Page 1

Segunda edición

Barsallo • Cabrera • Ferrer MANUAL de talleres y laboratorios de BIOLOGÍA 10

Visítenos en: www.pearsoneducacion.net

Segunda edición

ISBN: 978-607-32-0393-7

MANUAL de talleres y laboratorios de

BIOLOGÍA

10

T. E. Barsallo D. F. Cabrera L. E. Ferrer


Manual de talleres y laboratorios de BIOLOGÍA 10 Segunda edición

Tayra Elizabeth Barsallo Marengo Magíster en Educación con Especialización en Investigación y Docencia de la Educación Superior Profesora de Biología Instituto Justo Arosemena Ciudad de Panamá Diana Francia Cabrera Chifundo Magíster en Administración y Gestión de Centros Escolares Profesora de Biología Instituto José Dolores Moscote Ciudad de Panamá Lidia Esther Ferrer Vega Magíster en Educación con Énfasis en Administración Educativa Profesora de Biología Instituto José Dolores Moscote Ciudad de Panamá

ERRNVPHGLFRVRUJ Prentice Hall


Datos de catalogación bibliográfica BARSALLO, CABRERA y FERRER Manual de talleres y laboratorios de Biología 10. Segunda edición PEARSON EDUCACIÓN, México, 2011 ISBN: 978-607-32-0393-7 Área: Ciencias Formato: 21⫻27 cm

Páginas: 232

Este libro es una adaptación autorizada de la edición original titulada: Biología 10 Manual de talleres y laboratorios, 2ª ed. de Tayra Elizabeth Barsallo Marengo, Diana Francia Cabrera Chifundo y Lidia Esther Ferrer Vega; publicado por Pearson Educación de México S.A. de C.V., publicado como PRENTICE HALL, Copyright © 2009. ISBN 978-607-442-184-2. Todos los derechos reservados. Editor:

Melvin Núñez Víquez melvin.nunez@pearsoned.com Editor de desarrollo: Claudia Celia Martínez Amigón Supervisor de producción: Enrique Trejo Hernández SEGUNDA EDICIÓN, 2011 D.R. © 2011 por Pearson Educación de México, S.A. de C.V. Atlacomulco 500-5° Piso Industrial Atoto 53519, Naucalpan de Juárez, Estado de México Cámara Nacional de la Industria Editorial Mexicana. Reg. núm. 1031. Prentice Hall es marca registrada de Pearson Educación de México, S.A. de C.V. Reservados todos los derechos. Ni la totalidad ni parte de esta publicación pueden reproducirse, registrarse o transmitirse, por un sistema de recuperación de información, en ninguna forma ni por ningún medio, sea electrónico, mecánico, fotoquímico, magnético o electroóptico, por fotocopia, grabación o cualquier otro, sin permiso previo por escrito del editor. El préstamo, alquiler o cualquier otra forma de cesión de uso de este ejemplar requerirá también la autorización del editor o de sus representantes. ISBN 978-607-32-0393-7 Impreso en México. Printed in Mexico. 1 2 3 4 5 6 7 8 9 0 – 14 13 12 11

Prentice Hall es una marca de

www.pearsoneducacion.net

ISBN 978-607-32-0393-7


Contenido

Prefacio v Manual de talleres y laboratorios de Biología 10 Práctica 1

Materiales de laboratorio 1

Práctica 2

El microscopio compuesto y su uso 5

Práctica 3

Las técnicas micrográficas 11

Práctica 4

La lupa binocular o estereomicroscopio 17

Práctica 5

Ramas de la biología y ciencias auxiliares 23

Práctica 6

Sopa de especialidades científicas 27

Práctica 7

Características de los seres vivos 29

Práctica 8

Adaptaciones de los seres vivos 33

Práctica 9

Cómo empezó la vida: creencias y teorías 37

Práctica 10

Teorías sobre el origen de la vida 41

Práctica 11

La biogénesis 45

Práctica 12

Método científico

Práctica 13

La bibliografía 53

Práctica 14

Los “cómics”

Práctica 15

Los compuestos orgánicos 63

Práctica 16

Crucigrama de las moléculas biológicas 73

Práctica 17

Las moléculas orgánicas y su importancia en la nutrición 75

Práctica 18

Movimiento molecular 81

Práctica 19

Estructura de las células eucarióticas 85

Práctica 20

Célula animal 89

Práctica 21

Célula vegetal 93

Práctica 22

Sopa eucariótica 97

Práctica 23

Extracción de ADN 99

49

57

iii


Contenido

Práctica 24

Construyamos un modelo de ADN 103

Práctica 25

Síntesis de proteínas

Práctica 26

La mitosis 113

Práctica 27

La meiosis 119

Práctica 28

Mitosis y meiosis 123

Práctica 29

El cáncer 127

Práctica 30

Las leyes de la probabilidad 131

Práctica 31

Las leyes de la herencia 135

Práctica 32

Genética, dominancia y recesividad 139

Práctica 33

Cromosomas sexuales femeninos 143

Práctica 34

Variaciones sobre el tema mendeliano 147

Práctica 35

Problemas de genética 151

Práctica 36

Hominización 157

Práctica 37

Evidencias de la evolución 165

Práctica 38

Selección natural 169

Práctica 39

Adaptaciones al ambiente 173

Práctica 40

Clasificación 179

Práctica 41

Clasificación de los organismos 185

Práctica 42

Clave taxonómica 191

Práctica 43

Factores abióticos 195

Práctica 44

Factores físicos y biológicos de diversos biomas terrestres 199

Práctica 45

Biomas y ecosistemas 203

Práctica 46

Los niveles tróficos 207

Práctica 47

Cadena alimentaria 211

Práctica 48

Red alimentaria 215

Práctica 49

Sopa reproductiva 219

Práctica 50

Las enfermedades de transmisión sexual 221

Bibliografía 225

iv

109


Prefacio

En sus inicios, el hombre tenía que observar, analizar y probar los fenómenos y cosas que ocurrían a su alrededor. Debía aprender de sus experiencias, y transmitía estos conocimientos por medio de la demostración directa a sus congéneres; es decir, experimentando y repitiendo lo aprendido. Esa forma empírica se ha transformado y formalizado en el método científico. La historia de la ciencia se ha caracterizado porque la mayor parte de los conocimientos se fundamenta en dicho método: una vez que se hacía la observación de un hecho, se formulaba una teoría y se construía un modelo, el cual se debía comprobar por medio de reproducciones a escala bajo condiciones controladas, que nosotros conocemos como experimento. Son varias las ciencias experimentales: la física, la química, etc. La biología es una de las más completas, pues incluye o emplea conocimientos de todas las anteriores, como auxiliares, y además se apoya de otras ciencias que usa como herramientas, como las matemáticas. Las ciencias experimentales se distinguen porque contienen una parte teórica que se deriva de la experimentación, por lo cual, para entender con mayor claridad los conceptos teóricos debemos remitirnos a los experimentos prácticos. Sin embargo, en la enseñanza de la biología es muy común darle mayor peso a la parte teórica, debido a la poca cantidad de prácticas que se realizan o que están presentes en los manuales de laboratorio. Este manual propone un esquema que trata los puntos generales del método científico, lo que le permite al estudiante iniciar la aplicación de conceptos científicos, el desarrollo de sus habilidades en el manejo del instrumental básico de laboratorio, la investigación, el manejo de datos experimentales, el trabajo en equipo y la capacidad para poder integrar su experiencia con el conocimiento adquirido en la clase teórica. Tayra Elizabeth Barsallo Marengo Diana Francia Cabrera Chifundo Lidia Esther Ferrer Vega

v


Materiales de laboratorio

Práctica

1 INTRODUCCIÓN El laboratorio es el lugar donde se llevan a cabo trabajos experimentales de carácter científico. En el caso concreto de un laboratorio de escuela secundaria es el lugar donde, tanto profesores como alumnos, realizan experiencias de investigación y demostraciones relacionadas con el curso de biología. Se utiliza una amplia variedad de instrumentos o herramientas que en conjunto se denominan materiales del laboratorio de biología. Difícilmente se podría describir su montaje completo sin incurrir en el olvido de alguna pieza; sin embargo, en todo buen laboratorio hay que considerar siempre salas, instalaciones e instrumentos. Los instrumentos y aparatos deben estar ubicados de manera que se encuentren al alcance de los estudiantes, a fin de evitar desplazamientos innecesarios. Todos los materiales que se usan tienen un fin específico, y el empleo adecuado de ellos requiere ciertos cuidados para evitar que se deterioren o se destruyan; asimismo, es conveniente limpiarlos y acomodarlos en un lugar especial de acuerdo con las indicaciones del profesor(a) antes y después de utilizarlos.

OBJETIVOS

MATERIALES Y REACTIVOS

• Identificar el material que se usa en el laboratorio de biología • Describir el uso de cada uno de sus materiales

• Figuras de los materiales y aparatos del laboratorio de biología • Hojas blancas de 8 1/2  11 pulgadas • Tijeras • Goma

1


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO A continuación se presenta un listado de los materiales del laboratorio de biología, que está clasificado según el material que lo constituye. 1. Materiales de madera -Gradilla. -Horquillas. 2. Materiales de vidrio -Probetas graduadas. -Pipetas serológicas. -Tubos de ensayo. -Vasos químicos. -Frasco gotero. -Varillas agitadoras. -Cajas de Petri. -Embudo. -Vidrios reloj. -Matraces. -Erlenmeyer. -de Florencia. -Portaobjetos. -Cubreobjetos. -Pipeta volumétrica. 3. Materiales de porcelana -Cápsula para evaporación. -Mortero y pilón. -Crisol con tapa. 4. Instrumental -Estuche de disección. (Tijeras, aguja, pinza, bisturí) -Termómetro.

-Gotero. 5. Limpieza -Brochas lavadoras. -Detergente. -Papel toalla. -Paño para limpiar. 6. Material de goma -Tapones de hule. 7. Material de metal -Asa bacteriológica. -Trípode. -Soporte universal. -Pinzas. -Espátula. -Malla con asbesto. -Bandeja para disección. 8. Calentamiento -Plancha caliente. -Mechero. 9. Sustancias -Colorantes. -Indicadores. -Otros reactivos. 10. Materiales ópticos -Lupa. -Microscopio compuesto. -Lupa binocular.

1. Tu profesor(a) te mostrará los materiales y mencionará sus respectivos nombres, así como el uso de cada uno en el laboratorio. 2. Divide una hoja de 8 1/2  11 pulgadas en cuatro partes iguales, en cada parte, dibuja un instrumento de laboratorio, pon su nombre arriba y abajo explica para qué sirve. Nombre Figura Uso

Nombre Figura Uso

Nombre Figura Uso

Nombre Figura Uso

a. Utiliza las hojas necesarias de acuerdo con la cantidad de materiales proporcionados en la lista.

2


PRÁCTICA 1

Materiales de laboratorio

PREGUNTAS 1. ¿Cómo debes comportarte en el laboratorio? __________________________________________________________________________________ 2. Escribe algunas de las recomendaciones que debes seguir para desempeñar adecuadamente el trabajo en el laboratorio. __________________________________________________________________________________ 3. ¿Cuáles son los aspectos que se requieren para mantenerlo limpio y ordenado? __________________________________________________________________________________ 4. ¿Qué cuidados son necesarios para la conservación de los aparatos y el material de vidrio utilizados? __________________________________________________________________________________

CONCLUSIONES:

3


Práctica

El microscopio compuesto y su uso

2 INTRODUCCIÓN

El microscopio es un instrumento diseñado para examinar objetos que no pueden verse a simple vista. Sin su ayuda, el ojo humano no podría distinguir objetos menores a 0.1 mm. El microscopio compuesto está constituido por la combinación de dos sistemas de lentes convergentes y divergentes: uno próximo al ojo del observador, por lo cual se llama ocular, y otro próximo al objeto, denominado objetivo. También está constituido por partes mecánicas (tornillos y soporte), partes ópticas (objetivos) y partes de iluminación (lámpara, diafragma, condensador). La utilización del microscopio implica una preparación especial de la muestra que vamos a observar porque la luz tiene que pasar a través de ella para que nuestros ojos la puedan observar.

OBJETIVOS

MATERIALES Y REACTIVOS

• Conocer el uso y cuidados del microscopio • Identificar, nombrar y señalar las funciones de las diferentes partes del microscopio • Aprender a preparar y enfocar una placa húmeda

• • • • • • • • • •

Microscopio Papel periódico Bisturí Gotero Porta y cubreobjetos Vidrio-reloj Hojas de alguna planta Hilos azul y rojo Papel de lente Palillos de dientes

PROCEDIMIENTO A. Observa los distintos elementos del microscopio y anota las funciones de las partes del microscopio compuesto. B. Las siguientes indicaciones te ayudarán a cuidar y utilizar correctamente el microscopio. Para transportar el microscopio se recomienda utilizar siempre las dos manos, sujetándolo por el brazo con una mano y sosteniéndolo por el pie o base con la palma de la otra mano. 1. Se debe desplazar en posición vertical para evitar la caída del ocular. 2. Coloca el microscopio sobre la mesa de trabajo.

3. El brazo tiene que quedar hacia el observador. El aparato debe apoyarse correctamente hacia el centro de la mesa.

5


Biología 10. Manual de talleres y laboratorios

4. El observador debe situarse siempre de espaldas a cualquier lámpara potente de luz (Sol, luz general del laboratorio) ya que así se evitan los reflejos y el objeto de estudio queda más contrastado y se reduce la fatiga visual del observador. 5. Al principio de la observación selecciona el objetivo de menor aumento y al terminar de usar el microscopio asegúrate de que el revólver tenga en posición de enfoque el objetivo 4X. 6. Al cambiar los objetivos, un ruido avisa cuando el objetivo encaja en su lugar, alineado perfectamente con el tubo óptico. 7. Al efectuar el primer enfoque, el objetivo tiene que estar muy cerca de la preparación sin llegar a tocarla. Se coloca en esta posición mirando lateralmente el microscopio. Para enfocar, el desplazamiento del tubo óptico se efectúa de abajo hacia arriba. Debes evitar tocar la preparación con la lente de los objetivos. 7.1. Enciende la lámpara y abre el diafragma. La luz debe permanecer apagada mientras el microscopio no esté en uso. La cantidad de luz (regulada por el diafragma) debe ser directamente proporcional al aumento usado.

7.2. Mira por el lente del ocular, ajusta el diafragma para que todo el campo microscópico sea igualmente iluminado y evitar el deslumbramiento. 7.3. Coloca la muestra y sujétala con las pinzas. 7.4. Asegúrate de que el tubo del microscopio llegue a su posición más baja con la ayuda del tornillo micrométrico. 7.5. Enfoca con el tornillo macrométrico hasta obtener una imagen más o menos clara. Recuerda que para enfocar con el tornillo macrométrico debes bajar el tubo mirando de lado y no por el ocular. 7.6. Afina la imagen con el tornillo micrométrico para obtener detalles a varios niveles. 7.7. Si cambia a alto poder, gira lentamente el revólver y coloca el objetivo deseado en posición. No mires a través del ocular, mira el revólver para asegurarte de que el objetivo no toca la preparación. Luego afina la imagen con el tornillo micrométrico. 7.8. Terminada la observación, apaga la fuente luminosa y sube el óptico; o baja la platina y retira la preparación.

Mover siempre lenta y suavemente cualquier elemento del microscopio. Utiliza papel de seda fina especial o gamuza para lentes para la limpieza del ocular y los objetivos. C. Uso del microscopio con diferentes preparaciones 1. Prepara un montaje húmedo de la letra “h”. Corta un fragmento de periódico donde se encuentre la letra “h”. Coloca la letra en el portaobjetos y luego agrega una gota de agua, cúbrela con un cubreobjetos, evita que se formen burbujas. Procede a observar la preparación con el objetivo de 10x y el de 40x. Observa la posición de la letra “h” con respecto a su colocación sobre la platina, el movimiento de la letra al desplazarla de arriba hacia abajo, hacia la derecha y hacia la izquierda. Dibuja y explica lo observado.

100 X

6

400X


PRÁCTICA 2

El microscopio compuesto y su uso

2. Observación de una célula Pon una gota de solución de azul de metileno diluido en un portaobjetos. Abre la boca y con la parte plana de un palillo de dientes raspa la cara interna de tu mejilla. Coloca el contenido del raspado que hiciste sobre el portaobjetos, golpeando suavemente el palillo en la gota de colorante, y cubre la preparación con un cubreobjetos. Observa a través del microscopio con los objetos de 10x y 40x. Dibuja lo observado.

3. Preparación de una placa con dos hilos (azul y rojo) Coloca sobre el portaobjetos dos hilos (azul y rojo) de manera que se crucen entre sí, añade una gota de agua y coloca el cubreobjetos. Enfoca con el objetivo de bajo poder, ahora mueve el micrométrico y describe qué observas. Dibújalo. Identifica qué hilo está superpuesto.

4. Medición del campo visual del microscopio Con el objetivo de bajo poder haz un dibujo del campo del microscopio, colocando una regla sobre la platina, mide el campo observando por el ocular. ¿Cuántos milímetros mide?_________________________________

7


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿De qué partes del microscopio depende la correcta iluminación de la preparación? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Por qué la imagen que se obtiene en el microscopio compuesto es invertida? __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Cuál es la utilidad del portaobjetos y el cubreobjetos? __________________________________________________________________________________ __________________________________________________________________________________ 4. ¿Qué papel desempeñan en el funcionamiento del microscopio los tornillos macrométrico y micrométrico? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿Por qué se llama microscopio compuesto? __________________________________________________________________________________ __________________________________________________________________________________ 6. ¿Por qué es importante el cuidado del microscopio? __________________________________________________________________________________ __________________________________________________________________________________ 7. ¿Qué es un montaje húmedo? __________________________________________________________________________________ __________________________________________________________________________________ 8. ¿Cómo varía el campo de visión en cada cambio de objetivo? __________________________________________________________________________________ __________________________________________________________________________________ 9. ¿Cómo se calcula el aumento total del microscopio? __________________________________________________________________________________ __________________________________________________________________________________

8


PRÁCTICA 2

El microscopio compuesto y su uso

a) ¿Qué combinaciones de aumentos (del ocular, del objetivo) pueden hacerse con el microscopio de que dispones? __________________________________________________________________________________ __________________________________________________________________________________ 10. ¿Cuáles son las utilidades del carro mecánico de la platina? __________________________________________________________________________________ __________________________________________________________________________________ 11. A continuación aparece un esquema del microscopio compuesto. Indica las partes que lo integran.

9


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

10


Práctica

Las técnicas micrográficas

3 INTRODUCCIÓN

Las técnicas micrográficas son los distintos métodos que se requieren para poder observar en el microscopio las estructuras celulares. La célula puede ser estudiada bajo diversos aspectos: morfológicos, químicos y fisiológicos. Las preparaciones se llevan a cabo con el portaobjetos; es lo primero que se necesita para poder hacer observaciones al microscopio, luego se usará la técnica que se requiera. Debido a la transmisión de la luz en el microscopio, las técnicas de observación exigen que los objetos a estudiar respondan a ciertas condiciones. Para que la luz pueda atravesarlo deben tener poco espesor (del orden de algunas micras), por lo que hay que efectuar cortes muy finos. La observación al microscopio sólo proporciona información si ciertas regiones del objeto absorben luz mejor que otras, es decir, si el objeto presenta contrastes, en general los constituyentes celulares tienen muy pocos contrastes uno con respecto a otros, por lo cual es necesario usar ciertos artificios para aumentarlos; por ejemplo, se crean artificialmente ciertos contrastes realizando combinaciones entre los constituyentes químicos celulares y productos que absorban ciertas longitudes de onda de la luz, llamados técnicas de tinción. Los cortes de algunas micras de espesor sólo pueden efectuarse si la dureza de la muestra es apropiado. Si la muestra es muy blanda, es necesario endurecerla artificialmente para poder cortarla. Esto se puede lograr actuando sobre el constituyente más abundante de las células, que es el agua, haciéndola pasar del estado líquido al sólido y congelando la célula por medio de la técnica de congelación, o bien, sustituyéndola por otro líquido que pueda ser endurecido en ciertas condiciones. Esto se conoce como el método de inclusión. Sin embargo, estos métodos que permiten endurecer las células alteran en modo considerable su organización. Por eso es necesario consolidar previamente las estructuras por medio de una serie de operaciones que constituyen la fijación. Es un tratamiento físico o químico efectuado sobre células vivas, que permite ciertas manipulaciones posteriores con un mínimo de alteración en las estructuras celulares y mantener su morfología. Si las preparaciones quieren conservarse de forma permanente se les llaman preparaciones permanentes, y las que son para uso sólo del momento son las preparaciones temporales. Hay un gran número de métodos y técnicas para la observación de la gran cantidad de materiales biológicos. El más simple es el montaje simple en un portaobjetos con cubreobjetos, usando un colorante vital y observándolo al microscopio; y uno más complejo sería, la fijación - inclusión - corte - coloración - montaje - sellado. En el laboratorio se trabaja con material biológico del nivel celular, por lo que se hace necesario el uso de algunas técnicas micrográficas para poder hacer observaciones más precisas.

11


Biología 10. Manual de talleres y laboratorios

OBJETIVO

MATERIALES Y REACTIVOS

• Conocer algunas técnicas micrográficas básicas para el laboratorio de biología.

