo de vida y presencia así como el 50% de presentar 5 o de síndrome metabólico en estumás alteraciones metabólicas en diantes universitarios: diferencias adultos jóvenes aparentemente por sexo. Revista de Psicología sanos. En cuanto aquellos que pre- (PUCP), 32(1), 121-138.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

3. Ford, E. S., Giles, W. H., & Dietz, W. H. (2002). Prevalence of the metabolic syndrome among US adults: findings from the third National Health and Nutrition Examination Survey. Jama, 287(3), 356359. 4. Deschamps, E. G., Exsome, C. P., Sánchez, J. V., Flores, B. T., Bastida, S., Vaquero, M. P., & Sánchez-Muniz, F. J. (2007). Prevalencia de síndrome metabólico y su asociación con el índice de masa corporal en universitarios. Medicina clínica, 129(20), 766-769. 5. Ortega-Cortés, R., Trujillo, X., Hurtado López, E. F., López Beltrán, A. L., Colunga Rodríguez, C., Barrera de León, J. C., & Tlacuilo Parra, J. A. (2015). Componentes clásicos y no tradicionales del síndrome metabólico en niños y adolescentes con exceso ponderal. Nutrición Clínica y Dietética Hospitalaria, 35(2), 57-66. 6. Choi H, Ford E Fuente (2007). Riesgo de síndrome metabólico en sujetos con hiperuricemia.SIIC American Journal of Medicine 120(5):442-447 7. Minguela P. J.I, Rubio A.H, Gallardo R.I, Martínez F.I., a, García L.P., Muñoz G.R.I.,(2011). La hiperuricemia como factor de riesgo cardiovascular y renal. Dialisis y Transplante. Vol. 32. Núm. 02. Abril 2011 - Junio 2011

www.conferenciasindromemetabolico.org

259


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

INDICE CINTURA TALLA COMO FACTOR DE RIESGO DE SÍNDROME METABÓLICO Y OTRAS ALTERACIONES CARDIOMETABÓLICAS M.C. López Moreno Patricia1, M.C. Hernández Hernández María Elena1, M.C. Ortíz Bueno Angélica María1, M.C. Calderón Ibarra Elsa1, QFB. Blázquez Gutiérrez Ma. Elena1, M.C. Martínez García Julieta1, L.N. Kammar García Ashuin2, C. Flores Camela Luisa Nikte3, D.C. Martínez Montaño María de Lurdez Consuelo4 ABSTRACT A cross-sectional study of 340 samples of young adults new students of the Faculty of Medicine (FM) BUAP to consider participants was conducted criteria for inclusion and exclusion were proposed, biochemical tests were performed and categorized according to the parameters ATP III and IMC according to OMS for adults. Considering as the presence of SM when more than three metabolic alterations according to ATP III were detected and also the presence of five or more metabolic abnormalities was investigated in the same individual. Analyses were performed in GraphPad Prism statistical software for Windows v.6, statistical analysis waist-to-height (ICT), the risk analysis was performed using odds ratio (OR), seeking the risk of changes cardiometabolic in the presence of a large ICT Third Quartile (≥Q3). Statistical significance was tested by a chi square analysis Mantel-Haenszel. In turn population impact measures such as population etiological fraction and the etiologic fraction in the exposed were obtained. The results show that ICT is a good predictor of risk of metabolic syndrome and cardiovascular disease as values are presented above (ROC) 0.53 in an apparently healthy population. ICT control can reduce the incidence of atherogenic, cardiovascular, metabolic disorders and Sx present in patients five or more cardiometabolic disorders. PALABRAS CLAVES: índice cintura talla, factor de riesgo, síndrome metabólico

I. INTRODUCCIÓN ctualmente el diagnostico de S. M. se realiza en base a los criterios que propone ATP III mencionando que para determinarlo en un individuo debe presentar tres factores de riesgo. Entre estos criterios se encuentra la circunferencia de cintura, mayor de 102 (> 40 pulgadas) para hombres y mayor de 88 cm (> 35 pulgadas) para mujeres,1 actualmente se buscan factores de riesgo que pudieran predecir un diagnóstico temprano de S. M. que sea practico para el profesional de salud2,3 por lo que algunos investigadores proponen la relación que existe entre cintura y talla, una revisión realizada por Lucy

A

260

www.conferenciasindromemetabolico.org

M. Browning y cols.4 Proponen que un área bajo la curva (ROC) con un valor de 0.5 puede ser una herramienta útil para la detección temprana de enfermedades cerebrovasculares y diabetes. Esto nos dio la pauta para realizar el análisis estadístico de índice cintura-talla como factor de riesgo para S. M. y otras alteraciones cardiometabólicas en una población de jóvenes adultos aparentemente sanos. II. METODOLOGÍA

Estudio transversal. Muestra de 369 adultos jóvenes con edad de 18-22 años, de un universo de 1000 alumnos de nuevo ingreso de la FM de la BUAP. Los criterios de inclusión fueron: ser estudiante de nuevo ingreso de FM de la BUAP, contar con un ayuno de 12-14 horas, edad de 18 a 22 años, contar con el consentimiento informado. Se presentaron 370 individuos elegibles de los cuales se reclutaron 369 individuos, excluyendo a aquellos que no cumplieron con alguno de los criterios de inclusión. Los individuos se presentaron dentro de las instalaciones del departamento de Bioquímica de la FM de la BUAP, donde se les realizó toma de variables antropométricas (Peso, Talla, Circunferencia de cintura), toma de muestras sanguíneas, medición de la presión arterial y elaboración de su historia clínica. Para el análisis bioquímico, se determinó glucosa, triglicéridos, colesterol total y colesterol de la lipoproteína de alta densidad (cHDL), lipoproteínas de baja densidad (cLDL), lipoproteínas de muy baja

