Issuu on Google+

CANCER THERAPY

Volume 1 2003


CANCER THERAPY Addresses of Members of the Editorial Board FREE ACCESS www.cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!!! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editorial Board

Richard J. Ablin, Ph.D., Research Professor Department of Microbiology and Immunology and the Arizona Cancer Center University of Arizona College of Medicine 1501 N. Campbell Avenue P.O. Box 245049 Tucson, AZ 85724-5049 Telephone: 520-622-8319 Facsimile: 520-622-0518 E-mail: ablinrj@email.arizona.edu President, Robert Benjamin Ablin Foundation for Cancer Research 115 Franklin Turnpike, Suite 200 Mahwah, NJ 07430 E-mail: ablinrj@prostatefoundation.org Armand, Jean Pierre, M.D. Ph.D., Chairman Protocol Review European Organization for Research and Treatment of Cancer (EORTC) Avenue Mounier 83 bte 11 B-1200 Brussels Belgium Department of Medicine Gustave Roussy Institute

Villejuif France E-mail: armand@igr.fr Aurelian, Laure, Ph.D., Professor Departments of Pharmacology and Experimental Therapeutics University of Maryland School of Medicine Baltimore 21201 USA Tel.: +1-410-706-3895; fax: +1-410-706-2513; email: laurelia@umaryland.edu Berdel, Wolfgang E, M.D., Department of Medicine/Hematology University Hospitals Munster Germany Albert-Schweitzer-StraĂ&#x;e 33 48149 MĂźnster Tel. +49-(0)251-83-47587 Fax +49-(0)251-83-47588 E-Mail: berdel@uni-muenster.de Beyan, Cengiz, M.D., Gulhane Military Medical Academy Department of Hematology Etlik, 06010 Ankara, Turkey Tel: +312.304 4101 Fax: +312.304 4100 E-mail: cbeyan@yahoo.com,


cengizbeyan@hotmail.com Bottomley, Andrew, PhD, Quality of Life Unit, European Organization for Research and Treatment of Cancer Data Center, Avenue E. Mounier 83/11, 1200 Brussels, Belgium; email: abo@eortc.be Bouros, Demosthenes, M.D., Demokritus University of Thrace Medical school, Department of Pneumonology University Hospital of Alexandroupolis 68100 Alexandroupolis Greece Phone: +30-25510-76105 Fax: +30-25510-76106 e-mail: bouros@med.duth.gr Cabanillas, Fernando, M.D, Chairman, Professor, Department of Hematology, Division of Lymphoma/Myeloma The University of Texas M. D. Anderson Cancer Center, Houston, Texas e-mail: fcabanil@mail.mdanderson.org Castiglione, Monica, MHA, SIAK/IBCSG Director SIAK/IBCSG Coordinating Center Effingerstrasse 40 3008 Bern (Switzerland) Tel. +41 31 389 91 91 Fax +41 31 389 92 00 e-mail: monica.castiglione@siak.ch Chou, Kuo-Chen, Ph.D., D.Sc., Gordon Life Science Institute, 13784 Torrey Del Mar Drive, San Diego, California 92130. Tel: 858-484-1018. E-mail: kchou@san.rr.com Chu, Kent-Man, MD, Division of Upper Gastrointestinal Surgery, Department of Surgery, University of Hong Kong Medical Center, Queen Mary Hospital, Pokfulam, Hong Kong, China; email: chukm@hku.hk Chung, Leland W.K, Ph.D., Professor & Director Of Research Department of Urology B4100 Winship Cancer Institute 1365B Clifton Rd Phone: 404 778-4319 Email: lwchung@emory.edu Coukos, George, M.D., Ph.D., Center for Research on Reproduction and Women's

Health Department of Obstetrics and Gynecology University of Pennsylvania Medical Center 1209 Biomedical Research Building II/III 421 Curie Boulevard Philadelphia, PA 19104-6142 Phone: 215-662-3316 Fax: 215-573-7627 E-Mail: gcks@mail.med.upenn.edu Darzynkiewicz, Zbigniew, M.D., Ph.D., Director, Brander Cancer Research Institute New York Medical College 19 Bradhurst Ave. Hawthorne, NY 10532 tel: 914-347-2801 fax: 914-347-2804 e-mail: darzynk@nymc.edu Devarajan, Prasad M.D., Director, Nephrology & Hypertension, Cincinnati Children’s Hospital Medical Center, MLC 7022, 3333 Burnet Avenue, Cincinnati, OH 45229-3039. Phone: 513-636-4531. FAX: 513-636-7407. E-mail: prasad.devarajan@cchmc.org Der, Channing J. Ph.D, Professor Pharmacology Molecular Therapeutics Lineberger Comprehensive Cancer Center CB# 7295 Chapel Hill NC 27599 Telephone: (919) 966-5634 FAX: (919) 966-0162 e-mail: cjder@med.unc.edu Dritschilo, Anatoly, M.D., Department of Radiation Medicine Georgetown University Hospital 3800 Reservoir Road, NW Washington, D.C. 20007 Tel: (202) 687-2144 e-mail: DRITSCHA@gunet.georgetown.edu Duesberg, Peter H., Ph.D, Professor Department of Molecular & Cell Biology c/o Stanley/Donner Administrative Services Unit 229 Stanley Hall #3206 University of California at Berkeley Berkeley, CA 94720-3206 Fax: (510) 643-6455 Email: duesberg@uclink4.berkeley.edu El-Deiry, Wafik S. M.D., Ph.D., Associate Professor of Medicine (Hem/Onc), Genetics, and Pharmacology Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, 437 Clinical Research Building Philadelphia, PA 19104, USA Tel: 215-898-9015 Fax: 215-573-9139 Email: Wafik@mail.med.upenn.edu


Federico, Massimo, M.D. Dipartimento di Oncologia ed Ematologia, Centro Oncologico Modenese, Università di Modena e Reggio Emilia, Policlinico – Via del Pozzo 71, 41100 Modena, Italy. Phone +39-059-4224547; Fax +39-059-4224549; e-mail: federico@unimore.it

Gridelli, Cesare M.D., Divisione di Oncologia Medica, Azienda Ospedaliera "S.G.Moscati", via Circumvallazione, 83100 Avellino, Italy Tel :39-0825-203573; Fax. :39-0825-203556; E-mail:cgridelli@libero.it

Fiebig, Heiner H, Albert-Ludwigs-Universität Klinik für Tumorbiologie Breisacher Straße 117 79106 Freiburg, Germany Tel: (+49) 761-51 55 9 11 e-mail: fiebig@ruf.uni-freiburg.de

Hengge, Ulrich, M.D., Department of Dermatology Heinrich-Heine-University Duesseldorf Moorenstrasse 5 40212 Duesseldorf Tel.: +49 (0)211 - 811 8066 Fax: +49 (0)211 - 811 8700 E-Mail: ulrich.hengge@uni-duesseldorf.de

Fine, Howard A., M.D., Branch Chief Neuro-Oncology Branch Building 10, Room 12S245 10 Center Drive Bethesda, MD 20892 Phone: 301-402-6298 Fax: 301-480-2246 E-Mail: hfine@mail.nih.gov Frustaci, Sergio, M.D., Division of Medical Oncology, Centro di Riferimento Oncologico di Aviano, Via Pedemontana Occ. 12, 33170 Aviano (PN), Italy; email: sfrustaci@cro.it Georgoulias, Vassilis, MD, PhD Professor of Medical Oncology University General Hospital of Heraklion Dpt of Medical Oncology Tel: +30 2810 392750 Fax: + 30 2810 392802 E-mail: georgoul@med.uoc.gr Giordano, Antonio, M.D., Ph.D., Sbarro Institute for Cancer Research and Molecular Medicine Professor of Biology and Medicine College of Science and Technology Temple University BioLife Science Bldg. Suite 333 1900 N 12th Street Philadelphia PA 19122 Tel: 215-204 9520 Fax: 215-204 9522 E-Mail: antonio.giordano@temple.edu Greene, Frederick Leslie, M.D., Chairman, Department of General Surgery Carolinas Medical Center 1000 Blythe Boulevard., PO Box 32861 Charlotte, NC 28232-2861 Phone: 704/355-3176 Fax: 704/355-5619 E-Mail: rgreene@carolinas.org

Huber, Christian M.D., Chair of the Department for Oncology and Hematology of the University of Mainz Medizinische Klinik und Poliklinik Johannes-Gutenberg-University Langenbeckstrasse 1 55131 Mainz GERMANY Tel.:49-6131-177-281 Fax:49-6131-17-3446 E-mail:ch.huber@3-med.klinik.uni-mainz.de Hunt, Kelly, M.D., Associate Professor Department of Surgical Oncology, Unit 444 Chief, Surgical Breast Section The University of Texas M. D. Anderson Cancer Center 1515 Holcombe Blvd. Houston, TX 77030 Tel: 713-792-7216 Fax: 713-792-4689 email: khunt@mdanderson.org Kamen, Barton A., M.D. Ph.D, Professor of Medicine Specialty: Pediatrics - Board Certified SubSpecialty: Hematology - Board Certified 195 Little Albany Street New Brunswick NJ 08903 Telephone: (732) 235-8131 E-mail: kamenba@umdnj.edu Kazuma, Ohyashiki, M.D., Ph.D., Chairman and professor of the First Department of Internal Medicine, Tokyo Medical University, 6-7-1 Nishishinjuku, Shinjuku-ku, Tokyo, Japan. Phone: international+81-3-33426111 Fax: international+81-3-53816651 E-mail: ohyashik@rr.iij4u.or.jp Kinsella, Timothy J. M.D.,


Professor, Radation Oncology The research Institute of University Hospitals in Cleveland 11100 Euclid Avenue Cleveland, OH 44106 Mail Stop: LTR 6068 Department Phone: 216-844-2530 Department Fax: 216-844-4799 e-mail: tjk4@po.cwru.edu

Hong Kong SAR, China; email: waitongleung@cuhk.edu.hk

Kmiec, Eric B, Ph.D., University of Delaware Department of Biological Sciences Delaware Biotechnology Institute Innovation Way Room 270 Newark, Delaware 19716 Tel: (302) 831-3420 Fax: (302) 831-3427 E-mail: ekmiec@udel.edu

Lichtor, Terry M.D., Ph.D., Department of Neurosurgery, 1900 West Polk Street Chicago, Illinois 60612 Telelphone: 312-864-5120; Fax: 312-864-9606; e-Mail: Terry_Lichtor@rush.edu

Kosmidis Paris, M.D. ESMO President 2nd Medical Oncology Department, Hygeia Hospital, 2 An Tsoha & Vas Sofias Ave, 11521 Athens, Greece; email: parkosmi@otenet.gr Koukourakis, Michael, M.D. Ass.Professor - Head Dept. of Radiotherapy and Oncology Democritus University of Thrace Alexandroupolis 68100, Greece tel -30-6932-480808, fax: -30-25510-74623 Email: targ@her.forthnet.gr

Levin, Mark M.D., Director, Sister Regina Lynch Regional Cancer Center Holy Name Hospital 718 Teaneck Road Teaneck NJ 17666 e-mail: mlevinmd@aol.com

Liebermann, Dan A., Ph.D., Professor Fels Institute for Cancer Research and Molecular Biology and the Department of Biochemistry Temple University School of Medicine 3307 N. Broad Street Philadelphia, PA 19140 Tel: 215 707 6903 FAX: 215 707 2805 Email: lieberma@temple.edu, lieberma@unix.temple.edu Lipps, Hans J, Ph.D., Institut f체r Zellbiologie Universit채t Witten/Herdecke Stockumer Str. 10 58448 Witten -GermanyTel.: (49) 2302 669144 Fax.: (49) 2302 669220 e-mail: lipps@uni-wh.de

Kroemer, Guido, M.D. Ph.D Research Director CNRS-UMR1599 Institut Gustave Roussy, Pavillon de Recherche 1 39, rue Camille Desmoulins 94805 VILLEJUIF FRANCE Tel : 33-1- 42 11 60 46 Fax: 33-1- 42 11 60 47 or 33-1-42 11 52 44 E-mail : kroemer@igr.fr, kroemer@pobox.igr.fr

Lokeshwar, Balakrishna L., Ph.D., Tenured Associate Professor Department of Urology, McKnight Vision Research Building, University of Miami School of Medicine, P.O. Box 016960 (D880), Miami, FL 33101, USA Fax: +305-243-6893 e-mail: blokeshw@med.miami.edu

Kurzrock, Razelle, M.D., F.A.C.P., Department of Bioimmunotherapy, University of Texas M.D. Anderson Cancer Center; 1515 Holcombe Blvd, Box 422, Houston, TX 77030; email: rkurzroc@mdanderson.org

Mackiewicz, Andrzej, M.D., Ph.D., Head of The Dept. of Cancer Immunology, Chair of Oncology, University School of Medical Sciences (USOMS) at GreatPoland Cancer Center, Poznan, Poland e-mail: amac@amu.edu.pl

Leung, Thomas Wai-Tong M.D., Department of Clinical Oncology, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, New Territories,

Marin, Jose J. G., Ph.D., Campus Miguel de Unamuno, ED-S09. 37007-Salamanca, SPAIN Tel: +34-923-294674 Fax: +34-923-294669 mail: jjgmarin@usal.es


McMasters, Kelly M., M.D., Ph.D., Sam and Lolita Weakley Professor of Surgical Oncology University of Louisville, J. Graham Brown Cancer Center 315 E. Broadway, Suite 305 Louisville, KY 40202 502-629-3380 phone 502-629-3393 fax kelly.mcmasters@nortonhealthcare.org Morishita, Ryuichi, M.D., Ph.D., Division of Clinical Gene Therapy, Graduate School of Medicine, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail morishit@cgt.med.osaka-u.ac.jp Mukhtar, Hasan PhD, Department of Dermatology, University of Wisconsin Medical School Center, Room B25, 1300 University Avenue, Madison, WI 53706; email: hmukhtar@wisc.edu Norris, James Scott, Ph.D., Department of Microbiology and Immunology, Medical University of South Carolina, 173 Ashley Avenue, Charleston, South Carolina 29425, USA. e-mail: Norrisjs@musc.edu Palu, Giorgio, M.D., Department of Histology, Microbiology, and Medical Biotechnologies, University of Padova, Via Gabelli 63, I-35121 Padova, Italy. E-mail: giorgio.palu@unipd.it Park, Jae-Gahb, M.D., Ph.D., Professor Laboratory of Cell Biology Cancer Research Institute Seoul National University College of Medicine, 28 Yongon-dong, Chongno-gu, Seoul 110-744, Korea Tel : 82-2-760-3380 / Fax : 82-2-742-4727 E-mail : jgpark@plaza.snu.ac.kr Perez-Soler, Roman M.D., Professor, Chief, Division of Oncology , Department of Medicine Montefiore Medical Center The Albert Einstein Cancer Center 111 East 210th Street Hofheimer Main , Room 100

Bronx, NY, 10467 Tel: 718-920-4001 e-mail: rperezso@montefiore.org Peters, Godefridus J., Ph.D., Department of Medical Oncology VU University Medical Center (VUMC) PO Box 7057 1007 MB Amsterdam The Netherlands Phone: +31-20-4442633 Fax: +31-20-4443844 E-mail: gj.peters@vumc.nl Poon, Ronnie Tung-Ping, M.D., Associate Professor Department of Surgery, Queen Mary Hospital, 102 Pokfulam Rd, Hong Kong, China; email: poontp@hkucc.hku.hk Possinger Kurt-Werner, M.D., Division of Oncology/Hematology, School of Medicine (Charité), Humboldt University, Schumannstr. 20/21, 10117, Berlin, Germany Tel: +49 30 450-513002 Fax: +49 30 450-513952 e-mail: kurt.possinger@charite.de Rainov G Nikolai M.D., D.Sc., Department of Neurological Science Clinical Sciences Center The University of Liverpool Lower Lane Liverpool L9 7LJ Telephone: 0151 529 5323 Fax: 0151 529 5465 E-mail: N.G.Rainov@liverpool.ac.uk Randall, E Harris, M.D., Ph.D., The Ohio State University School of Public Health B-121 Starling Loving Hall 320 West 10th Avenue Columbus, Ohio 43210 Phone: (614) 293-3903 Fax: (614) 293-3937 Email: harris.44@postbox.acs.ohio-state.edu Ravaioli Alberto, M.D. Divisione di Oncologia ed Onco-Ematologia Ospedale Infermi Via Settembrini, 2 47900 Rimini Italy Tel/fax 0039 – 0541 – 705567 e-mail: aravaiol@auslrn.net Remick, Scot, C. M.D., Division of Hematology/Oncology, University Hospitals of Cleveland,


11100 Euclid Ave, Cleveland, OH; email: scr@po.cwru.edu Rhim, Johng S M.D., Professor and Associate Director Center for Prostate Disease Research, Uniformed Services University of Health Sciences, 4301 Jones Bridge Road, Bethesda MD 20814-4799, USA. Phone: 301-319-8223 Fax: 301-295-1978 e-mail: jrhim@cpdr.org Schadendorf, Dirk, M.D., Klinische Kooperationseinheit für Dermato-Onkologie (DKFZ) an der Universitäts-Hautklinik Mannheim Theodor Kutzer Ufer 1 68135 Mannheim Tel.: (0621)383 - 2126, Fax: (0621) 383 – 2163 e-mail: d.schadendorf@dkfz.de Schmitt, Manfred, Ph.D., Vice-Chairman (EORTC) Frauenklinik der Technischen Universität München Klinikum rechts der Isar Ismaninger Str. 22 D-81675 München Germany Tel: 49-89-4140 2449 49-89-4140 2427 (secret.) Fax: 49-89-4140 7410 E-mail: manfred.schmitt@lrz.tum.de Schuller, Hildegard M., D.V.M., Ph.D., Professor And Head Experimental Oncology Laboratory, College of Veterinary Medicine, University of Tennessee, A201a Veterinary Teaching Ho Knoxville, TN 37996-4542 Tel: (865) 974-8217 e-mail: hmsch@utk.edu Slaga, Thomas J., Ph.D., President AMC Cancer Research Center (UICC International Directory of Cancer Institutes and Organisations) 1600 Pierce Street 80214 Denver Colorado, USA Tel: (303) 239-3372 e-mail: slagat@amc.org Soloway, Mark S., M.D., Department of Urology, McKnight Vision Research Building, University of Miami School of Medicine PO Box 016960 (M814), Miami, FL 33101; Phone: (305) 243-6596 Fax: (305) 243-4653

email: msoloway@miami.edu Srivastava, Sudhir, Ph.D., MPH, MS, Chief, Cancer Biomarkers Research Group National Cancer Institute Executive Plaza North 6130 Executive Boulevard, Room 330F MSC 7346 Bethesda, MD 20892-7346 Phone: 301/496-3983 Fax: 301/402-0816 E-Mail: srivasts@mail.nih.gov Stefanadis, Christodoulos, M.D., University of Athens, Medical School, Greece e-mail: cstefan@cc.uoa.gr Stein, Gary S Ph.D., Chairman Department of Cell Biology UNIVERSITY OF MASSACHUSETTS Medical School 55 Lake Avenue North Worcester, Massachusetts 01655 Phone: (508) 856-5625 Fax: (508) 856-6800 E-mail: gary.stein@umassmed.edu Tirelli, Umberto, National Cancer Institute, Via Pedemontana Occidentale 12, 33081 Aviano (PN), Italy; email: oma@cro.it Todo, Tomoki, M.D., Ph.D., Assistant Professor of Neurosurgery The University of Tokyo 7-3-1 Hongo Bunkyo-ku, Tokyo 113-8655 Japan TEL: +81-3-5800-8853 FAX: +81-3-5800-8655 E-mail: toudou-nsu@umin.ac.jp van der Burg, Sjoerd H, Ph.D., Department of Immunohematology and Blood Transfusion, Building 1, E3-Q, Leiden University Medical Center, P. O. Box 9600, 2300 RC Leiden, the Netherlands. Phone: 31-71-52-64-00-7; Fax: 31-71-52-16-75-1; E-mail: shvdburg@worldonline.nl Wadhwa, Renu, Ph. D., Gene Function Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan; Phone: +81 29 861 9464; Fax: +81 29 861 3019, e-mail: renu-wadhwa@aist.go.jp


Waldman, Scott A. M.D., Ph.D., Division of Clinical Pharmacology Departments of Internal Medicine and Pharmacology Thomas Jefferson University 132 South 10th Street 1170 Main Philadelphia, Pennsylvania 19107 email: scott.waldman@mail.tju.edu Walker, Todd Ph.D., School of Biomedical Sciences Charles Sturt University Wagga Wagga. NSW 2650 AUSTRALIA Tel: +61 2 6933 2541 Fax: +61 2 6933 2587 E-mail towalker@csu.edu.au Watson, Dennis K. Ph.D., Professor Department of Pathology and Laboratory Medicine Interim Director Laboratory of Cancer Genomics Tel: 843-792-3962 e-mail: watsondk@musc.edu Waxman, David J., Ph.D., Professor of Cell and Molecular Biology, Boston University Professor of Medicine, Boston University School of Medicine Department of Biology Division of Cell and Molecular Biology Boston University 5 Cummington Street Boston, MA 02215-2406 U.S.A. Phone: 617-353-7401 Fax: 617-353-7404 E-mail: djw@bu.edu Weinstein, Bernard I., M.D., D.Sci (Hon.), Frode Jensen Professor of Medicine Columbia University 701 West 168th Street, HHSC 1509 New York, NY 10032 phone: 212-305-6921 fax: 212-305-6889 e-mail: ibw1@columbia.edu Werner, Jochen Alfred M.D., Professor and Chairman Dept. of Otolaryngology, Head and Neck Surgery Philipps-University of Marburg Deutschhausstr. 3 35037 Marburg, Germany Phone: +49-6421-2866478

Associate Board Members Chen, Zhong, M.D, Ph.D., National Institute of Deafness and other Communication Disorders, National Institutes of Health, USA Dietrich Pierre Yves, M.D., Division of Oncology, Hopitaux Universitaires de GenFve Switzerland

Fax: +49-6421-2866519 e-mail: wernerj@med.uni-marburg.de Whiteside, Theresa L Ph.D., Professor Pathology University of Pittsburgh Cancer Institute and the Departments of Pathology Immunology and Otolaryngology University of Pittsburgh School of Medicine Pittsburgh PA Phone: 412-624-0096 e-mail: whitesidetl@msx.upmc.edu Wieand, Harry Samuel Ph.D., Professor Biostatistics One Sterling Plaza Suite 325 201 N. Craig Street Pittsburgh PA 15213 Telephone: 412-383-2243 Facsimile: 412-383-1535 Email: wieand@nsabp.pitt.edu Yamada, Akira Ph.D., Cancer Vaccine Development Division, Kurume University Research Center for Innovative Cancer Therapy, Asahi-machi 67, Kurume 830-0011, Japan. Phone: 81-942-31-7744; Fax: 81-942-31-7745; E-mail: akiymd@med.kurume-u.ac.jp Yu, Dihua M.D., Ph.D., Professor Dept. Surgical Oncology, Unit 107 Director of Research, Division of Surgery The Univ. Texas M. D. Anderson Cancer Center 1515 Holcombe Blvd. Houston, TX 77030 Tel: 713-792-3636 Fax: 713-794-4830 email: dyu@mdanderson.org Zagon, Ian S., Ph.D, Professor of Neuroscience and Anatomy Department affiliation: Neuroscience & Anatomy College of Medicine office address: Department of Neuroscience and Anatomy H-109 Hershey Medical Center Hershey PA 17033 office phone: 717-531-8650 fax: 717-531-5003 email: isz1@psu.edu


1211 Geneva 14 Switzerland Tel: +41-22-37 29 861 Fax: +41-22-37 29 858 e-mail: pierre-yves.dietrich@hcuge.ch Jeschke Marc G, M.D., Ph.D., Klinik und Poliklinik für Chirurgie Abteilung für Plastische Chirurgie und Handchirurgie Universität Erlangen-Nürnberg Krankenhausstr. 12 91054 Erlangen Tel: +49-9131-8533277 Fax: +49-9131-8539327 e-mail: Mcjeschke@hotmail.com Limacher Jean-Marc, M.D., Département d'Hématologie et d'Oncologie Hôpitaux Universitaires de Strasbourg 1 place de l'Hôpital 67091 STRASBOURG Cedex Tel : 03.88.11.57.85 Fax : 03.88.11.63.60 E-mail: Jean-Marc.Limacher@chru-strasbourg.fr Los Marek J, M.D., Ph.D., Associate Professor Department of Biochemistry and Medical Genetics, CFI Canada Research Chair in New Cancer Therapies Manitoba Institute of Cell Biology University of Manitoba, 675 McDermot Ave. Rm. ON6010 Winnipeg, MB R3E 0V9 Tel: (204) 787-2294 Fax: 787-2190 Lab: 787-1403; 787-4108 E-mail: losmj@cc.umanitoba.ca Mazda Osam, M.D., Ph.D., Associate professor Department of Microbiology, Kyoto Prefectural University of Medicine, Kamikyo, Kyoto 602-8566, Japan Phone: +81-75-251-5329 FAX: +81-75-251-5331 E-mail_mazda@basic.kpu-m.ac.jp Merlin Jean-Louis, Ph.D., Centre Alexis Vautrin National Cancer Institute University Henri Poincaré France Avenue de Bourgogne 54511 Vandœuvre Les Nancy cedex Tel: 03 83 59 83 07 Fax: 03 83 44 78 51 Email jl.merlin@nancy.fnclcc.fr Okada Takashi, M.D., Ph.D., Assistant professor Division of Genetic Therapeutics, Center for Molecular Medicine Jichi Medical School 3311-1 Yakushiji, Minami-kawachi, Tochigi 329-0498, JAPAN Phone: (+81) 285-58-7402, Fax: (+81) 285-44-8675 E-mail: tokada@jichi.ac.jp


Pisa Pavel, M.D, Ph.D., Associate Professor of Internal Medicine Senior lecturer in Clinical Experimental Oncology Department of Oncology Karolinska Hospital, Stockholm, Sweden Fax: +46-8-5177 6630; e-mail pavel.pisa@cck.ki.se Squiban Patrick, M.D., Executive VP Medical and Regulatory Affairs Transgene SA 11 rue de Molsheim Strasbourg 67000, France Tel + 33 (0)3 88 27 91 73 Fax + 33 (0)3 88 27 91 41 e-mail: squiban@transgene.fr Tsuchida Masanori, M.D., Ph.D., Division of Thoracic and Cardiovascular Surgery Niigata University Graduate School of Medical and Dental Sciences 1-757 Asahimachi, Niigata 951-8120, Japan Phone:025-227-2243 Fax:025-227-0780 e-mail:mtsuchi@med.Niigata-u.ac.jp Ulutin, C端neyt, M.D., G端lhane Military Medicine Academy Radiation Oncology Department, Mesire sok., 8/6 Etlik, 06018, Ankara, Turkey e-mail: culutin@yahoo.com Xu Ruian, Ph.D., Gene Therapy Laboratory, IMB, The University of Hong Kong, Hong Kong Honorary Professor of Basic Medical School, Peking Union Medical College Tel: 00852-22990757 Fax: 00862-28179488 E-mail: rxua@hkucc.hku.hk

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org


Cancer Therapy Vol 1

Table of contents Cancer Therapy Vol 1, December 2003

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

1-9

Research Article

Intraarterial chemotherapy and chemoembolization in head and neck cancer. Establishment as a neoadjuvant routine method

Adorján F. Kovács

11-19

Review Article

Current aspects in the treatment of patients with relapsed or refractory testicular cancer

Oliver Rick, Jörg Beyer, Thomas Braun, Kurt Possinger, Wolfgang Siegert

21-29

Research Article

Gene expression profiles related with overcoming cisplatin resistance in human cancer cell lines

Moonkyu Kim, Young Jin Park, Ok Ju Kim, Gab Yong Lee, Eun Jung Chung, Young Kwan Sung, Jung Chul Kim, Insook Han, Youn Soo Sohn

31-37

Research Article

Vascular endothelial growth factor modulates cisplatin sensitivity in human ovarian carcinoma cells

Guodong Hu, Sean Ryan, Yunfeng Zhu, Eddie Reed, Xiping Li, Gangduo Wang, and Qingdi Q. Li

39-46

Research Article

Overexpression of angiogenic growth factors in lung cancer cells is associated with cisplatin resistance

Xiping Li, Xuyi Liu, Jie Wang, Zengli Wang, Wei Jiang, Eddie Reed, Yi Zhang, Yuanlin Liu, and Qingdi Q. Li

47-61

Review Article

Cisplatin nephrotoxicity: molecular mechanisms

Marie H. Hanigan and Prasad Devarajan

63-70

Research Article

Mitoxantrone, prednisone, pentostatin and bleomycin for patients with indolent non-Hodgkin’s lymphoma relapsed or unresponsive to previous treatments. Results of a phase II study conducted by the Gruppo Italiano per lo Studio dei Linfomi (GISL)

Massimo Federico, Vincenzo Callea, Romano Danesi, Antonella Montanini, Nicola Di Renzo, Mario Petrini, Mario Del Tacca, Maria Angela Sirotti, Giovanni Santacroce, Alberto Bagnulo, Matteo Dell’Olio and Maura Brugiatelli for GISL

71-79

Review Article

Chemotherapy in elderly patients with advanced breast cancer

Giuseppe Colantuoni, Antonio Rossi, Carmine Ferrara, Dario Nicolella, Filomena Del Gaizo, Ciro Guerriero, Giuseppe Airoma, Maria Luisa Barzelloni, Paolo Maione, Vincenzo Salerno, Cesare Gridelli


81-91

Review Article

Drug resistance in breast cancer

Hermann Lage

93-101

Review Article

Screening for lung cancer: a review and current status

Debora S. Bruno and William Tester

103-107

Research Article

Expression of RB1CC1, a novel tumor suppressor gene, is inversely correlated with the Ki-67 proliferation index in primary breast cancers

Koji Teramoto, Tokuhiro Chano, Yoshitomo Ozaki, Satoru Sawai, Noriaki Tezuka, Keiichi Kontani, Shozo Fujino, Hidetoshi Okabe

109-120

Research Article

Approaches to the treatment of brain tumors using cytokine-secreting allogeneic fibroblasts

Terry Lichtor, Roberta P Glick, Edward P Cohen

121-131

Research Article

Safety, feasibility and clinical benefit of localized chemotherapy using microencapsulated cells for inoperable pancreatic carcinoma in a phase I/II trial

Matthias Löhr, Jens-Christian Kröger, Anne Hoffmeyer, Mathias Freund, Johannes Hain, Albrecht Holle, Wolfram T. Knöfel, Stefan Liebe, Horst Nizze, Matthias Renner, Robert Saller, Petra Müller, Thomas Wagner, Karlheinz Hauenstein, Brian Salmons and Walter H. Günzburg

133-142

Review Article

Electrochemotherapy: advantages and drawbacks in treatment of cancer patients

Gregor Sersa, Maja Cemazar, and Zvonimir Rudolf

143-151

Research Article

p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells

Yi Lu, Jun Zhang, Derrick J. Beech, Linda K. Myers, and Lisa K. Jennings

153-162

Research Article

Wenyin Shi and Dietmar W. Siemann Basic fibroblast growth factor antisense oligonucleotides inhibit renal cell carcinoma cell growth and angiogenesis

163-171

Review Article

Antitumoral cell-based therapies

173-178

Research Article

Can mortalin be a candidate target for Renu Wadhwa, Kazunari Taira and Sunil C Kaul cancer therapy?

179-190

Review Article / Hypothesis

Therapeutic potential of antinuclear autoantibodies in cancer

Vladimir P. Torchilin, Leonid Z. Iakoubov, Zeev Estrov

191-196

Research Article

Filgrastim use: evaluation in cancer and critically ill non- cancer patients

Yolande B. Saab, Leyla Sharaf, Ismail Zeidan, Abdelrahman Bizri

Javier García-Castro, Daniel Rubio, Ricardo de la Fuente, Antonio Bernad


Cancer Therapy Vol 1

197-202

Research Article

Gemcitabine, cisplatin, fluorouracil and folinic acid as first line treatment of locally advanced and/or metastatic pancreatic cancer: a phase II study of the gruppo oncologico dell’Italia meridionale (G.O.I.M.)

Vittorio Gebbia, Francesco Giuliani, Generoso Uomo, Evaristo Maiello, Maria Rosaria Valerio, Nicolo Borsellino, Nicolò Gebbia, Giuseppe Colucci

203-208

Research Article

Phase I study of high dose 5fluorouracil and folinic acid in weekly continuous infusions

Jean-Marc Limacher, Bernard Duclos, Patrick Dufour, Jean-Marie Wihlm, Dominique Leveque, François Jehl, François Eichler, Roger Keiling, Shanti Natarajan-Ame, Jean-Emmanuel Kurtz, Jean-Pierre Bergerat

209-213

Research Article

High-dose methotrexate with citrovorum factor for malignant fibrous histiocytoma of soft tissue: a cell culture study

Toshiaki Hitora, Takashi Marui, Tetsuji Yamamoto, Toshihiro Akisue, Teruya Kawamoto, Keiko Nagira, Tetsuya Nakatani, Shinichi Yoshiya, Masahiro Kurosaka

215-221

Research Article

Phase II intergroup trial of sequential chemotherapy and radiotherapy for AIDS-related primary central nervous system lymphoma

Richard F Ambinder, Sandra Lee, Walter J Curran, Joseph A Sparano, Robert L Krigel, Justin McArthur, Christopher Schultz, Carl E Freter, Leslie Kaplan, Jamie H VonRoenn

223-232

Review Article

Sentinel lymph node biopsy for breast cancer: addressing the controversies

Anees Chagpar, John Pilavas, Celia Chao, Robert C.G. Martin II, Kelly M. McMasters

233-236

Research Article

A randomised, double-blind, phase II study of three different marimastat schedules administered to patients with resected Dukes C colorectal cancer

Philippa G. Corrie, David J. Kerr, Kim Bennett, Charles B. Wilson, Rachel Midgley, Peter Brown

237-244

Review Article

LY900003: A novel compound for the treatment of non-small cell lung cancer

Susannah E. Motl

245-256

Research Article

Activity of chemotherapy and immunotherapy on malignant mesothelioma: a systematic review of the literature with meta-analysis

Thierry Berghmans, Jean-Jacques Lafitte, Céline Mascaux, Anne-Pascale Meert, Marianne Paesmans and JeanPaul Sculier

257-261

Research Article

Expression of insulin-like growth factors and their receptors in malignant fibrous histiocytoma of soft tissues

Tetsuji Yamamoto, Toshihiro Akisue, Tetsuya Nakatani, Takashi Marui, Ikuo Fujita, Keiji Matsumoto, Toshiaki Hitora, Teruya Kawamoto, Keiko Nagira, Masahiro Kurosaka


263-268

Review Article

Ethical, cultural and religious aspects of hereditary cancer in Jewish communities

Mark Levin

269-273

Review Article

Selective intraarterial cisplatin chemotherapy in treatment of advanced malignant squamous cell carcinoma of the head and neck

Afshin Teymoortash and Jochen A.Werner

275-281

Review Article

Protein kinase C-! and its downstream effectors as potential targets for cancer therapy

Jihua Liu, David Durrant and Ray M. Lee

283-291

Reserach Article

293-298

A Phase I Safety and Imaging Study Using Radiofrequency Ablation (RFA) Followed by 131I-chTNT-1/B Radioimmunotherapy Adjuvant Treatment of Hepatic Metastases

Peter M. Anderson, Gregory A. Wiseman, Bradley D. Lewis, J. William Charboneau, William L. Dunn, Susan P. Carpenter, Terrence Chew

Reserach Article

Allelic loss at the SEP15 locus in breast cancer

Mohamed A. Nasr, Ya Jun Hu, and Alan M. Diamond

299-314

Review Article

Dendritic cell based vaccines for immunotherapy of colorectal cancer

Asim Saha, Sunil K. Chatterjee, Kartik Mohanty, Kenneth A. Foon, Malaya Bhattacharya-Chatterjee

315-322

Review Article

Multitargeted antifolate (Pemetrexed): A comprehensive review of its mechanisms of action, recent results and future prospects

Delphine Exinger, Franรงoise Exinger, Bertrand Mennecier, Jean-Marc Limacher, Patrick Dufour, JeanEmmanuel Kurtz

323-333

Review Article

Molecular therapy of gastric cancer

Jie Chen, Minhu Chen, Christoph Rรถcken , Tobias Gรถtze, Peter Malfertheiner and Matthias P.A. Ebert

335-342

Review Article

Tumor angiogenesis as a strategy for radiosensitization

Bo Lu, Dong W. Kim, Dennis E. Hallahan

343-351

Review Article

p14ARF: Role in the cellular stress response and applications to cancer

Yinghui Huang and Ruth A. Gjerset

353-362

Review Article

The role of B lymphocytes in breast cancer: a review and current status

Sazini Nzula, James J. Going, David I. Stott

363-371

Review Article

Advances in breast cancer therapy and chemoprevention: current strategies and new approaches

Brittney-Shea Herbert


Cancer Therapy Vol 1

373-391

Review Article

Treatment planning in endometrial cancer

Angiolo Gadducci, Stefania Cosio, Andrea Riccardo Genazzani

393-405

Review Article

Dendritic cell-mediated immunosuppression in malignant melanoma

Marta E Polak, Nicola J Borthwick, Martine J Jager, Ian A Cree


CANCER THERAPY Addresses of Members of the Editorial Board FREE ACCESS www.cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd. Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!!! Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!! Editorial Board

Richard J. Ablin, Ph.D., Research Professor Department of Microbiology and Immunology and the Arizona Cancer Center University of Arizona College of Medicine 1501 N. Campbell Avenue P.O. Box 245049 Tucson, AZ 85724-5049 Telephone: 520-622-8319 Facsimile: 520-622-0518 E-mail: ablinrj@email.arizona.edu President, Robert Benjamin Ablin Foundation for Cancer Research 115 Franklin Turnpike, Suite 200 Mahwah, NJ 07430 E-mail: ablinrj@prostatefoundation.org Armand, Jean Pierre, M.D. Ph.D., Chairman Protocol Review European Organization for Research and Treatment of Cancer (EORTC) Avenue Mounier 83 bte 11 B-1200 Brussels Belgium Department of Medicine Gustave Roussy Institute

Villejuif France E-mail: armand@igr.fr Aurelian, Laure, Ph.D., Professor Departments of Pharmacology and Experimental Therapeutics University of Maryland School of Medicine Baltimore 21201 USA Tel.: +1-410-706-3895; fax: +1-410-706-2513; email: laurelia@umaryland.edu Berdel, Wolfgang E, M.D., Department of Medicine/Hematology University Hospitals Munster Germany Albert-Schweitzer-StraĂ&#x;e 33 48149 MĂźnster Tel. +49-(0)251-83-47587 Fax +49-(0)251-83-47588 E-Mail: berdel@uni-muenster.de Beyan, Cengiz, M.D., Gulhane Military Medical Academy Department of Hematology Etlik, 06010 Ankara, Turkey Tel: +312.304 4101 Fax: +312.304 4100 E-mail: cbeyan@yahoo.com,


cengizbeyan@hotmail.com Bottomley, Andrew, PhD, Quality of Life Unit, European Organization for Research and Treatment of Cancer Data Center, Avenue E. Mounier 83/11, 1200 Brussels, Belgium; email: abo@eortc.be Bouros, Demosthenes, M.D., Demokritus University of Thrace Medical school, Department of Pneumonology University Hospital of Alexandroupolis 68100 Alexandroupolis Greece Phone: +30-25510-76105 Fax: +30-25510-76106 e-mail: bouros@med.duth.gr Cabanillas, Fernando, M.D, Chairman, Professor, Department of Hematology, Division of Lymphoma/Myeloma The University of Texas M. D. Anderson Cancer Center, Houston, Texas e-mail: fcabanil@mail.mdanderson.org Castiglione, Monica, MHA, SIAK/IBCSG Director SIAK/IBCSG Coordinating Center Effingerstrasse 40 3008 Bern (Switzerland) Tel. +41 31 389 91 91 Fax +41 31 389 92 00 e-mail: monica.castiglione@siak.ch Chou, Kuo-Chen, Ph.D., D.Sc., Gordon Life Science Institute, 13784 Torrey Del Mar Drive, San Diego, California 92130. Tel: 858-484-1018. E-mail: kchou@san.rr.com Chu, Kent-Man, MD, Division of Upper Gastrointestinal Surgery, Department of Surgery, University of Hong Kong Medical Center, Queen Mary Hospital, Pokfulam, Hong Kong, China; email: chukm@hku.hk Chung, Leland W.K, Ph.D., Professor & Director Of Research Department of Urology B4100 Winship Cancer Institute 1365B Clifton Rd Phone: 404 778-4319 Email: lwchung@emory.edu Coukos, George, M.D., Ph.D., Center for Research on Reproduction and Women's

Health Department of Obstetrics and Gynecology University of Pennsylvania Medical Center 1209 Biomedical Research Building II/III 421 Curie Boulevard Philadelphia, PA 19104-6142 Phone: 215-662-3316 Fax: 215-573-7627 E-Mail: gcks@mail.med.upenn.edu Darzynkiewicz, Zbigniew, M.D., Ph.D., Director, Brander Cancer Research Institute New York Medical College 19 Bradhurst Ave. Hawthorne, NY 10532 tel: 914-347-2801 fax: 914-347-2804 e-mail: darzynk@nymc.edu Devarajan, Prasad M.D., Director, Nephrology & Hypertension, Cincinnati Children’s Hospital Medical Center, MLC 7022, 3333 Burnet Avenue, Cincinnati, OH 45229-3039. Phone: 513-636-4531. FAX: 513-636-7407. E-mail: prasad.devarajan@cchmc.org Der, Channing J. Ph.D, Professor Pharmacology Molecular Therapeutics Lineberger Comprehensive Cancer Center CB# 7295 Chapel Hill NC 27599 Telephone: (919) 966-5634 FAX: (919) 966-0162 e-mail: cjder@med.unc.edu Dritschilo, Anatoly, M.D., Department of Radiation Medicine Georgetown University Hospital 3800 Reservoir Road, NW Washington, D.C. 20007 Tel: (202) 687-2144 e-mail: DRITSCHA@gunet.georgetown.edu Duesberg, Peter H., Ph.D, Professor Department of Molecular & Cell Biology c/o Stanley/Donner Administrative Services Unit 229 Stanley Hall #3206 University of California at Berkeley Berkeley, CA 94720-3206 Fax: (510) 643-6455 Email: duesberg@uclink4.berkeley.edu El-Deiry, Wafik S. M.D., Ph.D., Associate Professor of Medicine (Hem/Onc), Genetics, and Pharmacology Howard Hughes Medical Institute, University of Pennsylvania School of Medicine, 437 Clinical Research Building Philadelphia, PA 19104, USA Tel: 215-898-9015 Fax: 215-573-9139 Email: Wafik@mail.med.upenn.edu


Federico, Massimo, M.D. Dipartimento di Oncologia ed Ematologia, Centro Oncologico Modenese, Università di Modena e Reggio Emilia, Policlinico – Via del Pozzo 71, 41100 Modena, Italy. Phone +39-059-4224547; Fax +39-059-4224549; e-mail: federico@unimore.it

Gridelli, Cesare M.D., Divisione di Oncologia Medica, Azienda Ospedaliera "S.G.Moscati", via Circumvallazione, 83100 Avellino, Italy Tel :39-0825-203573; Fax. :39-0825-203556; E-mail:cgridelli@libero.it

Fiebig, Heiner H, Albert-Ludwigs-Universität Klinik für Tumorbiologie Breisacher Straße 117 79106 Freiburg, Germany Tel: (+49) 761-51 55 9 11 e-mail: fiebig@ruf.uni-freiburg.de

Hengge, Ulrich, M.D., Department of Dermatology Heinrich-Heine-University Duesseldorf Moorenstrasse 5 40212 Duesseldorf Tel.: +49 (0)211 - 811 8066 Fax: +49 (0)211 - 811 8700 E-Mail: ulrich.hengge@uni-duesseldorf.de

Fine, Howard A., M.D., Branch Chief Neuro-Oncology Branch Building 10, Room 12S245 10 Center Drive Bethesda, MD 20892 Phone: 301-402-6298 Fax: 301-480-2246 E-Mail: hfine@mail.nih.gov Frustaci, Sergio, M.D., Division of Medical Oncology, Centro di Riferimento Oncologico di Aviano, Via Pedemontana Occ. 12, 33170 Aviano (PN), Italy; email: sfrustaci@cro.it Georgoulias, Vassilis, MD, PhD Professor of Medical Oncology University General Hospital of Heraklion Dpt of Medical Oncology Tel: +30 2810 392750 Fax: + 30 2810 392802 E-mail: georgoul@med.uoc.gr Giordano, Antonio, M.D., Ph.D., Sbarro Institute for Cancer Research and Molecular Medicine Professor of Biology and Medicine College of Science and Technology Temple University BioLife Science Bldg. Suite 333 1900 N 12th Street Philadelphia PA 19122 Tel: 215-204 9520 Fax: 215-204 9522 E-Mail: antonio.giordano@temple.edu Greene, Frederick Leslie, M.D., Chairman, Department of General Surgery Carolinas Medical Center 1000 Blythe Boulevard., PO Box 32861 Charlotte, NC 28232-2861 Phone: 704/355-3176 Fax: 704/355-5619 E-Mail: rgreene@carolinas.org

Huber, Christian M.D., Chair of the Department for Oncology and Hematology of the University of Mainz Medizinische Klinik und Poliklinik Johannes-Gutenberg-University Langenbeckstrasse 1 55131 Mainz GERMANY Tel.:49-6131-177-281 Fax:49-6131-17-3446 E-mail:ch.huber@3-med.klinik.uni-mainz.de Hunt, Kelly, M.D., Associate Professor Department of Surgical Oncology, Unit 444 Chief, Surgical Breast Section The University of Texas M. D. Anderson Cancer Center 1515 Holcombe Blvd. Houston, TX 77030 Tel: 713-792-7216 Fax: 713-792-4689 email: khunt@mdanderson.org Kamen, Barton A., M.D. Ph.D, Professor of Medicine Specialty: Pediatrics - Board Certified SubSpecialty: Hematology - Board Certified 195 Little Albany Street New Brunswick NJ 08903 Telephone: (732) 235-8131 E-mail: kamenba@umdnj.edu Kazuma, Ohyashiki, M.D., Ph.D., Chairman and professor of the First Department of Internal Medicine, Tokyo Medical University, 6-7-1 Nishishinjuku, Shinjuku-ku, Tokyo, Japan. Phone: international+81-3-33426111 Fax: international+81-3-53816651 E-mail: ohyashik@rr.iij4u.or.jp Kinsella, Timothy J. M.D.,


Professor, Radation Oncology The research Institute of University Hospitals in Cleveland 11100 Euclid Avenue Cleveland, OH 44106 Mail Stop: LTR 6068 Department Phone: 216-844-2530 Department Fax: 216-844-4799 e-mail: tjk4@po.cwru.edu

Hong Kong SAR, China; email: waitongleung@cuhk.edu.hk

Kmiec, Eric B, Ph.D., University of Delaware Department of Biological Sciences Delaware Biotechnology Institute Innovation Way Room 270 Newark, Delaware 19716 Tel: (302) 831-3420 Fax: (302) 831-3427 E-mail: ekmiec@udel.edu

Lichtor, Terry M.D., Ph.D., Department of Neurosurgery, 1900 West Polk Street Chicago, Illinois 60612 Telelphone: 312-864-5120; Fax: 312-864-9606; e-Mail: Terry_Lichtor@rush.edu

Kosmidis Paris, M.D. ESMO President 2nd Medical Oncology Department, Hygeia Hospital, 2 An Tsoha & Vas Sofias Ave, 11521 Athens, Greece; email: parkosmi@otenet.gr Koukourakis, Michael, M.D. Ass.Professor - Head Dept. of Radiotherapy and Oncology Democritus University of Thrace Alexandroupolis 68100, Greece tel -30-6932-480808, fax: -30-25510-74623 Email: targ@her.forthnet.gr

Levin, Mark M.D., Director, Sister Regina Lynch Regional Cancer Center Holy Name Hospital 718 Teaneck Road Teaneck NJ 17666 e-mail: mlevinmd@aol.com

Liebermann, Dan A., Ph.D., Professor Fels Institute for Cancer Research and Molecular Biology and the Department of Biochemistry Temple University School of Medicine 3307 N. Broad Street Philadelphia, PA 19140 Tel: 215 707 6903 FAX: 215 707 2805 Email: lieberma@temple.edu, lieberma@unix.temple.edu Lipps, Hans J, Ph.D., Institut f체r Zellbiologie Universit채t Witten/Herdecke Stockumer Str. 10 58448 Witten -GermanyTel.: (49) 2302 669144 Fax.: (49) 2302 669220 e-mail: lipps@uni-wh.de

Kroemer, Guido, M.D. Ph.D Research Director CNRS-UMR1599 Institut Gustave Roussy, Pavillon de Recherche 1 39, rue Camille Desmoulins 94805 VILLEJUIF FRANCE Tel : 33-1- 42 11 60 46 Fax: 33-1- 42 11 60 47 or 33-1-42 11 52 44 E-mail : kroemer@igr.fr, kroemer@pobox.igr.fr

Lokeshwar, Balakrishna L., Ph.D., Tenured Associate Professor Department of Urology, McKnight Vision Research Building, University of Miami School of Medicine, P.O. Box 016960 (D880), Miami, FL 33101, USA Fax: +305-243-6893 e-mail: blokeshw@med.miami.edu

Kurzrock, Razelle, M.D., F.A.C.P., Department of Bioimmunotherapy, University of Texas M.D. Anderson Cancer Center; 1515 Holcombe Blvd, Box 422, Houston, TX 77030; email: rkurzroc@mdanderson.org

Mackiewicz, Andrzej, M.D., Ph.D., Head of The Dept. of Cancer Immunology, Chair of Oncology, University School of Medical Sciences (USOMS) at GreatPoland Cancer Center, Poznan, Poland e-mail: amac@amu.edu.pl

Leung, Thomas Wai-Tong M.D., Department of Clinical Oncology, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, New Territories,

Marin, Jose J. G., Ph.D., Campus Miguel de Unamuno, ED-S09. 37007-Salamanca, SPAIN Tel: +34-923-294674 Fax: +34-923-294669 mail: jjgmarin@usal.es


McMasters, Kelly M., M.D., Ph.D., Sam and Lolita Weakley Professor of Surgical Oncology University of Louisville, J. Graham Brown Cancer Center 315 E. Broadway, Suite 305 Louisville, KY 40202 502-629-3380 phone 502-629-3393 fax kelly.mcmasters@nortonhealthcare.org Morishita, Ryuichi, M.D., Ph.D., Division of Clinical Gene Therapy, Graduate School of Medicine, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan. E-mail morishit@cgt.med.osaka-u.ac.jp Mukhtar, Hasan PhD, Department of Dermatology, University of Wisconsin Medical School Center, Room B25, 1300 University Avenue, Madison, WI 53706; email: hmukhtar@wisc.edu Norris, James Scott, Ph.D., Department of Microbiology and Immunology, Medical University of South Carolina, 173 Ashley Avenue, Charleston, South Carolina 29425, USA. e-mail: Norrisjs@musc.edu Palu, Giorgio, M.D., Department of Histology, Microbiology, and Medical Biotechnologies, University of Padova, Via Gabelli 63, I-35121 Padova, Italy. E-mail: giorgio.palu@unipd.it Park, Jae-Gahb, M.D., Ph.D., Professor Laboratory of Cell Biology Cancer Research Institute Seoul National University College of Medicine, 28 Yongon-dong, Chongno-gu, Seoul 110-744, Korea Tel : 82-2-760-3380 / Fax : 82-2-742-4727 E-mail : jgpark@plaza.snu.ac.kr Perez-Soler, Roman M.D., Professor, Chief, Division of Oncology , Department of Medicine Montefiore Medical Center The Albert Einstein Cancer Center 111 East 210th Street Hofheimer Main , Room 100

Bronx, NY, 10467 Tel: 718-920-4001 e-mail: rperezso@montefiore.org Peters, Godefridus J., Ph.D., Department of Medical Oncology VU University Medical Center (VUMC) PO Box 7057 1007 MB Amsterdam The Netherlands Phone: +31-20-4442633 Fax: +31-20-4443844 E-mail: gj.peters@vumc.nl Poon, Ronnie Tung-Ping, M.D., Associate Professor Department of Surgery, Queen Mary Hospital, 102 Pokfulam Rd, Hong Kong, China; email: poontp@hkucc.hku.hk Possinger Kurt-Werner, M.D., Division of Oncology/Hematology, School of Medicine (Charité), Humboldt University, Schumannstr. 20/21, 10117, Berlin, Germany Tel: +49 30 450-513002 Fax: +49 30 450-513952 e-mail: kurt.possinger@charite.de Rainov G Nikolai M.D., D.Sc., Department of Neurological Science Clinical Sciences Center The University of Liverpool Lower Lane Liverpool L9 7LJ Telephone: 0151 529 5323 Fax: 0151 529 5465 E-mail: N.G.Rainov@liverpool.ac.uk Randall, E Harris, M.D., Ph.D., The Ohio State University School of Public Health B-121 Starling Loving Hall 320 West 10th Avenue Columbus, Ohio 43210 Phone: (614) 293-3903 Fax: (614) 293-3937 Email: harris.44@postbox.acs.ohio-state.edu Ravaioli Alberto, M.D. Divisione di Oncologia ed Onco-Ematologia Ospedale Infermi Via Settembrini, 2 47900 Rimini Italy Tel/fax 0039 – 0541 – 705567 e-mail: aravaiol@auslrn.net Remick, Scot, C. M.D., Division of Hematology/Oncology, University Hospitals of Cleveland,


11100 Euclid Ave, Cleveland, OH; email: scr@po.cwru.edu Rhim, Johng S M.D., Professor and Associate Director Center for Prostate Disease Research, Uniformed Services University of Health Sciences, 4301 Jones Bridge Road, Bethesda MD 20814-4799, USA. Phone: 301-319-8223 Fax: 301-295-1978 e-mail: jrhim@cpdr.org Schadendorf, Dirk, M.D., Klinische Kooperationseinheit für Dermato-Onkologie (DKFZ) an der Universitäts-Hautklinik Mannheim Theodor Kutzer Ufer 1 68135 Mannheim Tel.: (0621)383 - 2126, Fax: (0621) 383 – 2163 e-mail: d.schadendorf@dkfz.de Schmitt, Manfred, Ph.D., Vice-Chairman (EORTC) Frauenklinik der Technischen Universität München Klinikum rechts der Isar Ismaninger Str. 22 D-81675 München Germany Tel: 49-89-4140 2449 49-89-4140 2427 (secret.) Fax: 49-89-4140 7410 E-mail: manfred.schmitt@lrz.tum.de Schuller, Hildegard M., D.V.M., Ph.D., Professor And Head Experimental Oncology Laboratory, College of Veterinary Medicine, University of Tennessee, A201a Veterinary Teaching Ho Knoxville, TN 37996-4542 Tel: (865) 974-8217 e-mail: hmsch@utk.edu Slaga, Thomas J., Ph.D., President AMC Cancer Research Center (UICC International Directory of Cancer Institutes and Organisations) 1600 Pierce Street 80214 Denver Colorado, USA Tel: (303) 239-3372 e-mail: slagat@amc.org Soloway, Mark S., M.D., Department of Urology, McKnight Vision Research Building, University of Miami School of Medicine PO Box 016960 (M814), Miami, FL 33101; Phone: (305) 243-6596 Fax: (305) 243-4653

email: msoloway@miami.edu Srivastava, Sudhir, Ph.D., MPH, MS, Chief, Cancer Biomarkers Research Group National Cancer Institute Executive Plaza North 6130 Executive Boulevard, Room 330F MSC 7346 Bethesda, MD 20892-7346 Phone: 301/496-3983 Fax: 301/402-0816 E-Mail: srivasts@mail.nih.gov Stefanadis, Christodoulos, M.D., University of Athens, Medical School, Greece e-mail: cstefan@cc.uoa.gr Stein, Gary S Ph.D., Chairman Department of Cell Biology UNIVERSITY OF MASSACHUSETTS Medical School 55 Lake Avenue North Worcester, Massachusetts 01655 Phone: (508) 856-5625 Fax: (508) 856-6800 E-mail: gary.stein@umassmed.edu Tirelli, Umberto, National Cancer Institute, Via Pedemontana Occidentale 12, 33081 Aviano (PN), Italy; email: oma@cro.it Todo, Tomoki, M.D., Ph.D., Assistant Professor of Neurosurgery The University of Tokyo 7-3-1 Hongo Bunkyo-ku, Tokyo 113-8655 Japan TEL: +81-3-5800-8853 FAX: +81-3-5800-8655 E-mail: toudou-nsu@umin.ac.jp van der Burg, Sjoerd H, Ph.D., Department of Immunohematology and Blood Transfusion, Building 1, E3-Q, Leiden University Medical Center, P. O. Box 9600, 2300 RC Leiden, the Netherlands. Phone: 31-71-52-64-00-7; Fax: 31-71-52-16-75-1; E-mail: shvdburg@worldonline.nl Wadhwa, Renu, Ph. D., Gene Function Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan; Phone: +81 29 861 9464; Fax: +81 29 861 3019, e-mail: renu-wadhwa@aist.go.jp