• • • • • • • • • • • • • •

Microscopio Yogurt Hojas de diversas plantas Flores de diversas plantas Portaobjetos y cubreobjetos Juego de disección Hojas de plantas Orceína aséptica Hematoxilina Alcohol etílico Bálsamo de Canadá Alas de mariposa Cinta adhesiva transparente Palillos de dientes que tengan un extremo plano • Metanol al 95%

PROCEDIMIENTO Preparaciones 1. Montaje en seco Corta un pedacito del ala de una mariposa, de ser posible, que sea de las que tienen bellos colores. Ponlo sobre el portaobjeto y fíjalo con papel adhesivo transparente, observa y dibuja. Luego levanta la cinta adhesiva, en ella quedarán pegadas las escamas del ala. Sacude los fragmentos de la misma, vuelve a pegar el papel adhesivo al portaobjetos. Observa y dibuja.

12

Puedes montar de esta forma todas las preparaciones que requieran pequeños aumentos y tengan poco espesor. 2. Montaje con agua Limpia el portaobjetos, coloca unas gotas de agua y sobre ellas una pequeña cantidad de un raspado suave del envés de una hoja. Con cuidado deja caer el cubreobjetos procurando que no aparezcan burbujas de aire. Éstas se pueden eliminar con la ayuda de la aguja de disección o levantando de nuevo el cubreobjetos, si ellas aparecen porque el portaobjetos tiene grasa, hay que volverlo a lavar y hacer nuevamente la preparación. Observa con los objetivos de 10X y 40X. Dibuja.


PRÁCTICA 3

Las técnicas micrográficas

Observarás abundante Bacillus bulgariens, si hubiera contaminación, hallarás estreptococos. Es imprescindible utilizar el objetivo de máximo aumento.

100 X

B. Tejido epitelial. Mucosa bucal Raspa la cara interna de tu mejilla con un palillo. Extiende las células sobre un portaobjetos limpio. Fijación con metanol al 95% durante el frotis, espera 15 minutos. Retira el exceso de alcohol. Sécalo al aire (para mayor rapidez abanica el portaobjetos). Sumerge durante cinco minutos en orceína acética al 2%. Lava con agua por ambos lados del portaobjetos, a fin de quitar el exceso de colorante. Seca al aire. Observa al microscopio con el objetivo de menor aumento, localiza la zona que deseas estudiar. Observa con el objetivo de 40X. Dibuja.

400X

3. Teñido y montaje con agua Algunos de los colorantes que se emplean son: azul de metileno, lugol, hematoxilina, acetocarmín, etcétera. A. Bacterias del yogurt Se extiende un poco de yogurt en un portaobjetos con la ayuda de otro, después se pasa por la llama del mechero rápidamente. Añade azul de metileno y déjalo actuar durante cinco minutos. Lava, para eliminar el exceso de azul de metileno. Procede a observar al microscopio con el objetivo de 10X, 40X, 100X. Dibuja.

C. Observación de granos de polen Toma una flor y sacúdela sobre un vaso químico con alcohol al 70%. Esto debe hacerse 24 horas antes de realizar la experiencia. Lava con agua, pero antes retira el alcohol y seguidamente añádale el agua. Coloca los granos de polen sobre un portaobjetos, pon el cubreobjetos. Observa y dibuja. D. Observación de la epidermis de una hoja Pellizca con las pinzas de disección la epidermis de una hoja. Si lo has realizado correctamente, la epidermis arrancada pre-

13


Biología 10. Manual de talleres y laboratorios

senta un aspecto translúcido y uniforme. Introduce en agua la epidermis de la hoja para que recobre la posición normal. Recorta la epidermis en pequeños rectángulos. Utiliza uno o dos para colocarlos sobre el portaobjetos. Agrega hematoxilina. Déjala actuar por 10 minutos. Lava minuciosamente con agua, quíta el exceso de colorante. Seca por debajo con papel toalla. Vierte una gota de agua, pon el cubreobjetos. Observa y dibuja.

PREGUNTAS 1. ¿Por qué los cortes que se van a observar al microscopio deben tener poco espesor?

2. ¿Cuál es la función de los colorantes?

3. ¿Qué es una preparación temporal?

4. ¿Qué es una preparación permanente?

5. ¿Para qué se usa la técnica de congelación?

6. ¿Cuál es la importancia de la fijación cuando se está trabajando con alguna técnica micrográfica?

14


PRテ,TICA 3

Las tテゥcnicas microgrテ。ficas

CONCLUSIONES:

15


Práctica

Lupa binocular o estereomicroscopio

4 INTRODUCCIÓN

El esteromicroscopio amplía el campo de la experimentación visual. Su utilización es más sencilla que la del microscopio. Consta de dos microscopios completos, cada uno con su objetivo y ocular en los que al no coincidir sus ejes ópticos, las imágenes formadas en los oculares son distintas, lo mismo que ocurre con la visión ocular, por lo que vemos una imagen en tres dimensiones. No debe confundirse este aparato óptico con los microscopios binoculares, ya que en éstos la imagen formada en un único objetivo es desdoblada en dos imágenes idénticas por un prisma situado entre el objetivo y los dos oculares. La mayoría de las normas de cuidado, limpieza y transporte recomendadas para el microscopio compuesto deben considerarse también al utilizar la lupa binocular. Además debes tener en cuenta que: Moviendo los tubos oculares se busca la distancia interpupilar adecuada para cada observador. El tornillo de sujeción debe estar suficientemente apretado para evitar la caída del brazo de la lupa. Debe colocarse en la platina una placa de contraste, de color tal, que realce la observación. Cuando se va a realizar una observación con la lupa binocular, lo primero que hay que hacer es fijar el objeto a observar sobre la platina de la lupa, sujetándola con las pinzas. Enciende la lámpara. Con el objetivo, regula la altura mediante la rueda micrométrica o cremallera situada en ambos lados de la lupa. Así, se puede enfocar el objeto a observar y apreciar sus características con claridad. La lupa también dispone de un mecanismo para acomodar ambos ojos en unos tubos, de la misma manera como se hace con unos binoculares, corrigiendo las variaciones de visión del observador. Para obtener imágenes muy nítidas del objeto a observar es básico y práctico el enfoque y el acomodo de la vista. Una vez conseguida la calidad de la imagen, debes observar las diferencias o los detalles.

OBJETIVO

MATERIALES Y REACTIVOS

• Estudio de las características y manejo de la lupa binocular.

• • • • • • • •

Verde de metilo Lupa binocular Plato Petri Gotero Juego de disección Agua de charco Cebolla Hojas de algunas plantas

17


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO

1. Identifica las partes de la lupa binocular. 1

1._________________________________

5

2._________________________________ 3._________________________________ 4._________________________________ 6 5._________________________________ 7 8

2

6._________________________________ 7._________________________________ 8._________________________________

9

3

9._________________________________ 4 10

2. Observación de la epidermis de la hoja de una planta Coloca una hoja de alguna planta sobre la platina y sujétala con las pinzas. Mueve los tubos oculares buscando la distancia interpupilar adecuada. Dibuja lo observado.

18

10._________________________________ 3. Observación de las células de la epidermis de la cebolla Parte una cebolla a la mitad y separa la membrana transparente que está en la parte interna de una de sus hojas. Corta un trozo de ella con un bisturí y colócala sobre el portaobjetos. Agrega una gota de verde de metilo. Deja actuar por cinco minutos. Luego, lava con agua. Coloca el portaobjetos sobre la platina. Observa y dibuja.


PRรCTICA 4

4. Observaciรณn de un insecto Inicia observando a simple vista un insecto. Anota todo y realiza una descripciรณn. Dibuja lo mejor posible.

La lupa binocular o estereomicroscopio

6. Observaciรณn de organismos unicelulares Con la ayuda de un gotero coloca una gota de agua estancada sobre un plato Petri. Observa con la lupa binocular. Identifica algunos organismos. Dibuja lo observado.

5. Observaciรณn del mismo insecto con la lupa binocular Coloca el insecto sobre la platina. Mueve los tubos oculares buscando la distancia interpupilar adecuada. Enfoca la imagen hasta que obtengas la calidad de imagen deseada. Dibuja los detalles que se observan.

19


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Cuál es la distancia de trabajo de la lupa binocular en relación con la del microscopio compuesto? ¿Cómo ayuda esa distancia?

2. ¿Cómo es la profundidad de campo?

3. ¿Por qué no existe tornillo micrométrico?

4. Al desplazar un objeto observado, ¿en qué sentido se mueve la imagen final? La visión del objeto ¿es por reflexión o por refracción?

5. ¿En qué parte de la lupa hay que distinguir la luz de la fuente luminosa?

6. ¿Cuáles son las tres características de la imagen final?

7. ¿Qué finalidad tiene el ocular ajustable?

8. ¿Qué combinaciones de aumentos pueden hacerse en la lupa que hay en el laboratorio?

9. Haga un cuadro comparativo entre las partes ópticas y mecánicas y el funcionamiento del microscopio compuesto y el de la lupa binocular.

20


PRテ,TICA 4

La lupa binocular o estereomicroscopio

CONCLUSIONES:

21


Práctica

Ramas de la biología y ciencias auxiliares

5 INTRODUCCIÓN

La ciencia encargada del estudio de los seres vivos es la Biología. A los seres vivos se les llama también orgánicos, para poder diferenciarlos de los inertes o inorgánicos. La Biología está íntimamente relacionada con otras ciencias que la auxilian en su estudio, y a su vez ésta se subdivide en varios grupos que reciben el nombre de Ramas de la Biología.

OBJETIVO

MATERIALES Y REACTIVOS

• Delimitar el campo de estudio de la biología y su relación con otras ciencias.

• Lápices de colores • Tijeras • Goma o pegamento

23


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO Completa el siguiente diagrama de las ciencias que auxilian a la Biología. Anota los nombres que faltan en las elipses y colorea.

FÍSICA

BIOQUÍMICA

BIOLOGÍA

BIOESTADÍSTICA

GEOGRAFÍA

24


PRÁCTICA 5

Ramas de la biología y ciencias auxiliares

PROCEDIMIENTO Coloca los nombres de las Ramas de la Biología en el círculo interno. El profesor dará el nombre de las ramas de la Biología que seleccione. Escribe el significado de cada una en los espacios más grandes.

BIOLOGÍA

25


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

26


Práctica

Sopa de especialidades científicas

6 E

C

B

A

I

C

I

R

T

E

T

S

B

O

R

A

D

A

I

G

O

L

O

M

U

E

N

Q

G

O

G

A

I

G

O

L

O

C

N

O

P

A

S

O

F

I

F

G

O

P

H

O

M

A

R

A

I

H

L

T

N

I

O

L

N

A

G

A

R

T

T

G

E

O

A

E

S

L

O

F

I

I

N

T

O

O

O

M

N

L

C

I

O

R

I

G

L

E

A

P

L

L

A

I

M

O

A

R

F

R

U

T

S

I

E

O

O

T

R

O

L

T

U

E

U

R

K

T

D

D

G

R

O

C

L

O

R

L

N

J

I

O

E

O

I

I

U

L

O

O

G

A

Y

V

A

C

I

S

P

A

A

E

O

D

G

I

U

A

I

R

T

A

I

R

E

G

N

G

N

O

A

I

G

O

L

O

T

A

M

R

E

D

I

E

I

A

D

D

A

I

G

O

L

O

I

D

R

A

C

M

M

I

N

F

E

C

T

O

L

O

G

I

A

O

S

PROCEDIMIENTO Localiza en la sopa de letras las siguientes especialidades científicas y profesiones:

CARDIOLOGÍA CIRUGÍA DERMATOLOGÍA ENDOCRINÓLOGO FISIATRA GERIATRÍA GINECOLOGÍA

HEMATOLOGÍA INFECTOLOGÍA NEFROLOGÍA NEUMOLOGÍA NEUROLOGÍA OBSTETRICIA OFTALMÓLOGO

ONCOLOGÍA ORTOPEDIA PATOLOGÍA PODIATRA UROLOGÍA

27


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

28


Práctica

Características de los seres vivos

7 INTRODUCCIÓN

No existe ninguna definición sencilla de la vida. No es un concepto abstracto, puesto que no existe vida sino seres vivos. Para diferenciar a éstos de los objetos inanimados se debe recurrir a un conjunto de características que les son particulares, como que sus componentes estén organizados simultáneamente en los niveles molecular, celular, organísmico y poblacional, presentar metabolismo (la habilidad para tomar la materia y la energía del medio para transformarlas y satisfacer sus necesidades), responder a estímulos (irritabilidad), tener movimiento, reproducirse, crecer y desarrollarse, adaptarse y evolucionar. Todas estas funciones son comunes a todos los organismos; en ocasiones, algunos materiales o compuestos presentan algunas de estas características, por lo cual se debe diferenciar con la mayor precisión posible si todas las características mencionadas se encuentran presentes.

OBJETIVO

MATERIALES Y REACTIVOS

• Conocer, a través de la comparación de los sistemas vivos e inertes, las características de los seres vivos, para comprender el objeto de estudio de la biología.

• • • • • • • • • • • • • • •

Cuaderno de notas 15 semillas de lentejas 3 agujas de disección o espátulas Agua 1 plato de plástico 1 g de cloruro de hierro III Algodón 1 g de cloruro de cobalto 1 frasco de vidrio o un vaso de precipitados 1 g de sulfato ferroso 1 ml de solución acuosa de silicato de sodio (solución coloidal) Portaobjetos Microscopio óptico Cubreobjetos Navaja o bisturí

PROCEDIMIENTO Desarrollo de plántulas 1. Coloca el algodón sobre el plato y satúralo con agua, posteriormente coloca las se-

millas separadas e insértalas firmemente dentro del algodón.

29


Biología 10. Manual de talleres y laboratorios

2. Mantenlas durante 10 días cerca de la luz, vigilando que el algodón siempre esté húmedo. 3. Realiza observaciones cada tercer día y regístralas en el cuadro 1, hasta que las plántulas se hayan desarrollado. 4. Por último, ya en el laboratorio, coloca las plántulas junto a una ventana durante 30 minutos, anota y dibuja lo que sucede. 5. Realiza un corte del tallo de la planta, colócalo en el portaobjetos y obsérvalo con el microscopio.

Jardín químico 6. En el frasco de vidrio o en un vaso de precipitados, vierte 100 ml de la solución coloidal y colócala junto a una ventana.

7. Con ayuda de una aguja de disección, agrega cuatro cristales de cloruro de hierro III y observa lo que sucede, a continuación agrega cuatro cristales de cloruro de cobalto y posteriormente cuatro de sulfato ferroso, registrando tus observaciones en el cuadro 2. 8. Evita movimientos bruscos del frasco. 9. Gira el frasco al lado contrario de donde le dé la luz, espera unos minutos y anota y dibuja lo que sucede. 10. Toma una muestra de los cristales y colócala en un portaobjetos para observarla con el microscopio.

Cuadro 1 Observaciones Día 1 4 7 10

Cuadro 2 Observaciones Cloruro de hierro III Cloruro de cobalto Sulfato ferroso

30


PRÁCTICA 7

Características de los seres vivos

PREGUNTAS 1. ¿Qué características presentan en común los datos de los cuadros 1 y 2? 2. ¿Cuál es la diferencia que se da en el elemento común entre el sistema vivo y el inerte? 3. Con respecto a la reacción a la luz, ¿ésta es la misma para ambos sistemas? 4. Con respecto a las observaciones en los microscopios, ¿cuál estructura corresponde de manera típica a los seres vivos?

Bibliografía para consultar Alexander, P. et al., Biología, Prentice-Hall, México, 1992. Audesirk, T. et al., Biología, la vida en la tierra, Prentice-Hall, México, 2003. Cervantes, M. y M. Hernández, Biología general, Publicaciones Cultural, México, 1999. CNEB, Biología. Unidad diversidad y continuidad de los seres vivos, CECSA, México. Gaviño, G. et al., Técnicas biológicas selectas de laboratorio y de campo, Limusa, México, 2a Ed. 2001. Nelson, E., Principios de biología, Limusa, México, 2002. Villee, C. et al., Biología, McGraw-Hill, México, 1996.

31


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

32


Práctica

Adaptaciones de los seres vivos

8 INTRODUCCIÓN

Las adaptaciones son estructuras, procesos fisiológicos o conductas que ayudan a la supervivencia y la reproducción en un ambiente dado. Este ambiente no sólo comprende factores físicos, sino, también, los demás organismos con los que el ser vivo en estudio interactúa.

OBJETIVO • Reconocer las adaptaciones que presentan los organismos que les permiten incrementar las posibilidades de supervivencia y reproducción.

PREGUNTAS 1. Adaptaciones para conseguir alimentos Para saber si alguna parte del cuerpo es una adaptación, es necesario saber en qué medio habita el ser vivo, qué come y qué procedimientos realiza para hacerlo. En los siguientes esquemas de cráneo observa e identifica las partes que le sirven para conseguir su alimento. • Señala con una cruz el sitio donde se localiza la adaptación. • ¿Por qué crees que hay una adaptación? • ¿Cuáles son los seres vivos representados en estos esquemas?

33


Biología 10. Manual de talleres y laboratorios

2. Adaptaciones al calor Al realizar ejercicio físico u otra actividad la temperatura del cuerpo se eleva. • ¿Cómo se manifiesta en nuestro cuerpo esta sensación de calor? • ¿Cuáles son los órganos que permiten que nuestro cuerpo se mantenga fresco? • ¿Por qué experimentamos esa sensación de calor cuando hacemos ejercicio?

3. Adaptaciones en los vegetales Los vegetales han desarrollado estructuras que facilitan su conservación y les sirven para protegerse o adaptarse al clima. Observa los esquemas y responde lo que se te pide.

• ¿Cuál es la función de las espinas de una planta de rosal?

• ¿Qué tiene el girasol sobre la superficie de la hoja y para qué le sirve?

• ¿Cuáles son las adaptaciones que desarrollan los cactus y cuál es su función?

34


PRÁCTICA 8

Adaptaciones de los seres vivos

4. Adaptaciones en los animales De acuerdo con la ilustración, señala los órganos que le permiten a cada animal adaptarse a su medio y coloréalos.

35


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

36


Práctica

9

Cómo empezó la vida: creencias y teorías

OBJETIVO • Discutir de manera crítica las teorías que aplican el origen de la vida.

PROCEDIMIENTO 1. Analiza la siguiente lectura e ilustra cada una de las creencias y teorías. 2. Contesta las preguntas. Cómo empezó la vida: creencias y teorías Cómo se originó la vida en la Tierra es una de las preguntas más fascinantes de la biología y constituye un gran reto. Se han propuesto muchas ideas, hipótesis y teorías, pero el misterio aún no está resuelto. Orígenes divinos. Es común que en la historia registrada de las culturas humanas, exista la creencia de que la vida en la Tierra no surgió espontáneamente, sino que fue insuflada por un creador. Las principales religiones actuales enseñan que un ser superior creó la vida. Muchas personas encuentran imposible creer que la vida pudiera surgir sin la intervención de fuerzas más allá del entendimiento humano. La creación divina es más una creencia que una teoría científica, porque es aceptada con base en la fe. Origen extraterrestre. Esta teoría sugiere que la vida no empezó del todo en la Tierra, sino que fue traída por meteoritos (trozos de rocas transportados por el espacio que quedan atrapados por la fuerza gravitacional de la Tierra. Probablemente, son los restos despedazados de cometas.) Los meteoritos contienen

cantidades pequeñas de materia orgánica, lo cual puede ayudar a explicar la forma como entraron a los océanos primitivos de la Tierra las moléculas orgánicas que son consideradas necesarias para la formación de las células vivas. La sopa primordial. La versión más ampliamente aceptada entre los científicos es que la vida surgió por medio de procesos naturales. Esta teoría propone que los océanos primitivos de la Tierra fueron una sopa primordial, llena de moléculas orgánicas, y que la atmósfera contenía nitrógeno, metano, y amoniaco, pero no oxígeno. La energía proveniente del Sol, los volcanes y los relámpagos impulsaron las reacciones químicas que combinaron estas moléculas y gases en aminoácidos, lípidos y otras moléculas orgánicas complejas, que se encuentran en las células vivas. Sin embargo, hay puntos débiles en esta teoría. De acuerdo con el registro fósil, la vida debió desarrollarse más rápido de lo que supone esta teoría, y algunos científicos sospechan que la atmósfera primitiva pudo no haber contenido amoníaco ni metano. La teoría de la burbuja. A manera de sustitución, esta teoría postula que las reacciones

37


Biología 10. Manual de talleres y laboratorios

químicas de la sopa primordial se desarrollaron dentro de pequeñas burbujas de lípidos que fueron creadas por acción del viento, las olas y la lluvia. Hay evidencia de que el metano y el amoníaco pudieron estar presentes dentro de estas burbujas de lípidos. Cuando las moléculas que reaccionan se mantienen cerca en un espacio cerrado, las reacciones químicas se llevan a cabo con mayor rapidez que cuando las moléculas están en capacidad de alejarse. Un punto importante que se aplica a ambas teorías científicas descritas arriba, es que las proteínas, los lípidos y otras moléculas orgánicas grandes tienden a amontonarse para formar esferas pequeñas. Esta tendencia puede representar el primer paso para la organización de moléculas complejas en estructuras que nosotros llamamos células: las unidades básicas de la vida. La hipótesis del endosimbionte Hace muchos años, los científicos notaron que las cianobacterias y los cloroplastos se pareEvolución de células animales y vegetales por endosimbiosis

38

cían. De la misma manera, vieron que las mitocondrias y las bacterias también tenían apariencia similar. Estas observaciones clave llevaron a la hipótesis del endosimbionte. La hipótesis plantea que los eucariotas evolucionaron a través de relaciones simbióticas entre procariotas primitivos.

