Page 1

 

!"##  $%&'  #!"

()(  61

January / February 9 


CONTENTS / SUMÁRIO Rev Col Bras Cir 2019; 46(1) ORIGINAL ARTICLES Chest tube simulator: development of low-cost model for training of physicians and medical students Simulador de dreno de tórax: desenvolvimento de modelo de baixo custo para capacitação de médicos e estudantes de medicina Ana Luísa Bettega; Luis Fernando Spagnuolo Brunello; Guilherme Augusto Nazar; Giovanni Yuji Enomoto De-Luca; Lucas Mansano Sarquis; Henrique de Aguiar Wiederkehr; José Aguiomar Foggiatto; Silvania Klug Pimentel ..................................................................................... e2011 Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastric cancer Análise comparativa do polimorfismo genético da glutationa transferase, do Helicobacter pylori e do vírus Epstein-Barr entre a área do tumor e as margens de ressecção proximal e distal do câncer gástrico Thais Messias Maccormick; Carlos Eduardo Souza Carvalho; Guilherme Pinto Bravo Neto; Maria da Gloria da Costa Carvalho ................... e2068

Rev Col Bras Cir

Rio de Janeiro

Vol 46

Nº 1

jan/feb

2019


Órgão Oficial do Colégio Brasileiro de Cirurgiões EDITOR Guilherme Pinto Bravo Neto TCBC-RJ Associate Professor, Department of Surgery, Faculdade de Medicina, Universidade Federal do Rio de Janeiro-UFRJ-Rio de Janeiro-RJ-Brasil.

ASSOCIATE EDITORS FELIPE CARVALHO VICTER TCBC - RJ - UNIVERSIDADE DO ESTADO DO RIO DE JANEIRO - UERJ – RIO DE JANEIRO – RJ, BRASIL RODRIGO MARTINEZ TCBC-RJ - UNIVERSIDADE FEDERAL DO RIO DE JANEIRO – UFRJ - RIO DE JANEIRO – RJ – BRASIL FERNANDO PONCE DE LEON ACBC- RJ – UNIVERSIDADE FEDERAL DO RIO DE JANEIRO – UFRJ – RIO DE JANEIRO – RJ-BRASIL

LIBRARIAN Lenita Penido Xavier

WRITING ASSISTANT David S. Ferreira Júnior

GRAPHIC DESIGN HG Design Digital Ltda.

RESPONSIBLE JOURNALIST João Maurício Carneiro Rodrigues

ADVISORY BOARD ABRÃO RAPOPORT - ECBC-SP - Hospital Heliópolis - São Paulo - SP - BR ALDO DA CUNHA MEDEIROS - ECBC-RN - Universidade Federal do Rio Grande do Norte – Natal – RN - BR ALEXANDRE FERREIRA OLIVEIRA - TCBC-PE - Universidade Federal de Pernambuco – Recife – PE - BR ÁLVARO ANTONIO BANDEIRA FERRAZ - TCBC-PE - Universidade Federal de Pernambuco – Recife – PE - BR ANA CRISTINA GOUVEIA MAGALHÃES - Universidade Federal do Rio de Janeiro- Rio de Janeiro- RJ – BR ANDY PETROIANU - TCBC-MG – Universidade Federal de Minas Gerais – Belo Horizonte – MG - BR ANTONIO CARLOS VALEZI - TCBC-PR – Universidade Estadual de Londrina - Londrina - PR – BR ANTONIO JOSÉ GONÇALVES - TCBC-SP – Faculdade de Ciências Médicas da Santa Casa de São Paulo- São Paulo - SP - BR ARLINDO MONTEIRO DE CARVALHO JR. - TCBC-PB - Universidade Federal da Paraíba João Pessoa - PB - BR CARLOS ALBERTO PORCHAT - TCBC-RJ - Hospital Clementino Fraga Filho da Universidade Federal do Rio de Janeiro - RJ - BR CARLOS ANSELMO LIMA - TCBC-SE- Universidade Federal de Sergipe – Aracaju - SE - BR CARLOS DELROY - Universidade Federal de São Paulo - São Paulo - SP - BR DAYSE COUTINHO VALENTE - TCBC-RJ- Instituto Fernando Luiz Barroso – Rio de Janeiro - RJ - BR DIOGO FRANCO - TCBC-RJ - Universidade Federal do Rio de Janeiro- Rio de Janeiro – RJ - BR DJALMA JOSE FAGUNDES - ECBC-SP - Universidade Federal de São Paulo – São Paulo – SP – BR EDMUND CHADA BARACAT - TCBC – SP - Universidade Federal de São Paulo – São Paulo – SP – BR EDNA FRASSON DE SOUZA MONTERO - TCBC-SP- Universidade Federal de São Paulo – São Paulo – SP – BR EDUARDO CREMA - TCBC-MG - Universidade Federal do Triângulo Mineiro - Uberaba MG - BR EDUARDO HARUO SAITO - TCBC-RJ- Universidade do Estado do Rio de Janeiro – Rio de Janeiro - RJ - BR ELIZABETH GOMES DOS SANTOS - TCBC-RJ - Universidade Federal do Rio de Janeiro – Rio de Janeiro – RJ - BR FÁTIMA CARNEIRO FERNANDES - Universidade Federal do Rio de Janeiro - Rio de Janeiro - RJ - BR FLÁVIO DANIEL SAAVEDRA TOMASICH - TCBC-PR – Hospital de Clínicas da Universidade Federal do Paraná – Curitiba –PR- BR FLÁVIO MALCHER M. DE OLIVEIRA - TCBC-RJ - Hospital Universitário Gaffrée e Guinle - Rio de Janeiro - RJ - BR FREDERICO AVELLAR SILVEIRA LUCAS - TCBC-RJ - Instituto Nacional do Câncer – Rio de Janeiro - RJ - BR GIULIANO ANCELMO BENTO - ACBC- RJ – Universidade do Estado do Rio de Janeiro – Rio de Janeiro – RJ – BR GUSTAVO PEREIRA FRAGA - TCBC-SP - Universidade Estadual de Campinas – Campinas - SP – BR HAMILTON PETRY DE SOUZA - ECBC-RS - Pontifícia Universidade Católica do Rio Grande do Sul – Porto Alegre - RS – BR HAROLDO VIEIRA DE MORAES Jr. - Universidade Federal do Rio de Janeiro - Rio de Janeiro - RJ - BR HENRI CHAPLIN RIVOIRE - TCBC-RS -Universidade Federal do Rio Grande do Sul - Porto Alegre - RS - BR HENRIQUE MURAD - ECBC-RJ - Universidade Federal do Rio de Janeiro - Rio de Janeiro - RJ - BR JOSÉ ANACLETO DUTRA RESENDE Jr. - Hospital Universitário Pedro Ernesto-UERJ - Rio de Janeiro - RJ - BR JOSÉ EDUARDO DE AGUILAR NASCIMENTO - TCBC-MT-Universidade Federal de Mato Grosso – Cuiabá – MT –BR JOSÉ EDUARDO FERREIRA MANSO - TCBC-RJ – Universidade Federal do Rio de Janeiro – Rio de Janeiro – RJ – BR JOSÉ LUIZ BRAGA DE AQUINO - TCBC-SP - Faculdade de Ciências Médicas - PUC Campinas - SP - BR JOSÉ MARCUS RASO EULÁLIO - TCBC-RJ – Universidade Federal do Rio de Janeiro – Rio de Janeiro – RJ – BR JOSÉ MAURO DA SILVA RODRIGUES - TCBC-SP - Pontifícia Universidade Católica de São