Waldman, Scott A. M.D., Ph.D., Division of Clinical Pharmacology Departments of Internal Medicine and Pharmacology Thomas Jefferson University 132 South 10th Street 1170 Main Philadelphia, Pennsylvania 19107 email: scott.waldman@mail.tju.edu Walker, Todd Ph.D., School of Biomedical Sciences Charles Sturt University Wagga Wagga. NSW 2650 AUSTRALIA Tel: +61 2 6933 2541 Fax: +61 2 6933 2587 E-mail towalker@csu.edu.au Watson, Dennis K. Ph.D., Professor Department of Pathology and Laboratory Medicine Interim Director Laboratory of Cancer Genomics Tel: 843-792-3962 e-mail: watsondk@musc.edu Waxman, David J., Ph.D., Professor of Cell and Molecular Biology, Boston University Professor of Medicine, Boston University School of Medicine Department of Biology Division of Cell and Molecular Biology Boston University 5 Cummington Street Boston, MA 02215-2406 U.S.A. Phone: 617-353-7401 Fax: 617-353-7404 E-mail: djw@bu.edu Weinstein, Bernard I., M.D., D.Sci (Hon.), Frode Jensen Professor of Medicine Columbia University 701 West 168th Street, HHSC 1509 New York, NY 10032 phone: 212-305-6921 fax: 212-305-6889 e-mail: ibw1@columbia.edu Werner, Jochen Alfred M.D., Professor and Chairman Dept. of Otolaryngology, Head and Neck Surgery Philipps-University of Marburg Deutschhausstr. 3 35037 Marburg, Germany Phone: +49-6421-2866478

Associate Board Members Chen, Zhong, M.D, Ph.D., National Institute of Deafness and other Communication Disorders, National Institutes of Health, USA Dietrich Pierre Yves, M.D., Division of Oncology, Hopitaux Universitaires de GenFve Switzerland

Fax: +49-6421-2866519 e-mail: wernerj@med.uni-marburg.de Whiteside, Theresa L Ph.D., Professor Pathology University of Pittsburgh Cancer Institute and the Departments of Pathology Immunology and Otolaryngology University of Pittsburgh School of Medicine Pittsburgh PA Phone: 412-624-0096 e-mail: whitesidetl@msx.upmc.edu Wieand, Harry Samuel Ph.D., Professor Biostatistics One Sterling Plaza Suite 325 201 N. Craig Street Pittsburgh PA 15213 Telephone: 412-383-2243 Facsimile: 412-383-1535 Email: wieand@nsabp.pitt.edu Yamada, Akira Ph.D., Cancer Vaccine Development Division, Kurume University Research Center for Innovative Cancer Therapy, Asahi-machi 67, Kurume 830-0011, Japan. Phone: 81-942-31-7744; Fax: 81-942-31-7745; E-mail: akiymd@med.kurume-u.ac.jp Yu, Dihua M.D., Ph.D., Professor Dept. Surgical Oncology, Unit 107 Director of Research, Division of Surgery The Univ. Texas M. D. Anderson Cancer Center 1515 Holcombe Blvd. Houston, TX 77030 Tel: 713-792-3636 Fax: 713-794-4830 email: dyu@mdanderson.org Zagon, Ian S., Ph.D, Professor of Neuroscience and Anatomy Department affiliation: Neuroscience & Anatomy College of Medicine office address: Department of Neuroscience and Anatomy H-109 Hershey Medical Center Hershey PA 17033 office phone: 717-531-8650 fax: 717-531-5003 email: isz1@psu.edu


1211 Geneva 14 Switzerland Tel: +41-22-37 29 861 Fax: +41-22-37 29 858 e-mail: pierre-yves.dietrich@hcuge.ch Jeschke Marc G, M.D., Ph.D., Klinik und Poliklinik für Chirurgie Abteilung für Plastische Chirurgie und Handchirurgie Universität Erlangen-Nürnberg Krankenhausstr. 12 91054 Erlangen Tel: +49-9131-8533277 Fax: +49-9131-8539327 e-mail: Mcjeschke@hotmail.com Limacher Jean-Marc, M.D., Département d'Hématologie et d'Oncologie Hôpitaux Universitaires de Strasbourg 1 place de l'Hôpital 67091 STRASBOURG Cedex Tel : 03.88.11.57.85 Fax : 03.88.11.63.60 E-mail: Jean-Marc.Limacher@chru-strasbourg.fr Los Marek J, M.D., Ph.D., Associate Professor Department of Biochemistry and Medical Genetics, CFI Canada Research Chair in New Cancer Therapies Manitoba Institute of Cell Biology University of Manitoba, 675 McDermot Ave. Rm. ON6010 Winnipeg, MB R3E 0V9 Tel: (204) 787-2294 Fax: 787-2190 Lab: 787-1403; 787-4108 E-mail: losmj@cc.umanitoba.ca Mazda Osam, M.D., Ph.D., Associate professor Department of Microbiology, Kyoto Prefectural University of Medicine, Kamikyo, Kyoto 602-8566, Japan Phone: +81-75-251-5329 FAX: +81-75-251-5331 E-mail_mazda@basic.kpu-m.ac.jp Merlin Jean-Louis, Ph.D., Centre Alexis Vautrin National Cancer Institute University Henri Poincaré France Avenue de Bourgogne 54511 Vandœuvre Les Nancy cedex Tel: 03 83 59 83 07 Fax: 03 83 44 78 51 Email jl.merlin@nancy.fnclcc.fr Okada Takashi, M.D., Ph.D., Assistant professor Division of Genetic Therapeutics, Center for Molecular Medicine Jichi Medical School 3311-1 Yakushiji, Minami-kawachi, Tochigi 329-0498, JAPAN Phone: (+81) 285-58-7402, Fax: (+81) 285-44-8675 E-mail: tokada@jichi.ac.jp


Pisa Pavel, M.D, Ph.D., Associate Professor of Internal Medicine Senior lecturer in Clinical Experimental Oncology Department of Oncology Karolinska Hospital, Stockholm, Sweden Fax: +46-8-5177 6630; e-mail pavel.pisa@cck.ki.se Squiban Patrick, M.D., Executive VP Medical and Regulatory Affairs Transgene SA 11 rue de Molsheim Strasbourg 67000, France Tel + 33 (0)3 88 27 91 73 Fax + 33 (0)3 88 27 91 41 e-mail: squiban@transgene.fr Tsuchida Masanori, M.D., Ph.D., Division of Thoracic and Cardiovascular Surgery Niigata University Graduate School of Medical and Dental Sciences 1-757 Asahimachi, Niigata 951-8120, Japan Phone:025-227-2243 Fax:025-227-0780 e-mail:mtsuchi@med.Niigata-u.ac.jp Ulutin, C端neyt, M.D., G端lhane Military Medicine Academy Radiation Oncology Department, Mesire sok., 8/6 Etlik, 06018, Ankara, Turkey e-mail: culutin@yahoo.com Xu Ruian, Ph.D., Gene Therapy Laboratory, IMB, The University of Hong Kong, Hong Kong Honorary Professor of Basic Medical School, Peking Union Medical College Tel: 00852-22990757 Fax: 00862-28179488 E-mail: rxua@hkucc.hku.hk

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org


Cancer Therapy Vol 1, page 1 Cancer Therapy Vol 1, 1-9, 2003

Intraarterial chemotherapy and chemoembolization in head and neck cancer. Establishment as a neoadjuvant routine method Research Article

Adorján F. Kovács Department of Maxillofacial Plastic Surgery, Johann Wolfgang Goethe University Medical School, Frankfurt am Main, Germany

__________________________________________________________________________________ Corresponding author: Adorján F. Kovács MD, DMD, Department of Maxillofacial Plastic Surgery, Johann Wolfgang Goethe, University Medical School, Theodor-Stern-Kai 7, D – 60590 Frankfurt am Main, Germany; Tel.: ++49-69-63016610; Fax: ++49-6963015644; E-mail: A.Kovacs@em.uni-frankfurt.de Key words: cisplatin, head and neck, chemoembolization, clinical trials, intraarterial Received: 18 February 2003; Accepted: 24 February 2003; electronically published: April 2003

Summary Over decades, local chemotherapy for head and neck cancer was a challenging treatment modality mainly for palliative use. In the last decade, a reappraisal started due to technical innovations. But a regular and safe clinical use has not been established, nor has a pharmacological rationale for this modality been given for humans. A routine intensification of effectivity by embolization in the region of the head and neck also had been a desideratum. In an unselected patient population of 213 patients suffering from oral and oropharyngeal cancer, the routine usage of intraarterial chemotherapy in a neoadjuvant pre-surgery setting could be demonstrated. Remissions, side effects and survival data are presented. In 88 of these patients, a novel dosage format of cisplatin and clear-cut indications enabled a safe routine execution of chemoembolization. By means of microdialysis, tumor and plasma concentrations of drugs involved could be measured in patients. The results presented prove the therapeutic advantage of intraarterial chemotherapy and, especially, of chemoembolization. The prognostic value of response to local chemotherapy is discussed. Intraarterial chemotherapy is an effective modality with low toxicity and should be used broadly in multi-modality regimens for head and neck cancer. models (Harker and Stephens, 1992), the method nevertheless had the great advantage of higher tumor drug concentrations. Cisplatin proved to be the most effective drug (Harker, 1999) and gave the chance for rapid perfusion due to its relative cell phase non-specificity. Robbins transposed the so-called “two-route” chemotherapy (intraarterial cisplatin and its systemic neutralization by intravenous sodium thiosulfate) from the abdominal usage to the head and neck (Robbins et al, 1992). Modern sophisticated techniques like transfemoral catheterization, angiographic control, and superselective administration of a high dose of cisplatin (150mg/m2 body surface) combined with peripheral neutralization reduced the complications and side-effects. The therapeutic approach was organ-preserving (combination with parallel radiation) or palliative. The reported high effectivity and low systemic acute toxicity urged a broader usage of the method especially in consideration of the high mortality of head and neck

I. Introduction Local chemotherapy as perfusion of drug solutions and as embolization by means of particles is mainly used for hepatocellular carcinoma and liver metastases of colorectal cancer (Tellez et al, 1998). This is safely possible because vessels are quite large in diameter, and metastases and liver tissue are nourished by different circulatory systems of the liver with consequent low risk to jeopardize healthy tissue (Breedis and Young, 1954). In the area of the head and neck, local chemotherapy, though used for decades, had many drawbacks, mainly caused by catheter complications and adverse effects due to flow-out of the antineoplastic agents (Molinari et al, 1999). Eleven percent failures of catheterization (mainly retrograde from the temporal artery into the external carotid artery), 8 % catheter dislocations, 15 % local inflammations, and 4-6 % neurological complications including head ache, apoplexias, and facial pareses made the method unattractive. Theoretically, as demonstrated in animal 1


Kovács: Intraarterial chemotherapy in H&N cancer Postoperative adjuvant treatment consisted in radiation or chemoradiation depending on the histological result, contraindications for docetaxel, and patient agreement. Precise regimen is described elsewhere (Kovács et al, 2002b). Patients who could not be operated on have been offered a chemoradiation as organpreserving treatment (71,3 Gy to the primary, 51,3 Gy to the neck, 5 cycles docetaxel 20 mg/m2 body surface) or radiation (if there has been contra-indication for docetaxel). During this study, it was planned to achieve a pharmacological rationale for intraarterial chemotherapy in humans. Tumor and plasma concentrations of cisplatin and sodium thiosulfate have been compared by means of microdialysis (Ungerstedt, 1991) in 10 and 6 patients with oral cancer treated either with intraarterial perfusion using a cisplatin solution (150 mg/m 2 in 500 ml 0.9% NaCl) or with embolization using a crystalline cisplatin suspension (150 mg/m2 in 45-60 ml 0.9% NaCl), respectively. The microdialysis catheter was placed into the tumor (Figure 1), the intraarterial catheter into the tumor-feeding artery. Cisplatin was rapidly administered through the intraarterial catheter and sodium thiosulfate (9 g/m2) was infused intravenously. STS infusion was started 10 sec after starting the cisplatin infusion. Main advantage of the method is continuous measurement. Biopsies are not necessary. Further information can be found in Tegeder et al, 2003. Primary endpoints have been local clinical and histological remission, and side-effects of chemoperfusion and chemoembolization, respectively. Secondary endpoints have been the establishment of a clinical routine chemoembolization method for cancer of the head and neck, and the survival analysis. End of follow-up has been January, 2003.

cancer. Unselected populations of patients suffering from cancer of the oral cavity and the pharynx have a 5-yearsurvival of 40-45 % (Funk et al, 2002). Since 1996, intraarterial chemotherapy was used widely in a neoadjuvant pre-operative setting in the Department of Maxillofacial Plastic Surgery at Frankfurt am Main/Germany. The experimental and clinical results as well as novel developments of the method, leading to a routine usage of chemoperfusion and chemoembolization in the head and neck, are presented here.

II. Patients and methods 213 consecutive unselected patients with untreated primary squamous cell carcinoma of the oral cavity and the anterior oropharynx have been prospectively scheduled for treatment with neoadjuvant intraarterial chemotherapy and following surgery of the primary and the neck. Staging examinations encluded patient history, inspection, palpation, neck ultrasound, neck CT, chest Xray, and “whole-body” PET. Patient and tumor data can be seen in Table 1. The methods for transfemoral catheterization and administration of the cisplatin solution, the cisplatin crystal suspension, and sodium thiosulfate are described in detail elsewhere (Kovács et al, 1999; 2002a). Cisplatin as lyophilisate was produced by medac GmbH, Hamburg, Germany. At least one cycle was planned. Three weeks later, dimension of response was assessed (CR=complete remission, a complete disappearance of local tumor mass; PR=partial remission, a partial reduction of local tumor mass of more than 50%; SD=stable disease, a partial reduction of local tumor mass of less than 50% or stability of local tumor mass; PD=progressive disease, growth of the tumor > 25%) and patients were scheduled to surgery. Surgery was executed according generally accepted rules (radical resection of the primary in healthy margins, ipsilateral modified radical neck dissection with preservation of the jugular vein, the sternocleidomastoid muscle and the accessory nerve in case of a clinically positive neck, contralateral selective neck dissection of the upper two levels of the neck in case of midline tumour location).

III. Results All patients (100 %) received intraarterial chemotherapy. The therapy compliance has been excellent. In 32 patients, cycles have been repeated up to twice in case of non-operability and non-radiability, for palliative reason. There have been 256 interventions with 3 catheter-related complications (apoplexies, in two cases with complete remissions). Local remissions of the tumor after one cycle of intraarterial chemotherapy can be seen in Figures 2A (chemoperfusion) and 2B (chemoembolization).

155 males, 58 females; average age: 60 yrs cT 0 1

25

2

62

cN

cM

107

208

51

5

2a

1

2b

36

2c

16

3

20

4

106

2

cStage

22 24

35

38

22

30

24 68

4A

114

4B

2

4C Sum

pStage

5 213

213

213

213

171

Table 1. Demographic and tumor-related data of 213 unselected consecutive patients suffering from oral and oropharyngeal cancer. UICC classification: cT = clinical tumor category; cN = clinical node category; cM = clinical metastasis category; cStage = clinical staging; pStage = pathological staging.

Figure 1: Patient suffering from cancer of the floor of the mouth lying on the angiography table. Microdialysis probe is placed via submental route into the tumor center. Tube (right) is perfusing the probe with saline solution, tube leading to vial fixed at the neck is saving the dialysate.

2


Cancer Therapy Vol 1, page 3 Very low acute side-effects of both chemoperfusion and chemoembolization (mainly grade 1 WHO) are demonstrated in Figure 3. In the first 42 patients with 50 interventions of chemoembolization, there have been 3 temporary paralyses of the facial nerve and 4 facial skin necroses, both due to flow-out of cisplatin crystals into the medial meningeal artery (from the maxillary artery) or the skin collaterals of the tumor-feeding vessel. In the following 46 patients with 50 interventions, no such complications occurred. A containment of indications for chemoembolization has been the reason: safe procedure can be expected in the oral tongue, the floor of the mouth and the mandibular alveolar ridge (Figure 4). Preferential arteries for superselective catheterization have been the lingual and the facial arteries. High-dose chemotherapy with cisplatin and systemic sodium thiosulfate can be used routinely in a neoadjuvant setting in the head and neck. Chemoembolization for oral cancer with cisplatin crystals is a safe routine method if administered in the mentioned localizations using the established method with cisplatin crystals. Hundred-seventy-one patients (80 %) have been operated on radically. Radicality of resections and

postoperative complications were not influenced by pre-op chemotherapy. The neck surgery is listed in Table 2 . Seven patients have not been operated on at the neck due to maxillary tumor location. Forty-two patients (20 %) could not be operated on due to non-resectability of the primary or due to bad general condition. 20 patients have been in such bad initial state that intraarterial chemotherapy was repeated as only treatment for local control. One of these patients (cT2cN0) is living free of tumor since 4 years now, the others died after a mean survival period of 4 months. 8 of these non-operated patients were in the condition to receive chemoradiation. In 4 patients, this organpreserving treatment resulted in complete clinical remission of the detectable disease lasting for 13 months mean observation time. 14 patients without surgery received radiation therapy. These patients survived 3 months on average. 60 patients received no adjuvant treatment after surgery (small primaries, no histologic neck disease, refusals). 112 patients (53 %) underwent adjuvant radiation (n = 28) or adjuvant chemoradiation (n = 84).

Figure 2A: Clinical and histological response to intraarterial chemotherapy (chemoperfusion with cisplatin solution 150 mg/m2 body surface) in 125 patients. cCR = clinical complete remission, pCR = pathological complete remission, PR = partial remission, SD = stable disease, PD = progressive disease. Overall response (cCR + cPR) = 43 %.

Figure 2B: Clinical and histological response to intraarterial chemotherapy (chemoembolization with cisplatin crystal suspension 150 mg/m2 body surface) in 88 patients. Overall response = 74 %.

3


Kovรกcs: Intraarterial chemotherapy in H&N cancer

Figure 3: Acute side-effects of chemoperfusion and chemoembolization (n = 213 patients). All grade 1 WHO normalizing after 5-7 days. Note high percentage of patients with no measurable side-effects at all. Chemoembolization has no hematological side-effects but causes post-embolization-syndrome which lasts 7-10 days.

RND RND,MRND MRND MRND,MRND MRND,SHND MRND,SND SHND SHND,SHND SHND,SND SND SND,SND No neck surgery Sum

1 1 27 10 38 1 13 33 1 22 17 7 117

Table 2: Neck surgery in 171 unselected consecutive patients with oral and oropharyngeal cancer (RND = radical neck dissection level 1-4; MRND = modified radical neck dissection level 1-4; SHND = suprahyoidal neck dissection level 1-2; SND = selective neck dissection [sentinel node biopsy]; MRND,SHND = ipsilateral modified radical neck dissection with contralateral suprahyoidal neck dissection, et cetera). Figure 4: Areas of safe chemoembolization with the cisplatin crystal suspension marked in yellow (oral tongue, floor of mouth, mandibular alveolar ridge).

4


Cancer Therapy Vol 1, page 5 formed particles measuring 30x50 µm. No extra embolizing particles have been necessary. Embolization has been very rarely used in the head and neck area for cancer. Reports of other investigators are listed in Table 3. The fabrication of particles and encoating of the drugs was complicated and expensive, the head vessels having a small diameter have been occluded too early resulting in low doses of antineoplastic drugs, the danger of flow-out of stray emboli caused the investigators to stop the usage after a small number of patients. According to this body of literature, only 66 head and neck cancer patients have been treated with embolization regimens in the last 20 years all over the world. Effectivity has been not convincing. Side-effects have been neglected in these reports so far. The novel method of chemoembolization using a crystal suspension of cisplatin could be used routinely in 88 patients since May 2000 up to now. It was found to be very effective (remissions were evaluated following one cycle). Side-effects have been low, and early complications ceased after a confinement of indications to areas within the oral cavity. These areas harbor more than 60 % of the carcinomas of the oral cavity which guarantees a broad usage of this method. Molar sodium thiosulfate/cisplatin ratios of >500 are required outside the tumor to neutralize cisplatin whereas tumor ratios should be <100 to avoid a loss of tumor cell killing (Abe et al, 1986, 1990). The first goal was achieved with both treatment modalities, the second only with cisplatin embolization suggesting that crystalline cisplatin embolization is superior to intraarterial cisplatin perfusion in terms of tumor cisplatin concentrations. This gave a definitive rationale for both intraarterial chemoperfusion as well as chemoembolization with a cisplatin crystal suspension in humans. Overall compliance has been excellent. Intraarterial chemotherapy fits perfectly into a multimodality regimen as described. The survival of 65 % of an unselected population after a median observation time of 3 years must be considered as an improvement in overall survival which should be examined more precisely in a randomized study. Although administered locally and with local effect, the chemotherapy caused response has clear prognostic value (Figure. 6). The response apparently is dependent from the size of the primary tumor (Figure. 7), but even within the tumor classifications T1-2 and T3-4 there are differences in survival dependent from response (Figure. 8). Therefore, response to local chemotherapy can be used as prognostic sign. In contrast to other local treatment modalities like electroporation, photodynamic therapy or chemotherapeutic gel injections, intraarterial chemotherapy can be used in all tumor stages without side-effect limitations and is, therefore, best suited as a potential marker for differential therapeutic strategies. Potential subtypes of oral cavity squamous cell carcinomas may be found by more easily using a combination of intraarterial chemotherapy and gene expression analyses of the tumors.

First results of adjuvant chemoradiation have been reported (Kovács et al, 2002b). After a median observation time of 3 years (period from December 1996 to January 2003), 74 patients have died (35 %). 20 deaths have not been tumor-related. Kaplan-Meier-analysis generated a 5-year-survival expectation of 62 % but such estimations are solid only in case when 80 % of all patients reached the observation time of 5 years. Following embolization, maximum cisplatin tumor concentrations and tumor-AUCs were about 5 times higher than those achieved after intraarterial perfusion with a cisplatin solution (maximum concentration: 180.3±62.3 µM versus 37.6±8.9 µM) whereas the opposite was true for plasma concentrations (maximum concentration: 0.9±0.2 µM versus 4.7±0.6 µM). Sodium thiosulfate plasma levels were about three times higher than its tumor concentrations (maximum tumor concentration 1685±151 µM; maximum plasma concentration 5051±381 µM). Following the standard intraarterial perfusion average sodium thiosulfate/cisplatin AUC ratios for tumor and plasma were 211±75 and 984±139, respectively. Following cisplatin embolization the respective ratios were 48.5±29.5 and 42966±26728 (Figure 5, Tegeder et al, 2003).

IV. Discussion Intraarterial chemotherapy via transfemoral catheterization for advanced head and neck cancer was executed by several authors in a neoadjuvant pre-radiation setting (Vieitez et al, 1991; Scheel et al, 1996; Hirai et al, 1999) or as an organ-preserving method parallelly with radiation (Imai et al, 1995; Robbins et al, 1997; Oya and Ikemura, 1999; Regine et al, 2001). True neoadjuvant pre surgery usage of the method was very rare (Siegel et al, 1998; Benazzo et al, 2000). In the Department of Maxillofacial Plastic Surgery at Frankfurt am Main/Germany, the “two-route” chemotherapy was used since 1996 for all tumor stages to improve overall survival of an unselected population (Kovács et al, 1999). The reported side-effects have been so low that broad usage of the method seemed to be feasible. The results after 256 interventions demonstrated a great technical safety of the method. Remissions have been high and side-effects very low (grade 1 WHO). The method was intensified by the usage of a new dosage format of cisplatin (crystal suspension) resulting in an embolization of the tumor bed (Kovács et al, 2002a). Embolization theoretically encreases the therapeutic advantage by a longer tumor residence time of the drug. The lyophilized cisplatin was reconstituted with 0.9% sodium chloride leading to a yellow mixture with a final concentration of 5 mg ml-1. Microscopic assessment of the crystal diameters showed rod-shaped cisplatin crystals measuring 3x8 µm; regular clumping of these crystals

5


Kovács: Intraarterial chemotherapy in H&N cancer

Figure 5: Mean ± s.e.m cisplatin (CDDP; top) and sodium thiosulfate (STS; bottom) concentrations in tumor tissue (left) and plasma (right) following superselective high dose intraarterial cisplatin perfusion (!) and crystalline cisplatin embolization (!). Note the different scaling of the y-axes for tumor and plasma. Insert: Sodium thiosulfate/cisplatin AUC ratios for tumor and plasma following intraarterial cisplatin perfusion and cisplatin embolization (Tegeder et al, 2003).

Number of patients

Response

Side-effects

11

63%

100% local pain

28 (incl. 11 of Okamoto et al)

28%

?

Carboplatin 100 mg

19

20%

60% local pain

Cisplatin 13.6 mg

7

?

?

5-Fluorouracil 700 mg/m2 + Methotrexate 40 mg/m2

12

58%

?

Authors

Particles

Okamoto et al, 1985, 1986

Ethyl cellulose microcapsules

Cisplatin 40 – 60 mg

Kato et al, 1996

Ethyl cellulose microcapsules

diverse (mainly Cisplatin)

Tomura et al, 1996, 1998

Ethyl cellulose microcapsules Albumine microspheres

Li et al, 1999 Suvorova et al, 2002

Coil fragments

Chemotherapeutics

Table 3: List of other reported chemoembolizations for cancer in the head and neck area. Note low dosage of drugs and small patient populations.

6


Cancer Therapy Vol 1, page 7

Figure 6: Local response to neoadjuvant intraarterial chemotherapy and prognosis.

Figure 7: Histological complete local remission (pT0) to neoadjuvant intraarterial chemotherapy in relation to local tumor classification. N. s. = non significant, *** = highly significant (Chi-square-test).

7


Kovács: Intraarterial chemotherapy in H&N cancer

Figure 8: Prognostic influence of local response within “small” (T1-2) and “advanced” (T3-4) local tumor classifications. carboplatin (CBDCA) combined infusion for head and neck cancers. Eur J Radiol. 21, 94-99 Kato T, Sato K, Sasaki R, Kakinuma H, Moriyama M (1996) Targeted cancer chemotherapy with arterial microcapsule chemoembolization: review of 1013 patients. Cancer Chemother Pharmacol. 37, 289-296 Kovács AF, Turowski B, Ghahremani TM, Loitz M (1999) Intraarterial Chemotherapy as neoadjuvant treatment of oral cancer. J Cranio-Maxillofac Surg. 27, 302-307 Kovács AF, Obitz P, Wagner M (2002a) Monocomponent chemoembolization in oral and oropharyngeal cancer using an aqueous crystal suspension of cisplatin. Br J Cancer. 86, 196-202 Kovács AF, Schiemann M, Turowski B (2002b) Combined modality treatment of oral and oropharyngeal cancer including neoadjuvant intraarterial cisplatin and radical surgery followed by concurrent radiation and chemotherapy with weekly docetaxel - three year results of a pilot study. J Cranio-Maxillofac Surg. 30, 112-120 Li H, Wang C, Wen Y, Wu H (1999) Treatment of squamous cell carcinoma of the tongue using arterial embolism with cisplatin-loaded albumin microspheres: a microstructural and ultrastructural investigation. Chin J Dent Res. 2, 61-66 Molinari R, Chiesa F, Cantù G, Costa L, Grandi C, Sala L (1999) Prognostic factors in cancer of the oral cavity and anterior oropharynx treated with preliminary neoadjuvant intraarterial chemotherapy followed by surgery. In: Eckardt A (ed). Intra-arterial Chemotherapy in Head and Neck Cancer – Current Results and Future Perspectives. Einhorn-Presse Verlag: Reinbek, 148-161 Okamoto Y, Konno A, Togawa K, Kato T, Amano Y (1985) Microcapsule chemoembolization for head and neck cancer. Arch Otorhinolaryngol. 242, 105-111

References Abe R, Akiyoshi T, Tsuji H, and Baba T (1986) Protection of antiproliferative effect of cis-diamminedichloroplatinum (II) by sodium thiosulfate. Cancer Chemother Pharmacol . 18, 98-100 Abe R, Akiyoshi T, and Baba T (1990) Inactivation of cisdiamminedichloroplatinum (II) in blood by sodium thiosulfate. Oncology. 47, 65-69 Benazzo M, Caracciolo G, Zappoli F, Bernardo G, Mira E (2000) Induction chemotherapy by superselective intra-arterial highdose carboplatin infusion for head and neck cancer. Eur Arch Otorhinolaryngol. 257, 279-282 Breedis C, Young G (1954) The blood supply of neoplasms of the liver. Amer J Path. 30, 969-985 Funk GF, Karnell LH, Robinson RA, Zhen WK, Trask DT, Hoffman HAT (2002) Presentation, treatment and outcome of oral cavity cancer: a National Cancer Data Base report. Head Neck. 24, 165-180 Harker GJS, Stephens FO (1992) Comparison of intra-arterial versus intravenous 5-fluorouracil in sheep bearing epidermal squamous carcinoma. Eur J Cancer. 28, 1437-1441 Harker GJS (1999) Intra-arterial infusion chemotherapy in a sheep squamous cell carcinoma model. In: Eckardt A (ed). Intra-arterial Chemotherapy in Head and Neck Cancer – Current Results and Future Perspectives. Einhorn-Presse Verlag: Reinbek, 54-63 Hirai T, Korogi Y, Hamatake S, Nishimura R, Baba Y, Takahashi M, Uji Y, Taen A (1999) Stages III and IV squamous cell carcinoma of the mouth: three-year experience with superselective intraarterial chemotherapy using cisplatin prior to definitive treatment. Cardiovasc Intervent Radiol. 22, 201-205 Imai S, Kajihara Y, Munemori O, Kamei T, Mori T, Handa T, Akisada K, Orita Y (1995) Superselective cisplatin (CDDP)-

8


Cancer Therapy Vol 1, page 9 Okamoto Y, Konno A, Togawa K, Kato T, Tamakawa Y, Amano Y (1986) Arterial chemoembolization with cisplatin microcapsules. Br J Cancer. 53, 369-375 Oya R, Ikemura K (1999) Targeted intra-arterial carboplatin infusion with concurrent radiotherapy and administration of tegafur for advanced squamous cell carcinoma of the oral cavity and oropharynx. In: Eckardt A (ed). Intra-arterial Chemotherapy in Head and Neck Cancer – Current Results and Future Perspectives. Einhorn-Presse Verlag: Reinbek, 183-190 Regine WF, Valentino J, Arnold SM, Haydon RC, Sloan D, Kenady D, Strottmann J, Pulmano C, Mohiuddin M (2001) High-dose intra-arterial cisplatin boost with hyperfractionated radiation therapy for advanced squamous cell carcinoma of the head and neck. J Clin Oncol. 19, 33333339 Robbins KT, Storniolo AM, Kerber C, Seagren S, Berson A, Howell SB (1992) Rapid superselective high-dose cisplatin infusion for advanced head and neck malignancies. Head Neck. 14, 364-371 Robbins KT, Kumar P, Regine WF, Wong FS, Weir AB 3rd, Flick P, Kun LE, Palmer R, Murry T, Fontanesi J, Ferguson R, Thomas R, Hartsell W, Paig CU, Salazar G, Norfleet L, Hanchett CB, Harrington V, Niell HB (1997) Efficacy of targeted supradose cisplatin and concomitant radiation therapy for advanced head and neck cancer: the Memphis experience. Int J Radiat Oncol Biol Phys. 38, 263-271 Scheel JV, Schilling V, Kastenbauer E, Knöbber D, Böhringer W (1996) Cisplatin intraarteriell und sequentielle Bestrahlung. Langzeitergebnisse. Laryngorhinootologie. 75, 38-42 Siegel RS, Bank WO, Maung CC, Harisiadis L, Wilson WR (1998) Assessment of efficacy and tolerance of high-dose intra-arterial cisplatin in advanced head and neck tumors. Proc Amer Soc Clin Oncol. Abstract 1582 Suvorova IuV, Tarazov PG, Korytova LI, Sokurenko VP, Khazova TV (2002) [Arterial chemoembolization in the combined treatment of malignant tumors of the tongue and maxilla: preliminary results] Vestn Rentgenol Radiol. 2, 238 Tegeder I, Bräutigam L, Seegel M, Al-Dam A, Turowski B, Geisslinger G, and Kovács AF (2003) Cisplatin tumor concentrations following IA cisplatin infusion or

embolization in oral cancer patients. Clinical Pharmacology & Therapeutics, in press Tellez C, Benson AB, Lyster MT, Talamonti M, Shaw J, Braun MA, Nemcek AA, Vogelzang RL (1998) Phase II trial of chemoembolization for the treatment of metastatic colorectal carcinoma to the liver and review of the literature. Cancer. 82, 1250-1259 Tomura N, Kobayashi M, Hirano J, Watarai J, Okamoto Y, Togawa K, Kowada M, Murota H (1996) Chemoembolization of head and neck cancer with carboplatine microcapsules. Acta Radiol. 37, 52-56 Tomura N, Kato K, Hirano H, Hirano Y, Watarai J (1998) Chemoembolization of maxillary tumors via the superficial temporal artery using a coaxial catheter system. Radiat Med. 16, 157-160 Ungerstedt U (1991) Microdialysis--principles and applications for studies in animals and man. J Intern Med. 230, 365-73 Vieitez JM, Bilbao JI, Hidalgo OF, Martin S, Manzano RG, Tangco E (1991) Intra-arterial chemotherapy with carboplatin and 5-fluorouracil in epidermoid cancer of the oropharynx and oral cavity. Reg Cancer Treat. 4, 152-155

Adorján F. Kovács MD, DMD

9


Kovรกcs: Intraarterial chemotherapy in H&N cancer

10


Cancer Therapy Vol 1, page 11 Cancer Therapy Vol 1, 11-19, 2003.

Current aspects in the treatment of patients with relapsed or refractory testicular cancer Review Article

Oliver Rick1*, Jörg Beyer2, Thomas Braun1, Kurt Possinger1, Wolfgang Siegert1 1

Medizinische Klinik II m.S. Onkologie/Hämatologie, Universitätsklinikum Charité, Campus Mitte, Humboldt Universität, Schumann Str. 20/21, 10117 Berlin; 2Klinik für Innere Medizin m.S. Hämatologie/Onkologie, Universitätsklinikum Marburg, Baldingerstr., 35033 Marburg

__________________________________________________________________________________ *Correspondence: Dr. O. Rick, Medizinische Klinik II m.S. Onkologie/Hämatologie, Charité Campus Mitte, Schumann Straße 20/21, 10117 Berlin, Germany; Tel.: ++ 49-30 - 450 513268; Fax: ++ 49-30 - 450 513966; e-mail: oliver.rick@charite.de Key words: Testicular cancer, salvage treatment, high-dose chemotherapy Abbreviations: germ cell tumors, (GCT); high-dose chemotherapy, (HDCT); autologous stem cell rescue, (ASCR); cisplatin, etoposide and ifosfamide, (PEI); European Group for Blood and Marrow Transplantation, (EBMT); carboplatin, etoposide and cyclophosfamide, (PEC); carboplatin and etoposide, (CE); human chorionic gonadotropin, (HCG); alpha-fetoprotein, (AFP) Received: 22 February 2003; Accepted: 27 February 2003; electronically published: April 2003

Summary The optimal treatment of patients with relapsed or refractory germ cell tumors (GCT) after cisplatin-based firstline chemotherapy remains controversial. It is well known that the majority of these patients will ultimately die of their disease. Therefore, improvement of standard treatment is clearly desirable. The question of using conventional-dose or high-dose chemotherapy (HDCT) in this high-risk situation is under discussion. However, HDCT as subsequent salvage therapy in patients with relapsed or refractory GCT remains to be a relevant curative option. Prognostic factors have recently been recognized to aid in this decision. This report reviews the current treatment options and recent developments in respect to HDCT given as salvage treatment and discusses the role of prognostic factors in management of such situations. Depending on the presence or absence of adverse prognostic factors, only about 15-30% of these relapsed patients overall will become long-term survivors after conventional-dose salvage chemotherapy (Loehrer et al, 1988; Harstrick et al, 1991). To improve the unfavorable outcome of patients with relapse or progressive disease after conventional-dose treatment, high-dose chemotherapy (HDCT) followed by autologous stem cell rescue (ASCR) has been explored as a therapeutic option (Siegert et al, 1994; Rick et al, 2001). Due to increasing clinical experience in the management of side-effects, the use of ASCR and the availability of hematopoietic growth factors, HDCT has become a relatively safe procedure. Dose-escalations to about three to five times of the conventional-dose can be achieved for most drugs active in GCT as hematologic toxicities have become manageable with ASCR. However, acute nonhematologic toxicities, particularly mucositis, renal impairment and peripheral neurotoxicity are increased after HDCT as compared to conventional-dose regimens.

I. Introduction Most patients with metastatic germ-cell tumors can be cured using multimodal treatment with standard combination chemotherapy followed by surgical resection of residual masses (Bosl and Motzer, 1997). The outcome is worse if one of poor prognostic features are present, such as extragonadal primary mediastinal nonseminoma GCT, extrapulmonary visceral metastases and high levels of tumor markers at initial diagnosis. These patients have a chance of cure of less than 50% with standard first-line chemotherapy and are being classified as "poor prognosis" patients. Most of them progress after incomplete response to first-line cisplatin-based chemotherapy or relapse from prior complete remission and will be candidates for salvage treatment (Table 1) (International Germ Cell Cancer Collaborative Group, 1997). Conventional-dose salvage chemotherapy in combination with resection of residual masses will result in second complete remissions in only about 30-60% of patients. In addition, at least half of these patients will suffer subsequent relapses after salvage treatment and will ultimately die of their disease. 11


Rick et al: Current aspects in testicular cancer Table 1: Prognostic classification for first-line treatment (International Germ Cell Cancer Collaborative Group, 1997) GOOD PROGNOSIS Non-Seminoma Seminoma Testis or retroperitoneal primary and Non-pulmonary visceral metastases absent and Good markers AFP < 1000 ng/ml and HCG < 5000 U/l and LDH < 1.5 ! upper limit of normal

Any primary site and No non-pulmonary visceral metastases absent and Normal AFP, any HCG, any LDH

INTERMEDIATE PROGNOSIS Non-Seminoma

Seminoma

Testis/retroperitoneal primary and Non-pulmonary visceral metastases absent and Intermediate markers AFP " 1000 and # 10,000 ng/ml and HCG " 5000 and # 50,000 U/l or LDH " 1.5 ! N and # 10 ! N

Any primary site and Non-pulmonary visceral metastases present Normal AFP, any HCG, any LDH

POOR PROGNOSIS Non-Seminoma

Seminoma

Mediastinal primary or Non-pulmonary visceral metastases present or Poor markers AFP > 10,000 ng/ml or HCG > 50,000 U/l or LDH > 10 ! upper limit of normal

No patients classified as poor prognosis

Abbreviations: AFP, alpha-fetoprotein; HCG, $-subunit human chorionic gonadotropin; LDH, lactat dehydrogenase treatment which seems to be superior to survival rates obtained with conventional chemotherapy schedules. In patients receiving second or subsequent salvage treatment investigators in the US and Europe still reported long-term remission rates of 15-25% using high-dose carboplatin and etoposide with or without the addition of an alkylating agent (Rick et al, 1999). More recently, three study groups have modified this initial schedule. Rick et al, and the GTCSG explored a treatment strategy that combined intensive conventional-dose salvage with paclitaxel, ifosfamide and cisplatin followed by a single HDCT cycle with carboplatin, etoposide and thiotepa. The rationale for the trial was to optimize conventional-dose salvage treatment by using paclitaxel as well as intensifying HDCT with thiotepa (Rick et al, 2001). Motzer at al. (2000) investigated sequential dose-intensive paclitaxel and ifosfamide followed by three sequential cycles of high-dose carboplatin and etoposide. Rodenhuis et al, (1999) explored sequential dose-intensive treatment with

Also long-term non-hematologic organ toxicities and hematologic complications such as the incidence of secondary myelodysplasias or leukemias may be a concern years after successful HDCT.

II. Salvage HDCT in patients with relapsed or refractory GCT Standard treatment for patients with relapsed or refractory GCT after cisplatin-based first-line chemotherapy includes a combination of cisplatin, etoposide and ifosfamide (PEI) or cisplatin, vinblastine and ifosfamide (VeIP) (Rick et al, 1999). With regard to the worse long-term prognosis of patients with relapsing or progressing GCT after conventional-dose chemotherapy, however, the concept of HDCT with ASCR was investigated in numerous studies. Overall, event-free survival rates of 40-60% have been reported after such

12


Cancer Therapy Vol 1, page 13 etoposide and ifosfamide, followed by one cycle of highdose carboplatin and etoposide and two cycles of highdose carboplatin, cyclophosphamide and thiotepa supported by ASCR. Recently, Bhatia and co-workers (2000) reported data from 65 patients with relapsed or

refractory GCT treated with high-dose carboplatin and etoposide followed by PBPC rescue as initial salvage chemotherapy.

Figure 1: Overall-(A) and event-free (B) survival of patients after salvage treatment either with high-dose or standard-dose chemotherapy in 55 pairs of patients (Beyer et al, 2002)

13


Rick et al: Current aspects in testicular cancer factors". Until now the minimal range of the follow-up period is short and only 104/280 (37%) patients were analyzed for disease-free survival. Considering the interpretation of the results these facts must be mentioned. In 1986 Indiana University initiated a phase I/II trial using tandem HDCT with carboplatin and etoposide (CE) followed by ASCR in patients with multiple relapses, since then several investigators have examined the concept of repetitive HDCT cycles. Employing tandem cycles of HDCT with CE might be a method to overcome cisplatin resistance and to eradicate residual cancer cells rather than a single application or multiple applications with long term intervals between the cycles. Therefore, to maximize the dose-intensity of chemotherapy multiple large doses may be administered in short intervals (Nichols et al, 1989; Broun et al, 1997; Bhatia et al, 2000; Motzer et al, 2000). However, all current trials are encouraging that some of the patients with second or subsequent relapses can successfully be salvaged by HDCT. In addition, patients with poor prognostic features at the time of relapse or progression also seem to profit from early intensification of first salvage treatment. Whereas side-effects differ between schedules, the results of these most recent trials indicate, that prognostic factors for treatment outcome after HDCT could be more important than the use of a particular HDCT strategy or combination.

However, the majority of the patients included in the latter study showed "good-risk" factors for relapse prior to salvage HDCT. This fact may explain the very good outcome of these patients. In a retrospective matched-pair analysis Beyer et al, (2002) compared HDCT with conventional-dose chemotherapy as first-salvage treatment in patients with relapsed or refractory non-seminomas. The analysis suggests a benefit from HDCT with an estimated absolute improvement in event-free survival of 12% and in overall survival of 11% at 2 years (Figure 1). At the ASCO meeting Rosti et al, (2002) presented the data from a preliminary analysis of a prospective randomized multicenter study initiated by the European Group for Blood and Marrow Transplantation (EBMT), the "IT94 study". 280 patients with relapse from first-line cisplatin-based chemotherapy were randomized to receive either three cycles of conventional-dose PEI/VeIP plus HDCT included carboplatin, etoposide and cyclophosfamide (PEC) or four courses of standard PEI/VeIP. Calculation of the sample size was based on a 15% difference in the event-free survival rate at one year. The recruitment of the study stoped in September 2001 and 128/140 patients (91%) for the conventional treatment and 135/140 patients (96%) for the HDCT could be analyzed. In terms of event-free and overall survival no statistically significant differences were observed between both treatment groups (Rosti et al, 2002). However, only patients without any prior salvage chemotherapy who relapsed from complete remission or progressed from incomplete remission were included. Therefore the results of the study can only allow interpretation for patients with these "good prognosis

III. Ongoing trials Since September 2001 the "IT94"-study was stopped, in the salvage situation only one trial in Europe is actively recruiting.

Figure 2: Ongoing GTCSG trials for salvage treatment.

14


Cancer Therapy Vol 1, page 15 have been more favorable, if HDCT had been used early in these patients.

Colleagues from Berlin, Marburg and T端bingen in cooperation with the GTCSG initiated a prospective randomized multicenter trial to compare three cycles of standard PEI plus single HDCT with carboplatin, etoposide and cyclophosphamide versus one cycle of PEI followed by sequential cycles of dose-intensified carboplatin and etoposide (Figure 2). Patients with good or intermediate prognosis according to the criteria from Beyer et al, (1996) who require salvage treatment are included into the study and in January 2003 two thirds of the planned number of 230 patients were recruited. This trial continues to include patients with first relapse after a minimum of three cycles of a cisplatin-based chemotherapy despite the preliminary data from the "IT94-study". The randomized GTCSG-study includes patients with insufficient response to primary treatment and patients who relapsed after first- or subsequent salvage treatment. The results of this trial should help to determine the optimal HDCT regimen in terms of clinical outcome, long-term survival and toxicities when given as intensification of salvage treatment.

V. Treatment related toxicities Early as well as the late toxicities after salvage chemotherapy are substantial. Although the treatmentrelated mortality was considerably lower compared to reports that pioneered HDCT, it remained constantly around 3% in consecutive protocols. Apart from the expected hematologic toxicity that resulted in transfusion requirements in all patients, the majority of patients also experienced severe mucositis that necessitated hospitalization, total parenteral nutrition and intravenous analgesia (Siegert et al, 1994; Rick et al, 1998; Rick et al 2001). Other non-hematologic toxicities that eventually became dose-limiting were renal impairment. Overall, 8% of the patients required hemodialysis, of whom most patients recoverd with their renal function until discharge. The use of ifosfamide as a third drug in addition to highdose carboplatin and etoposide might have precipitated these toxicities. Despite activity of ifosfamide in germ cell tumors at conventional-doses, only modest dose increments were possible in high-dose combinations (Siegert et al, 1994; Beyer et al, 1997; Rick et al, 1998). Another relevant side effect after conventional-dose chemotherapy and HDCT is the peripheral nervous toxicity. After salvage treatment with three cycles of conventional-dose paclitaxel, ifosfamide and cisplatin followed by high-dose carboplatin, etoposide and thiotepa sensorymotor toxicity " grade II developed in 29% of the patients among 8% suffered from grade IV sensorymotor toxity. Furthermore, paresthesias " grade II developed in 24% of the patients. Peripheral nervous toxicity after HDCT persisted during the 12 week re-evaluation period and improved only gradually thereafter. Ototoxicity with tinnitus and hearing loss greater or equal grade II occurred in 32% of the patients after HDCT. Hearing began to improve in most patients shortly after HDCT and therefore, hearing aids were required in only few patients (Rick et al, 2001). Whereas most of the acute toxicities were reversible, about one third of the patients reported persisting sideeffects, mainly paresthesias and/or tinnitus, that interfered with their daily activities (Rick et al, 1998). Long-term toxicities have also been reported after conventional-dose cisplatin-based treatment, but persisting side-effects as well as more severe late toxicities such as renal impairment, transfusion-related hepatitis and etoposideinduced secondary leukemia clearly represent a reminder to use HDCT judiciously, preferably only within clinical trials and at experienced centers (Beyer et al, 1997; Rick et al, 1998).

IV. Prognostic factors Several retrospective analyses have tried to identify prognostic factors for conventional-dose as well as for high-dose salvage chemotherapy. Primary mediastinal nonseminomatous tumors seem to be incurable if first-line treatment fails. At least two large series did not find longterm survivors, neither with conventional-dose treatment nor with HDCT (Saxman et al, 1994; Beyer et al, 1996). In a multivariate analysis Beyer et al, (1996) tried to identify prognostic variables in 383 patients treated with HDCT given as first or subsequent salvage treatment. Progressive disease at the time of HDCT, nonseminomatous mediastinal primary tumor, refractory disease to conventional-dose cisplatin and human chorionic gonadotropin (HCG) levels greater than 1,000 U/L prior HDCT were identified as independent adverse prognostic factors for long-term survival after HDCT (Beyer et al, 1996). Overall survival rates for each prognostic group are shown in Figure 3.One of the relevant conclusions of the study was that all patients of the poor prognosis category progressed immediately after HDCT, had no benefit from the dose intensive strategy and should not be treated with HDCT. Fossa et al, (1999) analyzed the results of 164 nonseminoma patients who relapsed or progressed after cisplatin-based first-line chemotherapy and who received different conventional-dose regimens as first-salvage treatment. In a multivariate analysis response to first-line treatment, response duration as defined by the progression-free interval as well as serum levels of HCG and alpha-fetoprotein (AFP) prior to salvage treatment were identified as independent prognostic variables (Table 2). Unfortunately, the impact of histology on prognosis could not be assessed as seminoma patients were not included. Limited by its retrospective approach and the lack of a control group, this analysis cannot exclude the possibility that the results of salvage chemotherapy might

VI. Residual tumor resection and adjuvant chemotherapy After primary cisplatin-based chemotherapy surgical resection of residual tumor masses is currently the standard treatment if the metastases have not completely disappeared (Donohue et al, 1992; Fox et al, 1993). The histological status of the operated specimen may reveal 15


Rick et al: Current aspects in testicular cancer necrosis, mature teratoma or viable cancer cells. Whereas the resection of necrosis has no therapeutic benefit, the resection of mature teratoma or undifferentiated cancer is relevant. Therefore, attempts have been made to distinguish between patients with necrosis from patients with viable cancer (De Santis et al, 2001). Only few data exist of the histological status of tumor residuals and the probability of viable cancer after first or subsequent salvage chemotherapy (Hartmann et al,

1997; Donohue et al, 1994). Furthermore, the relevance of residual tumor resection and the incidence of cancer cells after HDCT has not yet been determined. Hartmann et al, (1997) found undifferentiated tumor in 20/25 patients (80%), Donohue et al, (1994) reported from viable carcinoma only in 53/164 patients (32%). Furthermore, two other analyses confirmed these results and demonstrated a high rate of patients with viable cancer after second-line chemotherapy (Peckham et al, 1988; Fox

Figure 3: Survival according to prognostic categories in 282 patients treated with high-dose salvage chemotherapy (Beyer et al, 1996)

Table 2: Prognostic model for conventional-dose salvage according to Fossa et al, (1999) • • •

no complete remission to first-line treatment progression-free interval < 2 years AFP > 100 kU/L or HCG > 100 U/L at initiation of salvage

Prognostic groups

survival at 2 years (95% confidence intervals)

“good prognosis”

74%

one risk factor present #

(60% - 88%)

“intermediate prognosis” any two risk factors present

45% (32% - 58%)

“poor prognosis” all three risk factors present

7% (0% - 15%)

16


Cancer Therapy Vol 1, page 17 et al, 1993). These data after salvage treatment showed a much higher frequency of viable cancer in comparison with histological findings after primary chemotherapy. Residual tumor resection following first-line cisplatinbased chemotherapy showed viable cancer in 10% of the patients (Fossa et al, 1989; Fizazi et al, 2001). One explanation may be the development of resistance against chemotherapy in patients received salvage treatment. Viable cancer and mature teratoma may be the origin of localized and/or late relapse (Loehrer et al, 1986). Thus, the complete removal of mature teratoma or residual cancer is indicated, particularly due to the lack of reliable non-invasive examinations to detect viable cancer cells. After resection of necrosis or mature teratoma, no further treatment is required. In the case of resection of viable cancer cells after primary cisplatin-based chemotherapy the application of an adjuvant chemotherapy remains disputable. Whereas several investigations have confirmed that the use of additive chemotherapy may improve the outcome of these patients (Tait et al, 1984; Fox et al, 1993; Donohue et al, 1994; Gerl et al, 1995; Stenning et al, 1998), other trials could not detect any benefit from an adjuvant treatment (Pizzocaro et al, 1998). Furthermore, Fizazi et al (2001) performed a multivariate analysis of prognostic factors for overall and event-free survival after resection of viable tumor cells in patients with disseminated GCT. They identified an incomplete resection, " 10% viable malignant cells in the residual tumor manifestation and an "intermediate or poor prognosis" in according to the IGCCCG classification as unfavourable features. Only patients with one adverse prognostic factor showed a statistically significant advantage from the adjuvant chemotherapy. In the salvage situation there is also no clear recommendation because only few data are available (Hartmann et al, 1997; Donohue et al, 1994) Whereas some authors did not find any benefit from adjuvant chemotherapy after resection of residual viable cancer, other investigators recommended the maintenance chemotherapy with daily oral etoposide following salvage therapy (Donohue et al, 1994; Cooper and Einhorn, 1995; Hartmann et al, 1997; Pizzocaro et al, 1998). Therefore, to answer this question the GTCSG have investigated a prospective randomized multicenter study to evaluate the efficacy of three cycles of oral etoposide in patients with viable cancer cells in the resected residual tumor masses (Figure 2).

subsequent retrospective multivariate analyses, may lead to individualized risk-adapted treatment strategies in relapsed patients. Considering these evaluated prognostic subcategories the addition of a new drug, such as paclitaxel, to the conventional-dose salvage chemotherapy in patients with good prognosis features could be a new option. In patients with poor prognosis factors the use of HDCT may be helpful to optimize the treatment efficacy. This risk-adapted strategy can avoid HDCT-induced toxicities in good prognosis patients and maintain a curative option in patients of the intermediate/poor prognosis category. Nevertheless, the use of a sequential HDCT concept in patients with unfavorable prognostic features could enhance the clinical outcome of these patients and should be investigated in future trials. Therefore, the results of the randomized GTCSG study are necessary to answer this open question and the data must constantly be seen and evaluated. The results of salvage chemotherapy may be further improved if combined with residual tumor resection in selected patients. Patients with viable cancer cells in the resected tumor masses should be included in ongoing studies. In order to find rational approaches for rare clinical situations, cooperative multiinstitutional efforts are needed.