Docentes del Departamento de Bioquímica de la Facultad de Medicina de la BUAP, Colaborador del Departamento de Bioquímica de la Facultad de Medicina de la BUAP 3 Estudiante de la Facultad de Medicina de la BUAP 4 Coordinadora del Departamento de Bioquímica de la Facultad de Medicina de la BUAP 1 2

Benemérita Universidad Autónoma de Puebla (BUAP)


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

densidad (cVLDL) y ácido úrico, en un analizador VITROS DT60 II. Se realizaron los cálculos del Índice de Castelli (Colesterol total/cHDL) e Índice aterogénico (cLDL/cHDL). Se categorizaron los parámetros bioquímicos según la ATP III y el IMC de acuerdo a la OMS para adultos. Se consideró como presencia de S. M. cuando se detectaron más de tres alteraciones metabólicas de acuerdo a ATP III y además se investigó de cinco o más alteraciones metabólicas en un mismo individuo. Lasalteraciones cardiovasculares fueron positivas cuando el índice de Castelli se encontró por arriba de 4.5 y las alteraciones aterogénicas cuando el índice alergénico supero las 4 unidades. Se crearon cuartiles con los resultados del ICT de los 369 individuos, y se usaron los dato por arriba del tercer cuartil (≥Q3) para analizar el riesgo a partir de ese punto de corte, para esto se realizaron análisis de riesgo por medio de una razón de momios (OR), buscando el riesgo de presentar alteraciones cardiometabólicas (alteraciones aterogénicas, cardiovasculares, S. M. y presentar mayor o igual de 5 alteraciones metabólicas) en la presencia de un ICT elevado (≥Q3). Se probó la significancia estadística por medio de un análisis en chi cuadrado de Mantel-Haenszel. A su vez se obtuvieron medidas de impacto poblacional como la fracción etiológica poblacional y la fracción etiológica en los expuestos. Los anteriores análisis se realizaron en el paquete estadístico GraphPad Prism v.6 para Windows.

III. RESULTADOS De los 369 individuos, la media fue de 0.49 ± 0.06, y el valor para el primer cuartil fue de 0.46, mientras que 0.49 lo fue para el segundo, 0.53 para el tercer cuartil y 0.73 para el cuarto. Por lo tanto se utilizaron los valores por arriba del tercer cuartil para categorizar un ICT elevado, utilizando ese punto de corte en los análisis de riesgo (Ver Cuadro 1). El riesgo de presentar S. M. es de casi 75 veces en los individuos que presentan el ICT por arriba de 0.53, que aquellos con un ICT normal (OR=74.9, IC: 10-566, p<0.0001); en cuanto al riesgo de presentar cinco o más alteraciones metabólicas, el riesgo es ocho veces mayor en aquellos individuos con un ICT elevado a diferencia de los individuos con valores normales ICT (OR=9, IC: 4-21, p<0.0001). Se encontró que los individuos con un ICT mayor a 0.53 tienen tres veces el riesgo de presentar alteraciones aterogénicas (OR=3.4, IC: 1.5-7.6, p<0.003) y ocho veces el riesgo de presentar alteraciones cardiovasculares (OR=8, IC: 3.5-18, p<0.0001) (Ver cuadro 2). Las medidas de impacto potencial sugieren que el control de un ICT elevado podrían prevenir el 36% del riesgo aterogénico, el 62% del riesgo a alteraciones cardiovasculares, de igual manera puede prevenir el 93% de los nuevos casos del S. M.así como el 64% de presentar cinco o más alteraciones cardiometabólicas, todo esto en adultos jóvenes aparentemente sanos. En cuanto a aquellos que presentan el ICT elevado, el

V3-N1 - 2016

control de este índice puede disminuir en un 71% la incidencia de alteraciones aterogénicas, 47% de las alteraciones cardiovasculares, 98% del síndrome metabólico y 89% de presentar cinco o más alteraciones cardiometabólicas. (Ver cuadro 3).

IV. CONCLUSIONES Los resultados obtenidos nos muestran que ICT es un buen predictor de riesgo de S. M. y enfermedades cardiovasculares ya que se presentan valores por arriba de 0.53 en una población aparentemente sana. Estas cifras tan alteradas nos llevaron a investigar cual sería el comportamiento si se logra obtener una relación correcta de ICT, lo cual muestra que se puede prevenir el desarrollo de S. M. y por ende patologías futuras como son: enfermedades cardiovasculares y/o diabetes. ICT es un buen predictor de síndrome metabólico y la aplicación como herramienta en el diagnóstico es de suma importancia para evitar alteraciones cardiometabólicas futuras.

V. BIBLIOGRAFÍA 1. Kahn, R., Buse, J., Ferrannini, E., & Stern, M. (2005). The metabolic syndrome: time for a critical appraisal Joint statement from the American Diabetes Association and the European Association for the Study of Diabetes. Diabetes care, 28(9), 2289-2304. 2. Valle-Leal, J., Abundis-Castro, L., Hernández-Escareño, J., & Flores-Rubio, S. (2015). Índice cintura-estatura como indicador de riesgo metabólico en niños. Reviswww.conferenciasindromemetabolico.org

261


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

ta Chilena de Pediatría. Vazquez, G., Duval, S., Jacobs, D. R., & Silventoinen, K. (2007). Comparison of body mass index, waist circumference, and waist/hip ratio in predicting incident diabetes: a meta-analysis. Epidemiologic reviews, 29(1), 115-128. 4. Browning, L. M., Hsieh, S. D., & Ashwell, M. (2010). A systematic review of waist-to-height ratio as a screening tool for the prediction of cardiovascular disease and diabetes: 0• 5 could be a suitable global boundary value. Nutrition research reviews, 23(02), 247-269.