Paulo - São Paulo - SP - BRA JOSÉ WILSON NOLETO - Universidade Federal da Paraíba - João Pessoa - PB - BR JULIO CESAR BEITLER - TCBC-RJ – Universidade Estácio de Sá – Rio de Janeiro - RJ - BR JÚLIO CEZAR UILI COELHO - TCBC-PR – Universidade Federal do Paraná – Curitiba - PR – BR KATIA SHEYLA MALTA PURIM - Universidade Positivo - Curitiba - PR - BR LEONEL DOS SANTOS PEREIRA - Universidade Federal do Rio de Janeiro - Rio de Janeiro - RJ - BR LISIEUX EYER DE JESUS - TCBC-RJ- Universidade Federal Fluminense – Niterói – RJ – BR LUIZ CARLOS DUARTE DE MIRANDA - ACBC-RJ - Universidade Federal do Rio de Janeiro - Rio de Janeiro - RJ - BR LUIZ CARLOS VON BAHTEN - TCBC-PR- Universidade Federal do Paraná – Curitiba - PR – BR LUIZ GUSTAVO DE OLIVEIRA E SILVA - TCBC-RJ- Hospital Federal de Ipanema/Ministério da Saúde- Rio de Janeiro - RJ - BR LUIZ RONALDO ALBERTI - Universidade Federal de Minas Gerais – Belo Horizonte – MG –BR MANOEL XIMENES NETO - ECBC-DF –Universidade de Brasília – Brasília - DF - BR MANUEL DOMINGOS DA CRUZ GONÇALVES - ECBC-RJ- Universidade Federal do Rio de Janeiro- Rio de Janeiro –RJ – BR MARCOS ALPOIN FREIRE - TCBC-RJ- Universidade Federal do Rio de Janeiro- Rio de Janeiro – RJ – BR MARIA APARECIDA DE ALBUQUERQUE CAVALCANTE - Universidade Federal do Rio de Janeiro - Rio de Janeiro - RJ - BR MARIA DE LOURDES P. BIONDO SIMÕES - TCBC-PR – Pontifícia Universidade Católica do Paraná – Curitiba – PR - BR MARCELO AUGUSTO F. RIBEIRO JR. - TCBC-SP - Universidade de Santo Amaro- UNISA - São Paulo - SP - BR MAURÍCIO AUGUSTO S. MAGALHÃES COSTA - TCBC-RJ - Sociedade Brasileira de Mastologia - Rio de Janeiro - RJ - BR MAURO ANTÔNIO C. GUIMARÃES FILHO - Hospital Moinho dos Ventos - Porto Alegre - RS- BR MAURO DE SOUZA LEITE PINHO - TCBC-SC – Universidade da Região de Joinville – Joinville - SC - BR NELSON ADAMI ANDREOLLO - TCBC-SP – Universidade Estadual de Campinas Campinas - SP - BR NELSON ALFRED SMITH - Universidade Federal do Rio de Janeiro- Rio de Janeiro – RJ – BR NELSON FONTANA MARGARIDO – TCBC-SP – Universidade de São Paulo – São Paulo – SP – BR ORLANDO JORGE MARTINS TORRES - TCBC-MA - Universidade Federal do Maranhão - São Luís - MA - BR OSVALDO MALAFAIA - ECBC-PR- Universidade Federal do Paraná – Curitiba –PR- BR PAULO FRANCISCO GUERREIRO CARDOSO - ACBC-RS- Fundação Faculdade Federal de Ciências Médicas de Porto Alegre – Porto Alegre – RS - BR PAULO GONÇALVES DE OLIVEIRA - TCBC-DF - Universidade de Brasília – Brasília - DF - BR RENATO ABRANTES LUNA - TCBC-RJ - Hospital Federal dos Servidores do Estado do Rio de Janeiro - Rio de Janeiro - RJ - BR RICARDO ANTONIO CORREIA LIMA - TCBC-RJ – Universidade Federal do Estado do Rio de Janeiro- Rio de Janeiro – RJ – BR RICARDO VITOR COHEN - TCBC-SP - Hospital Alemão Oswaldo Cruz - São Paulo - SP - BR ROBERTO CAMPOS MEIRELLES - TCBC-RJ - Universidade do Estado do Rio de Janeiro - Rio de Janeiro - RJ - BR RODRIGO ALTENFELDER SILVA - TCBC-SP - Faculdade de Ciências Médicas da Santa Casa de São Paulo - São Paulo - SP-BR RODRIGO FELIPPE RAMOS - TCBC - RJ - Universidade Federal Fluminense - Niterói - RJ - BR ROGERIO APARECIDO DEDIVITIS - TCBC-SP - Universidade de São Paulo - São Paulo SP - BR RUFFO DE FREITAS JÚNIOR - TCBC-GO - Universidade Federal de Goiás - Goiânia – GO – BR SILVIA CRISTINE SOLDÁ - TCBC-SP- Faculdade de Ciências Médicas da Santa Casa de São Paulo- São Paulo - SP - BR SILVIO HENRIQUES DA CUNHA NETO – TCBC- RJ - Universidade Federal do Rio de Janeiro- Rio de Janeiro – RJ – BR SIZENANDO VIEIRA STARLING - TCBC-MG - Hospital João XXIII - Belo Horizonte - MG - BR THALES PAULO BATISTA - TCBC-PE- Faculdade Pernambucana de Saúde/ Instituto de Medicina Integral Professor Fernando Figueira - Recife - PE - BR VIVIAN RESENDE - TCBC-MG - Universidade Federal de Minas Gerais - Belo Horizonte MG - BR WILSON CINTRA JR. - TCBC-SP-Universidade de São Paulo- São Paulo- SP - BR


NATIONAL CONSULTANTS ALCINO LÁZARO DA SILVA, ECBC-MG - Universidade Federal de Minas Gerais - MG ALUIZIO SOARES DE SOUZA RODRIGUES, ECBC-RJ - Universidade Federal do Rio de Janeiro - UFRJ - RJ ANTONIO PELOSI DE MOURA LEITE, ECBC-SP - Instituto de Moléstias Cardiovasculares de São José do Rio Preto - SP DARIO BIROLINI, ECBC-SP - Faculdade de Medicina da Universidade de São Paulo - SP EUGÊNIO AMÉRICO BUENO FERREIRA, ECBC-SP - Faculdade de Medicina de Jundiaí - SP FERNANDO LUIZ BARROSO, ECBC-RJ - Hospital Municipal de Ipanema - RJ. FERNANDO MANOEL PAES LEME, ECBC-RJ - Faculdade de Medicina de Campos - RJ GASPAR DE JESUS LOPES FILHO, TCBC-SP - Universidade Federal de São Paulo - SP GUILHERME EURICO BASTOS DA CUNHA, ECBC-RJ - Universidade Federal Fluminense - RJ HELÁDIO FEITOSA DE CASTRO FILHO, TCBC-CE Universidade Federal do Ceará - CE ISAC JORGE FILHO, TCBC-SP - Universidade de Ribeirão Preto - SP. JOSÉ REINAN RAMOS, TCBC-RJ - Hospital Vitória-RJ LUIZ GUILHERME BARROSO ROMANO, ECBC-RJ MARCOS F. MORAES, ECBC-RJ - Universidade Gama Filho-RJ

ORLANDO MARQUES VIEIRA, ECBC-RJ - Universidade Federal do Rio de Janeiro-RJ ROBERTO SAAD JR., TCBC-SP - Faculdade de Ciências Médicas da Santa Casa de São Paulo-SP SAMIR RASSLAN, ECBC-SP - Faculdade de Medicina da Universidade de São Paulo-SP SAUL GOLDENBERG, ECBC-SP - Universidade Federal de São Paulo- Escola Paulista de Medicina - SP

INTERNATIONAL CONSULTANTS ARNULF THIEDE - Department of Surgery, University of Würzburg Hospital, Oberdürrbacher Str. 6, D-97080 Würzburg, Germany CLAUDE DESCHAMPS - M.D - The Mayo Clinic, MN,USA EDUARDO PARRA-DAVILA - Florida Hospital Celebration Health - 400 Celebration Pl, Kissimmee, FL 34747, USA. EMILIO DE VICENTE LÓPEZ – Sanchinarro Hospital, Madrid, Spain KARL H. FUCHS - Markus-Krankenhaus Frankfurter Diakonie-Kliniken, Wilhelm- Epstein-Straße 4, 60435 Frankfurt am Main MURRAY BRENNAN - HeCBC Department of Surgery, Memorial SloanKettering Cancer Center, New York NY, USA ULRICH ANDREAS DIETZ - Department of Surgery I, University of Würzburg, Medical School, Würzburg, Germany W. WEDER - Klinikdirektor-UniversitätsSpital Zürich, Switzerland

FORMER EDITORS 1967 - 1969 JÚLIO SANDERSON

1969 - 1971 JOSÉ HILÁRIO

1973 - 1979 HUMBERTO BARRETO

1980 - 1982 EVANDRO FREIRE

1980 - 1982 EVANDRO FREIRE

1983 - 1985 JOSÉ LUIZ XAVIER PACHECO

1986 - 1991 MARCOS MORAES

1992 - 1999 MERISA GARRIDO

2000 - 2002 2002 - 2005 JOSÉ ANTÔNIO GOMES DE SOUZA GUILHERME PINTO BRAVO NETO

2006 - 2015 JOSÉ EDUARDO FERREIRA MANSO

THE JOURNAL OF THE BRAZILIAN COLLEGE OF SURGEONS is indexed in Latindex, Lilacs and Scielo, Scopus, Medline / PubMed, DOAJ, Free Medical Journals, and sent every two months to all members of the CBC, to its subscribers, to medical institutions, libraries, hospitals and study centers, to publications with which it keeps exchange and to its advertisers.

PUBLISHING, SUBSCRIPTIONS and ADMINISTRATION Rua Visconde de Silva, 52 - 3º andar - Botafogo - 22271-092 - Rio de Janeiro - RJ - Brasil Tel.: + 55 21 2138-0659; Fax: + 55 21 2286-2595; E-mail: revistacbc@cbc.org.br http//www.cbc.org.br PRINTING AND FINISHING Gráfica e Editora Prensa Ltda Rua João Alvares, 27 Saúde - Rio de Janeiro - RJ Tel.: (21) 2253-8343

International Standard Serial Number ISSN 0100-6991

GRAPHIC DESIGN Artur Farias

GRAPHIC DESIGN – COVER Libertta Comunicação JOURNAL OF THE BRAZILIAN COLLEGE OF SURGEONS

Indexed in Latindex, Lilacs and Scielo, Scopus, Medline/PubMed, DOAJ and Free Medical Journals


Original Article

DOI: 10.1590/0100-6991e-20192011

Chest tube simulator: development of low-cost model for training of physicians and medical students. Simulador de dreno de tórax: desenvolvimento de modelo de baixo custo para capacitação de médicos e estudantes de medicina. Ana Luísa Bettega, AcCBC-PR1; Luis Fernando Spagnuolo Brunello, AcCBC-PR1; Guilherme Augusto Nazar1; Giovanni Yuji Enomoto De-Luca1; Lucas Mansano Sarquis, AsCBC-PR2; Henrique de Aguiar Wiederkehr, AcCBC-PR2; José Aguiomar Foggiatto3; Silvania Klug Pimentel, TCBC-PR2 A B S T R A C T Objective: by using a 3D printer, to create a low-cost human chest cavity simulator that allows the reproduction of the closed chest drainage technique (CCD), comparing its effectiveness with that of the animal model. Methods: it was made a 3D printing of the bony framework of a human thorax from a chest computerized tomography scan. After printing the ribs, we performed tests with several materials that contributed to form the simulation of the thoracic cavity and pleura. An experimental, randomized, and controlled study, comparing the efficacy of the simulator to the efficacy of the animal model, was then carried out in the teaching of CCD technique for medical students, who were divided into two groups: animal model group and simulator model group, that trained CCD technique in animals and in the simulator model, respectively. Results: the chest reconstruction required anatomical knowledge for tomography analysis and for faithful 3D surface editing. There was no significant difference in the safety of performing the procedure in both groups (7.61 vs. 7.73; p=0.398). A higher score was observed in the simulator model group for “use as didactic material” and “learning of the chest drainage technique”, when compared to the animal model group (p<0.05). Conclusion: the final cost for producing the model was lower than that of a commercial simulator, what demonstrates the feasibility of using 3D printing for this purpose. In addition, the developed simulator was shown to be equivalent to the animal model in relation to the simulation of the drainage technique for practical learning, and there was preference for the simulator model as didactic material. Keywords: Simulation. Models, Animal. Simulation Training. Training. Education, Medical. Drainage. Chest Tubes.