References Beyer J, Kingreen D, Krause M, Schleicher J, Schwaner I, Schwella N, Huhn D, Siegert W (1997) Long term survival of patients with recurrent or refractory germ cell tumors after high dose chemotherapy. Cancer 79, 161-168. Beyer J, Kramar A, Mandanas R, Linkesch W, Greinix A, Droz JP, Pico JL, Diehl A, Bokemeyer C, Schmoll HJ, Nichols CR, Einhorn LH, Siegert W (1996) High-dose chemotherapy as salvage treatment in germ cell tumors: a multivariate analysis of prognostic factors. J Clin Oncol 14, 2638-2645. Beyer J, Rick O, Weinknecht S, Kingreen D, Lenz K, Siegert W (Nephrotoxicity after high-dose carboplatin, etoposide and ifosfamide in germ-cell tumors: incidence and implications for hematologic recovery and clinical outcome. Bone Marrow Transplant 20, 813-819. Beyer J, Stenning S, Gerl A, Fossa S, Siegert W (2002) Highdose versus conventional-dose chemotherapy as first-salvage treatment in patients with non-seminomatous germ-cell tumors: a matched-pair analysis. Ann Oncol 13, 599-605. Bhatia S, Abonour R, Porcu P, Seshadri R, Nichols CR, Cornetta K, Einhorn LH (2000) High-dose chemotherapy as initial salvage chemotherapy in patients with relapsed testicular cancer. J Clin Oncol 18, 3346-3351. Bosl G, Motzer RJ (1997) Testicular germ-cell cancer. N Engl J Med 337, 242-253. Broun ER, Nichols CR, Gize G (1997) Tandem high dose chemotherapy with autologous bone marrow transplantation for initial relapse of testicular germ cell cancer. Cancer 79, 1605-1610. Cooper M, Einhorn LH (1995) Maintenance chemotherapy with daily oral etoposide following salvage therapy in patients with germ cell tumors. J Clin Oncol 13, 1167-1169. De Santis M, Bokemeyer C, Becherer A, Stoiber F, Oechsle K, Kletter K, Dohmen BM, Dittrich C, Pont J (2001) Predictive impact of 2-Fluoro-2-Deoxy-D-Glucose positron emission tomography for residual postchemotherapy masses in patients with bulky seminoma. J Clin Oncol 19, 3740-3744. Donohue JP, Birhle R, Foster RS (1992) Evolving concepts in

VII. Conclusion In patients with relapsed/refractory disease HDCT has been demonstrated as a feasible and safe treatment concept which will be curative for a substantial proportion of these patients. Therefore, all of these patients should be included in ongoing studies. Considering the complication rate and the not yet finally clarified role of HDCT this treatment is not acceptable outside clinical trials. Prognostic factors in patients with relapsed or progressive disease are clearly necessary and therefore known risk factors should be included in future prospective randomized trials. These results, if confirmed by 17


Rick et al: Current aspects in testicular cancer surgical management of testis cancer. Cancer Treat Res 59, 89-97. Donohue JP, Fox EP, Williams SD, Loehrer PJ, Ulbright TM, Einhorn LH, Weathers TD (1994) Persistent cancer in postchemotherapy retroperitoneal lymph-node dissection: Outcome analysis. World J Urol 12, 190-195. Fizazi K, Tjulandin S, Salvioni R, Germa-Lluch JR, Bouzy J, Ragan D, Bokemeyer C, Gerl A, Flechon A, de Bono JS, Stenning S, Horwich A, Pont J, Albers P, De Giorgi U, Bower M, Bulanov A, Pizzocaro G, Aparicio J, Nichols CR, Theodore C, Hartmann JT, Schmoll HJ, Kaye SB, Culine S, Droz JP, Mahe C (2001) Viable malignant cells after primary chemotherapy for disseminated nonseminomatous germ cell tumors: prognostic factors and role of postsurgery chemotherapy-results from an international study group. J Clin Oncol 19, 2647-2657. Fossa SD, Aass N, Ous S, Hoie J, Stenwig AE, Lien HH, Paus E, Kaalhus O (1989) Histology of tumor residuals following chemotherapy in patients with advanced nonseminomatous testicular cancer. J Urol 142, 1239-1242. Fossa SD, Stenning SP, Gerl A, Horwich A, Clark PI, Wilkinson PM, Jones WG, Williams MV, Oliver RT, Newlands ES, Mead GM, Cullen MH, Kaye SB, Rustin GJ, Cook PA. (1999) Prognostic factors in patients progressing after platinum-based chemotherapy for malignant nonseminomatous germ cell tumours. Br J Cancer 80, 13921399. Fox EP, Weathers TD, Williams SD, Loehrer PJ, Ulbright TM, Donohue JP, Einhorn LH (1993) Outcome analysis of patients with persistent nonteratomatous germ cell tumor in postchemotherapy retroperitoneal lymph node dissections. J Clin Oncol 11, 1294-1299. Gerl A, Clemm C, Schmeller N, Dienemann H, Lamerz R, Kriegmair M, Wilmanns W (1995) Outcome analysis after post-chemotherapy surgery in patients with nonseminomatous germ cell tumours. Ann Oncol 6, 483-438. Harstrick A, Schmoll HJ, Kohne-Wompner CH, Bergmann L, Lammers U, Hohnloser J, Dolken G, Reichhardt P, Siegert W, Natt F, et al, (1991) Cisplatin, etoposide, and ifosfamide salvage therapy for refractory or relapsing germ cell carcinoma. J Clin Oncol 9, 1529-1535 Hartmann JT, Schmoll HJ, Kuczyk MA, Candelaria M, Bokemeyer C (1997) Postchemotherapy resections of residual masses from metastatic non-seminomatous testicular cell tumors. Ann Oncol 8, 531-538. International Germ Cell Cancer Collaborative Group (1997) International germ cell consensus classification: a prognostic factor-based staging system for metastatic germ cell cancers. J Clin Oncol 15, 594-603. Loehrer PJ Sr, Hui S, Clark S, Seal M, Einhorn LH, Williams SD, Ulbright T, Mandelbaum I, Rowland R, Donohue JP (1986) Teratoma following cisplatin-based combination chemotherapy for nonseminomatous germ cell tumors: a clinicopathological correlation. J Urol 135, 1183. Loehrer PJ Sr, Lauer R, Roth BJ, Williams SD, Kalasinski LA, Einhorn LH (1988) Salvage therapy in recurrent germ cell cancer: Ifosfamide and cisplatin plus either vinblastine or etoposide. Ann Intern Med 109, 540-546 Motzer RJ, Mazumdar M, Sheinfeld J, Bajorin DF, Macapinlac HA, Bains M, Reich L, Flombaum C, Mariani T, Tong WP, Bosl GJ (2000) Sequential dose-intensive paclitaxel, ifosfamide, carboplatin and etoposide salvage therapy for germ cell tumor patients. J Clin Oncol 18, 1173-1180. Nichols CR, Tricot G, Williams SD, van Besien K, Loehrer PJ, Roth BJ, Akard L, Hoffman R, Goulet R, Wolff SN, et al, (1989) Dose-intensive chemotherapy in refractory germ cell cancer-a phase I/II trial of high-dose carboplatin and

etoposide with autologous bone marrow transplantation. J Clin Oncol 7, 932-939. Peckham MJ, Horwich A, Easton DF, Hendry WF (1988) The management of advanced testicular teratoma. Br J Urol 62, 63-68. Pizzocaro G, Nicolai N, Milani A, Piva L, Merson M, Colavita M, Salvioni R (1998) Is further chemotherapy necessary in radically resected residual cancer in non-seminomatous germ cell tumors (NSGCT) of the testis following induction chemotherapy. Proc Am Soc Clin Oncol 17, abstract. Rick O, Beyer J, Kingreen D, Schwella N, Krusch A, Schleicher J, Kirsch A, Huhn D, Siegert W (1998) High-dose chemotherapy in germ cell tumours: a large single centre experience. Eur J Cancer 34, 1883-1888. Rick O, Bokemeyer C, Beyer J, Hartmann JT, Schwella N, Kingreen D, Neureither S, Metzner B, Casper J, Wandt H, Hartmann F, Schmoll HJ, Derigs G, Gerl A, Berdel WE, Kanz L, Siegert W (2001) Salvage treatment with paclitaxel, ifosfamide and cisplatin (TIP) plus high-dose carboplatin, etoposide and thiotepa (CET) followed by autologous stem cell rescue in patients with relapsed or refractory germ cell cancer. J Clin Oncol 19, 81-88. Rick O, Siegert W, Beyer J (1999) High-dose salvage chemotherapy. Germ-cell tumor treatment results in Germany. Int J Cancer 83, 839-840. Rodenhuis S, de Wit R, de Mulder PH, Keizer HJ, Sleijfer DT, Lalisang RI, Bakker PJ, Mandjes I, Kooi M, de Vries EG (1999) A multi-center prospective phase II study of highdose chemotherapy in germ-cell cancer patients relapsing from complete remission. Ann Oncol 10, 1467-1473. Rosti G, Pico JL, Wandt H, Koza V, Salvioni R, Theodore C, Lelli G, Siegert W, Horwich A, Marangolo M, Schmoll HJ, Linkesch W, Pizzocaro G, Bouzy J, Kramar A, Droz JP, Biron P (2002) High-dose chemotherapy in the salvage treatment of patients failing first-line platinum chemotherapy fo advanced germ cell tumors; first results of a prospective randomised trial of the European Group for Blood and Morrow Transplantation (EBMT): IT-94 study. Proc Am Soc Clin Oncol 21, abstract 716. Saxman SB, Nichols CR, Einhorn LH (1994) Salvage chemotherapy in patients with extragonadal nonseminomatous germ cell tumors: the Indiana University experience. J Clin Oncol 12, 1390-1393. Siegert W, Beyer J, Strohscheer I, Baurmann H, Oettle H, Zingsem J, Zimmermann R, Bokemeyer C, Schmoll HJ, Huhn D (1994) High-dose treatment with carboplatin, etoposide, and ifosfamide followed by autologous stem-cell transplantation in relapsed or refractory germ cell cancer: a phase I/II study. The German Testicular Cancer Cooperative Study Group. J Clin Oncol 12, 1223-1231. Stenning SP, Parkinson MC, Fisher C, Mead GM, Cook PA, Fossa SD, Horwich A, Jones WG, Newlands ES, Oliver RT, Stenwig AE, Wilkinson PM (1998) Postchemotherapy residual masses in germ cell tumor patients: Content, clinical features, and prognosis. Medical Research Council Testicular Tumor Working Party. Cancer 83, 1409-1419. Steyerberg EW, Gerl A, Fossa SD, Sleijfer DT, de Wit R, Kirkels WJ, Schmeller N, Clemm C, Habbema JD, Keizer HJ (1998) Validity of predictions of residual retroperitoneal mass histology in nonseminomatous testicular cancer. J Clin Oncol 16, 269-274. Steyerberg EW, Keizer HJ, Fossa SD, Sleijfer DT, Toner GC, Schraffordt Koops H, Mulders PF, Messemer JE, Ney K, Donohue JP, et al, (1995) Prediction of residual retroperitoneal mass histology after chemotherapy for metastatic nonseminomatous germ cell tumor: multivariate analysis of individual patient data from six study groups. J Clin Oncol 13, 1177-1187.

18


Cancer Therapy Vol 1, page 19 Tait D, Peckham MJ, Hendry WF, Goldstraw P (1984) Postchemotherapy surgery in advanced non-seminomatous germcell testicular tumours: The significance of histology with

particular reference to differentiated (mature) teratoma. Br J Cancer 50, 601-609.

19


Rick et al: Current aspects in testicular cancer

20


Cancer Therapy Vol 1, page 21 Cancer Therapy Vol 1, 21-29, 2003.

Gene expression profiles related with overcoming cisplatin resistance in human cancer cell lines Research Article

Moonkyu Kim 1, Young Jin Park1, Ok Ju Kim 2, Gab Yong Lee2, Eun Jung Chung3, Young Kwan Sung1, Jung Chul Kim1, Insook Han3*, Youn Soo Sohn4 1

Department of Immunology, School of Medicine, Kyungpook National University, Daegu 700-422

2

Department of Chemistry, Taegu Catholic University, Kyongsan 712-70

3

Trichogene, Inc., Daegu 700-422, Korea

4

Department of Chemistry, Ewha Womans University, Seoul, 120-750, Korea

__________________________________________________________________________________ *Corresponding author: Insook Han, e-mail: ishan60@hanmail.net Key words: cDNA microarray, platinum complex, liposome, cisplatin resistance, overcoming drug resistance Abbreviations: superoxide dismutase, (SOD); high-mobility group protein, (HMG) Received: 28 February 2003; Accepted: 29 February 2003; electronically published: April 2003

Summary Gene expression profiles were analyzed using cDNA microarray for cisplatin-sensitive and their resistant cancer cell lines. Sensitive cells included the cervical ME180, leukemia K562, and ovarian A2780. Their corresponding resistant cell lines to cisplatin were ME180/PDD, K562/PDD and A2780/PDD, respectively. All three cisplatinresistant cell lines showed small changes in gene expression profiles between them. Genes of cell adhesion & matrix, DNA binding & response, and specific enzymes, were up- or down-regulated depending on the cell type. However genes involved in cell cycle, oncogenes and SOD (superoxide dismutase) were up-regulated only in cisplatinresistant cell lines. In order to investigate changes in gene expression linked with overcoming cisplatin resistance, we have treated A2780/PDD cells with pegylated liposomal trans(+)-1,2-diaminocyclohexane glutamatoplatinum(II) complex [L-Pt(dach)(glu)], which is known to overcome cisplatin resistance. This treatment resulted in upregulation of cytokine, tumor suppressor and carbohydrate-modifying enzymes, whereas oncogene, DNA binding & response, cell membrane redox- and cacium-related enzymes, and SOD were down-regulated. All these changes in gene expression profiles between drug-treated and untreated A2780/PDD cells seemed to be related with the cytotoxicity to L-Pt(dach)(glu) in resistant cells, arising from overcoming cisplatin resistance. We show that microarray analysis is useful for evaluating the overcoming in cisplatin resistance and can efficiently be custom applied as an indicator of maintenance or lack of cisplatin resistance in chemotherapy for predicting therapeutic efficacy. significant toxic side effects such as acute nephrotoxicity and neurotoxicity, and its pre-existed or acquired drug resistance. Cisplatin resistance is multifactorial. It consists of mechanisms such as decreased drug accumulation (Andrews et al, 1988; Kelland et al, 1992), increased drug deloxification (Behrens et al, 1987; Mistry et al, 1991; Godwin et al, 1992), and an enhanced ability to repair (Lai et al, 1988; Masuda et al, 1988; Parker et al, 1991; Zhen et al, 1992) and tolerate (Johnson et al, 1997) DNA damage. Up-regulation of DNA repair genes including XPB, XPD, XPA and ERCC-1 have been implicated in the development of cisplatin resistance in human tumor cells (Wood, 1997; Dabholkar et al, 2000; Aloyz et al, 2002; Xu et al, 2002).

I. Introduction Cisplatin [cis-diamminedichloroplatinum(II)] is very effective in the treatment of various types of human cancers (Carter et al, 1984). The cytotoxicity of this drug is believed to result from the platinum binding to DNA. The reaction between cisplatin and DNA produces several types of platinum-DNA adducts; monoadducts and bifunctional intrastrand or interstrand crosslinked adducts. These DNA-platinum adducts prevent efficient DNA replication and transcription to exert the cytotoxic effect of cisplatin. Though cisplatin has excellent cytostatic effect in tumors as a result of DNA binding, the success of cisplatin-based chemotherapy is limited due to its

21


Kim et al: Gene expression and cisplatin resistance from Dr. Sohn in Ewha Womans University, Korea. Lipids like DMPC, PEG2000-DMPE, cholesterol were purchased from Avanti Polar Lipids (Alabaster, Ala).

Recently, cDNA microarrays have been successfully used to study global patterns of gene expression in human cancer research field (DeRisi et al, 1996; Golub et al, 1999; Alizadeh et al, 2000; Perou et al, 2000). Microarray can detect gene expression changes between two samples about the known and unknown huge number of genes by a single experiment. Thus, to investigate the change of gene expression concerned with cisplatin sensitivity and resistance, gene expressions was compared by using microarray analysis. Through the reports of gene expressions in cisplatin resistant cells and tissues, many kinds of genes were included such as apotosis, cell adhesion, motility, cell cycle, cell development regulators, receptors, growth factors, invasion regulators, oncogenes, as well as DNA damage and repair genes (Sakamoto et al, 2001), whereas previous studies before microarray on cisplatin resistance mechanism only focused on the genes related with the DNA damage and repair mechanisms. Therefore, we tried to use cDNA microarray analysis to identify diverse gene expressions in cisplatin-resistant cells compared to sensitive ones. First, we tried to analyze the gene expression profiles concerned with cisplatin sensitivity and resistance using three different cancer cell lines. Those are human cervical ME180, leukemia K562, and ovarian A2780 cancer cell lines; and their corresponding cisplatin-resistant cell lines, ME180/PDD, K562/PDD and A2780/PDD, respectively. Several strategies have been developed to both overcome cisplatin resistance (Canon et al, 1990) and reduce cisplatin-induced toxicity on extra-tumoral normal tissues (Konno et al, 1992). Among the strategies in platinum drug, the dach-platinum(II) complex have attracted significant attention for many years because they are not cross-resistant to cisplatin (Jennerwein et al, 1989). Another strategy was the application of liposome to overcome the cisplatin resistance. Liposomes offer a versatile drug-carrier technology with great potential for improving the pharmakokinetics of anti-cancer drugs. They have been widely used as a means to reduce the toxicity of drugs (Gabizon et al, 1998) and enhance their therapeutic indexes (Sharma et al, 1993). In the case of cytostatic drugs, increasing local tumor exposure by liposomes has been reported to be a useful strategy for overcoming the resistance of cancer cells to chemotherapy (Khokhar et al, 1991; Ho et al, 1997). Our results also proved the effect of the encapsulation of Pt(dach)(glu) in liposomes to increase cytostatic activity and overcome the cisplatin resistance in several cancer cell lines. Thus, we have applied cDNA microarray analysis to evaluate the overcoming cisplatin resistance in A2780/PDD cells by the treatment of liposomal (L-) Pt(dach)(glu). By comparing the changes of gene expressions in A2780/PDD cells by the treatment of L- Pt(dach)(glu), we have tried to figure out which genes are important to overcome the cisplatin resistance.

B. Preparation of liposomal platinum drug Liposomes containing Pt(dach)(glu) complex were prepared by lyophilization-rehydration method (Han et al, 2002). Briefly, lipids in chloroform were mixed at the desired molar ratio (DMPC/PEG2000-DMPE/CH=50/5/45), and the chloroform was removed in a rotary evaporator. To the dried lipid film, the platinum drug dissolved in methanol were added at the weight ratio of drug to lipid (1:20) and subsequently the methanol solvent was removed by rotary evaporator. Then, tertbutanol was added and the solutions was shaked at 40-50oC for 10-30 min to obtain the clear solutions. Aliquoted samples in vials were frozen in dry ice/acetone bath, and tert-butanol was removed by lyophilization overnight to give the lyophilized preliposomal powders. To reconstitute the preliposomes, saline or PBS solution was added at the concentration of 50 mg/ml, and the resulting suspension was shaked at 40oC for 60 min with vortexing and sonication.

C. Cancer cell lines ME180, K562 and A2780 cancer cell lines were derived from the patients prior to chemotherapy and obtained from Dr. Perez-Soler in Albert Einstein College of Medicine. All these cell lines (ME180, K562, A2780) were made resistant to cisplatin in vitro by means of continuous stepwise exposure to ciplatin to produce the corresponding cisplatin-resistant cell lines; ME180/PDD, K562/PDD, and A2780/PDD, respectively.

D. Cell cytotoxicity and resistance index Cell cytotoxicity was determined by MTT (methylthiazoletetrazolium) dye reduction assay. Cells were seeded in 150 Âľl of medium/well in 96-well plates, allowed to attach overnight, and then exposed to various concentrations of drugs for 48 h. After washing the cells with PBS twice, 40 Âľl of a 5 mg/mL solution of MTT was added per well. After 4 h at 37oC, the cells were lysed by adding 100 Âľl of dimethyl sulfoxide and incubated for 2 h. The cell survival fractions were determined by reading the absorbance at 570nm in a microplate reader (Model MCC/340, Titertek multiscan). All the IC50 (50% inhibitory cell dose) values of liposomal platinum drug were normalized against those of the corresponding empty liposomes.

II. Materials and methods A. Platinum drug and Cisplatin was purchased from Dong-A Pharmaceutical Co. (Ahnyang, Korea) and dachglutamatoplatinum drug [Pt(dach)(glu) in Figure 1] was obtained

Figure 1. Chemical structure of anti-cancer platinum drug

22


Cancer Therapy Vol 1, page 23 The reported values are the averages of triplicate experiments. The resistance indexes were calculated as the ratio of IC50 in resistant cells to IC50 in sensitive cells.

a filter that included all genes exhibiting a minimum level of expression of intensity of >1,000 fluorescent units (on a scale of 0-65,535 fluorescent units) for both red and green channels for each pair of experiments.

E. Preparation of total and messenger RNA

III. Results and discussion

Total RNA was extracted from cultured cells using a modified acid phenol method. Briefly, the growth medium was removed and the cells lysed with Trizol (Life Technologies). The lysate was cleared and extracted with 1/10 volume of 1-bromo-3chloropropane. The aqueous layer was collected in a new tube and precipitated with isopropanol. After 75% ethanol washing, the pellet was air dried and resuspended in DEPC-treated water, and quantified by A260/280 measurement using UV spectrometer (DU 530, Beckman, USA). For assessing the quality, 3~5 ug of total RNA was loaded onto denaturing 1.0% formaldehyde agarose gels and for electrophoresed. mRNA was then isolated from total RNA with oligotex mRNA midi kit (Qiagen, Chatsworth, CA, USA).

A. Preparation of cDNA microarray and hybridization To screen the specific genes in cisplatin-resistant cancer cell lines, we tested with our in-house cDNA microarray, which contains 3,063 cDNA clones from 7 different cDNA libraries. Housekeeping genes, !-actin (Accession No. NMµ001101) and glyceraldehyde-3phosphate dehydrogenase (GAPDH; Accession No. NMµ002046) was printed on the same array to serve as internal controls. The microarray was subsequently hybridized with cDNA probes labeled with fluorochromes. Probes were prepared with aRNA from cultured drug sensitive and resistant cells. The fluorescent targets were pooled and allowed to hybridize under stringent conditions to the clones on the microarray. Laser excitation of the incorporated targets yields an emission with a characteristic spectra, which is measured using a scanning confocal laser microscope. Monochrome images from the scanner (Scanarray 4000) were imported into software (GenePix) in which the images were pseudo-colored. The color images of the hybridization results were generated by representing the Cy-3 fluorescent image as green and the Cy-5 fluorescent image as red and then merging the two color images. To ensure reproducibility of the microarray results, we repeated each experiment twice with each RNA samples. The cDNA probe derived from sensitive cells was labeled with Cy-3 dUTP (green) and the cDNA probe from resistant cells was labeled with Cy5 dUTP (red). Green and red fluorescent signals indicate greater relative expression in sensitive and resistant cells, respectively. The yellow fluorescent signal indicates that both of the RNA is equal expression level. The spots with signal intensities that were at least 1.5-fold different from control levels in both experiments were designated as genes that are differentially expressed.

F. cDNA microarrays 1. Preparation of fluorescent DNA probe from mRNA Probes were made as described (DeRisi et al, 1996) with several modifications. The reverse transcriptase used here was Superscript II RNase H (Life Technologies). The Cy-3 dCTP and Cy-5 dCTP were purchased from Amersham Pharmacia Biotech. Each reverse transcription reaction contained 3 µg of mRNA and 0.5 µg of oligo(dT) primer. Following the reverse transcription step, samples were treated with each 1.0 µl of 1.5 M sodium hydroxide and 30 mM EDTA for 10 minutes at 65oC, them neutralized by adding 468 µl of TE buffer (pH 7.4). Using a Micron 30 (Millipore), the probe was purified and concentrated. Cy-3 and Cy-5 fluorescently labeled probes were mixed in 3 X SSC, 0.1 % SDS with 0.5 mg/ml poly A blocker (Amersham Pharmacia Biotech), and 0.5 mg/ml yeast tRNA (Life Technologies) to a final volume of 25 µl

2. Microarray hybridization Arrays were prehybridized in 3.5 X SSC, 0.1% SDS, 10 mg/ml BSA in a Coplin jar for 20 minutes at 50oC, and washed by dipping in water and in isopropanol, and dried using centrifuge. The prepared probes was denatured by heating at 95100oC for 2 minutes and added onto a array with cover slide. The hybridization was done in a CMT-Hybridization chamber (Corning) for 20 hours in a 50oC waterbath. Arrays were washed for 5 minutes at room temperature in low stringency wash buffer (0.1 X SSC/0.1% SDS), then twice for 5 minutes in high stringency wash buffer (0.1 X SSC) and dried using centrifuge.

B. Analysis of gene expression pattern in cisplatin-resistant cancer cell lines In order to examine the gene expression profiles in resistant cell lines to cisplatin, we analyzed three different human cancer cell lines; cervical ME180, leukemia K562, ovarian A2780 sensitive and their-resistant counterparts to cisplatin ME180/PDD, K562/PDD, and A2780/PDD cancer cell lines, respectively. The resistance index of ME180/PDD, K562/PDD and A2780/PDD cancer cell lines to cisplatin are 5.0, 3.7 and 6.0, respectively.

3. Microarray hybridization Fluorescence intensities at the immobilized targets were measured using Scanarray 4000 with a laser confocal microscope (GSI Lumonics, USA). The two fluorescent images (Cy-3 and Cy-5) were scanned separately from a confocal microscope, and color images were formed by arbitrarily assigning differentiated cell intensity values into the red channel and control intensity into the green channel and data were analyzed using Quantarray software (version 2.0.1, GSI Lumonics). Results were also analyzed by normalization between the images to adjust for the different efficiencies in labeling and detection with the two different fluors. This was achieved by matching of the detection sensitivities to bring a set of 32 internal control genes (!-actin and GAPDH) to nearly equal intensity. For this analysis, we used

Figure 2 shows tree view image of clustered data set of 3,063 genes in three human cancer cell lines. Table 1 summarizes 30~40 of up-regulated and 10~15 of downregulated genes with expression ratio in these cisplatinresistant cancer cell lines. Compared to the sensitive cells, three resistant cells showed the up-regulated genes with

23


Kim et al: Gene expression and cisplatin resistance Table 1: List of up- and down-regulated genes in three human resistant cancer cell lines to cisplatin Up-regulated genes Cell adhesion & matrix actin, alpha 2 integral type I protein myosin, light chain vimentin keratin 5 (KRT5) integrin-linked kinase(ILK) collagen, type V, alpha 3 tubulin, alpha, brain-specific myosin (MYL6) Cell cycle thymosin, beta 4 thymosin beta-10 cyclin-dependent kinase 4 DNA binding & response high-mobility group protein G protein (GNB2L1) G-rich RNA sequence binding factor 1 PAI-RBP1 Oncogenes RAS oncogene family prostate tumor over expressed gene 1 Enzymes B4GALT1 PPAP2B ubiquitin esterase L1 aldo-keto reductase family 1 Ca-independent phospholipase A2 tissue inhibitor of metalloproteinase 1 N-terminal acetyltransferase complex Other genes superoxide dismutase 1 anti-oxidant protein 2 fibroblast activation protein osteonectin HS1 binding protein (HAX1) prostatic binding protein (PBP)

Exp. ratio 3.7 2.4 2.2 2.1 1.9 1.7 1.6 1.6 2.0

Down-regulated genes

Exp. ratio

Cell adhesion & matrix elastin lumican decorin cadherin 2

0.1 0.1 0.2 0.2

DNA binding & response transcription factor Dp-2 nuclear receptor BP

0.4 0.4

3.2 1.8 1.7 1.8 2.3 2.0 1.9 1.9 1.8

Enzymes

2.9 2.7 2.6 2.0 1.9 1.7 1.7 1.8 2.0 2.1 2.0 2.2 1.7

antizyme inhibitor kinectin 1(kinesin receptor) thyroid receptor protein

0.5 0.4 0.5

Other genes Dickkopf-1 ATP binding protein netrin 4 selenoprotein (SEP15) crystallin, alpha B

0.1 0.5 0.5 0.5 0.5

expression profiles, respectively, however majortrends in described genes in Table 1 were similar. Characteristic point in Table 1 is that several genes of cell adhesion & matrix, DNA-associated, and enzyme are up- or downregulated depending on their types, however genes of cell cycle and oncogene were only shown in up-regulated genes of cisplatin-resistant cell lines.

expression ratio higher than 1.60 including genes of cell adhesion & matrix such as actin, integrin, collagen, tubulin, and keratin; cell cycle such as thymosin and cyclin-dependent kinase; DNA binding & response such as G protein, RNA binding factor and high mobility group; oncogene such as RAS oncogene and prostate tumor overexpressed gene; various enzymes such as ubiquitin esterase, aldo-keto reductase, and phospholipase; and superoxide dismutase (SOD).They also showed the downregulated genes with expression ratio lower than 0.5 including genes of cell adhesion such as elastin, cadherin, and decorin; DNA binding & response such as transcription factor Dp-2 and nuclear receptor binding protein; enzyme such as thyroid receptor protein, and antizyme inhibitor; and Dickkopf-1. ME180, K562 and A2780 resistant cell lines showed a little different gene

C. Analysis of gene expressions of A2780/PDD cells treated with liposomal platinum drug To examine the changes of gene expressions by overcoming the cisplatin resistance, we tried to compare the microarray results between untreated and treated A2780/PDD cells with liposomal Pt(dach)(glu),

24


Cancer Therapy Vol 1, page 25 respectively. Table 2 shows cell cytotoxicity results of cisplatin and L-Pt(dach)(glu), in A2780 sensitive and A2780/PDD resistant cells. L-Pt(dach)(glu) was known to overcome the cisplatin resistance due to the dach group in platinum complex and cell fusion ability of liposome. As a result, the IC50 values of cisplatin (20 Âľg/ml) and L-

Pt(dach)(glu) (10 Âľg/ml) were similar in sensitive cells, however those in resistant cells were 120 and 25 Âľg/ml, respectively. Therefore, the resistance indexes were calculated out to be 6.0 and 1.25 for cisplatin and LPt(dach)(glu), respectively. It means that L-Pt(dach)(glu) can overcome the cisplatin resistance in A2780/PDD cells.

Figure 2. Tree view image of clustered data set of 3,063 genes in three human carcinoma cell lines. The vertical axis corresponds to genes, and the horizontal axis to cell lines. Red colors indicate up-regulated transcripts and green colors indicate down-regulated transcripts in each cell line.

25


Kim et al: Gene expression and cisplatin resistance Table 2. Cell cytotoxicity of cisplatin and liposomal dach-platinum drug (L-Pt(dach)(glu)) in human ovarian A2780 cancer cell linesa Drug type

A2780

A2780/PDD

Resistance Index

Cisplatin

IC50c = 20

IC50 = 120

6.0

Liposomalb platinum drug (L-Pt(dach)(glu))

10

25

1.25

Table 3. Lists the up- and down-regulated genes in A2780/PDD resistant cells treated with liposomal dach-platinum drug. Up-regulated genes Exp. ratio Down-regulated genes Exp. ratio Cell adhesion & matrix Cell adhesion & matrix integrin beta 1 BP1 2.5 collagen, type VI, alpha 3 0.2 cyclophilin B 2.4 aggrecan 1 0.4 actin, beta 2.3 integrin beta 4 BP 2.1 tubulin, beta 2 1.9 fibrillarin 1.9

Enzymes fructose aldolase A carboxypeptidase E glucose phosphate isomerase proteasome subunit, beta catechol-O-methyltransferase enolase 1, alpha NADH dehydrogenase cytochrome c oxidase 8 isocitrate dehydrogenase Cytokines IL-1 receptor-kinase 1 IL-10 interferon-induced protein 1-8U Tumor suppressor non-metastatic cells 2 BCL2-associated athanogene 3 downregulated in ovarian cancer1 Other genes heat shock protein 1 dickkopf homolog 3 chromatin assembly factor 1 chloride intracellular channel 1 clusterin (lusis inhibitor) annexin A5

DNA binding & response high-mobility group protein 1 translation initiation factor 3 transcription factor BTF3 methyl-CpG BP 2 Enzymes topoisomerase II alpha glutathione S-transferase,13 thioredoxin isolog peroxiredoxin 3 glycyl-tRNA synthetase asparaginyl-tRNA synthetase

4.8 5.5 2.9 4.1 3.4 2.8 2.2 2.1 1.9

Ca2+ related genes calumenin reticulocalbin 1 calnexin Oncogenes hypoxia-inducible factor 1 ras homolog gene family, C RAB7 (RAS oncogene) TGF beta 2 Other genes superoxide dismutase 1 anti-oxidant protein 2 dynein, LIC-2 SMT3, homolog 2

2.0 2.1 3.0 2.6 2.6 2.0

6.9 3.5 2.6 2.3 2.2 1.9

26

0.2 0.2 0.5 0.5 0.2 0.5 0.5 0.5 0.1 0.4

0.2 0.3 0.5 0.2 0.2 0.5 0.2 0.5 0.3 0.5 0.5


Cancer Therapy Vol 1, page 27

Figure 3. Tree view image of clustered data set of 3,063 genes in A2780/PDD cell lines treated with liposomal dach-platinum drug (LPt(dach)(glu)). The vertical axis corresponds to genes, and the horizontal axis to cell lines treated with the liposomal dach-platinum drug. Red colors indicate up-regulated transcripts and green colors indicate down-regulated transcripts.

Based on chemosensitivity results in Table 2, A2780/PDD resistant cells were treated with LPt(dach)(glu) at the concentrations of IC50 values for 24 hours. After analyzing the microarray results using drugtreated and -untreated cells, the clustered data set of 3,063 genes are shown in Figure 3. Red colors indicate upregulated transcripts and green colors indicate downregulated transcripts. Table 3 shows up- and downregulated genes in A2780/PDD cells when treated with LPt(dach)(glu). Gene expressions of cell cyle, DNA binding & response, oncogene, superoxide dismutase (SOD) and anti-oxidant protein those were found to up-regulated in cisplatin-resistant cell lines compared to sensitive cell lines (Table 1) were reduced or even found in downregulated gene profile.

Pt(dach)(glu). On the other hand, gene expressions of cytokines such as IL-10, IL-1 receptor kinase 1, and interferon-induced protein; and tumor suppressors such as non-metastatic related, Bcl2 associated, and down regulator of ovarian cancer 1 were newly appeared in list of up-regulated genes. In brief, L-Pt(dach)(glu) reduced gene expressions of oncogenic factors, DNA-associated, cell cycle and proliferation, and induced those of cytokine and tumor suppressor genes. These results proved the positive effect of cell cytotoxicity of L-Pt(dach)(glu) in A2780/PDD cell lines which indicates overcoming cisplatin resistance. Furthermore, some carbohydratemodifying enzymes were newly added in up-regulated profiles. This suggests that this liposomal drug may go through different mode of action and cell-killing mechanism including several important carbohydrate modifications to overcome cisplatin resistance.

For example, DNA binding & response high-mobility group protein (HMG), oncogene (RAS), SOD and antioxidant protein were down-regulated from 1.8, 1.9, 1.8 and 2.0 expression ratio in A2780/PDD cells to 0.2, 0.2, 0.5 and 0.3 in drug-treated A2780/PDD cells, respectively. Most of cell adhesion and matrix genes were still found to up-regulated without significant changes by L-

Among down-regulated genes by the treatment of LPt(dach)(glu) (Table 3), high mobility group protein 1, RAS, SOD, and anti-oxidant protein genes were found in up-regulated gene list in cisplatin-resistant profile (Table 1). Many other oncogenes such as hypoxia-inducible

27


Kim et al: Gene expression and cisplatin resistance Andrews PA, Velury S, Mann SC, Howell SB (1988) cisDiamminedichloroplatimum(II) accmulation in sensitive and resistant human ovarian carcinoma cells. Cancer Res 48, 6873. Behrens BC, Hamilton TC, Masuda H, Grotzinger KR, WhangPeng J, et al (1987) Characterization of a cis-diammine dichloroplatimum(II)-resistant human ovarian cancer cell line and its use in evaluation of platinum analogues. Cancer Res 47, 414-418. Canon JL, Humblet Y, Symann M ( 1990) Resistance to cisplatin. How to deal with the problem? Eur J Cancer 26, 1-3. Carter S (1984) Cisplatin-past, present and future. In: Hacker MP (ed). Platinum Coordination Complexes in Cancer Chemotherapy Martinus Nijhoff Press: Boston, 359-370. Dabholkar M, Thornton K, Vionnet J, Bostick-Bruton F, Yu JJ, Reed E (2000) Increased mRNA levels of xeroderma pigmentosum complementation group B (XPB) and Cockayne’s syndrome complementation group B (CSB) or metallothionein-II (MT-II) in platinum-resista. Biochem Pharmacol 60, 1911-1619 DeRisi JL, Penland PO, Brown ML, Bittner PS, Meltzer M, Ray Y, Chen YAS, Trent JM (1996) Use of cDNA microarray to analyse gene expression patterns in human cancer. Nat Genet 14, 457-460. Gabizon AA, Goren D, Cohen R, Barenholz Y (1998) Development of liposomal anthracyclines: from basics to clinical applications. J Con Rel 53, 275-279. Godwin AK, Meister A, O’Dwyer PJ, Huang CS, Hamilton TC, Anderson ME (1992) High resistance to cisplatin in human ovarian cancer cell lines is associated with marked increase of glutathione synthesis. Proc Matl Acad Sci USA 89, 30703074.

factor, RAB7, and TGF-! and DNA binding & response genes such as transcription factor and methyl CpG binding protein genes were also down-regulated in L-Pt(dach)(glu) treatment. In addition, topoisomerase and redox-related enzymes such as glutathion, thioredoxin, and peroxiredoxin; and calcium-related genes such as calumenin, reticulocalbin, and calnexin were appeared in down-regulated profiles. In summary, L-Pt(dach)(glu) up-regulated gene expressions of cytokines, tumor suppressors and carbohydrate-modifying enzymes; and down-regulated those of oncogene, DNA binding & response, redox- and cacium-related enzymes, and SOD in cisplatin-resistant A2780/PDD cells. Therefore, some gene expression profiles of cisplatin resistant cells were changed to the opposite direction by the treatment of L-Pt(dach)(glu) which may explain their losing cisplatin resistance in A2780/PDD cells. Up-regulation of cytokine and tumor suppressor and down-regulation of oncogene definitely related with the cytotoxicity of anticancer-drug to kill the cancer cells. However, up-regulations of carbohydratemodifying enzymes; and down-regulations of redox- and calcium-related enzymes would give a clue that LPt(dach)(glu) have overcome cisplatin resistance through different mode of action and cell killing mechanism compared to previous anti-cancer drug, cisplatin. All these results proved that cDNA microarray analysis could be useful to evaluate the keeping or overcoming of cisplatin resistance in human cancer cell lines.

Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, et al (1999) Molecular claasification of cancer: class discovery and class prediction by gene expression monitoring. Science 286, 531-537. Ho SY, Babarese E, D’Arrigo JS (1997) Evaluation of lipidcoated microbubbles as a delivery vehicle for Taxol in brain tumor therapy. Neurosurgery 40, 1260-268. Jennerwein M, Eastman A, Khokhar AR (1989) Characterization of adducts produced in DNA by isomeric 1,2diaminocyclohexaneplatinum(II) complexes. Chem Biol Interact 70, 39-49. Johnson SW, Laub PB, Beesley JS, Ozols RF, Hamilton TC (1997) Increased platinum-DNA damage tolerance is associated with cisplatin resistance and cross-resistance to various chemotherapeutic agents in unrelated human ovarian cancer cell lines. Cancer Res 57, 850-856. Kelland LR, Mistry P, Abel G, Loh SY, O’Neill CF, Murrer VA, Harrap KR (1992) Mechanism-related circumvention of acquired cis-diamminedichloroplatinum(II) resistance using two pairs of human ovarian carcinoma cell lines by ammine/amine platinum(II) dicarboxylates. Cancer Res 52, 3857-3864. Khokhar AR, Al-Baker S, Brown T, Perez-Soler R (1991) Chemical and biological studies on a series of lipid-soluble DACH-Pt(II) complexes incorporated in liposomes. J Med Chem 34, 325-329. Konno T. (1992) Targeting chemotherapy for hepatoma-arterial administration of anticancer drugs dissolved in lipidol. Eur J Cancer 28, 403-409. Lai G-M, Ozols RF, Smyth JF, Young RC, Hamilton TC (1988) Enhanced DNA repair, resistance to cisplatin in human ovarian cancer. Biochem Pharmacol 37, 4597-4600. Masuda H, Ozols RF, Lai G-M, Fojo A, Rothenberg M, Hamilton TC (1988) Increased DNA repair as a mechanism of acquired resistance to cis-diammine dichloroplatimum(II)

The prediction of the cisplatin resistance and sensitivity of tumors is an extremely important criteria to use anti-cancer drug for cancer chemotherapy. One approach to solve the limitation of anti-cancer drug based chemotherapy is to elucidate the mechanisms of drug resistance and then develop ways to overcome resistance effectively or to prevent its occurrence. As for clinical application, microarray can be used to compare the gene expression profiles directly from patient samples to differentiate between chemotherapy sensitive group and the resistant group. It will really help to decide the treatment modalities. Thus, microarray analysis will be applied for personalization of chemotherapy such as selection of effective chemotherapy protocol and prediction of therapeutic efficacy in near future.

Acknowledgements This work was supported by grant (FG00-0101-0012-2-0) from the 21C Frontier Human Genome Project, The Ministry of Science and Technology, Republic of Korea.

References Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, et al (2000) Distinct types of diffuse large Bcell lymphoma identified by gene expression profiling. Nature 403, 503-511. Aloyz R, Xu ZY, Bello V, Bergeron J, Han FU, Yan Y, Malapetsa A, et al (2002) Regulation of cisplatin resistance and homologous recombinational repair by the TFIIH subunit XPD. Cancer Res 62, 5457-5462.

28


Cancer Therapy Vol 1, page 29 in human ovarian cancer cell lines. Cancer Res 48, 57135716. Mistry P, Kelland LR, Abel G, Sidhar S, Harrap KR (1991) The relationships between glutathione, glutathione-S-transferase, cytotoxicity of platinum drugs, melphalan in eight human ovarian carcinoma cell lines. Br J Cancer 64, 215-220. Parker RJ, Eastman A, Bostick-bruton F, Reed E (1991) Acquired cisplatin resistance in human ovarian cancer cells is associated with enhanced repair of cisplatin-DNA lesions and reduced drug accumulation. J Clin Invest 87, 772-777. Perou CM, Sorlie T, Eisen MB, Jeffrey SS, Rees CA, Pollack JR, Ross DT, et al (2000) Molecular portraits of human breast tumors. Nature 406, 747-752. Sakamoto M, Kondo A, Kawasaki K, Goto T, Sakamoto H, Miyake K, et al (2001) Analysis of gene expression profiles associated with cisplatin resistance in human ovarian cancer

cell lines and tissues using cDNA microarray. Human Cell 14, 305-315. Sharma A, Mayhew E, Straubinger RM (1993) Antitumor effect of Taxol-containing liposomes in a Taxol-resistant murine tumor model. Cancer Res 53, 5877-5881. Wood RD (1997) Nucleotide excision repair in mammalian cells. J Biol Chem 272, 23465-23468. Xu ZY, Chen ZP, Malapetsa A, Alaoui-Jamali MA, Bergeron J, et al (2002) DNA repair protein levels vis-Ă -vis anticancer drug resistance in the human tumor cell lines of the National Cancer Institute drug screening program. Anti-Cancer Drugs 13, 511-519. Zhen W, Link CJ Jr, Oâ&#x20AC;&#x2122;Connor PM, Reed E, Parker R, Howell SB, Bohr VA (1992) Increased gene-specific repair of cisplatin interstrand cross-links in cisplatin-resistant human ovarian cancer cell lines. Mol Cell Bio 12, 3689-3698.

29


Kim et al: Gene expression and cisplatin resistance

30


Cancer Therapy Vol 1, page 31 Cancer Therapy Vol 1, 31-37, 2003

Vascular endothelial growth factor modulates cisplatin sensitivity in human ovarian carcinoma cells Research Article

Guodong Hu, Sean Ryan, Yunfeng Zhu, Eddie Reed, Xiping Li, Gangduo Wang, and Qingdi Q. Li* The Mary Babb Randolph Cancer Center and Department of Microbiology, Immunology and Cell Biology, West Virginia University School of Medicine and Robert C. Byrd Health Sciences Center, Morgantown, WV 26506, USA __________________________________________________________________________________________________ *Corresponding Author: Qingdi Q. Li, M.D., Ph.D., 1831 Mary Babb Randolph Cancer Center, West Virginia University, Health Sciences Center, P.O. Box 9300, Morgantown, WV 26506-9300, USA; Tel: 304-293-6870; Fax: 304-293-4667; e-mail: qli@hsc.wvu.edu Key words: Angiogenesis, VEGF, ovarian cancer, Caov3 cells, cisplatin resistance. Abbreviations: VEGF, vascular endothelial growth factor; VPF, vascular permeability factor; GSH, glutathione; cisplatin (CDDP), cisdiamminedichloroplatinum (II); bFGF, basic fibroblast growth factor; HGF, hepatocyte growth factor; PGF, placenta growth factor; PDEGF, platelet-derived endothelial growth factor; PBS, phosphate-buffered saline; DMSO, dimethyl sulfoxide; MTT, 3-(4,5dimethylthuazole-2-yl)-2,5 diphenyl tetrazolium bromide; RT-PCR, reverse transcriptase polymerase chain reaction; FasL, Fas ligand; NER, nucleotide excision repair; JNK, c-Jun N-terminal kinase; ERK, extracellular signal-regulated kinase; MAPK, mitogen-activated protein kinase; MEK, mitogen-activated protein kinase/ERK kinase; AP-1, activator protein 1. Received: 11 February 2003; Accepted: 19 February 2003; electronically published: April 2003

Summary Cisplatin is among the most effective and widely used chemotherapeutic agents employed for treatment of human cancers, and a major limitation of cisplatin chemotherapy is serious drug resistance. Vascular endothelial growth factor (VEGF), a potent angiogenic factor, plays an important role in cell growth and survival of endothelial cells and tumor cells. However, the role of VEGF in cisplatin resistance in human cancers is unclear. Therefore, the present study sought to examine the effect of VEGF on cisplatin-induced cytotoxicity in human ovarian cancer CaOV3 cells. We show in this report that VEGF mediated cytoprotection against cisplatin-caused cell killing and significantly increased cell survival in CaOV3 cells exposed to cisplatin. VEGF was found to reduce cisplatin cytotoxicity and decrease cisplatin sensitivity in these cells, which are dependent upon the concentrations of cisplatin. The effect of VEGF was also sequence-dependent. Concurrent treatment of VEGF and cisplatin markedly increased cell viability as compared to cells exposed to cisplatin alone. By contrast, only a little effect of VEGF was observed when cells were treated with VEGF after or prior to cisplatin. These findings suggest that VEGF may contribute to the chemoresistance to cisplatin in patients with ovarian cancer and other tumors, and hence highlight that potential therapeutic strategies of anti-angiogenesis which specifically inhibit VEGF activity may reverse drug resistance to cisplatin. statistics stem from the fact that while most patients have a response to initial therapy, the majority of these responses are transient. Most patients will have cisplatin-resistant disease. The precise mechanism of cisplatin resistance in human cancers is, however, still not fully understood although substantial efforts have been made to solve this enigma. Multiple mechanisms have been implicated in the development of cisplatin resistance including reduced accumulation of the drug, elevated levels of glutathione (GSH), enhanced expression of metallothionein, increased DNA repair, enhanced tolerance of cisplatin damage, increased levels of Bcl-2-related anti-apoptosis genes, and

I. Introduction Human ovarian cancer is the fifth leading cause of cancer death among women in the United States and the most common cause of death in women in whom gynecologic cancer develops. The mainstay of therapy for advanced stage ovarian cancer is cisplatin-based systemic chemotherapy (Young et al, 1993; Reed, 1993; Reed, 1996; Reed et al, 1996; Reed, 1998). However, long-term disease-free survival following appropriate aggressive initial treatment ranges from 10 to 20% (Young et al, 1993; Omura et al, 1991). The disappointing survival 31


Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells subculturing. Cisplatin (Sigma-Aldrich Co., St. Louis, MO) was initially dissolved in phosphate-buffered saline without Ca2+ or Mg2+ at 1.0 mg/ml (3.33 µM cisplatin), and dilutions from this solution were made in medium to obtain the desired drug treatment concentrations. VEGF (Human Recombinant VEGF165) was purchased from Oncogene Research Products (Cambridge, MA). VEGF was initially dissolved in phosphatebuffered saline (PBS) at 5 µg/ml, and dilutions from this solution were made in medium to obtain the desired cytokine treatment concentrations. CaOV3 cells were assayed for sensitivity to cisplatin by measurement of the inhibition of growth following 24 to 48-h exposure to cisplatin ranging from 20 to 40 µM. Cells were seeded at an initial cell density of 2 X 104 cells/ml. Cells were starved for 48 h with the medium containing 0.2% fetal bovine serum. Cells were then treated with VEGF or cisplatin alone, or the combination of VEGF and cisplatin in different sequences. After continuous contact with cisplatin for 24-48 h, medium was removed, and cell viabilities were determined using the MTT cell viability assay. Cells treated similarly in the absence of VEGF and/or cisplatin served as controls.

alterations in signal transduction pathways involved in apoptosis (Reed et al, 1996; Gosland et al, 1996; Dabholkar and Reed, 1996; Kerbel, 1997; Reed, 1998; Reed, 1998). Angiogenesis is the process of new blood vessel growth and is necessary for growth of solid malignant tumors (Folkman, 1991). Angiogenesis not only allows a tumor to increase in size, but also increases the probability of metastasis (Folkman, 1993). Vessel growth is controlled by a balance of endogenous inhibitors and stimulators (Folkman, 1991). A number of growth factors and cytokines have been identified as potential positive inducers of angiogenesis, including vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), hepatocyte growth factor (HGF), placenta growth factor (PGF), and platelet-derived endothelial growth factor (PDEGF) (Kerbel, 2000; Slodkowska et al, 2000; Liekens et al, 2001). Recently, an increasing number of studies both in vitro and in mice demonstrated that angiogenic growth factors augment tumor cell survival and confer drug resistance by inhibiting apoptosis (Borsellino et al, 1995; Volm et al, 1999; Grothey et al, 1999; Coleman et al, 2000). For instance, evidence showed that HGF reduces sensitivity to chemotherapeutic agents and stimulates cell invasion and migration (Meng et al, 2000). Other investigations indicated that elevated levels of intracellular bFGF correlate with resistance to fludarabine in chronic lymphocytic leukemia (Menzel et al, 1996). Furthermore, overexpression of bFGF is associated with resistance to cisplatin in a human bladder cancer cell line (Miyake et al, 1998). Moreover, the addition of exogenous bFGF to endothelial cells inhibits apoptosis induced by DNA damage from ionizing radiation (Fuks et al, 1994). However, the role of VEGF and other angiogenic factors in the development of cisplatin drug resistance is unknown at the present time. The goal of the current study was to evaluate the effect of VEGF on cisplatin antitumor activity in human ovarian cancer cells. We show in this paper that VEGF decreases drug sensitivity and increases cell survival in human CaOV3 ovarian tumor cells exposed to cisplatin.

B. Cell toxicity assay The effect of VEGF and/or cisplatin on antitumor activity in human CaOV3 ovarian carcinoma cells was determined by the MTT survival assay, or using a commercial MTT assay kit (CellTiter 96! Aqueous One Solution Cell Proliferation Assay; Promega Corporation, Madison, WI) according to the manufacturer’s instructions. The MTT survival assay was performed as described previously (Yu et al, 2000). The MTT assay is a commonly used method in evaluation of cell survival, based on the ability of viable cells to convert MTT, a soluble tetrazolium salt [3-(4,5-dimethylthuazole-2-yl)-2,5 diphenyl tetrazolium bromide], into an insoluble formazan precipitate, which is quantitated by spectrophotometry following solubilization in dimethyl sulfoxide (DMSO). Briefly, CaOV3 cells untreated and treated with VEGF or cisplatin alone, or the combination of VEGF and cisplatin in 96-well tissue culture dishes were incubated with MTT (2 µg/ml) for 4 h. The cells were then solubilized in 125 µl of DMSO and absorbance readings were taken using a 96-well Opsys MR" Microplate Reader (ThermoLabsystems; Chantilly, VA). The amount of MTT dye reduction was calculated based on the difference between absorbance at 570 nm and at 630 nm. Cell viability in treated cells was expressed as the amount of dye reduction relative to that of untreated control cells. The wells which contained only medium and 10 µl of MTT were used as blanks for the plate reader. Three sets of experiments were performed in 8-12 wells for each treatment.

II. Materials and methods A. Cell line and cell culture conditions The human ovarian carcinoma cell line CaOV3 (HTB-75; American Type Culture Collection, Manassas, VA) that has been described previously was used in all of the experiments. Cells were cultured in monolayers using a RPMI 1640 medium supplemented with 10% (v/v) fetal calf serum, 2 mM Lglutamine, 0.2 units/ml human insulin, 50 units/ml penicillin, and 50 µg/ml streptomycin (Life Technologies, Inc, Gaithersburg, MD). Cells were grown in logarithmic growth at 37 ˚C in a humidified atmosphere consisting of 5% CO2 and 95% air. Cells were routinely tested for mycoplasma infection using a commercial assay system (MytoTect; Life Technologies); new cultures were established monthly from frozen stocks. All media and reagents contained <0.1 ng/ml endotoxin as determined by Limulus polyphemus amebocyte lysate assay (Whittaker Bioproducts, Walkersville, MD). Cell viability was determined in triplicate by trypan blue dye exclusion. Before starting the experiments, cells were grown to 70-90% confluence after

III. Results A major goal of the ongoing project is to understand whether angiogenic growth factors that induce angiogenesis might reverse the drug resistance to cisplatin in human ovarian cancer and better understand the underlying mechanisms in the process. In the present investigation, we first determined whether the angiogenic factor VEGF could influence the cisplatin anticancer activity in human ovarian carcinoma cells. VEGF was found to significantly reduce cell susceptibility to cell killing caused by cisplatin and augment cell survival in the CaOV3 human ovarian tumor cell line. As shown in Fig. 1, concurrent treatment of both VEGF and cisplatin for 24

32


Cancer Therapy Vol 1, page 33 h dramatically decreased cisplatin-induced cell killing in these cells from 80% cells to 32-47% cells. This amounts to approximately a 2.5-fold reduction in the amount of cell killing as compared to the control in which cells were treated with cisplatin alone. A greater effect of VEGF was observed in cells exposed to VEGF plus cisplatin for 24 h, and then fresh medium containing only VEGF was replenished for an additional 24 h. In contrast, only a little effect of VEGF in this regard was seen when VEGF was given after or prior to cisplatin. We also examined the cytoprotective effect of VEGF in cells exposed to 20 µM cisplatin for a longer time (48 h) and in cells exposed to a higher concentration of cisplatin at 40 µM. In each case, the effect of VEGF was virtually identical to the effect seen in cells exposed to 20 µM cisplatin for 24 h. Figure 2 shows that there was marked cell kill in the cisplatin-treated group, in which approximately 87% of the cells were killed in a 48-h incubation time. By contrast, VEGF treatment significantly diminished the cell kill in this model system, yielding a 4.7 to 5.8-fold higher level of cell viability than in cells exposed to cisplatin alone.

The same was true when CaOV3 cells were exposed to 40 µM of cisplatin. Our data in Fig. 3 shows that VEGF, at the concentration of 50 ng/ml, both decreased cisplatininduced cytotoxicity and increased cell survival in these cells. Table I is the comparison of the effect of VEGF on cell viability between different concentrations of cisplatin, or different exposure time to the drug in human CaOV3 ovarian cancer cells. As seen in the table, there is no significant difference in the effect of VEGF on cell toxicity between the cells exposed to cisplatin for 24 h or for 48 h. However, the cell viability following cisplatin and VEGF treatment was much lower in cells exposed to 40 µM cisplatin than in cells exposed to 20 µM cisplatin, indicating that the higher the concentration of cisplatin, the lower the protective effect of VEGF. Together, these results suggest that VEGF has strong cytoprotective activity against cisplatin-caused cell death and promotes cell survival in cisplatin-treated human CaOV3 ovarian cancer cells.

Figure 1. Effect of VEGF on cytotoxicity by CDDP (20 µM for 24 h) in human ovarian carcinoma cells as assessed by the MTT survival assay. 2 X 10 4 cells per well from CaOV3 cells were evenly distributed in 96-well plates, and were starved for 48 h in culture medium containing 0.2% fetal bovine serum. Cells were then treated as the following: Control, treated with medium only; VEGF alone, treated with 50 ng/ml VEGF only; CDDP alone, exposed to CDDP at 20 µM for 24 h, and fresh medium was then replenished; CDDP-VEGF, exposed to CDDP for 24 h, and then fresh medium containing VEGF was replenished; CDDP+VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium was replenished; CDDP+VEGF-VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium containing VEGF was replenished; VEGF-CDDP, treated with VEGF for 24 h, changed to fresh medium containing CDDP for another 24 h, and then fresh medium was replenished; VEGF-CDDP-VEGF, treated with VEGF for 24 h, changed to fresh medium containing CDDP for an additional 24 h, and then fresh medium containing VEGF was replenished. All the cells were harvested 48 h from the time when 20 µM CDDP was added to the culture. Cell viability was measured by the MTT assay and is expressed as a percentage of untreated control. CDDP, cisplatin.

Figure 2. Effect of VEGF on cytotoxicity by CDDP (20 µM for 48 h) in human ovarian cancer cells as determined by the MTT cell viability assay. 2 X 104 cells per well from CaOV3 cells were evenly plated in 96-well plates, and were starved for 48 h in culture medium containing 0.2% fetal bovine serum. Cells were then treated as the following: Control, treated with medium only; VEGF alone, treated with 50 ng/ml VEGF only; CDDP alone, exposed to CDDP at 20 µM for 48 h, and fresh medium was then replenished; CDDP-VEGF, exposed to CDDP for 48 h, and then fresh medium containing VEGF was replenished; CDDP+VEGF, exposed to CDDP and VEGF for 48 h, and then fresh medium was replenished; CDDP+VEGF-VEGF, exposed to CDDP and VEGF for 48 h, and then fresh medium containing VEGF was replenished; VEGF-CDDP, treated with VEGF for 24 h, changed to fresh medium containing CDDP for 48 h, and then fresh medium was replenished; VEGF-CDDP-VEGF, treated with VEGF for 24 h, changed to fresh medium containing CDDP for 48 h, and then fresh medium containing VEGF was replenished. All the cells were harvested 72 h from the time when 20 µM CDDP was added to the culture. Cell viability was measured by the MTT assay and is expressed as a percentage of untreated control. CDDP, cisplatin.

33


Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells

IV. Discussion VEGF, also known as vascular permeability factor (VPF), is a cytokine/growth factor, and has been known to be a potent, endothelial-cell-specific angiogenic mitogen. VEGF is secreted from tumor cells and other cells via its specific binding to its tyrosine kinase receptors (VEGFR1/Flt-1 and VEGFR2/Flk-1/KDR). Binding of VEGF to its receptors leads to intracellular propagation of a mitogenic signal through activation of the PI3 kinaseAkt and the ras-raf-MAP kinase pathways. VEGF and its receptors are expressed in angiogenic tissues during development, wound healing, and other situations such as neoplasm (Boocock et al, 1995) when angiogenesis occurs. Evidence has been accumulated that VEGF and its receptor mRNAs or proteins have been identified by reverse transcriptase polymerase chain reaction (RT-PCR), in situ hybridization, or immunohistochemistry in a number of tumors, including ovarian cancer (Boocock et al, 1995). The spatial and temporal patterns of expression of VEGF and its receptors as well as the results of targeted mutagenesis support that they are required for both normal and pathological angiogenesis during development. Similarly, the role of VEGF in tumor angiogenesis has been clearly demonstrated using tumor models in rodents. Moreover, recent studies also found that VEGF plays a role in the regulation of apoptosis induction and cell survival. Thus, VEGF contributes to the development and progression of malignant tumors. However, the role of VEGF and its receptor tyrosine kinases in the formation and development of drug resistance in human cancers remains unknown. In the present study, we demonstrated for the first time that VEGF plays an important role in the modulation of cisplatin antitumor activity in human ovarian carcinoma cells.