262

www.conferenciasindromemetabolico.org

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

ÍNDICE CINTURA-TALLA: PRECISIÓN DIAGNÓSTICA DE SÍNDROME METABÓLICO Y OTRAS ALTERACIONES CARDIOMETABÓLICAS M.C Hernández Hernández María Elena1, MC. López Moreno Patricia1, MC. Ortíz Bueno Angélica María1, M. C. Calderón Ibarra Elsa1, QFB. Blázquez Gutiérez Ma. Elena1, M. C. Martínez García Julieta1, LN. Kammar García Ashuin2, Flores Camel Luisa Nikte3, D.C. Martínez Montaño María de Lurdez Consuelo4 ABSTRACT This study aimed to evaluate the diagnostic value of Waist-to-Height Ratio in the detection of metabolic syndrome and index and metabolic abnormalities in young apparently healthy, a cross-sectional study whose sample was 369 young adults aged 18-22 years first-year medical career of BUAP, biochemical and anthropometric parameters for the presence of MS and cardiovascular risk were determined, the waistheight index was calculated and quartiles were generated to analyze the diagnostic or predictive utility of this measure by analysis of verisimilitude. The results show that if the ICT is above 0.53 there is a sensitivity of 91% for SM, 72% for the presence of five or more metabolic alterations in one individual and 70% for the prediction of cardiovascular risk, to the VPP show a probability of 81% of present metabolic Sx, 77% for the presence of five or more metabolic abnormalities and 76% for cardiovascular risk. The PPT+ show that the probability of having metabolic Sx increases to 81%, 77% for five or more cardiometabolic disorders and 76% for cardiovascular disorders. The AUC were 91%, 80% and 76% for the diagnosis of metabolic Sx, presence of five or more metabolic disorders and cardiovascular risk respectively. PALABRAS CLAVE Índice cintura-talla, síndrome metabólico, alteraciones cardiometabólicas, valor diagnóstico

I. INTRODUCCIÓN a presencia de SM y enfermedad cadiovascular (ECV) está vinculada fisiopatológicamente con el sobrepeso y obesidad, se ha observado que las personas que presentan obesidad abdominal están más propensas al desarrollo de alteraciones cardiometabólicas en comparación con aquellas que presentan obesidad periférica.1 La prevalencia de SM y alteraciones cardiovasculares en países subdesarrollados es cada vez más alta en adultos jóvenes, por consecuencia se han buscado predictores que se asocien de manera sencilla con la detección de algún desorden metabólico2. Se ha demostrado que las pruebas para adiposidad como el índice de

L

masa corporal (IMC) e índice cintura cadera (ICC) en adultos sanos están relacionas positivamente a alteraciones metabólicas3 y el índice cintura-talla (ICT) es una herramienta con alto potencial para predecir la presencia de obesidad y síndrome metabólico en niños4 sin embargo es necesario analizar el valor diagnostico de estas pruebas para SM y alteraciones cardiovasculares. II. METODOLOGÍA Estudio transversal cuya muestra

fue de 369 adultos jóvenes con edad de 18-22 años, de un universo de 1000 alumnos de nuevo ingreso de la Facultad de Medicina (FM) de la BUAP. Los criterios de inclusión fueron: ser estudiante de nuevo ingreso de la FM de la BUAP, contar con un ayuno de 12-14 horas, edad de 18 a 22 años, contar con el consentimiento informado. Se presentaron 374 individuos elegibles de los cuales se reclutaron 369 individuos, excluyendo a aquellos que no cumplieron con alguno de los criterios de inclusión. Los individuos se presentaron dentro de las instalaciones del departamento de bioquímica de la FM de la BUAP, donde se les realizó toma de variables antropométricas (Peso, Talla, Circunferencia de cintura), toma de muestras sanguíneas, medición de la presión arterial y elaboración de su historia clínica. Para el análisis bioquímico, se determinó glucosa, triglicéridos, colesterol total y colesterol de la lipoproteína de alta densidad, lipoproteínas de baja densidad, lipoproteínas de muy baja den-

Docentes del Departamento de Bioquímica de la Facultad de Medicina de la BUAP Colaborador del Departamento de Bioquímica de la Facultad de Medicina de la BUAP 3 Estudiante de la Facultad de Medicina de la BUAP 4 Coordinadora del Departamento de Bioquímica de la Facultad de Medicina de la BUAP 1 2

Institución de Procedencia: Benemérita Universidad Autónoma de Puebla

www.conferenciasindromemetabolico.org

263


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

sidad (cVLDL) y ácido úrico, en un analizador VITROS DT60 II. Se realizaron los cálculos del Índice de Castelli (Colesterol total/ cHDL), Indice cintura-talla (cintura cm/talla cm). Se categorizaron los parámetros bioquímicos según la ATP III5, el IMC de acuerdo a la OMS para adultos6 y el Índice cintura talla (ICT) de acuerdo a Maffeis 20087. Se consideró la presencia de Síndrome Metabólico cuando se detectaron más de tres alteraciones metabólicas de acuerdo a ATP III y además se investigó la presencia de cinco o más alteraciones metabólicas en un mismo individuo, la alteración cardiovascular fue positivas cuando el Indice De Castelli se encontró por arriba de 4.5 unidades. Se crearon cuartiles con los resultados del ICT de los 369 individuos y se usaron los datos por arriba del cuartil tres para analizar la utilidad diagnóstica o predictiva de ese punto de corte. Para esto se realizaron análisis de verosimilitud, obteniendo la sensibilidad, especificidad, valores predictivos positivos (VPP) y valores predictivos negativos (VPN), coeficientes de verosimilitud (CV) y probabilidades post-test positivo (PPT+) y negativo (PPT-), teniendo en cuenta la probabilidad 1:1 de presentar cada una de las alteraciones metabólicas. Se graficaron los resultados de la sensibilidad y 1-especificidad generando una curva ROC y obteniendo su área bajo la curva (AUC) y su valor de probabilidad. Los análisis se realizaron en el paquete estadístico GraphPadPrism v.6 para Windows. 264