Evolución de células animales y vegetales por endosimbiosis Origen de la hipótesis del endosimbionte. En 1962, los científicos descubrieron ADN en los cloroplastos. Este descubrimiento condujo a la bióloga norteamericana Lynn Margulis a desarrollar la hipótesis del endosimbionte. A partir de entonces, ella ha estado recogiendo evidencias que respalden la hipótesis. Otras observaciones incluyen el hecho de que los cloroplastos y las mitocondrias tienen sus propios ribosomas, y crecen y se reproducen de forma independiente de la célula en la que se encuentran, y que las células no tienen medios para fabricar ni cloroplastos ni mitocondrias. Evidencia estructural. Cómo desarrollaron una relación simbiótica las cianobacterias y las bacterias, y cómo empezaron a funcionar como organelos celulares, es materia de amplia especulación científica. Sin embargo, la evidencia estructural que ha sido recopilada indica que los ancestros de las mitocondrias y los cloroplastos fueron una vez procariotas de vida libre. Por ejemplo, las mitocondrias y las bacterias pueden reproducirse a sí mismas, poseen ácidos nucleicos similares, tienen aproximadamente el mismo tamaño y la misma forma y hacen síntesis de proteínas en ribosomas. Los cloroplastos y las cianobacterias también comparten características importantes, de las cuales la principal es la capacidad de llevar a cabo la fotosíntesis.


PRÁCTICA 9

Cómo empezó la vida: creencias y teorías

PREGUNTAS 1. Confecciona un cuadro para conocer las fortalezas y debilidades de la teoría de la sopa primordial, la teoría de la burbuja y la teoría del origen extraterrestre. 2. ¿De qué manera se apoyan entre sí las tres teorías?

3. ¿Crees que sus debilidades tienden a apoyar la creencia de la formación de la vida por medios divinos?

4. Hoy en día algunos procariotas viven en estrecha asociación con eucariotas. ¿Puede usarse este hecho como evidencia para la hipótesis del endosimbionte? Explica tu respuesta.

39


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

40


Práctica

Teorías sobre el origen de la vida

10 INTRODUCCIÓN

No se sabe cuál fue la primera forma de vida. Lo único que se puede hacer es formular una suposición coherente acerca de sus características. Se plantea que la primera forma de vida fue el resultado de un conjunto de reacciones que sufrieron los compuestos inorgánicos y que estos permitieron la formación de la materia viva, evolucionando hasta formar a los organismos actuales.

OBJETIVO

MATERIALES Y REACTIVOS

• Interpretar algunas teorías sobre el origen de la vida.

• Plátano maduro • Frascos con tapa (2) • Etiquetas engomadas

PROCEDIMIENTO A. Comprobación de lo erróneo de la Teoría de la Generación Espontánea. 1. Esteriliza los frascos (con agua hervida). 2. Etiqueta los frascos, anotándole los números 1 y 2. 3. Coloca la mitad del plátano maduro en el frasco número 1 y déjalo destapado. 4. La otra mitad del plátano maduro colócala en el frasco número 2 y tápalo herméticamente.

5. Observa lo que pasa en ambos frascos durante cinco días. 6. Registra tus observaciones diariamente, en el cuadro.

41


Biología 10. Manual de talleres y laboratorios

Día

Frasco 1

Frasco 2

1

2

3

4

5

B. Escribe las aportaciones de los siguientes investigadores en relación con el origen de los seres vivos: 1. Lázaro Spallanzani 2. Francisco Redi 3. Luis Pasteur 4. Alexis Ivanovich Oparin 5. Stanley L. Miller

42


PRÁCTICA 10

Teorías sobre el origen de la vida

PREGUNTAS 1. ¿Cuáles son las diferencias que observaste en los frascos? 2. ¿Por qué en el frasco número 2 no hay presencia de organismos vivos? 3. ¿De dónde provinieron los organismos vivos del frasco número 1? 4. Analiza y concluye. ¿Es acertada la Teoría de la Generación Espontánea? Explica tu respuesta. 5. Con base en los conocimientos adquiridos, ¿cuál de las teorías acerca del origen de los seres vivos consideras más acertada? 6. Explícala.

43


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

44


Práctica

La biogénesis

11 INTRODUCCIÓN

Los estudios científicos con microorganismos establecieron la biogénesis como una explicación de la forma como se producen los seres vivos. Ella sostiene que los seres vivos proceden de otros seres vivos.

OBJETIVO

MATERIALES Y REACTIVOS

• Demostrar que todo ser vivo proviene de otro ser vivo.

• • • • • • • • •

Caldo de res Papel filtro Cuatro tubos de ensayo Mechero Algodón Vaso químico Varilla agitadora Cinta adhesiva Tapón de caucho

PROCEDIMIENTO

1. Calienta uno de los extremos de los tubos y tápalos. 2. Calienta agua en el vaso químico y agrega el caldo de res, agita con la varilla. 3. Agrega el caldo de cultivo en partes iguales a los tubos y numéralos del uno al cuatro.

4. Tapa el primer tubo con un algodón y el segundo con papel filtro. Cierra el extremo del tercero con un tapón de caucho y al cuarto no le hagas nada, sólo déjalo abierto. 5. Coloca los tubos en una gradilla y déjalos en un lugar fresco por ocho días.

45


Biología 10. Manual de talleres y laboratorios

Obsérvalos cada día y registra los resultados. _____________________________________ 6. Después de los ocho días, toma una gota de cada tubo y obsérvala en el microscopio. Anota las observaciones.

PREGUNTAS 1.

¿Qué es la biogénesis? __________________________________________________________________________________ __________________________________________________________________________________

2. ¿Qué cambios observaste en los tubos de ensayo durante el experimento? ¿Cuál de los tubos presentó primero un cambio de colocación? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Se apreciaron cambios en todos los tubos? ¿En cuales? __________________________________________________________________________________ __________________________________________________________________________________ 4. ¿Cuál es la unidad básica de que están constituidos los seres vivos? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿Qué científicos explicaron la biogénesis? Explica. __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

46


PRテ,TICA 11

La biogテゥnesis

CONCLUSIONES:

47


Práctica

Método científico

12 INTRODUCCIÓN

El método científico es la base de la investigación científica. Es un conjunto de conocimientos organizados y ordenados lógicamente que conducen al descubrimiento de la verdad de los fenómenos científicos. Consta de cuatro operaciones básicas interrelacionadas: observación, experimentación, hipótesis y conclusión.

OBJETIVO

MATERIALES Y REACTIVOS

• Diferenciar el conocimiento empírico del conocimiento científico.

• Una rosa • Estampa con una rosa

PREGUNTAS A. Compara el conocimiento empírico con el conocimiento científico.

________________________________________

Olor de la rosa

________________________________________

Tamaño de la rosa

________________________________________

PE GU E

Color de la rosa

AQ UÍ

1. Observa la figura de la rosa y anota las características que se te solicitan.

¿Qué conocimiento te proporcionó esta operación?

2. Observa la planta del rosal y contesta lo que se te solicita Color de la rosa

________________________________________

Olor de la rosa

________________________________________

Tamaño de la rosa

________________________________________

49


Biología 10. Manual de talleres y laboratorios

3. El resultado obtenido mediante este procedimiento es un ejemplo ¿De qué tipo de conocimiento? 4. Anota las diferencias que encontraste entre el análisis de un esquema y un ejemplar real. 5. ¿Qué conocimiento empírico (esquema) o científico (planta), es más importante en nuestra ciencia? 6. ¿Por qué?

MATERIALES Y REACTIVOS • • • • • • • •

Matraz Erlenmeyer Tapón de hule Tubo de vidrio Tubo de hule Vaso de precipitados Agua Alka Seltzer o Sal Andrews Agua de cal

B. Elabora una hipótesis e identifica los pasos del método científico.

SE

AL LT

KA

ZE

R

agua de cal

matraz Erlenmeyer

50

vaso de precipitados


PRÁCTICA 12

1. Coloca dentro de un matraz Erlenmeyer la mitad de una pastilla de Alka Seltzer soluble y agrega 15 mililitros de agua. 2. Cubre la boca del matraz inmediatamente con el tapón que tenga un tubo de cristal insertado. 3. Introduce en el extremo del tubo de cristal el tubo de hule, y conecta el otro tubo de cristal (de desprendimiento) en el vaso de precipitados que contiene agua simple. 4. ¿Qué sucede en el vaso de precipitados?

Método científico

7. ¿Qué sucede?

8. El resultado de este experimento es tu segunda hipótesis. Escríbela.

5. El resultado del experimento es tu primera hipótesis. Escríbela. 9. ¿Qué diferencia encuentras en las reacciones observadas en el vaso con agua simple y en el que contiene agua de cal?

6. Repite el procedimiento 1 y 2 e introduce el extremo del tubo de desprendimiento en el vaso de precipitados que contiene 150 ml agua de cal.

10. Compara si tu experimento funcionó de la misma manera que el realizado por los demás grupos del laboratorio.

51


Biología 10. Manual de talleres y laboratorios

11. Escribe tu hipótesis final.

12. Anota los pasos del método científico que hayas empleado. 1. 2. 3. 4. 5.

CONCLUSIONES:

52


Práctica

La bibliografía

13 INTRODUCCIÓN

Inmediatamente después de que tu profesor(a) te asigne el tema de investigación, acércate a la biblioteca para buscar la bibliografía que utilizarás. La bibliografía se refiere la descripción de un libro o lista de libros utilizados o consultados para la realización de un trabajo y que se incluye en orden alfabético al final de la obra. Los elementos que componen la bibliografía de un libro son: • • • • • • •

Autor(es). Título de la obra. Año de publicación. Número de edición. Editorial. Lugar publicación. Total de páginas.

Los elementos que componen la bibliografía de una revista son: • • • • • • •

Autor(es). Título del artículo (entre comillas). Nombre de la revista (subrayado). Lugar de publicación. Volumen y número. Fecha de publicación. Paginación.

La bibliografía debe aparecer en forma alfabética tomando como referencia el apellido del primer autor o segundo autor en el caso que sean dos o más.

OBJETIVO

MATERIALES Y REACTIVOS

• Ofrecer algunas directrices para la elaboración y presentación de referencias bibliográficas que pueden ser necesarias para utilizarlas en trabajos de estudio o investigación.

• Libros • Revistas • Material extraído de Internet

53


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Elabora y presenta cinco bibliografías de los libros seleccionados. ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ 2.

Elabora y presenta cinco bibliografías de las revistas seleccionadas. ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________

3.

Enlista cinco direcciones del material extraído de Internet. ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________ ____________________________________________________________________________________

54


PRÁCTICA 13

La bibliografía

PREGUNTAS 1. ¿Cuáles son los elementos que integran la bibliografía de un libro? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Cuáles son los elementos que integran la bibliografía de una revista? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Qué importancia tiene la investigación bibliográfica? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

CONCLUSIONES:

55


Práctica

Los “cómics”

14 INTRODUCCIÓN

Hacemos una diferencia entre caricatura y cómic: la primera es una manera de dibujar un estilo; el segundo es un medio de comunicación que a menudo se sirve de la caricatura. La definición no enumera géneros ni tipos de materias, ni estilos de prosa o poesía, nada dice sobre papel, tinta, imprenta, pluma, cartulinas, lápices, etcétera, no descarta material ni clases de herramientas, no hace mención de blanco y negro o color, exageración de anatomía o estilo realista o cómico. En resumen, la diferencia entre ellos consiste en que una caricatura es una viñeta aislada donde no existe una secuencia y se refiere sólo a una manera de dibujar; en cambio, el cómic es un medio de comunicación que en algunas ocasiones utiliza la caricatura. Cómic: Ilustraciones y otras imágenes yuxtapuestas en secuencia deliberada, con el propósito de transmitir información y obtener una respuesta estética del lector.

OBJETIVO

MATERIALES Y REACTIVOS

• Representar temas de interés biológico a través de los cómics.

• Tema de interés • Lápiz • Lápices de colores

Creando un personaje:

Paso 1:

Aquí te daremos en cinco pasos una muestra de cómo crear un personaje básico para tus cómic:

Dibuja un círculo y divídelo en cuatro partes, como si fuese una torta.

57


Biología 10. Manual de talleres y laboratorios

Paso 2:

Paso 4:

Dibuja dentro del círculo los rasgos faciales (ojos, nariz, boca, etcétera.)

Para agregar volumen dibujaremos una cara en una esfera. Para esto, las líneas divisorias se hacen curvas, lo dibujamos de tal manera que donde éstas se cruzan, se dibuja la nariz y luego agregamos el resto de los elementos. Practica con diferentes expresiones.

Paso 3: Si los dibujas en la parte inferior, la cara parece mirar hacia abajo. Si los pones en la parte superior, parece mirar hacia arriba. De igual forma, si los pones hacia la izquierda o la derecha, la cara parece mirar a los respectivos costados. Paso 5: Ahora, entinta sobre el dibujo a lápiz (las líneas divisorias no se entintan). Espera que se seque y borra el lápiz con la goma. Si le añades pelo, ya tienes la cara terminada.

IMAGINEMOS LA SIGUIENTE HISTORIA “A un joven y a su novia, mientras pasean, se les aparecen unos extraterrestres. Éstos destruyen la ciudad y ponen a la chica en peligro. El protagonista se transforma, vence a los extraterrestres y rescata a su novia.”

58

Para determinar cuántas páginas ocuparemos en la historia, haremos el siguiente cuadro:

Páginas 1a3 4a5 6a9 10 a 16

Contenido El protagonista pasea con su novia. Viene un ovni. Del ovni salen unos extraterrestres. En una pelea los extraterrestres destruyen la ciudad. 17 La chica está en peligro. 18 a 19 El protagonista se transforma. 20 a 29 Lucha con los extraterrestres. 30 Final feliz.


PRÁCTICA 14

Los “cómics”

Hay dos puntos esenciales que deben ser tomados en cuenta: primero, la Técnica Plástica que se usa para plasmar la historia y, segundo, el Lenguaje Narrativo. Ambos son extremadamente difíciles de dominar, por esto creo que la mejor manera de practicarlos es realizando muchas historias cortas. Cuando uno comienza en esto, tiende a dibujar historias eternas que dejan al Señor de los Anillos como un simple panfleto. Error, lo mejor es hacer una serie de historias cortas con un comienzo, desarrollo, clímax y desenlace; es la única manera de comenzar a entender el mecanismo del cómic. Experimenta mucho hasta que por fin encuentres el estilo y el lenguaje que te queden más cómodos. En cuanto al lenguaje narrativo, el tema es extenso y complejo, pero de todos modos creo que puedo aclarar algunos puntos esenciales. 1. El Mensaje debe ser claro. Aunque parezca tonto decirlo, lo esencial es que la idea que tú quieres comunicar (por más compleja que sea tu historia) se entienda. Por esto mi estilo es cada vez menos barroco y, al contrario, me he ido simplificando mucho más. 2. Dominar el ritmo. Este punto es lo más difícil en la creación de un cómic. El ritmo hace que tu historia sea lo que es: si tu historia es de terror lo recomendable es que el ritmo sea lento y tenso, que cree una atmósfera determinada. Si, al contrario, tu historia es de acción, lo correcto es que uses un ritmo rápido que cree dinamismo en la lectura, etcétera. Para manejar este factor es necesario saber aplicar el “salto” entre viñetas, el uso del diálogo y el texto descriptivo, el impacto visual de la viñeta en sí y… bueno, podría seguir enumerando, pero el asunto es complejo y varía con las diferentes culturas. El Manga tiene un ritmo diferente al del cómic estadounidense y éste a su vez es diferente al del cómic europeo. Si te interesa este asunto te recomiendo la lectura de los siguientes libros de dos grandes autores: 1. ¿Cómo se hace un cómic? de Scott Mc Cloud (un libro extraordinario que será de interés para cualquier persona que se interese en entender cómo funciona nuestra mente ante la avalancha visual que hoy en día nos acorrala). 2. Cómic el Arte Secuencial de Will Eisner, maestro de maestros. El Boceto es como un mapa de lo que tú plasmarás en tu página de cómic, es la etapa más entretenida de la creación de una historieta, es el momento en que estableces la disposición de las viñetas y las secuencias entre éstas para que favorezcan la lectura de la página. Para esto tienes que disponer tu página con el conocido sistema de lectura en z, es decir, la atención debe ser dirigida de izquierda a derecha, luego bajar a la próxima secuencia de viñetas y comenzar nuevamente por el extremo izquierdo; y así continuar hasta que el foco de atención abandone la página por el extremo inferior derecho de la hoja. A esta manera de llevar la atención del lector se le llama El Recorrido Visual. Para controlar este recorrido se utilizan diversos elementos de la página como la forma de las viñetas, la disposición de los globos de diálogos o los textos en off ; también la disposición de los elementos dentro de las viñetas (ángulos de cámara, masas en movimiento, dirección de mirada, líneas cinéticas, etcétera) puede ayudar a crear un recorrido más claro. El trazado a lápiz corresponde a la forma definitiva que tendrá el trabajo. Hoy en día está de moda realizar un dibujo muy fino y detallado, esto se debe a que comúnmente en el cómic estadounidense el trabajo a lápiz y el entintado son realizados por artistas diferentes, por eso la única manera de que el arte de un dibujante destaque plenamente es realizando un excelente dibujo a lápiz.

59


Biología 10. Manual de talleres y laboratorios

En el original que aquí puedes ver notarás que casi todo el diseño del boceto permaneció hasta la etapa de entintado. Digo “casi”, porque siempre es posible hacer algunas modificaciones al trabajo final, sobre todo si se trabaja con un editor. Es muy común que las áreas de sombras extensas no se sombreen con el lápiz, sólo son marcadas con pequeñas equis (x). El entintador sabe que eso significa que debe cubrir el área con tinta. Se puede trabajar con un portaminas 0.5 para el detalle y con un 0.9 para el visitado. También se usan minas b y hb. En cuanto al papel, puede servir prácticamente cualquiera que soporte el entintado, pero lo ideal es que sea de superficie lisa para que el lápiz y la pluma corran con facilidad. El porte ideal de una plancha, para mí, es de 4028 cm, aproximadamente. Un punto importante de esta etapa es el rotulado o el escribir los textos en los globos. Actualmente, por lo menos en Estados Unidos, los textos y los globos de diálogo son agregados digitalmente al trabajo final, pero se puede hacer una buena rotulación a mano. Lo importante de este asunto es el diseño de las viñetas. Durante el dibujo a lápiz se debe dejar el suficiente espacio libre de información para colocar los globos de diálogos y las cajas de texto en off. Aquí, nuevamente, las posibilidades son infinitas. Se recomienda por el estilo de entintado basado en el dibujante americano Mike Mignola y en menor medida en el trabajo de Frank Miller. La principal misión del entintado es dar volumen a los elementos, crear efectos de profundidad de campo y proporcionar detalles a la composición, pero principalmente el entintado tiene que definir qué es qué en la página. Los grandes maestros ocupaban generalmente pinceles y plumas para llevar a cabo esta tarea. Estas dos herramientas son, por mucho, las más difíciles de ocupar con eficacia. Hoy en día algunos artistas usan plumones biselados para hacer el trabajo, lo cual no es recomendable porque están hechos a base de alcohol, y esto hace que el trabajo final se desvanezca con el tiempo. Por esta razón es mejor gastar un poco más de plata y comprarse una buena tinta china. Se debe usar una pluma fina para delinear los detalles y pinceles de diferentes grosores y cortes para cubrir las zonas de sombra; también se debe usar tiralíneas de diferentes grosores para delinear contornos y rotular. Lo ideal es entintar la página de una sola vez y evitar correcciones o pegar viñetas sobre alguna que te quedo un poco fuera.

60


PRÁCTICA 14

Los “cómics”

Bueno, ¿qué es el volumen? El volumen es lo que nos va a permitir convertir una imagen plana en otra en tres dimensiones. Vamos a darle profundidad a nuestros dibujos tan sólo con un par de líneas gruesas superpuestas. Por supuesto que el efecto de volumen, perspectiva y 3D puede aplicarse con infinitud de técnicas, pero creo que por el momento, con que conozcas sólo una ya es más que suficiente, que esto se está extendiendo demasiado. Veamos el siguiente dibujo:

Observa cómo la cabeza del dragón se encuentra en primer plano, el guerrero en segundo y los árboles en tercer lugar. Fíjate también en el grosor de las líneas. Una línea gruesa provoca un efecto de acercamiento. Una línea muy fina, todo lo contrario, de lejanía.

61


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

62


Práctica

Los compuestos orgánicos

15 INTRODUCCIÓN

La mayoría de los compuestos que se encuentran en la célula son orgánicos, esto significa que contienen el elemento carbono. En su mayoría, los compuestos orgánicos de los sistemas vivientes se pueden colocar en uno de los siguientes grupos: carbohidratos, lípidos, proteínas y ácidos nucleicos. En esta actividad realizarás pruebas para identificar la presencia de las moléculas orgánicas en los alimentos.

OBJETIVOS

MATERIALES Y REACTIVOS

• Identificar la presencia de carbono en los carbohidratos. • Usar pruebas químicas para detectar la presencia de algunas moléculas orgánicas en los alimentos.