Figure 3. Effect of VEGF on cell toxicity by CDDP (40 µM for 24 h) in human ovarian tumor cells as measured by the MTT survival assay. 2 X 10 4 cells per well from CaOV3 cells were evenly distributed in 96-well plates, and were starved for 48 h in culture medium containing 0.2% fetal bovine serum. Cells were then treated as the following: Control, treated with medium only; VEGF alone, treated with 50 ng/ml VEGF only; CDDP alone, exposed to CDDP at 40 µM for 24 h, and fresh medium was then replenished; CDDP-VEGF, exposed to CDDP for 24 h, and then fresh medium containing VEGF was replenished; CDDP+VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium was replenished; CDDP+VEGF-VEGF, exposed to CDDP and VEGF for 24 h, and then fresh medium containing VEGF was replenished; VEGF-CDDP, treated with VEGF for 24 h, changed to fresh medium containing CDDP for an additional 24 h, and then fresh medium was replenished; VEGF-CDDP-VEGF, treated with VEGF for 24 h, changed to fresh medium containing CDDP for another 24 h, and then fresh medium containing VEGF was replenished. All the cells were harvested 48 h from the time when 40 µM CDDP was added to the culture. Cell viability was determined by the MTT assay and is expressed as a percentage of untreated control. CDDP, cisplatin

Table I. Comparison of the effect of VEGF on cell viability between CDDP at different concentrations or exposure time in human CaOV3 ovarian cancer cells.

a

See Figures 1-3 legends for additional details. Cell viabilities were determined by the MTT survival assay and expressed as a percentage of untreated control. CDDP, cisplatin

b

34


Cancer Therapy Vol 1, page 35 damages. It is broadly accepted that the antitumor activity of cisplatin results from the formation of cisplatin-DNA adducts that strongly interfere with the processing of genomic information (Rosenberg, 1979; Reed et al, 1993; Dabholkar and Reed, 1996). Cisplatin-DNA damage is repaired predominantly by the nucleotide excision repair (NER) machinery. Enhanced DNA repair capacity contributes to the formation of drug resistance to cisplatin in a wide variety of tumor cells. Our and other previous studies revealed that cisplatin may increase NER repair gene expression and DNA repair activity through a JNK-AP1 pathway leading to cell survival (Potapova et al, 1997; Li et al, 1998; Li et al, 1998; Li et al, 1999). On the other hand, a great deal of studies have supported the general view that activation of the ERK pathway delivers a survival signal. Consistent with such a prosurvival function for ERK, studies have shown that an inhibition of ERK signaling leads to increased sensitivity of ovarian cancer cell lines to cisplatin (Hayakawa et al, 1999; Persons et al, 1999). Therefore, it is possible that JNK and ERK may act collaboratively or synergistically to enhance survival of cisplatin-treated cells, as inhibition of either pathway accentuated cisplatin toxicity (Hayakawa et al, 1999). Based on these observations, we propose that VEGF may stimulate a ras-raf-MEK-ERK or PI3K-Akt cascade activity that enhances cisplatin-induced activation of JNKAP1. Such a mechanism might serve to integrate the actions of receptor protein tyrosine kinases and nonreceptor protein tyrosine kinases, which may underlie the mechanism of VEGF and cisplatin mediated DNA repair and cell survival in human ovarian cancer and other carcinomas. Studies are in progress to explore whether VEGF mediates cytoprotection against cisplatin-induced apoptosis in human cancer cells by upregulating apoptosisrescue signals, assess the effect of VEGF on DNA repair activity, and elucidate the role of PI3K-Akt, ERK or JNK in the signal transduction pathways through which VEGF modulates DNA repair activity or apoptotic activity in human carcinoma cells. In conclusion, we provided in vitro evidence for the first time that VEGF mediated cytoprotection against cisplatin-caused cell killing and significantly increased cell survival in human ovarian cancer cells exposed to cisplatin. Taken together with previous studies, our results strengthen the case that VEGF contributes to the carcinogenesis and chemoresistance of the chemotherapeutic agent cisplatin. Strategies targeting VEGF signaling pathway or the activity of VEGF, or down-regulating its expression could be employed to reduce drug resistance, increase tumor cell apoptosis, and enhance the chemotherapeutic effectiveness of cisplatin.

The addition of exogenous VEGF to the growth medium of CaOV3 cells markedly enhanced the dose-dependent survival of cells exposed to increasing concentrations of cisplatin, and therefore directly reduced the sensitivity of CaOV3 cells to this chemotherapy drug. The cytoprotective effect of VEGF against cisplatin toxicity is sequence-dependent, with maximal effect seen in cells exposed to VEGF and cisplatin simultaneously, suggesting that VEGF may exert its action through reducing cisplatincaused cell damage. A higher survival rate was observed in cells treated with VEGF plus cisplatin for 24 h, followed by VEGF only for an additional 24 h, as compared to the cells incubated with medium only after VEGF and cisplatin were removed from the cultures. This appears to suggest that continuous exposure of the cells to VEGF after cisplatin damage may prevent the cells from further damage or apoptosis caused by cisplatin, or it may enhance cell repair of cisplatin-induced DNA damage leading to a higher rate of cell viability. Exogenous VEGF did not produce any cytotoxic effects in the absence of cisplatin, and it had the expected stimulatory effect on cell growth (Figures 1 and 2). Similar effect of VEGF was also observed in TOV-21G human ovarian cancer cell line, indicating that augmented cell survival and decreased cisplatin sensitivity appear to be a common effect of VEGF in different ovarian cancer cells. The mechanism underlying the effect of VEGF in ovarian tumor cells is, however, unclear at this point. Given its broad spectrum of activities, VEGF may exert its effect in mediating the development of drug resistance through several ways. First of all, VEGF may be involved in cisplatin drug resistance via anti-apoptotic activity. Recently, experimental and clinical studies showed that VEGF was related not only to angiogenic activity, but also to the inhibition of apoptotic activity (Slodkowska et al, 2000). For example, the effects of VEGF on delaying apoptosis and prolonging the survival of tumor cell may be indirect, via the inhibition of specific genes that promote apoptosis, such as down-regulating Fas and Fas ligand (FasL) proteins, or decreasing levels of cytochrome c in the cytoplasm (Volm et al, 1996; Coleman et al, 2000). Alternatively, VEGF may block cisplatin-induced apoptosis through reducing cisplatin-caused DNA damage. Cisplatin-induced apoptosis has been closely tied to its ability to cause DNA damage (Eastman, 1990). In addition, VEGF-mediated protection of tumor cells against cisplatin may result not only from activation of an anti-apoptosis pathway, but also from an increase in repair of DNA damage. In other words, VEGF may modulate cisplatin sensitivity indirectly through the regulation of DNA repair activity. Although we do not have direct evidence at this point that VEGF mediate this effect by enhancing DNA repair, we showed in a separate study that SU5416, a selective inhibitor of VEGF receptors, counteracted the effect of VEGF by augmenting cisplatin cytotoxicity and increasing cisplatin sensitivity in human ovarian tumor cells. We further found that the effect of SU5416 on the increase in cell death or reduction of cell survival of cisplatin-treated cells is due in part to the reduction in repair efficiency of cisplatin-caused DNA

Acknowledgements This project was supported by grants from the National Institutes of Health, Bethesda, Maryland (No. 1P20RR016440-010003) and West Virginia University Research Development Grant (to Q.Q.L.).

35


Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells Menzel T, Rahman Z, Gabrilove J (1996) Elevated intracellular level of basic fibroblast growth factor correlates with stage of chronic lymphocytic leukemia and is associated with resistance to fludarabine. Blood 87, 1056-1063. Miyake H, Hara I, Kamidono S (1998) Expression of basic fibroblast growth factor is associated with resistance to cisplatin in a human bladder cancer cell line. Cancer Lett. 123, 121-126. Omura GA, Brady MF, Park RC (1991) Long-term follow-up and prognostic factor analysis in advanced ovarian carcinoma: The Gynecologic Oncology Group experience. J. Clin. Oncol. 9, 1138-1150. Persons DL, Cui W, Pelling JC (1999) Cisplatin-induced activation of mitogen-activated protein kinases in ovarian carcinoma cells: inhibition of extracellular signal-regulated kinase activity increases sensitivity to cisplatin. Clin. Cancer Res. 5, 1007-1014. Potapova O, Haghighi A, Bost F, Liu C, Birrer MJ, Gjerset R, Mercola D (1997) The Jun kinase/stress-activated protein kinase pathway functions to regulate DNA repair and inhibition of the pathway sensitizes tumor cells to cisplatin. J. Biol. Chem. 272, 14041-14044. Reed E (1993) Platinum analogs, anticancer drugs. In Cancer Principles and Practice of Oncology Rosenberg SA, Ed. Philadelphia, PA, Lippincott, pp. 390-400. Reed E (1996) The chemotherapy of ovarian cancer. PPO Updates 10, 1-12. Reed E (1998) Nucleotide excision repair and anti-cancer chemotherapy. Cytotechnology 27, 187-201. Reed E ( 1998) Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treatment Reviews 24, 331-344. Reed E, Dabholkar M, Chabner BA (1996) Platinum analogues. In Cancer Chemotherapy and Biotherapy: Principles and Practice, 2nd ed. Longo DL, Ed. Philadelphia, PA, Lippincott-Raven Publishers, pp. 357-378. Reed E, Parker RJ, Gill I, Bicher A, Dabholkar M, Vionnet JA (1993) Platinum-DNA adduct in leukocyte DNA of a cohort of 49 patients with 24 different types of malignancies. Cancer Res. 53, 3694-3699. Rosenberg B (1979) Anticancer activity of cisdichlorodiammineplatinum (II) and some relevant chemistry. Cancer Treat. Rep. 63, 1433-1438. Slodkowska J, Sikora J, Roszkowski-Sliz K (2000) Expression of vascular endothelial growth factor and basic fibroblast growth factor receptors in lung cancer. Analyt. Quant. Cytol. Histol. 22, 398-402. Snedecor GW, Cochran WG (1967) Statistical methods. Ames, IA, The Iowa State University Press. Volm M, Koomagi R, Mattern J (1996) Interrelationships between microvessel density, expression of VEGF and resistance to doxorubicin of non-small lung cell carcinoma. Anticancer Res. 16, 213-218. Volm M, Mattern J, Koomagi R (1999) Inverse correlation between apoptotic (Fas ligand, Caspase-3) and angiogenic factors (VEGF, Microvessel density) in squamous cell lung carcinomas. Anticancer Res. 19, 1669-1672. Young RC, Perez CA, Hoskins WJ (1993) Cancer of the ovary. In Cancer-Principles & Practice of Oncology, 4th ed. Rosenberg SA, Ed. Philadelphia, PA, J. B. Lippincott, pp. 1245-1252. Yu JJ, Li Q, Reed E (2000) Comparison of two human ovarian carcinoma cell lines (A2780/CP70 and MCAS) that are

References Boocock CA, Sharkey AM, McLaren J, Barker PJ, Wright KA, Twentyman PR, Smith SK (1995) Expression of vascular endothelial growth factor and its receptors flt and KDR in ovarian carcinoma. J. Natl. Cancer Inst. 87, 506-516. Borsellino N, Belldegrun A, Bonavida B (1995) Endogenous interleukin 6 is a resistance factor for cisdiaminedichloroplatinum and etoposide-mediated cytotoxicity of human prostate carcinoma cell lines. Cancer Res. 55, 4633-4639. Coleman AB, Momand J, Kane SE (2000) Basic fibroblast growth factor sensitizes NIH 3T3 cells to apoptosis induced by cisplatin. Molecular Pharmacology 57, 324-333. Dabholkar M, Reed E (1996) Cisplatin. Cancer Chemother. Biol. Response Modif. 16, 88-110. Eastman A (1990) Activation of programmed cell death by anticancer agents: cisplatin as a model system. Cancer Cells 2, 275-280. Folkman J (1971) Tumor angiogenesis: Therapeutic implications. N. Engl. J. Med. 285, 1182-1186. Folkman J (1993) Diagnostic and therapeutic applications of angiogenesis research. C. R. Acad. Sci. III 316, 909-918. Fuks Z, Persaud RS, Haimovitz-Friedman A (1994) Basic fibroblast growth factor protects endothelial cells against radiation-induced programmed cell death in vitro and in vivo. Cancer Res. 54, 2582-2590. Gosland M, Lum B, Schimmelpfennig J, Baker J, Doukas M (1996) Insights into mechanisms of cisplatin resistance and potential for its clinical reversal. Pharmacotherapy 16, 1639. Grothey A, Voigt W, Schmoll HJ (1999) The role of insulin-like growth factor I and its receptor in cell growth, transformation, apoptosis, and chemoresistance in solid tumors. J. Cancer Res. Clin. Oncol. 125, 166-173. Hayakawa J, Ohmichi M, Kurachi H, Mercola D, Murata Y (1999) Inhibition of extracellular signal-regulated protein kinase or c-Jun N-terminal protein kinase cascade, differentially activated by cisplatin, sensitizes human ovarian cancer cell line. J. Biol. Chem. 274, 31648-31654. Kerbel RS (1997) A cancer therapy resistant to resistance. Nature 390, 335-336. Kerbel RS (2000) Tumor angiogenesis: past, present and the near future. Carcinogenesis 21, 505-515. Li Q, Ding L, Yu JJ, Mu C, Tsang B, Bostick-Bruton F, Reed E (1998) Cisplatin and phorbol ester independently induce ERCC-1 protein in human ovarian tumor cells. Int. J. Oncol. 13, 987-992. Li Q, Gardner K, Zhang L, Tsang B, Bostick-Bruton F, Reed E (1998) Cisplatin induction of ERCC-1 mRNA expression in A2780/CP70 human ovarian cancer cells. J. Biol. Chem. 273, 23419-23425. Li Q, Tsang B, Bostick-Bruton F, Reed E (1999) Modulation of ERCC-1 messenger RNA expression by pharmacological agents in human ovarian carcinoma cells. Biochem. Pharmacol. 57, 347-353. Liekens S, Clercq ED, Neyts J (2001) Angiogenesis: regulators and clinical applications. Biochem. Pharmacol. 61, 253270. Meng Q, Rosen EM, Fan S (2000) Hepatocyte growth factor decreases sensitivity to chemotherapeutic agents and stimulates cell adhesion, invasion, and migration. Biochem. Biophys. Res. Commun. 274, 772-779.

36


Cancer Therapy Vol 1, page 37 equally resistant to platinum, but differ at codon 118 of the ERCC1 gene. Int. J. Oncol. 16, 555-560.

Front row from left: Qingdi Q. Li and Sean Ryan Rear row from left: Hang Hu, Guodong Hu, Xiping Li and Gangduo Wang

37


Hu et al: VEGF reduces sensitivity to cisplatin in ovarian cancer cells

38


Cancer Therapy Vol 1, page 39 Cancer Therapy Vol 1, 39- 46, 2003.

Overexpression of angiogenic growth factors in lung cancer cells is associated with cisplatin resistance Research Article

Xiping Li1, 2, Xuyi Liu3, Jie Wang3, Zengli Wang2, Wei Jiang3, Eddie Reed1, Yi Zhang4, Yuanlin Liu4, and Q. Quentin Li1* 1

Mary Babb Randolph Cancer Center and Department of Microbiology, Immunology and Cell Biology, West Virginia University School of Medicine and Robert C. Byrd Health Sciences Center, Morgantown, WV 26506, USA; 2Department of Respiratory Medicine, Sichuan University Huaxi Medical Center, Chengdu 610041, P. R. China; 3Department of Medicine, Peking University School of Oncology, Beijing 100036, P. R. China; 4Institute for Basic Medical Research, Chinese Academy of Military Medical Sciences, Beijing 100850, P. R. China

__________________________________________________________________________________ *Correspondence: Q. Quentin Li, M.D., Ph.D., 1831 Mary Babb Randolph Cancer Center, West Virginia University Health Sciences Center, P.O. Box 9300, Morgantown, WV 26506-9300, USA, Tel: 304-293-6870; Fax: 304-293-4667; E-mail: qli@hsc.wvu.edu Key Words: Angiogenesis, VEGF, bFGF, c-erbB-2, lung cancer, cisplatin resistance Received: 13 March 2003; Accepted: 19 March 2003; electronically published: April 2003

Summary Cisplatin is among the most effective agents in the treatment of human lung cancer, and the development of resistance to this drug is the main reason that results in chemotherapy failure in the clinic. Recent evidence showed that angiogenesis growth factors, including vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), augment tumor cell growth and survival, and confer drug resistance by inhibition of apoptosis. However, the relationship between angiogenesis and drug resistance in human cancer remains poorly understood. We therefore conducted this study to investigate the expression of angiogenic growth factors and drug-resistance related genes in cisplatin-sensitive and cisplatin-resistant human lung cancer cells. We report in this work that the levels of the mRNA and protein expression of VEGF and bFGF were strikingly elevated in resistant A549DDP lung cancer cells than those in parental A549 lung cancer cells. We also found that the levels of multidrug resistancerelated protein (MRP) and c-erbB-2 were significantly higher in A549DDP resistant cells when compared with A549 parental cells. As expected, lung resistance protein (LRP) was expressed only in A549DDP resistant cells but not in A 549 parental cells. Interestingly, there was a strong correlation between bFGF and c-erbB-2 or bFGF and MRP in these cells. These findings indicate that the overexpression of VEGF and bFGF, as well as the drug-resistance related genes, is associated positively with cisplatin resistance in human lung cancer cells, and therefore support the potential therapeutic applications of anti-angiogenics in regulating cisplatin sensitivity in resistant lung cancer and other tumors. and metallothionines, increased DNA repair, enhanced tolerance of cisplatin damage, increased levels of bcl-2related anti-apoptosis genes, and alterations in signal transduction pathways involved in apoptosis (Dabholkar and Reed, 1996; Gosland et al, 1996; Reed et al, 1996; Reed, 1998; Reed, 1998). However, the mechanism by which cells develop resistance to cisplatin is far from clear at this time. Therefore, intense research is needed to solve this problem because it is a major impediment to the clinical success of the drug.

I. Introduction Lung cancer is the major cause of death from all human malignancies in the United States. cisDiamminedichloroplatinum (II) (cisplatin, DDP) is one of the most effective drugs currently available for treatment for a wide variety of solid tumors, including lung cancer, bladder cancer, ovarian cancer, testicular cancer, and head and neck cancer (Reed, 1993; Reed, 1996; Reed et al, 1996). One of the hurdles with cisplatin treatment is the clinical development of resistance to this drug (Dabholkar and Reed, 1996; Gosland et al, 1996; Reed et al, 1996; Reed, 1998; Reed, 1998). Multiple mechanisms have been implicated in the development of cisplatin resistance, including reduced cisplatin uptake or decreased accumulation of the drug, elevated levels of glutathione

Angiogenesis, the formation of new blood vessels, is essential for normal reproduction, development, and organ repair. Angiogenesis is also important in a variety of tumor processes, such as tumor growth and metastasis and drug resistance (Kerbel, 2000; Stavrovskaya, 2000;

39


Li et al: Association between angiogenic factor expression and cisplatin resistance TagTM 0.5 µl, cDNA 2 µl, sterilized distilled water 36.5 µl. The amplification for VEGF was done for 5 min at 95 oC, 1 min at 94 o C, 1.5 min (last 2 cycles, 2 min) at 58 oC, and 2 min (last 2 cycles, 5 min) at 72 oC for a total of 32 cycles. For bFGF was 40 sec (last 3 cycles, 1.5 min) at 94 oC, 1.3 min (last 3 cycles, 2 min) at 48 oC, and 1.2 min (last 3 cycles, 2 min) at 72 oC for a total of 28 cycles. For MRP and LRP: 94 oC 4 min; 94 oC 30 sec, 55 oC 1 min, and 72 oC 2 min for a total of 30 cycles. For bcl-2 and cerbB-2: 94 oC 4 min; 94 oC 30 sec, 55 oC 30 sec, and 72 oC 30 sec for a total of 30 cycles. All genes were extended thoroughly at 72 oC for 10 min. The PCR primers for the target gene cDNA were listed in Table 1. Electrophoresis was performed with 10 µl of PCR products in 1.8% agarose gel. The electrophoretogram was scanned. The relative mRNA expression levels of target genes were calculated with the optical density (OD) values from the target genes and "-actin.

Liekens et al, 2001). These processes are regulated differentially by a variety of distinct pro-angiogenic molecules and anti-angiogenic molecules (Slodkowska et al, 2000). The angiogenic switch is mediated by the balance of angiogenic inducers and angiogenic inhibitors. A number of growth factors, cytokines, chemokines, enzymes, and adhesion molecules have been identified as potential positive regulators of angiogenesis so far. Vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) are among the most important ones (Kerbel, 2000; Liekens, 2001). Recently, experimental and clinical studies are accumulating to show that angiogenic factors augment tumor cell growth and survival, and confer drug resistance by inhibition of apoptotic activity (Volm et al, 1999; Coleman et al, 2000). However, the relationship between angiogenesis and cisplatin drug resistance in human tumors is poorly understood. The present investigation was therefore designed to study the expression of the angiogenesis growth factors VEGF and bFGF in cisplatinsensitive and cisplatin-resistant human lung cancer cell lines. We also set out to examine the expression of the drug-resistance related genes lung resistance protein (LRP), multidrug resistance-related protein (MRP), cerbB-2 and blc-2, and analyze the relationships between the angiogenic factors and the drug-resistance related genes in these model systems. We report herein the results of this investigation.

C. Immunocytochemistry The protein expression of VEGF, bFGF, MRP, LRP, bcl-2, and c-erbB-2 in A549 and A549DDP cells was assessed by immunocytochemistry using an anti-VEGF monoclonal antibody (1:100) and an anti-bFGF polyclonal antibody (1:200) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), as well as antiMRP, LRP, bcl-2 and c-erbB-2 monoclonal antibodies (1:201:40) (Beijing Zhongshan Biotech Company, Beijing, China). The samples were stained by SP staining. All reagents were used in the negative controls except the primary antibodies.

D. Statistical analysis of data Data were analyzed for significance using the student's t test. The relationship between the data was analyzed statistically by Peason correlation test. The criterion for statistical significance was p<0.05.

II. Materials and methods A. Cell lines and cell culture conditions The human lung adenocarcinoma parental cell line A549 and the cisplatin-resistant cell line A549DDP were cultured in DMEM medium containing 10 % fetal calf serum, at 37 oC in a humidified 5% CO2 incubator.

III. Results A. The cytotoxicity of cisplatin to cisplatin-sensitive and cisplatin-resistant human lung adenocarcinoma cell lines

Both cell lines were assayed for sensitivity to cisplatin by measurement of the inhibition of growth following 48-h exposure to cisplatin ranging from 0.1 to 1,000 µM. Cell lines were seeded at an initial cell density of 5 ! 104 cells/ml. After continuous contact with the drug for 48 h, medium was removed, and cell viabilities were determined by using MTT assay. Cells treated similarly in the absence of drug served as controls.

Sensitivity to cisplatin was determined by measuring inhibition of cell growth following continuous exposure of cells to concentrations of the drug ranging from 0.1 to 1,000 µM cisplatin for 48 h. The A549 human lung adenocarcinoma parental cell line and A549DDP cisplatinresistant cell line exhibited cisplatin IC50 values of 1 µM and 10 µM, respectively (Figure 1).

B. RNA isolation and RT-PCR analysis Total RNA was extracted from cell lines using Trizol reagent (GIBCO-BRL, Gaithersburg, MD, USA), according to the standard acid-guanidium-phenol-chloroform method. The RT-PCR was performed using the TaKaRa RNA RT-PCR Kit (TaKaRa Shuzo Co., Ltd., CA, USA). The reverse-transcribed total volume was 20 µl per sample. It included that MgCl2 4 µl, 10X RNA PCR buffer 2 µl, RNase free H2O 7.5 µl, dNTP 2 µl, RNase inhibitor 0.5 µl, reverse transcriptase 1 µl, random primer 1 µl, RNA 2 µl. Placed all tubes in a thermal cycler and set the parameters by the following conditions: 30 oC 10 min, 46 oC 30 min, 99 oC 5 min, and 5 oC 5 min per cycle. The reverse transcriptase reaction product was served as a template DNA for PCR amplification. "-actin cDNA was used as an internal reference. Total volume of PCR was 50 µl per sample. It included that 10 µRNA PCR buffer 5 µl, 25 mM MgCl2 3 µl, 10 µM dNTP 1 µl, 10 µM primer: sense 1 µl and antisense 1 µl,

B. The mRNA expression of angiogenic growth factors and drug-resistance related genes in cisplatin-sensitive and cisplatinresistant human lung cancer cells Reverse transcription PCRs were performed to analyze the levels of mRNA expression of the angiogenic factors and the drug-resistance related genes. Table 1 shows the primers used and the PCR-amplified products for each gene in our experiments. Figure 2 presents the relative mRNA expression of the angiogenesis growth factors and the drug-resistance related genes in both cisplatin resistant A549DDP lung cancer cells and A549 parental cells. 40


Cancer Therapy Vol 1, page 41 Table 1. RT-PCR primers and amplification products of VEGF, bFGF, MRP, LRP, bcl-2, c-erbB-2 and "-actin genes. Gene

Primer

VEGF

Amplification product

Sense: 5'-GAA GTG GTG AAG TTC ATG GAT GTC-3'

541 bp, 408 bp

Antisense: 5'-CGA TCA TTC TGT ATC AGT CTT TCC-3' bFGF

Sense: 5'-GTG TGT GCT AAC CGT TAC CT-3'

237 bp

Antisense: 5'-GCT CTT AGC AGA CAT TGG AAG-3' MRP

Sense: 5'-TCT CTC CCG ACA TGA CCG AGG-3'

140 bp

Antisense: 5'-CCA GGA ATA TGC CCC GAC TTC-3' LRP

Sense: 5'-GTC TTC GGG CCT GAG CTG GTG TCG-3'

221 bp

Antisense: 5'-CTT GGC CGT CTC TTG GGG GTC CTT-3' bcl-2

Sense: 5'-GTG GAG GAG CTC TTC AGG GA-3'

304 bp

Antisense: 5'-AGG CAC CCA GGG TGA TGC AA-3' c-erbB-2

Sense: 5'-GAT GTA TTT GAT GGT GAC CT-3'

183 bp

Antisense: 5'-ATC TGG CTG GTT CAC ATA TT-3' "-actin Sense: 5'-ATC TTC AAA CCT CCA TGA TG-3'

120 bp

Antisense: 5'-ACC CCC ACT GAA AAA GAT GA-3' _______________________________________________________________________ Compared to cisplatin-sensitive cells, cisplatin-resistant cells show consistently higher mRNA levels of VEGF, bFGF, MRP, LRP, and c-erbB-2. The relative mRNA levels of expression were 10.03 for VEGF, 3.08 for bFGF, 0.96 for MRP, 2.07 for c-erbB-2, and 0.81 for LRP. In A549 parental cells, the relative mRNA levels of expression for VEGF was 1.81, 1.53 for bFGF, 0.53 for MRP, 0.84 for c-erbB-2, and was not detectable for LRP. The differences between A549DDP resistant cells and A549 parental cells in relative mRNA expression levels for VEGF, bFGF, MRP, c-erbB-2 and LRP were statistically significant (all p<0.01) (Table 2).

C. The protein expression of angiogenic growth factors and drug-resistance related genes in cisplatin-sensitive and cisplatinresistant human lung carcinoma cells Our experimental results from immunocytochemistry showed that the levels of protein expression of VEGF, bFGF, and MRP were all higher in A549DDP resistant cells, as compared with A549 parental cells. While LRP and cerbB-2 were negative in A549 parental cells, they were positive in A549DDP resistant cells (Table 2; Figures 3, 4, 5, 6, 7 and 8).

Figure 1. The sensitivity of A549 and A549DDP human lung adenocarcinoma cell lines to cisplatin. 5 X 104 cells per well from A549 cells or A549DDP cells were evenly plated in 96-well plates. Cells were then exposed to cisplatin at 0.1, 1, 10, 100, or 1,000 ÂľM for 48 h. Cell viability was measured by the MTT assay 48 h after drug exposure and is expressed as a percentage of the untreated control.

41


Li et al: Association between angiogenic factor expression and cisplatin resistance bFGF and MRP shows correlative expression of these two genes in A549 parental cells (r = 0.979; p = 0.032). A comparison of bFGF and c-erbB-2 shows that mRNA levels for bFGF were also correlated with c-erbB-2 in A549DDP resistant cells (r = 1; p = 0.004). The relationships shown suggest that as bFGF mRNA increases, so do MRP and c-erbB-2 mRNAs

D. The relationship between angiogenic growth factors and drug-resistance related genes in A549 and A549DDP human lung adenocarcinoma cells Peason correlation test has been used to measure the degree to which two genes may show concurrent increased or decreased mRNA expression levels. Comparison of

Figure 2. The levels of the mRNA expression of angiogenic growth factors and drug-resistance related genes in cisplatinsensitive and cisplatin-resistant human lung adenocarcinoma cell lines. RT-PCR analysis of the mRNA levels of VEGF, bFGF, MRP, LRP, c-erbB-2, and bcl-2 in cisplatin-sensitive human A549 lung adenocarcinoma cells (A) and in cisplatin-resistant human A549DDP lung adenocarcinoma cells (B). A 541-bp and a 408bp segments of VEGF cDNA, a 237-bp segment of bFGF cDNA, a 140-bp segment of MRP cDNA, a 221-bp segment of LRP cDNA, a 304-bp segment of bcl-2 cDNA, a 183-bp segment of c-erbB-2 cDNA, and a 120-bp segment of "-actin cDNA were amplified by RT-PCR, respectively, and the aliquots of amplified DNAs were electrophoresed through a 1.8% agarose gel. The relative mRNA levels of the target genes were quantified by densitometry and expressed as a ratio to "-actin, and these values are shown graphically in panel (C). 1, LRP; 2, c-erbB-2; 3, bcl-2; 4, MRP; 5, bFGF; 6, VEGF.

drug resistance and the molecular basis involved could lead to strategies resulting in improved therapeutic benefits to patients with cisplatin resistant carcinomas.

IV. Discussion Although significant progress has been made in the treatment of lung cancer with combination chemotherapy, lung cancer remains the leading cause of cancer death (American Cancer Society, 2000). Platinum-containing anti-tumor drugs are the most commonly used agents for the treatment of lung carcinoma (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). Toxicities and emergence of drug-resistant tumors, however, are major problems preventing curative therapy (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). While several mechanisms of resistance to cisplatin have been identified (Gosland et al, 1996), no single mechanism can clearly explain cisplatin drug-resistance in lung cancer. Understanding the relationship between angiogenesis and

In our study, we found that the levels of the angiogenic growth factors VEGF and bFGF expression were dramatically increased in cisplatin resistant A549DDP lung cancer cells as compared to A549 parental cells, suggesting a role of angiogenic growth factors in the formation of cisplatin drug resistance in these cells. We also confirmed the previous observations by others that LRP, MRP, bcl-2 and c-erb-2 are actively associated with drug resistance in lung cancer. However, the mechanism underlying the relationship between angiogenesis and drug resistance, as well as the role of angiogenic growth factors in the development of cisplatin drug resistance in human tumors remains unclear at this time. 42


Cancer Therapy Vol 1, page 43 Table 2. The comparison of the levels of mRNA and protein expression of angiogenic growth factors and drug-resistance related genes between cisplatin-sensitive and cisplatin-resistant human lung cancer cells.

Figure 3. VEGF protein levels in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-VEGF monoclonal antibody (1:100) (Santa Cruz, CA, USA) shows that VEGF protein is strongly positive in human lung A549DDP adenocarcinoma cells (SP staining _ 40).

Figure 5. bcl-2 protein expression in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-bcl-2 monoclonal antibody shows that bcl-2 protein is strongly positive in human lung A549DDP adenocarcinoma cells (SP staining _ 40).

Figure 4. bFGF protein levels in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-bFGF polyclonal antibody (1:200) (Santa Cruz, CA, USA) shows that bFGF protein is strongly positive in human lung A549DDP adenocarcinoma cells (SP staining _ 40).

Figure 6. MRP protein expression in cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-MRP monoclonal antibody shows that MRP protein is positive in human lung A549DDP adenocarcinoma cells (SP staining ! 40).

43


Li et al: Association between angiogenic factor expression and cisplatin resistance

A

A

B

B

Figure 7. The levels of c-erbB-2 protein expression in cisplatinsensitive A549 and cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-c-erbB2 monoclonal antibody shows that c-erbB-2 protein is negative in the human lung adenocarcinoma cell line A549 (A), but it is positive in human lung A549DDP adenocarcinoma cells (B) (SP staining _ 40).

Figure 8. The levels of LRP protein expression in cisplatinsensitive A549 and cisplatin-resistant A549DDP human lung cancer cells. Immunohistochemistry staining with an anti-LRP monoclonal antibody shows that LRP protein is negative in the human lung adenocarcinoma cell line A549 (A), but it is positive in human lung A549DDP adenocarcinoma cells (B) (SP staining _ 40).

The MRP gene is a member of the ATP-binding cascade (ABC) transporter superfamily. It is involved in the efflux of cytotoxic drugs. MRP overexpression can lead to reduced drug access to its intracellular target, by increasing drug efflux and/or by altering its intracellular distribution (Kuwano et al, 1999). LRP is the main human vault protein. It mediated the drug resistance to cisplatin and alkylating agents by becoming involved in the rapid drug distribution from the nucleus to cytoplasmic vesicles. LRP can reduce the drug concentration in the nucleus and decrease the drug effect on DNA targets (Martin et al, 1998). The c-erbB-2 gene belongs to the epidermal growth factor receptor family. It is involved in the regulation of a variety of vital functions controlled by any of the erbBreceptor family members, including cell growth, differentiation, and apoptosis.

(American Cancer Society, 2000). Platinum-containing anti-tumor drugs are the most commonly used agents for the treatment of lung carcinoma (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). Toxicities and emergence of drug-resistant tumors, however, are major problems preventing curative therapy (Reed, 1993; Dabholkar and Reed, 1996; Reed et al, 1996). While several mechanisms of resistance to cisplatin have been identified (Gosland et al, 1996), no single mechanism can clearly explain cisplatin drug-resistance in lung cancer. Understanding the relationship between angiogenesis and drug resistance and the molecular basis involved could lead to strategies resulting in improved therapeutic benefits to patients with cisplatin resistant carcinomas. In our study, we found that the levels of the angiogenic growth factors VEGF and bFGF expression were dramatically increased in cisplatin resistant A549DDP lung cancer cells as compared to A549 parental cells, suggesting a role of angiogenic growth factors in the formation of cisplatin drug resistance in these cells. We also confirmed the previous observations by others that LRP, MRP, bcl-2 and c-erb-2 are actively associated with

IV. Discussion Although significant progress has been made in the treatment of lung cancer with combination chemotherapy, lung cancer remains the leading cause of cancer death

44


Cancer Therapy Vol 1, page 45 the angiogenic growth factor expression in A549DDP were strikingly higher than those in A549 cells, indicating an association between angiogenic growth factor expression and cisplatin drug resistance in the lung carcinoma cells. Little is known at present about the exact role of VEGF and bFGF in the process and the underlying mechanisms. Given their broad spectrum of activities, angiogenic growth factors may play an important role in mediating the development of drug resistance through several ways. Firstly, angiogenic growth factors can lead to drug resistance by suppression of tumor cell apoptosis. For example, the effects of VEGF and bFGF on delaying apoptosis and prolonging the survival of tumor cell may be indirect, via the induction of one or more of cytokines or inhibition of specific genes that promote apoptosis (Volm et al, 1996; Coleman et al, 2000). Secondly, angiogenic growth factors may modulate cisplatin sensitivity indirectly through the regulation of the activity of MRP, cerbB-2, or some other drug-resistance related genes in tumor cells. As an indication, we show in this work that bFGF expression is correlated positively with c-erbB-2 and MRP expression in these cells. Thirdly, tumor vasculature is often inadequate for the tumor mass because the rate of neovascularization frequently fails to keep pace with tumor growth. A number of studies have indicated that VEGF may play an important role in tumor angiogenesis, and VEGF has been demonstrated to be upregulated by hypoxia. It has been shown that hypoxia can induce resistance to a number of antineoplastic agents. Hypoxia can also enhance genetic instability in tumor cells, which can lead to more rapid development of drug resistant tumor cells (Volm et al, 1996). Finally, we demonstrated recently in a separate study that VEGF mediated cytoprotection against cisplatin cell death and increased cell survival in cisplatin-resistant human tumor cells. Although the underlying mechanism is not known at this point, we showed that SU5416, a selective inhibitor of VEGF receptors, counteracted the effect of VEGF by enhancing cisplatin cytotoxicity and increasing cisplatin sensitivity in the cells. We further found that the effect of SU5416 on the increase in cell death or reduction of cell survival of cisplatin-treated cells is due in part to the reduction in repair efficiency of cisplatin-caused DNA damages. Enhanced DNA repair capacity contributes to the formation of drug resistance to cisplatin in a wide variety of tumor cells. Studies are under way to investigate whether angiogenic growth factors mediate protection against cisplatin-induced apoptosis in human cancer cells by upregulating apoptosis-rescue signals, assess the effect of angiogenic growth factors on DNA repair activity, and elucidate the role of PI3-kinase or Akt in the signal transduction pathway through which VEGF regulates DNA repair activity in human carcinoma cells. In summary, we show in this article that the levels of the angiogenesis growth factors, VEGF and bFGF, and the drug-resistance related genes LRP, MRP and c-erbB-2 are significantly elevated in cisplatin-resistant human A549 DDP lung carcinoma cells, as compared to A549 parental cells. There is a strong correlation between the expression of the angiogenic growth factors and the drug-resistance related genes in the lung carcinoma cells. These data suggest that

drug resistance in lung cancer. However, the mechanism underlying the relationship between angiogenesis and drug resistance, as well as the role of angiogenic growth factors in the development of cisplatin drug resistance in human tumors remains unclear at this time. The MRP gene is a member of the ATP-binding cascade (ABC) transporter superfamily. It is involved in the efflux of cytotoxic drugs. MRP overexpression can lead to reduced drug access to its intracellular target, by increasing drug efflux and/or by altering its intracellular distribution (Kuwano et al, 1999). LRP is the main human vault protein. It mediated the drug resistance to cisplatin and alkylating agents by becoming involved in the rapid drug distribution from the nucleus to cytoplasmic vesicles. LRP can reduce the drug concentration in the nucleus and decrease the drug effect on DNA targets (Martin et al, 1998). The c-erbB-2 gene belongs to the epidermal growth factor receptor family. It is involved in the regulation of a variety of vital functions controlled by any of the erbBreceptor family members, including cell growth, differentiation, and apoptosis. Data from laboratory studies showed that higher levels of p185c-erbB-2 expression in tumor cell lines were correlated with increased resistance to Taxol (Yu et al, 1998)). Our study showed that the expression of MRP, LRP and c-erbB-2 in cisplatin drug-resistant cells was significantly higher than that in parental cells. These results suggest that these genes may be involved in the formation and development of cisplatin drug resistance in A549DDP lung cancer cells. Although the precise mechanism involved is unclear now, it has been demonstrated that the overexpression of MRP confers resistance to the chemotherapy-induced apoptosis that is associated with the overexpression of anti-apoptotic genes and the downregulation of pro-apoptotic genes (Gupta et al, 1998). Further studies are necessary to investigate the mechanisms that may be responsible for the role of these genes in mediating the formation of the cisplatin resistance phenotype in lung cancer and other tumors. Angiogenesis is important in a variety of processes, such as growth, metastasis and resistance (Stavrovskaya, 2000, Liekens et al, 2001). The angiogenic cascade is regulated differentially by a variety of distinct proangiogenic molecules, as well as a number of antiangiogenic molecules (Slodkowska et al, 2000). VEGF, endothelial cell-specific mitogen and angiogenesis factor, is emerging as a major regulator of normal and pathologic angiogenesis (Volm et al, 1999; Volm et al, 1999). bFGF is a multifunctional molecule that belongs to a family of fibroblast growth factors. It appears to play a role in embryonic development, tumor invasion, wound healing, and angiogenesis (Gupta et al, 1998). VEGF and bFGF may be involved in tumorigenesis via proliferative and anti-apoptotic activities. Recently, experimental and clinical studies showed that VEGF and bFGF were related not only to angiogenic activity, but also to rapid tumor growth and the inhibition of apoptotic activity (Slodkowska et al, 2000). Our study showed that although VEGF and bFGF were all expressed in A549 and A549DDP cells, the levels of

45


Li et al: Association between angiogenic factor expression and cisplatin resistance Liekens S, Clercq ED, Neyts J (2001) Angiogenesis: regulators and clinical applications. Biochem. Pharmacol. 61, 253270. Martin F, Gudrun P, Thomas S (1998) Expression of the lung resistance protein predicts poor outcome in De Novo acute myeloid leukemia. Blood 91, 1508-1513. Reed E (1993) Platinum analogs, anticancer drugs. In Cancer Principles and Practice of Oncology. DeVita VT, Hellman S, Rosenberg SA, Eds. Philadelphia, PA, Lippincott, p. 390400. Reed E (1996) The chemotherapy of ovarian cancer. PPO Updates 10, 1-12. Reed E (1998) Nucleotide excision repair and anti-cancer chemotherapy. Cytotechnology 27, 187-201. Reed E ( 1998) Platinum-DNA adduct, nucleotide excision repair and platinum based anti-cancer chemotherapy. Cancer Treatment Reviews 24, 331-344. Reed E, Dabholkar M, Chabner BA (1996) Platinum analogues. In Cancer Chemotherapy and Biotherapy: Principles and Practice, 2nd ed. Chabner BA, Longo DL, Eds. Philadelphia, PA, Lippincott-Raven Publishers, p. 357-378. Slodkowska J, Sikora J, Roszkowski-Sliz K (2000) Expression of vascular endothelial growth factor and basic fibroblast growth factor receptors in lung cancer. Analyt. Quant. Cytol. Histol. 22, 398-402. Stavrovskaya AA (2000) Cellular mechanisms of multidrug resistance of tumor cells. Biochemistry (Mosc) 65, 95-106. Volm M, Koomagi R, Mattern J (1996) Interrelationships between microvessel density, expression of VEGF and resistance to doxorubicin of non-small lung cell carcinoma. Anticancer Res. 16, 213-218. Volm M, Koomagi R, Mattern J (1999) Angiogenesis and cigarette smoking in squamous cell lung carcinomas: an immunohistochemical study of 28 cases. Anticancer Res. 19, 333-336. Volm M, Mattern J, Koomagi R (1999) Inverse correlation between apoptotic (Fas ligand, Caspase-3) and angiogenic factors (VEGF, Microvessel density) in squamous cell lung carcinomas. Anticancer Res. 19, 1669-1672. Yu D, Liu B, Jing T, Sun D, Huang M-C (1998) Overexpression of both p185c-erbB2 and p170mdr-1 renders breast cancer cells highly resistant to taxol. Oncogene 16, 2087-2094.

the overexpression of VEGF and bFGF is strongly associated with cisplatin drug resistance in these lung cancer model systems. Therefore, our studies provide the rationale for the development of novel and potentially useful therapeutic strategies of anti-angiogenesis for cisplatin resistant malignancies.

Acknowledgements This work was supported by grants from Beijing Natural Science Foundation (No. 7992005), Beijing New Star Plan for Science and Technology (No.148) and China State '9. 5' Research Program (No. 96-906-01-23), and by grants from the National Institutes of Health, Bethesda, Maryland (No. 1P20RR016440-010003) and West Virginia University Research Development Grant (to Q.Q.Li).

References American Cancer Society (2000) Cancer Facts and Figures. Coleman AB, Momand J, Kane SE (2000) Basic fibroblast growth factor sensitizes NIH 3T3 cells to apoptosis induced by cisplatin. Molecular Pharmacology 57, 324-333. Dabholkar M, Reed E (1996) Cisplatin. Cancer Chemother. Biol. Response Modif. 16, 88-110. Gosland M, Lum B, Schimmelpfennig J, Baker J, Doukas M (1996) Insights into mechanisms of cisplatin resistance and potential for its clinical reversal. Pharmacotherapy 16, 1639. Gupta S, Aggarwal S, Nakamura S (1998) A possible role of multidrug resistance-associated protein (MRP) in basic fibroblast growth factor secretion by AIDS-associated Kaposi's sarcoma cells: A survival molecule? J. Clin. Immunol. 18, 256-263. Kerbel RS (1997) A cancer therapy resistant to resistance. Nature 390, 335-336. Kerbel RS (2000) Tumor angiogenesis: past, present and the near future. Carcinogenesis 21, 505-515. Kuwano M, Toh S, Uchiumi T (1999) Multidrug resistanceassociated protein subfamily transporters and drug resistance. Anticancer Res. 14, 123-131.

46


Cancer Therapy Vol 1, page 47 Cancer Therapy Vol 1, 47-61, 2003.

Cisplatin nephrotoxicity: molecular mechanisms Review Article

Marie H. Hanigan# and Prasad Devarajan* #

Department of Cell Biology, University of Oklahoma Health Sciences Center, and *Departments of Nephrology & Hypertension and Developmental Biology, Cincinnati Childrenâ&#x20AC;&#x2122;s Hospital Medical Center, University of Cincinnati

__________________________________________________________________________________ *Correspondence to : Prasad Devarajan M.D., Director, Nephrology & Hypertension, Cincinnati Childrenâ&#x20AC;&#x2122;s Hospital Medical Center, MLC 7022, 3333 Burnet Avenue, Cincinnati, OH 45229-3039. Phone: 513-636-4531. FAX: 513-636-7407. E-mail: prasad.devarajan@cchmc.org Key words: cisplatin, nephrotoxicity, molecular mechanisms, thiol compounds, apoptosis, death receptor, caspases, oxidative stress Abbreviations: copper transporter, (Ctr1); gamma-glutamyl transpeptidase, (GGT); hepatocyte growth factor, (HGF)

Received: 24 March 2003; Accepted: 31 March 2003; electronically published: April 2003 Contributed by Dr. Prasad Devarajan

Summary Cisplatin is one of the most widely used chemotherapeutic agents for the treatment of several human malignancies. The efficacy of cisplatin is dose dependent, but the significant risk of nephrotoxicity frequently hinders the use of higher doses to maximize its antineoplastic effects. Several advances in our understanding of the biochemical and molecular mechanisms underlying cisplatin nephrotoxicity have recently emerged, and are reviewed in this article. Evidence is presented for distinct mechanisms of cisplatin toxicity in actively dividing tumor cells versus the normally quiescent renal proximal tubular epithelial cells. The unexpected role of gamma-glutamyl transpeptidase in cisplatin nephrotoxicity is elucidated. Recent studies demonstrating the ability of proximal tubular cells to metabolize cisplatin to a nephrotoxin are reviewed. The evidence for apoptosis as a major mechanism underlying cisplatin-induced renal cell injury is presented, along with the data exploring the role of specific intracellular pathways that may mediate the programmed cell death. The information gleaned from this review may provide critical clues to novel therapeutic interventions aimed at minimizing cisplatin-induced nephrotoxicity while enhancing its antineoplastic efficacy.

escalation. However, high-dose therapy with cisplatin is limited by its cumulative nephrotoxicity and neurotoxicity (O'Dwyer et al, 1999). Its dose-limiting toxicities have spurred the development of the non-nephrotoxic derivative carboplatin and other platinum-based drugs. However, cisplatin is still the drug of choice in many platinum-based therapy regimens, and remains one of the most commonly used chemotherapy drugs. The structure of cisplatin is shown in Figure 1. Cisplatin is toxic to the renal proximal tubules (Gonzales-Vitale et al, 1977). The severity of toxicity in early clinical trials called into question the use of cisplatin as a chemotherapy agent (DeConti et al, 1973). Hydration protocols were developed that reduced the nephrotoxicity and allowed dose escalation to therapeutic levels (Cornelison and Reed 1993).

I. Introduction Cisplatin is a potent antitumor drug. Cisplatin-based combination chemotherapy regimens are currently used as front-line therapy in the treatment of testicular cancer, ovarian germ cell tumors, epithelial ovarian cancer, head and neck cancer, advanced cervical cancer, bladder cancer, mesothelioma, endometrial cancer, non-small cell lung cancer, malignant melanoma, carcinoids, penile cancer, adrenocorticol carcinoma and carcinoma of unknown primary (Langerak and Dreisbach 2001). Cisplatin-based chemotherapy is used with radiation therapy in the treatment of esophageal cancer, localized cervical cancer and head and neck cancer (Curran 2002). It is used as consolidation therapy for many types of solid tumors that have failed standard treatment regimens. The therapeutic effects of cisplatin are significantly improved by dose

47


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity

Figure 1. Structure of cisplatin.

Figure 2. Proposed biochemical mechanisms of cisplatin nephrotoxocity. See text for details. GGT = gamma-glutamyl transpeptidase; AP-N = diaminopeptidase N.

However, even with vigilant hydration, approximately one-third of patients treated with cisplatin have transient elevation of blood urea nitrogen levels or other evidence of kidney damage in the days following cisplatin treatment (Meyer and Madias 1994). Reports of accidental overdoses, all of which have led to renal failure, confirm the potency of cisplatin as a renal toxin in humans (Chu et al, 1993). Nephrotoxicity is an unusual side effect of chemotherapy in general. Most chemotherapy drugs target pathways that are essential to dividing cells. The rapidly dividing cells in the bone marrow are sensitive to these agents. The dose-limiting toxicity of carboplatin is bonemarrow suppression with cumulative anemia (McKeage 2000). Carboplatin can be administered at doses 5-fold higher than cisplatin without evidence of nephrotoxicity or neurotoxicity. Both cisplatin and carboplatin bind DNA, killing dividing tumor cells (Fink and Howell 2000; Perez 1998). The toxicity of cisplatin towards the quiescent renal proximal tubular cells indicates that there are at least two distinct mechanisms by which cisplatin kills cells, as illustrated in Figure 2.

II. Cisplatin uptake and DNA binding Cisplatin is transported into cells by the copper transporter Ctr1 (Ishida et al, 2002; Lin et al, 2002). Once inside the cell the chloride ions dissociate from the platinum due to the low intracellular chloride concentrations. The positively charged platinum ion binds cellular nucleophiles in DNA, RNA and proteins (Cohen and Lippard 2001). Experimental evidence indicates that platinum-DNA adducts are the lesion that is toxic to dividing cells, as shown in Figure 2 (Eastman 1999). Thiols such as the sulfur of GSH will bind to the platinum molecule, replacing one of the chloride ions and preventing binding to other cellular nucleophiles (BernersPrice and Kuchel 1990). Increased intracellular GSH concentrations correlate with decreased platinum-DNA binding in freshly isolated peripheral blood mononuclear cells (Sadowitz et al, 2002). Studies of tumor cell lines have shown a correlation between increased levels of intracellular GSH and resistance to cisplatin (Chen et al, 1995; Hrubisko et al, 1993; Godwin et al, 1992). GSTs are 48


Cancer Therapy Vol 1, page 49 a family of enzymes that catalyze the conjugation of GSH to a variety of substrates. GSTs can also bind the electrophilic substrates and thereby inactivate them (Oakley et al, 1999). Several isoforms of GST have been shown to bind cisplatin in vivo (Sadzuka et al, 1994). There are conflicting data in the literature as to which GST isozymes correlate with cisplatin resistance (Puchalski and Fahl 1990; Leyland-Jones et al, 1991; Nakagawa et al, 1990; Ban et al, 1996; Townsend et al, 1992; Nishimura et al, 1998; Cheng et al, 1997; Hamada et al, 1994; Kigawa et al, 1998; Germain et al, 1996; van der Zee et al, 1992; Murphy et al, 1992). Of the studies in which increased resistance to cisplatin was observed, none determined whether the inactivation of cisplatin was due to GST binding to the cisplatin or catalyzing its conjugation to GSH.

III. Evidence for two mechanisms of cisplatin toxicity

alkenes are conjugated to glutathione (GSH) in the liver and the kidney (Lash et al, 1998). The GSTs that catalyze the conjugation have not been identified, but the reaction rates of several of the nephrotoxic halogenated alkenes are higher with the microsomal GSTs than with the cytosolic GSTs (Wolf et al, 1984). Hexachlorobutadiene is conjugated to GSH predominantly in the liver and the GSH-conjugate is excreted into the bile (Nash et al, 1984). The metabolite is further processed through a hepatobiliary route (Anders and Dekant 1998). Bile duct cells express high levels of GGT and aminopeptidase N on their cell surface. GSH-conjugates in the bile are cleaved to cysteinyl-glycine (cys-gly)-conjugates by GGT and to cysteine-S-conjugates by aminodipeptidase N. The cysteine-S-conjugate is reabsorbed by the intestine and transported in the serum to the kidney. The kidney also contains GSTs that can metabolize the halogenated alkenes (Hassall et al, 1984). Renal GSH-conjugates would have to be excreted from the cell to undergo further processing by GGT and diaminopeptidase N expressed the surface of the proximal tubular cells. The cysteine-Sconjugates are transported into the renal proximal tubular cells by a carrier-mediated process (Wright et al, 1998), and are metabolized to a reactive thiol by a PLP-dependent cysteine-S-conjugate-beta-lyase. The enzyme that catalyzes this reaction has not been identified, although cysteine-S-conjugate beta-lyase activity has been found in the cytosolic and mitochondrial fractions of the kidney (Cooper et al, 2002). The thioacylating metabolites produced by cysteine-S-conjugate beta-lyase are highly reactive, and will bind to proteins in the proximity of the beta-lyase (Bruschi et al, 1993). Mitochondrial aspartate aminotransferase, which has cysteine-S-conjugate betalyase activity, is modified by the thioacylating products and is one of the likely candidates for the cysteine-Sconjugate beta-lyase that metabolizes the halogenated alkenes (Bruschi et al, 1998). The mitochondria of the proximal tubular cells are the primary target of haloalkene-induced toxicity as has been observed with cisplatin (Hayden et al, 1991; Brady et al, 1990; Lash et al, 1986; Hayden and Stevens 1990; Chen et al, 2001; Anders 1995). The cysteine-conjugates of the halogenated alkenes have been shown to induce either apoptosis or necrosis in LLC-PK1 cells depending on the chemical structure of the compound and the antioxidant status of the cell (Zhan et al, 1999; van de Water et al, 2001).

distinct

A series of studies on the role of the enzyme gammaglutamyl transpeptidase (GGT) in cisplatin toxicity revealed that in tumor cells GGT expression increased resistance to cisplatin, while in kidney GGT expression made the cells sensitive to cisplatin toxicity (Hanigan et al, 1999; Hanigan et al, 2001). GGT is a cell surface enzyme that cleaves the gamma-glutamyl bonds. GGT cleaves extracellular GSH into glutamic acid and cysteinyl-glycine (Figure 2). Cysteinyl-glycine is cleaved into cysteine and glycine by diaminopeptidase N (McIntyre and Curthoys 1982). Thus, by initiating the cleavage of extracellular GSH into its constituent amino acids, GGT provides the cell with an increased supply of cysteine (Hanigan and Ricketts 1993). In rapidly dividing cells, cysteine can become limiting for cell growth and for intracellular GSH synthesis. Transfection of human prostate tumor cells with GGT increased their growth rate in nude mice and increased their resistance to cisplatin (Hanigan et al, 1999). In contrast, the high level of GGT expression in renal proximal tubular cells renders them sensitive to cisplatin toxicity. Inhibition of GGT blocked the nephrotoxicity of cisplatin in both rats and mice (Hanigan et al, 1994; Townsend and Hanigan 2002). Cisplatin is not toxic to the kidneys in GGT knockout mice (Hanigan et al, 2001). The disparate roles of GGT in the antitumor activity and nephrotoxicity of cisplatin suggest that the mechanism by which cisplatin kills tumor cells is distinct from the mechanism by which it kills the proximal tubular cells in the kidney.