www.conferenciasindromemetabolico.org

III. RESULTADOS De los 369 individuos, la media para ICT fue de 0.49 ± 0.06, el valor para el primer cuartil fue de 0.46, 0.49 para el segundo, 0.53 para el tercer cuartil y 0.73 para el cuarto (cuadro 1). Los resultados de cada análisis de verosimilitud muestran al ICT como una prueba bastante sensible, para el diagnóstico de Sx metabólico presento una sensibilidad del 91%, 72% para la presencia de cinco o más alteraciones metabólicas en un solo individuo, 70% para la predicción de riesgo cardiovascular. En cuanto a la especificidad, los resultados muestran un 78% de especificidad para tres alteraciones estudiadas. Los VPP muestran una probabilidad del 81% de presentar SM, 77% para la presencia de cinco o más alteraciones metabólicas , y en cuanto a riesgo cardiovascular un 76% si se presenta un ICT por arriba de 0.53, mientras los VPN muestran que la probabilidad de no presentar SM, cinco o más alteraciones metabólicas y alteraciones cardiovasculares y es de 90%, 74% y 72% respectivamente si el ICT está por debajo de 0.53 Los resultados de las PPT+ muestran que la probabilidad de tener Sx metabólico con el punto de corte propuesto incrementa a un 81%, un 77% para cinco o más alteraciones cardiometabólicas y la probabilidad de predecir alteraciones cardiovasculares se incrementa a un 76% . En cuanto a las PPT-, un ICT menor a 0.53 disminuye la probabilidad de presentar SM a un 13% y de presentar cinco o mas alteraciones cardiome-

V3-N1 - 2016

tabólicas en un 32%, mientras que la probabilidad de predecir riesgo cardiovascular disminuye a un 35% (Cuadro 2). Las AUC fueron de un 91% y 80% para el diagnóstico de Sx metabólico (p<0.0001) y presencia de cinco o más alteraciones metabólicas (p<0.0001) respectivamente, en cuanto a la predicción de riesgo cardiovascular fue de 76% (p<0.0001) (Figuras 1-4). IV. CONCLUSIONES Los hallazgos del presente estudio demuestran que el ICT es un buen marcador para SM y alteraciones cardiovasculares utilizando el punto de corte 0.53 en jóvenes aparentemente sanos, por lo se puede considerar su utilidad en el diagnóstico de SM y en la predicción de alteraciones cardiometabólicas.

V. BIBLIOGRAFÍA 1. Després, J. P. (2001). Health consequences of visceral obesity. Annals of medicine, 33(8), 534541. 2. Qiao Q, Nyamdorj. Is the association of type II diabetes with waist circumference or waist-to-hip ratio stronger than that with body mass index.Eur J ClinNutr2010; 64: 30-4. 3. Espinoza, M., Ruiz, N., Barrios, E., Reigosa, A., Leal, U., & González, J. C. (2009). Perfil metabólico de riesgo cardiovascular y resistencia a la insulina según índice de masa corporal, circunferencia de cintura y cintura hipertrigliceridémica en pacientes adultos. Revista médica de Chile, 137(9), 1179-1186.


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

4. Zhou, D., Yang, M., Yuan, Z. P., Zhang, D. D., Liang, L., Wang, C. L.,& Zhu, Y. M. (2014). Waist-to-Height Ratio: A simple, effective and practical screening tool for childhood obesity and metabolic syndrome. Preventive medicine, 67, 35-40. 5. Alberti, K. G. M. M., Eckel, R. H., Grundy, S. M., Zimmet, P. Z., Cleeman, J. I., Donato, K. A., ... & Smith, S. C. (2009). Harmonizing the metabolic syndrome a joint interim statement of the international diabetes federation task force on epidemiology and prevention; national heart, lung, and blood institute; American heart association; world heart federation; international atherosclerosis society; and international association for the study of obesity. Circulation,120(16), 1640-1645. 6. Norma Oficial Mexicana NOM008-SSA3-2010. Para el tratamiento integral del sobrepeso y la obesidad 7. Maffeis C, Banzato C, Talamini G. Waist to Height ratio, ausful index to identify high risk in overwaight children. J. Pediatr, 2008; 152: 207-213.

www.conferenciasindromemetabolico.org

265


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

FACTORES ASOCIADOS A OBESIDAD EN ADOLESCENTES DE CHIAPAS M.C. Miguel A. Vázquez-Moreno1, M.C. Abraham C. Gómez-Choel2, Dra. Ana O. Cañas-Urbina1 RESUMEN La obesidad y sobrepeso conllevan el riesgo de padecer síndrome metabólico a mediano o largo plazo. Dentro de los principales factores que promueven su desarrollo se encuentran los hábitos sedentarios (elevado tiempo frente al televisor e inactividad física) que se ha relacionado fuertemente con el desarrollo de dislipidemia (triglicéridos elevados y colesterol HDL bajo) en adolescentes obesos. Objetivo. Determinar la asociación de los hábitos sedentarios (actividad física, tiempo frente al televisor) y las concentraciones de lípidos séricos (triglicéridos, colesterol HDL) con el sobrepeso/ obesidad en adolescentes de Chiapas. Metodología. Se aplicaron cuestionarios para determinar actividad física y tiempo frente al televisor. Para la determinación de la concentración de triglicéridos y colesterol HDL se analizó una muestra de sangre venosa. Resultados. El 37% de los adolescentes que evitan hábitos sedentarios presentan obesidad y sobrepeso. Los adolescentes con sobrepeso/obesidad presentan concentraciones mayores de triglicéridos y menores de colesterol HDL que aquellos adolescentes con normopeso. Conclusiones. Las estrategias de control y prevención de obesidad y sobrepeso no deben limitarse al control del sedentarismo. PALABRAS CLAVE. Sobrepeso y obesidad, sedentarismo, dislipidemia, adolescentes