INTRODUCTION

S

imulation consists of a tool that aims to reproduce, interactively and safely, aspects of real life1,2. In the health area, simulation is seen as an effective form of teaching, which improves patient and safety care, since the individual undergoing training ― student or physician ― goes through experiences very close to those of real life and consistent with decision-making in daily medical practice1. Simulation in the medical field can also provide the ability to recognize limitations and technical failures in procedures performed by health professionals. A well-conducted simulation program can create a favorable scenario in which

activities become predictable, standardized, secure, and reproducible3. Simulators can be classified in different ways, ranging from computerized systems, dolls that play the role of patients, environments that simulate work situations, and even real people playing roles following a previously elaborated script. Another important aspect is the fidelity of the simulator. Here, “fidelity” is understood as the simulator’s ability to approach the aspect and activities of the system to be simulated in real life2. Simple simulators can be highly effective when used to simulate cognitive tasks and review procedure steps. On the other hand, more complex simulators are needed to train and develop fine motor coordination skills.

1 - Federal University of Parana, Faculty of Medicine, Curitiba, PR, Brazil. 2 - Hospital do Trabalhador, General Surgery and Trauma Service, Curitiba, PR, Brazil. 3 - Federal Technological University of Parana, Academic Department of Mechanics, Curitiba, PR, Brazil. Rev Col Bras Cir 46(1):e2011


2

Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

However, one of the major problems and limitations that simulation centers present is the cost of most equipment, mannequins, partial models used, instructors, and maintenance1-8. Nevertheless, it is fully possible to develop low-cost simulators that prioritize the learning of tasks and routines in which repetitive practice is more important1. For simulations involving teams, detailed environments, high-tech mannequins, high-value softwares, integrated simulators, instructors, and real patients, the cost will be higher, but there will be the development of more complex simulations, so as to fit the specific purpose of each station1,2,4. The use of porcine rib hemithorax for training of the chest drain insertion technique by physicians and Brazilian medical students has already been described, with a high anatomical correlation between the porcine ribs and the human thorax9. The main advantage of the method is its low cost and easy obtainment of the material, since animal segments are relatively easier to acquire than a complete corpse. However, the model also presents limitations: because it is biological and perishable material, it cannot be reused and requires cooling care, so that the material does not deteriorate and the work does not become unfeasible. In addition, it is necessary that the skin and the subcutaneous tissue are intact and with optimum consistency and thickness, and, although the porcine rib is relatively easy to find in conventional supermarkets, the â&#x20AC;&#x153;ideal materialâ&#x20AC;?, under the mentioned conditions, is not. The objective of this work was to create a low-cost simulator using 3D printing, with anatomical conditions similar to a segment of the human thoracic cavity, in order to reproduce the closed chest drainage technique and apply the model developed in the training of medical

students to evaluate its effectiveness and the satisfaction of the participants in relation to the simulator model compared to the animal model.

METHODS An experimental, randomized, and controlled study was carried out through the development of a 3D printing model that allowed the simulated training of the closed chest drainage procedure for medical students at the emergency room of Hospital do Trabalhador, Curitiba, Parana, Brazil. A 3D printing of the bony framework of a human thorax was made using a chest tomography, without the need of a funder and through a partnership with Federal Technological University of Parana (UTFPR) with a total cost of approximately 133 dollars (Figure 1). After printing the ribs, tests were performed with various materials that contributed to form the simulation of the thoracic cavity and pleura (Figure 2).

Figure 1. 3D printing of a thorax.

Rev Col Bras Cir 46(1):e2011


Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

3

Figure 2. Chest drain simulator model (SIM drain).

After completion, this model was used for the training of medical students in internship period at the emergency room of Hospital do Trabalhador. The academics, from the fifth to the eighth period, were invited to participate in the research on a voluntary basis. They were students from the five medical schools of Curitiba: Federal University of Parana (UFPR), Universidade Positivo (UP), Pontifical Catholic University of Parana (PUCPR), Evangelical Faculty of Parana (FEPAR), and Faculdades Pequeno PrĂ­ncipe (FPP). A brief lecture was presented, exposing the chest drainage technique with the visual aid of a video. After this first part, the students answered part of the questionnaire evaluating the technique of the model. They answered questions about their safety in performing chest drainages after the presentation of its theoretical content. These technical questions were taken from a checklist of the chest drainage procedure developed by professors of the Training and Simulation discipline at Federal University of Parana.

The students were randomly divided into two groups: AMG, animal model group, the traditional simulation model, which performed drainage in the porcine model (porcine ribs), and SMG, simulator model group, which performed drainage in the simulator model developed by the authors. After the practical activity, the students answered the questionnaire composed of two parts. The first part was about the studentsâ&#x20AC;&#x2122; experience in simulation and their safety in performing chest drainages in patients after the practical activity with the simulator. The second part was related to the content of the research. The students answered questions about the importance of this procedure in the undergraduation program, as well as if the model was useful as didactic material and allowed the learning of the technique, if they would like to use other simulators developed with the same concept, if the practical activity was adequate, and if the learning of the procedure was

Rev Col Bras Cir 46(1):e2011


4

Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

appropriate. All questions in the questionnaire should be answered through a scale ranging from 0 to 10. At the end, the academics answered questions to identify the sample, such as age, gender, university, and period. They had space to write comments and suggestions. The results obtained were tabulated by Microsoft Excel. The normal distribution variables were described using mean and standard deviation. Epidemiological data were calculated with simple statistical percentages. The continuous variables were analyzed using Student's t-test. The rejection level of the null hypothesis was set at 5%. The present study was approved by Research Ethics Committee Involving Human Beings/Secretary of Health of Parana State under the number 2199465.

RESULTS A total of 49 medical students participated in this study. The mean age was of 22.4 years and 30 students (61.2%) were female. Only 15 academics (30.6%) stated that they did not have experience with simulators. Twenty-three (46.9%) were submitted to the practical activity with the animal model (porcine ribs) and 26 (53%) with the simulator model, developed by the researchers. After the theoretical presentation on the chest drainage technique and the video showing the procedure, the 49 medical students answered this question: â&#x20AC;&#x153;How safe would you feel to perform the procedure on a patient?". The average of the grades was 5.44 (in the AMG, the average was 5.47; in the SMG, 5.42 â&#x20AC;&#x2022; p=0.460). After the practical activity, the 49 academics were asked to answer the same question, and, on this occasion, the average of the grades was 7.67 (in the AMG, the average

was 7.60; in the SMG, 7.73 â&#x20AC;&#x2022; p=0.398). The score of the participants of this study (n=49) ranged from 5.44 to 7.67 (p<0.001). In the AMG, it ranged from 5.47 to 7.60, reflecting an increase of 38.9% (p<0.0001). In the SMG, the score ranged from 5.42 to 7.73, reflecting an increase of 42.6% (p<0.0001) (Table 1). In relation to the experience in the simulation, the students were asked to punctuate some items about the safety they would have to perform the following techniques in a patient: approximately 1.5cm skin incision, divulsion of the planes with penetration into the pleural cavity, introduction of the index finger into the pleural orifice, drain insertion (posterosuperiorly) until the mark is reached. When comparing the average of the grades of the two groups after the practical activity, totals of 8.95 for the AMG and 9.11 for the SMG (p=0.335) were found for the first item evaluated; for the second item, 7.95 for the AMG and 8.57 for the SMG (p=0.146); for the third item, 8.69 for the AMG and 9.07 for the SMG (p=0.194); and, for the fourth item, 8.26 for the AMG and 8.73 for the SMG (p=0.143) (Table 2). The range of the average of the grades (in percentage) after the theoretical presentation and the practical activity was described in table 3. In both groups, there was an increase in the average of the grades in all evaluated items of the checklist. Regarding the content, the participants considered of great relevance the practice of the chest drainage procedure for medical undergraduate students, attributing an average score of 9.81. When the SMG students were asked if they would like to use other simulators developed with the same concept, the average of the grades was 9.69. When asked whether the model was useful as didactic material for the undergraduation program,

Rev Col Bras Cir 46(1):e2011


Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

5

DISCUSSION

the average of the grades was 8,0 for the AMG and 8.88 (p=0.016) for the SMG. When asked if the model allowed the learning of the chest drainage techniques, the average of the grades was 8.17 for the AMG; 8.88 for the SMG (p=0.022) (Table 4).

Medical education has been undergoing a paradigm shift, placing simulation as an effective tool to meet the new educational and social

Table 1. Safety of performing a chest drainage procedure on a patient.

After theoretical presentation After practical training

Total (n=49) 5.44 (±1.93) 7.67 (±1.63)

AMG* (n=23) 5.47 (±2.04) 7.61 (±1.43)

SMG** (n=26) 5.42 (±1.87) 7.73 (±1.82)

p 0.460 0.398

* AMG: animal model group; ** SMG: simulator model group.

Table 2. Technical experience undergone through practical training.

Approximately 1.5cm skin incision Divulsion of the planes with penetration into the pleural cavity Introduction of the index finger into the pleural orifice Drain insertion (posterosuperiorly) until the mark is reached

Total (n=49) 9.04 (±1.29) 8.28 (±2.04)

AMG*(n=23) 8.95 (±1.49) 7.95 (±2.34)

SMG**(n=26) 9.11 (±1.17) 8.57 (±1.72)

p 0.335 0.146

8.89 (±1.53)

8.69 (±1.89)

9.07 (±1.12)

0.194

8.51 (±1.52)

8.26 (±1.81)

8.73 (±1.22)

0.143

* AMG: animal model group; ** SMG: simulator model group.