V. Evidence that cisplatin metabolized to a nephrotoxin

is

There is compelling evidence from both in vivo studies and cell culture that cisplatin is metabolized to a nephrotoxin through a GSH-conjugate intermediate as are the halogenated alkenes. The proposed pathway is shown in Figure 2. Platinum-GSH conjugates may be formed in either the liver or the kidney. Studies with 195mPt-labeled cisplatin show that following injection the highest levels of platinum are found in the liver and kidney (Lange et al, 1973; Benard et al, 1983). Platinum accumulation in the liver is transient. Biliary excretion of cisplatin accounts for

IV. Role of GGT in the nephrotoxicity of halogenated alkenes Cisplatin is not unique in its requirement for GGT activity to exert its nephrotoxic effects. The nephrotoxic halogenated alkenes, which kill the proximal tubular cells in the kidney, also require GGT activity for their metabolism to a nephrotoxin (Dekant 2001). These compounds include hexachlorobutadiene, dichloroacetylene and trichloroethylene. The halogenated 49


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity approximately 1% of the administered dose in 6 hr (Siddik et al, 1987). The structures of the platinum-containing compounds that are excreted into the bile have not been identified. Metabolic intermediates of cisplatin have been identified in rat serum. Seven platinum-containing species were resolved by HPLC from serum within 15 min of cisplatin injection (Daley-Yates and McBrien 1984). The mixture was more nephrotoxic than equimolar cisplatin. Inhibiting the conjugation of cisplatin to GSH has been shown to reduce cisplatin nephrotoxicity. In mice, systemic inhibition of GSTs with ketoprofen reduced cisplatin nephrotoxicity (Sadzuka et al, 1994a; Sadzuka et al, 1994). In rats, inhibition of GSH synthesis also protected against the nephrotoxicity of cisplatin (Mayer et al, 1987). The nephrotoxic platinum-conjugates are very unstable relative to the metabolic intermediates of the halogenated alkenes. The GSH and cysteine-conjugates of the halogenated alkenes can be synthesized and purified whereas the nephrotoxic platinum-conjugates are unstable in solution (Kramer et al, 1987; Gaskin et al, 1995; Townsend et al, 2003). At least some of the platinum-GSH conjugates may be formed and metabolized within the kidney (Mistry et al, 1989). Cisplatin-GSH conjugates can be transported out of the cell by MRP2 (cMOAT), a member of the multidrug resistance-associated protein family of efflux pumps (Ishikawa et al, 1996; Borst et al, 2000). There is evidence that other pumps that have not yet been defined can also serve this function (Ueda et al, 1999). GSH-conjugates are metabolized extracellularly to cysteinyl-glycine-conjugates by GGT, which is a cell surface enzyme. Inhibition of GGT has been shown to block the nephrotoxicity of cisplatin in both rats and mice (Hanigan et al, 1994; Townsend and Hanigan 2002). Cisplatin is not nephrotoxic in GGT-knockout mice (Hanigan et al, 2001). Cysteinyl-glycine conjugates are cleaved by aminopeptidase N which is also on the cell surface (Hughey et al, 1978; McIntyre and Curthoys 1982). AOAA, an inhibitor of PLP-dependent enzymes, blocks the nephrotoxicity of cisplatin (Townsend and Hanigan 2002). AOAA also blocks the final enzymatic step in the bioactivation of the nephrotoxic halogenated alkenes. AOAA blocks the beta-elimination reaction that converts the cysteine-S-conjugates of the halogenated alkenes to reactive thiols (Lash et al, 1994; Elfarra et al, 1986). These data demonstrate that cisplatin can undergo enzymatic activation to a metabolite that is more toxic than the parent compound. Confluent cultures of proximal tubular cells have been used to study cisplatin nephrotoxicity (Montine and Borch 1988; Kroning et al, 1999; Legallicier et al, 1996; Park et al, 2002; Townsend et al, 2003). The toxicity of cisplatin toward confluent monolayers of proximal tubular cells suggests that cells express the enzymes and transporters required in each step of the bioactivation of cisplatin to a reactive thiol. However, the efficiency with which they conjugate cisplatin to GSH may not be optimal. Preincubating cisplatin with equimolar cisplatin for up to 30 min potentiated the toxicity of cisplatin toward confluent monolayers of LLC-PK1 cells (Townsend et al, 2003). Examination of the incubation mixtures revealed a monoplatinum-mono-GSH conjugate

and a diplatinum-monoGSH conjugate that formed spontaneously in the solution (Townsend et al, 2003). With prolonged incubation, the cisplatin-GSH solution became non-toxic in parallel with increased formation of the diplatinum-monoGSH conjugate. Solutions containing the monoplatinum-monoGSH were more toxic than equimolar cisplatin. The increased toxicity due to the presence of the platinum-GSH conjugate could be blocked by inhibiting GGT (Townsend et al, 2003). Preincubation of cisplatin with equimolar N-acetyl-cysteine (NAC) also potentiated the toxicity of the cisplatin, and this correlated with the formation of a monoplatinum-monoNAC conjugate (Townsend et al, 2003). NAC is deacetylated to cysteine (Commandeur et al, 1991). The transporter of the platinum-cystiene conjugate into the cell has not been identified. In vivo, AOAA inhibits the nephrotoxicity of cisplatin (Townsend and Hanigan 2002). In LLC-PK1 cells, AOAA blocks the toxicity of the platinum-NAC conjugate, as well as the platinum-conjugates that are upstream in the metabolic pathway (Townsend et al, 2003). Prolonged incubation of cisplatin with NAC inactivated solution and correlated with the formation of diplatinum-monoNAC conjugates. As detailed below, the molecular mechanism by which cisplatin kills renal cells is dependent on the concentration of cisplatin and the antioxidant status of the cell (Lee et al, 2001; Park et al, 2002).

VI. Protection from cisplatin nephrotoxicity by thiol compounds Thiol compounds have been used clinically to reduce the nephrotoxicity of cisplatin. High doses of GSH injected intravenously within 30 min of cisplatin administration is protective (Tedeschi et al, 1991; Smyth et al, 1997). The amount of GSH that is necessary to achieve this protective effect in humans is 30 to 40-fold higher than the dose of cisplatin. These data may appear to contradict the hypothesis that the formation of a cisplatinGSH conjugate activates cisplatin to a nephrotoxin, but high concentrations of GSH can protect against cisplatin nephrotoxicity by serving as a competitive inhibitor of GGT activity (Hanigan et al, 1994). GSH is the major physiologic substrate for GGT (Curthoys and Hughey 1979; Hanigan and Pitot 1985). GGT is localized to the cell surface and would be inhibited by high levels of GSH in the extracellular fluid (Hanigan and Frierson Jr. 1996). By inhibiting GGT activity, GSH would reduce the metabolism of the cisplatin-GSH to a cisplatin-cysteinylglycine conjugate. A large number of sulfur-containing compounds such as procainamide, diethyldithiocarbamate, N-methyl-D-glucaminedithio carbamate, methimazole, sulfathiazole and the prodrug Amifostine have been shown to reduce the nephrotoxicity of cisplatin without inhibiting its antitumor effect (Jones et al, 1992; Borch et al, 1980; Jones et al, 1992; Yee et al, 1994; Korst et al, 1998; Osman et al, 2000). Procainamide is an antiarrhythmic drug that binds cisplatin forming a procainamide-cisplatin complex (Esposito et al, 1996). In the presence of procainamide more platinum is bound to DNA, which

50


Cancer Therapy Vol 1, page 51 would explain the maintenance of the antitumor activity (Viale et al, 2000). The binding of procainamide to the cisplatin may prevent the formation of a cisplatin-GSH complex and thereby protect against the metabolism of cisplatin to a nephrotoxin. Other thiol compounds may also be binding cisplatin in a complex that does not prevent the binding of the platinum to DNA but does prevent the formation of a GSH-cisplatin conjugate. In contrast, sodium thiosulfate and biotin inhibit both the nephrotoxicity and antitumor activity of cisplatin (Howell and Taetle 1980; Uozumi et al, 1984; Jones et al, 1992).

receptor proteins such as Fas and TNFR1 (Ashkenazi and Dixit 1996). On the other hand, activation of the initiator pro-caspase 9 is dependent primarily on mitochondrial signaling pathways regulated by members of the Bcl-2 family of proteins (Adams and Cory 1996; Brenner and Kroemer 2000). Activation of pro-apoptotic Bcl-2 family members such as Bax can trigger a sequence of events that leads to alterations in mitochondrial permeability, release of mitochondrial cytochrome c into the cytosol, and activation of pro-caspase 9 (Korsmeyer et al, 2000; Goldstein et al, 2000). The anti-apoptotic Bcl-2 family members such as Bcl-2 itself play a pivotal protective role by preserving mitochondrial function and preventing release of cytochrome c (Adams and Cory 1996). Several levels of cross-talk exist between the caspase 8- and 9dependent pathways. First, initial activation of caspase 8 via death receptor pathways can induce the mitochondrial translocation of BID, a pro-apoptotic member of the Bcl-2 family, with resultant cytochrome c release and activation of caspase 9 (Luo et al, 1998). Second, the p53 gene is a potent transcription factor that regulates apoptosis most notably by activating pro-apoptotic Bcl-2 family members as well as the Fas-FADD axis (Burns and El-Deiry 1999). Third, both pathways culminate in the activation of caspase 3, with subsequent entry into the "execution" phase of apoptosis (Thornberry and Lazebnik, 1996). In this review, the evidence for cisplatin-induced apoptosis in renal tubular cells will first be presented. In the subsequent sections, the role of each of these pathways in cisplatininduced apoptosis of renal tubular cells will be reviewed. Studies from a number of laboratories over the past few years have demonstrated that cisplatin can induce apoptosis in renal tubular cells both in animal models and in cell culture systems. Using an established mouse model of cisplatin nephrotoxicity (intraperitoneal injection of cisplatin 20 mg/kg body weight), the appearance of apoptotic epithelial cells by Tunel assay was first shown predominantly in the distal tubular and collecting duct (Megyesi et al, 1998). Subsequent studies have confirmed and extended these findings. Apoptosis in this model has now been documented by a variety of additional methods (including hematoxylin-eosin staining, DNA laddering, and electron microscopy) to occur in both distal and proximal tubular cells, predominantly in the outer medullary region (Shiraihi et al, 2000; Tsuruya et al, 2003). Apoptosis was evident within 3 days of cisplatin injection, temporally correlating with the onset of renal dysfunction. Several analogous studies have also been completed in a rat model (cisplatin 5 mg/kg intraperitoneally), with comparable results (Zhou et al, 1999; Miyaji et al, 2001; Huang et al, 2001; Nishikawa et al, 2001; Chang et al, 2002). Importantly, several maneuvers aimed at attenuating the extent of tubular cell apoptosis have also resulted in amelioration of renal dysfunction (Megyesi et al, 1998; Zhou et al, 1999; Shiraishi et al, 2000,Miyaji et al, 2001; Nishikawa et al, 2001; Chang et al, 2002; Tsuruya et al, 2003). These findings have provided support for the notion that inhibition of apoptosis may represent a novel and powerful therapeutic strategy for the prevention and treatment of cisplatin nephrotoxicity, and have stimulated recent efforts

VII. Evidence for cisplatin-induced apoptosis in renal tubular cells It has long been recognized that in acute renal failure induced by nephrotoxins or other causes, renal tubular cells suffer a spectrum of cytotoxic injuries, ranging from mild sublethal changes to a catastrophic necrotic death characterized by swelling and rupture of cells and activation of an inflammatory response (Thadani et al, 1996). The ensuing clinical syndrome has conventionally been designated by the term acute tubular necrosis. However, it is now known that at least two distinct mechanisms may be responsible for renal tubular cell death following injury, depending primarily on the extent and severity of the insult. While extensive injury can lead to necrotic cell death, increasing evidence has indicated that the less severe renal injuries most commonly encountered in modern clinical practice are associated predominantly with patchy apoptosis of tubular epithelial cells (Ueda et al, 2000; Levine and Lieberthal 2001). Apoptosis or programmed cell death is characterized by distinct morphologic changes consisting of cell shrinkage, nuclear condensation, and internucleosomal DNA fragmentation (Kerr et al, 1972). It is well known that induction of programmed cell death is a common mechanism by which cytotoxic drugs such as cisplatin kill tumor cells (Friesen et al, 1999). In recent years, kidney tubular cell apoptosis has been detected in an increasing array of renal disorders, and is emerging as a final common pathway in response to a variety of cellular stresses applied at an intensity below the threshold for necrosis (Ueda et al, 2000; Levine and Lieberthal 2001). This observation especially holds true for cisplatin nephrotoxicity, in which necrotic cell death is encountered with higher doses whereas lower concentrations induce apoptosis (Lieberthal et al, 1996; Lau 1999). The past decade has witnessed an explosion of information on the molecular and cellular biology of programmed cell death, and specific intracellular proteases belonging to the caspase family have emerged as crucial effectors of apoptosis (Thornberry and Lazebnik 1998). Members of this family (now totaling at least 14) are expressed as pro-enzymes and require activation by upstream signal transduction pathways to commit a cell into the execution phase of apoptosis. It is convenient to classify the major intracellular apoptotic pathways according to the type of pro-caspase that is activated. Activation of the initiator pro-caspase 8 results predominantly from signaling via integral membrane death 51


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity at identifying the programmed cell death pathways induced by cisplatin. These investigations have been facilitated by the establishment and elucidation of cell culture models. Cisplatin was first shown to cause apoptosis in cultured mouse proximal tubular cells (Lieberthal et al, 1996; Takeda et al, 1997; Takeda et al, 1998; Fukuoka et al, 1998). Several subsequent studies have now documented the ability of cisplatin to induce apoptosis in pig proximal tubular (Kruidering et al, 1998; Lau 1999; Okuda et al, 1999; Zhan et al, 1999; Kaushal et al, 2001; Park et al, 2002), human proximal tubular (Razzaque et al, 1999; van de Water et al, 2000; Nowak 2002; Cummings and Schnellmann 2002), and even collecting duct cells (Liu et al, 1998; Lee et al, 2001). A recurrent theme gleaned from these works is that cisplatin induces apoptosis in a dose- and duration-dependent manner, and that while this agent activates programmed cell death at lower (10-100 µM) doses, it can also result in necrotic cell death at higher (200-800 µM) concentrations.

drugs such as cisplatin induce apoptosis in tumor cells (Friesen et al, 1999). A possible role for this pathway in cisplatin nephrotoxicity was first suggested by experiments done in cultured human proximal tubular epithelial cells, in which cisplatin (20-80 µM) resulted in apoptosis which was temporally correlated with an increased expression of Fas (Razzaque et al, 1999). A subsequent detailed analysis in mouse and rat kidney as well as in cultured murine proximal tubular cells has recently provided substantial support for this mechanism (Tsuruya et al, 2003). In this study, wild-type mice subjected to cisplatin displayed renal dysfunction, tubular cell apoptosis, and an increase in mRNAs encoding Fas and Fas ligand in the kidneys, whereas Fas-mutant B6lpr/lpr mice exhibited an attenuated response. Proximal tubular cells cultured from wild-type mice responded to cisplatin by upregulation of Fas mRNA and protein, increase in caspase 8 activity, and apoptosis, all of which were blunted in cells from kidneys of Fas-mutant mice (Tsuruya et al, 2003). Furthermore, the cells derived from wild-type mice exhibited increased TNF-! secretion following cisplatin exposure, and kidneys of TNFR1deficient mice displayed an attenuated functional and apoptotic response to cisplatin (Ramesh and Reeves 2002; Tsuruya et al, 2003). Taken together, these results suggest that cisplatin induces renal epithelial cell apoptosis at least in part via activation of death receptor pathways, as illustrated in Figure 3.

VIII. Activation of death receptor pathways Renal tubular epithelial cells upregulate Fasdependent pathways and undergo apoptosis following ischemic injury both in vitro (Feldenberg et al, 1999) and in vivo (Nogae et al, 1998), and activation of the Fas pathway is a common mechanism by which cytotoxic

Figure 3. Proposed apoptotic pathways in cisplatin nephrotoxicity. See text for details. ROM = reactive oxygen metabolites; Casp = caspase. Death receptor pathways are shown in green, and mitochondrial pathways are in purple. All arrows indicate stimulatory influences, except Bcl2 which is inhibitory.

52


Cancer Therapy Vol 1, page 53 mitochondrial function and structure (Gordon and Gattone 1986). This issue has recently been revisited, especially in reference to injury induced by oxidative stress (Nishikawa et al, 2001; Chang et al, 2002), and is reviewed in the section on role of oxidative damage. At any rate, cisplatininduced oxidative stress in renal mitochondria has been postulated to result in the release of cytochrome c into the cytosol, with resultant activation of caspase 9 (Nishikawa et al, 2001). However, this does not explain the welldocumented observation of Bax translocation from the cytosol to the mitochondria following cisplatin exposure (Lee et al, 2001; Park et al, 2002).

However, it is worth emphasizing that following cisplatin treatment, both Fas-mutant and TNFR1-deficient animals continued to exhibit a significant number of Tunel-positive apoptotic tubular cells (albeit about 50% less than in wildtype mice), and displayed only a partial protection of renal function (a rise in BUN of approximately 50% compared to wild-type). These observations indicate that other pathways leading to apoptosis must additionally be invoked in cisplatin nephrotoxicity. Also, the precise mechanism by which cisplatin (or its toxic metabolite) activates either the Fas- or the TNFR1-dependent pathways is unknown. Based on results obtained from other cell types, a possible role for p53 (Miyashita and Reed 1995; Muller et al, 1998; Burns and El-Deiry 1999; Chandel et al, 2000) and oxidative stress (Bauer et al, 1998) as inducers of Fas-mediated apoptosis in this situation has been postulated (Figure 3). These notions are detailed in subsequent sections.

X. Activation of caspases Since caspases represent the final mediators of apoptosis in most situations, several authors have sought evidence for caspase activation following cisplatin exposure. A role for the "executioner" caspase 3 was first suggested in cultured proximal tubular cells, which responded to cisplatin exposure by increasing caspase 3 activity in a dose- and duration-dependent manner (Fukuoka et al, 1998; Lau 1999). Cell-permeant inhibitors of caspase 3, such as zVAD.fmk and DEVD.CHO, were effective in protecting against cisplatin-induced DNA damage and cell death (Zhan et al, 1999; Kaushal et al, 2001). Subsequent studies searching for activation of the more proximate caspases have revealed a dramatic activation of caspase 9, and to a lesser extent of caspase 8 (Kaushal et al, 2002; Park et al, 2002). These findings are in agreement with the collective previous data implicating both the mitochondrial and the death receptor pathways in cisplatin-induced nephrotoxocity. However, more detailed analyses have shown that while specific inhibition of caspase 9 (with LEHD-CHO) largely prevented cisplatininduced DNA fragmentation in cultured cells, a specific inhibitor of caspase 8 (IETD.fmk) was much less efficacious (Park et al, 2002). Furthermore, recent results have indicated that cisplatin-induced apoptosis in cultured renal proximal tubular cells proceeds via both caspasedependent and caspase-independent pathways, and that inhibition of the executioner caspase 3 blocks only about 50% of cisplatin-induced apoptosis (Cummings and Schnellmann 2002; Nowak 2002). The potential efficacy of caspase inhibition in a complex in vivo system such as the kidney in response to cisplatin is currently unknown.

IX. Activation of mitochondrial pathways Substantial evidence is now available to implicate the mitochondrial apoptotic pathways in cisplatin-induced tubular cell death. Initial studies completed in cultured proximal tubular cells demonstrated that forced overexpression of Bcl-2 rendered the cells partially resistant to cisplatin-induced apoptosis (Takeda et al, 1997; Zhan et al, 1999). This observation has been confirmed in rats in which pretreatment with uranyl acetate caused a significant upregulation of Bcl-2 in the kidney, and ameliorated cisplatin-induced tubular cell apoptosis as well as the ensuing renal dysfunction (Zhou et al, 1999). According to the "dueling dimers" prediction, Bcl-2 inhibits apoptosis primarily by opposing pro-apoptotic molecules in the mitochondrial pathway (Oltvai and Korsmeyer 1994). Indeed, cisplatin nephrotoxicity has been associated with increased renal expression of Bax in vivo (Huang et al, 2001), and with translocation of Bax from the cytosol to a membrane fraction in cultured cells (Lee et al, 2001). A detailed analysis of mitochondrial pathways activated by cisplatin has recently been completed in cultured proximal tubular cells (Park et al, 2002). Cisplatin-induced apoptosis was associated with increased caspase 9 activity, and the DNA laddering was inhibited by pretreatment with specific caspase 9 inhibitors, thereby implicating the mitochondrial mechanisms. Cisplatin also triggered a duration-dependent translocation of Bax from the cytosol to the mitochondria, induction of mitochondrial permeability transition, and release of cytochrome c into the cytosol (Park et al, 2002). Collectively, these studies suggest a major role for mitochondrial pathways in cisplatin-induced apoptosis, at least in cultured renal epithelial cells, as shown in Figure 3. The relative contribution of these pathways in the analogous in vivo situation remains under active investigation. Also, the precise mechanisms by which cisplatin activates the mitochondrial apoptotic pathways is unclear. It has been known for a long time that cisplatininduced nephrotoxicity is accompanied by alterations in

XI. Role of regulatory pathways In order to reconcile the seemingly disparate results indicating activation of both death receptor and mitochondrial pathways in cisplatin-induced nephrotoxicity, investigators have examined the regulatory mechanisms that can account for "cross-talk" between the two. Studies have now documented the rapid activation and nuclear translocation of p53 in response to cisplatin both in kidneys (Miyaji et al, 2001) and in cultured renal proximal tubular cells (Cummings and Schnellmann 2002). Inhibition of p53 prior to cisplatin exposure blunted the apoptotic response by 50%, attesting to the importance 53


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity of this regulatory pathway at least in vitro. It is well known that both cisplatin-induced DNA damage and cisplatin-induced oxidant stress are potent activators of p53 (Muller et al, 1998; Chandel et al, 2000), and that p53 can in turn activate both Bax as well as the Fas-FADD axis (Miyashita and Reed 1995; Burns and El-Deiry 1999). It is therefore likely that this regulatory mechanism may play a crucial role in cisplatin-induced apoptosis. It is well known that one of the responses of the normally quiescent renal tubular epithelial cell to damage induced by cisplatin includes entry into the cell cycle with subsequent cell proliferation, which presumably represents a reparative event (Megyesi et al, 1995; Sano et al, 2000). However, cisplatin also results in DNA damage (Zamble and Lippard 1995), and uncontrolled proliferation of these cells would be expected to result in apoptotic and/or necrotic cell death.Fortunately, renal epithelial cells have evolved mechanisms to prevent further progression of the cell cycle, allowing time and opportunity for their DNA to be repaired and the cell to then complete the regeneration and replacement process (Megyesi et al, 1998; Megyesi et al, 2002). Candidate proteins that contribute to the cell cycle arrest required for DNA repair include p21 and 14-33". Several studies have now documented that cisplatininduced nephrotoxicity is associated with upregulation of p21 mRNA (Megyesi et al, 1996; Huang et al, 2001) and protein (Megyesi et al, 1998; Miyaji et al, 2001; Megyesi et al, 2002). While it is well known that the p53 gene is a potent regulator of p21 (El-Deiry et al, 1993), induction of p21 in cisplatin nephrotoxicity appears to be p53dependent as well as -independent (Megyesi et al, 1996). Mice lacking p21 develop normally, but respond to cisplatin with a more severe nephrotoxic injury, including a more rapid onset of renal failure, uncoordinated progression into S-phase of the cell cycle, and increased apoptosis (Megyesi et al, 1998). Recent work has suggested a role for another cell cycle inhibitor, 14-3-3". Following cisplatin exposure, there is a marked induction of 14-3-3" mRNA and protein in the kidney tubular cells both in vivo and in vitro (Megyesi et al, 2002). Both p21 and 14-3-3" are known to be induced following DNAdamaging injury, at least in part via a p53-dependent mechanism (Hermeking et al, 1997). Both are overexpressed in terminally differentiating epithelia, both are required for proper coordination of the cell cycle, and the absence of either of these factors can accelerate apoptosis (Megyesi et al, 2002). It is recognized that apoptosis represents a default pathway in most cells, and can be activated by a relative deficiency of a variety of "survival factors" (Raff 1992). One example of a survival factor for kidney tubular cells following cisplatin injury is hepatocyte growth factor (HGF). Kidney mRNA levels for HGF are rapidly induced by ischemic or nephrotoxic injury (Liu et al, 1998), and administration of exogenous HGF ameliorates the renal dysfunction induced by cisplatin in vivo by enhancing tubular repair processes (Kawaida et al, 1994). It has recently been shown by a variety of assays that forced over-expression of HGF in cultured renal tubular cells partially inhibited the apoptotic response to cisplatin

incubation (Liu et al, 1998). Whether HGF exerts its beneficial effects in vivo also by protecting tubular cells from cisplatin-induced apoptotic death is not known.

XII. Role of oxidative stress and mitochondrial dysfunction The mechanisms by which cisplatin activates the myriad of apoptotic pathways outlined above remain unclear. However, a role for cisplatin-induced oxidative stress may provide an attractive hypothesis (Baliga et al, 1997). Several studies have now documented the importance of reactive oxygen metabolites (ROM) in cisplatin-induced renal cell apoptosis (Ueda et al, 2000). It is well known that mitochondria continuously produce ROM such as superoxide (Richter et al, 1995). Mitochondria also continuously scavenge ROM via the action of antioxidant enzymes such as superoxide dismutase, glutathione peroxidase, catalase, and glutathione S-transferase (Richter et al, 1995). Cisplatin is known to accumulate in mitochondria of renal epithelial cells (Singh 1989; Gemba and Fukuishi 1991). Several investigators have demonstrated that cisplatin induces ROS in renal epithelial cells primarily by decreasing the activity of antioxidant enzymes and by depleting intracellular concentrations of GSH (Sadzuka et al, 1992; Kruidering et al, 1997; Husain et al, 1998; Huang et al, 2001). A large number of studies have now accumulated documenting the beneficial effects of a variety of antioxidants in cisplatin-induced nephrotoxicity. Agents such as superoxide dismutase, dimethylthiourea, and GSH have been shown to reduce the degree of renal failure and tubular cell damage when administered simultaneously with cisplatin in rats (McGinness et al, 1978; Sadzuka et al, 1992; Matsushima et al, 1998). Antioxidants such as GSH, superoxide dismutase, catalase, deferoxamine, probucol, and heme oxygenase-1 specifically provide partial protection against cisplatin-induced apoptosis in cultured renal epithelial cells (Lieberthal et al, 1996; Okuda et al, 2000; Shiraishi et al, 2000). Furthermore, significant attenuation of cisplatin-induced apoptosis and renal failure in animal models have resulted from maneuvers such as treatment with the hydroxyl radical scavenger DMTU (Zhou et al, 1999), targeted proximal tubular delivery of superoxide dismutase (Nishikawa et al, 2001), and pre-treatment with L-carnitine (Chang et al, 2002). Reactive oxygen molecules can trigger several of the apoptotic mechanisms activated by cisplatin (Figure 3). For example, ROM can induce Fas (Bauer et al, 1998), activate p53 (Chandel et al, 2000), alter mitochondrial permeability (Kruidering et al, 1997; Nowak 2002), release cytochrome c into the cytosol (Reed 1997), and even directly activate caspases (Higuchi et al, 1998). However, one recent study has suggested that at least in cultured proximal tubular cells, the primary cause of cell death following cisplatin exposure is not ROM formation per se (Kruidering et al, 1996). Rather, cisplatin-induced mitochondrial dysfunction with consequent induction of cell death pathways appeared to be the underlying mechanism. Several studies have

54


Cancer Therapy Vol 1, page 55 demonstrated that cisplatin causes mitochondrial dysfunction in kidney epithelial cells (Gordon and Gattone 1986; Brady et al, 1990; Brady et al, 1993; Kruiderink et al, 1996; Nowak 2002). The major mitochondrial targets of cisplatin appear to be the enzymatic complexes that comprise the electron transport chain, leading to a reduction in cellular ATP levels (Kruiderink et al, 1996; Nowak 2002). If the dose of cisplatin is high, ATP depletion is severe, and a rapid metabolic collapse and necrotic cell death would follow (Lieberthal et al, 1996). Lesser grades of ATP depletion associated with lower (pharmacologic) doses of cisplatin can induce apoptosis via release of mitochondrial cytochrome c, which has been documented in cultured renal epithelial cells exposed to cisplatin (Kruiderink et al, 1996; Park et al, 2002; Nowak 2002). It is currently not known exactly how cisplatin inhibits the enzymatic complexes of the respiratory chain. The mechanisms by which cisplatin causes release of cytochrome c also remain controversial, and include induction of mitochondrial permeability transition (Park et al, 2002) and increases in mitochondrial transmembrane potential (Nowak 2002). By analogy with studies of ATP depletion by alternative methods (exposure to inhibitors of oxidative phosphorylation such as antimycin A), it may be inferred that cisplatin-induced ATP depletion can also trigger death receptor-mediated apoptosis (Feldenberg et al, 1999) and the mitochondrial apoptotic pathways (Saikumar et al, 1998). Thus, partial ATP depletion may constitute a common biochemical pathway that leads to apoptosis following a variety of cellular stresses applied at an intensity below the threshold for necrosis. If ATP depletion plays a central role in cisplatininduced apoptosis, and the primary cause of cell death is not ROM formation, then how does one explain the encouraging results obtained from ROM inhibition as detailed above? One possibility is that these two pathogenetic processes co-exist, and are not mutually exclusive. Thus, while ATP-depletion may induce the primary cell injury and programmed cell death, this in turn may accelerate ROM formation by the damaged cells, which may contribute to an amplification loop leading to ROM-mediated cell death of the same cell or even the neighboring cells. ROM inhibition can limit this amplification loop, and may also alleviate nephrotoxicity by reducing the accompanying inflammatory response (Kruidering et al, 1997).

cisplatin to a nephrotoxin, use of antioxidants to counter the ravages of reactive oxygen molecules, and targeted inhibition of apoptotic mechanisms activated by cisplatin specifically in kidney cells.

References Adams JM, and Cory S (1996) The Bcl-2 protein family: arbiters of cell death. Science 281, 1322-1326. Anders MW (1995) Mitochondrial bioactivation of cysteine Sconjugates and 4-thiaalkanoates: implications for mitochondrial dysfunction and mitochondrial diseases. Biochim Biophys Acta 1271, 51-57. Anders MW, and Dekant W (1998) Glutathione-dependent bioactivation of haloalkenes. Annu Rev Pharmacol Toxicol 38, 501-537. Ashkenazi A, and Dixit VM (1996) Death receptors: signaling and modulation. Science 281, 1305-1308. Baliga R, Ueda N, Walker PD, Shah SV (1997) Oxidant mechanisms in toxic acute renal failure. Am J Kid Dis 29, 467-477 Ban N, Takahashi Y, Takayama T, Kura T, Katahira T, Sakamaki S, Niitsu Y (1996) Transfection of glutathione Stransferase (GST)-pi antisense complementary DNA increases the sensitivity of a colon cancer cell line to adriamycin, cisplatin, melphalan, and etoposide. Cancer Res 56, 3577-3582. Bauer MK, Vogt M, Los M, Siegel J, Wesselborg S, SchulzeOsthoff K (1998) Role of reactive oxygen intermediates in activation-induced CD95 (APO-1/Fas) ligand expression. J Biol Chem 273, 8048-8055. Benard P, Desplanches G, Macquet JP, Simon J (1983) Wholebody autoradiographic study of the distribution of 195mPt in healthy and tumor-bearing mice treated with labeled cisplatin. Cancer Treat Rep 67, 457-466. Berners-Price SJ and Kuchel PW (1990) Reaction of cis- and trans-[PtCl2(NH3)2] with reduced glutathione studied by 1H, 13C, 19Pt, and 15N-{1H}DEPT NMR. J Inorg Biochem 38, 305-326. Borch RF, Katz JC, Lieder PH, Pleasants ME (1980) Effect of diethyldithiocarbamate rescue on tumor response to cisplatinum in a rat model. Proc Natl Acad. Sci U S A 77, 5441-5444. Borst P, Evers R, Kool M, Wijnholds J (2000) A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 92, 1295-1302.

XIII: Summary and future perspectives This review has focused on recent evidence for the paradoxical role of GGTP in cisplatin nephrotoxicity, the unexpected ability of proximal tubular cells to metabolize cisplatin to a nephrotoxin, and the evidence for apoptotic pathways and reactive oxygen metabolites as major mechanisms underlying cisplatin-induced renal cell injury. The information gleaned from this review may provide critical clues to novel therapeutic interventions aimed at minimizing cisplatin-induced nephrotoxicity while enhancing its antineoplastic efficacy. Such strategies may include inhibition of pathways leading to activation of

Brady HR, Kone BC, Stromski ME, Zeidel ML, Giebisch G, Gullans SR (1990) Mitochondrial injury: an early event in cisplatin toxicity to renal proximal tubules. Am J Physiol 258, F1181-F1187 Brady HR, Zeidel ML, Kone BC, Giebisch G, Gullans SR ( 1993) Differential actions of cisplatin on renal proximal tubule and inner medullary collecting duct cells. J Pharmac Exp Ther 265, 1421-1428.

55


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity Brenner C, and Kroemer G (2000) Mitochondria-the death signal integrators. Science 289, 1150-1151.

Cornelison TL and Reed E (1993) Nephrotoxicity and hydration management for cisplatin, carboplatin, and ormaplatin. Gynecol. Oncol. 50, 147-158.

Brown R, Hirst GL, Gallagher WM, McIlwrath AJ, Margison GP, van der Zee AG, Anthoney DA (1997) hMLH1 expression and cellular responses of ovarian tumour cells to treatment with cytotoxic anticancer agents. Oncogene 15, 45-52.

Cummings BS and Schnellmann RG (2002) Cisplatin-induced renal cell apoptosis: caspase 3-dependent and -independent pathways. J Pharmacol Exp Ther 302, 8-17. Curran WJ (2002) New chemotherapeutic agents: update of major chemoradiation trials in solid tumors. Oncology 63 Suppl 2, 29-38.

Bruschi SA, Lindsay JG, Crabb JW (1998) Mitochondrial stress protein recognition of inactivated dehydrogenases during mammalian cell death. Proc Natl Acad Sci U S A 95, 13413-13418.

Curthoys NP, Hughey RP (1979) Characterization and physiological function of rat renal gamma-glutamyl transpeptidase. Enzyme 24, 383-403.

Bruschi SA, West KA, Crabb JW, Gupta RS, Stevens JL (1993) Mitochondrial HSP60 (P1 protein) and a HSP70-like protein (mortalin) are major targets for modification during S(1,1,2,2-tetrafluoroethyl)- L-cysteine-induced nephrotoxicity. J. Biol. Chem. 268, 23157-23161.

Daley-Yates PT, McBrien DCH (1984) Cisplatin metabolites in plasma, A study of their pharmacokinetics and importance in the nephrotoxic and antitumour activity of cisplatin. Biochem Pharmacol 33, 3063-3070.

Burns TF, and El-Deiry WS (1999) The p53 pathway and apoptosis. J Cell Physiol 181, 231-239.

DeConti RC, Toftness BR, Lange RC, Creasey WA (1973) Clinical and pharmacological studies with cisdiamminedichloroplatinum(II). Cancer Res 33, 1310-1315.

Chandel NS, Vander Heiden MG, Thompson CB, and Schumaker PT (2000) Redox regulation of p53 during hypoxia. Oncogene 19:3840-3848.

Dekant W (2001) Chemical-induced nephrotoxicity mediated by glutathione S-conjugate formation. Toxicol Lett 124, 21-36.

Chang B-J, Nishikawa M, Sato E, Utsumi K, and Inoue M (2002) L-Carnitine inhibits cisplatin-induced injury of the kidney and small intestine. Arch Biochem Biophys 405, 55-64.

Eastman A (1999) The mechanism of action of cisplatin:From adducts to apoptosis. In: Lippert B (ed) Cisplatin:Chemistry and Biochemistry of a Leading Anticancer Drug. WileyVCH, New York, pp 111-135.

Chen G, Hutter KJ, Zeller WJ (1995) Positive correlation between cellular glutathione and acquired cisplatin resistance in human ovarian cancer cells. Cell Biol Toxicol 11, 273281.

El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, and Vogelstein B (1993) WAF-1, a potential medictor of p53 tumor suppression. Cell 75, 817-825.

Chen Y, Cai J, Anders MW, Stevens JL, Jones DP (2001) Role of mitochondrial dysfunction in S-(1,2-dichlorovinyl)-lcysteine- induced apoptosis. Toxicol Appl Pharmacol 170, 172-180.

Elfarra AA, Lash LH, Anders MW (1986) Metabolic activation and detoxication of nephrotoxic cysteine and homocysteine s-conjugates. Proc Natl Acad Sci USA 83, 2667-2671.

Cheng X, Kigawa J, Minagawa Y, Kanamori Y, Itamochi H, Okada M, Terakawa N (1997) Glutathione S-transferase-pi expression and glutathione concentration in ovarian carcinoma before and after chemotherapy. Cancer 79, 521527.

Esposito M, Viale M, Vannozzi MO, Zicca A, Cadoni A, Merlo F, Gogioso L (1996) Effect of the antiarrhythmic drug procainamide on the toxicity and antitumor activity of cisdiamminedochloroplatinum(II). Toxicol Appl Pharmacol 140, 370-377.

Chu G, Mantin R, Shen YM, Baskett G, Sussman H (1993) Massive cisplatin overdose by accidental substitution for carboplatin. Toxicity and management. Cancer 72, 37073714.

Feldenberg LR, Thevananther S, Del Rio M, De Leon M, and Devarajan P (1999) Partial ATP depletion induces Fas- and caspase-mediated apoptosis in MDCK cells. Am J Physiol (Renal Physiol) 276, F837-F846.

Cohen SM, Lippard SJ (2001) Cisplatin: from DNA damage to cancer chemotherapy. Prog Nucleic Acid Res Mol Biol 67, 93-130.

Fink D, Howell SB (2000) How does cisplatin kill cells? In: Kelland LR, Favilli F (eds) Platinum-based Drugs in Cancer Therapy. Humana Press, Totowa, New Jersey, pp 149-167.

Commandeur JN, Stijntjes GJ, Wijngaard J, Vermeulen NP (1991) Metabolism of L-cysteine S-conjugates and N(trideuteroacetyl)-L- cysteine S-conjugates of four fluoroethylenes in the rat. Role of balance of deacetylation and acetylation in relation to the nephrotoxicity of mercapturic acids. Biochem Pharmacol 42, 31-38.

Friesen C, Fulda S, and Debatin KM (1999) Cytotoxic drugs and the CD95 pathway. Leukemia 13, 1854-1858. Fukuoka K, Takeda M, Kobayashi M, Osaki T, Shirato I, Soejima A, Nagasawa T, and Endou H (1998) Distinct interleukin-1#-converting enzyme family proteases mediate cisplatin- and staurosporine-induced apoptosis of mouse proximal tubule cells. Life Sci 62, 1125-1138.

Cooper AJ, Bruschi SA, Anders MW (2002) Toxic, halogenated cysteine S-conjugates and targeting of mitochondrial enzymes of energy metabolism. Biochem Pharmacol 64, 553-564.

Gaskin PJ, Adcock HJ, Buckberry LD, Teesdale-Spittle PH, Shaw PN (1995) The C-S lysis of L-cysteine conjugates by

56


Cancer Therapy Vol 1, page 57 aspartate and alanine aminotransferase enzymes. Hum Exp Toxicol 14, 422-427.

Hayden PJ, Ichimura T, McCann DJ, Pohl LR, Stevens JL (1991) Detection of cysteine conjugate metabolite adduct formation with specific mitochondrial proteins using antibodies raised against halothane metabolite adducts. J Biol Chem 266, 18415-18418.

Gately DP, Howell SB (1993) Cellular accumulation of the anticancer agent cisplatin: a review. Br J Cancer 67, 11711176.

Hayden PJ, Stevens JL (1990) Cysteine conjugate toxicity, metabolism, and binding to macromolecules in isolated rat kidney mitochondria. Mol Pharmacol 37, 468-476.

Gemba M, and Fukuishi N (1991) Amelioration by ascorbic acid of cisplatin-induced injury in cultured renal epithelial cells. Contrib Nephrol 95, 138-142.

Hermeking H, Lengauer C, Polyak K, He TC, Zhang L, Thiagalingam, Kinzler KW, and Vogelstein B (1997) 14-33" is a p53-regulated inhibitor of G2/M progression. Mol Cell 1, 3-11.

Germain I, Tetu B, Brisson J, Mondor M, Cherian MG (1996) Markers of chemoresistance in ovarian carcinomas: an immunohistochemical study of 86 cases. Int J Gynecol Pathol 15, 54-62.

Higuchi M, Honda T, Proske RJ, Yeh ETH (1998) Regulation of reactive oxygen species-induced apoptosis and necrosis by caspase 3-like proteases. Oncogene 17, 2752-2760.

Godwin AK, Meister A, O'Dwyer PJ, Huang CS, Hamilton TC, Anderson ME (1992) High resistance to cisplatin in human ovarian cancer cell lines is associated with marked increase of glutathione synthesis. Proc Natl Acad Sci USA 89, 30703074.

Howell SB, Taetle R (1980) Effect of sodium thiosulfate on cisdichlorodiammineplatinum(II) toxicity and antitumor activity in L1210 leukemia. Cancer Treat Rep 64, 611-616.

Goldstein JC, Waterhouse NJ, Juin P, Evan GI, and Green DR (2000) The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Nat Cell Biol 2, 156-162.

Hrubisko M, McGown AT, Fox BW (1993) The role of metallothionein, glutathione, glutathione S-transferases and DNA repair in resistance to platinum drugs in a series of L1210 cell lines made resistant to anticancer platinum agents. Biochem Pharmacol 45, 253-256.

Gonzales-Vitale JC, Hayes DM, Cvitkovic E, Sternberg SS (1977) The renal pathology in clinical trials of cis-platinum (II) diamminedichloride. Cancer 39, 1362-1371.

Huang Q, Dunn RT, Jayadev S, DiSorbo O, Pack FD, Farr SB, Stoll RE, and Blanchard KT (2001) Assessment of cisplatininduced nephrotoxocity by microarray technology. Toxicol Sci 63, 196-207.

Gordon JA, and Gattone VH (1986) Mitochondrial alterations in cisplatin-induced acute renal failure. Am J Physiol (Renal Fluid Electrolyte Physiol) 19, F991-F998.

Hughey RP, Rankin BB, Elce JS, Curthoys NP (1978) Specificity of a particulate rat renal paptidase and its localization along with other enzymes of mercapturic acid synthesis. Arch Biochem Biophys 186, 211-217.

Hamada S, Kamada M, Furumoto H, Hirao T, Aono T (1994) Expression of glutathione S-transferase-pi in human ovarian cancer as an indicator of resistance to chemotherapy. Gynecol Oncol 52, 313-319. Hanigan MH, Frierson Jr. HF (1996) Immunohistochemical detection of gamma-glutamyl transpeptidase in normal human tissue. J Histochem Cytochem 44, 1101-1108.

Husain K, Morris C, Whitworth C, Trammell GL, Rybak LP, Somani SM (1998) Protection by ebselen against cisplatininduced nephrotoxicity: antioxidant system. Mol Cell Biochem 178, 127-133.

Hanigan MH, Gallagher BC, Taylor PTJr, Large MK (1994) Inhibition of gamma-glutamyl transpeptidase activity by acivicin in vivo protects the kidney from cisplatin-induced toxicity. Cancer Res 54, 5925-5929.

Ishida S, Lee J, Thiele DJ, Herskowitz I (2002) Uptake of the anticancer drug cisplatin mediated by the copper transporter Ctr1 in yeast and mammals. Proc Natl Acad Sci U S A 99, 14298-14302.

Hanigan MH, Gallagher BC, Townsend DM, Gabarra V (1999) Gamma-glutamyl transpeptidase accelerates tumor growth and increases the resistance of tumors to cisplatin in vivo. Carcinogenesis 20, 553-559.

Ishikawa T, Bao JJ, Yamane Y, Akimaru K, Frindrich K, Wright CD, Kuo MT (1996) Coordinated induction of MRP/GS-X pump and gamma-glutamylcysteine synthetase by heavy metals in human leukemia cells. J Biol Chem 271, 1498114988.

Hanigan MH, Lykissa ED, Townsend DM, Ou C, Barrios R, Lieberman MW (2001) Gamma-glutamyl transpeptidasedeficient mice are resistant to the nephrotoxicity of cisplatin. Am J Pathol 159, 1889-1894.

Jones MM, Basinger MA, Holscher MA (1992) Control of the nephrotoxicity of cisplatin by clinically used sulfurcontaining compounds. Fundamental and Applied Toxicology 18, 181-188.

Hanigan MH, Pitot HC (1985) Gamma-glutamyl transpeptidase its role in hepatocarcinogenesis. Carcinogenesis 6, 165-172.

Katano K, Kondo A, Safaei R, Holzer A, Samimi G, Mishima M, Kuo YM, Rochdi M, Howell SB (2002) Acquisition of resistance to cisplatin is accompanied by changes in the cellular pharmacology of copper. Cancer Res 62, 65596565.

Hanigan MH, Ricketts WA (1993) Extracellular glutathione is a source of cysteine for cells that express gamma-glutamyl transpeptidase. Biochemistry 32, 6302-6306. Hassall CD, Gandolfi AJ, Duhamel RC, Brendel K (1984) The formation and biotransformation of cysteine conjugates of halogenated ethylenes by rabbit renal tubules. Chem Biol Interact 49, 283-297.

Kaushal GP, Kaushal V, Hong X, and Shah SV (2001) Role and regulation of caspases in cisplatin-induced injury to renal tubular epithelial cells. Kidney Int 60, 1726-1736.

57


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity Kawaida K, Matsumoto K, Shimazu H, aand Nakamura T (1994) Hepatocyte growth factor prevents acute renal failure and accelerates renal regeneration in mice. Proc Natl Acad Sci USA 91, 4357-4361.

Lash LH, Sausen PJ, Duescher RJ, Cooley AJ, Elfarra AA (1994) Roles of cysteine conjugate b-lyase and s-oxidase in nephrotoxicity: studies with s-(1,2-dichlorovinyl)-l-cysteine and s-(1,2-dichlorovinyl)-l-cysteine sulfoxide. J Pharmacol Exp Therap 269, 374-383.

Kerr JFR, Wyllie AH, and Currie AR (1972) Apoptosis: a basic biological phenomenon with wide-ranging implication in tissue kinetics. Br J Cancer 26, 239-257.

Lau AH (1999) Apoptosis induced by cisplatin nephrotoxic injury. Kidney Int 56, 1295-1298.

Kigawa J, Minagawa Y, Kanamori Y, Itamochi H, Cheng X, Okada M, Oishi T, Terakawa N (1998) Glutathione concentration may be a useful predictor of response to second-line chemotherapy in patients with ovarian cancer. Cancer 82, 697-702.

Lee RH, Song JM, Park MY, Kang SK, Kim YK, and Jung JS (2001) Cisplatin-induced apoptosis by translocation of endogenous Bax in mouse collecting duct cells. Biochem Pharmacol 62, 1013-1023. Legallicier B, Leclere C, Monteil C, Elkaz V, Morin JP, Fillastre JP (1996) The cellular toxicity of two antitumoral agents derived from platinum, cisplatinum versus oxaliplatinum, on cultures of tubular proximal cells. Drugs Exptl Clin Res 22, 41-50.

Komatsu M, Sumizawa T, Mutoh M, Chen ZS, Terada K, Furukawa T, Yang XL, Gao H, Miura N, Sugiyama T, Akiyama S (2000) Copper-transporting P-type adenosine triphosphatase (ATP7B) is associated with cisplatin resistance. Cancer Res 60, 1312-1316. Korsmeyer SJ, Wei MC, Saito M, Weiler S, Oh KJ, and Sclesinger PH (2000) Pro-apoptotic cascade activates BID, which oligomerizes BAK or BAX into pores that result in the release of cytochrome c. Cell Death Diff 7, 1166-1173.

Leyland-Jones BR, Townsend AJ, Tu CP, Cowan KH, Goldsmith ME (1991) Antineoplastic drug sensitivity of human MCF-7 breast cancer cells stably transfected with a human alpha class glutathione S-transferase gene. Cancer Res 51, 587594.

Korst AE, Boven E, van der Sterre ML, Fichtinger-Schepman AM, Van der Vijgh WJ (1998) Pharmacokinetics of cisplatin with and without amifostine in tumour- bearing nude mice. Eur J Cancer 34,412-416

Lieberthal W, Triaca V, and Levine J (1996) Mechanisms of death induced by cisplatin in proximal tubular epithelial cells: apoptosis vs. necrosis. Am J Physiol (Renal Physiol) 39, F700-F708.

Kramer RA, Foureman G, Greene KE, Reed DJ (1987) Nephrotoxicity of S-(2-chloroethyl)glutathione in the Fischer rat: Evidence for gamma-glutamyltranspeptidaseindependent uptake by the kidney. J Pharmacol Exp Ther 242, 741-748.

Levine JS, andLieberthal W (2001) Terminal pathways to cell death. In Acute Renal Failure, Molitoris BA and Finn WF (editors), W.B. Saunders, Philadelphia, pp 30-59). Lin X, Okuda T, Holzer A, Howell SB (2002) The copper transporter CTR1 regulates cisplatin uptake in Saccharomyces cerevisiae. Mol Pharmacol 62, 1154-1159.

Kroning R, Katz D, Lichtenstein AK, Nagami GT (1999) Differential effects of cisplatin in proximal and distal renal tubule epithelial cell lines. Br J Cancer 79, 293-299.

Liu Y, Sun AM, and Dworkin LD (1998) Hepatocyte growth factor protects renal epithelial cells from apoptotic death. Biochem Biophys Res Comm 246, 821-826.

Kruidering M, Van de Water B, De Heer E, Mulder GJ, Nagelkerke JF (1997) Cisplatin-induced nephrotoxicity in porcine proximal tubular cells: mitochondrial dysfunction by inhibition of complexes I to IV of the respiratory chain. J Pharmacol Exp Therap 280, 638-649.

Luo X, Budihardjo I, Zou H, Slaughter C, and Wang X (1998) Bid, a Bcl-2-interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell 94, 481-490.

Kruidering M, van der Water B, Zhan Y, Baelde JJ, Heer E, Mulder GJ, Stevens JL, and Nagerkerke JF (1998) Cisplatin effects on F-actin and matrix proteins precede renal tubular cell detachment and apoptosis in vitro. Cell Death Diff 5, 601-614.

Matsushima H, Yonemura K, Ohishi K, Hishida A (1998) The role of oxygen free radicals in cisplatin-induced acute renal failure in rats. J Lab Clin Med 131, 518-526. Mayer RD, Lee K, Cockett ATK (1987) Inhibition of cisplatininduced nephrotoxicity in rats by buthionine sulfoximine, a glutathione synthesis inhibitor. Cancer Chemother Pharmacol 20, 207-210.

Lange RC, Spencer RP, Harder HC (1973) The antitumor agent cis-Pt(NH3)2Cl2: Distribution studies and dose calculations for 193m Pt and 195m Pt. J Nuclear Medicine 14, 191-195.

McGinness JE, Proctor PH, Demopoulos HB, Hokanson JA, Kirkpatrick DS (1978) Amelioration of cis-platinum nephrotoxicity by orgotein (superoxide dismutase). Physiol Chem Phys 10, 267-277.

Langerak AD, Dreisbach LP (2001) Chemotherapy Regimens and Cancer Care. Landes Bioscience, Georgetown, Texas. Lash LH, Elfarra AA, Anders MW (1986) Renal cysteine conjugate beta-lyase. Bioactivation of nephrotoxic cysteine S-conjugates in mitochondrial outer membrane. J Biol Chem 261, 5930-5935.

McIntyre TM, Curthoys NP (1982) Renal catabolism of glutathione: characterization of a particulate rat renal dipeptidase that catalyzes the hydrolysis of cysteinylglycine. J Biol Chem 257, 11915-11921.

Lash LH, Qian W, Putt DA, Jacobs K, Elfarra AA, Krause RJ, Parker JC (1998) Glutathione conjugation of trichloroethylene in rats and mice: sex-, species-, and tissuedependent differences. Drug Metab Dispos 26, 12-19.

McKeage MJ (2000) Clinical toxicology of platinum-based cancer chemotherapeutic agents. In: Kelland LR, Farrell NP

58


Cancer Therapy Vol 1, page 59 (eds) Platinum-based Drugs in Cancer Therapy. Humana Press, Totowa, New Jersey, pp 251-275.

relevance to nephrotoxicity. Toxicol Appl Pharmacol 73, 124-137.

Megyesi J, DiMari J, Udvarhelyi M, Price PM, and Safirstein R (1995) DNA synthesis is dissociated from the immediateeary gene response in the post-ischemic kidney. Kidney Int 48, 1451-1458.

Nishikawa M, Nagatomi H, Chang B-J, Sato E, and Inoue M (2001) Targeting superoxide dismutase to renal proximal tubule cells inhibits mitochondrial injury and renal dysfunction induced by cisplatin. Arch Biochem Biophys 387, 78-84.

Megyesi J, Udvarhelyi N, Safirstein RL, and Price PM (1996) The p53-independent activation of transcription of p21WAF1/CIP1/SDI1 after acute renal failure. Am J Physiol 271, F1211-F1216.

Nishimura T, Newkirk K, Sessions RB, Andrews PA, Trock BJ, Rusmussen AA, Montogomery EA, Bischoff EK, Hanigan MH, Cullen KJ (1998) Association between expression of glutathione-associated enzymes and response to platinumbased chemotherapy in head and neck cancer. Chem Biol Interac 112, 187-198.

Megyesi J, Safirstein RL, and Price PM (1998) Induction of p21WAF1/CIP1/SDI1 in kidney tubule cells affects the course of cisplatin-induced acute renal failure. J Clin Invest 101, 777-782.

Nogae S, Masanobu M, Kobayashi N, Saito T, Abe K, Saito H, Nakane PK, Nakanishi Y, and Koji T (1998) Induction of apoptosis in ischemia-reperfusion model of mouse kidney: Possible involvement of Fas. J Am Soc Nephrol 9, 620-631.

Meyer KB, Madias NE ( 1994) Cisplatin nephrotoxicity. Mineral Electrolyte Metab 20, 201-213. Mistry P, Lee C, McBrien DC (1989) Intracellular metabolites of cisplatin in the rat kidney. Cancer Chemother Pharmacol 24, 73-79.

Nowak G (2002) Protein kinase C-! and ERK1/2 mediate mitochondrial dysfunction, decreases in active Na transport, and cisplatin-induced apoptosis in renal cells. J Biol Chem 277, 43377-43388.

Miyaji T, Kato A, Yasuda H, Fujigaki Y, and Hishida A (2001) Role of the increase in p21 in cisplatin-induced acute renal failure in rats. J Am Soc Nephrol 12, 900-908.

Oakley AJ, Lo BM, Nuccetelli M, Mazzetti AP, Parker MW (1999) The ligandin (non-substrate) binding site of human Pi class glutathione transferase is located in the electrophile binding site (H-site). J Mol Biol 291, 913-926.

Miyashita T, and Reed JC (1995) Tumor suppressor p53 is a direct transcriptonal activator of the human bax gene. Cell 80, 293-299.

O'Dwyer PJ, Stevenson JP, Johnson SW (1999) Clinical Status of Cisplatin, Carboplatin and Other Platinum-Based Antitumor Drugs. In: Lippert B (ed) Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Zurich, pp 29-70.

Miyashita H, Nitta Y, Mori S, Kanzaki A, Nakayama K, Terada K, Sugiyama T, Kawamura H, Sato A, Morikawa H, Motegi K, Takebayashi Y (2003) Expression of copper-transporting P-type adenosine triphosphatase (ATP7B) as a chemoresistance marker in human oral squamous cell carcinoma treated with cisplatin. Oral Oncol 39, 157-162.

Okuda M, Masaki K, Fukatsu S, Hashimoto Y, and Inui K (2000) Role of apoptosis in cisplatin-induced toxicity in the renal epithelial cell line LLC-PK1. Biochem Pharmacol 59, 195201.

Montine TJ, Borch RF (1988) Quiescent LLC-PK1 cells as a model for cis-diamminedichloroplatinum (II) nephrotoxicity and modulation by thiol rescue agents. Cancer Res 48, 6017-6024.

Oltvai Z, and Korsmeyer S (1994) Checkpoints of dueling dimers foil death wishes. Cell 79, 189 â&#x20AC;&#x201C;192.

Muller M, Wilder S, Bannasch D, Israeli D, Lehlbach K, LiWeber M, Friedman SL, Galle PR, Stremmel W, Oren M, and Krammer PH (1998) P53 activates the CD95 (APO1/Fas) gene in response to DNA damage by anticancer drugs. J Exp Med 188, 2033-2045.

Osman AM, El Sayed EM, El Demerdash E, Al Hyder A, El Didi M, Attia AS, Hamada FM (2000) Prevention of cisplatininduced nephrotoxicity by methimazole. Pharmacol Res 41, 115-121. Park MS, De Leon M, and Devarajan P (2002) Cisplatin induces apoptosis in LLC-PK1 cells via activation of mitochondrial pathways. J Am Soc Nephrol 13, 858-865.

Murphy D, McGown AT, Hall A, Cattan A, Crowther D, Fox BW (1992) Glutathione S-transferase activity and isoenzyme distribution in ovarian tumour biopsies taken before or after cytotoxic chemotherapy. Br J Cancer 66, 937-942.

Perez RP (1998) Cellular and molecular determinants of cisplatin resistance. Eur J Cancer 34, 1535-1542.

Nakagawa K, Saijo N, Tsuchida S, Sakai M, Tsunokawa Y, Yokota J, Muramatsu M, Sato K, Terada M, Tew KD (1990) Glutathione-S-transferase pi as a determinant of drug resistance in transfectant cell lines. J Biol Chem 265, 42964301.

Puchalski RB, Fahl WE (1990) Expression of recombinant glutathione S-transferase pi, Ya, or Yb1 confers resistance to alkylating agents. Proc Natl Acad Sci U S A 87, 2443-2447. Raff M (1992) Social controls on cell survival and cell death. Nature 356, 397-400.

Nakayama K, Miyazaki K, Kanzaki A, Fukumoto M, Takebayashi Y (2001) Expression and cisplatin sensitivity of copper-transporting P-type adenosine triphosphatase (ATP7B) in human solid carcinoma cell lines. Oncol Rep 8, 1285-1287.

Ramesh G, and Reeves WB (2002) TNF-! mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J Clin Invest 110, 835-842. Razzaque MS, Koji T, Kumatori A, and Taguchi T (1999) Cisplatin-induced apoptosis in human proximal tubular

Nash JA, King LJ, Lock EA, Green T (1984) The metabolism and disposition of hexachloro-1:3-butadiene in the rat and its

59


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity epithelial cells is associated with the activation of the Fas/Fas ligand system. Histochem Cell Biol 111, 359-365.