I. INTRODUCCIÓN a obesidad es una enfermedad de alto interés en salud pública debido a que conlleva el riesgo de padecer síndrome metabólico (Morales-Salinas & Coca, 2010). Se define como una acumulación excesiva de grasa corporal causada principalmente por un desequilibrio entre el ingreso y el gasto de energía (OMS, 2015). Este padecimiento es de etiología multifactorial y dentro del grupo de factores que promueven su desarrollo se encuentran la exposición al humo de tabaco, la obesidad familiar, el bajo peso al nacer y los hábitos sedentarios (elevado tiempo frente al televisor e inactividad física) (Sartorius, Veerman, Manyema, Chola, & Hofman, 2015). Éste último, es uno de los factores de mayor interés y debe

L

266

www.conferenciasindromemetabolico.org

obesidad en adolescentes de Chiapas.

II. METODOLOGÍA Se realizó un estudio prospectivo, transversal y descriptivo en adolescentes escolares de la costa de Chiapas. Se aplicó un cuestionario para determinar los hábitos de actividad física y tiempo frente al televisor. Las mediciones antropométricas para la determinación de obesidad y sobrepeso se realizaron en base a lo recomendado por la OMS (OMS, 2015a). Para la medición de triglicéridos y colessu importancia a que se ha relaterol HDL se analizó una muestra cionado fuertemente con el desarde sangre venosa recolectada con rollo de dislipidemia (triglicéridos ayuno de entre 10-12 horas. elevados y colesterol HDL bajo) en adolescentes obesos (BianchiIII. RESULTADOS ni-Quadros, Pinheiro-Godia, Cincuenta adolescentes aceptaRosendo-Silva, & Rodrigues-Silva, ron participar en el estudio, de los 2015). De manera que el aumencuales la edad promedio fue de to desmedido de la prevalencia de 13.1 ± 0.8 años y al asociar sus háobesidad y sobrepeso en niños y bitos de actividad física y tiempo adolescentes incrementa el riesfrente al televisor con obesidad y go de desarrollar dislipidemia y sobrepeso (Figura 1a), se enconsíndrome metabólico en la edad tró que el 30% de los adolescentes adulta. Por ello, el presente trabajo que realizan al menos una hora de tiene como objetivo determinar la actividad física diaria y el 30% de asociación de los hábitos sedentalos adolescentes que pasan menos rios (actividad física, tiempo frente de 2 horas al día frente al televisor, al televisor) y las concentraciones presentan obesidad o sobrepede lípidos séricos (triglicéridos, so. También se encontró que el colesterol HDL) con el sobrepeso/ 37% de los adolescentes que evi1

Facultad de Ciencias Químicas, UNACH

2

Hospital General del Instituto Mexicano del Seguro Social, Tapachula, Chiapas


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tan ambos hábitos sedentarios presentan obesidad y sobrepeso. Lo anterior indica que evitar hábitos sedentarios no es un factor de control de sobrepeso, sino que debe abordarse también en combinación con otros factores como la ingesta alimentaria y los antecedentes heredofamiliares. La obesidad y el sobrepeso también fueron asociados a la concentración de triglicéridos y colesterol HDL, encontrándose que los adolescentes con obesidad o sobrepeso presentan concentraciones mayores de triglicéridos (124.3* / 78.1 mg/dl; p=0.01) y menores de colesterol HDL (40.8 / 49.7 mg/dl; p=0.13) que aquellos adolescentes con normopeso (Figura 1b).

V. REFERENCIAS Bianchini-Quadros, T., Pinheiro-Godia, A., Rosendo-Silva, R., & Rodrigues-Silva, L. (2015). Predictive capacity of anthropometric indicators for dyslipidemia screening in children and adolescents. Jornal de pediatria, doi:10.1016/j. jped.2014.11.006. Morales-Salinas, A., & Coca, A. (2010). Obesidad, actividad física y riesgo cardiovascular: clasificación ergoantropométrica, variables farmacológicas, biomarcadores y paradoja del obeso. Medicina clínica, 134(11), 492-498. OMS (2015). Obesidad y sobrepeso. Obtenido de Organización Mundial de la Salud: http://www. who.int/mediacentre/factsheets/

IV. CONCLUSIONES Evitar hábitos sedentarios como estrategia de prevención y supresión de obesidad o sobrepeso en adolescentes debe implementarse con el manejo y control de otros factores que promueven el desarrollo de obesidad, tales como la ingesta alimentaria y los antecedentes heredofamiliares.

fs311/es/ OMS (2015a). Curso de capacitación para la evaluación de crecimiento del niño. Obtenido de Patrones de crecimiento infantil. Organización Mundial de la Salud: http://www.who.int/childgrowth/training/es/ Sartorius, B., Veerman, L. J., Manyema, M., Chola, L., & Hofman, K. (2015). Determinants of Obesity and Associated Population Attributability, South Africa: Empirical Evidence from a National Panel Survey, 2008-2012. PLOS ONE, 10(6), 1-20.