Table 3. Range of the score, before and after the practical activity.

After theoretical presentation After practical activity Range (%)   AMG* SMG** AMG* SMG** AMG* SMG** Approximately 1.5cm skin incision 8.21 8.03 8.95 9.11 9,0 13.4 Divulsion of the planes with 6.82 6.84 7.95 8.57 16.5 25.2 penetration into the pleural cavity Introduction of the index finger 7.34 8.34 8.69 9.07 18.3 8.7 into the pleural orifice Drain insertion (posterosuperiorly) 5.91 6.23 8.26 8.73 39.7 40.1 until the mark is reached * AMG: animal model group; ** SMG: simulator model group.

Table 4. Didactic content.

Was the model useful as didactic material for the undergraduation program? Did the model allow the learning of the chest drainage techniques? Was the practical activity adequate? Was the learning of the procedure adequate?

Total (n=49) 8.46 (±1.45)

AMG*(n=23) 8.0 (±1.56)

SMG**(n=26) 8.88 (±1.24)

p 0.016***

8.55 (±1.24)

8.17 (±1.26)

8.88 (±1.14)

0.022***

9.02 (±1.42) 8.51 (±1.67)

8.91 (±1.78) 8.30 (±1.89)

9.11 (±1.03) 8.69 (±1.46)

0.312 0.211

* AMG: animal model group; ** SMG: simulator model group; *** statistically significant result.

Rev Col Bras Cir 46(1):e2011


6

Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

challenges of our time10. The high cost of simulators is still the main limitation of their use by universities in the teaching of medical students11. Thus, the role of the practical, effective, and low-cost simulator developed by the authors of the article is highlighted. When questioned about the safety in performing the chest drainage procedure in a patient after the theoretical class, very similar scores were observed between the SMG and the AMG, what confirms the homogeneity of the groups in which they were separated. By relating the scores the students gave to the same questioning after the theoretical presentation and after the practical activity, the results were statistically significant. There was an increase in the score for both the AMG and the SMG, what reveals that the practical activity has a superior benefit in developing confidence and safety to perform the procedure when compared to just theoretical presentation and illustrative videos, and, in this respect, both models that were used fulfilled the goal. Literature is extensive in stating that the observation-based learning model is debatable because it does not stimulate the student’s total involvement and does not produce effective training. Thus, for skill acquisition, especially in the surgical and interventional procedure areas, sustained practice is necessary12. In addition, the use of some synthetic model is essential so that the student can gain confidence and, later, carry out clinical procedures on patients13. In the question about how secure they felt in performing the procedure after the practical activity with the simulator, the scores were also similar for both groups, and, although the SMG presented a greater difference between the pre- and postpractice grades, there was no statistic significance between them, revealing that the simulator model may not be superior to the traditional animal model in the learning gain of the students, but it is equivalent.

Nowadays, the “3 R’s Program” is known and well-established. Its objective is of reducing, refining, and replacing the number of animals used in research and improving the conduction of the studies in order to reduce to the possible minimum the suffering and to increase the search for alternative methods that, in the end, replace the in vivo tests14. Thus, the use of the simulator is an excellent option for training, since, besides having the consistency similar to that of a real model, it does not allow the sacrifice of an animal model, in the initial phase of the academic learning15. For comparison between groups, the researchers chose the checklist steps that depended on the practice in a simulator model to be performed. They were the following: approximately 1.5cm skin incision, divulsion of the planes with penetration into the pleural cavity, introduction of the index finger into the pleural orifice, drain insertion (posterosuperiorly) until the mark is reached. The results showed that there was an increase in the average of the grades in all the evaluated steps of the checklist, reinforcing the fact that, after the practical training activity, the learning is greater. There was no statistically significant difference in the average of the grades between the groups after the practical activity, what shows that the models are similar in relation to the objective of teaching the procedure for academics. However, it must be considered that the increase in the averages was higher for the SMG in three of the four evaluated parameters. It was also observed that the item called “drain insertion (posterosuperiorly) until the mark is reached” was the one which obtained the highest score increment after practical activity, in the AMG and SMG, with an increase of approximately 40% in both groups. This data is of great relevance for the teaching in medical schools, since it is known that one of the great difficulties of the apprentice doctor is the correct placement of the drain in the patient (posterosuperiorly) and

Rev Col Bras Cir 46(1):e2011


Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

that poor positioning can result in non-adequate functioning and complications16,17. Although the checklist item called “marking the drainage site” was not evaluated, it should be considered that only the simulator model can guide the student to fulfill this requirement, since it preserves the anatomical reference points of the human chest, unlike the animal model, in which a piece of porcine rib is used for the same purpose. As didactic material, the simulator model was preferred by the students, with statistically significant difference. This can be explained by the students’ perception of being more comfortable using the simulator in relation to the animal model. The use of animals remains as a training alternative, but with increasing respect for ethical norms for their utilization and respecting their use for increasingly specific situations in which complexity is high18. The search for alternative resources to the use of animals leads to the ethical valorization in the educational environment, besides preserving the ethical, moral, psychological, and social integrity of the students13. In addition, the students stated that, for the learning of the chest drainage technique, the simulator model was also superior to the animal

7

model, with statistically significant difference. This result was already expected, since satisfaction with simulation as a teaching method has been consistently proven19. The use of technological advancements for teaching is imperative, primarily for younger generations of medical students, and educational formats must adapt to learning styles and preferences20. As limitation to the study, we can mention the subjectivity of the evaluated items in the form of a questionnaire response (using a graduated scale), since the experience of each one with the simulation depends on several personal factors, such as previous experience with simulators, perception about the use of animals for teaching, and the student’s personal experience in the offered practical activity. With our work, we could conclude that the final cost for producing the model was lower than that of a commercial simulator, what demonstrates the feasibility of using 3D printing for this purpose. In addition, the developed simulator was shown to be equivalent to the animal model in relation to the simulation of the drainage technique for practical learning, and there was preference for the simulator model as didactic material.

R E S U M O Objetivo: criar, em impressora 3D, um simulador de baixo custo de caixa torácica humana que permita a reprodução da técnica de drenagem fechada de tórax (DFT) comparando sua eficácia com a do modelo animal. Métodos: foi realizada impressão 3D do arcabouço ósseo de um tórax humano a partir de uma tomografia de tórax. Após a impressão das costelas, foram realizados testes com diversos materiais que contribuíram para formar a simulação da caixa torácica e da pleura. Foi, então, realizado um estudo experimental, randomizado e controlado comparando sua eficácia ao modelo animal no ensino da DFT para estudantes de medicina, que foram divididos em dois grupos: Grupo Modelo Animal e Grupo Modelo Simulador, que treinaram DFT em animais e no modelo simulador, respectivamente. Resultados: a reconstrução do tórax exigiu o conhecimento anatômico para análise da tomografia e para edição fiel da superfície 3D. Não houve diferença significativa quanto à segurança de realizar o procedimento entre os grupos (7,61 vs. 7,73; p=0,398). Foi observada maior pontuação no grupo modelo simulador para uso como material didático e aprendizado da técnica de drenagem torácica quando comparado ao grupo modelo animal (p<0,05). Conclusão: o custo final para a confecção do modelo foi inferior ao de um simulador comercial, o que demonstra a viabilidade do uso da impressão 3D para esse fim. Além disso, o simulador desenvolvido se mostrou equivalente ao modelo animal quanto à simulação da técnica de drenagem para aprendizado prático e houve preferência pelo modelo simulador como material didático. Descritores: Simulação. Modelos Animais. Treinamento por Simulação. Capacitação. Educação Médica. Drenagem. Tubos Torácicos.

Rev Col Bras Cir 46(1):e2011


8

Bettega Chest tube simulator: development of low-cost model for training of physicians and medical students.

REFERENCES 1.

Gaba DM. The future vision of simulation in health care. Qual Saf Health Care. 2004;13 Suppl 1:i2-10. 2. Maran NJ, Glavin RJ. Low- to high-fidelity simulation - a continuum of medical education? Med Educ. 2003;37 Suppl 1:22-8. 3. Okuda Y, Bryson EO, DeMaria S Jr, Jacobson L, Quinones J, Shen B, et al. The utility of simulation in medical education: what is the evidence? Mt Sinai J Med. 2009;76(4):330-43. 4. Good ML. Patient simulation for training basic and advanced clinical skills. Med Educ. 2003;37 Suppl 1:14-21. 5. Heitz C, Eyck RT, Smith M, Fitch M. Simulation in medical student education: survey of clerkship directors in emergency medicine. West J Emerg Med. 2011;12(4):455-60. 6. Flores CD, Bez MR, Bruno RM. O uso de simuladores no ensino da medicina. Rev Bras Inform Educ. 2014;22(2):98-108. 7. Flato UAP, Guimarães HP. Educação baseada em simulação em medicina de urgência e emergência: a arte imita a vida. Rev Soc Bras Clin Med. 2011;9(5):360-4. 8. Pezzi L, Pessanha Neto S. O Laboratório de habilidades na formação médica. Cad ABEM. 2008;4:16-22. 9. Netto FA, Sommer CG, Constantino MM, Cardoso M, Cipriani RF, Pereira RA. Teaching project: a lowcost swine model for chest tube insertion training. Rev Col Bras Cir. 2016;43(1):60-3. 10. Luna RA, Spight D. Simulação em educação médica: uma mudança necessária. Rev Hosp Univ Pedro Ernesto. 2014;13(4):57-61. 11. Ferreira C, Carvalho JM, Carvalho FL de Q. Impacto da metodologia de simulação realística, enquanto tecnologia aplicada à educação nos cursos de saúde. In: Seminário de Tecnologias Aplicadas a Educação e Saúde, 2, 2015 Out 26-27; Salvador (BA). Salvador: UNEB; 2015. p.32-40.