• • • • • • • • • • • • • • • •

Crisoles Trípodes Mecheros Bunsen Tubos de ensayo Tenazas Almidón al 1% Gelatina al 1% Papel de envolver Solución Benedict Reactivo de Biuret Miel para bebé Aceite vegetal o manteca Lugol o yodo Clara de huevo diluida Granos de maíz Sudan III

63


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO PARTE A. ¿Contienen carbono los carbohidratos? Los azúcares y los almidones son ejemplo de carbohidratos. Si alguna vez has quemado una papa (almidón) habrás notado que se pone negra. El responsable de este color es el carbono que posee el almidón. En esta actividad determinarás si los cristales de azúcar también poseen carbono. Coloca una pequeña cantidad de cristales de azúcar en un crisol. Luego pon el crisol en un trípode y calienta con el mechero Bunsen. Observa el azúcar a medida que lo calientas. ¿Qué le pasa a los cristales de azúcar? ___________________________________________________ _____________________________________________________ Sujeta un tubo de ensayo con unas tenazas y colócalo invertido sobre el crisol. Deja que el tubo de ensayo se enfríe en esa posición. _____________________________________________________ ¿Qué observas? _______________________________________________________________________ ¿Qué otra sustancia consideras que estaba presente en el vapor? ___________________________ Continúa calentando el crisol hasta que observes un residuo negro en el fondo. ______________ ¿Qué crees que sea esta sustancia? _____________________________________________________ ¿Qué le sucedió a los átomos de hidrógeno y de oxígeno que estaban presentes en la molécula de azúcar? ______________________________________________________________________________ ¿Qué tipo de cambio ocurrió en el azúcar? _______________________________________________ ¿Hubo algún cambio de color? _________________________________________________________ Explica tu respuesta. __________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________

PARTE B. Prueba para determinar la presencia de moléculas orgánicas. Hay una serie de pruebas químicas que sirven para determinar la presencia de moléculas de carbohidratos (azúcar, almidón), grasas y proteínas en una sustancia.

Prueba para azúcares simples Toma dos tubos de ensayo marcados. En el tubo 1 coloca cinco gotas de agua y en el tubo 2, cinco gotas de la miel para bebé. Agrega 1 ml de solución Benedict a cada uno de los dos tubos. ¿Qué color aparece en los tubos? _______________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Calienta los tubos colocándolos a baño María por unos cinco minutos. Observa el cambio de color.

64


PRÁCTICA 15

Los compuestos orgánicos

¿Qué cambios de color hubo en el tubo 1? _______________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ ¿Qué cambios de color hubo en el tubo 2? _______________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ ¿Cuál es la coloración final del tubo 2? __________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Este color indica la presencia de azúcares simples reductores. Este resultado indica una prueba positiva. ¿Cuál es el propósito del tubo 1 cuyo resultado indica una prueba negativa? _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Dibuja

65


Biología 10. Manual de talleres y laboratorios

Prueba para almidón Toma dos tubos de ensayo marcados. Coloca cinco gotas de agua en el tubo 1 y cinco gotas de solución de almidón al 1% en el tubo 2. Agrega dos gotas de lugol a cada uno de los tubos. ¿Qué cambios de color hubo en el tubo 1? _______________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ ¿Qué cambios de color hubo en el tubo2? _______________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Lo que observaste en el tubo 2 es una prueba positiva para almidón. Dibuja

Prueba para grasas y aceites Riega dos gotas de aceite en un pedazo de papel para envolver carnes. Sosténlo contra la luz. ¿Observas una “mancha de grasa” translúcida en el papel?_________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________

66


PRÁCTICA 15

Los compuestos orgánicos

En otro papel para envolver carnes riega dos gotas de agua. Déjalo secar por un rato y luego compara las dos manchas _________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Hay otra prueba que es más exacta. Coloca aproximadamente 1 cc de una sustancia que va a ser probada en un tubo de ensayo seco y agrega 10 gotas de Sudan III. En otro tubo vierte 1 cc de agua y también agrega 10 gotas de Sudan III. Deja reposar los tubos por unos 10 minutos. Examina y describe los resultados _______________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Dibuja

Pruebas para proteínas Toma dos tubos de ensayo marcados con 1 y 2. Coloca 20 gotas de agua en el tubo 1 y 20 gotas de gelatina al 1% y clara de huevo diluida en el tubo 2. Agrega dos gotas de reactivo de Biuret a cada uno de los tubos. NOTA: Ten cuidado al usar el reactivo de Biuret porque te puede quemar la piel o la ropa. ¿Qué cambios de color ocurrieron en el tubo 1? __________________________________________ __________________________________________________________________________________

67


Biología 10. Manual de talleres y laboratorios

¿Qué cambios de color ocurrieron en el tubo 2? __________________________________________ _____________________________________________________________________________________ La solución de gelatina es una proteína, ¿qué cambios de color en el reactivo de Biuret indican la presencia de proteínas? ________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Dibuja

Completa el siguiente cuadro Compuesto

Reactivo

Resultado

Almidón Azúcar (miel) Aceite Proteína (huevos)

Pruebas utilizando granos de maíz Las pruebas anteriores para almidón, aceites y proteínas pueden repetirse utilizando granos de maíz que han estado en agua por 24 horas aproximadamente y luego cortados longitudinalmente.

68


PRÁCTICA 15

Los compuestos orgánicos

¿Qué áreas del grano de maíz muestran la presencia de almidón? __________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ ¿Qué áreas del grano de maíz muestran la presencia de proteínas? _____________________________________________________________________________________ _____________________________________________________________________________________ Dibuja un grano de maíz y con lápices de colores muestra las áreas en las que se observaron resultados positivos de las pruebas.

Una vez terminada la prueba lava todos los utensilios de vidrio.

69


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Qué prueba utilizarías para determinar la presencia de carbono en un compuesto orgánico? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Cuál es la composición de un azúcar reductor? __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Hay algún cambio de color cuando se calienta el azúcar? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 4. Explica tu respuesta___________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿De qué color se pone el yodo cuando se agrega al almidón? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 6. ¿Qué indicador reacciona cambiando de azul a chocolate o naranja cuando se calienta en presencia de ciertos azúcares? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 7. ¿Cómo reacciona el reactivo de Biuret con una proteína? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 8. ¿Por qué el Sudan III tiñe las grasas y no el agua? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

70


PRテ,TICA 15

Los compuestos orgテ。nicos

CONCLUSIONES:

71


Práctica

Crucigrama de las moléculas biológicas

16 PROCEDIMIENTO

Completa el siguiente crucigrama sobre las moléculas biológicas 1

2 3 4

5

6

7

9

8 10

11

12

13

Verticales 1. Unidad estructural de las proteínas. Contiene un grupo amino (NH2) y un grupo carboxilo (COOH). 2. Forman parte de la masa de un organismo, pero en pequeñas cantidades. 3. Compuestos orgánicos que sirve ncomo fuente de energía para los seres vivos. 5. Catalizadores del mundo vivo. 6. Fabricación de moléculas orgánicas por los seres vivos. 8. Parte más pequeña de un elemento. En su interior contiene protones, electrones y neutrones.

Horizontales 4. Compuestos orgánicos aceitosos, no solubles en agua. 7. Sustancias que al mezclarse con agua contienen mayor cantidad de iones de H+. 9. Constituyentes estructurales de las células. 10. Unión de aminoácidos mediante enlaces peptídicos. 11. Tiene igual número de protones y electrones, su número de neutrones varía. 12. Monosacáridos unidos entre sí formando largas cadenas. 13. Unidades estructurales de los ácidos nucleicos formados por un grupo fosfato, un azúcar y una base nitrogenada (purina o pirimidina).

73


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

74


Práctica

Las moléculas orgánicas y su importancia en la nutrición

17

INTRODUCCIÓN Los alimentos son las sustancias que el hombre ingiere con el fin de elaborar sus propias células y obtener la energía necesaria para llevar a cabo sus funciones vitales. Se clasifican siguiendo distintos criterios, entre los que se destacan el origen, el papel fisiológico, la composición, etc. Los requerimientos nutricionales son específicos. En nuestra dieta deben estar presentes lípidos, carbohidratos, proteínas, minerales y vitaminas para que se satisfagan las diversas necesidades del cuerpo.

OBJETIVO

MATERIALES Y REACTIVOS

• Analizar la composición de los alimentos que consumimos diariamente.

• Veinte etiquetas de productos alimenticios consumidos en casa • Tijeras • Goma

PROCEDIMIENTO 1. Analiza cada una de las etiquetas determinando los nutrientes que contiene cada producto (carbohidratos, lípidos, proteínas y vitaminas).

2. Completa el cuadro 1. 3. Recorta el frente y el contenido nutricional de cinco etiquetas y pégalos en el área indicada.

75


76

20

19

18

17

16

15

14

13

12

11

10

9

8

7

6

5

4

3

2

1

#

(ETIQUETA)

PRODUCTO

MONOSACÁRIDO

DISACÁRIDO

POLISACÁRIDO

CARBOHIDRATOS LÍPIDOS

MOLÉCULAS ORGÁNICAS

PROTEÍNAS

VITAMINAS

Biología 10. Manual de talleres y laboratorios


PRテ,TICA 17

Las molテゥculas orgテ。nicas y su importancia en la nutriciテウn

ETIQUETAS DE PRODUCTOS

77


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Qué alimentos o productos contienen carbohidratos? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Cuál es la función de los carbohidratos? __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Qué alimentos o productos contienen proteínas? __________________________________________________________________________________ __________________________________________________________________________________ 4. ¿Cuál es la función de las proteínas? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿Qué alimentos o productos contienen lípidos? __________________________________________________________________________________ __________________________________________________________________________________ 6. ¿Cuál es la función de los lípidos? __________________________________________________________________________________ __________________________________________________________________________________ 7. ¿Qué alimentos o productos contienen vitaminas? __________________________________________________________________________________ __________________________________________________________________________________ 8. ¿Cuál es la función de las vitaminas? __________________________________________________________________________________ __________________________________________________________________________________

78


PRテ,TICA 17

Las molテゥculas orgテ。nicas y su importancia en la nutriciテウn

CONCLUSIONES:

79


Práctica

Movimiento molecular

18 INTRODUCCIÓN

La membrana celular es la entrada a la célula. Todos los materiales que entran o que salen de la célula deben atravesar la membrana celular y el paso de esas sustancias tiene que ser regulado para que ella mantenga dentro un balance químico adecuado.

OBJETIVOS

MATERIALES Y REACTIVOS

• Demostrar la acción diferencial de la membrana permeable. • Observar los mecanismos del movimiento molecular a través de membranas biológicas.

• • • • • • • • • • • • • • •

Vaso químico de 600 ml Embudo Papel celofán Hilo, pabilo y ligas Portaobjetos y cubreobjetos Sulfato de cobre Solución saturada de glucosa Tubos de ensayo Solución Benedict Betabel Bisturí Solución de sal al 30% Solución de lugol Solución de almidón Microscopio

PROCEDIMIENTO I. Difusión A. Llena un tubo de ensayo con agua. Añade un poco de sulfato de cobre. Deja el tubo en la gradilla y obsérvalo a

intervalos hasta que termine el periodo de laboratorio. B. Arma un sistema como el de la figura que aparece a continuación.

81


Biología 10. Manual de talleres y laboratorios

4. Con un lápiz de cera marca el nivel del líquido. 5. Coloca el embudo con la solución dentro de un vaso químico, llénalo con agua, aproximadamente hasta la mitad del embudo. 6. Déjalo allí por varias horas. 7. Observa lo que ocurrió dentro del embudo. Anótalo. _____________________________________ _____________________________________ _____________________________________ _____________________________________

1. Amarra con un pedazo de hilo o liga uno de los extremos de una bolsa de celofán. 2. Llénalo con una solución de almidón, ten cuidado de que no se derrame. 3. Agrégale 40 gotas de una solución saturada de glucosa. 4. Ata el otro extremo y lava muy bien por fuera. 5. Coloca la bolsita de celofán en un vaso químico con agua y unas gotas de lugol o yodo de la forma en que se observa en la figura. 6. Después de transcurridos 30 minutos, observa lo que ocurre y toma 5 ml de la solución de vaso químico y agrégale solución Benedict, caliente a baño María. Observa y anota tus resultados. _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________ II. Ósmosis 1. Toma un embudo pequeño y tapa el extremo más amplio con papel celofán. 2. Amarra fuertemente. 3. Invierte el embudo y llévalo con una solución saturada de agua y azúcar hasta donde se inicia el tallo del embudo.

82

Figura: III. Observación de los fenómenos de turgencia y plasmólisis 1. Realiza cortes finos de un betabel; una vez hechos los cortes, móntalos en un portaobjetos, agrega una gota de agua, coloca su cubreobjetos. 2. Observa que todo el citoplasma aparece rojizo. Dibuja.


PRÁCTICA 18

Movimiento molecular

3. Quita el exceso de agua y agrega una gota de una solución de sal al 30%. 4. Al cabo de unos cinco minutos observa y comprueba lo que le ha ocurrido al citoplasma. Anota y dibuja lo observado. _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________

PREGUNTAS 1. ¿Qué es una membrana semipermeable? __________________________________________________________________________________ 2. ¿Qué es difusión? __________________________________________________________________________________ 3. ¿Qué es plasmólisis? __________________________________________________________________________________ 4. ¿Qué es turgencia? __________________________________________________________________________________ 5. ¿Qué apariencia tomó la solución cuando le colocó sulfato de cobre? __________________________________________________________________________________ 6. Al cabo de una hora, ¿que sucedió? __________________________________________________________________________________ 7. ¿Para qué se usa Benedict? __________________________________________________________________________________ 8. ¿Qué uso se le dio al lugol? __________________________________________________________________________________

83


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

84


Práctica

Estructura de las células eucarióticas

19 INTRODUCCIÓN

Las células eucarióticas difieren de las procarióticas en algunos aspectos como el tamaño, pueden medir más de 10 micras de diámetro; estructuras encerradas por membranas llamadas organelos; citoesqueleto y DNA dentro del núcleo, delimitado por la doble membrana de la envoltura nuclear.

OBJETIVO

MATERIALES Y REACTIVOS

• Conocer las funciones de cada una de las estructuras de las células eucarióticas

• Libro de texto • Lápices de colores

PROCEDIMIENTO 1. Completa el cuadro con las funciones de cada una de las estructuras de la célula animal y la célula vegetal.

ESTRUCTURAS DE LAS CÉLULAS EUCARIÓTICAS Estructura

Función

Tipo de célula en que se encuentra

Pared celular Membrana Plasmática Núcleo Membrana Nuclear Nucleolo

85


Biología 10. Manual de talleres y laboratorios

Núcleo plasma Citoplasma Organelos citoplásmicos Retículo endoplásmico (RE) Liso Rugoso Ribosomas Complejo de Golgi Lisosomas Vacuolas Microcuerpos Peroxisomas Glioxisomas Mitocondrias Plastidios Leucoplastos Cloroplastos Cromoplastos Citoesqueleto Microtúbulos Microfilamentos Filamentos intermedios Centríolos Cilios Flagelos Uniones intercelulares Desmosomas Uniones estrechas Uniones en hendiduras

86


PRÁCTICA 19

Estructura de las células eucariotas

2. Identifica las estructuras señaladas en las células animal y vegetal.

a. Célula animal

b. Célula vegetal

87


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

88


Práctica

Célula animal

20 INTRODUCCIÓN

A Robert Hooke, en el año 1665, se le ocurrió mirar una laminilla finísima de corcho con un microscopio muy sencillo. Observó una multitud de huecos o celdillas a las que llamó células. Más adelante, otros científicos comprobaron que todos los seres vivos estaban formados de células. Las células tienen organelos que les permiten vivir por sí solas. Existen organismos formados por una o varias células. Éstos se llaman unicelulares o pluricelulares, respectivamente. La célula es la unidad básica y estructural de todo ser vivo. En ella cada orgánulo y organelo realiza funciones específicas. Toda célula consta de tres partes fundamentales: la membrana celular, el núcleo y el citoplasma. Dentro del citoplasma encontramos otros organelos, como las mitocondrias, los lisosomas, ribosomas, aparato de Golgi, vacuolas, retículo endoplasmático, plastidios y otros. Entre las células animal y vegetal existen diferencias básicas: la célula animal carece de cloroplastos, mientras que la célula vegetal si los tiene; la célula vegetal tiene una pared celular, la animal no; la vegetal produce clorofila y celulosa, mientras que la animal no. En el siguiente experimento podrás observar las estructuras de la célula animal.

OBJETIVOS

MATERIALES Y REACTIVOS

• Describir qué es la célula. • Identificar las estructuras fundamentales de una célula animal.

• • • • • • •

Palillos de dientes Portaobjetos Cubreobjetos Microscopio Yodo o lugol Mucosa bucal Lápices de colores

89


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Con un palillo de dientes haz un raspado de la mucosa bucal interna (muy suavemente) y procede a hacer el frotis en el portaobjetos; coloca una gota de yodo o lugol y luego cubre con el cubreobjetos. 2. Coloca el portaobjetos sobre la platina y procede a identificar la forma, el núcleo, la membrana celular y el citoplasma. 3. Haz un dibujo de lo observado y calcula el poder de aumento.

PREGUNTAS 1. ¿Qué formas presentaron las células epiteliales?

90


PRÁCTICA 20

Célula animal

2. ¿De qué color se tiñó el núcleo y el citoplasma en las células epiteliales?

3. ¿Qué función desempeña el portaobjetos?

4. ¿Qué función desempeña el cubreobjetos?

5. De acuerdo con la evolución de las células, ¿cómo se clasificaría a las células epiteliales?

91


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

92


Práctica

Célula vegetal

21 INTRODUCCIÓN

Entre la célula animal y la célula vegetal existen diferencias. En el experimento anterior vimos que la célula animal carece de cloroplastos. La célula vegetal, además, posee una pared celular de celulosa, la cual da dureza y soporte a los vegetales. Al mismo tiempo, la célula vegetal presenta algunas formas geométricas, mientras que la animal generalmente no las presenta. En la célula vegetal también podemos encontrar algunas sustancias como las antocianas, que le dan un color violeta o morado (remolacha) y carotenos, que le dan un color anaranjado, como es el caso de la zanahoria. También, tienen los vegetales pequeñas estructuras como las células pétreas que se encuentran, por ejemplo, en la pera. Los cloroplastos son muy importantes en los vegetales, ya que en ellos se realiza la fotosíntesis, proceso que permite a la planta elaborar su propio alimento, de lo cual dependemos todos los seres vivos que poblamos la Tierra, ya sea en forma directa o indirecta. El pigmento que le da el color verde a las plantas se llama clorofila y se localiza en los cloroplastos. Este pigmento absorbe la energía de la luz solar para que la planta pueda realizar el proceso de la fotosíntesis. En el presente laboratorio podrás observar e identificar las estructuras de la célula vegetal.

OBJETIVOS

MATERIALES Y REACTIVOS

• Reconocer las diferencias que existen entre la célula vegetal y la célula animal. • Identificar algunos pigmentos y estructuras que se localizan en la célula vegetal.

• • • • • • •

Microscopio Portaobjetos Cebolla Gotero Cubreobjetos Hojas de lirio Jugo de pera

93


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Desprende el catáfilo de cebolla y colócalo en un portaobjetos. Pon una gota de yodo sobre la preparación y luego cúbrela con el cubreobjetos. Repite la operación con la hoja de lirio. 2. Lleva la preparación al microscopio e identifica la pared celular, el núcleo y el citoplasma. Dibuja.

3. Coloque una gota de jugo de pera en el portaobjeto, coloque el cubreobjeto. Observe y dibuje.

94


PRÁCTICA 21

Célula vegetal

PREGUNTAS 1. ¿Qué diferencias observaste entre las células de la cebolla y el lirio?

2. ¿Qué función desempeña la pared celular?

3. Enumera algunas diferencias entre la célula animal y la célula vegetal.

95


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

96


Práctica

Sopa eucariótica

22 PROCEDIMIENTO

Localiza en la sopa de letras las siguientes estructuras de las células: EUCARIÓTICAS PARED CELULAR MEMBRANA PLASMÁTICA MEMBRANA NUCLEAR NUCLEOLO CENTRIOLOS NÚCLEO

NUCLEOLO NUCLEOPLASMA CITOPLASMA RETÍCULO ENDOPLASMÁTICO LEUCOPLASTOS CLOROPLASTOS CENTRIOLOS

RIBOSOMAS APARATO DE GOLGI LISOSOMAS VACUOLAS MITOCONDRIAS CROMOPLASTOS CITOESQUELETO

Q W

E

M

E

M

B

R

A

N

A

N

U

C

L

E

A

R

G

B

X

C

R E

J

I

C

U

L

O

E

N

D

O

P

L

A

S

M

A

T

I

C

O

S

Q

S

O

L

O

I

R

T

N

E

C

A

I

Ñ

O

E

L

O

S

E

M

A E

W

V

A

C

U

O

L

A

S

E

R

S

I

T

L

O

C

O

N

A

I

C

Q

N

F

M

K

K

L

L

O

T

F

Q

D

S

I

S

M

T

T

M

R F

Z

U

L

I

N

E

A

A

T

G

S

W

D

A

A

O

D

S

R

S

D

F

C

C

S

F

G

M

S

S

V

C

E

U

L

S

R

E

A

I

A

N S

F

L

S

C

C

S

A

R

A

S

Z

I

U

P

B

M

P

L

O

L

O U

T

E

S

W

A

M

R

O

L

C

B

E

L

O

E

I

E

P

L

P

C G

N

O

S

L

O

Y

E

O

P

Z

U

S

E

M

R

R

S

O

O

O

O F

G

L

P

S

O

L

K

K

O

Z

K

A

S

O

T

O

O

R

S

E

T

S

S

O

O

S

C

P

L

K

C

C

K

O

I

R

A

M

P

O

R

L

I

I

T

B

S

U

D

D

E

E

U

Ñ

R

O

S

C

M

U

A

L

P

C

M I

I

T

N

L

C

I

T

O

E

S

Q

U

E

L

E

T

O

C

M

U

C R

A

C

I

T

A

M

S

A

L

P

A

N

A

R

B

M

E

M

E

N

A A

P

A

R

A

T

O

D

E

G

O

L

G

I

Y

O

P

O

R

S

I

D

97


Actividades Biol贸gicas 10. Talleres y laboratorios

CONCLUSIONES:

98


Práctica

Extracción de ADN

23 INTRODUCCIÓN

El ADN (ácido desoxirribonucleico) permite a los organismos o a las células de un organismo transmitir información con precisión de una generación a otra. El ADN se compone de cuatro nucleótidos, cada nucleótido está formado por tres partes: un grupo fosfato, un azúcar llamado desoxirribosa y una de las cuatro bases nitrogenadas que son adenina, timina, guanina y citosina. El ADN es una molécula muy larga que tiende a agruparse y de allí su facilidad para extraerla.