V3-N1 - 2016

www.conferenciasindromemetabolico.org

267


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

PREVALENCIA Y ASOCIACIÓN DE LOS COMPONENTES DEL SÍNDROME METABÓLICO EN JÓVENES UNIVERSITARIOS CON SOBREPESO Y OBESIDAD Uvalle- Navarro RL1,2, Mederos-Torres CV1,2, Díaz-Burke Y2, González-Sandoval CE2, Medina-Díaz E2, Díaz-Navarro AM2, Vargas-Vital JA2, Roldán-Roa EB3, López-Roa RI2 ABSTRACT Metabolic syndrome (MetS), is defined as the joint of risks factors interrelated between themselves. The ATPIII has identified 6 components that are related with cardiovascular disease (CVD). The higher prevalence of MetS in young population, it is mostly because of the increase of the obesity. The goal of this work was calculate the prevalence of MetS, and also to determine which component is more related with the development of this pathology among young students with overweight and obesity. Methodology: the sample consist of 67 students, between 18 and 25 years old, with a BMI≥25 kg/m2, anthropometric measure were taken along with a blood sample. For the diagnosis of MetS we used the ATPIII criteria. Results: the prevalence of MetS was 33% also the most frequent parameter was the low levels of HDL, on the other hand, the component with the highest association was hyperglycemia (OR 28.6; IC 95% 1.50-545.2; p=<0.0027**). Conclusion: there is a high prevalence of MetS among young students with overweight and obesity, hyperglycemia seems to be a determinant factor for the development of this pathology. PALABRAS CLAVE: síndrome metabólico, jóvenes universitarios, obesidad y sobrepeso.

I. INTRODUCCIÓN l síndrome metabólico (SM), es un padecimiento complejo con altos costos socioeconómicos. Se define como un conjunto de factores de riesgo interconectados entre sí, la ATPIII identificó 6 componentes del síndrome metabólico que se relacionan con la enfermedad cardiovascular (ECV): 1) obesidad abdominal, 2) dislipidemia aterogénica, 3) aumento en la presión sanguínea, 4) hiperglicemia, 5) estado pro-trombótico y 6) estado pro-inflamatorio. (1) La elevada prevalencia del SM en población joven se debe principalmente al incremento de la obesidad. La obesidad y los subsecuentes cambios en el metabolismo pueden atribuirse en parte al consumo de

E

268

www.conferenciasindromemetabolico.org

comida rápida y adquisición de estilos de vida sedentarios (2) y en el caso de los estudiantes universitarios también se asocia a alteraciones en el ciclo circadiano (3). Es importante detectar los factores de riesgo modificables asociados al SM ya que se conoce que el SM incrementa dos veces más el riego a padecer ECV y cinco veces más el riesgo a padecer diabetes Mellitus tipo II (DMTII) (4). El objetivo de este trabajo fue calcular la prevalencia del SM así como determinar los componentes del SM con mayor asociación con el desarrollo de esta patología en una población de estudiantes universitarios con

sobrepeso y obesidad.

II. METODOLOGÍA La muestra consistió en 67 estudiantes de la licenciatura en Q.F.B. del CUCEI, Universidad de Guadalajara, previa firma del consentimiento informado. El rango de edad de la población fue de 18 a 25 años con un IMC≥25 kg/m2. Se les tomaron las medidas antropométricas y una muestra de sangre con un ayuno de 12 horas para la obtención de suero. Para el diagnóstico del SM se tomaron los parámetros establecidos por la ATPIII. Los individuos se clasificaron en dos grupos con SM y no SM, la estadística descriptiva se reportó como promedio ± desviación estándar y se analizó con una prueba t-student para datos paramétricos y U-Mann Whitney para datos no paramétricos. Para determinar la asociación de las variables del SM se realizó un análisis Chi-cuadrada con Fisher como prueba alternativa. III. RESULTADOS La prevalencia del SM en la población estudiada fue del 33%. El 48% de la población presentó al

Posgrado en Ciencias Médicas, Universidad de Colima Departamento de Farmacobiología CUCEI, Universidad de Guadalajara 3 CIMAT, Guanajuato 1 2


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

menos dos parámetros del SM y el 3 % no presentó ningún parámetro (Figura1).

El parámetro más frecuente del SM fueron niveles bajos de HDL. Nosotros encontramos que la prevalencia de SM fue mayor en mujeres que en hombres. Encontramos elevadas de manera significativa las variables: triglicéridos, HDL, CA y PAS cuando comparamos el grupo de individuos con SM contra el grupo No SM. Los componentes con mayor asociación al SM fueron glucosa (OR 28.6; IC 95% 1.50-545.2; p=<0.0027**), seguida por hipertrigliceridemia (OR 21.96; IC 95% 5.616-85.9; p=<0.0001****), presión arterial elevada (OR 20.53; IC 95% 2.33-181; p=0.0012**), niveles bajos de HDL (OR 8.766; IC 95% 0.477-161) y finalmente obesidad abdominal elevada (OR 8.531; IC 95% 1.037-70.2).

IV. CONCLUSIONES • La prevalencia del SM en la población de estudiantes universitarios obesos y con sobrepeso fue del 33%, es elevada si la comparamos con el trabajo de Murguía-Romero et al., con una población de características similares en rango de edad pero que difiere en el IMC (5). • Encontramos que el SM fue más frecuente en mujeres que en hombres lo que concuerda con el estudio de Márquez-Sandoval et al. (6). • El 47.7% de nuestra población presenta al menos 2 componentes del SM. En donde, la va-

riable del SM más frecuente fue los niveles bajos de HDL. • Los niveles de triglicéridos, glucosa, HDL y PAS fueron significativamente más elevados en el grupo de jóvenes con SM. • Los componentes del SM que tienen una mayor asociación con este padecimiento fueron la hiperglucemia, hipertrigliceridemia, presión arterial elevada y la obesidad abdominal. • La población de jóvenes universitarios se caracteriza por tener estilos de vida poco saludables lo que favorece el desarrollo de sobrepeso, obesidad y eventualmente SM. Esto hace necesario www.conferenciasindromemetabolico.org

269


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

implementar estrategias como cambios en el tipo de dieta y la realización de ejercicio aeróbico que tengan un impacto en la disminución de los factores de riesgo que provocan el SM.