12. Kneebone R, ApSimon D. Surgical skills training: simulation and multimedia combined. Med Educ. 2001;35(9):909-15. 13. Magalhães M, Ortêncio Filho H. Alternativas ao uso de animais como recurso didático. Arq Ciênc Vet Zool Unipar. 2006;9(2):147-54. 14. Hayes AW, editor. Principles and methods of toxicology. 5th ed. Abingdon (OX):Taylor & Francis; 2001. 15. Maluf Junior I, Silva ABD, Groth AK, Lopes MAC, Kurogi AS, Freitas RDS, et al. An alternative experimental model for training in microsurgery. Rev Col Bras Cir. 2014;41(1):72-4. 16. Ball CG, Lord J, Laupland KB, Gmora S, Mulloy RH, Ng AK, et al. Chest tube complications: how

17.

18.

19.

20.

well are we training our residents? Can J Surg. 2007;50(6):450-8. Hashmi U, Nadeem M, Aleem A, Khan FUHH, Gull R, Ullah K, et al. Dysfunctional closed chest drainage - common causative factors and recommendations for prevention. Cureus. 2018;10(3):e2295. Motta EV, Baracat EC. Treinamento de habilidades cirúrgicas para estudantes de medicina - papel da simulação. Rev Med (São Paulo). 2018;97(1):18-23. Lorello GR, Cook DA, Johnson RL, Brydges R. Simulation-based training in anaesthesiology: a systematic review and meta-analysis. Br J Anaesth. 2014;112(2):231-45. Troncon LEA, Maffei CML. A incorporação de recursos de simulação no curso de graduação em medicina da Faculdade de Medicina de Ribeirão Preto - USP. Medicina (Ribeirão Preto). 2007;40(2):153-61.

Received in: 09/19/2018 Accepted for publication: 10/25/2018 Conflict of interest: none. Source of funding: none. Mailing address: Ana Luísa Bettega E-mail: bettega.ana@gmail.com silvaniaklug@gmail.com

Rev Col Bras Cir 46(1):e2011


Original Article

DOI: 10.1590/0100-6991e-20192068

Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastric cancer. Análise comparativa do polimorfismo genético da glutationa transferase, do Helicobacter pylori e do vírus Epstein-Barr entre a área do tumor e as margens de ressecção proximal e distal do câncer gástrico. Thais Messias Maccormick1; Carlos Eduardo Souza Carvalho1; Guilherme Pinto Bravo Neto, TCBC-RJ2; Maria da Gloria da Costa Carvalho1 A B S T R A C T Objective: to compare the polymorphism of the Glutathione S-transferase theta 1 (GSTT1) and Glutathione S-transferase mu 1 (GSTM1) genes from the tumor area with the proximal and distal margins of stomach specimens resected from patients with gastric cancer, and to investigate the presence of Epstein-Barr virus (EBV) DNA and Helicobacter pylori. Methods: we prospectively collected tissue specimens from the tumor area and from the proximal and distal resection margins of the stomachs of ten patients with gastric adenocarcinoma who underwent gastrectomy with D2 lymphadenectomy, and submitted these specimens to DNA extraction. We compared the tumor area with the proximal and distal margins of the resected stomachs for polymorphism of GSTT1 and GSTM1 genes and investigated the presence of EBV-DNA and H. pylori. We used the p53 exon 5 gene as an internal control of the multiplex PCR reaction. Results: in one patient, we detected null GSTT1 and GSTM1 genotypes in the tumor area, in contrast to the presence of both genes in the proximal and distal margins. We found EBV-DNA and H. pylori in the tumor area and also in the proximal and distal margins. In another patient, the proximal margin was negative for GSTT1, and EBV-DNA was negative in the distal margin. In three patients, EBV-DNA was negative only in the distal margin. Conclusion: this is the first report where different genotypes, EBV-DNA and H. pylori infection were observed in the same patient, indicating a probable deletion of these genes in response to tumor progression and intratumoral heterogeneity. Keywords: Glutathione Transferase. Polymorphism. Genetic. Stomach Neoplasms. Helicobacter pylori. Epstein-Barr Virus Infections.

INTRODUCTION

G

astric cancer (GC) is still an important cause of death from cancer throughout the world. In Brazil is the third most common malignancy among men and the fifth among women1. However, the genetic pathway of this tumor development and progression remains uncertain. It's a multifactorial disease that results from individual genetic predisposition and exposure environmental factors such as diet, alcohol consumption, smoking and chronic infection of Helicobacter pylori or Epstein-Barr virus (EBV)2-4.

The Epstein-Barr virus belongs to the genus lymphocryptovirus of the human gama-herpesvirus family, and infects more than 90% of the world adult population5. It is a ubiquitous herpesvirus that is classified as a group 1 carcinogen by the International Agency for Research on Cancer. EBV is associated with various malignances such as Burkitt lymphoma, Hodgkin lymphoma, nasopharyngeal carcinoma, natural killer cell lymphoma and also gastric cancer2,6. Epstein Barr virus and H. pylori co-infection are positively associated with severe gastritis in pediatric patients and gastric cancer3,4,7,8.

1 - Federal University of Rio de Janeiro, Department of Pathology, Rio de Janeiro, RJ, Brazil. 2 - Federal University of Rio de Janeiro, Department of Surgery, Rio de Janeiro, RJ, Brazil. Rev Col Bras Cir 46(1):e2068


2

Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

Glutathione S-transferases (GST; EC 2.5.1.18), a super gene family of phase II detoxification enzymes, appears to form a protective mechanism against chemical carcinogenesis9. Glutathione S-transferase mu 1 (GSTM1) and Glutathione S-transferase theta 1 (GSTT1) are critical enzymes for detoxification of endogenous and environmental carcinogens. The GSTT1 gene is located in chromosome 22, and the GSTM1, in chromosome 110. Homozygote deletions or absence of genotype of GSTT1 and GSTM1 genes may be associated with increased risk of cancer11. Polymorphism is a term used in genetics to describe multiple forms of a single gene that exists in an individual or among a group of individuals. The GSTM1 and GSTT1 isoenzymes exhibit deletion polymorphisms, resulting in a lack of activity, and the null genotypes have been associated with a significantly increased risk of gastric cancer12. Our study aims to compare the polymorphism of the GSTT1 and GSTM1 genes in the tumor area with the proximal and distal margins of stomach specimens resected from patients with gastric cancer, and to investigate the co-infection of EBV and H. pylori.

METHODS We prospectively studied ten patients with gastric adenocarcinoma who underwent gastrectomy with D2 lymphadenectomy at the Clementino Fraga Filho University Hospital of the Federal University of Rio de Janeiro, Brazil. We extracted the genomic DNA from fresh tumor tissue and from the proximal and distal resection margins (Figure 1). We isolated it by digestion in 500µl containing 10mM Tris-HCl, pH 7.5, 10mM NaCl, 2% SDS, 10mM EDTA, pH 8.0, and 15µl 10mg/ml proteinase K at 60ºC for 2h. Thereafter, we added an equal volume of 1:1 (v/v) phenol: chloroform, followed by vigorous shaking and centrifugation. The aqueous phase was separated and the DNA precipitated with two volumes of absolute ethanol at -20ºC overnight. After centrifuga tion, we washed the pellets with 70% ethanol and resuspended the DNA in Milli-Q water. We submitted the extracted genomic DNA to PCR to confirm DNA integrity using p53 gene exon 5 primers, generating a 274 bp product as reported by Pestaner et al.13. We detected GSTM1 and

Figure 1. Gastrectomy specimens from patients 1 and 5, showing the tumor area (T), the proximal margin (PM) and the distal margin (DM).

Rev Col Bras Cir 46(1):e2068


Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

GSTT1 genotypes by multiplex polymerase chain reaction (PCR) with the p53 gene exon 5 as an internal control for the success of the amplification reaction. The primers used for GSTM1, GSTT1, and p53 are described in table 1. The PCR conditions included initial denaturation at 94ºC for five minutes followed by 30 cycles of 95ºC for 1min, 64ºC for 1min, 72ºC for 1min. The final extension was at 72ºC for 5min14. After amplification, we separated the PCR products in 10% polyacrylamide gel electrophoresis and visualized them with silver nitrate. We performed gel staining as follows: one initial step of DNA fixation using a 10% ethanol and 0.37% acetic acid solution for 10min, one step of impregnation by 0.2% silver nitrate solution for 10min fol lowed by a rinse with distilled water for 30s, and one final step with 3% NaOH and 0.4% formal dehyde solution until the DNA bands were clearly visible. We used the initial solution to stop the reaction15. Detection of Epstein-Barr Virus (EBV) and Helicobacter pylori DNA.

We assessed the presence of EBV and H. pylori DNA in the samples using PCR. To detect the EBV-DNA, we employed the consensus primers TC67

3

and TC6916, whose product is a 288bp fragment. For the H. pylori-DNA detection, we used primer pairs for the glmM gene as described by Espinoza et al.17 to obtain a PCR product size of 140bp. We performed the amplification for EBV-DNA as follows: 95ºC for 1min, followed by 40 cycles at 94ºC for 1min, 55ºC for 2min, 72ºC for 1min, and a final extension step of 5min at 72ºC. The parameters for the amplification of H. pylori-DNA were: 5min for the initial denaturing at 96ºC, then 35 cycles at 95ºC, 55ºC and 72ºC, being 1min for each temperature during the cycles, and a final elongation step at 72ºC for 7min. We stored the products resulting from DNA amplification (amplicons) at 4ºC until use, when we analyzed them in 10% polyacrylamide gel stained with silver15. We used Raji cell lines and a positive sample for H. pylori infection as positive reaction controls for EBV and H. pylori, respectively. The negative controls were samples containing just the reaction mixture without DNA. This research complies with the guidelines for human studies and animal welfare regulations. Our institute's committee on human research (Research Ethics Committee/Institutional Review Board) has approved the study protocol (CAAE 43698915.6.0000.5257) and all patients signed an informed consentform.