OBJETIVOS

MATERIALES Y REACTIVOS

• Observar sin la ayuda del microscopio los filamentos del ADN.

• • • • • • • • • • • •

Semillas de lentejas Cebolla Espinaca Jugo de piña o ablandador de carne Alcohol etílico al 95% Una licuadora Un colador Detergente líquido Vasos químicos Varilla de vidrio Sal Tubos de ensayo

PROCEDIMIENTO A. Estudio del ADN en las lentejas 1. Toma media taza de lentejas y ponlas en agua con una pizca de sal por cinco minutos. Todo esto colócalo en una licuadora y procésalo por 15 segundos. Finalmente,

filtra la mezcla resultante para eliminar cualquier partícula de gran tamaño. 2. A la mezcla obtenida agrégale dos cucharaditas de detergente líquido y revuelve suavemente sin formar espuma. Luego

99


Biología 10. Manual de talleres y laboratorios

3.

4.

5.

6.

deja reposar de cinco a diez minutos. Por último, coloca la mezcla en tres vasos químicos. Agrega a cada vaso químico una pizca de ablandador de carne o jugo de piña y revuelve muy despacio. Si lo haces muy rápido tal vez no logres observar nada al final del experimento. Inclina el vaso químico que contiene la mezcla y vierte muy lentamente alcohol etílico al 95%, de modo que se forme una capa sobre la mezcla anterior. Vierte tanto alcohol como mezcla haya en el vaso químico. El ADN comenzará a coagularse como una masa blancuzca y subirá hasta la parte donde está el alcohol. Retíralo con la ayuda de la varilla de vidrio y obsérvalo detenidamente. Describe lo observado. _____________________________________ _____________________________________ _____________________________________ _____________________________________

_____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________ B. Estudio del ADN en la cebolla y hojas de espinaca Repite todo el procedimiento anterior, pero utilizando ahora cebolla y luego espinaca. Observa y anota _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________ _____________________________________

PREGUNTAS 1. ¿Por qué se usó sal al momento de hacer la mezcla inicial? __________________________________________________________________________________ 2.

¿Qué se quería lograr al usar la licuadora? __________________________________________________________________________________

3.

¿Cuál es la función del ablandador de carne o del jugo de piña? __________________________________________________________________________________

4. ¿Cuál es la función del alcohol? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿En cuál de las tres muestras se observó en mayor cantidad el ADN? __________________________________________________________________________________

100


PRテ,TICA 23

Extracciテウn de ADN

CONCLUSIONES:

101


Práctica

Construyamos un modelo de ADN

24 INTRODUCCIÓN

La construcción de un modelo de la molécula de ADN es realizada por los científicos para visualizar la información obtenida de él. Esta observación facilita la comprensión del funcionamiento de dicha molécula.

OBJETIVO

MATERIALES Y REACTIVOS

• Construir el modelo molecular del ADN y relacionar el código genético con su replica.

• • • •

Lápices de colores Tijeras Goma Hojas 81/2  14 pulgadas

PROCEDIMIENTO 1. Elabora tu propio modelo de ADN hasta con nueve nucleótidos con las figuras que aparecen en la hoja adjunta. Resalta el carácter complementario de las purinas pirimidinas. Pinta cada una de sus partes. 2. Construye un modelo de ARNm a partir de la primera cadena de ADN. Pinta los componentes de tu modelo.

103


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. Al darte el siguiente código, ¿podrías predecir a qué base se enlaza cada una? G __________________

A ________________

T __________________

C ________________

2. A continuación, hay una secuencia de bases en una cadena de ADN, ¿cuál sería la secuencia correspondiente de la cadena complementaria? A

T

G

G

T

C

A

G

T

C

3. ¿Cuál es la estructura de una molécula de ADN?

4. ¿Cómo están formados los lados de la molécula de ADN?

5. ¿Cuáles son los componentes de cada nucleótido?

104

G

C

T

A

C


PRÁCTICA 24

Construyamos un modelo de ADN

6. ¿Cuáles son las bases de purina del ADN?

7. ¿Cuáles son las bases de pirimidina del ADN?

8. ¿Cuáles son las letras del código de las bases?

9. ¿Qué mantiene unidas las tiras de la molécula de ADN?

10. ¿Qué aminoácidos codifica la secuencia de nucleótidos de tu modelo?

105


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

106


PRテ,TICA 24

Construyamos un modelo de ADN

C

T G P

A

P

P

C

G

A

T

P

P

C

P

P

P

A U

P

P

T

107


Práctica

Síntesis de proteínas

25 INTRODUCCIÓN

En el núcleo, el ADN contiene instrucciones para hacer miles de proteínas diferentes, recuerda que éste no puede salir del núcleo. Cuando se necesita cierta proteína, se forma el mRNA, de la información que hay en el ADN. El proceso de producir mRNA de las instrucciones del ADN se llama transcripción. El ensamblaje de una molécula de proteína, de acuerdo con el código de una molécula de mRNA, se conoce como traducción porque comprende el cambio del lenguaje de los ácidos nucléicos (sucesión de bases) al lenguaje de las proteínas (sucesión de aminoácidos); al completarse la traducción, la información almacenada en el ADN se expresa como una proteína específica. El código genético se descifró usando mRNA artificiales, el código suele escribirse en términos de los tripletes de bases del mRNA (en lugar de las del ADN) que representan cada aminoácido. Estos tripletes de mRNA se llaman codones y existen 64 codones para formar los 20 aminoácidos esenciales. Los codones de terminación o de “alto” marcan el término de la síntesis de la proteína.

OBJETIVOS

MATERIALES Y REACTIVOS

• Comprender los pasos de la síntesis de proteínas. • Utilizar el código genético para determinar los aminoácidos de una proteína.

• Libro de texto. Código genético

109


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Utilizar el código genético para indicar qué aminoácidos se forman con las combinaciones de las siguientes bases: AAG__________ CUC__________ ACU__________ CCU__________ CAC__________ UUC__________ AUU__________ CGC__________ GUG__________ UGC__________

Isoleucina__________________________

2. Con ayuda del código genético encuentra las combinaciones de bases que forman estos aminoácidos.

Valina______________________________

Leucina_____________________________ Fenilalanina_________________________ Prolina______________________________

Alanina_____________________________ Metionina___________________________ Arginina_____________________________ Treonina____________________________ Serina______________________________

3. Determina la secuencia de aminoácidos a partir de la siguiente cadena del ARN mensajero. • Separa con un guión cada codón. • Escribe el nombre de cada aminoácido. UCAUGCAUACUUCCUAGAUUCGCA

PREGUNTAS 1. ¿Por qué el código genético utiliza tripletes de mRNA en lugar de tripletes de ADN? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Qué indican los codones de terminación o de “alto”? __________________________________________________________________________________ __________________________________________________________________________________

110


PRテ,TICA 25

Sテュntesis de proteテュnas

CONCLUSIONES:

111


Práctica

La mitosis

26 INTRODUCCIÓN

El número de cromosomas de un organismo se mantiene por un proceso de división celular que recibe el nombre de mitosis. La mitosis se lleva a cabo en una serie de etapas consecutivas conocidas como interfase, profase, metafase, anafase y telofase. En las células somáticas, el núcleo se divide por mitosis, de tal manera que cada una de las células hijas resultantes recibe exactamente el mismo número y tipo de cromosomas que la célula madre.

OBJETIVO

MATERIALES Y REACTIVOS

• Demostrar el proceso de mitosis en células vegetales.

• Solución fijadora, acetocarmín. (una parte de ácido acético y tres partes de alcohol etílico al 95%) • Raíces de cebolla • Ácido clorhídrico (molar) • Microscopio • Porta y cubreobjetos • Pinzas • Navajas, cuchilla o bisturí • Mechero

113


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Define los siguientes conceptos:

a. Cariocinesis _______________________________________________________________________ __________________________________________________________________________________ b. Citocinesis ________________________________________________________________________ __________________________________________________________________________________ c. Huso acromático___________________________________________________________________ __________________________________________________________________________________ d. Profase ___________________________________________________________________________ __________________________________________________________________________________ e. Metafase __________________________________________________________________________ __________________________________________________________________________________ f. Anafase___________________________________________________________________________ __________________________________________________________________________________ g. Telofase___________________________________________________________________________ __________________________________________________________________________________

2. Observación de las fases de la mitosis Coloca los bulbos de cebolla en agua por lo menos cinco días antes de realizar el laboratorio. Dibuja su aspecto una vez transcurridos los cinco días.

114


PRÁCTICA 26

La mitosis

• Cuando las raíces hayan llegado de dos a cinco centímetros de largo, corta un centímetro terminal de varias raíces. • Coloca los cortes en la solución fijadora durante 24 horas. • Pasa los fragmentos de raíz en un vaso químico que contiene HCI durante 10 minutos, al final del cual los fragmentos tendrán una consistencia blanda, la cual se puede detectar con una aguja de disección. • Coloca dos gotas de acetocarmín en un portaobjetos. • Transfiere las raíces al portaobjetos. • Con una cuchilla o bisturí corta los fragmentos de raíz en piezas más pequeñas y espera 10 minutos. • Coloca un cubreobjetos sobre la preparación. • Calienta suavemente con el mechero. • Coloca el portaobjetos con la superficie superior invertida sobre un pedazo de papel filtro. • Presiona suavemente sobre la superficie del papel y con este movimiento aplasta la preparación, de manera que las células se dispersen. • Observa al microscopio en 10x y 40x, localiza las fases de la mitosis. Dibuja

115


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Qué es mitosis? __________________________________________________________________________________ 2. ¿Cuáles estadios de la mitosis puedes localizar? __________________________________________________________________________________ 3. ¿En qué etapa se encuentran la mayor parte de las células? __________________________________________________________________________________ 4. ¿Qué tamaño tienen las células al final de la telofase respecto de las otras células? __________________________________________________________________________________ 5. ¿Puedes contar los cromosomas en algunas células? __________________________________________________________________________________ 6. ¿Cuántos cromosomas posee la cebolla? __________________________________________________________________________________ 7. ¿Cuál crees que sea la función del fijador empleado para preparar las placas de cebolla? __________________________________________________________________________________ 8. ¿Cuál es la principal diferencia entre la telofase animal y la vegetal? __________________________________________________________________________________

116


PRテ,TICA 26

La mitosis

CONCLUSIONES:

117


Práctica

La meiosis

27 INTRODUCCIÓN

La reproducción sexual está basada en la formación de gametos que se unen en el momento de la fecundación. Todas las células del adulto provienen de este huevo fecundado y, como él, contienen “n” cromosomas procedentes del óvulo y “n” cromosomas procedentes del espermatozoo. Es decir, contienen dos series homólogas de cromosomas, por lo que se dice que son diploides “2n”. Los gametos, en cambio, contienen solo “n” cromosomas y se llaman haploides (n). La reducción del número de cromosomas que aparecen al final de la gametogénesis ocurre gracias a una forma especial de división celular llamada meiosis.

OBJETIVO

MATERIALES Y REACTIVOS

• Reconocer y comprender la dinámica del proceso de la miosis.

• • • •

Placas fijas de meiosis Microscopio Lápiz Lápices de colores

PROCEDIMIENTO 1. Fases de la meiosis A. Elabora un cuadro sinóptico indicando las divisiones y las fases de la meiosis.

a._______ 1 ______________

b._______ c._______ d._______

____________________

a._______ 2 ______________

b._______ c._______ d._______

119


BiologĂ­a 10. Manual de talleres y laboratorios

B. Dibuja las fases de la meiosis que observes al microscopio y anota sus caracterĂ­sticas.

Fase:_______________

Fase:_______________

Fase:_______________

Fase:_______________

Fase:_______________

120


PRÁCTICA 27

La meiosis

PREGUNTAS 1. ¿Qué es la meiosis? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Qué nombres reciben las células sexuales femenina y masculina? __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Qué son las células haploides? __________________________________________________________________________________ __________________________________________________________________________________ 4. ¿Qué son las células diploides? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿Cuántas divisiones presenta la meiosis? __________________________________________________________________________________ __________________________________________________________________________________ 6. ¿Cuáles son las etapas de la primera división? __________________________________________________________________________________ __________________________________________________________________________________ 7. ¿Cuáles son las etapas de la segunda división? __________________________________________________________________________________ __________________________________________________________________________________ 8. ¿Cuántas células hay al final de la primera división meiótica? __________________________________________________________________________________ __________________________________________________________________________________ 9. ¿Cuántas células hay al final de la segunda división meiótica? __________________________________________________________________________________ __________________________________________________________________________________ 10. ¿Por qué es necesaria la meiosis para la reproducción sexual? __________________________________________________________________________________ __________________________________________________________________________________

121


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

122


Práctica

Mitosis y meiosis

28 INTRODUCCIÓN

Todas las células necesitan reproducirse y para ello realizan divisiones celulares. Todos los organismos eucariotas, con pequeñas diferencias, realizan el proceso conocido como mitosis, donde, a partir de un número diploide (2n) de cromosomas de una célula “madre”, se forman dos células hijas con el mismo número cromosómico, es decir, se mantiene la misma información genética. Este proceso se realiza en organismos unicelulares para poder reproducirse, y se lleva a cabo en los pluricelulares para el crecimiento o reparación de tejidos y órganos. La mitosis forma parte del ciclo celular, donde hay dos periodos, la interfase, dividida en tres fases: G1, S y G2; y la mitosis, que está dividida en cuatro fases: profase, metafase, anafase y telofase. La meiosis es un proceso de división celular que emplean los organismos con sexos distintos para poder reproducirse. A diferencia de la mitosis, aquí las células hijas presentan un número haploide de cromosomas (n), es decir, tan sólo tienen la mitad de la información genética de la célula madre. Las células obtenidas en este proceso reciben el nombre de gametos y son las células sexuales. La meiosis presenta dos divisiones consecutivas que se dividen en fases semejantes a las de la mitosis, sólo que algunas se repiten: profase I, metafase I, anafase I, telofase I, que constituyen la primera división meiótica; sigue una fase llamada intercinesis, similar a la interfase, sin que se dupliquen los cromosomas, y después inicia la segunda división meiótica con la profase II, metafase II, anafase II y telofase II. El número total de células obtenidas es de cuatro.

OBJETIVOS

MATERIALES Y REACTIVOS

• Distinguir el proceso miótico del mitótico, observando las distintas fases en células animales y vegetales en un fotograma. • Establecer diferencias entre la mitosis y la meiosis.

• Libro de texto

123


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Identifica las distintas fases de la mitosis y la meiosis en células vegetales y animales.

Núm. de la célula

Núm. de la célula

Mitosis (fase)

Meiosis (fase)

2. Completa el siguiente cuadro comparativo de la mitosis y la meiosis. Mitosis

Meiosis

Definición Número de cromosomas de las células hijas Número de divisiones Número de células hijas Células donde ocurre

PREGUNTAS 1. ¿Por qué los cromosomas no son visibles durante la interfase? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Por qué es esencial que cada célula resultante de la mitosis reciba exactamente la misma cantidad de material nuclear? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

124


PRÁCTICA 28

Mitosis y meiosis

3. ¿Dónde se encuentran los cromosomas en la célula? ¿Siempre están presentes? __________________________________________________________________________________ __________________________________________________________________________________ 4. ¿Cuál es la función de la mitosis? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿Cuál es la función de la meiosis? __________________________________________________________________________________ __________________________________________________________________________________

CONCLUSIONES:

125


Biología 10. Manual de talleres y laboratorios

Observa las siguientes fotografías. Ordena del 1 a 6, y escribe el nombre a cada una de las fases, de acuerdo con lo que aprendiste en esta práctica.

126

(a)_______________________

(a)_______________________

(a)_______________________

(a)_______________________

(a)_______________________

(a)_______________________


Práctica

El cáncer

29 INTRODUCCIÓN

Todas las partes de un organismo, animal o vegetal, están constituidas por células. Cada célula nace, vive, se multiplica y muere. En principio, la multiplicación celular o mitosis da origen a dos células hijas de cada célula madre. Las características de las células producidas por mitosis son idénticas a las de la célula madre: tienen el mismo número de cromosomas (2n) y el código genético de éstos es igual para todas las células del linaje. Dicho de otro modo, cada una de ellas desempeñará el mismo papel bioquímico, bioenergético y fisiológico de la célula madre, excepto cuando la división corresponde al proceso de diferenciación celular en el desarrollo embrionario. La multiplicación no es indefinida. Un organismo animal en equilibrio no debe tener ni demasiadas ni pocas células sanguíneas, hepáticas, óseas, etcétera. Las células que mueren son sustituidas y las excedentes son destruidas o eliminadas. El organismo es un universo que controla rigurosamente los nacimientos y que, a diferencia de las sociedades humanas, evoluciona como si supiera con precisión cuál debe ser el nivel exacto —cuantitativo y cualitativo— de la demografía celular. ¿Cuáles son los revisores de esta demografía? El jefe de los revisores es el código genético, es decir, el ADN celular. La vigilancia local la ejercen los tejidos orgánicos sanos, que se oponen naturalmente a toda proliferación intempestiva. La regulación general depende de los controles hormonales y del sistema inmunitario. Cuando estos controles fallan por causas que todavía se desconocen en conjunto, se puede ver cómo ciertas células se multiplican anárquica y anormalmente en una región determinada del organismo y se extienden después progresivamente en él, formando en todas partes focos de proliferación anormal. La multiplicación local anormal de las células contribuye a la formación de un tumor. Éste puede ser benigno, es decir, que no provoca ninguna consecuencia grave para la salud del individuo que lo padece, al menos si se cuida de manera apropiada (lobanillos, verrugas, ciertos quistes, etcétera); sin embargo, cuando se extiende, cuando algunas de las células que contiene migran y constituyen otros focos tumorales en el organismo, recibe el nombre de cáncer y se le califica de maligno. La palabra cáncer en latín significa cangrejo (el tumor que se difunde se asemeja a un cangrejo que extiende lentamente las patas). El cáncer es un tumor que tiende a crecer, destruye los tejidos que lo rodean y produce colonias similares en otros lugares del cuerpo. Sin embargo, los especialistas contemporáneos han ampliado el sentido de este término, y hoy ya no se designa al tumor en sí mismo, sino al conjunto de la enfermedad y su evolución: tumor + colonización a distancia + trastornos diversos del organismo en relación con este estado = cáncer.

127


Biología 10. Manual de talleres y laboratorios

OBJETIVO • Determinar la relación entre el cáncer y el proceso mitótico.

PROCEDIMIENTO 1. Analiza la lectura y contesta las preguntas.

128


PRÁCTICA 29

El cáncer

PREGUNTAS 1. ¿Cómo definirías el cáncer? Enumera algunos tipos de cáncer que hayas oído mencionar.

2. ¿Qué procedimientos médicos se utilizan para controlar el cáncer?

3. ¿Qué instituciones de tu región luchan contra este terrible mal?

4. ¿Hay mecanismos de prevención del cáncer?

129


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

130


Práctica

Las leyes de la probabilidad

30 INTRODUCCIÓN

La probabilidad es el estudio de la forma como operan las leyes del azar; el azar se refiere a la posibilidad de que ocurra determinado evento. Por ejemplo, obtener “sello” al tirar una moneda al aire. Probabilidad =

Número de veces que ocurre un evento Número total de eventos posibles

Cuando tiramos una moneda al aire puede que caiga cara o sello, un total de dos eventos, por lo que hay una probabilidad en dos posibles eventos de que caiga sello (1/2). En genética se usan dos principios importantes en la probabilidad: 1. Regla de eventos independientes: los eventos que ya ocurrieron no afectan la probabilidad de que pueda ocurrir uno de esos mismos eventos. 2. La regla del producto: la probabilidad de que ocurran a la vez eventos independientes es el producto de las probabilidades de que esos eventos ocurran por separado.

OBJETIVO

MATERIALES Y REACTIVOS

• Demostrar las leyes de la probabilidad.

• • • •

Dos monedas Cinta adhesiva Tijeras Papel

131


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Trabaja con un compañero o compañera. Lanza al aire dos monedas al mismo tiempo. 2. Lanza las monedas 10 veces, luego 50 y después 100 y anota los resultados. Determina el número de caras y sellos obtenidos (razón). Tabla 1

Número de lanzadas al aire

cara /cara

cara/sello

sello/sello

10 50 100

3. Corta cuatro pedazos de cinta adhesiva del tamaño de las monedas y cubre cada una de sus caras. En un lado escribe T mayúscula y en la otra t minúscula. Imagina que T representa plantas de guisantes altas y t plantas bajas. 4. Lánzalas al aire al mismo tiempo, 10, 50 y 100 veces. Registra los resultados en la Tabla 2. Tabla 2

Número de lanzadas

TT

Tt

tt

10 50 100

Al lanzar dos monedas estás representando el cruce entre dos plantas de guisantes híbridas, como en el cruce de la generación filial 1 de Mendel.