V. BIBLIOGRAFÍA 1. Grundy SM, Brewer HB, Cleeman JI, Smith SC, Lenfant C, National Heart, Lung, and Blood Institute, et al. Definition of metabolic syndrome: report of the National Heart, Lung, and Blood Institute/American Heart Association conference on scientific issues related to definition. Arterioscler Thromb Vasc Biol. febrero de 2004;24(2):e13-18. 2. Poobalan A, Aucott L. Obesity Among Young Adults in Developing Countries: A Systematic Overview. Curr Obes Rep. marzo de 2016;5(1):2–13. 3. Lopez-Minguez J, Gómez-Abellán P, Garaulet M. Circadian rhythms, food timing and obesity. Proc Nutr Soc. el 24 de junio de 2016;1–11. 4. Cornier M-A, Dabelea D, Hernandez TL, Lindstrom RC, Steig AJ, Stob NR, et al. The metabolic syndrome. Endocr Rev. diciembre de 2008;29(7):777–822. 5. Murguía-Romero M, Jiménez-Flores JR, Sigrist-Flores SC, Tapia-Pancardo DC, Jiménez-Ramos A, Méndez-Cruz AR, et al. PREVALENCE OF METABOLIC SYNDROME IN YOUNG MEXICANS: A SENSITIVITY ANALYSIS ON ITS COMPONENTS. Nutr Hosp. 2015;32(1):189–95. 6. Márquez-Sandoval F, Macedo-Ojeda G, Viramontes-Hörner 270

www.conferenciasindromemetabolico.org

D, Fernández Ballart JD, Salas Salvadó J, Vizmanos B. The prevalence of metabolic syndrome in Latin America: a systematic review. Public Health Nutr. octubre de 2011;14(10):1702–13.

V3-N1 - 2016


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

COMPONENTES DEL SÍNDROME METABÓLICO, DIFERENCIAS ENTRE LA EDAD Y EL TIEMPO DE EVOLUCIÓN Alejandro Guadalupe Rodríguez González1, Esmirna A. Acosta Navarro2, Raquel Goytia Acevedo3, María Aurora Maravilla Domínguez3 ABSTRACT. Introduction: Metabolic syndrome (MetS), it is an entity of high epidemiological impact. In Mexico the MetS has a prevalence of 42.3 % and is presented mostly in women than in men. In addition the prevalence and frequency of its components varies between populations. Methods: In a cross sectional study the frequency and prevalence of metabolic syndrome components were evaluated on 29 subjects attended in the UNEME-EC in 2014. Age was classified into two Categories: < 60 years and ≥ 60 years. Evolution time was considered from diagnosis of hyperglycemia, and categorized in ≤10 years and > 10 years. Results: In this sample 55.17% (n=16) showed alteration in 4 of the 5 components of MetS and dyslipidemia prevalence was a higher in subjects with ≤10 years of evolution compared with subjects >10 years (55% vs 44% respectively). Conclusions: dyslipidemia, hyperglycemia and obesity were the most common disorders in this population KEY WORDS: Metabolic syndrome, prevalence, dyslipidemia, hyperglycemia and obesity

I. INTRODUCCIÓN l síndrome metabólico (SxMet), constituye una entidad de alto impacto epidemiológico, afecta la salud pública en el mundo1 y esta asociado a un incremento de 5 veces en la prevalencia de diabetes Mellitus tipo 2 (DM2) y de 2-3 veces en la de enfermedad cardiovascular (ECV).2,3 Su prevalencia es variable; en los Estados Unidos se reporta 21 al 33%; en otros países varía de 16,3% (Marruecos) a 52.8% (aborígenes de Nueva Zelanda)4.Ademas, reciente evidencia demuestra que la prevalencia de sus componentes puede ser también diferente entre poblaciones5 Según los criterios del NCEP-ATP III, con modificación de los valores de cintura conforme a la Federación Internacional de Dia-

E

betes (IDF), en México el SxMet tiene una prevalencia de 42.3% en los adultos mexicanos > de 20 años.6 En México, en la población adulta (20 a 69 años), hay más de 17 millones de pacientes con hipertensión arterial (HTA), más de 14 millones con dislipidemia, más de 6 millones con DM2 y más de 35 millones con sobrepeso y obesidad 7. El estudio NHANES en EUA reveló que entre 1988-1994 la prevalencia del SxMet fue de 24% y aumentó a >30% en sujetos mayores de 50 años y a >40% después de los 60 años.8 La mayor prevalencia fue en el grupo México-americano (32%), y el grupo más afectado fue el de las mujeres; la correlación

más importante fue SxMet y DM2.9 Conforme a ENSANUT 2006, la prevalencia de SxMet utilizando ATP III fue de 36.8%, de acuerdo a la AHA y NHLBI de 41.6% y con la IDF la prevalencia fue de 49.8%, siendo en todos los casos mayor en mujeres que en hombres. Un análisis reciente del Estudio de Diabetes de la Ciudad de México encontró que 15.1% de la población desarrolló el SxMet seguido de DM2 en 6 años de observación (46% mujeres y 44% hombres).10 II. METODOLOGÍA Con diseño transversal, se evaluó el estado metabólico de 32 sujetos que acudieron a la UNEME-EC en el 2014. Mediante muestreo consecutivo se seleccionaron los primeros 30 expedientes de pacientes que cumplieran con los criterios diagnósticos de SxMet (3 ó más de los 5 criterios diagnósticos). Se eliminó el expediente de un sujeto por pertenecer a un grupo etáreo diferente. Se obtuvieron datos demográficos, biológicos y bioquímicos. Los datos obtenidos fueron manejados en el paquete STATA versión 11.1 (STATA Co. Chicago, Ilinois). La edad se clasificó en dos categorías, <60 años y