Table 1. List of primers used.

Gene GSTM1** GSTT1***   p53 (exon 5)   EBV-TC67# EBV-TC69# glmM17  

Sequence of forward (F) and reverse (R) primers (F) 5' GAACTCCCTGAAAAGCTAAAGC 3' (R) 5' GTGGGCTCAAATATACGGTGG 3' (F) 5' TTCCTTACTGGTCCTCACATCTC 3' (R) 5' TCACCGGATCATGGCCAGCA 3' (F) 5' GCAACCAGCCCTGTCGTGTCTCCA 3' (R) 5' GGAATTCTGTTCACTTGTGCCCTGACTTTCAAC3' 5' CAG GCT TCC CTG CAA TTT TAC AAG CGG 3' 5' CCCAGAAGTATACGTGGTGACGTAGA 3' (F) 5'GGA TAA GCT TTT AGG GGT GTT AGG GG3' (R) 5'GCA TTC ACA AAC TTA TCC CCA ATC3'

Product size (bp*) 220 450   274   288   140  

bp*: base pairs; GSTM1**: Glutathione S-transferase mu 1; GSTT1***: Glutathione S-transferase theta 1; TC67/TC69#: consensus primers; Espinoza et al17.

Rev Col Bras Cir 46(1):e2068


Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

4

RESULTS Ages ranged from 51 to 75 years; six patients were male and four were female. Table 2 shows the tumor characteristics, surgical and pathological findings, as well as staging. Table 3 shows the polymorphism for GSTT1 and GSTM1 from the tumor area (T), the distal margin (DM) and the proximal margin (PM). Table 4 shows the presence or absence of Epstein-Barr Virus (EBV) or H.pylori associated with gastric cancer.

We detected products of GSTT1 and GSTM1 genes in both proximal and distal margins in patient 1, but observed null genotypes in the tumor area. In patient 5, the proximal margin was negative for GSTT1. The presence of amplification product for the p53 gene in all samples indicates the internal control of the reaction. In the other eight analyzed patients, we observed no such imbalance (Figure 2). We found EBV DNA in the tumor area and also in the proximal and distal margins in patients 1, 3 and 8, but not in the distal margin of patients 5, 9 and 10. We observed H.pylori and EBV co-infection in 5/10 (50%) of cases (table 4).

Table 2. Tumor characteristics, surgical and pathological findings, and staging.

Patient

Age

Gender

Tumor location

Histologic type

Surgery

Resection margin

Staging

1

51

M

Cardia III

Poorly differentiated/ diffuse type

Total gastrectomy

Negative

T3N3aM1

2

75

M

Body

Moderately differentiated/ intestinal type

Subtotal gastrectomy

Negative

T2N0M0

3

71

M

Antrum Moderately differentiated/ intestinal type

Subtotal gastrectomy

Negative

T3N1M0

4

53

M

Cardia III

Total gastrectomy

Positive

T3N2M0

5

56

F

Antrum Moderately differentiated/ intestinal type

Subtotal gastrectomy

Negative

T3N3aM0

6

53

F

Fundus

Poorly differentiated/ diffuse type

Total gastrectomy

Negative

T3N1M0

7

52

F

Antrum

Well differentiated/ intestinal type

Subtotal gastrectomy

Negative

T1aN0M0

8

69

M

Antrum

Poorly differentiated/ diffuse type

Subtotal gastrectomy

Negative

T3N2M0

9

61

M

Body + Moderately differentiated/ Antrum intestinal type

Total gastrectomy

Negative

T3N1M0

10

58

F

Antrum

Antrectomy

Negative

T3N0M0

Poorly differentiated/ diffuse type

Poorly differentiated/ difuse type

Rev Col Bras Cir 46(1):e2068


Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

5

Table 3. Glutathione S-transferase mu 1 (GSTM1) and Glutathione S-transferase theta 1 (GSTT1) genotypes.

Genes Patients 1 2 3 4 5 6 7 8 9 10

DM* POS POS POS POS POS NEG POS POS POS POS

GSTT1 T† NEG POS POS POS POS NEG POS POS POS POS

PM POS POS POS POS NEG NEG POS POS POS POS ‡

DM* POS POS NEG POS POS POS NEG POS POS POS

GSTM1 T† NEG POS NEG POS POS POS NEG POS POS POS

PM‡ POS POS NEG POS POS POS NEG POS POS POS

H.pylori T† POS NEG POS NEG POS POS POS POS NEG POS

PM‡ POS NEG POS NEG POS NEG POS POS NEG POS

DM*: distal margin; T†: Tumor area; PM‡: proximal margin; POS: positive; NEG: negative.

Table 4. EBV DNA and H. pylori detection.

Patients 1 2 3 4 5 6 7 8 9 10

DM* POS NEG POS NEG NEG NEG NEG POS NEG NEG

EBV T† POS NEG POS NEG POS NEG NEG POS POS POS

PM POS NEG POS NEG POS NEG NEG POS POS POS ‡

DM* POS NEG POS NEG POS POS POS POS NEG POS

DM*: distal margin; T†: Tumor area; PM‡: proximal margin; POS: positive; NEG: negative.

DISCUSSION The

review

of

Knuutila

et

al.18,19

describes many chromosomal aberrations, such as losses and gains of tumor DNA sequences, Figure 2. Multiplex PCR of GSTM1 and GSTT1 genes and of exon 5 of the p53 protein encoding gene (Tp53), 100 base pairs ladder (bp) negative control (C-). Patient 1: DNA from tumor fragment (T) showing null genotype (absence of 480 and 215 bp) for GSTT1 and GSTM1. PM and DM correspond to proximal and distal tumor margins, showing amplification for GSTT1 and GSTM1. The p53 exon 5, used as an internal control, is detected in all samples. Patient 5: GSTT1 was absent only in PM.

which occur in various malignant tumors. Chromosomal instability and heterogeneous gene amplifications/deletions are associated with many malignances20-23. For gastric cancer, Noguchi et al.24 detected no chromosomal deletions of the GSTM1 and GSTT1 genes in their work.

Rev Col Bras Cir 46(1):e2068


6

Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

The authors, when comparing their results to of

variations such as chromosome number or structure changes, which are also called chromosome instability28,29.

chromosomal aberrations between European

Epstein-Barr virus is associated with

patients and those from high-risk populations,

several human tumors, and in 1990, EBV genomes

such as from Japan, suggesting different tumor

were detected in gastric carcinomas 30. Wu et

geneses in these populations. In our study in

al. 31 demonstrated that EBV DNase may induce

Brazilian patients with gastric adenocarcinomas,

genomic instability through two mechanisms:

we noticed a null genotype for GSTT1 and

directly, by damage to the DNA, and indirectly, by

GSTM1 only in the tumor area of one patient,

inhibition of DNA repair. Helicobacter pylori and

and a null genotype for GSTT1 in the proximal

EBV infections are well-established risk factors

margin in other. These results reflect an

for gastric cancer development. H. pyloricauses

intratumoral heterogeneity for the genes studied.

gastritis in humans, with chronic inflammation.

In one of our other studies, a multiplex PCR was

This chronic inflammation is thought to be

performed for GSTT1 and GSTM1 genes using

the cause of genomic instability 32. H. pyloriis

samples from the three distinct areas of a solid

categorized as a group I carcinogen, since this

pseudopapillary neoplasm of the pancreas. The

bacterium is responsible for the highest rate of

results showed a null genotype for GSTT1 in

cancer-related deaths worldwide33.

one performed with Japanese population25, observed

differences

in

the

pattern

tumor areas 1 and 3 when compared with area

In our study, only the specimens from

2. The null genotype for GSTT1 in areas 1 and

patients 2 and 4 were free of infection by either

3 of the tumor indicates tumor heterogeneity .

EBV or H.pylori. Probably, other risk factors such

This is the first report where different genotypes

as age, gender, smoking, drinking, or dietary

for GSTT1 and GSTM1, EBV-DNA and H. pylori

factors may be associated in these patients.

infection were observed in the same patient,

Interaction between EBV andH. pyloriin the

indicating a probable deletion of these genes in

host stomach lining may have some synergistic

response to tumor progression and intratumoral

effects in the development of gastric cancer32.

heterogeneity. Intratumoral heterogeneity has been described as an inherent characteristic in most human cancers27. A major cause of genetic heterogeneity in cancer is genomic instability27. Genomic instability includes increased frequencies of base pair mutation, microsatellite instability,

In our study, the co-infection between H. pylori

26

and EBV may be associated as one of the factors responsible for the onset of patients' gastric cancer. The genomic instability in response to EBV or H.pylori infection could also be responsible for the null genotypes of GSTM1 and GSTT1 found in the present study.