132


PRÁCTICA 30

Las leyes de la probabilidad

PREGUNTAS 1. ¿Cómo funciona la Ley de la Probabilidad? __________________________________________________________________________________ __________________________________________________________________________________ 2. Determina el fenotipo y el genotipo del procedimiento 3. __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Cuál es la razón dominante al lanzar las monedas? __________________________________________________________________________________ __________________________________________________________________________________ 4. ¿Cuál es la razón dominante al lanzar las monedas con las letras? __________________________________________________________________________________ __________________________________________________________________________________ 5. ¿Cómo relacionas esta experiencia con las leyes de Mendel? __________________________________________________________________________________ __________________________________________________________________________________ 6. Elabora un cuadro de Punnett para el procedimiento 3. __________________________________________________________________________________ __________________________________________________________________________________ 7. ¿Qué fenotipo poseen los descendientes? __________________________________________________________________________________ __________________________________________________________________________________ 8. Diferencia fenotipo de genotipo. __________________________________________________________________________________ __________________________________________________________________________________

133


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

134


Práctica

Las leyes de la herencia

31 INTRODUCCIÓN

Todo ser vivo, planta o animal, microbio o ser humano, posee características heredadas de uno o dos progenitores, según sea el caso. Desde el principio de la historia las personas han tratado de comprender cómo se transmite la herencia de una generación a la otra. El trabajo del monje austriaco Gregorio Mendel tuvo particular importancia para comprender la herencia biológica. Sus trabajos de investigación lo llevaron a sacar dos conclusiones: la primera fue que la herencia biológica está determinada por factores que se transmiten de una generación a la siguiente; y la segunda es conocida como el principio de la dominancia. Los principios de Mendel son la base de la ciencia de la Genética.

OBJETIVO • Conocer el principio de transmisión y expresión de los caracteres hereditarios.

PROCEDIMIENTO I.

Gregorio Mendel al trabajar con flores de chícharos utilizó factores o genes contenidos en los gametos.

1. Escribe con qué otros nombres se conoce a los gametos.

y 2. La letra minúscula simboliza que el factor es

135


Biología 10. Manual de talleres y laboratorios

3. Anota cuál color será dominante en la flor del siguiente ejercicio, si el factor G expresa color verde de las flores y la g flores amarillas. Datos G

= verde

g

= amarillas

Factores

Color dominante

GG Gg gg

II. Primera ley de Mendel Anota los datos que se solicitan en los espacios vacíos. Gametos  G Gametos 

G

g

F1

g Primera generación filial 1. Anota cuál color se ocultó o se convirtió en recesivo.

2. En la generación F1, ¿qué color fue dominante?

3. ¿Qué proporciones se encontraron?

El siguiente cuadro nos ayudará para responder el comportamiento de la generación F2 ; anota los resultados de los cruces que se solicitan. Gametos G Gametos

g

G g Segunda generación filial

136

F2


PRÁCTICA 31

Las leyes de la herencia

4. ¿Qué proporciones aparecen ahora?

5. ¿Cuáles colores se expresaron?

III. Segunda ley de Mendel 1. Ahora estudiaremos la herencia expresada por dos o más factores contenidos en un gameto.

2. Examina la distribución de dos caracteres en las generaciones F1 y F2 en el chícharo, donde la generación P1 es una variedad de semilla lisa (LL) y redonda (RR), con una variedad de semilla rugosa (ll) y alargada (rr).

Generación P1

Semilla

Semilla

Fenotipo

Lisa redonda

Rugosa alargada

Genotipo

LLRR

llrr

Gametos

LR

lr

3. Con la información anterior resuelve el siguiente cuadro:

F1

Gametos

Gametos

lr

LR

LR

lr 4. Anota las características que a continuación se te indican. Básate en el cuadro anterior, de la Generación P1 . Proporciones fenotípicas: _____________________________ Proporciones genotípicas: ____________________________ Gametos: ____________________________ Generación F2 Gametos:

137


Biología 10. Manual de talleres y laboratorios

5. Escribe las siguientes características: Proporciones fenotípicas

______________________________________________________ ______________________________________________________ ______________________________________________________

Proporciones genotípicas

______________________________________________________ ______________________________________________________ ______________________________________________________

CONCLUSIONES: CONCLUSIONES:

138


Práctica

Genética, dominancia y recesividad

32 INTRODUCCIÓN

Los genetistas consideran al organismo individual como depósito temporal de una colección de genes ordenados. No es fácil estudiar la herencia en el hombre, ya que sus cruzamientos son a voluntad, sus descendientes escasos (desde el punto de vista genético) y el tiempo entre generación y generación bastante largo. Así, se ha recurrido a estudios estadísticos y a la genética de las poblaciones. Sin embargo, en la citología de los humanos se ha adelantado bastante y se han desarrollado técnicas como el ideograma o cariotipo.

OBJETIVO

MATERIALES Y REACTIVOS

• Conocer las características hereditarias ligadas al sexo.

• Ejemplar de estudio (alumnos)

PROCEDIMIENTO Herencia ligada al sexo 1. La especie humana posee 46 cromosomas distribuidos de la siguiente forma: 22 pares de autocromosomas y uno de heterocromosomas (XX para la hembra y XY para el macho). 2. Analiza el diagrama de cruces genéticos y resuélvelo. (Recordemos que en el cruce de hombre-mujer, un solo gene de cada uno formará parte del nuevo ser.)

139


Biología 10. Manual de talleres y laboratorios

Óvulos

Espermatozoides Figura 1

Mujer X X

X

X

X

XX

XX

Y

XY

XY

3. Observa la figura 1. Contesta las preguntas y realiza las actividades que se indiquen.

X X Óvulos

5. ¿Cuál de los cromosomas ligados al sexo es el de menor tamaño?

6. Los cromosomas XY son para el varón, ¿qué letras corresponden a la mujer?

4. En la figura 2 encierra con un círculo rojo los cromosomas correspondientes a la mujer y con azul los del varón.

Ideogramas  y  en humanos

Figura 2

140

Hombre X Y X Y Espermatozoides


PRÁCTICA 32

7. De los cruces obtenidos en el cuadro anterior, ¿qué cantidad en porcentaje se formó. de XX

____________%

y de XY

____________%

Genética, dominancia y recesividad

Analiza con tu equipo los resultados anteriores y compáralos con la versión de que nacen más mujeres que hombres. Anota tu conclusiones.

8. El cromosoma X alberga gran cantidad de genes, y el cromosoma Y genéticamente está casi vacío; en realidad es un cromosoma en trance de regresión. Manifestación de un gene dominante 1. La presencia de un gene dominante permite abarquillar la lengua; por el contrario, las personas que sólo tienen el gen no dominante o recesivo son incapaces de hacerlo.

Labio

2. ¿Puedes abarquillar tu lengua con facilidad?

3. Realiza un estudio estadístico de cuántos alumnos del grupo abarquillan su lengua. Esta será una muestra representativa.

Lengua

Ejemplo: se realizó una encuesta de lengua abarquillada en una población de 100 personas y se obtuvieron los siguientes resultados: 64 abarquillaban la lengua y 36 no. Se anotó y se calcularon los porcentajes correspondientes.

Anota cuántos son: ___________ 4. Mediante una encuesta directa con los resultados de cada uno de los equipos del grupo, contesta los datos que se piden en el siguiente cuadro:

Características

Lengua abarquillada Lengua no abarquillada

Ejemplo

Población

Población 100 personas

______ personas

Núm.

Núm.

%

%

72 18

Cuadro 1. Porcentaje de la frecuencia del gene que expresa lengua abarquillada.

141


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

142


Práctica

Cromosomas sexuales femeninos

33 INTRODUCCIÓN

Los cromosomas son estructuras celulares que se localizan en el núcleo; están formados por cromatina y sólo son visibles durante la división celular. En la especie humana existen 46 cromosomas, agrupados en 23 pares; 22 de ellos se denominan autosomas y el último es el par sexual. Los cromosomas sexuales determinan el sexo de los individuos. El sexo masculino está determinado por la presencia del par sexual denominado cromosomas XY y el femenino por un par de cromosomas XX. Uno de los cromosomas sexuales femeninos, denominado cuerpo de Barr, se puede observar en preparaciones de células de la mucosa bucal de las mujeres. Es una estructura ovoide adherida a la membrana nuclear, teñida de un color más oscuro que el resto del núcleo.

OBJETIVO

MATERIALES Y REACTIVOS

• Identificar la presencia de cromosomas sexuales en la mucosa bucal femenina.

• • • • • • • • • • •

Palillos de dientes Portaobjetos Cubreobjetos Microscopio 10 ml de colorante acetato de orceína 10 ml de solución de alcohol al 50% 10 ml de colorante verde de Janus 20 ml de alcohol etílico 1 gotero Lápices de colores 10 ml de solución de alcohol al 95% previamente filtrado • Aceite de inmersión

143


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO

1. Con un palillo, efectúa un raspado de atrás hacia adelante en la parte interna de la mejilla.

cuado. Vierte sobre la preparación una gota de aceite de inmersión y cambia al objetivo de mayor aumento.

2. Extiende el raspado bucal de abajo hacia arriba en el portaobjetos como si realizaras un frotis.

7. Observa cuidadosamente y verás los cuerpos de Barr en la periferia de cada núcleo celular como puntos de color lila. Dibújalos y coloréalos.

3. Agrega cuatro gotas de alcohol al 95%; procura que cubra perfectamente la preparación y espera diez minutos. Después hidrata la preparación, añadiendo cuatro gotas de alcohol al 50% y aguarda cinco minutos. 4. Incorpora a la preparación cinco gotas de acetato de orceína y deja transcurrir ocho minutos; lava la preparación con agua para eliminar el exceso de colorante. 5. Coloca cuatro gotas de colorante verde de Janus (de contraste), espera un par de minutos y lava de nuevo la preparación para retirar el exceso de colorante. Deja secar al aire. 6. Acomoda la preparación en el microscopio y obsérvala con el objetivo de menor aumento; localiza un campo visual ade-

144


PRÁCTICA 33

Cromosomas sexuales femeninos

PREGUNTAS 1. ¿Cuáles son los cromosomas sexuales femeninos? __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Qué nombre recibe cada uno de los cromosomas sexuales femeninos? __________________________________________________________________________________ __________________________________________________________________________________

CONCLUSIONES:

145


Práctica

Variaciones sobre el tema mendeliano

34 INTRODUCCIÓN

De acuerdo con lo estudiado de las leyes de Mendel (principios mendelianos), podríamos pensar que siempre hay dos posibles alelos para cada gen y que un alelo es completamente dominante sobre el alelo recesivo. Sin embargo, esto no es así, si Mendel hubiera estudiado otras características y no las que seleccionó, se habría encontrado con que casi todas las características son influidas en formas más variadas y sutiles. Hoy se conoce que se dan otros tipos de herencia, que no responden a las leyes mendelianas (herencia no mendeliana), como la herencia con dominancia incompleta o codominancia y los alelos múltiples de un solo gen.

OBJETIVO

MATERIALES Y REACTIVOS

• Comprobar que la mayor parte de los rasgos esta sujeta a influencias variadas y sutiles.

• Regla • Lápiz

PROCEDIMIENTO 1. En la dominancia incompleta, el fenotipo de los heterocigotos es intermedio entre los fenotipos de los homocigotos. Por ejemplo, en las plantas “buenas tardes” al cruzar plantas de flor roja (RR) con homocigotos de flor blanca (rr), los híbridos (Rr) son de flor rosada. ¿Qué ocurre al cruzar plantas de buenas tardes rosadas entre sí? Realiza el cruce como si se tratara de un monohíbrido ordinario. Indica el fenotipo para el probable retoño. Analiza la representación esquemática del cruce antes descrito. R = flor roja Cruce:

r = flor blanca homocigoto dominante RR

Gametos

®

homocigoto recesivo X

®

rr r

r

147


Biología 10. Manual de talleres y laboratorios

Cuadro de Punnett r

r

R

Rr

Rr

Genotipo: 100% heterocigoto

R

Rr

Rr

Fenotipo: 100% flor rosada

Autocruce (las plantas de la F1 entre sí) Cruce:

heterocigoto Rr R

Gametos:

X

heterocigoto Rr

r

R

r

Cuadro de Punnett R

r

R

RR

Rr

r

Rr

rr

Genotipo: 25% homocigoto dominante, 50% heterocigoto y 25% homocigoto recesivo. Fenotipo: 25% flor roja, 50% flor rosada y 25% flor blanca.

La dominancia incompleta es una forma en que se manifiesta este tipo de herencia, pero también se puede evidenciar como una codominancia, en la cual los dos fenotipos serán visibles. Un ejemplo de esta situación la representan los tipos sanguíneos humanos, en que el fenotipo resultante no es una mezcla de los fenotipos de los progenitores, sino que ambos alelos ejercen su dominio; este comportamiento recibe el nombre de codominancia. Por eso encontramos personas cuyo grupo sanguíneo es AB. 2. Alelos múltiples, muchas variantes para un mismo gen. El fondo genético, poza o acervo de genes de una población, es el conjunto total de los alelos de todos los genes en una población. Si en un fondo común de genes existen más de dos alelos para una determinada característica, se habla de polimorfismo genético o de alelos múltiples. Una de las formas más sencillas de evidenciar este fenómeno es el tipo sanguíneo. ¿Cuántos tipos sanguíneos existen en tu aula de clases?

Los tipos sanguíneos A, B, AB y O son el resultado de tres alelos diferentes de un mismo gen, generalmente designado como 1A, 1B e i. Con la simbología anterior podrías indicar cuáles son alelos dominantes y cuáles son recesivos.

148


PRÁCTICA 34

Variaciones sobre el tema mendeliano

El alelo 1A determina la síntesis de glucoproteína A, el alelo 1B determina la síntesis de glucoproteína B que sobresalen en la superficie de los eritrocitos, pero el alelo i no produce la síntesis de glucoproteínas. Determina los seis probables genotipos de la combinación de estos tres alelos. Utiliza la simbología IA IA, IB IB.

Los alelos IA e IB son codominantes uno con el otro y dominantes ante i. Lo anterior, ¿qué quiere decir?

Las glucoproteínas de los eritrocitos pueden reaccionar con anticuerpos en el plasma sanguíneo. Si una persona, por ejemplo, con el tipo sanguíneo A recibe una transfusión de sangre tipo B, los anticuerpos anti-B hacen que las células de tipo sanguíneo A se aglutinen, y se mantienen unidas por los anticuerpos tipo B. Estas aglutinaciones pueden formar coágulos, de consecuencias médicas graves. Analice el siguiente cuadro con información de donadores y receptores de sangre de acuerdo con el tipo sanguíneo. ¿Por qué el tipo sanguíneo AB es el receptor universal y el tipo O el donador universal? Donadores y receptores de sangre en transfusiones Grupo del donador A B AB

O

Grupo permitido del receptor A AB B AB AB A B AB O

149


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Cuáles son las probables combinaciones genotípicas de la descendencia de una pareja conformada por un hombre de tipo sanguíneo O y una mujer de tipo AB? 2. ¿Cuáles son las probables combinaciones genotípicas de la descendencia de una pareja conformada por un hombre de tipo sanguíneo A, hijo de un hombre AB y una mujer O; y una mujer de tipo B, hija de un hombre tipo O y una mujer B? Recuerda que el tipo ii corresponde a un homocigoto recesivo e IA IB a codominancia. 3. Un hombre antepone una demanda de divorcio alegando que el tipo sanguíneo B del tercer hijo de su esposa no es suyo, puesto que sus dos hijos anteriores son de tipo A, igual al de él. Para la verificación, los microbiólogos determinan el tipo sanguíneo de los padres del hombre, establecido que el padre es A y la madre es O. La esposa es de tipo sanguíneo B, tiene un hermano de tipo A y una hermana de tipo B, su padre es AB y su madre es O. ¿Es el niño hijo del esposo de la mujer? Respalda tu respuesta con el cuadro de Punnett para el cruce respectivo. 4. Otro tipo de proteína presente sobre los eritrocitos es el factor Rh (Rhesus). Si se encuentra presente, la sangre se describe como Rh positiva (Rh+); y si la proteína está ausente, la sangre es Rh negativo (Rh–). El factor Rh+ es una característica genética dominante. Practica con la información anterior, tanto de factor como de tipo sanguíneo, el siguiente cruce dihíbrido y determina las probables combinaciones genotípicas y fenotípicas de la descendencia. Una mujer doble homocigota dominante tipo sanguíneo A y Rh+ y un hombre doble heterocigota tipo sanguíneo B y Rh+.

CONCLUSIONES: CONCLUSIONES:

150


Práctica

Problemas de genética

35 INTRODUCCIÓN

Los principios de la genética clásica fueron establecidos por Gregorio Mendel al realizar sus famosos experimentos de entrecruzamiento de plantas. De estos estudios, Mendel concluyó que cada carácter en particular está controlado o determinado por un par de genes. A los genes alternativos de una característica se les da el nombre de alelos. Cuando se cruzan individuos homocigóticos que tienen alelos alternativos para una misma característica, se produce un híbrido que presenta una sola de las características alternativas para esa característica (la dominante, la cual enmascara la expresión de los alelos recesivos). Primera Ley de Mendel: El enmascaramiento de alelos recesivos dará por resultado organismos con un mismo fenotipo pero diferente genotipo. De acuerdo con la Segunda Ley de Mendel, de la segregación, cada gameto recibe sólo un alelo de los genes del organismo. Los dos alelos de un gen se segregan uno del otro en la meiosis. Cuando un espermatozoide fecunda un óvulo, la progenie resultante recibe un alelo del padre y uno de la madre. Con frecuencia, un genetista debe analizar la herencia de dos o más rasgos en el mismo grupo de individuos. La Tercera Ley de Mendel, ley de la distribución independiente de los caracteres sostiene que los alelos de un rasgo se distribuyen a los gametos con independencia de los alelos de los otros rasgos.

OBJETIVOS

MATERIALES Y REACTIVOS

• Determinar los genotipos y fenotipos resultantes de la combinación de gametos en el zigoto. • Determinar las razones o proporciones fenotípicas resultantes.

• Libro de texto

151


BiologĂ­a 10. Manual de talleres y laboratorios

PROCEDIMIENTO A. Define los siguientes conceptos:

1.

Alelo: _____________________________________________________________________________ __________________________________________________________________________________

2. Recesivo: _________________________________________________________________________ __________________________________________________________________________________ 3. Dominante:________________________________________________________________________ __________________________________________________________________________________ 4. Fenotipo:__________________________________________________________________________ __________________________________________________________________________________ 5. Genotipo: _________________________________________________________________________ __________________________________________________________________________________ 6. Homocigoto:_______________________________________________________________________ __________________________________________________________________________________ 7. Heterocigoto: ______________________________________________________________________ __________________________________________________________________________________ 8. Puro: _____________________________________________________________________________ __________________________________________________________________________________ 9. HĂ­brido: ___________________________________________________________________________ __________________________________________________________________________________ 10. Cuadro de Punnett: ________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

152


PRÁCTICA 35

Problemas de genéticas

B. Resuelve cada uno de los problemas que se plantean a continuación en F1 y F2, indicando el genotipo y fenotipo en cada caso. 1.

Si una planta homocigótica de tallo alto (AA) se cruza con una planta homocigótica de tallo enano (aa), recordando que el tallo alto es dominante sobre el tallo enano. ¿Cómo serán los genotipos y fenotipos de la F1 y de la F2? F1

Genotipo________________ Fenotipo______________________

F2

Genotipo________________ Fenotipo______________________ Genotipo________________ Fenotipo______________________ Genotipo________________ Fenotipo______________________

153


Biología 10. Manual de talleres y laboratorios

2. Encuentra las proporciones fenotípicas y genotípicas de un cruce de un tallo alto con semillas amarillas (TTAA) con un tallo enano con semillas verdes (ttaa) En F1 y F2: F1

Genotipo________________ Fenotipo______________________

F2

Genotipos: __________________________________________________________________________________ __________________________________________________________________________________

Fenotipos: __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

Proporción fenotípica: __________________________________________________________________________________ __________________________________________________________________________________

154


PRテ,TICA 35

Problemas de genテゥtica

CONCLUSIONES:

155


Práctica

Hominización

36 INTRODUCCIÓN

El hombre y su proceso evolutivo. En su clasificación de los seres vivos, Linneo (1707-1778) consideró al hombre como una especie del Reino Animal: Homo sapiens. Un siglo después, Darwin (1809-1882) escandalizó a gran parte de los sabios de su época al sentar las bases de la moderna concepción evolucionista de la vida con la publicación de El Origen de las Especies (1859) y del origen de la especie humana en su obra El Origen del Hombre (1871). La polémica suscitada al respecto tuvo amplia resonancia en la opinión pública debido a que, las ideas evolutivas en general, y las del origen del hombre en particular, no afectaban tan sólo al pensamiento científico, sino que sus consecuencias incidían también en la filosofía de la época. Se trataba de la concepción que el hombre tenía de sí mismo. Y, si en el periodo del Renacimiento, la Tierra había dejado de ser el centro del Universo para convertirse en un simple planeta del Sistema Solar, ahora el hombre ya no se consideraba un ser aparte, sino el resultado de un proceso evolutivo regido por los mismos mecanismos que han llevado a todas las especies vivientes a su estado actual. Esta concepción evolucionista del origen del hombre ha encontrado su soporte material en diversas ramas del conocimiento biológico: la paleontología, la anatomía comparada, la embriología, la bioquímica, la serología, la fisiología, la etología, e incluso, la parasitología, que han aportado pruebas para aquellas ideas revolucionarias del siglo pasado que habían situado correctamente al hombre en el lugar que le corresponde en la naturaleza. La especie humana, tal como la conocemos en la actualidad, es resultado de un largo proceso de evolución biológica y cultural, que podría explicarse fundamentalmente por la acción combinada de los siguientes mecanismos: mutación, selección natural, derivación genética, migración, flujo genético, consanguinidad y matrimonios selectivos. La evolución es un proceso biológico que nos obliga a considerar la variabilidad humana en el tiempo. ¿En qué momento aparece la especie humana? ¿Cómo se ha llegado al estado actual? Para responder estas preguntas, los antropólogos estudian el proceso de hominización. Las pruebas de este proceso están constituidas por restos fósiles pertenecientes a distintas épocas y con características también distintas. Los diferentes rasgos esqueléticos se comparan entre sí y con otras especies de primates, además de con el hombre actual. También se intenta conocer a qué época pertenecieron (datación) y se estudian sus utensilios para inferir el desarrollo cultural de quienes los fabricaron.