Tedeschi M, De Cesare A, Oriana S, Perego P, Silva A, Venturino P, Zunino F (1991) The role of glutathione in combination with cisplatin in the treatment of ovarian cancer. Cancer Treat Rev 18,253-259.

Reed JC (1997) Cytochrome c: can't live with it - can't livewithout it. Cell 91, 559-562.

Thadani R, Pascual M, and Bonventre JV (1996) Acute renal failure. N Engl J Med 334, 1448-1460.

Richter C, Gogvadze V, Laffranchi R, Schlapbach R, Schweizer M, Suter M, Walter P, Yaffee M (1995) Oxidants in mitochondria: from physiology to disease. Biochim. Biophys. Acta 1271, 67-74.

Thornberry NA, and Lazebnik Y (1998) Caspases: enemies within. Science 281, 1312-1316.

Sadowitz PD, Hubbard BA, Dabrowiak JC, Goodisman J, Tacka KA, Aktas MK, Cunningham MJ, Dubowy RL, Souid AK (2002) Kinetics of cisplatin binding to cellular DNA and modulations by thiol- blocking agents and thiol drugs. Drug Metab Dispos. 30, 183-190.

Townsend AJ, Tu CP, Cowan KH (1992) Expression of human mu or alpha class glutathione S-transferases in stably transfected human MCF-7 breast cancer cells: effect on cellular sensitivity to cytotoxic agents. Mol Pharmacol 41, 230-236.

Sadzuka Y, Shoji T, Takino Y (1992) Effect of cisplatin on the activities of enzymes which protect against lipid peroxidation. Biochem Pharmacol 43, 1872-1875.

Townsend DM, Deng M, Zhang L, Lapus MG, Hanigan MH (2003) Metabolism of cisplatin to a nephrotoxin in proximal tubule cells. J Am Soc Nephrol 14, 1-10.

Sadzuka Y, Shimizu Y, Takino Y (1994) Role of glutathione Stransferase isoenzymes in cisplatin-induced nephrotoxicity in the rat. Toxicol Lett 70, 211-222.

Townsend DM, Hanigan MH (2002) Inhibition of gammaglutamyl transpeptidase or cysteine S-conjugate beta-lyase activity blocks the nephrotoxicity of cisplatin in mice. J Pharmacol Exp Ther 300, 142-148.

Sadzuka Y, Shimizu Y, Takino Y, Hirota S (1994) Protection against cisplatin-induced nephrotoxicity in the rat by inducers and an inhibitor of glutathione S-transferase. Biochem Pharmacol 48, 453-459.

Townsend DM, Marto JA, Deng M, Macdonald TJ, Hanigan MH (2003) HPLC and mass spectrometry characterization of the nephrotoxic biotransformation products of cisplatin. Drug Metab Dispos, in press.

Saikumar P, Dong Z, Weinberg JM, Venkatachalam MA (1998) Mechanisms of cell death in hypoxia/reoxygenation injury. Oncogene 17, 3341-3349.

Tsuruya K, Ninomiya T, Tokumoto M, Hirakawa M, Masutani K, Taniguchi M, Fukuda K, Kanai H, Kishihara K, Hirakata H, and Iida M (2003) Direct involvement of the receptormediated apoptotic pathways in cisplatin-induced renal tubular cell death. Kidney Int 63, 72-82.

Sano K, Fujigaki Y, Miyaji T, Ikegaya N, Ohishi K, Yonemura H, and Hishida A (2000) Role of apoptosis in uranyl acetateinduced acute renal failure and acquired resistance to uranyl acetate. Kidney Int 57, 1560-1570.

Ueda K, Suzuki H, Akiyama S, Sugiyama Y (1999) Differences in substrate specificity among glutathione conjugates (GS-X) pump family members: comparison between multidrug resistance- associated protein and a novel transporter expressed on a cisplatin- resistant cell line (KCP-4). Jpn J Cancer Res 90, 439-447.

Shiraishi F, Curtis LM, Truong L, Poss K, Visner GA, Madsen K, Nick HS, and Agarwal A (2000) Heme oxygenase-1 gene ablation or expression modulates cisplatin-induced renal tubular apoptosis. Am J Physiol (Renal Physiol) 278, F726F736.

Ueda N, Kaushal GP, and Shah SV (2000) Apoptotic mechanisms in acute renal failure. Am J Med 108, 403-415.

Siddik ZH, Newell DR, Boxall FE, Harrap KR (1987) The comparative pharmacokinetics of carboplatin and cisplatin in mice and rats. Biochem Pharmacol 36, 1925-1932.

Uozumi J, Ishizawa M, Iwamoto Y, Baba T (1984) Sodium thiosulfate inhibits cis-diamminedichloroplatinum (II) activity. Cancer Chemother Pharmacol 13, 82-85.

Singh G (1989) A possible cellular mechanism of cisplatininduced nephrotoxicity. Toxicology 58, 71-80.

Van Der Water B, Tijdens IB, Verbrugge A, Huigsloot M, Dihal AA, Stevens JL, Jaken S, and Mulder GJ (2000) Cleavage of the actin-capping protein !-adducin at Asp-Asp-Ser-Asp633Ala by caspase-3 is preceded by its phosphorylation on serine 726 in cisplatin-induced apoptosis of renal epithelial cells. J Biol Chem 275, 25805-25813.

Smyth JF, Bowman A, Perren T, Wilkinson P, Prescott RJ, Quinn KJ, Tedeschi M (1997) Glutathione reduces the toxicity and improves quality of life of women diagnosed with ovarian cancer treated with cisplatin: results of a double-blind, randomised trial. Ann Oncol 8, 569-573. Takeda M, Kobayashi M, Shirato I, Osaki T, and Endou H (1997) Cisplatin-induced apoptosis of immortalized mouse proximal tubule cells is mediated by interleukin-1# converting enzyme (ICE) family of proteases but inhibited by overexpression of Bcl-2. Arch Toxicol 71, 612-621.

Van der Water B, Houtepen F, Huigsloot M, Tijdens IB (2001) Suppression of chemically induced apoptosis but not necrosis of renal proximal tubular epithelial (LLC-PK1) cells by focal adhesion kinase (FAK). Role of FAK in maintaining focal adhesion organization after acute renal cell injury. J Biol Chem 276, 36183-36193.

Takeda M, Kobayashi M, Shirato I, and Endou H (1998) Involvement of macromolecule synthesis, endonuclease activation and c-fos expression in cisplatin-induced apoptosis of mouse proximal tubule cells. Toxicol Lett 94, 83-92.

Van der Zee AG, van Ommen B, Meijer C, Hollema H, Van Bladeren PJ, de Vries EG (1992) Glutathione S-transferase activity and isoenzyme composition in benign ovarian tumours, untreated malignant ovarian tumours, and

60


Cancer Therapy Vol 1, page 61 malignant ovarian tumours after platinum/cyclophosphamide chemotherapy. Br J Cancer 66, 930-936. Viale M, Vannozzi MO, Pastrone I, Mariggio MA, Zicca A, Cadoni A, Cafaggi S, Tolino G, Lunardi G, Civalleri D, Lindup WE, Esposito M (2000) Reduction of cisplatin nephrotoxicity by procainamide: does the formation of a cisplatin-procainamide complex play a role? J Pharmacol Exp Ther 293, 829-836. Wolf CR, Berry PN, Nash JA, Green T, Lock EA (1984) Role of microsomal and cytosolic glutathione S-transferases in the conjugation of hexachloro-1:3-butadiene and its possible relevance to toxicity. J Pharmacol Exp Ther 228, 202-208. Wright SH, Wunz TM, North J, Stevens JL (1998) Na-dependent transport of S-(1,2-dichlorovinyl)-L-cysteine by renal brushborder membrane vesicles. J Pharmacol Exp Ther 285, 162-169. Yee S, Fazekas-May M, Walker EM, Montague D, Stern S, Heard KW (1994) Inhibition of cisplatin toxicity without decreasing antitumor efficacy. Use of a dithiocarbamate. Arch Otolaryngol Head Neck Surg 120, 1248-1252. Zamble BD, and Lippard SJ (1995) Cisplatin and DNA repair in cancer chemotherapy. Trends Biol Sci 20, 435-439. Zhan Y, van de Water B, Wang Y, and Stevens JL (1999) The roles of caspase-3 and bcl-2 in chemically-induced apoptosis but not necrosis of renal epithelial cells. Oncogene 18, 65056512. Zhou H, Miyaji T, Kato A, Fujigaki Y, Sano K, and Hishida A (1999) Attenuation of cisplatin-induced acute renal failure is associated with less apoptotic cell death. J Lab Clin Med 134, 649-658

Dr. Prasad Devarajan

Dr. Marie H. Hanigan

61


Hanigan and Devarajan: Molecular mechanisms of cisplatin nephrotoxicity

62


Cancer Therapy Vol 1, page 63 Cancer Therapy Vol 1, 63-70, 2003.

Mitoxantrone, prednisone, pentostatin and bleomycin for patients with indolent non-Hodgkin’s lymphoma relapsed or unresponsive to previous treatments. Results of a phase II study conducted by the Gruppo Italiano per lo Studio dei Linfomi (GISL) Research Article

Massimo Federico1*, Vincenzo Callea2, Romano Danesi3, Antonella Montanini1, Nicola Di Renzo4, Mario Petrini3, Mario Del Tacca3, Maria Angela Sirotti1, Giovanni Santacroce1, Alberto Bagnulo1, Matteo Dell’Olio5 and Maura Brugiatelli6 for GISL 1

Dipartimento di Oncologia ed Ematologia, Università di Modena e Reggio Emilia; 2Divisione di Ematologia, Presidio Ospedali Riuniti “Bianchi, Melacrino, Morelli”, Reggio Calabria; 3Divisione di Farmacologia e Chemioterapia, Dipartimento di Oncologia, Trapianti e Tecnologie Avanzate in Medicina, Università di Pisa; 4Unità Operativa di Ematologia ed Oncologia Medica, C.R.O.B., Ospedale Oncologico Regionale, Rionero in Vulture (PZ); 5Divisione di Ematologia, Centro Trapianti di Midollo Osseo, IRCCS “Casa Sollievo della Sofferenza”, S. Giovanni Rotondo (FG); 6 Divisione di Ematologia, Azienda Ospedaliera Papardo, Messina.

__________________________________________________________________________________ *Correspondence to: Massimo Federico, Dipartimento di Oncologia ed Ematologia, Centro Oncologico Modenese, Università di Modena e Reggio Emilia, Policlinico - Via del Pozzo 71, 41100 Modena, Italy. Phone +39-059-4224547; Fax +39-059-4224549; e-mail: federico@unimore.it Key words: chemotherapy, indolent NHL, MiPPeB, non-Hodgkin's lymphoma, Pentostatin Received: 25 March 2003; Accepted: 10 April 2003; electronically published: April 2003 Contributed by Massimo Federico

Summary Background. Taking into account the promising results achieved with purine analogs in combination regimens in patients with indolent NHL, we designed a phase II study aimed at assessing the efficacy of Pentostatin in combination with Mitoxantrone, Prednisone and Bleomycin (MiPPeB). Patients and Methods. Thirty patients (18 males and 12 females) with relapsed or unresponsive indolent NHL were treated with MiPPeB. The treatment consisted of Pentostatin 5 mg/m2, on day 1 and 8, Mitoxantrone 10 mg/m2, on day 1, Bleomycin 8 mg/m2, on day 8, Prednisone 100 mg, on day 1 and 8; cycles were administered at 3 week intervals for a maximum of 6 cycles. In 5 patients we investigated the pharmacokinetics of Pentostatin and 2’-deoxyadenosine. Results. A median of 5 cycles (range 2-6) was administered. Ten Complete Remissions (CRs) and 8 Partial Remissions (PRs) were observed, with an overall (CR+PR) response rate of 60%. The median response duration was 38 months (95% CI: 28 to 48 months). The actuarial 3-year relapse free survival for 10 patients in CR was 57%. The 3-year overall and failure free survival rates were 71% and 23%, respectively. Toxicity was mainly hematological with grade 3-4 neutropenia in 37% and grade 3 thrombocytopenia in 7% of the cases. Conclusion. MiPPeB, as used in the present study, showed a promising activity with acceptable toxicity in patients with relapsed or unresponsive indolent NHL and resulted in durable remission. Harris et al, 2000), include different disease entities characterized by a similar clinical course, with a relatively long median survival and, usually, good response to initial therapy. A typical feature in the clinical course of patients

I. Introduction Low-grade non-Hodgkin's lymphomas (NHL) or, as they are now defined, indolent NHL (Harris et al, 1994;

63


Federico: Pentostatin combination chemotherapy in Non-Hodgkinâ&#x20AC;&#x2122;s Lympoma with indolent NHL is their tendency to relapse, with subsequent responses of progressively shorter duration (Horning, 1993). New therapeutic approaches for indolent NHL currently under investigation include (a) attempts to eradicate the disease using high-dose chemotherapy with stem cell rescue (Schouten et al, 1994; Ladetto et al, 2002) and (b) new combinations of drugs of known specific efficacy in these diseases. Fludarabine (2-fluoro-ara-AMP), 2-CdA (2chlorodeoxyadenosine) and Pentostatin (2deoxycoformicin) are new structurally similar purine nucleoside analogs (Figure 1) recently considered with increasing interest for the treatment of different lymphoproliferative disorders, including hairy cell leukemia (Chassileth et al, 1991; Ganeshaguru et al, 1991), chronic lymphocytic leukemia (Bergmann et al, 1993; Keating et al, 1998;), cutaneous T-cell lymphomas (Grever et al, 1983; Foss et al, 1994), and indolent NHL (Hoffman et al, 1994). The sensitivity of indolent NHL to purine analogs is now largely demonstrated, although the majority of studies deal with Fludarabine (Hochster et al, 1992; Redman et al, 1992) and 2-chlorodeoxyadenosine (Brugiatelli et al, 1996; Robak et al, 2001). So far, Pentostatin has been less commonly employed for the treatment of NHL (Cummings et al, 1991; Iannitto et al, 2002), although its efficacy has been well documented in other indolent lymphoproliferative disorders such as hairy cell leukemia (Grever et al, 1995), prolymphocytic leukemia (Dohner et al, 1993), Sezary Syndrome and Mycosis Fungoides (Mercieca et al, 1994). More recently a higher activity of purine analogs has been demonstrated in combination regimens (McLaughlin et al, 1994; Tobinai et al, 1995; McLaughlin et al, 1996; Flinn et al, 2000).

Considering that in patients with indolent NHL the highest therapeutic activity of purine analogs was obtained in combination regimens and, in particular, the promising results of the combination with Mitoxantrone and steroids, we designed a phase II pilot study aimed at assessing the efficacy of Pentostatin in combination with Mitoxantrone, Prednisone and Bleomycin (MiPPeB) in patients with relapsed or unresponsive indolent NHL. Bleomycin was added to the schedule in order to increase the absolute dose intensity of the regimen since this drug is characterized by very limited myelotoxicity that favors its use in combination regimens. Moreover, considering that (a) the pharmacokinetic of Pentostatin is not well described in the literature, (b) limited data are available concerning the pharmacodynamic effect of the drug, and (c) information on drug distribution would be helpful in optimizing its use in combination regimens, in 5 patients we also investigated the pharmacokinetics and pharmacodynamic effect of Pentostatin.

II. Patients and methods Between November 1997 and July 2000, 30 patients with indolent NHL, were registered for the study and scheduled to receive 6 courses of a combination of Mitoxantrone, Prednisone, Pentostatin and Bleomycin (MiPPeB). The characteristics of these patients are summarized in Table 1. Patients were eligible for the study if they presented with a diagnosis of indolent NHL (categories A-D of the Working Formulation, or lymphocytic or follicular lymphoma of the R.E.A.L. classification), had relapsed or were unresponsive to previous therapy and presented with active disease. According to the Gruppo Italiano per lo Studio dei Linfomi (GISL) criteria (Morabito et al, 2002), active phase of the disease was defined as the presence of at least one of the following signs or symptoms: presence of systemic symptoms; bulky disease (>5 cm); anemia (Hb <10 g/L) or thrombocytopenia (Plt <100.000/L); diffuse bone marrow pattern of infiltration; lymphocyte doubling time (LDT) <12 months or a doubling of the maximum diameter of at least 3 measurable sites in less than 12 months. Patients unresponsive to previous therapy could be included only in case of no treatment requirement for the last 6 months. Additional inclusion criteria were: age 18-75 years; stage II-IV; no more than 3 previous lines of chemotherapy; life expectancy >6 months; absence of history of repeated and/or severe infectious complications; absence of cardiac, renal, hepatic and respiratory failure; ECOG performance status 0-2; HBsAg negativity, HCV-RNA negative in HCV-Ab positive cases. Exclusion criteria included: severe or symptomatic restrictive or obstructive lung disease; ejection fraction less than 50%, signs or symptoms of congestive heart failure, or myocardial infarction within the past 3 months, angina pectoris, any major ventricular arrythmia, or uncontrolled blood pressure; active infections; concurrent or previous malignancy, other than non melanomatous skin cancer, surgically cured carcinoma in situ of the cervix, or a history of cancer that had not been active in the past 5 years; patients who were HIV positive or who had AIDS or ARC. The present protocol was approved by the ethical committees according to the local rules and the period. It was the responsibility of the investigator to ensure that each patient gave her/his consent in writing, prior to partecipating in this study. All completed informed consent forms were retained by the investigator.

Figure 1: The structures of deoxyadenosine (A), and the purine analogs fludarabine (B), 2-chlorodeoxyadenosine (C), and 2'deoxycoformycin (D).

64


Cancer Therapy Vol 1, page 65 Table 1. Patient characteristics.

Characteristics

B. Response assessment

No.

%

18 12

60 40

18 12

60 40

21 8 1

70 27 3

Response to treatment was assessed within four weeks after the end of the last chemotherapy. At this time, a CT-scan of the chest and abdomen/pelvis was performed together with any other instrumental investigation found to be abnormal at any previous evaluation. Complete remission (CR) was defined as the disappearance of all clinical evidence of disease and the normalization of all laboratory values and radiographs abnormal before starting treatment. Patients who achieved CR during therapy, but relapsed within 30 days after therapy had been completed, were classified as non responders. Partial remission (PR) was defined as a greater than 50% reduction in the largest dimension of each anatomic site of measurable disease for at least one month. No remission (NR) was defined as a less than 50% regression or stable or progressive disease. All early deaths due to disease progression or treatment-related toxicity were considered as treatment failure, and included in the group of NR.

15 12 3

50 40 10

Patients were considered evaluable for response assessment after at least 3 courses, unless treatment was discontinued because of disease progression or early death. Toxicity was assessed according to the WHO criteria.

22 8

73 27

27 3

90 10

26 4

33 13

10 16 4

33 54 13

17 7 6

57 23 20

9 10 11

31 33 36

Sex Male Female Age !60 years >60 years WHO performance status 0 1 2 IPI 0-1 2 Not assessable Systemic symptoms Absent Present Bulky disease No Yes Leukemic Phase No Yes Beta2-microglobulin levels High Normal Not assessed Doubling time >12 months <12 months Not assessable Previous therapy 1 2 3

Pentostatin 5 mg/m2 Prednisone 100 mg Mitoxantrone 10 mg/m2 Bleomycin 8 mg/m2

0

+6

0

time

+4

hours

hours

Day 1

Day 8

21 days

Figure 2. Treatment plan.

A. Treatment plan

Table 2. Dose modifications.

Patients received a maximum of 6 courses of the MiPPeB regimen, given every 3 weeks, in an outpatient setting according to the following schedule: Pentostatin 5 mg/m2, on days 1 and 8, at hour 0, administered as an IV infusion in 100 ml of normal saline, over 30 minutes; Prednisone 100 mg, on days 1 and 8, at hour 0, administered as an IV infusion in 50 ml of normal saline, over 15 minutes; Mitoxantrone 10 mg/m2, on day 1, at hour 6, administered as an IV infusion in 100 ml of normal saline, over 30 minutes; Bleomycin 8 mg/m2, on day 8, at hour 4, administered as an IV infusion in 100 ml of normal saline, over 15 minutes (Figure 2). The MiPPeB courses were given at 21-day intervals, provided that at the time of recycling WBC count was >4.0 x 109/L, and platelet count >100 x 109/L. If the above-mentioned criteria were not satisfied on the day of recycling, the administration of a subsequent MiPPeB course was performed according to the dose modifications rules reported in Table 2.

65

WBC

PLT

DOSES

DRUGS

>4.0 3.9 - 3.0

>100 99 - 75

100% 100% 50%

<3.0

<75

100% 0%

All Bleomycin Mitoxantrone Pentostatin Bleomycin Mitoxantrone Pentostatin


Federico: Pentostatin combination chemotherapy in Non-Hodgkin’s Lympoma It was the responsibility of the clinical investigators to ensure that all clinical record forms designed for the study were completed satisfactorily and returned to the trial office. The clinical investigator was required to sign each completed record form to signify that it represented an accurate record of the patient.

of two extranodal sites. In addition, 20% presented with systemic symptoms and 23% had LDH over the normal range. Six patients were refractory to previous therapy, 12 had a duration of CR lasting less than 12 months and 12 relapsed after more than one year of CR. At study entry 9 patients had relapsed after first line therapy, and 21 had received two or more chemotherapy regimens before MiPPeB. Seven patients had already received a purine analog (Fludarabine), in 6 cases combined with an anthracycline which in 4 of those cases, consisted of Mitoxantrone. Finally, one patient was in relapse after high dose therapy with stem cell rescue. Median time between initial diagnosis and inclusion in the present study was 46 months (range 10-110 months). The disease history lasted less than one year, 1-3 years, and more than 3 years in 6, 12 and 12 patients respectively. The mean interval between last therapy and study entry was 18 months (range 4-46 months); this interval was less than one year in 12 patients (40%), and more than one year in the remaining 18 cases. A total of 152 courses were administered to the 30 patients. The median number of cycles was 5 (range 2 to 6) and the median interval between cycles was 26 days (range 19 to 70). Twentyeight patients completed at least 3 courses and 18 received all the 6 planned courses. Reasons for early withdrawal and status at that time are summarized in Figure 3. The main reason for interrupting planned therapy was progressive disease (6 patients) or unsatisfactory response (3 patients). However, four patients stopped therapy while in CR after 3, 4, 5, 5 courses, respectively, because of poor patient compliance.

C. Statistical analysis This was a prospective, open label, multicenter, phase II pilot study to assess the feasibility, safety, tolerability and efficacy of a Pentostatin-based regimen in patients with relapsed indolent NHL. The sample size was small and no statistical hypothesis testing was planned. The trial size was based on feasibility and was chosen for practical rather than statistical considerations in order to obtain information for planning a possible phase III study. Main endpoints were: complete remission, duration of remission, disease free survival. Secondary endpoint was overall survival. All data were analyzed with the Statistical Package for the Social Sciences (SPSS), release 9.0.1. Differences in CR rates between the groups were analyzed by the Pearson’s C2 test for contingency tables. Overall survival (OS), disease free survival (DFS) and relapse free survival (RFS) curves were estimated by the method of Kaplan-Meier. Overall survival was calculated from the beginning of treatment until death from any cause. DFS and RFS were calculated from the end of induction therapy to the first evidence of disease. Response rates, survival, relapse and toxicity were analyzed on all patients. A p value of 0.05 (two-sided) was considered the limit of significance for all the analyses.

D. Pharmacokinetic/pharmacodynamic study of Pentostatin In addition to the clinical trial, 5 of the 30 patients were enrolled in a pharmacokinetic/pharmacodynamic study of Pentostatin.

A. Response With MiPPeB, 10 patients (33%) (95% CI: 16% to 50%) achieved a CR and an additional 8 patients (27%) (95% CI: 11% to 43%) a PR, with an overall response rate of 60% (95% CI: 43% to 76%). In addition, 7 (23%) (95% CI: 8% to 39%) cases showed a durable stable phase of the disease after treatment. The objective response rate was similar for patients with early or late relapse (p=0.247), and for those with one or more previous therapies (p=0.602). After a median follow-up of 30 months (39 months for patients still alive) 6 patients out of 10 in CR relapsed. The 3-year RFS is 57% (95% CI: 27 to 52) (Figure 4). The median duration of remission for 18 responding patients was 38 months (range 2 - 57), better than the median duration of the last response (21 months, range 6-36 months). Nine patients died, all of them because of disease progression. The 3-year survival rate for the 30 enrolled patients is 71% (Figure 5). Among baseline patients’ characteristics of potential prognostic value only a short doubling time was associated with a significantly lower chance of achieving a response to MiPPeB therapy (P=0.047). Moreover, performance status (P=0.0192), number of previous therapies (0.0001), and beta2-microglobulin (0.0174), resulted of prognostic relevance in univariate analysis of survival. Given the limited number of cases a multivariate analysis was not performed.

Heparinized plasma samples were obtained at baseline (before the administration of Pentostatin) and at 5, 15, 30, 60 min, 2, 3, 6, 12, 18, 24, 48, and 72 hours after drug dose in five patients, three on day 1 and two on day 8 of treatment. Plasma concentrations of Pentostatin (Danesi et al, 2002) and 2’deoxyadenosine (Koller et al, 1980) were assessed by specific high-performance liquid chromatography (HPLC) methods with ultraviolet detection. Intra- and inter-assay precision (coefficients of variation) were <10.1% for Pentostatin and <9.4% for 2’deoxyadenosine. Individual plasma concentration vs. time data were fitted using non-linear least-squares regression analysis by means of computer software (MWPHARM, MediWare, Groeningen, the Netherlands) and peak plasma concentration, terminal half life, total body clearance and apparent volume of distribution at steady state were calculated by conventional methods (Rowland and Tozer, 1995).

III. Results Between November 1997 and July 2000, 30 patients were registered for the study and all were assessable for response and toxicity. The median age was 57 years (range 36 - 72), with 18 patients younger than 60 years. Among the remaining clinical features at presentation, it should be noted that 76% had advanced (stage III or IV) disease, 13 (43%) had non follicular histology, and 5 (17%) had the involvement 66


Cancer Therapy Vol 1, page 67

Figure 5. Kaplan Meier Overall survival.

B. Toxicity Toxicity was rather mild, especially considering that the majority of cases were heavily pretreated. No significant organ toxicity was reported. As expected in a pretreated patient setting, toxicity was mainly hematological consisting of frequent although not severe leucopenia and in few instances thrombocytopenia. Leucopenia was not associated with severe infection occurrence.

C. Pentostatin pharmacokinetic /pharmacodynamic study Mean peak plasma concentrations of Pentostatin and 2’-deoxyadenosine were 7±2.6 µM and 68±23 µM, respectively, while mean baseline 2’-deoxyadenosine levels were 4.1±1.9 µM. Plasma concentration-time curves showed a first-order elimination with biphasic decay, with a terminal half life of Pentostatin of 8.7±3.1 hours. Average total body clearance (CLTB) of Pentostatin was 103.45±22.4 mL/min and apparent volume of distribution at steady state (Vdss) was 42.4±7.

Figure 3. Flow-chart of the study.

V. Discussion One of the main features of the clinical course of indolent lymphomas is represented by its continuous pattern of relapse with subsequent responses of shorter and shorter duration after conventional chemotherapy (Horning SJ, 1993). So far, this clinical behavior has not been changed by the introduction of purine analogs and immunotherapy with monoclonal antibodies. Some more durable responses have been reported after high dose chemotherapy with stem cell rescue (Schouten et al, 1994; Ladetto et al, 2002) although this treatment approach cannot be used in the vast majority of cases. Therefore, keeping in mind this unavoidable tendency to relapse, it would be advisable to design a long-term treatment program for each patient by choosing among the different treatments now available for this histological category.

Figure 4. Kaplan Meier Relapse-free survival.

67


Federico: Pentostatin combination chemotherapy in Non-Hodgkinâ&#x20AC;&#x2122;s Lympoma Therefore, the present study introduces the combination of Pentostatin with Mitoxantrone and Bleomycin among the effective therapeutic options suitable for patients with advanced indolent lymphomas. Previously, the activity of purine analogs as single agents has been clearly demonstrated. In patients with relapsed or recurrent indolent NHL the response rate to Fludarabine ranges between 43% and 70% (Hochster et al, 1992; Hoffman et al, 1994). Similar results have been reported for 2-CdA. In a group of 14 patients unresponsive to previous treatments, 3 CR and 4 PR have been reported by Brugiatelli et al. (1996) in a multicentric study. In a preliminary study of 26 patients with untreated indolent NHL Emanuele et al (1994) reported 35% and 54% CR and PR respectively. As far as Pentostatin is concerned an overall response rate of 29% and 33% has been reported in patients with relapsed or refractory indolent NHL by Cummings et al (1991), and Duggan et al (1990), respectively. These two studies using Pentostatin as salvage treatment demonstrate the possibility of obtaining clinical responses, up to more than 50 months in patients with NHL. The higher efficacy of Fludarabine in combination with Mitoxantrone as compared with its use as single agent has been repeatedly reported with response rates up to 90%, when used as first line and salvage treatment respectively (McLaughlin et al, 1994; Seymour et al, 2001). Using Fludarabine, Mitoxantrone and Dexamethasone (FND), McLaughlin et al (1996) achieved an overall response rate of 94% (47% CR and 47% PR) in a group of 51 patients with recurrent or refractory indolent NHL. Although all purine analogs could exert similar effectiveness, so far, the clinical experience with 2-CDA and Pentostatin for the treatment of lymphomas (Cummings et al, 1991; Brugiatelli et al, 1996; Iannitto et al, 2002) is much more limited as compared to Fludarabine. At the moment their use is almost completely confined to the treatment of hairy cell leukemia (Grever et al, 1995) and in the case of Pentostatin of T-cell neoplastic diseases as a single agent (Mercieca et al, 1994). More recently, the combination of Pentostatin with Cyclophosphamide or Chlorambucil has been reported with promising results (Goodman, 2000; Waselenko et al, 2000; Weiss, 2000). Based on the known efficacy of the combination of Fludarabine and Mitoxantrone and on in vitro data of synergism of the latter one with Pentostatin (Morabito et al, 1997), we designed the present MiPPeB schedule in order to take advantage of the synergistic effect of the two drugs, possibly potentiated by the addition of a third nonmyelotoxic drug, namely Bleomycin. In addition, we tried to maximize the synergistic effect of the combination by using a time-dependent scheme of administration which could respect the biological properties of the different drugs, similar to the schedules employed for the treatment of acute leukemias.

The results of the present study performed on heavily pretreated patients show that MiPPeB combination chemotherapy induced an overall response rate of 60% with 33% CR, thus at least comparable to the results obtained with the combination of Fludarabine and Cyclophosphamide (Flinn et al, 2000) or Fludarabine and Mitoxantrone (McLaughlin et al, 1994; McLaughlin et al, 1996; Seymour et al, 2001). The efficacy of this combination is confirmed by the duration of response which is similar that obtained in our patients by the previous treatment. It is noteworthy that out of 7 cases already treated with Fludarabine mostly in combination with Mitoxantrone 2 CR were obtained and 2 cases reached a stable disease status, thus suggesting the possibility of effectively using both purine analogs during the course of the disease. Moreover, the toxicity profile of the MiPPeB schedule deserves a comment. The main side effect was myelotoxocity, but, despite frequent episode of neutropenia, purine analog-induced immunedepression and heavy pretreatment, often including another purine analog, infectious complications were not frequent and never severe. Only one death due to infection occurred in a patient with disease progression. Finally, the pharmacokinetic and pharmacodynamic studies demonstrated that at the present dosing schedule, Pentostatin reaches effective ADA inhibitory levels in plasma, as shown by the increase in 2â&#x20AC;&#x2122;-deoxyadenosine concentrations over baseline levels; in addition to this, the Vdss value lower than total body water indicates that extensive tissue binding does not occur, while the extent of drug clearance suggests that the kidney is the main route of drug excretion from the body, as confirmed by a recent study in patients with mild renal impairment (Lathia et al, 2002). In conclusion, the results of the present study demonstrate the efficacy with acceptable toxicity of Pentostatin included in combination chemotherapy for the salvage treatment of indolent lymphomas not suitable for high dose chemotherapy approaches. Accordingly, MiPPeB or MiPPeB-like schedules deserve inclusion among the conventional chemotherapy options for this category of lymphoproliferative disorders and should be tested also in a front-line setting.

Acknowledgments The study was supported by Associazione Angela Serra per la Ricerca sul Cancro, Modena, and Fondazione Ferrata-Storti, Pavia, Italy.

Participating institutions Gruppo Italiano per lo Studio dei Linfomi (GISL) Chairpersons: M. Federico, P. G. Gobbi, L. Baldini. List of Institutions contributing to the present study: Dipartimento di Ematologia e Trasfusionale (F. Nobile), Presidio Ospedali Riuniti "Bianchi, Melacrino, Morelli", Reggio Calabria; Cattedra e Servizio di Ematologia (A. T. Maiolo, L. Baldini), IRCCS Ospedale

68


Cancer Therapy Vol 1, page 69 Cyclophosphamide for the treatment of refractory autoimmune disorders. Semin Oncol 27 (2 suppl 5), 67-71. Grever M, Kopecky K, Foucar MK, Head D, Bennett JM, Hutchison RE, Corbett WE, Cassileth PA, Habermann T and Golomb H (1995) Randomized comparison of Pentostatin versus interferon alfa-2a in previously untreated patients with Hairy Cell Leukemia, an intergroup study. J Clin Oncol 13 , 974-982. Grever MR, Bisaccia E, Scarborough DA, Metz EN and Neidhart JA (1983) An investigation of 2'- deoxycoformicin in the treatment of cutaneous T-cell lymphoma. Blood 61, 279-282. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J (2000) Lymphoma classification - from controversy to consensus, the R.E.A.L. and WHO classification of lymphoid neoplasm. Ann Oncol 11, 3-10. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JK, Cleary ML, Delsol G, De Wolf- Peeters C, Falini B, and Gatter KC (1994) A revised European-American classification of lymphoid neoplasms, a proposal from the International Lymphoma Study Group. Blood 84, 1361-1392. Hochster HS, Kim KM, Green MD, Mann RB, Neiman RS, Oken MM, Cassileth PA, Stott P, Ritch P and O'Connell MJ (1992) Activity of Fludarabine in previously treated nonHodgkin's lymphoma, results of an Eastern Cooperative Group Study. J Clin Oncol 10, 28-32. Hoffman M, Tallman MS, Hakimian D, Janson D, Hogan D, Variakogis D, Kuzel T, Gordon LI and Rai K (1994) 2Chlorodeoxyadenosine is an active salvage therapy in advanced indolent non-Hodgkin's lymphoma. J Clin Oncol 12, 788-792. Horning SJ (1993) Natural history of and therapy for the indolent non-Hodgkin's lymphomas. Semin Oncol 20, 75-88. Iannitto E, Barbera V, Quintini G, Cirrincione S and Leone M (2002) Hepatosplenic "# T-cell lymphoma, complete response induced by treatment with Pentostatin. Brit J Haematol 117, 995-99. Keating MJ, O’Brien S, Lerner S, Koller C, Beran M, Robertson LE, Freireich EJ, Estey E and Kantarjian H (1998) Longterm follow-up of patients with CLL receiving Fludarabine regimens as initial therapy. Blood 92, 1165-1171. Koller CA, Stetson PL, Nichamin LD, Mitchell BS (1980) An assay of deoxyadenosine and adenosine in human plasma by HPLC. Biochem Med 24, 179-184. Ladetto M, Corradini P, Vallet S, Benedetti F, Vitolo M, Martelli M, Brugiatelli M, Coser P, Perrotti A, Majolino I, Fioritoni G, Morandi S, Musso M, Zambello R, Chisesi T, Di Renzo N, Vivaldi P, De Crescenzo A, Gallamini A, Salvi F, Santini G, Boccomini C, Sorio M, Astolfi M, Drandi D, Pileri A and Tarella C (2002) High rate of clinical and molecular remission in follicular lymphoma patients receiving highdose sequential chemotherapy and autografting at diagnosis, a multicenter, prospective study by the Group Italiano Trapianto Midollo Osseo (GITMO). Blood 100, 1559-1565. Lathia C, Fleming GF, Meyer M, Ratain MJ, Whitfield L (2002) Pentostatin pharmacokinetics and dosing recommendations in patients with mild renal impairment. Cancer Chemoth Pharm 50, 121-126. McLaughlin P, Hagemeister FB, Romaguera JE, Sarris AH, Pate O, Younes A, Swan F, Keating M and Cabanillas F (1996) Fludarabine, Mitoxantrone and Dexametasone, an effective new regimen for indolent lymphoma. J Clin Oncol 14, 12621268. McLaughlin P, Hagemeister FB, Swan F, Jr, Cabanillas F, Pate O, Romaguera JE, Rodriguez MA, Redman JR and Keating M (1994) Phase I study of the combination of Fludarabine, Mitoxantrone and Dexametasone in low-grade lymphoma. J Clin Oncol 12, 575-579.

Maggiore, Milano; Dipartimento di Oncologia ed Ematologia (G. Torelli, M. Federico, S. Sacchi), Università di Modena e Reggio Emilia, Modena; Divisione di Medicina (G. Partesotti, G. Santacroce), Ospedale Civile, Sassuolo, Modena; Divisione di Medicina (A. Bagnulo, A. Zoboli), Ospedale S. Sebastiano, Correggio, Reggio Emilia; Divisione di Ematologia (A.M. Carella, N. Di Renzo, M. Dell’Olio), IRCCS "Casa Sollievo della Sofferenza", S. Giovanni Rotondo, Foggia; Dipartimento di Oncologia (M. Petrini, F. Caracciolo), Divisioni di Ematologia e Farmacologia, Università di Pisa; Unità Operativa di Oncologia Medica (V. Pitini), Policlinico Universitario, Messina.

References Bergmann L, Fenchel K, Jahn B, Mitrou PS and Hoelzer D (1993) Immunosuppressive effects and clinical response of Fludarabine in refractory chronic lymphocytic leukemia. Ann Oncol 4, 371-375. Brugiatelli M, Holowiecka B, Dmoszynska A, Krieger O, Planinc-Peraica A, Labar B, Callea V, Morabito F, Jaksic B, Holowiecki J, Lutz D (1996) 2-Chlorodeoxyadenosine treatment in non-Hodgkin's lymphoma and B-cell chronic lymphocytic leukemia resistant to conventional chemotherapy, results of a multicentric experience. Ann Hematol 73, 79-84. Cassileth PA Cheuvart B, Spiers AS, Harrington DP, Cummings FJ, Neiman RS, Bennett JM and O'Connell MJ (1991) Pentostatin induces durable remissions in hairy cell leukemia. J Clin Oncol 9, 243-246. Cummings FJ, Kim K, Neiman RS, Comis RL, Oken MM, Weitzman SA, Mann RB and O'Connell MJ (1991) Phase II trial of Pentostatin in refractory lymphomas and cutaneous Tcell disease. J Clin Oncol 9, 565-571. Danesi R, Petrini M, Loni L, Federico M, Riggi G, Del Tacca M (2002) Pharmacokinetics and pharmacodynamics of Pentostatin in non-Hodgkin lymphomas. Proceedings ASCO 21, 120a (abstract 479). Dohner H, Ho AD, Thaler J, Stryckmans P, Sonneveld P, De Witte T, Lechner K, Lauria F, Bodewadt-Radzun S and Suciu S (1993) Pentostatin in prolymphocytic leukemia, phase II trial of the European Organization for Research and Treatment of Cancer, Leukemia Cooperative Study Group. J Natl Cancer Inst 85, 658-662. Duggan DB, Anderson JR, Dillman R, Case D, Gottlieb AJ (1990) 2-deoxycoformycin (Pentostatin) for refractory nonHodgkin's lymphoma, a CALGB phase II study. Med Pediatr Oncol 18, 203-6. Emanuele S et al. (1994) 2-Chlorodeoxyadenosine (2-CDA) activity in patients with untreated low-grade lymphoma. Proceedings ASCO 13, 1002 (abstract). Flinn IW, Byrd JC, Morrison C, Jamison J, Diehl LF, Murphy T, Piantadosi S, Seifter E, Ambinder RF, Vogelsang G and Grever MR (2000) Fludarabine and Cyclophosphamide with Filgrastim support in patients with previously untreated indolent lymphoid malignancies. Blood 96, 71-75. Foss FM, Ihde DC, Linnoila IR, Fischmann AB, Schechter GP, Cotelingam JD, Steinberg SM, Ghosh BC, Stocker JL and Bastian A (1994) Phase II trial of Fludarabine phosphate and interferon alfa-2a in advanced mycosis fungoides and Sezary syndrome. J Clin Oncol 12, 2051-2059. Ganeshaguru K, de Mel WC, Sissolak G, Catovsky D, Dearden CE, Mehta AB, Hoffbrand AV (1991) Increase in 2',5'oligoadenylate synthetase caused by deoxycoformycin in hairy cell leukaemia Adv Exp Med Biol 309A, 65-8. Goodman M (2000) Pentostatin and high dose

69


Federico: Pentostatin combination chemotherapy in Non-Hodgkinâ&#x20AC;&#x2122;s Lympoma Mercieca J, Matutes E, Dearden C, MacLennan K and Catovsky D (1994) The role of Pentostatin in the treatment of T-cell malignancies, analysis of response rate in 145 patients according to disease subtype. J Clin Oncol 12, 2588-2593. Morabito F, Baldini L, Stelitano C, Luminari S, Frassoldati A, Merli F, Colombi M, Sabbatini R, Brugiatelli M, Federico M, for the Gruppo Italiano per lo Studio dei Linfomi (GISL) (2002) Prospective study of indolent non-follicular nonHodgkinâ&#x20AC;&#x2122;s lymphoma, validation of Gruppo Italiano per lo Studio dei Linfomi (GISL) prognostic criteria for watch and wait policy. Leuk Lymph 43, 1933-38. Morabito F, Callea I, Console G, Stelitano C, Sculli G, Filangeri M, Oliva B, Musolino C, Iacopino P, Brugiatelli M (1997) The in vitro cytotoxic effect of Mitoxantrone in combination with Fludarabine or Pentostatin in B-cell chronic lymphocytic leukemia. Haematologica 82, 560-65. Redman JR, Cabanillas F, Velasquez WS, McLaughlin P, Hagemeister FB, Swan F, Jr, Rodriguez MA, Plunkett WK, and Keating MJ (1992) Phase II trial of Fludarabine phosphate in lymphoma, an effective new agent in low-grade lymphoma. J Clin Oncol 10, 790-794. Robak T, Blonski JZ, Kasznicki M, G_ra-Tybor J, DwilewiczTrojaczek J, Boguradzki P, Konopka L, Ceglarek B, Sulek J, Kuliczkowski K, Wolowiec D, Stella-Holowiecka B, Skotnicki AB, Nowak W, Moskwa-Sroka B, Dmoszynska A and Calbecka M (2001) Cladribrine combined with Cyclophosphamide and Mitoxantrone as front-line therapy in chronic lymphocytic leukemia. Leukemia 15, 1510-16. Rowland M, Tozer TN (1995) Clinical pharmacokinetics, concepts and applications (3rd Edition). Baltimore, Williams & Wilkins. Schouten HC, Colombat P, Verdonck LF, Gorin NC, Bjorkstrand B, Taghipour G, Goldstone AH (1994) Autologous bone marrow transplantation for low-grade non-Hodgkin's Lymphoma, the European Bone Marrow Transplantation Group experience. Ann Oncol 5(suppl 2), S147-149. Seymour JF, Grigg AP, Szer J and Fox RM (2001) Fludarabine and Mitoxantrone, effective and well tolerated salvage therapy in relapsed indolent limphoproliferative disorders. Ann Oncol 12, 1455-1460. Tobinai K, Shimoyama M, Tajima K, Kozuru M, Tomonaga M, Araki K, Kasai M, Takatsuki K, Tara M, Hotta T et al (1995) Deoxycoformycin containing combination chemotherapy for adult T-cell leukemia-lymphoma (ATL), Japan Clinical Oncology Group (JCOG) Study 9109. Proceedings ASCO 14, A1217 (meeting abstract). Waselenko JK, Grever MR, Beer M, Lucas MA, Byrd JC (2000) Pentostatin (Nipent) and Chlorambucil with granulocytemacrophage colony-stimulating factor support for patients with previously untreated, treated and Fludarabine-refractory B-cell chronic lymphocytic leukemia. Semin Oncol 27 (2, suppl 5), 44-51. Weiss MA (2000) A phase I and II study of Pentostatin (Nipent) with Cyclophosphamide for previously treated patients with chronic lymphocytic leukemia. Semin Oncol 27 (2 suppl 5), 41-43.

Dr. Federico Massimo

70


Cancer Therapy Vol 1, page 71 Cancer Therapy Vol 1, 71-79, 2003.

Chemotherapy in elderly patients with advanced breast cancer Review Article

Giuseppe Colantuoni, Antonio Rossi, Carmine Ferrara, Dario Nicolella, Filomena Del Gaizo, Ciro Guerriero, Giuseppe Airoma, Maria Luisa Barzelloni, Paolo Maione, Vincenzo Salerno1, Cesare Gridelli* U.O. Oncologia Medica, Azienda Ospedaliera “S.G. Moscati”, Avellino, Italy 1 Facoltà di Medicina e Chirurgia, Università “Federico IIÆ”, Napoli, Italy

__________________________________________________________________________________ *Correspondence to: Cesare Gridelli, M.D.; U.O. Oncologia Medica; Azienda Ospedaliera “S.G. Moscati”; Via Circumvallazione, 68, 83100 Avellino; Tel +39 0825 203 573, Fax +39 0825 203 556, e-mail: cgridelli@libero.it Key words: breast cancer, single-agent chemotherapy, elderly patients, age cut-off, comorbidities and frailty, combination regimens,oral drugs, new biological agents Received: 11 April 2003; Accepted: 20 April 2003; electronically published: April 2003 Contributed by Cesare Gridelli

Summary Breast cancer arises in about 48% of patients older than 65 years and more than 30% occurs in those over 70 years. Chemotherapy is administered to elderly patients with advanced breast cancer resistant to hormonal treatment or with visceral metastases. Elderly patients tolerate chemotherapy poorly compared to their younger counterpart because of progressive reduction of organ function and comorbidities related to age. For this reason, the elderly have been excluded from or underrepresented in most cancer studies and in clinical practice, they often receive inadequate and untested treatments. One of the main field of clinical research is the role of new biological agents. In order to plan medical treatment in advanced breast cancer elderly patients, and to further individualise treatment choice, is mandatory to practice a comprehensive geriatric assessment that includes assessment of comorbidity, socio-economic conditions, functional dependence, emotional and cognitive conditions, an estimate of life expectancy and recognition of frailty. (The authors review the literature regarding age-specific issues in the management of advanced breast cancer elderly patients, and report their own experience in the field.) Program show an increase of patients diagnosed with breast cancer and having 65 years or older from 37% in 1973 to 46.7% in 1995 (Surveillance, Epidemiology and End Results (SEER) Program 1998). Breast cancer arises in about 48% of patients older than 65 years and more than 30% occurs in those over 70 years. Breast cancer mortality is declining by 8% in the US and 3% in Europe, although the decline is smaller in elderly patients than in younger ones, and thus leaving open questions on diagnosis and treatment approaches (Levi et al 2001). Chemotherapy is indicated in elderly patients with advanced breast cancer resistant to hormonal treatment or with visceral metastases. Anyway, physicians are less likely to offer chemotherapy to their older breast cancer patients presumably because of perceived poorer tolerance, greater risks associated with myelosuppression, and reduced efficacy compared with younger patients. When given the option, older women are less likely to

I. Introduction Ongoing epidemiologic research over the past several decades has consistently confirmed a continuing trend toward an aging population. The over-65 age group is growing faster than other age groups, and therefore accounts for an increasing percentage of the total population. The portion of the population older than 65 rose from approximately 8% in 1950 to 13% in 1990. By the year 2030, fully 20% of the population will be older than 65 (Yancik, and Lies 2000). Increasing age is a major risk factor for developing breast cancer, peaking at about age 75 and then declining slightly. The prevalence and incidence of breast cancer in older women may increase by 30% over the next decade if the expansion of the older population continues at the present rate (Klimmick and Balducci 2000). Breast cancer in the elderly has attracted considerable interest in the recent years. Data from the Surveillance, Epidemiology and End Results (SEER) 71


Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer accept chemotherapy presumably because of concerns regarding subjective side effects such as alopecia, nausea and vomiting (Busch et al 1996). Nonetheless, due to physiologic reduction of functional organ reserve and presence of comorbid conditions, elderly patients are often unsuitable for a standard polichemotherapy as used in their younger counterpart. Consequently, they are usually excluded from clinical trials as well. Elderly patients with advanced breast cancer (ABC) frequently suffer from tumour-related symptoms and need some kind of palliative treatments. In clinical practice, they often receive inadequate and untested treatments (Fentiman et al 1990; Monfardini and Yancik 1993). This article explores age-specific issues of the management of ABC in older women, and the authors report their own experience in this setting.

system, the renal or hepatic system, and any other major organ system. These conditions are usually chronic rather than self-limiting or acute and easily treated. Comorbidity, like impaired functional status, is a key negative prognostic factor in elderly patients with cancer and it can also adversely affect the patientâ&#x20AC;&#x2122;s functional status. Another important issue is the definition of frail elderly persons. With the expansion of the older population, the number of frail elderly and frail elderly with cancer is expected to rise. According to a conservative estimate, approximately 400.000 frail elderly in United States are affected by some form of cancer at any given time. Moreover, frailty is not equivalent to near death in fact, the average life expectancy of a frail person is in excess of 2 years (Balducci and Stanta 2000; Balducci and Exterman 2000). The frailty is a condition in which most functional reserve is exhausted. Frail patients are those who depend on others for the activities of daily living prevalently because of physical and cognitive dysfunction. Generally in these group of patients chemotherapy should be avoided. Reliable information regarding patient comorbid health problems is mandatory in order to plan an appropriate treatment. However, to date, a standard, fully satisfactory way to assess comorbidity has not been defined (Yancik et al 2001). A better understanding of the effects of chemotherapeutic agents on older patients and increased knowledge of pharmacokinetic data will help to determine their appropriate use in the elderly (Litchman and Villani 2000). In order to plan medical treatment in ABC elderly patients, and to further individualise treatment choice, is mandatory to practice a comprehensive geriatric assessment (CGA). The CGA includes assessment of comorbidity, socio-economic conditions, functional dependence, emotional and cognitive conditions, an estimate of life expectancy and recognition of frailty. The choice of the drug should be based on the evaluation of both toxicity profile of each drug and on the CGA of the patient. The basic component of CGA are presented in Table 1 (Balducci et al 2001).

II. Age cut-off Within epidemiological literature the age of 65 is usually considered as a cut-point to select elderly population. On the contrary, in clinical trials, the age of 70 is frequently used as lower limit for patients selection. A cut-off age of 75 years is less common. Indirect comparison of trials including or not patients aged 65 to 70 may be biased. A further bias may be due to the distribution of the so called â&#x20AC;&#x153;very oldâ&#x20AC;? patients, aged 80 or more (Surveillance, Epidemiology and End Results (SEER) Program 1998). Furthermore we must consider that is very difficult to establish a maximum age for chemotherapy treatment in the elderly. In clinical practice biological instead of chronological age should be considered. Unfortunately, to date, laboratory tests and geriatric evaluation are inadequate to define ageing; therefore, at the present, chronological age should be used as frame of reference for clinical trials. A cut-off of 70 years seems to be the most appropriate. In fact, 70 years of age may be considered as the lower boundary of senescence, because the incidence of age-related changes starts to increase after the age of 70 years (Balducci 2000).

III. Comorbidities and frailty IV. Literature review

The data indicate that the clinical outcome in each type of cancer is predicted not by age itself but by the degree of comorbidity and functional decline that may be present. In fact, elderly patients tolerate chemotherapy poorly because of comorbidity and organ failure. Elderly patients who are otherwise healthy can obtain the same benefits from chemotherapy as younger patients. Furthermore, older patients are as able as younger patients to tolerate chemotherapy, but their management may require more attention to supportive care. Preliminary observation on cancer patients also confirm the coexistence of other disease in elderly cancer patients (Surveillance, Epidemiology and End Results (SEER) Program 1998). Comorbidities are serious medical conditions that are not directly related to the cancer itself but involve the cardiovascular system, the respiratory

All published papers specifically addressing chemotherapy of elderly ABC patients until March 31, 2003 were searched using MEDLINE (PubMed, National Library of Medicine, Bethesda, MD, USA; used keywords: advanced breast cancer, elderly patients, chemotherapy). Therefore, all published papers in medical journals were reviewed and all abstracts presented at the last 5 years main international meetings were considered. Our literature search found 25 studies. Twelve of them have been published as abstract at main international meetings and 13 have been published as extended papers. One trial only was a phase III randomised study.

72


Cancer Therapy Vol 1, page 73

Table 1. Elements of a Comprehensive Geriatric Assessment (CGA) Parameter assessed

Elements of the assessment

Function

Performance status Activities of daily living (ADL) Instrumental activities of daily living (IADL)

Comorbidity

Number of comorbid conditions Severity of comorbid conditions (comorbidity index)

Socio-economic conditions

Living conditions Presence and adequacy of a caregiver

Cognition

Folstein mini-mental state evaluation Other tests

Emotional conditions

Geriatric depression scale (GDS)

Pharmacy

Number of medications Appropriateness of medications Risk of drug interactions

Nutrition

Mini-nutritional assessment (MNA)

Geriatric syndromes

Dementia Delirium Depression Falls Neglect and abuse Spontaneous bone fractures among 27 patients aged > 68 years; MDR and OS were 6 and 8 months, respectively. Single-agent docetaxel (TXT) has been tested in 2 different schedules: every 3 weeks and weekly. In a phase I trial 4 patients older than 70 years were treated with escalating dose of TXT (75, 85, 90, 95 and 100 mg/m2) given every 3 weeks. The authors stopped the study after the first 4 patients enrolled at the first dose-level due to toxicity and reporting no clinical response. They concluded that TXT at 75 mg/m2 and over, every 21 days, is too toxic in the elderly (Zanetta et al 2000). On the contrary, Constenia et al (1999) treated 14 elderly patients (> 65 years, six of which frail) with TXT at 75 mg/m2 and 100 mg/m2, every 3 weeks, with lenograstim support. They reported a RR of 71% with acceptable hematological toxicity. Two trials used weekly TXT. Dâ&#x20AC;&#x2122;hondt et al (2000) administered weekly TXT at the dose of 36 mg/m2 in 29 elderly or younger unfit patients, mostly heavily pretreated. The median age was 60 years and the RR was 21% with a good tolerability. In another phase II study, TXT (36 mg/m2) was administered weekly for 6 weeks in 41 elderly or poor performance status patients with ABC. The reported RR was 36% with a 72% of disease control, a median TTP of 7 months, a median OS of 13 months and with 1- and 2year actuarial survival rate of 61% and 29%, respectively. Most common toxicity was grade 3-4 fatigue occurring in 20% of patients (Hainsworth et al 2001).

The Table 2 and 3 summarised the results of single-agent and combination chemotherapy, respectively.

A. Single-agent chemotherapy Sixteen trials of single-agent chemotherapy were reported. Three trials used single-agent oral idarubicin (IDA). Chevalier et al (1990) on 30 elderly patients (> 70 years) with ABC using m2 IDA (15 mg/m2, p.o., d 1, 2, 3, every 3 weeks) reported a RR of 26% with a median duration of response (MDR) of 2.7 months. Provè et al (1998) treated 29 elderly patients failing hormonal therapy with IDA (20 mg/m2/week x 4). The Authors reported a RR of 24% with MDR of 8.5 months and mild toxicity consisting, mainly of myelosuppression. Toffoli et al (2000) used IDA on 10 elderly patients, at the dose of 5 mg/day and 10 mg/day every other day, for 21 days, recycled every 4 weeks. A RR of 20% was reported with severe toxicity and the Authors suggested a safer dosage of 5 mg/day for further experiences. Another trial by Chevalier et al (1992) using singleagent pirarubicin (30 mg/m2, i.v., d 1, every 3 weeks) on 31 elderly patients reported 25% RR with a median time to progression (TTP) of 3 months. Repetto et al, (1995) using mitoxantrone (MITO) (10-14 mg/m 2, i.v., d 1 every 3 weeks), reported 26% PR

73


Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer

Table 2. Phase II studies with single agent chemotherapy Author

No.pts

Age (years)

Drug

RR (%)

MTP (mos)

Chevallier, 1990

31

> 70

Idarubicin

26

2.7

Provè, 1998

29

> 65

Idarubicin

24

8.5

Toffoli, 2000

10

> 65

Idarubicin

20

-

Chevallier, 1992

30

> 70

Pirarubicin

25

3

Repetto, 1995

27

> 68

Mitoxantrone

26

6

Zanetta, 2000

4

> 70

Docetaxel

0

-

Constenia, 1999

14

> 65

Docetaxel

71

-

D’hondt, 2000

29

60*

Docetaxel

21

-

Hainsworth, 2001 Repetto, 2002

41

> 65**

Docetaxel

36

7

29

> 70

Paclitaxel

55

-

O’Shaughnessy, 1998

62

25

-

> 55

Capecitabine Vs CMF

16

-

Procopio, 2001

33 31

> 65

Capecitabine

35

-

Sorio, 1997

25

> 65

Vinorelbine

30

-

Buonadonna, 1998

38

> 65

Vinorelbine

39.5

7

Vogel, 1999

56

> 60

38

6

Rossi, 2003

24

> 70

Vinorelbine Vinorelbine

37.5

5

RR = response rate; MTP = median time to progression; *median age; **younger patients with poor performance status included.