Rev Col Bras Cir 46(1):e2068


Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

7

R E S U M O Objetivo: comparar o polimorfismo dos genes Glutationa S-transferase teta 1 (GSTT1) e Glutationa S-transferase mu 1 (GSTM1) da área do tumor com as margens proximal e distal de espécimes de estômago ressecados de pacientes com câncer gástrico, e investigar a presença do DNA do vírus Epstein-Barr (EBV) e Helicobacter pylori. Métodos: coletamos prospectivamente amostras teciduais da área do tumor e das margens de ressecção proximal e distal dos estômagos de dez pacientes com adenocarcinoma gástrico submetidos à gastrectomia com linfadenectomia D2 e submetemos esses espécimes à extração de DNA. Comparamos a área do tumor com as margens proximal e distal dos estômagos ressecados para o polimorfismo dos genes GSTT1 e GSTM1 e investigamos a presença de DNA do EBV e H. pylori. Utilizamos o exon 5 do gene p53 como controle interno da reação de PCR multiplex. Resultados: em um paciente, detectamos genótipos GSTT1 e GSTM1 nulos na área do tumor, em contraste com a presença de ambos os genes nas margens proximal e distal. Encontramos DNA do EBV e H. pylori na área do tumor e também nas margens proximal e distal. Em outro paciente, a margem proximal foi negativa para GSTT1 e o DNA do EBV foi negativo na margem distal. Em três pacientes, o EBVDNA foi negativo apenas na margem distal. Conclusão: este é o primeiro relato em que diferentes genótipos, infecção por EBV-DNA e H. pylori foram observados no mesmo paciente, indicando provável deleção desses genes em resposta à progressão tumoral e heterogeneidade intratumoral. Descritores: Glutationa Transferase. Polimorfismo Genético. Neoplasias Gástricas. Helicobacter pylori. Infecções por Vírus Epstein-Barr.

REFERENCES

6.

1.

Oliveira MM, Malta DC, Guauche H, Moura L, Silva GA. Estimativa de pessoas com diagnóstico de câncer no Brasil: dados da Pesquisa Nacional de Saúde, 2013. Rev Bras Epidemiol. 2015;18(suppl 2):146-57. 2. Böger C, Krüger S, Behrens HM, Bock S, Haag J, Kalthoff H, et al. Epstein-Barr virusassociated gastric cancer reveals intratumoral heterogeneity of PIK3CA mutations. Ann Oncol. 2017;28(5):1005-14. 3. Herrera V, Parsonnet J. Helicobacter pylori and gastric adenocarcinoma. Clin Microbiol Infect. 2009;15(11):971-6. 4. Cárdenas-Mondragón MG, Carreón-Talavera R, Camorlinga-Ponce M, Gomez-Delgado A, Torres

5.

J, Fuentes-Pananá EM. Epstein Barr virus and Helicobacter pylori co-infection are positively associated with severe gastritis in pediatric patients. PLoS One. 2013;8(4):e62850. Saha A, Kaul R, Murakami M, Robertson ES. Tumor viruses and cancer biology: modulating signaling pathways for therapeutic intervention. Cancer Biol Ther. 2010;10(10):961-78.

de Aquino PF, Carvalho PC, da Gama Fischer JS, de Souza AQ, Viana JS, Chalub SR, et al. Epstein-Barr virus DNA associated with gastric adenocarcinoma and adjacent non-cancerous mucosa in patients from Manaus, Brazil. Genet Mol Res. 2012;11(4):4442-6. 7. Buzás GM, Konderák J. Co-infection with Helicobacter pylori and Epstein-Barr virus in benign upper digestive diseases: an endoscopic and serologic pilot study. United European Gastroenterol J. 2016;4(3):388-94. 8. Polakovicova I, Jerez S, Wichmann IA, SandovalBórquez A, Carrasco-Véliz N, Corvalán AH. Role of microRNAs and exosomes in Helicobacter pylori and Epstein-Barr virus associated gastric cancers. Front Microbiol. 2018;9:636. 9. Hayes JD, Pulford DJ. The glutathione S-transferase supergene family: regulation of GST and the contribution of the isoenzymes to cancer chemoprotection and drug resistance. Crit Rev Biochem Mol Biol. 1995;30(6):445-600. 10. Coggan M, Whitbread L, Whittington A, Board P. Structure and organization of the human thetaclass glutathione S-transferase and D-dopachrome tautomerase gene complex. Biochem J. 1998;334(Pt 3):617-23.

Rev Col Bras Cir 46(1):e2068


8

Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

11. Chen ZH, Xian JF, Luo LP. Association between GSTM1, GSTT1, and GSTP1 polymorphisms and gastric cancer risk, and their interactions with environmental factors. Genet Mol Res. 2017;16(1). 12. Palli D, Saieva C, Gemma S, Masala G, GomezMiguel MJ, Luzzi I, et al. GSTT1 and GSTM1 gene polymorphisms and gastric cancer in a high-risk italian population. Int J Cancer. 2005;115(2):284-9. 13. Pestaner JP, Bibbo M, Bobroski L, Seshamma T, Bagasra O. Potential of the in situ polymerase chain reaction in diagnostic cytology. Acta Cytol. 1994;38(5):676-80. 14. Silva MM, Da Fonseca CO, Moura-Neto R, Carvalho JF, Quirico-Santos T, Carvalho MG. Influence of GSTM1 and GSTT1 polymorphisms on the survival rate of patients with malignant glioma under perillyl alcohol-based therapy. Genet Mol Res. 2013;12(2):1621-30. 15. Rosenbaum V, Riesner D. Temperature-gradient gel electrophoresis. Thermodynamic analysis of nucleic acids and proteins in purified form and in cellular extracts. Biophys Chem. 1987;26(2-3):235-46. 16. Saito I, Servenius B, Compton T, Fox RI. Detection of Epstein-Barr virus DNA by polymerase chain reaction in blood and tissue biopsies from patients with Sjogren's syndrome. J Exp Med. 1989;169(6):2191-8. 17. Espinoza MG, Vazquez RG, Mendez IM, Vargas CR, Cerezo SG. Detection of the glmM gene in Helicobacter pylori isolates with a novel primer by PCR. J Clin Microbiol. 2011;49(4):1650-2. 18. Knuutila S, Bjรถrkqvist AM, Autio K, Tarkkanen M, Wolf M, Monni O, et al. DNA copy number amplifications in human neoplasms: review of comparative genomic hybridization studies. Am J Pathol. 1998;152(5):1107-23. 19. Knuutila S, Autio K, Aalto Y. Online access to CGH data of DNA sequence copy number changes. Am J Pathol. 2000;157(2):689. Erratum in: Am J Pathol. 2000;157(4):1413. 20. Mizuguchi A, Takai A, Shimizu T, Matsumoto T, Kumagai K, Miyamoto S, et al. Genetic features of multicentric/multifocal intramucosal gastric carcinoma. Int J Cancer. 2018;143(8):1923-34.

21. Maleki SS, Rรถcken C. Chromosomal instability in gastric cancer biology. Neoplasia. 2017;19(5):412-20. 22. Kurkalang S, Banerjee A, Ghoshal N, Dkhar H, Chatterjee A. Induction of chromosome instability and stomach cancer by altering the expression pattern of mitotic checkpoint genes in mice exposed to areca-nut. BMC Cancer. 2013;13:315. 23. Grade M, Difilippantonio MJ, Camps J. Patterns of chromosomal aberrations in solid tumors. Recent Results Cancer Res.2015;200:115-42. 24. Noguchi T, Wirtz HC, Michaelis S, Gabbert HE, Mueller W. Chromosomal imbalances in gastric cancer. Correlation with histologic subtypes and tumor progression. Am J Clin Pathol. 2001;115(6):828-34. 25. Koizumi Y, Tanaka Si, Mou R, Koganei H, Kokawa A, Kitamura R, et al. Changes in DNA copy number in primary gastric carcinomas by comparative genomic hybridization. Clin Cancer Res. 1997;3(7):1067-76. 26. Chagas VLA, Ribeiro BSP, Silva MSM, Forny DN, Rosman FC, Carvalho MGC. Epigenetics of solid pseudopapillary neoplasm of the pancreas. J Pancreas. 2018;19(4):223-7. 27. Burrell RA, McGranahan N, Bartek J, Swanton C. The causes and consequences of genetic heterogeneity in cancer evolution. Nature. 2013;501(7467):338-45. 28. Al-Sohaily S, Biankin A, Leong R, Kohonen-Corish M, Warusavitarne J. Molecular pathways in colorectal cancer. J Gastroenterol Hepatol. 2012;27(9):1423-31. 29. Roschke AV, Kirsch IR. Targeting karyotypic complexity and chromosomal instability of cancer cells. Curr Drug Targets. 2010;11(10):1341-50. 30. Burke AP, Yen TS, Shekitka KM, Sobin LH. Lymphoepithelial carcinoma of the stomach with Epstein-Barr virus demonstrated by polymerase chain reaction. Mod Pathol. 1990;3(3):377-80. 31. Wu CC, Liu MT, Chang YT, Fang CY, Chou SP, Liao HW, et al. Epstein-Barr virus DNase (BGLF5) induces genomic instability in human epithelial cells. Nucleic Acids Res. 2010;38(6):1932-49. 32. Singh S, Jha HC. Status of Epstein-Barr virus coinfection with Helicobacter pylori in gastric cancer. J Oncol.2017;2017:3456264.

Rev Col Bras Cir 46(1):e2068


Maccormick Comparative analysis of glutathione transferase genetic polymorphism, Helicobacter pylori and Epstein-Barr virus between the tumor area and the proximal and distal resection margins of gastriccancer.