Estudiante semestre 10. Licenciatura de Medicina, FACSA., GP/UJED. Pasante de Servicio Social, Licenciatura de Nutrición, FACSA., GP/UJED 3 Profesor, Facultad de Ciencias de la Salud. (FACSA) GP, Dgo. Universidad Juárez del Estado de Durango 1 2

www.conferenciasindromemetabolico.org

271


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

≥60 años. El tiempo de evolución considerado a partir del diagnóstico de hiperglucemia, se clasificó en ≤10 y >10 años. Las variables componentes del SxMet [presión arterial en mmHg; valores séricos de glucosa en mg/dl; %-HbA1c; colesterol total en mg/dl; C-HDL en mg/dl; C-LDL en mg/dl y TG en mg/dl] se tomaron al ingreso, 6 meses y al año del expediente. Estos valores se utilizaron para clasificar de SxMet de acuerdo a los criterios del ATPIII. El IMC calculado al inicio, 6 y 12 meses y expresado en kg/m2, se clasificó de acuerdo a la OMS en obesidad (≥ 30), sobrepeso (25 y 29.9) y peso normal (18.5-24.9). III. RESULTADOS En este estudio participaron 29 pacientes con SxMet, la edad promedio y DE del grupo fue de 55.4 ± 7.2 años; 79% de la población fueron mujeres. En esta muestra el 31% (n=9) de los sujetos exhibió los 5 criterios del SxMet, el 55.17% (n=16) 4 criterios y el 13.8% (n=4) tres criterios. (Tabla 1). La prevalencia de los componentes de SxMet a partir de los años de evolución fue la siguiente: la dislipidemia exhibió una prevalencia del 55% en los sujetos con ≤10 años de evolución y un 44% en los sujetos con >10 años de evolución. La prevalencia de hiperglucemia en sujetos con ≤10 años de evolución fue mayor (53.6%) comparada con la de sujetos de >10 años de evolución (46.4%). La prevalencia de la hipertrigliceridemia fue de 57.7 % en los sujetos con ≤10 años de evolución, y de 42.3% en aquel272

www.conferenciasindromemetabolico.org

los con >10 años de evolución. La prevalencia de la hipertensión fue muy similar entre los sujetos con ≤10 y >10 años de evolución: 52% y 48%, respectivamente. Los sujetos con ≤10 años de evolución mostraron mayor prevalencia de obesidad (68.7%) comparados con aquellos de >10 años de evolución un 31.3%. (Tabla 2) Cuando los sujetos se clasificaron por categoría de edad <60 y ≥60 años y cada categoría se subclasificó por tiempo de evolución, se obtuvieron las siguientes categorías: A (edad <60 años y ≤10 años de evolución, n=11, 57.9%) B (edad <60 años y >10 años de evolución, n=8, 42.1%) C (edad ≥60 años y ≤10 años de evolución, n=5, 50%) y D (≥60 y >10 años de evo-

lución, n=5,50%). La prevalencia de los componentes del síndrome metabólico por grupo de edad y años de evolución se observan detalladamente en la tabla 3.

IV. CONCLUSIONES Un 55.17% de la población presenta afección en 4 de los componentes. El 65% de la población afectada es menor de 60 años. La hiperglucemia y la dislipidemia son más frecuentes en sujetos < de 60 años mientras en ≥ de 60 años predomina la obesidad y la dislipidemia.   V. BIBLIOGRAFÍA 1. Sánchez, F. e. (2008). Prevalence and behaviour of risk fac-


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

tors in metabolic syndrome according to different age intervals, in a female cohort of the area of influence of the Clínica de las Américas in Medellín, Colombia. Rev. Col. Cardiol. , 102-110. 2. Eckel RH, G. S. (2005). Metabolic syndrome. Lancet, 141518. 3. Zimmet P, A. G. (2005). Mainstreaming the metabolic syndrome: a definitive definition. Editorial. Medical, 175-6. 4. Ryder, E. (2005). Una epidemia global:El síndrome Metabólico. An Venez Nutr , 105-109 5. Kim HJ (2016) Differences in Prevalence of Metabolic Syndrome by Breastfeeding Experience of Women in Their 30s and 40s. Jun;10(2):136-42. doi: 10.1016/j.anr.2015.02.002. Epub 2016 Apr 19. 6. Jaime Carranza Madrigal, S. M. (2008). El síndrome metabólico en México. Medicina interna de México, 251-261. 7. Olaiz-Fernández G, R.-D. J.-L.-H.-A. (2006). Encuesta Nacional de Salud y Nutrición 2006. 13. HAN TS, S. N.-V. (2002). Prospective Study of C-reactive protein in relation to the development of diabetes and metabolic syndrome in Mexico City. Diabetes Care , 20162021. 8. Ann Poynten, D. C. (2012). Resistencia a la insulina:el puente entre diabetes y enfermedades cardiovasculares. diabetes voice , 41-43. 9. Deepa, V. M. (2006). El síndrome metabólico en los paises en desarrollo. Diabetes Voice , 15-17. 10. Han Ts, S. N.-V. (2002).

V3-N1 - 2016

Prospective Study of C-reactive protein in relation to the development of diabetes and metabolic syndrome in Mexico City. Diabetes Care , 2016-2021.

www.conferenciasindromemetabolico.org

273


REVISTA DE LA CONFERENCIA CIENTÍFICA ANUAL SOBRE SÍNDROME METABÓLICO

V3-N1 - 2016

Revista de la Conferencia Científica Anual sobre Síndrome Metabólico V3N1, Octubre 2016  

Revista de la Conferencia Científica Anual sobre Síndrome Metabólico V3N1, Octubre 2016

Read more
Read more
Similar to
Popular now
Just for you