Table 3. Studies with combination chemotherapy Author

Phase

No.pts

Age (years)

Drug

RR (%)

MTP (mos)

39

72*

Idarubicin + Cyclophosphamide

37.2

-

Kurtz, 2000

II I

19

> 65

Idarubicin + Cyclophosphamide

21

6.6

Gladieff, 1996

II

25

> 70

Mitoxantrone + vinorelbine

22

13

Mammoliti, 1996

II

24

> 65

Mitoxantrone + Levo-leucovorin + 5-fluorouracil

50

9

van Veelen, 1998

II

28

> 70

Mitoxantrone + methotrexate

39

6.8

Jagiello-Gruszfeld, 2002

II

30

> 70

Mitoxantrone + methotrexate

50

6

Bajetta, 1998

73

> 70

7

39

> 65

Doxifluridine + levo-leucovorin Paclitaxel + carboplatin

26

O’Rourke, 2002

II II

46

-

Taylor, 1986

III

181

> 65

Tamoxifen Vs CMF

45

10.4

38

7.9

Zaniboni, 1998

RR = response rate; MTP = median time to progression; CMF = cyclophosphamide, methotrexate, 5-fluorouracil; *median age

74


Cancer Therapy Vol 1, page 75 Gladieff et al (1996) in a phase II study, treated 25 women older than 70 years with the combination of MITO (10 mg/m2, i.v., d 1) plus VNR (20 mg/m2, i.v., d 1-8), both recycled every 3 weeks. The RR was 22% with a median TTP of 13 months. The dose-limiting toxicity was myelosuppression with no case of febrile neutropenia. Mammoliti et al (1996) used a combination of MITO (10 mg/m2, i.v., d 1), 5-fluorouracil (500 mg/m2, i.v., d 15-16) and levo-leucovorin (LV) (250 mg/m2, i.v., d 15-16), recycled every 4 weeks, in a phase II study on 24 patients over 65 years. The RR was 50% with a disease control of 87.5% and mild toxicity. The median PFS and OS were 9 and 14 months, respectively. Two trials investigated the combination of MITO plus methotrexate in patients aged more than 70 years. The RR reported in the 2 trials was 39% and 50% with MDR of 6.8 and 6 months and a median OS of 9 and 8 months, respectively (van Veelen et al 1998. Jagiello-Gruszfeld et al 2002). TAX–based combination regimens have been investigated in elderly women also. O’Rourke et al (2002) treated 39 elderly patients (> 65 years) with TAX 100 mg/m2 by 1-h infusion plus carboplatin AUC 2, on days 1, 8 and 15 every 4 weeks. The RR was 46% with a median OS of 13 months. Grade 3-4 neutropenia in 33% of cases and a grade 3-4 neuropathy in 18% of patients was reported. Beex et al (1992) treated 23 elderly patients (> 70 years) using 100% (in 10 cases) and 75% (in 13 cases) of the standard dose of CMF regimen. Results were similar in both groups and superimposible to those commonly reported with standard CMF. These results seem to suggest that the CMF dose could not exceed 75% of the standard dose in the elderly. Taylor et al treated 181 patients over 65 years with either tamoxifen or CMF in a randomised crossover study. Response rate was 45% with tamoxifen and 38% with CMF, with MDR of 10.4 and 7.9 months, respectively. The authors concluded that starting with hormonal therapy rather than CMF chemotherapy could be justified in elderly patients while polichemotherapy, however, is safe and active after hormonal treatment failure (Taylor 4th et al 1986). Bajetta et al (1998) treated 73 women (> 70 years) with doxifluridine (600 mg/m 2/b.i.d., p.o., d 1, 2, 3, 4) and LV (25 mg/b.i.d., p.o., d 1, 2, 3, 4), both given orally, recycled every 12 days. The OR was 26% with MDR and OS of 7 and 24 months, respectively. The treatment was very well tolerated and side effects were manageable and always reversible.

Paclitaxel (TAX) was administered weekly (80 mg/m2, i.v. day 1, 8 and 15 every 4 weeks), in a phase II study, in 29 elderly patients with ABC. The reported results were 3 complete and 13 partial responses for an overall RR of 55% with mild toxicity (Repetto et al 2002). Two studies with capecitabine were reported. O’Shaughnessy et al randomised patients in a phase II trial to capecitabine (2510 mg/m2/b.i.d., p.o., days 1 to 14, every 3 weeks) or CMF (cyclophosphamide, methotrexate and 5-fluorouracil). The study accrued 95 women aged > 55 years. Objective response was 25% for capecitabine and 16% for CMF with a median TTP of 132 days and 94 days, respectively. The authors concluded that home-based monotherapy with capecitabine shows at least comparable efficacy to CMF (O’Shaughnessy et al 1998). Procopio et al (2001) treated 40 women older than 65 years with capecitabine (2500 and than 2000 mg/m2/b.i.d., p.o., day 1 to 14, every 3 weeks). They reported RR of 35% with a median TTP of 6 months, one patient died due to gastrointestinal toxicity among 31 evaluable patients. Four studies reported on single-agent vinorelbine (VNR) in the treatment of elderly patients with ABC (Sorio et al 1997; Buonadonna et al 1998; Vogel et al 1999; Rossi et al 2003). Sorio et al (1997) treated 20 patients (> 65 years) with VNR at the dose of 30 mg/m2, i.v., as first-, second- and third-line therapy, on days 1 and 8 every 3 weeks, reporting 30% OR. Buonadonna et al (1998) reported 39.5% RR with MDR of 7 months and a disease control of 60.5%. The schedule of VNR used was 25 mg/m2, on days 1 and 8, every 3 weeks. Median age was 70 years and about 40% of patients were treated as second-line therapy. Vogel et al (1999) reported a RR of 38% with MDR of 9 months and a disease control of 76%. VNR was administered at the dose of 30 mg/m2, weekly for the first 13 weeks and then every 2 weeks. Median dose intensity of VNR was 20.6 mg/m2/week. Recently, Rossi et al (2003), treated 24 elderly ABC patients with VNR 30 mg/m2, i.v. day 1 and 8, every 3 weeks. Nine (37.5%) objective responses (2 complete and 7 partial responses) were observed with MDR and survival of 7 and 11 months, respectively. VNR given on day 1 and 8, recycled every 3 weeks, has a very similar dose-intensity and seems to be better tolerated as compared to weekly administration.

B. Combination regimens Among polichemotherapy trials, 2 included treatment with anthracyclines. Zaniboni et al (1998) used an oral regimen with IDA plus cyclophosphamide (CTX) in 39 heavily pretreated breast cancer elderly patients. The treatment was well tolerated with a 37.2% RR. Kurtz et al performed a phase I trial using a fixed dose of CTX (200 mg/m2/day, p.o., d 1, 2, 3) and an increasing dose of IDA (10 mg/m2/day, p.o., d 1, 2, 3), recycled every 3 weeks, both administered orally. Nineteen patients were treated with myelosuppression as dose-limiting toxicity and maximum tolerated dose reached at 12 mg/m 2/day. Among 14 patients, 4 (21%) achieved a PR with MDR of 6.6 months (Kurtz et al 2000).

V. New Directions Our literature review showed an increasing interest for oral drugs. In 8 out of the 25 reported studies the Authors used an oral drug formulation. In the future novel biological agents should be an interesting new approach. The use of oral drugs in this setting as well is of great interest.

75


Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer pharmacokinetics of oral VNR is not altered in older patients who presented similar bioavalability and at least comparable inter-individual variability to younger patients (Puozzo et al 2001). Based on these data studies of oral VNR in ABC elderly patients are warranted.

A. Oral drugs Patientâ&#x20AC;&#x2122;s preferences and quality of life issues, which are becoming central considerations in palliative treatment regimens, request the development of oral drugs administration. Indeed, a work has suggested that i.v. lines were a major source of discomfort and stress for cancer patients and approximately 90% of them expressed a preference for oral versus i.v. chemotherapy, predominantly because of the convenience of administration outside a clinical setting or current concerns or previous problems with i.v. access (Liu et al 1997). For the mentioned reasons, if equivalent safety and efficacy can be demonstrated, the oral drugs formulation provides more convenience for patients; this added convenience may be particularly important in elderly and unfit patients. Anyway, the majority of drugs administered orally are intended to act systematically, and for these, absorption is a prerequisite for activity. Delays or losses of the drug during absorption may contribute to variability in the drug response, and occasionally, may result in the treatment failure. An ideal chemotherapeutic drug would have little interpatient variability in absorption and time curve (AUC) and, more importantly, little intrapatient variability with successive doses (DeMario and Ratain 1998). In the present review, capecitabine is an interesting oral drug. Capecitabine is a selectively tumor activated fluoropyrimidine which is effective in a wide range of solid tumors, particularly in breast and colon cancer. In the two reported studies, capecitabine was active and well tolerated in the treatment of ABC elderly patients (Oâ&#x20AC;&#x2122;Shaughnessy et al 1998; Procopio et al 2001). Based on the available data and our experience as well, VNR seems to be one of the most active singleagent. Bonneterre et al. conducted a dose-finding phase I study in advanced breast cancer patients. Three dose levels were evaluated on a weekly regimen basis: 60, 80 and 100 mg/m2. Twenty-seven patients were enrolled in the study and the maximum tolerated dose was 100 mg/m2 with a dose-limiting toxicities being neutropenia, nausea /vomiting and neuroconstipation. The recommended dose of oral VNR for further trials was defined at 80 mg/m2 /week. The activity was observed at 80 and 100 mg/m2 (Bonneterre et al 1996). Following these results, the absolute bioavailability of oral VNR was determined in 24 patients receiving oral administration at 80 mg/m2 or i.v. VNR at 25 mg/m2 one week apart in a cross over design. The bioavailability factor calculated on blood exposure (AUC) was 43 + 14%. When data from the population pharmacokinetic analysis is taken into account (including all the patients from phase I studies) the bioavailability factor is 36 + 10% and this has formed the justification for a pragmatic use of about 40% as the basis for clinical equivalence studies. Based on these results the oral dose of 80 mg/m2 was demonstrated to correspond to 30 mg/m2 of the i.v. formulation and 60 mg/m2 oral to 25 mg/m2 i.v. (Marty et al 2001). Recently, a trial performed in elderly patients with advanced non small cell lung cancer, demonstrated that the

B. New biological agents The numerous molecular mechanisms implicated in the pathogenesis of breast cancer present exciting avenues for target-specific approaches to therapy. Based on the current data, the inhibitors of cell signalling seem to be the most promising class of agents for the treatment of breast cancer. Her-2/neu, a member of the group I growth factor receptor family, is a tyrosine-kinase membrane receptor that, when activated, induces a phosphorylation cascade in cytoplasmic kinases leading to increased transcription of nuclear proteins and cellular growth. It is amplified and/or overexpressed in 20% to 30% of patients with breast cancer (Press et al 1990). Overexpression of this oncogene product is associated with increased rates of tumour growth, enhanced rates of metastasis, shorter disease-free survival, and overall survival (Slamon et al 1989; Press et al 1990; Liu et al 1995). Patients with HER-2/neuoverexpressing tumours have more aggressive and more malignant courses. HER-2/neu has been targeted by monoclonal antibodies, immunoconjugates, vaccines, antibody-directed enzyme prodrug therapy, antisense therapy and gene therapy (Hortobagyi 1990). Trastuzumab is a humanized monoclonal antibody against the extracellular domain of HER-2/neu (Hudziak et al 1989). As a single agent, trastuzumab resulted in 15% objective response in ABC, as second-line treatment (Cobleigh et al 1999). Trastuzumab is well tolerated, lowgrade fever, chills, fatigue and constitutional symptoms occur primarily with the first infusion and serious adverse effects are infrequent (Hortobagyi 1999). Trastuzumab has been showed well tolerated in elderly women (> 60 years) with HER-2-positive ABC and produces significant benefits added to chemotherapy (Fyfe et al 2001). The EGFR (Epidermal Growth Factor Receptor), another member of the group I growth factor receptor family, is a 170 kDa transmembrane glycoprotein that consists of an extracellular domain, a hydrophobic transmembrane domain and an intracellular region containing the tyrosine kinase domain. The EGFR exists as inactive monomers, which dimerize after ligand activation. This causes homodimerization or heterodimerization between EGFR and another member of the erb receptor family. After the ligand binding, the tyrosine kinase intracellular domain of the receptor is activated, with autophosphorylation of the intracellular domain, which initiates a cascade of intracellular events. Several studies have demonstrated that EGFR-mediated signals also contribute to other processes that are crucial to cancer progression, including angiogenesis, metastatic spread, and inhibition of apoptosis (Ciardiello and Tortora 2001). ZD1839, a synthetic anilinoquinazoline, is a p.o. 76


Cancer Therapy Vol 1, page 77 active, selective reversible inhibitor of EGFR tyrosine kinase. Recently, 2 phase II trials tested ZD1839 in ABC patients. Robertson et al (2002) treated with ZD1839 500 mg, 22 patients with either ER-negative or ER-positive breast cancer that became clinical resistant to tamoxifen. The median age was 61 years (range 32-85 years). The Authors reported a partial response in 9% of patients. Albain et al, (2002) treated with an oral daily 500 mg dose of ZD1839 until disease progression, intolerable disease or consent withdrawal, 63 pretreated ABC patients (ages 3480 years) with interesting results. The use of oral drugs as well among new biological agents is of great interest.

peculiar patient population. In conclusion, chemotherapy is feasible and active in ABC elderly patients resistant to hormonal therapy or with visceral metastases. Considering that the most part of these patients need to be treated with chemotherapy, large randomised phase III trials, including quality of life evaluation, are warranted.

References Albain K, Elledge R, Gradishar WJ, Hayes DF, Rowinsky E, Hudis C, Pustzai L, Tripathy D, Modi S, and Rubi S (2002). Open-label, phase II, multicenter trial of ZD1839 (â&#x20AC;&#x2DC;Iressaâ&#x20AC;&#x2122;) in patients with advanced breast cancer. Breast Cancer Res Treat 76 (suppl 1), 20 (abstr). Bajetta E, Biganzoli L, Carnaghi C, Di Bartolomeo M, Spagnoli I, Cassata A, Galante E, Mariani L, Stampino CG, and Buzzoni R (1998). Oral doxifluridine plus levoleucovorin in elderly patients with advanced breast cancer. Cancer 83, 1136-1141. Balducci L, and Stanta G (2000). Cancer in the frail patient: a coming epidemic. Hematol Oncol Clin North Am 14, 235250. Balducci L, and Exterman M (2000). Management of the frail person with advanced cancer. Crit Rev Oncol Hematol 33, 143-148. Balducci L (2000). Geriatric oncology: challenge for the new century. Eur J Cancer 36, 1741-1754. Balducci L, Extermann M, and Carreca I (2001). Management of breast cancer in the older woman. Cancer Control 8, 431441. Beex LV, Hermus AR, Pieers GF, van Hoesel QG, Nooy MA, and Mignolet F (1992). Dose intensity of chemotherapy with cyclophosphamide, methotrexate and 5-fluorouracil in the elderly with advanced breast cancer. Eur J Cancer 28, 686690. Bonneterre J, Chevalier B, and Le Bras F (1996). Phase I clinical trial of oral vinorelbine (VRL) in patients (PTS) with advanced breast cancer (ABC): preliminary results. Breast Cancer Res Treat 41, 505. Buonadonna A, Crivellari D, and Frustaci S (1998). Vinorelbine (VRL) as palliative treatment in elderly patients (PTS) with metastatic breast cancer. Final results. Proc 8th International Congress on Anti-Cancer Chemotherapy P103 (abstr). Busch E, Kemeny M, Fremgen A, Osteen RT, Winchester DP, and Clive ER (1996). Patterns of breast cancer care in the elderly. Cancer 78, 101-111. Chevalier B, Monnier A, Metz R, Namer M, Marty M, Roche H, Bastit P, and Hurteloup P (1990). Phase II study of oral idarubicin in elderly patients with advanced breast cancer. Am J Clin Oncol 13, 436-439. Chevalier B, Mignot L, Delozier T, Morvan F, Ferme C, and Herait P (1992). Phase II study of tetrahydropyranyl adriamycin (pirarubicin) in elderly patients with advanced breast cancer. Am J Clin Oncol 15, 395-398. Ciardiello F, and Tortora G (2001). A novel approach in the treatment of cancer: targeting the Epidermal Growth Factor Receptor. Clin Cancer Res 7, 2958-2970. Cobleigh MA, Vogel CL, Tripathy D, Robert NJ, Scholl S, Fehrenbacher L, Wolter JM, Paton V, Shak J, Lieberman G, and Slamon DJ (1999). Multinational study of the efficacy end safety of humanized anti-HER2 monoclonal antibody in women who have HER2-overexpressing metastatic breast

VI. Conclusions The treatment of elderly patients is an emerging issue. Unfortunately, among the published studies, one only is a randomised phase III trial while several phase II trials have been performed. The most part of the studies enrolled elderly patients with a cut-off age ranging from 60 to 65 years old, probably not representative of real elderly population. Many referenced studies included in the same series patients treated as first-, second- and third-line chemotherapy confounding the reported results. Some of the cited trials used anthracycline-based chemotherapy. It is widely believed that the incidence and severity of toxic effects from anthracyclines are greater in older patients than in younger ones, and clinical experience often reinforces this belief. Anyway, Ibrahim et al confirmed the possibility to administer anthracyclines in elderly women with ABC. They performed a retrospective analysis on 1011 women over 65 years (24%) or 50-64 years, all treated with a doxorubicin-based chemotherapy. Although OR was higher for the younger patients (67% versus 51%, p = 0.001), no significant difference in terms of doseintensity, TTP, OS and toxicity was observed (Ibrahim et al 1996). While the response to chemotherapy and clinical outcome are certainly poorer in elderly patients with chronic comorbidity than in younger and healthier patients, the evidence to date suggests that the benefits and toxic effects of chemotherapy in otherwise-healthy older patients are comparable to those in younger patients. Age is not predictive of treatment failure and chemotherapy is not necessarily less effective or less tolerable in older patients. Based on the described studies, single-agent chemotherapy seems to determine superimposible results as compared to polichemotherapy. To date even if there is no specifically randomised study, single-agent chemotherapy probably might be considered the standard treatment for ABC in the elderly. Great interest is for oral drugs if well tolerated and usually with a good patientâ&#x20AC;&#x2122;s compliance. One of the main research-line to explore is the introduction of new biological agents in the treatment schemes. In fact, if new biological agents proved to be effective in the treatment of ABC, therapeutic strategies in the elderly could include a very useful tool, considered their excellent toxicity profile, very suitable for this 77


Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer cancer that has progressed after chemotherapy for metastatic disease. J Clin Oncol 17, 2639-2648. Constenia M, Carrete N, Lorenzo I, Garcia-Arroyo FR, Campos B, Rey C, and Ozores R (1999). Docetaxel (TXT) monotherapy & lenograstim (G-CSF) for advanced breast cancer in the elderly. Eur J Cancer 35 (suppl 4), S323 (abstr 1298). DeMario MD, and Ratain MJ (1998). Oral chemotherapy: rationale and future directions. J Clin Oncol 16, 2557-2567. D’hondt R, Paridaens R, Wildiers J, and Thomas J (2000). Weekly docetaxel in aged or frail metastatic breast cancer patients: toxicity profile and activity. Ann Oncol 11 (suppl 4), 72 (abstr 319PD). Fentiman IS, Tirelli U, Monfardini S, Schneider M, Festen J, Cognetti F, and Aapro MS (1990). Cancer in the elderly: why so badly treated? Lancet 28, 1020-1022. Fyfe G, Mass R, Murphy M, and Slamon D (2001). Older (age > 60 years) patients obtain survival benefit from herceptin plus chemotherapy. Eur J Cancer 37 (suppl 6), S189 (abstr 692). Gladieff L, Houyau P, Mihura J, Martinez M, Caunes N, Chevreau C, Bugat R, and Roche H (1996). A phase II study with mitoxantrone-vinorelbine association in the treatment of advanced breast cancer in elderly women. Bull Cancer 83, 703-706. Hainsworth JD, Burris III HA, Yardley AD, Bradof JE, Grimaldi M, Kalman LA, Sullivan T, Baker M, Erland JB, and Greco A (2001). Weekly docetaxel in the treatment of elderly patients with advanced breast cancer: A Minnie Pearl Cancer Research Network phase II trial. J Clin Oncol 19, 35003505. Hortobagyi GN (1990). Options for treatment of metastatic breast cancer. ASCO Educational Book pp. 515-521. Hudziak RM, Lewis GD, Winget M, Fendly BM, Shepard HM, and Ullrich A (1989). p185HER2 monoclonal antibody has antiproliferative effects in vitro and sensitizes human breast tumor cells to tumor necrosis factor. Mol Cell Biol 9, 11651172. Ibrahim NK, Frye DK, Buzdar AU, Walters RS, and Hortobagyi GN (1996). Doxorubicin-based chemotherapy in elderly patients with metastatic breast cancer. Arch Intern Med 156, 882-888. Jagiello-Gruszfeld AI, Pienkowski T, and Giermek J (2002). The combination of mitoxantrone and methotrexate in elderly patients with advanced breast cancer. Proc Am Soc Clin Oncol 21, 259b (abstr 2855). Klimmick GG, and Balducci L (2000). Breast cancer and aging: clinical interactions. Hematol Oncol Clin North Am 14, 213-234. Kurtz JE, Deplanque G, Borel C, Mathelin C, Prevost G, Poulin G, Barats JC, Bergerat JP, Chapelle-Marcillac I, Bardonnet M, and Dufour P (2000). Dose-finding study of oral idarubicin and cyclophosphamide in first-line treatment of elderly patients with metastatic breast cancer. Ann Oncol 11, 229-230. Levi F, Lucchini F, Negri E, Boyle P, and La Vecchia C (2001). Changed trends of cancer mortality in the elderly. Ann Oncol 12, 1467-1477. Litchman SM, and Villani G (2000). Chemotherapy in the elderly: pharmacologic considerations. Cancer Control 7, 548-556. Liu Y, El-Ashry D, Chen D, Ding IJ, and Kern FG (1995). MCF7 breast cancer cells overexpressing transfected c-erbB-2 have an in vitro growth advantage in estrogen-depleted

conditions and reduced estrogen-dependence and tamoxifensensitivity in vivo. Breast Cancer Res Treat 34, 97-117. Liu G, Franssen E, Fitch MI, and Warner E (1997). Patients preferences for oral versus intravenous palliative chemotherapy. J Clin Oncol 15, 110-115. Mammoliti S, Merlini L, Caroti C, and Gallo L (1996). Phase II study of mitoxantrone, 5-fluorouracil, and levo-leucovorin (MLF) in elderly advanced breast cancer patients. Breast Cancer Res Treat 37, 93-96. Marty M, Fumoleau P, Adenis A, Rousseau Y, Merrouche Y, Robine G, Senac I, and Puozzo C (2001). Oral vinorelbine pharmacokinetics and absolute bioavalability study in patients with solid tumors. Ann Oncol 12, 1643-1649. Monfardini S, and Yancik R (1993). Cancer in the elderly: meeting the challenge of an aging population. J Natl Cancer Inst 85, 532-538. O’Rourke M, Loesch D, Robert N, Cox E, Roppolo G, and Asmar L (2002). Efficacy and tolerability of a weekly taxol (T) plus carboplatin (C) regimen in patients < 65 years versus > years with advanced breast cancer (ABC). Proc Am Soc Clin Oncol 21, 39b (abstr 1967). O’Shaughnessy J, Moiseyenko V, Bell D, Nabholtz JM, Miles D, Gorbunova V, Laws S, Griffin T, and Osterwalder B (1998). A randomized phase II study of xeloda (capecitabine) vs CMF as first line chemotherapy of breast cancer in women aged > 55 years. Proc Am Soc Clin Oncol 17, 103a (abstr 398). Press MF, Jones LA, Godolphin W, Edwards CL, and Slamon DJ (1990). HER-2/neu oncogene amplification and expression in breast and ovarian cancers. Prog Clin Biol Res 354A, 209221. Procopio G, Bajetta E, Catena L, Alù M, Longarini R, Zilembo N, La Torre I, Platania M, Della Torre S, and Dognini G (2001). Safety and activity of capecitabine in elderly patients with advanced breast cancer. Eur J Cancer 37 (suppl 6), S197 (abstr 720). Provè A, Becquart D, Dirix L, Joosen E, Vonck I, Lobelle J, Riggi M, Paridaens R, and Van Oosterom A (1998). Oral idarubicin (IDA) chemotherapy (CT) in elderly advanced breast cancer (ABC) patients (pts) failing hormonal therapy: conclusive results. Proc Am Soc Clin Oncol 17, 167a (abstr 641). Puozzo C, Gridelli C, and Jaworski M (2001). Pharmacokinetics of navelbine® in elderly patients. Tumori 88 (suppl 1), S75S76. Repetto L, Simoni C, Venturino A, Biancardi V, Gasco M, Campora E, and Rosso R (1995). Mitoxantrone in elderly women with advanced breast cancer: a phase II study. Anticancer Res 15, 2297-2300. Repetto L, Del Mastro L, Perrone F, Di Nota A, Zagonel V, Fratino L, Marenco D, Diadema MR, Lattuada S, and Rosso R (2002). Weekly paclitaxel – phase II trial in older patients with advanced breast cancer: A GIOGer study. Ann Oncol 13 (suppl 5), 105 (abstr 382P). Robertson JFR, Gutteridge E, Cheung KL, Owers R, Koehler M, and Hamilton L (2002). A phase II study of ZD1839 (‘Iressa’) in tamoxifen resistant ER-positive and endocrineinsensitive (ER-negative) breast cancer. Breast Cancer Res Treat 76 (suppl 1), 357 (abstr). Rossi A, Gridelli C, Gebbia V, Rosati G, Tortoriello A, Maione P, Borsellino N, Rossi N, Pisano A, Colantuoni G, Iaffaioli RV, Castaldo V, and Manzione L (2003). Single agent vinorelbine as first-line chemotherapy in elderly patients with advanced breast cancer. Anticancer Res in press.

78


Cancer Therapy Vol 1, page 79 Slamon DJ, Godolphin W, Jones LA, et al (1989). Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science 244, 707-712. Sorio R, Robieux I, Galligioni E, Freschi A, Colussi AM, Crivellari D, Saracchini S, and Monfardini S (1997). Pharmacokinetics and tollerance of vinorelbine in elderly patients with metastatic breast cancer. Eur J Cancer 33, 301-303. Surveillance, Epidemiology and End Results (SEER) Program (1998). Public use CD-ROM (1973-1995). Bethesda (MD): Cancer Statistics Branch; National Cancer Institute. Taylor SG 4th, Gelman RS, Falkson G, and Cummings FJ (1986). Combination chemotherapy compared to tamoxifen as initial therapy for stage IV breast cancer in elderly women. Ann Intern Med 104, 455-461. Toffoli G, Crivellari D, Magri MD, Sorio R, Spazzapan S, Lombardi D, Scuderi C, Paolello C, Boiocchi M, and Veronesi A (2000). Innovative schedule of oral idarubicin (IDA) in elderly patients with metastatic breast cancer: a phase II study. Ann Oncol 11 (suppl 4), 37 (abstr 156). van Veelen H, Tjabbes T, Bong SB, Piersma H, and Runhaar EA (1998). Mitoxantrone and methotrexate (MM) in elderly patients (pts) with metastatic breast cancer (MBC). Ann

Oncol 9 (suppl 4), 20 (abstr 93P). Vogel C, Oâ&#x20AC;&#x2122;Rourke M, Winer E, Hochster H, Chang A, Adamkiewicz B, White R, and McGuirt C (1999). Vinorelbine as first-line chemotherapy for advanced breast cancer in women 60 years of age or older. Ann Oncol 10, 397-402. Yancik R, and Lies RAG (2000). Aging and cancer in America: demographic and epidemiologic perspectives. Hematol Clin North Am 14, 17-23. Yancik R, Ganz P, Varricchio CG, and Conley B (2001). Perspective on comorbidities and cancer in older patients: approaches to expand the knowledge base. J Clin Oncol 19, 1147-1151. Zanetta S, Albrand G, Bachelot T, Ardiet CJ, Tranchand B, and Droz JP (2000). A phase I trial of docetaxel every 21 days in elderly patients with metastatic breast cancer (MBC). Ann Oncol 11 (suppl 4), 73 (abstr 322PD). Zaniboni A, Bolognesi A, Arnoldi E, Tabiadon D, Barni S, and Intini C (1998). Oral idarubicin and cyclophosphamide for metastatic breast cancer in elderly patients. Anticancer Drugs 9, 295-299.

Seated Cesare Gridelli From right Paolo Maione, Alida Barbato,Dario Nicolella, Giuseppe Airoma,Giuseppe Colantuoni, Filomena Del Gaizo, Rosa Bruno, Antonio Rossi, Carmine Ferrara.

79


Colantuoni et al: chemotherapy in elderly patients with advanced breast cancer

80


Cancer Therapy Vol 1, page 81 Cancer Therapy Vol 1, 81-91, 2003.

Drug resistance in breast cancer Review Article

Hermann Lage Humboldt University Berlin, Charité Campus Mitte, Institute of Pathology, Schumannstr. 20/21, D-10117 Berlin, Germany

__________________________________________________________________________________ Correspondence: PD Dr. H. Lage, Institute of Pathology, Charité Campus Mitte, Humboldt University Berlin, Schumannstr. 20/21, D10117 Berlin, Germany; Tel.: +49-30-450 536 045; Fax: +49-30-450 536 900; e-mail: hermann.lage@charite.de Key words: breast cancer, multidrug resistance, ABC-transporters, P-gp, MRP1, MRP2, BCRP, Major vault protein, YB-1 Received: 28 April 2003; Accepted: 06 May 2003; electronically published: May 2003

Summary Resistance to cytotoxic chemotherapy is the main cause of therapeutic failure and death in women suffering on breast carcinoma. Commonly, patients refractory to chemotherapeutic treatment regimens show resistance to multiple antineoplastic agents of different structure and mode of action, i.e. the cancerous breast tissue exhibits a multidrug resistance (MDR) phenotype. Clinical MDR of breast cancer is likely to be multifactorial and heterogenous. Several mechanisms have been identified to play a role in MDR, e.g. overexpression of various members of the superfamily of ABC (adenosine triphosphate binding cassette)-transporters have been shown to be associated with MDR in solid tumors including breast cancer. Besides the classical MDR transporter P-glycoprotein (P-gp) additional ABC-transporters such as MRP1 or BCRP have been analyzed concerning their role in clinical MDR of breast cancer. Moreover, “upstream” factors like transcription factors regulating the gene activity of ABCtransporter encoding genes, such as the Y-box transcription factor YB-1 were demonstrated to play a role in MDR of mammary carcinoma. However, since the available data are contradictorily, hitherto the clinical significance of these and various other molecules on breast cancer remains unclear. This review will discuss the current state of knowledge of MDR-associated factors and their impact on clinical MDR in breast carcinoma. HER-2/neu-postive neoplasms of the breast, the use of the monoclonal antibody trastuzumab directed against that oncoprotein (Hortobagyi, 2001; Vogel et al., 2002). For the majority of patients, the necessary treatment will probably be a combination of these pharmacological treatment options. However, here the mechanisms of drug resistance against classical cytotoxic compounds used against breast cancer will be discussed; endocrine and immunological therapy will not be within the scope of this mini overview. Biological resistance mechanisms of solid tumors against cytotoxic antitumor agents can be distinguished in (i) pharmacokinetic resistance, and (ii) cellular resistance. Important factors of pharmacokinetics include low dose metabolic inactivation, the location of tumor deposits in so-called pharmacological sanctuaries, e.g. compartments behind the blood-brain barrier, and poor penetration of drugs through the interstitial tumor tissue. However, within this mini-review merely the cellular drug resistance mechanisms in breast cancer will be discussed. Traditional chemotherapy protocols for the treatment of advanced breast cancer consisted of cyclophosphamide, methotrexate, 5-fluorouracil, prednisone, and vincristine combinations (Harris et al., 2000). Later on, anthracycline-

I. Introduction Breast cancer is the most frequent form of cancer and the leading cause of death among females in the Western world, where, despite of radical mastectomy approximately one third of affected women die (Kelsey and Berkowitz, 1988). Around one of 10 Western women will develop breast cancer at some time in their lifetime. Although chemotherapy improves survival rates in the adjuvant setting, around 50% of all treated patients will relapse (Harris et al., 1993). The major reason for therapeutic failure is the development of resistance against anticancer agents used. Under clinical circumstances it is unknown whether drug-resistant mammary carcinoma cells occur as a result of the pressure of antineoplastic agents, or if they were already present in the tumor at the start of the chemotherapeutic treatment that they survive. Recent pharmacological treatment regimens of breast cancer include (i) conventional chemotherapy on the basis of cytotoxic anticancer drugs, (ii)) in steroid-hormone receptor-positive patients an endocrine therapy, e.g. the use of adjuvant tamoxifen in estrogen receptor (ER)positive tumors (Osborne, 1998), and (iii) an immunological-basing therapy, e.g. in proto-oncogene

81


Lage: Drug resistance in breast cancer based chemotherapy has gradually become standard in the treatment of advanced breast cancer. Doxorubicin and its analogue epirubicin are considered as highly active anthracyclines, that are commonly used in combinations with 5-fluorouracil and cyclophosphamide. Although, breast cancer is often considered as one of the more drugsensitive solid tumors, all initially responsive cancers relapse and develop drug resistance, in the case of resistance against a broad spectrum of structurally unrelated drugs with different mode of action a multidrug resistance (MDR).

At least two types of MDR can be distinguished on the basis of different mechanisms: (i) the so-called “classical” or P-glycoprotein (P-gp)-depending MDR, and (ii) the “atypical” or non-P-gp-depending MDR. The most extensively studied mechanism of drug resistance is the “classical” MDR phenotype characterized by a typical cross resistance pattern against natural product-derived anticancer agents, such as anthracyclines (doxorubicin and epirubicin are among the most effective cytotoxic drugs used in the treatment of breast cancer), epipodophyllotoxines, Vinca alkaloids, or taxanes, and the reversibility by the calcium channel inhibitor verapamil and cyclosporin A derivatives. The underlying mechanism conferring this “classical” MDR phenotype is the cellular overproduction of a 170-kDa, membrane-spanning P-gp (P-170, PGY1, MDR1, ABCB1) (Ling et al., 1997), member of the superfamily of ABC (adenosine triphosphate binding cassette)-transporters (Lage, 2003).

II. The multidrug resistance (MDR) phenotype in breast cancer The original concept of MDR was introduced into the scientific literature in 1970 (Biedler et al., 1970). The multidrug-resistant phenotype is frequently characterized by a cross-resistance to drugs to which the tumor has not been exposed previously. Such a MDR phenotype can be intrinsic (primary) or acquired (secondary). The development of a MDR in advanced breast cancer is primarily responsible for the failure of current treatment regimens (Trock et al., 1997). Despite comprehensive knowledge on in vitro mechanisms of MDR, the precise nature of the in vivo drug-resistant phenotype in breast cancer remains unclear.

III. Human ABC-transporters ABC-transporters act as energy-dependent drug efflux pumps, thereby decreasing the accumulation of cytotoxic agents in the intracellular millieu (Figure. 1). ABC-transporter proteins are defined by the presence of a highly conserved approximately 215 amino acids consensus sequence designated as ABC, ABC domain,

Figure 1. Schematic diagram that shows various possibilities of mechanistic action of ABC-transporters mediating drug resistance in breast cancer. (a) ABC-transporters are predominantly localized to the cytoplasm membrane. In an ATP-dependent manner the drugs will be extruded from the cell by the transporter proteins. (b) On the other side, it is also possible that ABC-transporters pump activity contributes to vesicular compartmentation of cytotoxic drugs, or (c) that ABC-transporters facilitate phase II drug metabolism by carrying xenobiotic substances into the lumen of the endoplasmic reticulum. D, anticancer drug.

82


Cancer Therapy Vol 1, page 83 treatment failure. Likewise this meta-analysis confirmed the considerable heterogeneity among the studies. The Pgp incidence in these 31 studies ranged from 0% to 80%. As shown in Table 2, also in very recent studies of P-gp expression these discrepancies persist anymore. Even when using the same monoclonal anti-P-gp antibody JSB1, the detection rate ranged from 0% to 71% (Yang et al., 1999; Faneyte et al., 2001). The putative reasons for the enormous discrepancies in P-gp detection were already discussed extensively in the mid 1990s (Beck et al., 1996). The problems designing a study providing improved P-gp expression data can be summarized as follows: (i) methods using P-gp on protein level as well as on mRNA level using whole tumor specimens can not differentiate from adjacent normal epithelial cells, stroma cells and tumor cells; (ii) Western blotting analyzes for P-gp protein expression and Northern blotting analyzes for mdr1 mRNA expression are not sensitive enough to detect low levels in clinical samples; (iii) many polymerase chain reaction (PCR)-based assays for detection of the mdr1-specific mRNA fail to take into account the fact that quantitation of PCR amplification

ABC-ATPase domain, or nucleotide-binding domain (NBD). The domain contains two short peptide motifs, a glycine-rich Walker A - and a hydrophobic Walker B motif (Walker et al., 1982), both involved in ATP binding and commonly present in all nucleotide-binding proteins. A third consensus sequence is named ABC signature (Hyde et al., 1990) and is unique in ABC domains. ABCcontaining proteins couple the phosphate bond energy of ATP hydrolysis to many cellular processes and are not necessarily restricted to transport functions. However, the proper meaning of the term ABC-transporter protein, is satisfied when the ABC-protein is in addition, associated with a hydrophobic, membrane-embedded transmembrane domain (TMD) usually composed of at least six transmembrane (TM) !-helices. The TMDs are believed to determine the specificity for the substrate molecules transported by the ABC-transporter protein. The minimal structural requirement for a biological active ABCtransporter seems to be two TMDs and two ABCs [TMDNBD]2. In “full-transporters”, this structural arrangement may be formed by a single polypeptide chain and in multiprotein complexes by more than one polypeptide chain. The organization of human ABC-transporter encoding genes are commonly distributed in one gene encoding a “full-transporters” [TMD-NBD]2 or two genes encoding subunits of heteromeric “half-transporters“ [TMD-NBD] (Figure. 2). Since completion of the human genome sequence (Lander et al., 2001; Venter et al., 2001), 48 different ABC-transporters have been identified and were divided by their phylogenetic characteristics into 7 subfamilies, ABCA, ABCB, ABCC, ABCD, ABCE, ABCF, and ABCG (Dean et al., 2001). Besides P-gp mediating the “classical” MDR phenotype, ABC-transporters have important roles in “atypical” forms of MDR and at least 12 human ABC-transporters are associated with drug transport in human cancers (Table 1).

A. P-gp (ABCB1) The 170 kDa P-gp represents the first purified (Riordan et al., 1979) human ABC-transporter protein and is the best characterized molecule involved in MDR (Ling et al., 1997). Structurally, this mdr1 gene encoded transporter consists of 1280 amino acids residues forming a [TMD-NBT] 2 configuration. Very early studies of MDR demonstrated frequently expression of P-gp in breast cancer (e.g. Sugawara et al., 1988; Goldstein et al., 1989; Ro et al., 1990; Gerlach et al., 1987; Wallner et al., 1991; Verrelle et al., 1991; Keith et al., 1990; Merkel et al., 1989; Sanfillippo et al., 1991; Wishart et al., 1990; Schneider et al., 1989). These early studies were limited by small sample size, the retrospective character, differences in detection methods and therewith the enormous discrepancies in results. In these studies the percentage of P-gp-positive breast cancer samples varied between 0% and 85%. However, a meta-analysis of 31 studies performed by Trock et al. (1997) revealed that 41% of breast cancers expressed P-gp, the frequency of detectable expression increased after therapy, and the P-gp expression was associated with a higher likelihood of

Figure 2. Models for the predicted domain arrangements of human ABC-transporter proteins involved in anticancer drug resistance. (a) Nucleotide binding domain [NBD] containing a Walker A and a Walker B motif, and the ABC signature. (b) Transmembrane domain [TMD] consisting of six transmembrane (TM) !-helices. Probably, the TMDs are forming a pore structure in the membrane. (c) [NBT-TMD] configuration, e.g. ABC8 (White, ABCG1), BCRP (ABCG2). (d) [TMD-NBT] configuration, e.g. TAP1 (ABCB2), and TAP2 (ABCG3). (e) [TMD-NBT]2 configuration, e.g. MDR1 (ABCB1), MRP4 (ABCC4), MRP5 (ABCC5), MRP7 (ABCC7). (f) [TMD 0(TMDNBT)2] configuration, e.g. MRP1 (ABCC1), MRP2 (ABCC2), MRP3 (ABCC3), MRP6 (ABCC6). The upper parts of the topological models represent the extracellular orientation or the lumen of a cellular compartment, such as the endoplasmic reticulum, Golgi apparatus, peroxisome, or mitochondrium, whereas the bottom represents the intracellular, cytosolic compartment. It is notable that the topological models are highly schematic, and that “half-transporters” (c, d) have to assemble in a homo- or heterodimeric structure to form a biological active transporter molecule.

83


Lage: Drug resistance in breast cancer products is most accurate in the exponential phase of the reaction; (iv) PCR-based detection protocols may exhibit a much higher sensitivity that alternative methods including immunohistochemistry (IHC); (v) although IHC has the advantage that cancer cells can be distinguished from contaminating cells, problems arise in the quantification of the P-gp expression level; (vi) it is difficult to detect P-gp in formalin-fixed tumor tissue and differences in fixation techniques may contribute to the variability of the data, even when the same antibody was used; (vii) the commonly used anti-P-gp antibodies exhibit experimental difficulties, e.g. C219 crossreacts with the human MDR3transporter protein, that has not been demonstrated to confer MDR, and also shows cross reaction with myosin, or MRK16 that is highly specific for P-gp, but may have heterogeneous staining even in control cell lines; (viii) disagreements whether breast cancer cells should be scored as Pgp-positive if cytoplasm is stained but membrane staining cannot be identified. Breast cancer studies requiring P-gp-specific membrane staining often report a far lower frequency of P-gp expression (Faneyte et al., 2001). All of these problems are not specific for Pgp; they obtain alike for all other ABC-transporters and alternative drug resistance-mediating factors. Correlation of P-gp expression in breast cancer and clinical drug resistance was investigated in several studies. In locally advanced breast cancer P-gp expression has been demonstrated to increase as a result of chemotherapy. Chevillard et al. (1996) reported that the P-gp incidence increased from 14% to 43%; Chung et al. (1997) found an increasing P-gp incidence from 26% to 57%. Although the meta-analysis of P-gp expression studies in breast cancer by Trock et al. (1997) concluded that women with P-gppositive tumors were more likely to experience chmotherapy failure, several recent studies have not been able to confirm a significant infuence of P-gp expression on response rate or overall survival (Linn et al., 1997; Wang et al., 1997; Honkoop et al., 1998). Thus, the impact of P-gp expression on clinical outcome of breast cancer patients still remains open.

MRP1 encoding mRNA in 100% of breast cancer specimens by RT-PCR at expression levels comparable with normal tissues reinforces this point (Filipits et al., 1996; Dexter et al., 1998; Burger et al., 2003). An immunohistochemical study finding 34 % of breast cancer samples positive for MRP1 expression reported a correlation between MRP1 expression and relapse-free Table 1: Recent expression analyzes of drug resistancemediating factors in breast cancer Study P-gp (ABCB1) Burger et al., 2003 Faneyte et al., 2001 Arnal et al., 2000 Yang et al., 1999 Dexter et al., 1998 Linn et al., 1997 Filiptis et al., 1996 MRP1 (ABCC1) Burger et al., 2003 Dexter et al., 1998 Linn et al., 1997 Nooter et al., 1997 Filiptis et al., 1996 MRP2 (ABCC2) Burger et al., 2003 BCRP (ABCG2) Faneyte et al., 2002 Burger et al., 2003 YB-1 Janz et al., 2002 Saji et al., 2003 MVP (LRP) Burger et al., 2003 Pohl et al., 1999 Linn et al., 1997

B. MRP1 (ABCC1) The second major ABC-transporter involved in MDR of human cancers was first described in 1992 (Cole et al., 1992). This 190 kDa ABC-transporter was found to be over-expressed in a doxorubicin-selected lung cancer cell line and originally named â&#x20AC;&#x153;MDR-associated proteinâ&#x20AC;?, MRP. Due to the identification of various homologous proteins to MRP (Borst et al., 2000), it is now designated as MRP1 or ABCC1. In addition to the [TMD-NBT]2 configuration of P-gp, MRP1 has an additional TMD0 domain consisting of 5 TM !-helices attached to the Nterminal forming a [TMD0(TMD-NBT)2] configuration. Anticancer drug substrates for MRP1 include anthracyclines and methotrexate commonly used for treatment of breast cancer, and Vinca alkaloids, and epipodophyllotoxins, (Jedlitschky et al., 1996). Since MRP1 is expressed ubiquitously in normal human tissues, it is not surprising detecting MRP1 expression in neoplastic tissue including breast cancer. Finding of the

n

Expression [%]

Method

59

4 high; 54 low

RT-PCR

140 30 40

71 (cytoplasm) 100 low 92-100

IHC RT-PCR RT-PCR

106 33 31 31 40

IHC RT-PCR IHC RT-PCR RT-PCR

134 63

0 39 6 100 low 64 before CT; 57 after CT 60 9 strong; 48 weak

59

27 high; 31 low

RT-PCR

31 31 40

IHC RT-PCR RT-PCR

259

100 100 low 20 before CT; 56 after CT 34

134 63

100 24 strong; 76 weak

RT-PCR IHC

56

23 high; 32 low

RT-PCR

52 59

100 (variable levels) 0 29 high; 71 low

RT-PCR IHC RT-PCR

83

76

IHC

63

100

IHC

59

17 high; 41 low

RT-PCR

99

21 high; 47 intermediate; 20 low 71 before CT; 69 after CT

IHC

40

RT-PCR IHC

IHC

RT-PCR

IHC, immunohistochemistry; RT-PCR, reverse transcriptase polymerase chain reaction; CT, chemotherapy.

84


Cancer Therapy Vol 1, page 85 Table 2: Human ABC-transporters associated with drug resistance ABC-transporter HUGO Common names nomenclature ABCA2 ABCA2

Physiological substrates

Drugs

References

steroids

estramustine

Laing et al., 1998; Vulevic et al., 2001 Ling, 1997; Ueda et al., 1999

P-gp, P-170, MDR1, PGY1

ABCB1

phospholipids, neutral and cationic organic compounds

TAP1

ABCB2

peptides

TAP2

ABCB3

peptides

MDR3, PGY3

ABCB4

phosphatidylcholine

anthracyclines, Vinca alkaloids, epipodophyllotoxines, taxanes, antibiotics, and many others mitoxantrone, epipodophyllotoxins mitoxantrone, epipodophyllotoxins paclitaxel, Vinca alkaloids

BSEP, SPGP, ABC16, PGY4 MRP, MRP1

ABCB11

bile salts

paclitaxel

ABCC1

glutathion-, and other conjugates, organic anions, leukotrienes

MRP2, cMOAT

ABCC2

glutathion-, and other conjugates, organic anions, leukotriene C4

MRP3, MOAT-D, MLP2

ABCC3

glucuronides, bile salts, peptides

MRP4, MOAT-B

ABCC4

organic anions

anthracyclines, Vinca alkaloids, epipodophyllotoxins, methotrexate platin-drugs, anthracyclines, Vinca alkaloids, epipodophyllotoxins, camptothecins, methotrexate Vinca alkaloids, epipodophyllotoxins, methotrexate nucleotide analoga, methotrexate

MRP5, MOAT-C

ABCC5

BCRP, MXR, ABCP

ABCG2

organic anions, cyclic nucleotides prazosin

nucleotide analoga mitoxantrone, anthracyclines, camptothecins, topotecan

Izquierdo et al., 1996a; Lage et al., 2001 Izquierdo et al., 1996a; Lage et al., 2001 Ruetz et al., 1994; Gottesman et al., 2002 Childs et al., 1998; Gerloff et al., 1998 Cole et al., 1992; Jedlitschky et al., 1996; Borst et al., 2000; Taniguchi et al., 1996; Cui et al., 1999; König et al., 1999 de Jong et al., 2001; Kool et al., 1999; Zeng et al., 1999 Schuetz et al., 1999; Chen et al., 2001; Chen et al., 2002 Jedlitschky et al. 2000; Wijnholds et al., 2000 Doyle et al., 1998; Allikmets et al., 1998; Miyake et al., 1999; Lage and Dietel, 2000

have a role in clinical MDR of breast cancer treated with anthracyclineor methotrexate -containing chemotherapeutic regimes. However, there are only sporadic data available concerning to MRP2 expression in breast cancer. So far, a RT-PCR-basing study demonstrated no correlation between clinical outcome and MRP2 mRNA expression level (Burger et al., 2003). These preliminary data suggest that the importance of MRP2 in breast cancer remains uncertain and that further studies are necessary to clarify the role of MRP2 in drugresistant phenotypes of mammary carcinoma.

survival (Nooter et al., 1997), whereas a RT-PCR-based study reported that MRP1 expression merely correlated with progression-free survival in patients treated with anthracycline-based therapy regime (5-fluorouracil, adriamycin/epirubicin, and cyclophosphamide), but not in patients treated without anthracyclines (cyclophosphamide, methotrexate, 5-fluorouracil) (Burger et al., 2003). Thus, the role of MRP1 in clinical MDR of mammary carcinoma remains to be elucidated.

C. MRP2 (ABCC2) MRP2 (cMOAT / ABCC2) ehibiting a [TMD 0(TMDNBT)2] configuration, has been shown to be the bilirubin glucuronide transporter at the cannalicular membrane of the hepatocyte (König et al., 1999). MRP2 originally was found to be over-expressed in cisplatin-resistant cancer cells (Taniguchi et al., 1996). Moreover, transfection experiments demonstrated that MRP2 can confer resistance to the clinical important substance class of anthracyclines and methotrexate, as well as to platinum containing drugs, Vinca alkaloids, epipodophyllotoxins, and camptothecins (Cui et al., 1999). Thus, MRP2 may

D. Other MRPs (ABCC3 – ABCC6) Transfection experiments have shown that overexpression of MRP3 conferred resistance against Vinca alkaloids, epipodophyllotoxins, and methotrexate (Kool et al., 1999; Zeng et al., 1999). MRP4 was shown to confer resistance against nucleotide-based antiviral drugs as well as methotrexate (Schuetz et al., 1999; Chen et al., 2001; Chen et al., 2002). In addition, transfection studies demonstrated that MRP5 is able to mediate resistance against thiopurine anticancer drugs 6-mercaptopurine and

85


Lage: Drug resistance in breast cancer thioguanine and the anti-HIV drug 9-(2phosphonylmethoxyethyl)adenine (Wijnholds et al., 2000). Finally, there is no indication that MRP6 is associated with any form of drug resistance. However, so far there are no data available demonstrating an expression of these MRPs in breast cancer.

weak correlation between expression and drug-resistant phenotype. Thus, over-expression of ABC2 contributes to estramustine resistance (Laing et al., 1998) and that overexpression of both sub-units of the dimeric “transporter associated with antigen presentation” (TAP), TAP1 and TAP2, results in increased resistance against mitoxantrone or etoposide (Izquierdo et al., 1996a; Lage et al., 2001). However, so far there are no data available that these ABC-transport proteins play any role in drug resistance of breast cancer.

E. BCRP (ABCG2) Recently, the long sought mitoxantrone transporter was identified by 3 independent studies nearly contemporaneously. Since this ABC-transporter was identified in a breast cancer-derived cell line, it was designated as “breast cancer resistance protein” (BCRP) (Doyle et al., 1998). Alternative designations are “mitoxantrone resistance-associated protein” (MXR) (Miyake et al., 1999), “placenta-specific ABC gene” (Allikmets et al., 1999) or ABCG2 according to the suggestions of the HUGO, Human Gene Nomenclature Committee. The 72 kDa ABC-transporter is a so-called “half-transporter” with a [NBD-TMD] configuration that probably forms dimers to produce an active transport complex (Lage and Dietel, 2000). Up to the present, detection of BCRP in clinical samples of breast carcinoma was performed in three different studies using immunohistochemistry and/or RTPCR. The first study analyzed samples of 43 breast cancer patients by RT-PCR and found no correlation of BCRP mRNA expression and relapse or prognosis (Kanazaki et al., 2001). Faneyte et al. (2002) analyzed 52 breast cancer samples (25 primary breast carcinomas and 27 patients who received preoperative anthracycline-based chemotherapy) by RT-PCR and found widely varied BCRP mRNA expression levels, whereby no difference in BCRP mRNA expression between anthracycline-naive and treated tumor samples could be detected. Applying immunohistochemistry, BCRP was detected in normal breast epithelium and vessels but not in neoplastic cells. As a consequence, BCRP expression level was not associated with a decreased response or survival time. On the contrary, an alternative RT-PCR-based study analyzed 59 primary breast cancer specimens of patients who received either anthracycline-based (5-fluorouracil, adriamycin/epirubicin, cyclophosphamide) chemotherapy or a cyclophosphamide, methotrexate, 5-fluorouracil consisting regime as first-line systemic treatment after diagnosis of advanced disease. In the anthracycline-treated subgroup of patients, this study demonstrated a correlation between BCRP mRNA expression level and progressionfree survival (Burger et al., 2003). However, no correlation between the BCRP mRNA expression level and post-relapse overall survival was found. In conclusion, these preliminary data suggest that BCRP expression may have some predictive value for clinical outcome, but the role of BCRP in clinical drug-resistant breast cancer has to be investigated much more in detail.

IV. YB-1 YB-1, a member of the DNA-binding protein family, was initially reported as a transcription factor which interacts with the so-called Y-box - an inverted CCAAT box - region of the promoter of MHC class II genes (Didier et al. 1988). In vitro experiments using multidrugresistant MCF-7 breast carcinoma cells demonstrated that nuclear localization of this transcription factor regulates the transcriptional activity of the P-gp encoding mdr1 gene (Ohga et al., 1996). Immunohistochemistry demonstrated that in 27 out of 27 samples of untreated primary breast cancers, YB-1 was expressed in the cytoplasm although it was not detectable in normal surrounding breast tissue. In a subgroup of breast tumors (9 of 27), however, YB-1 was also localized in the nucleus and, in these cases, high levels of P-gp were present (Bargou et al., 1997). The data suggest that nuclear localization of YB-1 is associated with expression of P-gp and as a result with a MDR phenotype in breast carcinoma. There are contradictory data concerning the clinical relevance of nuclear YB-1 protein expression in breast cancer. An immunohistochemical study with 83 samples of breast cancer patients (41 patients treated with different chemotherapeutic regimens and 42 patients without any postoperative chemotherapy) reported that high YB-1 expression in neoplastic tissue and surrounding benign epithelial cells was significantly associated with poor patient outcome (Janz et al., 2002). In patients, who received postoperative chemotherapy, the 5-year relapse rate was 66% in patients with high YB-1 expression. In contrast, in patients with low YB-1 expression level, no relapse has been observed within that time. These data clearly suggest that YB-1 protein expression indicates clinical drug resistance in breast cancer and has prognostic and predictive significance. In marked contrast to these observations, an alternative immunohistochemical study using samples of 63 breast carcinoma specimens concluded that nuclear expression of YB-1 (and P-gp expression) may not be a useful prognostic marker in breast carcinoma (Saji et al., 2003). However, patients in this study underwent mastectomy and the influence of YB1 expression on chemotherapeutic responding rate - if there has been any chemotherapy – has not been analyzed. Thus, the impact of YB-1 expression on clinical drug resistance of mammary carcinoma remains a promising topic.

F. Other ABC-transporters The remaining human ABC-transporters that were demonstrated to be able to transport drugs, exhibit only a 86


Cancer Therapy Vol 1, page 87 others. On the contrary, these studies found no significant difference in Topo II mRNA levels in breast cancer patients between relapsed and nonrelapsed groups (Efferth et al., 1992; Ito et al., 1998). Drug resistance can result from defective cellular signal transduction pathways leading to apoptosis. Defects may be the consequence of malignant transformation; e.g. in cancers with mutant or non-functional p53 (Lowe et al., 1993). Furthermore, cancer cells may acquire deficiencies in apoptotic pathways during exposure to anticancer drugs, such as alterations of ceramide levels (Liu et al., 2001) or alterations in the cell cycle machinery that regulate checkpoints and prevent initiation of programmed cell death. MDR can also result from coordinately regulated detoxifying cellular systems, such as DNA repair pathways, e.g. enhanced activity of O6-methylguanineDNA methyltransferase (MGMT) (Pegg et al., 1990) or alterations in the DNA mismatch repair (MMR) system (Lage and Dietel, 1999). Furthermore, activation of the system of the cytochrome P450 mixed-function oxidases can mediate a drug-resistant phenotype. A coordinate induction of P-gp and cytochrome P450 3A has been reported (Schuetz et al., 1996). However, all those data have not been consistent, and studies using specimens of human breast cancer have not yet confirmed a link with clinical drug resistance (Symmans, 2001).