33. Chmiela M, Karwowska Z, Gonciarz W, Allushi B, Staczek P. Host pathogen interactions in Helicobacter pylori related gastric cancer. World J Gastroenterol. 2017;23(9):1521-40. Received in: 11/17/2018 Accepted for publication: 12/30/2018

9

Conflict of interest: none. Source of funding: National Council for Scientific and Technological Development (CNPq). Mailing address: Maria da Gloria da Costa Carvalho E-mail: gloria@gcarvalho.org

Rev Col Bras Cir 46(1):e2068


INSTRUCTIONS FOR AUTHORS SCOPE AND POLITICS The Journal of the Brazilian College of Surgeons (CBC), an official division of the CBC, is published bimonthly in one annual volume, and proposes the dissemination of articles of all surgical specialties, contributing to its teaching, development and national integration. Articles published in the Journal of the Brazilian College of Surgeons follow the uniform requirements recommended by the International Committee of Medical Journals Editors (ICMJE – www.icmje.org), and are submitted to a double blind peer review. The journal of the Brazilian College of surgeons supports the policies for registration of clinical trials of the World Health Organization (WHO) and the ICMJE, recognizing the importance of these initiatives for the record and international dissemination of information on clinical studies in open access. Thus, it will only accept for publication the clinical research articles that have received an identification number on a clinical trial registry validated by the criteria established by WHO and ICMJE. The identification number must be registered at the end of the abstract. Between three and five members of the Editorial Board, anonymous to the authors, receive the texts, also anonymously, and decide for their publication. In the event of conflict of opinions, the Director of publications will evaluate the need for a new appraisal. Rejected articles are returned to authors. Only the works within the journal’s publication standards will be submitted to evaluation. Approved articles may sustain editorial-type alterations, provided that they do not alter the merit of the work. GENERAL INFORMATION The Journal of the Brazilian College of Surgeons evaluates articles for publication in Portuguese (Brazilian authors) and English (foreign authors) that follow the rules for manuscripts submitted to biomedical journals prepared and published by the International Committee of Medical Journal Editors (ICMJE – www.icmje.org) [CIERM Rev Col Bras Cir. 2008; 35 (6): 425-41, or article on the website of the journal (www.revistadocbc.org.br)] with the following characteristics: • Editorial: Is the initial article of an issue, generally about a current subject, requested by the Editor to the author of recognized technical and scientific capacity. • Original Article: Is the full account of clinical or experimental research, with positive or negative results. It must consist of Abstract, Introduction, Methods, Results, Discussion and References, the latter limited to a maximum of 35, aiming to the inclusion, whenever possible, of articles from national authors and national journals. The title should be written in Portuguese and English, and should contain the maximum of information with the minimum of words, without abbreviations. It must be accompanied by the complete name(s) of author(s) followed by the name(s) of the institution(s) where the work was performed. If multicenter, Arabic numerals must indicate the provenance of each of the authors in relation to the listed institutions. Authors should send along with their names only one title and one that best represents their academic activity. The Abstract should have a maximum of 250 words and be structured as follows: objective, methods, results, conclusions and keywords in the form referred to by DeCS (http://decs.bvs.br ). • Review article: The Editorial Board encourages the publication of matters of great interest to the surgical specialties containing synthetic analysis and relevant criticism and not merely a chronological description of literature. I must contain an introduction with description of the reasons that led to the writing of the article, the search criteria, followed by text ordered in titles and subheadings according to the complexity of the subject, and unstructured abstract. When applicable, at the end there may be conclusions and opinions of authors summarizing the review contents. • Letters to the Editor: Scientific Comments or controversy regarding articles published in the journal of the CBC. In general, such letters are sent to the principal author of the article to response and both letters are published in the same journal issue, no replica being allowed. • Scientific Communication: Content that deals with the form of presentation of scientific communication, investigating the problems and proposing solutions. Due to its features, this section can be multidisciplinary, receiving contributions from doctors, surgeons and non-surgeons and other professionals from various areas. It must have an unstructured Abstract, Keywords and free text. • Technical Note: Information about a particular operation or procedure of importance in surgical practice. The original must not exceed six pages including pictures and references if necessary. It must have an unstructured Abstract, Keywords and free text. • Education: Freeform content that addresses the teaching of surgery, both in graduate and post-graduate levels. Unstructured abstract. • Bioethics in surgery: Discussion of bioethical aspects in surgery. The content should address bioethical dilemmas in the performance of surgical activity. Freeform. Unstructured abstract. • Case reports: May be submitted for evaluation and the approved reports will be published, mainly in electronic journal of case reports, the Journal of Case Reports of the Brazilian College of Surgeons which can be accessed through the Brazilian College of Surgeons’ website (www.cbc.org.br) or directly at www.relatosdocbc.org.br. ARTICLE SUBMISSION Sending articles for the Journal of the Brazilian College of Surgeons can only be done through the online platform for submission of scientific papers, which can be accessed through the Brazilian College of Surgeons’ website (www.cbc.org.br) or directly at www.rcbc.gnpapers.com.br.

FORM AND STYLE • Text: Manuscripts submitted for review by the Journal of the Brazilian College of Surgeons must be unpublished and should not be evaluated in whole or in part by another scientific journal. Images should be forwarded separately from the text, and in accordance with the instructions on the online submission platform. Articles should be concise, not exceeding 2500 words. The abbreviations should be as few as possible, limited to the terms mentioned repetitively, as long as they do not hinder the understanding of the text, and should be defined from the first use. • References: Must be predominantly of works published in the last five years, restricted to those cited in the text, in order of citation, numbered consecutively and presented according to the Vancouver format (rules for manuscripts submitted to Biomedical Journals ICMJE- www.icmje.org – CIERM Rev Col Bras Cir. 2008; 35 (6): 425-41-www. revistadocbc.org.br). Annals of congresses and personal communications will not be accepted as references. Citations of books and theses should be discouraged. The authors of the article are responsible for the accuracy of the references. • Acknowledgements: Should be made to people who importantly contributed to the work’s realization. TABLES (maximum of six) Tables should be numbered with Arabic numerals, with captions on the top containing one or two sentences, and explanations of symbols at the bottom. Cite the tables in the text in numerical order including only information necessary for understanding of important points of the text. The data presented should not be repeated in graphs. Tables should follow the above-mentioned Vancouver standards. Tables must be typed in the body of the text, and never sent as figures. FIGURES (maximum of six) Figures are all the photos, graphics, paintings and drawings. All figures must be referred to in the text, being numbered consecutively by Arabic numbers and accompanied by descriptive captions. Histological images should contain in the legends the histological technique used and the degree of magnification. All figures should be submitted separately at the end of the manuscript.

MANDATORY CONDITIONS (READ CAREFULLY) It is expressed that, with the electronic submission, the author (s) agree (s) with the following assumptions: 1) that there is no conflict of interests, compliant with the Brazilian Federal Council of Medicine (CFM) resolution No. 1595/2000 that prevents the publication of works and materials with promotional purposes of products and/or medical devices; 2) that one must cite the funding source, if any; 3) that the work was submitted to the respective Ethics in Research Committee which approved it, providing the aproval number in the text; 4) that all authors authorize that the article suffer changes in the submitted text to be standardized in the language format of the Journal, which can result in removal of redundancies, as well as tables and/ or figures that are deemed unnecessary to understanding the text, provided that it does not change its meaning. If there are disagreements of the authors about these assumptions, they should write a letter leaving explicit the point at which they disagree, which will be appraised by the Editor, who will decide whether the article can be forwarded for publication or returned to the authors. 5) that the authors are allowed to hold the copyright of their published work without restrictions. 6) that if there is conflict of interest, it should be quoted with the text: “the author (s) (provide names) received financial support of the private company (provide name) for this study”. When there is a research foment funding source, it must also be cited. 7) that the responsibility for concepts or statements issued on articles and announcements published in the Journal of the Brazilian College of Surgeons is entirely up to the author (s) and advertisers. 8) that works already published or simultaneously submitted for evaluation in other periodicals will not be accepted. 9) that each approved article will have a cost of R$ 1,000.00 (one thousand reais) for the authors. If the lead author is a member of the Brazilian College of Surgeons, there will be a 50% discount on the article’s fee. Case Reports, approved for publication in the Journal of Case Reports of the Brazilian College of Surgeons are exempt from charges.

CONTACT: 2016-Brazilian College of Surgeons Rua Visconde de Silva, 52-3the floor 22271-090-Rio de Janeiro-RJ-Brazil Tel: + 55 21 2138-0659 Fax: + 55 21-2286 2595 Address for submission of manuscripts: E-mail: revistacbc@cbc.org.br


ABOUT THE JOURNAL Basic information Objectives: To disseminate scientific works of the surgical area of medicine that contribute to its teaching and development. History: The publication and dissemination of scientific activities of its members is one of the aims of medical societies. The Brazilian College of Surgeons (Colégio Brasileiro de Cirurgiões – CBC), founded in 1929, already in its first statute provided for the issuance of the “Bulletin of the Brazilian College of Surgeons” as its official division, whose starting number was published in January 1930. In 1967, the National Directory of CBC changed its name to “Journal of the Brazilian College of Surgeons”. From 1974 on, the journal began to be published bi-monthly, on a regular basis, to the present day. The abbreviation for its title is Rev Col Bras Cir, which should be used in bibliographies, footnotes and in references and bibliographic legends.

Creative Commons The journal of the Brazilian College of Surgeons is licensed with a 4.0 International , non-commercial, Creative Commons Attribution. This license lets others remix, adapt and create from your work, for non-commercial purposes. Although the new works have to assign proper credit and may not be used for commercial purposes, users do not have to license these derivative works under the same terms.

Free access policy This journal provides free and immediate access to its content, following the principle that providing free scientific knowledge to the public provides greater democratization of world knowledge.

About APC (Article Processing Charges) In view of the high costs for publication of the journal, from the issue 1/2017 on, every approved article started to have a cost of R$ 1000.00 (1000 reais) for the authors. Articles in which the lead author is a member of the CBC will have a discount of 50% of the publication fee.

Anti-Plagiarism Policy The Journal of the Brazilian College of Surgeons uses the iThenticate program to identify plagiarism in articles submitted for publication.

Indexing sources · · · · · · ·

Latindex LILACS Scopus DOAJ Free Medical Journals MEDLINE/PUBMED SciELO

Intellectual property All journal content, except where otherwise stated, is licensed under a Creative Commons License of type CC-BY attribution.

Sponsors The Journal of the Brazilian College of Surgeons is sponsored by CBC through: · Annuity of its associated members · Money from advertisers · Article publication fee


!"#$%&'!$!%()!      

  

Profile for cbc cirurgioes

Revista do CBC v46n1-Inglês  

Revista do CBC v46n1-Inglês

Revista do CBC v46n1-Inglês  

Revista do CBC v46n1-Inglês