157


Biología 10. Manual de talleres y laboratorios

OBJETIVOS

MATERIALES Y REACTIVOS

• Estudiar la evolución de los rasgos anatómicos craneales en el proceso de hominización. • Analizar la variabilidad del hombre en el tiempo.

• Perfiles de cráneos de hombres de diferentes épocas • Cinco acetatos • Cinco lápices de colores • Una hoja milimétrica

PROCEDIMIENTO 1.

Se estudiarán los caracteres descriptivos del cráneo de estos fósiles por ser el componente esquelético que ha sufrido los cambios relativamente más importantes a lo largo del proceso de hominización y porque alberga al cerebro, lo que hace que la capacidad craneal y el volumen cerebral estén íntimamente relacionados. En el cráneo pueden considerarse las siguientes partes:

NEUROCRÁNEO

Cráneo

ESPLACNOCRÁNEO (O CARA)

MANDÍBULA

2. En esta práctica se adjuntan una serie de perfiles a escala natural representativos del Australopithecus africanus, Homo erectus, H. sapiens neanderthalensis, H. sapiens fossilis, y del hombre actual.

3. Se calcarán los cinco perfiles del siguiente modo: primero el perfil correspondiente al hombre actual y se unirán los puntos G e I mediante una recta. Después, y sobre el mismo papel, se hará lo mismo con los demás perfiles haciendo coincidir los puntos G (glabela: punto más prominente de la región interciliar de la frente) y situando a los puntos /(inion: punto más prominente de la protuberancia occipital externa) sobre la recta que pasa por G e I trazada anteriormente. La utilización de colores diferentes para los distintos perfiles contribuirá a una mejor comprensión del dibujo. También si se desea se pueden superponer, en hojas aparte, los perfiles de dos en dos.

158


PRÁCTICA 36

Hominización

4. Una vez realizada la superposición de perfiles, responde las siguientes preguntas. A partir de los datos de la tabla, construye una gráfica de la evolución de la capacidad craneal. ¿En qué punto se observa una inflexión importante en la gráfica? Interpreta dicha gráfica. 5. Evolución de la capacidad craneal.

PROSIMIOS SIMIOS DRIOPITECOS AUSTRALOPITECOS H. HABILIS PITECANTROPOS H. SAPIENS

Millones de años 70 40 20 4 2,5 0,5 0

Capacidad craneal 50CC 80 175 550 675 1000 1500

PREGUNTAS 1.

¿Qué ocurre con el prognatismo (proyección hacia adelante de la cara) en el proceso de hominización? __________________________________________________________________________________ __________________________________________________________________________________

2. Compara los arcos superciliares en todos los perfiles, ¿qué puede decirse de este carácter anatómico después de la observación de los distintos estadios evolutivos? __________________________________________________________________________________ __________________________________________________________________________________ 3. ¿Qué aspecto presenta el occipital del Hombre de Neandertal? __________________________________________________________________________________ __________________________________________________________________________________ 4. Observando el neurocráneo y esplacnocráneo (cara) en cada uno de los estadios evolutivos, ¿qué se puede decir de la relación entre el tamaño del cráneo y el de la cara (relación neurocráneo/esplacnocráneo) a lo largo de la hominización? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 5. Observa en cada caso el hueso frontal, ¿Qué podemos decir de su inclinación? __________________________________________________________________________________ __________________________________________________________________________________

159


Biología 10. Manual de talleres y laboratorios

6. ¿Qué implica lo anterior con respecto a la capacidad craneal? __________________________________________________________________________________ __________________________________________________________________________________ 7. ¿Puede existir alguna relación entre la capacidad intelectual y los distintos grados de inclinación del frontal? Explica (recuerda la función de los lóbulos frontales del cerebro). __________________________________________________________________________________ __________________________________________________________________________________ 8. Valora (de 1 a 5) todos los caracteres en cada uno de los estadios de la hominización. PROGNARELACIÓN TISMO CRÁNEO/CARA

ARCOS SUPER- INCLINACIÓN CAPACIDAD CILIARES DEL FRONTAL CRANEAL

AUSTRALOPITECO PITECANTROPO NEANDERTAL CROMAÑÓN ACTUAL

9. Compara los caracteres anteriormente considerados entre el chimpancé y otros simios y el hombre actual. ¿Cuáles están más desarrollados en cada una de las especies? ¿Cuáles lo están menos? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 10. Observa el esquema “Filogenia de los Primates” ¿puede decirse que el hombre “desciende” del chimpancé o de algún otro mono actual?, ¿qué sentido puede tener el dicho de que “el hombre desciende del mono”? __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

160


PRテ,TICA 36

Hominizaciテウn

CONCLUSIONES:

161


BiologĂ­a 10. Manual de talleres y laboratorios

1. Hombre actual. (H. sapiens)

2. Australopiteco (A. Africanus)

162


PRテ,TICA 36

Hominizaciテウn

3. Pitecantropo (H. erectus)

4. Neandertal (H. sapiens neanderthalensis)

163


Biología 10. Manual de talleres y laboratorios

5. Cromañón (H. Sapiens fossilis)

164


Práctica

Evidencias de la evolución

37 INTRODUCCIÓN

La evolución es considerada por los biólogos como un hecho; es un proceso de cambio mediante el cual se forman nuevas especies a partir de especies preexistentes. Existen muchas pruebas o evidencias que confirman que las diferencias que se aprecian entre los organismos han sido producto del proceso evolutivo, originadas por la necesidad que los organismos han tenido de adaptarse al medio.

OBJETIVO

MATERIALES Y REACTIVOS

• Identificar las evidencias de la evolución.

• • • •

Libro de texto Figuras de las evidencias Tijeras Goma

PROCEDIMIENTO 1. Define los siguientes conceptos a. Evolución: ______________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ b. Fósil: __________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________

165


Biología 10. Manual de talleres y laboratorios

c. Estructura homóloga: ___________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ d. Estructura análoga: _____________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ e. Estructura vestigial: _____________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ __________________________________________________________________________________ 2. Completa el mapa conceptual sobre evolución e ilustra cada evidencia

Evolución es

Evidencias

ejm

ejm

Figura

166

Figura

como

Figura

como

Figura


PRÁCTICA 37

Evidencias de la evolución

PREGUNTAS 1. ¿Cuál es la ciencia que estudia los fósiles? 2. Menciona algunas estructuras semejantes en el desarrollo embrionario de varias especies. 3. ¿Qué estudia la embriología? 4. Define qué es evolución convergente. 5. ¿Qué evidencias anatómicas puedes mencionar? 6. ¿Cuáles son las diferencias entre las estructuras homólogas y las análogas?

CONCLUSIONES:

167


Práctica

Selección natural

38 INTRODUCCIÓN

La selección natural es el proceso propuesto por Charles Darwin, en ella explica que los organismos están sometidos a diferentes presiones ambientales —factores físicos como luz, presión, temperatura, relieve topográfico—, y existe una competencia entre individuos de la misma especie por el alimento y espacio para poder reproducirse. Debido a esto, Darwin pensaba que aquéllos que presentaban mejores adaptaciones (características físicas, fisiológicas o de comportamiento heredadas que facilitan su supervivencia) a su ambiente, tenían mayor probabilidad de desarrollarse y reproducirse para mantener su información genética como especie. Aquellos que no presentaran o desarrollaran dicha capacidad, no podrían reproducirse o sus descendientes representarían una pequeña proporción de la población. Es importante mencionar que Darwin no pensaba en la supervivencia de un solo individuo, sino en la de varios organismos de una población. La especiación son los cambios que se presentan en una población a lo largo del tiempo, y se pueden mantener o no, pues varían según las presiones de selección que existan en un momento dado, así tenemos distintos estados de la población y este proceso da origen a nuevas especies.

OBJETIVOS

MATERIALES Y REACTIVOS

• Demostrar, con ayuda de una simulación, uno de los mecanismos de la selección natural. • Comprender cómo una característica de los organismos de una población permite predecir su supervivencia y las variaciones que tendrán a lo largo del tiempo.

• • • • •

Cuaderno de notas 2 pliegos de papel periódico 1 hoja de papel blanco 1 hoja de papel negro u oscuro Tijeras

PROCEDIMIENTO 1. Recorta uno de los pliegos de papel periódico en cuadrados de 3  3 cm, haz lo mismo con las hojas de papel negro y papel blanco. Con 35 piezas de cada color de papel será suficiente. Cada tipo de papel representa una “especie” distinta.

2. Extiende el pliego de papel periódico restante y empléalo como ambiente, coloca al azar todos los recortes de papel en la superficie, trata de distribuirlos de manera homogénea y que no queden amontonados en un solo lugar.

169


Biología 10. Manual de talleres y laboratorios

3. Para realizar la práctica, tú y tus compañeros actuarán el papel de “depredadores”, para esto deberán colocarse de espaldas al pliego de papel, voltear rápidamente y tomar el primero de los recortes que vean. Cada uno hágalo 5 o 10 veces. Registra los datos de “organismos capturados” en la siguiente tabla:

“Depredador”

“Animales blancos”

4. Calcula el número de “organismos” sobrevivientes de cada especie y de la población total, trata de predecir qué ocurrirá en la siguiente generación, qué tipo de especie tendrá más organismos. Compara los resultados de tu equipo con el resto del salón y trata de explicar las diferencias.

“Animales negros”

“Animales manchados”

#1

#2

PREGUNTAS 1. Según los resultados del experimento, ¿qué tipo de “animales” sobrevivieron en mayor proporción? Explica por qué. 2. Da algunos ejemplos que se dan en forma semejante en la naturaleza. 3. Si el ambiente (el papel periódico) fuera cambiando a un color más oscuro, ¿habría cambios en la frecuencia poblacional? ¿Por qué?

170


PRテ,TICA 38

Selecciテウn natural

CONCLUSIONES:

171


Práctica

Adaptaciones al ambiente

39 OBJETIVO

MATERIALES Y REACTIVOS

• Analizar las diferencias que presentan los organismos en sus estructura.

• Figuras de las semillas de tomate, caoba, guayacán y coco • Figuras de los siguientes animales, avestruz, pato, garza, pelícano, halcón, águila, guacamaya, azulejo y palomino

PROCEDIMIENTO A. Recorta y pega en el espacio correspondiente las semillas que se te piden.

Tomate

Guayacán

Caoba

Coco

173


Biología 10. Manual de talleres y laboratorios

Anota la información que se te solicita.

Nombre de la semilla

Característica morfológica que presenta

Forma de dispersión o propagación

Cuadro No. 1. Características de las semillas.

B. Recorta y pega los picos de las aves que se te piden en el siguiente cuadro.

Garza

Águila

Pelícano

Halcón

Cuadro No. 2. Las características de las formas de los picos.

Nombre del ave

174

Característica morfológica que presenta

Alimento que consume


PRÁCTICA 39

Adaptaciones al ambiente

C. Recorta y pega las patas de las aves que se te solicitan en el siguiente cuadro.

Pato

Avestruz

Águila

Azulejo

Palomino

Guacamaya

Cuadro No. 3. Características de las formas de las diferentes patas.

Nombre de las aves

Formas de las patas

Características o morfológicas

Función de la estructura

175


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. Explica, utilizando un ejemplo, qué entiendes por adaptación morfológica.

2. Explica qué entiendes por adaptación fisiológica.

3. Explica cuál es el papel biológico o importancia de las semillas.

4. ¿Cuál es el papel biológico de los picos de las aves?

5. ¿Cuál es el papel biológico o importancia de las patas de las aves?

6. ¿Cuál es el papel biológico o importancia de las hojas de las plantas?

176


PRÁCTICA 39

Adaptaciones al ambiente

7. Con base en las observaciones realizadas y ayudado por tu libro, escribe la definición de: a. Nicho ecológico

b. Hábitat

8. ¿Cuál es la relación entre un nicho ecológico y el hábitat de un organismo y las adaptaciones que éste presente?

CONCLUSIONES:

177


Práctica

Clasificación

40 INTRODUCCIÓN

La taxonomía o sistemática, es la ciencia que se ocupa de clasificar a los seres vivos de acuerdo con sus semejanzas y diferencias, en un sistema integrado por categorías.

OBJETIVO

MATERIALES Y REACTIVOS

• Conocer los elementos útiles para una clasificación.

• • • • • •

Libro Revista Bolígrafo Pluma fuente Moneda de 50 cts Monedas

PROCEDIMIENTO

A. Uso e importancia de la clave dicotómica en la clasificación 1. Todas las claves taxonómicas siguen un modelo dicotómico que se ejemplifica a continuación. 2. Coloca sobre tu mesa un libro, una revista, una pluma fuente, un bolígrafo, una moneda de cincuenta centavos y otra de un nuevo peso. Numéralos en orden progresivo. 3. Observa detenidamente el primer objetivo. 4. Tienes tres posibilidades para clasificarlo; consulta el cuadro A y si la primer descripción (1) se acerca a la definición del objeto escogido continúa para completarla con las

opciones que se indican en el recuadro de la derecha. 5. En caso de que la descripción no concuerde con la definición del objeto, pasa a la segunda (2), y de haber acertado, continúa con las opciones que están en el recuadro de la derecha. 6. Si ninguna de las dos primeras descripciones es correcta, pasa a la tercera (3) y continúa con las opciones del recuadro de la derecha. 7. Realiza esta operación con los demás objetos hasta conseguir su definición completa y correcta.

179


Biología 10. Manual de talleres y laboratorios

Cuadro A 1. Formado por hojas de papel en las que existen 4. Con cubierta dura... libro signos impresos. Sí es así, continúa con las 4a. Con cubierta flexible hecha del mismo material opciones 4 o 4a que las hojas del interior... revista 2. Objeto de forma cilíndrica con punta que deja una marca al deslizarse sobre el papel. Si es así, continúa con las opciones 5 o 5a

5. Con punta cónica negra... pluma fuente 5a. Con punta en forma de pequeña bolita... bolígrafo

3. Metálico en forma de disco... Continuar en la opción 6 o 6a

6. De color plateado... moneda de 50 cts. 6a. De color plateado / bronce y pequeña... moneda de un centavo o diez cts.

B. Clasificación de formas geométricas

2. Guíate por el ejemplo del cuadro A. 3. Dibújalos y escribe en el espacio correspondiente del cuadro B los argumentos en que te fundamentaste.

1. Los siguientes dibujos presentan varias formas y sombreados; obsérvalos y determina un método para agruparlos en seis grandes números.

B

A

C

D

F

E

J L

I

M

O

180

H

G

K

N


PRÁCTICA 40

Clasificación

Cuadro B

Grupo

Clasificación

Fundamento

Ejemplo

Forma geométrica

I II III IV V VI

C. Clasificación de los organismos 1. Observa las siguientes figuras de organismos y clasifícalos en cinco grupos: monera, hongos, protistas, animales y plantas.

Alga

Camello

Bacteria

Paramecio Pino Girasol

Grillo Hombre Sombrerillo

Hongo

Esporas Micelio

Láminas

Pie o columna Hifas

181


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Podrías mencionar algunas fallas de la clave anterior?

2. ¿Cómo la mejorarías?

3. ¿Qué es una clave dicotómica?

4. ¿Qué es clasificación?

5. ¿Qué es taxonomía?

6. ¿Cuál es la utilidad de las clasificaciones?

7. Clasifica las imágenes del recuadro como protistas, monera, hongos, animales y plantas.

8. ¿En qué reino está ubicado el hombre?

182


PRテ,TICA 40

Clasificaciテウn

CONCLUSIONES:

183


Práctica

Clasificación de los organismos

41 INTRODUCCIÓN

La taxonomía —de la palabra griega taxis, que significa arreglo u ordenamiento— es la ciencia que permite hacer estudios sobre la clasificación de los seres vivos y permite colocarlos dentro de categorías. Las categorías taxonómicas forman un orden jerárquico, es decir, una serie de niveles en los que la categoría mayor abarca a todas las demás. Hay siete categorías principales: especie, género, familia, orden, clase, división —para las plantas y similares a ellas—, o filum y reino. Cada categoría desde la especie hasta el reino, es cada vez más general e incluye organismos cuyo antepasado común era cada vez más remoto en su relación evolutiva. La siguiente tabla refleja la relación existente entre los organismos: El nombre científico de un organismo se forma de las dos categorías más pequeñas: el género y la especie. Por ejemplo, el nombre científico para el ser humano, Homo sapiens, nos coloca en el género Homo (“hombre”) y en la especie sapiens (“pensante”). El género es una categoría que comprende organismos muy estrechamente emparentados que, por lo general, no se cruzan. La especie es una categoría limitada de los organismos que se cruzan bajo condiciones naturales —esto sólo para los que los hacen sexualmente—; por ejemplo: El género Sialia (azulejos) incluye el azulejo oriental (Sialia sialis), el azulejo occidental (Sialia mexicana) y el azulejo de la montaña (Sialia currucoides), aves muy parecidas que normalmente no se cruzan. Los nombres científicos deben siempre subrayarse o escribirse en cursiva. La primera letra del nombre del género siempre se escribe con mayúscula y la primera del nombre de la especie con minúscula. La comunidad de biólogos reconoce estos nombres en todo el mundo, lo cual supera las barreras idiomáticas y permite una comunicación precisa, puesto que los nombres comunes o vulgares varían en las diferentes regiones.

185


Biología 10. Manual de talleres y laboratorios

OBJETIVOS

MATERIALES Y REACTIVOS

• Utilizar la taxonomía para clasificar y estudiar a los seres vivos. • Reconocer la importancia de clasificar a los seres vivos.

• Figuras • Tijeras • Goma

Categoría

Ser humano

Chimpancé

Lobo

Mosca de fruta

Árbol secoya

Girasol

Reino

Animalia

Animalia

Animalia

Animalia

Plantae

Plantae

Filum

Chordata

Chordata

Chordata

Arthropoda

Coniferophyta

Anthophyta

Clase

Mammalia

Mammalia

Mammalia

Insecta

Coniferosida

Dicotyledoneae

Orden

Primates

Primates

Carnívora

Diptera

Coniferales

Asterales

Familia

Hominidae

Pongidae

Canidae

Drosophilidae

Taxodiaceae

Asteraceae

Género

Homo

Pan

Canis

Drosophila

Sequoiadendron

Helianthus

Especie

Sapiens

troglodytes

lupus

melanogaster

giganteum

annuus

PREGUNTAS 1. Escribe ejemplos de seres que estén clasificados bajo algún criterio o propiedad.

2. ¿Por qué es importante clasificar?

3. ¿Cuántos organismos conoces? Escribe una lista. Clasifícalos teniendo en cuenta alguna propiedad.

186


PRÁCTICA 41

Clasificación de los organismos

4. Explica las siguientes afirmaciones: a. La clasificación refleja la relación existente entre los organismos.

b. Es necesario clasificar los organismos.

c. Las categorías taxonómicas son provisionales y están sujetas a revisión mientras se siga descubriendo más sobre la vida en la Tierra.

5. Escribe predicciones: a. Si los organismos no tuvieran un nombre científico, ¿cómo se afectaría la comunidad científica?

b. Si organismos de diferentes especies se cruzan, ¿qué puede suceder?

6. Con base en las características descritas, clasifica los organismos en los reinos que hoy existen. Pega figuras representativas de: a. Organismo con pared celular de celulosa.

b. Organismo que se alimenta absorbiendo o ingiriendo nutrientes o haciendo fotosíntesis.

c. Generalmente, son organismos no móviles que absorben los nutrientes.

187


Biología 10. Manual de talleres y laboratorios

7. Escribe las diferencias entre: a. El reino Animal y Plantae:

b. El reino Fungi y Plantae:

c. El reino Monera y Protista:

8. Con base en las interpretaciones realizadas sobre el tema, ¿cuántas especies existen? a. Elabora una tabla de datos sobre la abundancia de especies identificadas.

b. Realiza un diagrama de barras con la anterior tabla de datos.

c. ¿En qué se basa la distribución de la abundancia de especies?

188


PRテ,TICA 41

Clasificaciテウn de los organismos

CONCLUSIONES:

189


Práctica

Clave taxonómica

42 INTRODUCCIÓN

En la práctica anterior ya aprendiste que se manejan diferentes criterios para clasificar a los seres vivos. Todos estos criterios dan la descripción del organismo, sin embargo, el buscar la descripción específica de uno en particular, sería demasiado laborioso y complicado, por lo que se creó un sistema de claves dicotómicas para poder llegar a determinar qué organismo estamos estudiando. Se nombran dicotómicas porque con dos enunciados se compara la presencia o ausencia de una característica, o la diferencia en número o posición. El saber cómo emplearlas es de gran ayuda para los taxónomos e investigadores, pues se puede especificar con qué especie se está trabajando.

OBJETIVOS

MATERIALES Y REACTIVOS

• Aprender el uso de una clave taxonómica. • Identificar a un organismo por medio de los criterios marcados en la clave dicotómica.

• Cuaderno de notas • Hojas de diferentes clases de pinos

PROCEDIMIENTO 1. Observa cuidadosamente las hojas de pino, nota que están agrupadas en grupos que se llaman fascículos, cada hoja se llama folio o folíolo, y de manera común se les denomina como agujas.

2. Usa la siguiente clave taxonómica para identificar a qué especie o género pertenecen las hojas que colectaste.

a) Hojas con forma de ramas

Cipreses

b) Hojas con forma de aguja

Pasa a c)

c) Hojas con forma de aguja individuales

Casuarinas o Abies

d) Hojas con forma de aguja agrupadas en fascículos

Pinos, pasa a e)

e) Fascículos de tres a cinco agujas

Pasa a h)

f) Fascículos de cuatro a seis agujas

Pasa a j)

191


Biología 10. Manual de talleres y laboratorios

g) Fascículos de cuatro a seis agujas

Pasa a j)

h) Fascículos de tres agujas, hojas flexibles y colgantes

Pino patula

i)

Fascículos de tres agujas, hojas rígidas no colgantes

Pasa a l)

j)

Agujas de más de 15 cm de largo

Pasa a n)

k) Agujas de menos de 15 cm de largo

Pasa a p)

l) Conos de 3-6 cm, café pálido sin resina

Pino teocote

m) Conos de 7-14 cm, café oscuro con resina

Pino hartwegi

n) Agujas gruesas de ramillas escamosas

Pino montezumae

o) Agujas delgadas de ramillas casi lisas

Pino pseudostrobus

p) Agujas con vaina resistente

Pino hartwegii

q) Agujas con vaina caediza

Pasa a r)

r) Conos persistentes de 4-6 cm, café grisáceo

Pino leiophylai

s) Conos caedizos de 20-40 cm, café amarillento

Pino ayacahiote

PREGUNTAS 1.

Menciona los pasos para usar una clave taxonómica.

2. ¿Hay algún error en esta clave? 3. La anterior fue una clave bastante sencilla, sin embargo, otros organismos son más complejos. ¿Qué conocimientos crees que deberías tener para poder usar esas claves? 4. ¿Es igual una guía de campo que una clave taxonómica? ¿En qué casos se emplearía cada una?

192


PRテ,TICA 42

Clave taxonテウmica

CONCLUSIONES:

193


Práctica

Factores abióticos

43 INTRODUCCIÓN

Un ecosistema es un sistema de organismos vivientes y del medio con el cual intercambia materia y energía. Un ecosistema contiene componentes bióticos (todo lo vivo en el ecosistema), tales como poblaciones de plantas, animales y microorganismos y componentes abióticos (físicos, sin vida) tales como agua, suelo, radiación. Los factores ambientales abióticos son los componentes del ecosistema que carecen de vida pero ejercen una influencia determinante en la vida de los seres vivos. Los principales factores abióticos son la luz, la temperatura, la humedad, la presión, la salinidad y la presión atmosférica. Los factores abióticos intervienen en la reproducción, la irritabilidad, el crecimiento, el metabolismo y la adaptación de los seres al medio.

OBJETIVO

MATERIALES Y REACTIVOS

• Analizar la influencia de la luz y la temperatura ambiental en el crecimiento de las plantas.

• • • • • • • • • • •

Vaso de precipitados de 250 ml 20 semillas de pimentón 20 semillas de tomate 20 semillas de poroto Tres bolsas para emparedado medianas Ocho tiras de cartón de 8 cm de largo Un colador Tres platos Petri Dos cajas de cartón Linterna Algodón

195


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Coloca las semillas dentro del vaso y agrega 100 ml de agua, déjalas reposar durante 10 minutos. 2. Rotula los platos Petri con los números del 1 a 3. Acomoda en cada uno dos tiras de cartón de manera que el plato Petri quede dividido en cuatro porciones. 3. Coloca una capa de algodón humedecido en cada plato Petri. 4. Vierte el contenido del vaso químico en el colador. Enjuaga las semillas. 5. Coloca cinco semillas en cada una de las divisiones del plato Petri. Ver figuras.

#1

Pimentón

#2

Tomate

#3

Poroto

6. Introduce el plato 1 dentro de una caja de cartón y colócala en un lugar frío; el plato 2 en un lugar cálido e iluminado y el plato 3 dentro de una caja en una zona con temperatura alta durante siete días. 7. Registra los resultados en la tabla 1. Tabla 1

Tipo de Semilla Ejote Tomate Pimentón

196

Número de semillas germinadas Caja 1 Caja 2 Caja 3


PRÁCTICA 43

Factores abióticos

PREGUNTAS 1. ¿Qué factores abióticos intervinieron en el experimento? __________________________________________________________________________________ 2. ¿En qué ambiente germinaron más semillas? __________________________________________________________________________________ 3. ¿En qué ambiente germinaron menos semillas? __________________________________________________________________________________ 4. ¿Qué factores pudieron ocasionar la falta de germinación de las semillas? __________________________________________________________________________________

CONCLUSIONES:

197


Práctica

Factores físicos y biológicos de diversos biomas terrestres

44

INTRODUCCIÓN En los biomas se dan comunidades bióticas, que constituyen poblaciones mutuamente acopladas, las cuales interactúan y utilizan los factores físicos que se encuentren en ellos.

OBJETIVO

MATERIALES Y REACTIVOS

• Identificar los diferentes factores físicos y biológicos que componen algunos biomas terrestres.

• Libro de texto de biología • Figuras de plantas y animales representativos de la selva, sabanas y desiertos

PROCEDIMIENTO 1. Completa el siguiente cuadro indicando los principales factores físicos y biológicos de la selva, la sabana y los desiertos. En el caso de los factores biológicos ilustra con las figuras de plantas y animales.

199


200

Sabana

Desierto

Selva

Biomas Terrestres Clima

Vientos

Temperatura

Factores físicos Lluvia

Plantas y animales

Factores biológicos

Biología 10. Manual de talleres y laboratorios


PRÁCTICA 44

Factores físicos y biológicos de diversos biomas terrestres

PREGUNTAS 1. Menciona algunos factores físicos de los biomas terrestres.

2. Menciona algunos factores biológicos de cada uno de los biomas terrestres estudiados.

CONCLUSIONES:

201


Práctica

Biomas y ecosistemas

45 INTRODUCCIÓN

La energía fluye a través de los ecosistemas a partir de los productores fotosintéticos y a lo largo de varios niveles de consumidores. Cada categoría de organismo constituye un nivel trófico (literalmente, “nivel de alimentación”).

OBJETIVO

MATERIALES Y REACTIVOS

• Identificar los niveles tróficos que integran las cadenas alimentarias.

• Lápices de colores • Libro de texto

PROCEDIMIENTO 1. Biomas y cadenas alimentarias. Confecciona con figuras una cadena alimenticia de cada uno de los biomas terrestres. 2. Ecosistema local. Dibuja algún ecosistema del sitio donde vives. Indica cuáles son los productores primarios y los consumidores primarios, secundarios y terciarios.

203


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Qué es la biósfera? 2. ¿Qué es un ecosistema? 3. ¿Qué es un bioma? 4. ¿Cómo fluye la energía en los ecosistemas? 5. ¿Cuáles son las características de la selva tropical? 6. ¿Cuáles son las características de las sabanas? 7. ¿Cuáles son las características de los bosques caducifolios de clima templado? 8. ¿Cuáles son las características de los bosques de clima templado lluvioso? 9. ¿Cuáles son las características de los chaparrales? 10. ¿Cuáles son las características de los desiertos? 11. ¿Cuáles son las características de la tundra y la taiga? 12. ¿Qué es el fitoplancton? 13. ¿Qué es el zooplancton? 14. ¿Cuáles son las características de los arrecifes de coral? 15. ¿A qué se puede llamar bosques de algas y pastizal marino?

204


PRテ,TICA 45

Biomas y ecosistemas

ツソQuテゥ aprendiste? Resuelve el siguiente crucigrama

4

1

2 6 3 1

4

2

5 5

3

6

205


Biología 10. Manual de talleres y laboratorios

Horizontales

Verticales

1. Ecosistema formado por plantas acuáticas con aspecto de pasto.

1. Es la superficie del planeta donde hay seres vivos.

2. Ecosistema formado por árboles de hojas anchas y caducas.

2. La vegetación dominante es de pastos, musgos y líquenes.

3. Hay bosques de este tipo en las partes media de Norteamérica hasta Centroamérica, Europa occidental y Asia oriental.

3. Está en el norte de América y Eurasia. Su vegetación es de abetos, pinos y cipreses.

4. En ellos el flujo de materiales es cíclico.

4. Ecosistema donde dominan las algas verdes.

5. En este bioma hay cactus y carneros cuernilargo.

5. En este bioma hay animales como el águila harpía y el jaguar.

6. La relación de los integrantes de este ecosistema es mutualista.

6. Se le conoce como sabana en África y pradera en Norteamérica.

CONCLUSIONES:

206


Práctica

Los niveles tróficos

46 INTRODUCCIÓN

Para entender el flujo de energía en un ecosistema, los organismos se clasifican de acuerdo con “quién come a quién”, en niveles tróficos. Se distinguen dos grandes grupos, productores y consumidores. Los productores fabrican su propio alimento, es decir, los fotosintetizadores y quimiosintetizadores, y por la forma de obtener la energía se denominan autótrofos. Los productores constituyen siempre en una cadena alimenticia el primer nivel trófico. Los consumidores, por la forma de obtener la energía también se denominan heterótrofos. Dentro del grupo de los consumidores están los que se alimentan de productores, los herbívoros o consumidores primarios; los que se alimentan de animales, carnívoros o consumidores secundarios. Los carnívoros pueden ser primarios, secundarios, etc. Los omnívoros pueden alimentarse de productores, herbívoros y carnívoros. Finalmente, están los descomponedores o reductores, un tipo especial de heterótrofos que cumplen una importante función en el ecosistema al realizar el reciclaje de todos los nutrientes que salen del sistema.

OBJETIVO • Determinar las categorías de organismos de una comunidad y su posición en la cadena alimentaria.

207


Biología 10. Manual de talleres y laboratorios

PROCEDIMIENTO 1. Mediante un ejemplo escribe cómo es que tú formas parte de una cadena alimentaria. __________________________________________________________________________________ __________________________________________________________________________________ 2. Busca en tu libro de texto cada concepto y defínelo.

A. CONSUMIDOR __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ B. PRODUCTOR __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ C. DESCOMPONEDOR __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________ __________________________________________________________

208


PRÁCTICA 46

Los niveles tróficos

PREGUNTAS 1. Enumera los diferentes niveles tróficos de acuerdo con su jerarquía. __________________________________________________________________________________ __________________________________________________________________________________ 2. ¿Podrían vivir los autótrofos sin los heterótrofos? Explica. __________________________________________________________________________________ __________________________________________________________________________________

CONCLUSIONES:

209


Práctica

Cadena alimentaria

47 INTRODUCCIÓN

El ecosistema es una región natural del planeta constituido por dos factores: un abiótico, determinado por el suelo, la temperatura y el agua básicamente; y otro biótico, integrado por flora y fauna, en el que por necesidades de alimentación, protección y reproducción se establecen interrelaciones que reciben el nombre de cadenas y redes alimenticias. En una cadena alimentaria se establece una relación lineal de alimentación de una comunidad, con base en un solo representante de cada nivel trófico.

OBJETIVO

MATERIALES Y REACTIVOS

• Apreciar el papel de los productores consumidores y reintegradores en las cadenas alimentarias.

• Tijeras • Goma • Figuras de plantas, animales y organismos desintegradores

PROCEDIMIENTO 1. Investiga y anota las definiciones de los siguientes términos: a) Abiótico

b) Biótico

c) Flora

d) Fauna

e) Productor

211


BiologĂ­a 10. Manual de talleres y laboratorios

f) Consumidor

g) Desintegrador

2. Ejemplo de cadena alimenticia terrestre. a) Recorta las figuras. b) Arma la cadena alimenticia, con las figuras que trajiste a clase, formando un ciclo de la materia. En el espacio asignado pĂŠgalos y seĂąala con flechas las secuencias correspondientes.

212


PRテ,TICA 47

Cadena alimentaria

PREGUNTAS 1. Mencione algunos organismos productores que conozcas. 2. De el nombre de algunos consumidores primarios. 3. ツソConoces algunos consumidores secundarios? Escribe su nombre. 4. ツソCuテ。les consumidores terciarios conoces? 5. Menciona algunos descomponedores

CONCLUSIONES:

213


Práctica

Red alimentaria

48 INTRODUCCIÓN

Las cadenas y redes alimentarias describen las relaciones de alimentación dentro de un ecosistema e ilustran quién se come a quién. La cadena alimentaria establece las relaciones lineales y las redes alimentarias son las que muestran las múltiples cadenas alimentarias de un ecosistema interconectadas. Ellas describen las relaciones de alimentación efectivas dentro de un ecosistema específico.

OBJETIVOS

MATERIALES Y REACTIVOS

• Realizar una red alimenticia con los componentes dados. • Distinguir los consumidores de los productores y de los descomponedores. • Conectar los componentes de una red alimenticia.

• Esquemas traídos por los estudiantes para realizar la red alimenticia.

PROCEDIMIENTO 1. Realiza las conexiones entre los diferentes organismos “quién se come a quién”. Puedes utilizar diferentes colores para colocar las flechas que indicarán que tal organismo se come al otro, por ejemplo, el gato se come al ratón... 2. Después de haber realizado la red alimenticia o cadena alimenticia, contesta el cuestionario observando su trabajo y comentando con tus compañeros.

215


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿De cuáles organismos se alimenta una víbora?

2. ¿De cuáles organismos se alimenta un halcón?

3. ¿Qué pasaría si la zorra comiera un solo tipo de organismo?

4. ¿Cuáles son los organismos que se alimentan del maíz?

5. Menciona un organismo que consume la mayor cantidad de otros organismos.

6. En esta cadena alimentaria, ¿qué componentes están ausentes?

Consumidores terciarios omnívoros superiores Tigre

Consumidores secundarios carnívoros

Ratón Culebra

Búho

Zorro

Consumidores primarios (herbívoros) Conejo Venado Pájaro

216

Ardilla


PRÁCTICA 48

Red alimentaria

Productores

Árbol

Hierbas

Descomponedores

UNA RED ALIMENTICIA SENCILLA

217


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

218


Práctica

Sopa reproductiva

49 OBJETIVO

• Reconocer la importancia de la sexualidad en el desarrollo integral del ser humano.

PROCEDIMIENTO 1. En la siguiente sopa reproductiva, localiza cuatro órganos del sistema reproductor femenino y cuatro del sistema reproductor masculino. T

R

O

M

P

A

D

E

F

A

L

O

P

I

O

G

H

A

O

E

G

R

E

S

D

F

H

J

I

K

B

N

L

M

I

O

Ñ

P

S

V

G

R

A

S

Z

H

J

K

P

E

N

E

O

P

J

K

R

T

E

S

T

I

C

U

L

O

S

J

U

I

B

I

V

C

H

O

I

V

E

S

I

C

U

L

A

S

S

E

M

I

N

A

L

E

S

C

U

H

L

Ñ

M

T

G

B

R

A

C

F

H

Q

G

E

Y

T

U

L

B

W

A

Y

E

U

Y

E

N

C

I

M

A

I

F

U

A

L

V

T

D

K

J

R

G

R

A

M

R

L

V

D

N

D

S

T

O

A

U

C

M

A

O

V

A

R

I

O

S

E

C

A

V

D

A

S

B

Z

U

R

E

T

R

A

X

A

T

E

S

S

D

A

O

Y

I

A

C

B

A

N

D

E

T

A

M

O

I

R

D

I

C

U

S

C

O

N

D

U

C

T

O

S

D

E

F

E

R

E

N

T

E

S

2. Redacta una muy pequeña definición de los órganos del sistema reproductor masculino y femenino localizados en la sopa reproductiva.

Órganos femeninos

Órganos masculinos

219


Biología 10. Manual de talleres y laboratorios

PREGUNTAS 1. ¿Qué otro nombre reciben las células sexuales?

2. ¿Qué nombre recibe la célula sexual femenina?

3. ¿Qué nombre recibe la célula sexual masculina?

4. ¿Qué órgano está presente tanto en el sistema reproductor femenino como en el masculino?

4.1 ¿Cuál es la función de ese órgano en el sistema reproductor femenino y masculino?

5. Menciona la función de cada uno de los órganos encontrados en la sopa reproductiva.

CONCLUSIONES:

220


Práctica

Las enfermedades de transmisión sexual

50 INTRODUCCIÓN

Algunas de las enfermedades más graves que afectan a los humanos son transmitidas por medio del contacto sexual. Se llaman enfermedades de transmisión sexual o ETS.

OBJETIVO

MATERIALES Y REACTIVOS

• Identificar algunas de las enfermedades de transmisión sexual y sus métodos de prevención.

• Lápices de colores

PROCEDIMIENTO 1. Coloca al lado de cada microorganismo la letra de la enfermedad que causa. Enfermedad

Microorganismo

(a) Gonorrea

Treponema pallidum

(

)

(b) Sífilis

Tricomonas vaginalis

(

)

(c) Herpes

Virus VIH

(

)

(d) SIDA

Neisseria gonorrhoeae

(

)

(e) Tricomoniasis

Virus del herpes

(

)

PREGUNTAS 2. ¿Cuáles son las infecciones de transmisión sexual más comunes?

221


Biología 10. Manual de talleres y laboratorios

3. ¿Cómo se previenen las enfermedades de transmisión sexual o ETS?

4. ¿Cuál es el virus que se transmite por mantener relaciones sexuales con personas infectadas?

5. ¿Por qué el SIDA es la ETS más peligrosa que existe.

6. ¿Cómo se transmite el VIH? 7. Marca con una X y colorea los factores de riesgo para la transmisión del virus que causa el SIDA. Dar la mano Recibir transfusiones

222


PRテ,TICA 50

Tener relaciones sexuales

Besarse

Asistir a clase

Las enfermedades de transmisiテウn sexual

Abrazar a un enfermo de SIDA

Recibir una vacuna con una jeringa

Comer en restaurantes

223


BiologĂ­a 10. Manual de talleres y laboratorios

CONCLUSIONES:

224


Bibliografía

AUDESIRK, Teresa; Audesirk, Gerald; Bruce, Byerss. Biología. La vida en la Tierra. Sexta Edición. México. 2003. BIGGS, Alton; Kapicka, Christ; Lundgren, Linda. Biología. La dinámica de la vida. McGraw Hill. México.1999. CAMPBELL, Neil A.; Mitchel, Laurence G.; Reece, Jane. Biología: Conceptos y Relaciones. Tercera Edición. Pearson Educación. México. 2001. DELGADO, María Cecilia; Eslava, Edgar. Aventura. Cuaderno de Actividades. Ciencias 7.Grupo Editorial Norma Educativa. Bogotá, Colombia. 1999. ESPINEL A., María del P.; Mendieta, Jenny, Arbeláez, G. Nydia; Alcarcel G., Martha L. Ciencias 7, 8, 9. Prentice Hall. Pearson Educación Colombia. Colombia. 2000. INFANTE C., Hilda. Prácticas de Biología 2. Quinta reimpresión. Santillana, S.A. de C. V. México. 2001. LEÓN, Sara; Ortiz, Andrés; Caballero, Arturo. Prácticas de Laboratorio de Biología 1. Esfinge. México. 1994. MENESES, Paulo; Mejía Galván, Elsa; Jarquere, Vicente; H., Gustavo. Biología: Actividades y Prácticas de Laboratorio. Limusa. México. 1988. MILLER, Kenneth; Levine, Joseph. Biología. Pearson Educación. New Jersey. 2004. ORAM, Raymond, Hummer, Paul; Smoot, Robert. Biología. Sistemas Vivientes. Compañía Editorial Continental. México. 1986. PARGA, Diana. Olimpiadas: Ciencias 7. Libro de Actividades. Voluntad. Bogotá, Colombia. 2000. PARGA, Diana. Olimpiadas: Ciencias 8. Libro de Actividades. Voluntad. Bogotá, Colombia. 2000. PARGA, Diana. Olimpiadas: Ciencias 9. Libro de Actividades. Voluntad. Bogotá, Colombia. 2000. PETER, Alexander; Bahret, Mary Jean; Chávez, Judith; Courts, Gary; Skolky D´Alessio, Naomi. Biología. Prentice Hall. SALGADO, Reina; Ramírez, José Martín; Hernández M., Pedro. La Biología y tú. Ediciones Pedagógicas. México.1993. SANDÍ Ureña, Rita. Biología. Un enfoque práctico. Educación diversificada. Primera Edición. 2000. SANDÍ Ureña, Rita. Biología. Un enfoque práctico. Educación diversificada. Primera Edición. 2002. VERGARA V., César A. Biología 1 y 2. Guías de Investigación. REA. Internacional Editorial. Panamá. 2001.

ERRNVPHGLFRVRUJ

225


Manual de talleres y laboratorios de biologia 10 barsallo  

excelente material para los docentes para usar en el laboratorio

Advertisement