V. Major vault protein (MVP) Another MDR-associated factor included in many clinical studies is MVP, the “major vault protein” also known as LRP (“lung resistance protein”). MVP is an integral part of the vault complex that is found in the cytoplasm and in the nuclear membrane (Scheffer et al., 2000). Vaults are the largest ribonucleoprotein particles known so far (13 MDa); they are almost ubiquitously expressed at the highest levels in potentially toxin-exposed epithelia of the gastrointestinal tract and in macrophages (Izquierdo et al., 1996b). It has been reported that vaults are involved in the intracellular distribution of chemotherapeutic agents including anthracyclines (Dalton et al., 1999). Thought to mediate redistribution of anticancer drugs away from their targets in the nucleus, MVP expression may be coordinately regulated with ABC-transporters such as P-gp or MRP1 although direct evidence that this is the case is lacking. Clinical data indicate that MVP is often expressed in human malignancies and that the expression level may be associated with poor response to chemotherapeutic treatment in ovarian carcinoma and acute myelogenous leukemia (AML) (Dalton et al., 1999; Scheffer et al., 2000). Studies on MVP expression in breast cancer are limited. The available data showed by immunohistochemistry that MVP is frequently expressed in primary breast cancer, but its expression level was independent to response to chemotherapy or survival (Linn et al., 1997; Pohl et al., 1999). A recent study applying a RT-PCR-based MVP detection protocol reported that high expression level of MVP mRNA was found to be significantly associated with poor progression-free survival in anthracycline-treated patients but not in a subgroup of patients who received an chemotherapeutic regime without anthracyclines (Burger et al., 2003). In conclusion, MVP may have some predictive value for clinical outcome of breast carcinoma patients, but its role has to be confirmed in additional studies.

V. Additional mechanisms

drug

VI. Conclusions For overcoming therapy resistance of mammary carcinoma the mechanisms that are involved have to be elucidated. In the case of a monocausal drug resistance mechanism, such as the overexpression of an ABCtransporter, a disruption of drug extrusion results in a resensitization of tumor cells to treatment with antineoplastic agents, and therewith may allow a successful drug treatment of the multidug-resistant cancer cells. Pharmacologically active drug resistance-reversing compounds are designated as MDR modulators or chemosensitizers. One obstacle in applying MDR modulators arised from their commonly occurring intrinsic toxicity at doses necessary to be active, e.g. heart failure, hypotension, hyperbilirubinemia, bone-marrow and neurological toxicity. Additionally, tumor cells can develop resistance against the applied chemosensitizers, a so-called tertiary resistance. However, with recognition of the problems of potency and pharmacokinetic interactions, so far the third-generation of MDR-modulators (e.g. XR9576, R-101933, LY-335979, OC144-093) has been developed and was applied in the first clinical trials (Gottesman et al., 2002). Although, several mechanisms have been identified to contribute to clinical drug-resistance of breast carcinoma, hitherto the problem of therapy resistance against anti cancer drugs was not vanquished. An important problem is the principle that neoplastic tissues including breast carcinoma cells are genetically heterogenous. Although this phenomenon occurs as a

resistance

Resistance to antineoplastic agents clinically applied for the treatment of breast carcinoma can also be mediated by additional mechanisms. A mechanism that has been identified to contribute to drug resistance in cancer is mediated by a decreased activity of the nuclear enzyme DNA topoisomerase II (Topo II) (Danks et al., 1988). In mammalian cells two Topo II isoforms, the 170 kDa Topo II! and the 180 kDa Topo II" exist as homodimers. Drug resistance phenotypes due to decreased expression and activity of Topo II isoforms have been described for several drug-resistant cancer cell lines derived from various tissues including breast cancer cells (Sinha et al., 1988). One study analyzing specimens of 15 cases of breast carcinoma concluded that Topo II mRNA expression level might be a useful marker of clinical response to anthracyline treatment in breast cancer patients (Kim et al., 1991). However, these conclusions could not be confirmed by 87


Lage: Drug resistance in breast cancer Chen ZS, Lee K, and Kruh GD (2001) Transport of cyclic nucleotides and estradiol 17-beta-D-glucuronide by multidrug resistance protein 4. Resistance to 6mercaptopurine and 6-thioguanine. J Biol Chem 276, 3374733754.

result of uncontrolled cell growth in the cancerous tissue and favors clonal expansion, tumor cells that are exposed to anticancer drugs will be selected for their ability to survive and grow in the presence of antineoplastic agents. Thus, in any population of cancer cells that underwent chemotherapeutic treatment, more than one mechanismof drug resistance may be active. In other words, the clinical drug resistance of breast carcinoma probably represents a multifactorial multidrug resistance phenomenon. Hence, the needful strategy for overcoming drug resistance has to target various drug resistance mediating factors simultaneously, e.g. by the development of “multispecific” inhibitors, such as the acridinecarboxamide derivative GF120918 that reverses P-gp-mediated MDR as well as BCRP-mediated resistance (de Bruin et al., 1999). Moreover, it may be a promisingly strategy to inhibit upstream factors of drug resistance-mediating mechanisms. One possible upstream factor represents the Y-box transcription factor YB-1. Besides the regulation of the P-gp encoding mdr1 gene, in vitro data suggest that YB-1 can induce the activation of alternative MDR factors such as MRP1 (Stein et al., 2001). Thus, the identification of additional upstream factors regulating the activity of MDR-mediating genes in breast cancer is of urgent need.

Chen ZS, Lee K, Walther S, Raftogianis RB, Kuwano M, Zeng H, and Kruh GD (2002) Analysis of methotrexate and folate transport by multidrug resistance protein 4 (ABCC4): MRP4 is a component of the methotrexate efflux system. Cancer Res 62, 3144-3150. Chevillard S, Pouillart P, Beldjord C, Asselain B, Beuzeboc P, Magdelenat H, and Vielh P (1996) Sequential assessment of multidrug resistance phenotype and measurement of S-phase fraction as predictive markers of breast cancer response to neoadjuvant chemotherapy. Cancer 77, 292-300. Childs S, Yeh RL, Hui D, and Ling V (1998) Taxol resistance mediated by transfection of the liver-specific sister gene of P-glycoprotein. Cancer Res 58, 4160-4167. Chung HC, Rha SY, Kim JH, Roh JK, Min JS, Lee KS, Kim BS, and Lee KB (1997) P-glycoprotein: the intermediate end point of drug response to induction chemotherapy in locally advanced breast cancer. Breast Cancer Res Treat 42, 6572. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz EU, Duncan AM, and Deeley RG (1992) Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science 258, 1650-1654.

Acknowledgements

Cui Y, König J, Buchholz JK, Spring H, Leier I, and Keppler D (1999) Drug resistance and ATP-dependent conjugate transport mediated by the apical multidrug resistance protein, MRP2, permanently expressed in human and canine cells. Mol Pharmacol 55, 929-937.

Own work in this field has been supported by the “Deutsche Forschungsgemeinschaft” (DFG) (grants no. LA 1039/1-3, LA 1039/2-1), and the “Deutsche Krebshilfe” (grant no. 10-1628-La 4).

Dalton WS, and Scheper RJ (1999) Lung resistance-related protein: determining its role in multidrug resistance. J Natl Cancer Inst 91, 1604-1605. Danks MK, Schmidt CA, Cirtain MC, Suttle DP, and Beck WT (1988) Altered catalytic activity of and DNA cleavage by DNA topoisomerase II from human leukemic cells selected for resistance to VM-26. Biochemistry 27, 8861-8869.

References Allikmets R, Schriml LM, Hutchinson A, Romano-Spica V, and Dean M (1998) A human placenta-specific ATP-binding cassette gene (ABCP) on chromosome 4q22 that is involved in multidrug resistance. Cancer Res 58, 5337-5539. Arnal M, Franco N, Fargeot P, Riedinger JM, Brunet-Lecomte P, and Lizard-Nacol S (2000) Enhancement of mdr1 gene expression in normal tissue adjacent to advanced breast cancer. Breast Cancer Res Treat 61, 13-20.

Dean M, Rzhetsky A, and Allikmets R (2001) The human ATPbinding cassette (ABC) transporter superfamily. Genome Res 11, 1156-1166. de Bruin M, Miyake K, Litman T, Robey R, and Bates SE (1999) Reversal of resistance by GF120918 in cell lines expressing the ABC half-transporter, MXR. Cancer Lett 146, 117-126. de Jong MC, Slootstra JW, Scheffer GL, Schroeijers AB, Puijk WC, Dinkelberg R, Kool M, Broxterman HJ, Meloen RH, and Scheper RJ (2001) Peptide transport by the multidrug resistance protein MRP1. Cancer Res 61, 2552-2557. Dexter DW, Reddy RK, Geles KG, Bansal S, Myint MA, Rogakto A, Leighton JC, and Goldstein LJ (1998) Quantitative reverse transcriptase-polymerase chain reaction measured expression of MDR1 and MRP in primary breast carcinoma. Clin Cancer Res 4, 1533-1542. Didier DK, Schiffenbauer J, Woulfe SL, Zacheis M, and Schwartz BD (1988) Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc Natl Acad Sci USA 85, 7322-7326.

Bargou RC, Jurchott K, Wagener C, Bergmann S, Metzner S, Bommert K, Mapara MY, Winzer KJ, Dietel M, Dorken B, and Royer HD (1997) Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 3, 447-450. Biedler JL, and Riehm H (1970) Cellular resistance to actinomycin D in Chinese hamster cells in vitro: crossresistance, radioautographic, and cytogenetic studies. Cancer Res 30, 1174-1184. Borst P, Evers R, Kool M, and Wijnholds J (2000) A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 92, 1295-1302. Burger H, Foekens JA, Look MP, Meijer-van Gelder ME, Klijn JG, Wiemer EA, Stoter G, and Nooter K (2003) RNA expression of breast cancer resistance protein, lung resistance-related protein, multidrug resistance-associated proteins 1 and 2, and multidrug resistance gene 1 in breast cancer: correlation with chemotherapeutic response. Clin Cancer Res 9, 827-836.

Doyle LA, Yang W, Abruzzo LV, Krogmann T, Gao Y, Rishi AK, and Ross DD (1998) A multidrug resistance transporter from human MCF-7 breast cancer cells. Proc Natl Acad Sci USA 95, 15665-15670.

88


Cancer Therapy Vol 1, page 89 Efferth T, Mattern J, and Volm M (1992) Immunohistochemical detection of P glycoprotein, glutathione S transferase and DNA topoisomerase II in human tumors. Oncology 49, 368375.

lung resistance protein in normal human tissues and tumors. Am J Pathol 148, 877-887. Janz M, Harbeck N, Dettmar P, Berger U, Schmidt A, JĂźrchott K, Schmitt M, and Royer HD (2002) Y-box factor YB-1 predicts drug resistance and patient outcome in breast cancer independent of clinically relevant tumor biologic factors HER2, uPA and PAI-1. Int J Cancer 97, 278-282.

Faneyte IF, Kristel PM, Maliepaard M, Scheffer GL, Scheper RJ, Schellens JH, and van de Vijver MJ (2002) Expression of the breast cancer resistance protein in breast cancer. Clin Cancer Res 8, 1068-1074. Faneyte IF, Kristel PM, and van de Vijver MJ (2001) Determining MDR1/P-glycoprotein expression in breast cancer. Int J Cancer 93, 114-122.

Jedlitschky G, Leier I, Buchholz U, Barnouin K, Kurz G, and Keppler D (1996) Transport of glutathione, glucuronate, and sulfate conjugates by the MRP gene-encoded conjugate export pump. Cancer Res 56, 988-994.

Filipits M, Suchomel RW, Dekan G, Haider K, Valdimarsson G, Depisch D, and Pirker R (1996) MRP and MDR1 gene expression in primary breast carcinomas. Clin Cancer Res 2, 1231-1237. Gerlach JH, Bell DR, Karakousis C, Slocum HK, Kartner N, Rustum YM, Ling V, and Baker RM (1987) P-glycoprotein in human sarcoma: evidence for multidrug resistance. J Clin Oncol 5, 1452-1460.

Jedlitschky G, Burchell B, and Keppler D (2000) The multidrug resistance protein 5 functions as an ATP-dependent export pump for cyclic nucleotides. J Biol Chem 275, 3006930074. Kanzaki A, Toi M, Nakayama K, Bando H, Mutoh M, Uchida T, Fukumoto M, and Takebayashi Y (2001) Expression of multidrug resistance-related transporters in human breast carcinoma. Jpn J Cancer Res 92, 452-458.

Gerloff T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF, and Meier PJ (1998) The sister of Pglycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 273, 10046-10050.

Keith WN, Stallard S, and Brown R (1990) Expression of mdr1 and gst-pi in human breast tumours: comparison to in vitro chemosensitivity. Br J Cancer 61, 712-716. Kelsey JL, and Berkowitz GS (1988) Breast cancer epidemology. Cancer Res 48, 5615-5623.

Goldstein LJ, Galski H, Fojo A, Willingham M, Lai SL, Gazdar A, Pirker R, Green A, Crist W, and Brodeur GM (1989) Expression of a multidrug resistance gene in human cancers. J Natl Cancer Inst 81, 116-124. Gottesman MM, Fojo T, and Bates SE (2002) Multidrug resistance in cancer: role of ATP-dependent transporters. Nat Rev Cancer 2, 48-58.

Kim R, Hirabayashi N, Nishiyama M, Saeki S, Toge T, and Okada K (1991) Expression of MDR1, GST-pi and topoisomerase II as an indicator of clinical response to adriamycin. Anticancer Res 11, 429-431. KĂśnig J, Nies AT, Cui Y, Leier I, and Keppler D (1999) Conjugate export pumps of the multidrug resistance protein (MRP) family: localization, substrate specificity, and MRP2mediated drug resistance. Biochim Biophys Acta 1461, 377394.

Harris JR, Morrow M, and Bonadonna G (1993) Cancer of the breast. In: DeVita VT Jr, Hellman S, Rosenberg SA, eds. Cancer, Priciples and Practice of Oncology. Philadelphia: Lippincott, pp. 1264-1332. Harris JR, Lippman ME, Morrow M, and Osborne CK (1993) Treatment of metastatic breast cancer. In: Harris JR, Lippmann ME, Morrow M, eds. Diseases of the breast. Philadelphia: Lippincott Williams & Wilkens, p. 749.

Kool M, van der Linden M, de Haas M, Scheffer GL, de Vree JM, Smith AJ, Jansen G, Peters GJ, Ponne N, Scheper RJ, Elferink RP, Baas F, and Borst P (1999) MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci USA 96, 6914-6919.

Honkoop AH, van Diest PJ, de Jong JS, Linn SC, Giaccone G, Hoekman K, Wagstaff J, and Pinedo HM (1998) Prognostic role of clinical, pathological and biological characteristics in patients with locally advanced breast cancer. Br J Cancer 77, 621-626. Hortobagyi GN (2001) Overview of treatment results with trastuzumab (Herceptin) in metastatic breast cancer. Semin Oncol 288, 43-47. Hyde SC, Emsley P, Hartshorn MJ, Mimmack MM, Gileadi U, Pearce SR, Gallagher MP, Gill DR, Hubbard RE, and Higgins CF (1990) Structural model of ATP-binding proteins associated with cystic fibrosis, multidrug resistance and bacterial transport. Nature 346, 362-365.

Lage H (2003) ABC-transporters: implications on drug resistance from microorganisms to human cancers. Int J Antimicrob Agents, in press Lage H, and Dietel M (1999) Involvement of the DNA mismatch repair system in antineoplastic drug resistance. J Cancer Res Clin Oncol 125, 156-165.

Ito K, Fujimori M, Nakata S, Hama Y, Shingu K, Kobayashi S, Tsuchiya S, Kohno K, Kuwano M, and Amano J (1998) Clinical significance of the increased multidrug resistanceassociated protein (MRP) gene expression in patients with primary breast cancer. Oncol Res 10, 99-109.

Laing NM, Belinsky MG, Kruh GD, Bell DW, Boyd JT, Barone L, Testa JR, and Tew KD (1998) Amplification of the ATPbinding cassette 2 transporter gene is functionally linked with enhanced efflux of estramustine in ovarian carcinoma cells. Cancer Res 58, 1332-1337.

Izquierdo MA, Neefjes JJ, Mathari AE, Flens MJ, Scheffer GL, and Scheper RJ (1996a) Overexpression of the ABC transporter TAP in multidrug-resistant human cancer cell lines. Br J Cancer 74, 1961-1967. Izquierdo MA, Scheffer GL, Flens MJ, Giaccone G, Broxterman HJ, Meijer CJ, van der Valk P, and Scheper RJ (1996b) Broad distribution of the multidrug resistance-related vault

Lander ES, Linton LM, Birren B, et al; International Human Genome Sequencing Consortium (2001) Initial sequencing and analysis of the human genome. Nature 409, 860-921.

Lage H, and Dietel M (2000) Effect of the breast-cancer resistance protein on atypical multidrug resistance. Lancet Oncol 1, 169-175. Lage H, Perlitz C, Abele R, Tampe R, Dietel M, Schadendorf D, and Sinha P (2001) Enhanced expression of human ABCtransporter TAP is associated with cellular resistance to mitoxantrone. FEBS Lett 503, 179-184.

Ling V (1997) Multidrug resistance: molecular mechanisms and clinical relevance. Cancer Chemother Pharmacol 40 Suppl, S3-S8.

89


Lage: Drug resistance in breast cancer Linn SC, Pinedo HM, van Ark-Otte J, van der Valk P, Hoekman K, Honkoop AH, Vermorken JB, and Giaccone G (1997) Expression of drug resistance proteins in breast cancer, in relation to chemotherapy. Int J Cancer 71, 787-795.

Schneider J, Bak M, Efferth T, Kaufmann M, Mattern J, and Volm M (1989) P-glycoprotein expression in treated and untreated human breast cancer. Br J Cancer 60, 815-818. Schuetz EG, Beck WT, and Schuetz JD (1996) Modulators and substrates of P-glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol Pharmacol 49, 311-318.

Liu YY, Han TY, Giuliano AE, and Cabot MC (2001) Ceramide glycosylation potentiates cellular multidrug resistance. FASEB J 15, 719-730. Lowe SW, Ruley HE, Jacks T, and Housman DE (1993) p53dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74, 957-967. Merkel DE, Fuqua SA, Tandon AK, Hill SM, Buzdar AU, and McGuire WL (1989) Electrophoretic analysis of 248 clinical breast cancer specimens for P-glycoprotein overexpression or gene amplification. J Clin Oncol 7, 1129-1136.

Schuetz JD, Connelly MC, Sun D, Paibir SG, Flynn PM, Srinivas RV, Kumar A, and Fridland A (1999) MRP4: A previously unidentified factor in resistance to nucleoside-based antiviral drugs. Nat Med 5, 1048-1051. Sinha BK, Haim N, Durse L, Kerrigan D, and Pommier Y (1988) DNA strand breaks produced by etoposide (VP-16,213) in sensitive and resistant human breast tumor cells: implications for the mechanisms of action. Cancer Res 48, 5096-5100. Stein U, J端rchott K, Walther W, Bergmann S, Schlag PM, and Royer HD (2001) Hyperthermia-induced nuclear translocation of transcription factor YB-1 leads to enhanced expression of multidrug resistance-related ABC transporters. J Biol Chem 276, 28562-28569. Sugawara I, Kataoka I, Morishita Y, Hamada H, Tsuruo T, Itoyama S, and Mori S (1988) Tissue distribution of Pglycoprotein encoded by a multidrug-resistant gene as revealed by a monoclonal antibody, MRK 16. Cancer Res 48, 1926-1929. Symmans WF (2001) Breast cancer response to paclitaxel in vivo. Drug Res Updates 4, 297-302. Taniguchi K, Wada M, Kohno K, Nakamura T, Kawabe T, Kawakami M, Kagotani K, Okumura K, Akiyama S, and Kuwano M (1996) A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation. Cancer Res 56, 4124-4129.

Miyake K, Mickley L, Litman T, Zhan Z, Robey R, Cristensen B, Brangi M, Greenberger L, Dean M, Fojo T, and Bates SE (1999) Molecular cloning of cDNAs which are highly overexpressed in mitoxantrone-resistant cells: demonstration of homology to ABC transport genes. Cancer Res 59, 8-13. Nooter K, Brutel de la Riviere G, Look MP, van Wingerden KE, Henzen-Logmans SC, Scheper RJ, Flens MJ, Klijn JG, Stoter G, and Foekens JA (1997) The prognostic significance of expression of the multidrug resistance-associated protein (MRP) in primary breast cancer. Br J Cancer 76, 486-493. Ohga T, Koike K, Ono M, Makino Y, Itagaki Y, Tanimoto M, Kuwano M, and Kohno K. (1996) Role of the human Y boxbinding protein YB-1 in cellular sensitivity to the DNAdamaging agents cisplatin, mitomycin C, and ultraviolet light. Cancer Res 56, 4224-4228. Osborne CK (1998) Tamoxifen in the treatment of breast cancer. New Eng J Med 339, 1609-1618. Pegg AE (1990) Mammalian O6-alkylguanine-DNA alkyltransferase: Regulation and importance in response to alkylating carcinogenic and therapeutic agents. Cancer Res 50, 6119-6129.

Trock BJ, Leonessa F, and Clarke R (1997) Multidrug resistance in breast cancer: a meta-analysis of MDR1/gp170 expression and its possible functional significance. J Natl Cancer Inst 89, 917-931.

Pohl G, Filipits M, Suchomel RW, Stranzl T, Depisch D, and Pirker R (1999) Expression of the lung resistance protein (LRP) in primary breast cancer. Anticancer Res 1999 19, 5051-5055. Riordan JR, and Ling V (1979) Purification of P-glycoprotein from plasma membrane vesicles of Chinese hamster ovary cell mutants with reduced colchicine permeability. J Biol Chem 254, 12701-12705. Ro J, Sahin A, Ro JY, Fritsche H, Hortobagyi G, and Blick M (1990) Immunohistochemical analysis of P-glycoprotein expression correlated with chemotherapy resistance in locally advanced breast cancer. Hum Pathol 21, 787-791.

Ueda K, Yoshida A, and Amachi T (1999) Recent progress in Pglycoprotein research. Anticancer Drug Des 14, 115-121. Venter JC, Adams MD, Myers EW et al(2001) The sequence of the human genome. Science 291, 1304-1351. Verrelle P, Meissonnier F, Fonck Y, Feillel V, Dionet C, Kwiatkowski F, Plagne R, and Chassagne J (1991) Clinical relevance of immunohistochemical detection of multidrug resistance P-glycoprotein in breast carcinoma. J Natl Cancer Inst 83, 111-116. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehrenbacher L, Slamon DJ, Murphy M, Novotny WF, Burchmore M, Shak S, Stewart SJ, and Press M (2002) Efficacy and safety of trastuzumab as a single agent in firstline treatment of HER2-overexpressing metastatic breast cancer. J Clin Oncol 20, 719-726.

Ruetz S, and Gros P (1994) Phosphatidylcholine translocase: a physiological role for the mdr2 gene. Cell 77, 1071-1081. Saji H, Toi M, Saji S, Koike M, Kohno K, and Kuwano M (2003) Nuclear expression of YB-1 protein correlates with Pglycoprotein expression in human breast carcinoma. Cancer Lett 190, 191-197. Sanfilippo O, Ronchi E, De Marco C, Di Fronzo G, and Silvestrini R (1991) Expression of P-glycoprotein in breast cancer tissue and in vitro resistance to doxorubicin and vincristine. Eur J Cancer 27, 155-158. Scheffer GL, Schroeijers AB, Izquierdo MA, Wiemer EA, and Scheper RJ (2000) Lung resistance-related protein/major vault protein and vaults in multidrug-resistant cancer. Curr Opin Oncol 12, 550-556.

Vulevic B, Chen Z, Boyd JT, Davis W Jr, Walsh ES, Belinsky MG, and Tew KD (2001) Cloning and characterization of human adenosine 5'-triphosphate-binding cassette, subfamily A, transporter 2 (ABCA2). Cancer Res 61, 33393347. Walker JE, Saraste M, Runswick MJ, and Gay NJ (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1, 945-951. Wallner J, Depisch D, Hopfner M, Haider K, Spona J, Ludwig H, and Pirker R (1991) MDR1 gene expression and prognostic

90


Cancer Therapy Vol 1, page 91 factors in primary breast carcinomas. Eur J Cancer 27, 1352-1355. Wang CS, LaRue H, Fortin A, Gariepy G, and Tetu B (1997) mdr1 mRNA expression by RT-PCR in patients with primary breast cancer submitted to neoadjuvant therapy. Breast Cancer Res Treat 45, 63-74. Wijnholds J, Mol CA, van Deemter L, de Haas M, Scheffer GL, Baas F, Beijnen JH, Scheper RJ, Hatse S, De Clercq E, Balzarini J, and Borst P (2000) Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proc Natl Acad Sci USA 97, 7476-7481.

transporter-D) in human embryonic kidney 293 cells confers resistance to anticancer agents. Cancer Res 59, 5964-5967.

Wishart GC, Plumb JA, Going JJ, McNicol AM, McArdle CS, Tsuruo T, and Kaye SB (1990) P-glycoprotein expression in primary breast cancer detected by immunocytochemistry with two monoclonal antibodies. Br J Cancer 62, 758-761. Yang X, Uziely B, Groshen S, Lukas J, Israel V, Russell C, Dunnington G, Formenti S, Muggia F, Press and MF (1999) MDR1 gene expression in primary and advanced breast cancer. Lab Invest 79, 271-280.

Dr. Hermann Lage

Zeng H, Bain LJ, Belinsky MG, and Kruh GD (1999) Expression of multidrug resistance protein-3 (multispecific organic anion

91


Lage: Drug resistance in breast cancer

92


Cancer Therapy Vol 1, page 93 Cancer Therapy Vol 1, 93-101, 2003.

Screening for lung cancer: a review and current status Review Article

Debora S. Bruno and William Tester* Albert Einstein Cancer Center, 5501 Old York Road, Philadelphia, PA 19141

__________________________________________________________________________________ *Correspondence: William Tester, MD, FACP, Albert Einstein Cancer Center, 5501 Old York Road, Philadelphia, PA 19141; Tel: 215-456-3800; e-mail: testerb@einstein.edu Key words: lung cancer, screening, spiral computed tomography, sputum immunocytochemistry Received: 05 May 2003; Accepted: 08 May 2003; electronically published: May 2003

Summary Lung cancer is the leading cause of cancer death in the USA. The overall 5-year survival rate for patients diagnosed with this disease is estimated at 15%. The major reason that the cure rate is so low is that the great majority of lung tumors are found at late stages. After the disappointing results of the National Cancer Institute sponsored trials in the 1970â&#x20AC;&#x2122;s, there was widespread acceptance that screening for lung cancer is not indicated, since none of the randomized screening trials demonstrated a reduction in cancer-related mortality. However, longer follow-up from these early studies does show that individuals who were screened and underwent surgery for early stage lung cancer did experience improved survival. Also, earlier detection has been associated with improved survival for patients with cervical and colon cancer. Some recent studies suggest that the use of newer screening tools may result in improved lung cancer mortality. The objectives of this paper are to review the older prospective screening studies, and to discuss the possible biases and study design flaws that might have affected the outcome of those screening trials. This work will also define populations considered to be at high risk for the development of lung cancer and that should most benefit from screening. The early results of trials employing new techniques for lung cancer screening such as spiral computed tomography, positron emission tomography (PET) scanning and sputum immunocytochemistry for the detection of potential curable lung cancers are presented. for curative treatment, it has been hoped that detection of early stage cancer in asymptomatic individuals can result in meaningful benefit (Mulshine et al, 1989).

I. Introduction Lung cancer is the leading cause of death from cancer in the USA, accounting for more deaths per year than cancers of the breast, colon, prostate, and cervix combined (Bach et al, 1999; Parkin et al, 1999). The American Cancer Society estimates there will be 169,500 new cases of lung cancer diagnosed in 2002 and 157,400 deaths (American Cancer Society, 2003). Lung cancer usually presents as an advanced, unresectable tumor and is usually fatal disease. It has been a challenge during the past decades to develop efficient screening tools and treatment for such an aggressive neoplasm. The overall survival at five years measured by the National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) program in the United States is 14%. For European countries, the average five-year survival is 8%, the same as for developing countries (Parkin et al, 1999; Black, 2000). However, for resectable patients with pathologic stage I non-small-cell lung cancer, 5-year survival rates range from 65 to 80% (Flehinger et al, 1992; Inoue et al, 1998). Since stage I disease has the potential

II. What population is under high risk for the development of lung cancer? The risks and benefits of screening methods make them applicable predominantly to high-risk populations, since costs and harms that they might generate can only be justified by a reduction in mortality for that specific cause screened. Factors that identify those at risk for lung cancer have been recognized through epidemiologic study over the past 30 years (Tockman et al, 1987). There are two categories of evidence that indicate smoking to be the major cause of human lung cancer. Without exception, epidemiological studies have demonstrated a consistent association between smoking and lung cancer in both genders. Also, chemical analyses of cigarette smoke reveal a multitude of known mutagens and carcinogens that are absorbed and metabolized, and 93


Bruno and Tester: Screening for lung cancer cause demonstrable genetic changes in smokers (Loeb et al, 1984; McLemore et al, 1990). Across studies, risk increases with: number of cigarettes smoked (the relative risk is 3.0 for 1 pack-per-day smokers), years smoked, earlier age at onset of cigarette smoking, degree of inhalation, tar and nicotine content of cigarettes smoked and use of nonfiltered compared with filtered cigarettes (Loeb et al, 1984). Lung cancer rates decrease when smoking is stopped and approaches those of people who have never smoked at 10 years after cessation (Garfinckel and Silverberg, 1991). A study from the United Kingdom evaluating the relationship between smoking, smoking cessation and lung cancer points to the fact that even people who stop smoking at 50 or 60 years of age avoid most of their subsequent risk of developing lung cancer, and those who stop at 30 years of age avoid more than 90% of the risk attributable to tobacco of those who continue to smoke (Peto et al, 2000). Advanced age is also considered a risk factor for lung cancer development. Tockman and colleagues (1987) reported a 2.8 relative risk for lung cancer for an age of greater than 59 years. Most screening programs to date have incorporated a minimum age cut-off of 45 years for recruitment of subjects to be screened. Among cigarette smokers, the presence of airways obstruction is a greater risk for the subsequent development of lung cancer than is age alone or the level of smoking. A measure of the forced expiratory volume in the first second (FEV1) of less than 60% of the predicted value is associated with a 6.4 times greater risk for lung cancer compared with the risk associated with the absence of ventilatory impairment (Tockman et al, 1987). One possible explanation could be that chronic obstructive pulmonary disease may interfere with the ability of the airways to eliminate inhaled carcinogens effectively (Cohen, 1980). In the presence of damaged bronchial mucosa and prolonged exposure to carcinogens, a carcinogenic effect would be enhanced. Occupational exposure is estimated to account for approximately 5% of lung cancer in the United States (Beckett, 2000) and the majority of these cancers are caused by asbestos, followed by radon, silica, chromium, cadmium, nickel, arsenic and beryllium. Among these, asbestos has received the most study (Weiss, 1999). Cigarette smoke and asbestos interact strongly in causing bronchogenic carcinomas and the evidence indicates that the presence of asbestosis is a much better predictor of excess lung cancer risk than measures of exposure to asbestos. Patients with resected stage I NSCLC (T1N0M0 and T2N0M0) have an annual incidence of a second primary lung cancer of 3-5% and this is an order of magnitude greater (10-fold greater) than the incidence experienced by the middle-aged, heavy smokers in the NCI Early Lung Cancer trial almost two decades ago (Mountain, 1997). Second primary lung cancer (SPLC) has been defined as a lung cancer, either of a different histologic cell type which appears within 2 years following resection of the index cancer, or as a tumor of the same cell type, that has characteristics of a primary lung cancer and arises in a

different lobe if it appears after 2 years following resection (Tockman et al, 1988). Since cured NSCLC patients exhibit such high rates of second lung cancer they might constitute an appropriate population for early detection and chemoprevention trials. Similarly, patients successfully treated for head and neck cancers and small cell lung cancer (SCLC) are at high risk for second primary lung cancer. Association of a squamous cell carcinoma of the head and neck and a pulmonary cancer is frequent: prevalence is about 5 to 10% (De Mones et al, 1999). Also, cured SCLC patients have one of the highest rates of second primary tumor (SPT) development, being SPTs the most common cause of cancer death 4 or more years after definitive primary therapy. SPTs occur most commonly in tobacco-exposed sites (i.e., lungs, esophagus and head and neck) (Lippman et al, 1994). Currently no available diagnostic procedure has yet been proven to be of significant value for general use in the early detection of lung cancer in these high-risk populations.

III. Early lung cancer detection - early trials Much research has been conducted to evaluate the effectiveness of various combinations of screening tests on lung cancer mortality. In the 1950s and 1960s, several uncontrolled and nonrandomized controlled studies evaluated various combinations of roentgenograms and cytology given at various time intervals, ranging up to once every 6 months. These studies failed to show a benefit from lung cancer screening (Eddy, 1989). The lack of success of those previous sputum cytologic screening programs has been attributed in part to the technical inability to localize the source of expectorated cancer cells in patients with negative chest roentgenograms (Berlin et al, 1984). With the development of the fiberoptic bronchoscope, localization of occult endobronchial neoplasms became possible and in the early 1970s it became feasible to design studies to determine whether a reduction in lung cancer mortality might be achieved by screening cytology and chest roentgenography (Berlin et al, 1984; Carbone et al, 1970). From 1971 to 1982, three National Cancer Institute sponsored studies on Screening for Early Lung Cancer were conducted at the Mayo Clinic, Johns Hopkins and Memorial Sloan-Kettering Cancer Center. Those studies enrolled a total of 31,360 men 45 years of age and older who smoked at least 1 pack of cigarettes per day or had smoked this amount within the year prior to enrollment. In the Mayo Clinic trial, all participants received chest roentgenograms and sputum cytologic examinations prior to random allocation into screened and control groups (Figure 1) (Fontana et al, 1984; Fontana et al, 1986; Sanderson, 1986). Those free of cancer were randomized to a study group (chest roentgenograms and sputum cytologic tests every 4 months), or a control group (recommendations for annual chest roentgenograms and sputum cytology, without efforts to assure compliance). 94


Cancer Therapy Vol 1, page 95 The study design unfortunately failed to establish that the control group was truly not screened. More than half of the control population underwent periodic screening, including recommendations described above. The Johns Hopkins and Memorial Sloan-Kettering studies randomly allocated their volunteers into “dual screen” and “X-ray only screen” groups (Figure 2) (Melamed et al, 1984; Tockman, 1986). The dual-screen group received an annual chest roentgenogram examination plus annual sputum cytologic testing followed by a 3-day collection of sputum for cytologic examination every 4 months. The “X-ray only” group received only annual chest roentgenograms. Results of the initial screen (prevalence) of the three trials showed that 2,815 patients were found to have indeterminate abnormalities on the screening roentgenograms or x-rays considered “suspicious for cancer”, indicating the need for further evaluation. From those patients, 120 (4.3%) were found to have lung cancer. Only 79 (0.4%) of the 21,127 men who received the dual screen had sputum examinations reported as showing either marked atypia or carcinoma cells. From those patients, 55 had lung cancer and 12 had cancer of the upper respiratory tract (predictive value of 85%). Of the 160 cases detected in the dual-

screen group, 67 (41%) would have been detected by cytologic examination alone and 123 (77%) by X-ray alone. Half of the lung cancers detected on dual screening (81 patients) were stage I. Those that were stage I and were resected had a 5-yr survival that was almost 80%. Of the 81 stage I lung cancers, approximately 60% were visible roentgenographically and nearly 40% were roentgenographically occult and detected by cytology alone. The early stage cancers detected by cytology alone were central squamous cell carcinomas. The most frequently encountered early-stage cancers detected by roentgenograms alone were peripheral adenocarcinomas. Only 9% of stage I cancers were detected by both techniques. It is clear that a higher proportion of early stage cancers were detected and that patients staged as I or II had a better 5-year survival than those in stage III. However, the three trials failed to demonstrate improved resectability or survival rates among the study groups compared to the controls. These trials did not produce lowered overall lung cancer mortality, which is considered the ultimate indicator of the effectiveness of a screening test.

Prevalence screening 10,933 male outpatients, smokers (1 ppd or more) Chest x-ray and sputum cytology

91 cases of lung cancer • 59 cases diagnosed by x-ray • 17 cases diagnosed by cytology • 15 cases diagnosed by both

9,211 men free of disease entered into prospective or incidence screening

Screening group: Chest x-ray and sputum cytology every 4 months

206 new “incidence” lung cancer cases, with 5-year survival rate of 40%

Figure 1: The Mayo Lung Project

95

Control group: Recommendations for annual chest x-ray and sputum cytology, without any efforts to assure compliance

160 new “incidence” lung cancer cases, with 5-year survival rate of 15%


Bruno and Tester: Screening for lung cancer

Prevalence screening 10,040 male smokers assigned to either dual screening or xray-only

Single screen with chest xrays detected 144 cases of lung cancer

Dual screen with chest x-ray annually plus sputum cytology detected 144 cases of lung cancer

73 resectable cancers, 40% stage I NSCLC

77 resectable cancers, 40% stage I NSCLC

5-year survival rates for both groups were equivalent: 35% 5-year survival for the stage I NSCLC: 76% Figure 2: The Memorial Sloan-Kettering Project

The Mayo Lung Project reported that the 5-year survival for patients who developed lung cancer was better in the screened group (40% versus 15%). However, with extended follow-up the overall lung cancer mortality for the entire population screened was not shown to be improved (Marcus et al, 2000). An analysis (Strauss, 2002) performed to determine which endpoint of that study (survival versus mortality) provides an unbiased measure of effectiveness shows that among resected patients, survival at 7 years was 50% (96% CI, 39% to 61%). The survival plateau demonstrated in the KaplanMeier survival curves argues in favor that overdiagnosis is not a confounder factor. In contrast, among those not undergoing resection, survival at 5 years was only 2% (95% CI, 1% to 8%). The author concluded that survival was superior in the screened population, and that this advantage was not attributable to lead-time bias, length bias, or overdiagnosis bias. Mortality though was biased, because incidence differences (30% higher incidence in the screened group) confounded the ability of mortality to reflect the true effect of screening.

The first of these is lead-time bias: patients who are diagnosed at an early stage in their illness may appear to survive longer than those diagnosed at a later stage only because the diagnosis is established for a longer period of time. Length bias is related to tendency of slow-growing tumors to be discovered during screening while fastgrowing tumors are more likely to become clinically evident between screening intervals. Length bias is expected to improve survival rates for those patients who had a better prognosis from the start. However, if any of these biases accounted for the favorable survival in the screened groups of the Mayo, Sloan-Kettering and Hopkins studies reported above, one would expect that the same stage I patients would have comparable survival even if they remained untreated. Fortunately, this data is available. Although the majority of patients in those studies diagnosed with a stage I non-small-cell lung cancer were treated by surgical resection, 5 to 21% of patients with stage I NSCLC failed to be treated surgically either because patients refused surgery or because there were medical contraindications to surgery. Flehinger (1992) described five-year survivals (with lung cancer death as an endpoint) for those who were operated on ranged from 52 to 62%, while for those who did not undergo surgery survival ranged from 0 to 8%. The third type of potential bias, and perhaps the only screening bias that can account for improvements in stage

IV. Possible Causes of Screening Biases In the evaluation of a screening program, several potential sources of bias must be considered: lead-time bias, length bias and overdiagnosis (MacLean, 1996). 96


Cancer Therapy Vol 1, page 97 distribution, resectability, survival, higher incidence, and equal mortality as end-point in a screened compared to a control population is overdiagnosis (Strauss et al, 1993; Strauss, 1997; Strauss et al, 1997). This term refers to the detection, by screening, of lesions that are not clinically significant and would not adversely affect the lifespan of a patient. It means that some of the slow growing cancers never would have been diagnosed in the absence of screening and those individuals would have died of another disease without their subclinical cancer being recognized (Parkin and Moss, 2000). This concept is especially applicable for slow-growing neoplasms such as prostate cancer. It is well known that the clinical incidence of this disease does not match the prevalence noted at autopsy, where more than 40% of men over 50 years of age are found to have carcinoma of the prostate, while 9.5% of 50 year-old men will actually develop clinically apparent disease over their lifetime (Fried et al, 1997). In a series of over 20,000 autopsies carried out over a 25-year period, 700 cancers (11%) were found in whom the diagnosis of cancer had not been considered relevant clinically (Karwinski et al, 1990). In over half of them the unrecognized tumor was considered an incidental finding, being kidney and prostate the main organs involved in those cases. In contrast, the unrecognized cancers that caused death were almost often from pancreas or lung. These patients tended to be older than those with clinically recognized disease. In conclusion, it seems that because of its biological behavior, lung cancer is unlikely to be an overdiagnosed neoplasm in screening programs.

under way (Tockman et al, 1994; Mulshine et al, 2000) In this study, eleven centers collaborated in the accrual of 1,000 patients with stage I NSCLC who had undergone complete resection. Any patient currently in follow-up 6 months or more after surgical resection, chemotherapy or radiotherapy performed an annual sputum induction. The MoAbs examined in this study are 624H12 and 703D4, the same ones shown to be of value in retrospective studies. Preliminary results from this study indicate that when the predictive value of MoAb markers is compared to routine morphologic study, the positive predictive value of hnRNP MoAb is 67% (Mulshine, 1999). Another promising technology for screening is the detection of growth factors associated with chronic lung injury and transformation of this epithelium from normal, to dysplastic, to frankly invasive cancer. Gastrin-releasing peptide (GRP), Insulin-like Growth Factor I (IGF-I) and Transferrin (TF) are examples of growth factors associated with carcinogenesis. The presence of elevated levels of these growth factors in the bronchial lavage of subjects at high risk for lung cancer may provide complementary information to the sputum immunostaining regarding the early detection of lung cancer (Mulshine et al, 1991). Also, the knowledge of the existence of such molecules has lead to development of monoclonal antibodies, which might be of value as therapy in high-risk individuals. More recently, new early lung cancer screening programs have been designed using low-dose spiral computed tomography (CT) to improve the likelihood of detection of small non-calcified nodules, and thus of lung cancer at an earlier and potentially more curable stage. Once exposure to radiological examinations is associated with the risk of induction of malignancy, this has to be balanced against the benefits of early detection of a malignant tumor. Effective dose equivalent ranges from 0.06 to 0.25 millisieverts (mSv) with chest radiography in 2 views, 3-27 mSv with CT using conventional examination parameters, and 0.3-0.55 mSv using low dose CT settings. Based on considerations by the International Commission on Radiological Protection, it can be expected that radiation exposure with an effective dose equivalent of 1 mSv would lead to 5 additional malignancies in 100,000 individuals exposed (International Commission on Radiological Protection, 1991). The results of a Japanese study conducted by Kaneko et al (1996) brought to focus the idea of screening highrisk populations for lung cancer using a new screening method: spiral CT. A total of 1,369 members from the forprofit organization called Anti-Lung Cancer Association (ALCA) â&#x20AC;&#x201C; mostly men, average age 60 years and smokers (> 20 pack-year) were submitted to dual screening using spiral CT and chest radiography. Chest radiography was able to detect only 4 of the 15 cases of lung cancer that were diagnosed with low-dose spiral CT. Although the yield was low, these results confirmed the superiority of that new technique in the detection of early stage peripheral lung cancers. Sone and colleagues (1998) developed a massscreening program also in Japan to evaluate the usefulness

V. Innovative screening technologies The specimens obtained during the NCI-sponsored trials provided a potential means for identifying other markers of early lung cancer (Mulshine, 1999). To develop a more sensitive detection technique, Tockman and co-workers used immunostaining of sputum cells with lung cancer-associated monoclonal antibodies (MoAbs) to determine if early preneoplastic cytologic changes of lung cancer could be more reliably detected (Mulshine et al, 1991). Using the two MoAbs 703D4 and 624H12, developed against non-small cell and small-cell lung cancer cells, specimens from the Johns Hopkins study were reexamined. They found that in subjects with moderate atypical metaplasia, these antibodies could predict the later development of lung cancer at least 2 years prior to clinical recognition, with a sensitivity of 91% and a specificity of 88% (Tockman et al, 1988). Of the 22 known positive cases of lung cancer, 20 were detected by dual antibody analysis. Nineteen of these cases were recognized by the 703D4 MoAb alone, whereas 624H12 was less sensitive, detecting eight cases of lung cancer alone. Because of the higher sensitivity of the 703D4 antibody, much of the biochemical research has been focused on this marker 12 that recognizes heterogeneous nuclear ribonucleoprotein (hnRNP) A2/B1 involved in cellular proliferation and the carcinogenesis cascade. A prospective validation trial of sputum immunocytochemical early detection of the lung cancer is 97


Bruno and Tester: Screening for lung cancer of annual screening for lung cancer by low-dose CT and the characteristics of identified lung cancers. The prevalence data obtained in 1996 showed that among 5,483 individuals aged between 40 and 74 years, including smokers and non-smokers, suspicious nodules were detected in 279 (5.1%) subjects and 22 (8% of the 279) were confirmed surgically to have lung cancer. Corresponding figures in 1997 were 173 suspicious nodules of 4425 individuals, being 25 of them (14%) confirmed to be lung cancers. In 1998, 136 of 3878 (3.5%) individuals were diagnosed with suspicious nodules and of those only 9 (7%) of them were confirmed malignant. The mean size of lesions was 17mm and CT identified almost ten times as many cancers (0.48%) than a standard mass screening done 1 year before in the same area using roentgenograms and sputum cytology (0.03-0.05%). The sensitivity and specificity of detecting surgically confirmed lung cancers were 55% and 95%, respectively, in 1996. The sensitivity and specificity were 83% and 97% in the 1997 screening. Of the 60 cases of lung cancers identified in the screening 88% were surgically confirmed as stage IA. Such a small number of neoplasms detected in this study can be attributed to the fact that the screening was done in a rural area of Japan where the rate of lung cancer has been reported to be low. That constituted a lowrisk population, once non-smokers were included in the study. The Early Lung Cancer Action Project (ELCAP) was designed to evaluate baseline and annual repeat screening by low-dose CT in people at high risk of lung cancer and is under way at Cornell University-New York Presbyterian Hospital. The projectâ&#x20AC;&#x2122;s overall design and findings from baseline screening were recently published (Henschke et al, 1999). ELCAP has enrolled 1,000 symptom-free volunteers, aged 60 years or older, with at least 10 packyears of cigarette smoking, who were medically fit to undergo thoracic surgery. Non-calcified nodules were detected three times more commonly than by chest radiography, malignant tumors four times more commonly, and stage I tumors six times more commonly. Of the 27 CT-detected lung cancers, 26 (96%) were resectable, compared to only 30 (51%) of the 59 tumors detected on baseline chest radiography done under Mayo Lung Project. Critics to this study include mainly lack of randomization of subjects to a non-screened arm and a number of enrolled individuals that is not sufficient to provide statistical power to evaluate impact in survival and mortality in long-term follow-ups. Another prospective cohort study conducted at Mayo Clinic enrolled 1,520 individuals aged 50 years or older who had smoked at least 20 pack-years to undergo a baseline screening with spiral computed tomography and sputum cytology followed by a three-year annual screening (Swensen et al, 2002). One or more lung nodules were identified in 1,000 (66%) of the 1,520 participants, although primary lung cancers were documented in only 25 of the 1,464 individuals (1.7%) who returned for the first of their annual incidence scans and sputum examinations. CT alone detected 23 cases and sputum cytology alone detected 2 cases. Twelve (57%) of the 21 non-small cell cancers detected by computed

tomography were stage IA, although a stage shift can not be confirmed. Of significant concern was the extremely high rate of false-positive results lesions identified by the spiral CT. The study conducted by Diederich et al (2002) at the University of MĂźnster, Germany, screened with low-dose spiral CT a total of 817 asymptomatic smokers (minimum age of 40 years and minimum tobacco consumption of 20 pack-years). The authors were able to demonstrate a prevalence of lung cancer of 1.3% in this high-risk population. Only seven out the twelve lesions (58%) diagnosed as being malignant were actually stage I. Nawa et al (2002) developed another screening program in Japan, targeting health care professionals. From April 1998 to August 2000, spiral CT screening was performed as part of annual health examinations on a total of 7,956 individuals. The majority of patients were men, with ages ranging from 50 to 59 years. 62.1% of the subjects were current or former smokers. After baseline screening, a total of 36 cases of primary lung cancer were histologicaly confirmed (0.44% prevalence). 28 patients (77.7%) were classified as stage IA. The most common histology was adenocarcinoma (35 of 37) and the mean diameter was 17 mm. The retrospective study by Patz et al (2000) evaluated 510 patients with surgically resected, pathologic stage IA NSCLC. The purpose of this study was to determine the relationship between size and survival in patients with stage IA NSCLC (lesions < 3 cm). No correlation between decrease in tumor dimension and improvement in survival was found, and the authors used this result to caution against the use of low-dose spiral CT as an effective tool for early diagnosis of lung cancer. One explanation why the expected relationship between tumor size and survival was not observed was the fact that the authors reported survival based on deaths from all causes, rather than deaths related only to lung cancer (Black, 2000). Nearly half of deaths in those patients were actually due to other causes and the inclusion of these deaths may have reduced the power of this study to detect differences in lung cancer survival. The size of the studied population was also a concern regarding the statistical power of that study when it comes to evaluation of cancer survival. In summary, several studies have evaluated the utility of CT screening in the detection of early lung cancer. Depending largely upon the population studied, it appears that the detection rates range from 0.4% to 1.7%. The tumors detected tend to be small, peripheral, and are resectable in 50-70% of cases. None of these studies included a prospective control group, therefore the true effect of CT screening on cancer related mortality is unknown. Positron emission tomography (PET) has gained attention as a new modality that appears useful in differentiating benign from malignant lesions when investigating a solitary pulmonary nodule detected previously by chest radiographs or CT scans. The technique is based on the uptake of a radioactive glucose, fluorodeoxyglucose, in metabolically active cells. In a

98


Cancer Therapy Vol 1, page 99 recent study, Pitman and colleagues (2001) evaluated the accuracy of blinded reading of PET scans in 40 of 60 consecutive patients referred for evaluation of an indeterminate lung nodule or mass. The results showed that PET yielded 23 true positives, 13 true negatives, 3 false positives (2 tuberculosis, 1 sarcoidosis) and 1 false negative (an adenocarcinoma), giving a sensitivity of 96%, a specificity of 81%, a negative predictive value of 93% and a positive predictive value of 88% for malignancy. When it comes to the discussion whether it is cost effective to screen individuals using expensive techniques, Mahadevia and colleagues (2003) evaluated the potential clinical and economic implications of an annual lung cancer-screening program based on helical CT. Using a computer-simulated model they compared annual helical CT screening to no screening for hypothetical cohorts of 100,000 current, quitting, and former heavy smokers. Over a 20-year period, assuming a 50% stage shift, the current heavy smoker cohort had 13% lung cancer-specific mortality reduction, with cost-effectiveness measured at $ 116,300 per quality-adjusted life-year (QALY) gained. The QALY is a measure of the quantity of life gained from a treatment, weighted by the quality of that life. It is generally agreed that any intervention costing more than $100,000 per QALY is not considered to be cost-effective (Earle et al, 2000). Therefore, spiral CT was not considered a cost-effective tool for lung cancer screening by the results of that study. Several additional studies are currently under way. The National Cancer Institute and the American College of Radiology Imaging Network is enrolling 25,000 persons at high risk for lung cancer for a multicenter, randomized-controlled trial (National Cancer Institute and American College of Radiology Imaging Network, 2003). The study has the objective to compare lung cancerspecific mortality in high-risk subjects who undergo lowdose spiral CT scan of the chest versus chest radiography. In addition, the National Lung Screening Trial (NLST) â&#x20AC;&#x201C; sponsored by the National Cancer Institute- has been enrolling participants for what will become the largest

randomized controlled screening trial for lung cancer (Figure 3) (National Institutes of Health, National Cancer Institute, 2002). A total of 50,000 participants (25,000 per arm) will be accrued for this study within 2 years. The study aims to compare spiral computed tomography and chest radiography as screening tools for lung cancer. The study as it is designed has sufficient power to determine if there is 20% or greater reduction in lung cancer mortality by either technique.

VI. Conclusions Screening for lung cancer has been the target of extensive research and controversy over the past decades. A high risk population can be identified, including smokers, those submitted to occupational exposures and survivors of prior lung cancer and head and neck cancer. Previous screening trials showed limited value on early detection and mortality. Those studies, however, did not employ modern technology and some suffered from flaws in their design. An enthusiastic era of prospective trials using promising technologies such as low-dose spiral CT and sputum immunocytochemistry is facing again the challenge of proving that early detection of lung cancer can actually save lives. Until positive results of such studies are available assuring the practice of mass screening for lung cancer in high-risk populations, the decision to screen asymptomatic patients remains an individual decision. Physicians must consider the current value of available screening techniques, their patientsâ&#x20AC;&#x2122; level of risk and whether they would be suitable for surgical intervention before making individualized decisions for screening. Until prospective studies of lung cancer screening show a significant improvement in mortality, general population-based screening cannot be routinely recommended.

50,000 current or former smokers assigned to screening with either chest radiography or spiral CT

25,000 individuals to be screened with chest radiography

25,000 individuals to be screened with spiral computed tomography

Figure 3: The National Lung Screening Trial (NLST)

99


Bruno and Tester: Screening for lung cancer 3302-3317. Eddy DM (1989) Screening for lung cancer. Ann Intern Med 111, 232-237. Flehinger BJ, Kimmel M, Melamed MR (1992) The effect of surgical treatment on survival from early lung cancer. Chest 101, 1013-1018. Fontana RS, Sanderson DR, Taylor WF, et al (1984) Early Lung cancer detection: results of the initial (prevalence) radiologic and cytologic screening in the Mayo Clinic study. Am Rev Respir Dis 130, 561-565. Fontana RS, Sanderson DR, Woolner LB, et al (1986) Lung cancer screening: the Mayo program. J Occup Med 28, 746750. Frank E, Winkleby MA, AltmanDG, et al (1991) Predictors of physicians’ smoking cessation advice. JAMA 266, 31393144. Fried RM et al (1997) Prostate cancer screening and management. Med Clin North Am 81, 801. Garfinckel L, Silverberg E (1991) Lung cancer and smoking trends in the United Sates over the past 25 years. CA 41, 137.

Until the results of these ongoing prospective studies are known, we cannot recommend population screening. However, we can identify individuals at extremely high risk for lung cancer. These individuals would include those with smoking history of greater than 20 pack years who would be surgical candidates plus (1) a history of resected stage I lung cancer, (2) early stage head and neck cancer that appears cured, and/or (3) abnormal pulmonary function tests (FEV1 < 60% of predicted). However, there is strong evidence that the most effective approach to lung cancer is primary prevention– cessation of cigarette smoking (Wolpaw et al, 1996). Attention to this area needs to increase despite their difficulties and frustration. Although physicians agree that it is appropriate for doctors to counsel patients to stop smoking, they are inconsistent in providing such advice. The most commonly reported barriers to counseling are the belief that most patients are uninterested, perceived lack of skills and time constrains (Frank et al, 1991; Jaen et al, 1994). Studies have found though, that brief, directive smoking interventions delivered during routine care are cost-effective and have the potential for significant public health benefit. The assessment of smoking status and smoking cessation interventions should be definitely integrated into standard office practice (Robinson et al, 1995).

Henschke CI, McCauley DI, Yankelevitz DF, et al (1999) Early Lung Cancer Action Project: overall design and findings from baseline screening. The Lancet 354, 99-105. Inoue K, Sato M, Fujimura S, Sakurada A et al (1998) Prognostic assessment of 1310 patients with non-small-cell lung cancer who underwent complete resection from 1980 to 1993. J Thorac Cardiovasc Surg 116, 407-411. International Commission on Radiological Protection (1991) 1990 Recommendations, Publication 60. Oxford, England: Pergamon Press.

References American Cancer Society: Cancer Facts and Figures 2003. Atlanta, GA: American Cancer Society. Last accessed March 24, 2003.

Jaen CR, Stange KC, Nutting PA (1994) Competing demands of primary care: a model for the delivery of clinical preventive services. J Fam Pract 38, 166-171. Kaneko M, Eguchi K, Ohmatsu H, Kakinuma R, Naruke T, Suemasu K, Moriyama N (1996) Peripheral lung cancer: screening and detection with low-dose spiral CT versus radiography. Radiology 201, 778-802.

Bach PB, Cramer LD, Warren JL, Begg CB (1999) Racial differences in the treatment of early-stage lung cancer. N Engl J Med 34, 1198-1205. Beckett WS (2000) Occupational respiratory diseases. N Engl J Med 342, 406-413. Berlin NI, Buncher R, Fontana RS et al (1984) The National Cancer Institute Cooperative Early Lung Cancer Detection Program – Results of the initial screen (Prevalence). Am Rev Respir Dis 130, 545-549.

Karwinski B, Svendsen E, Hartveit F (1990) Clinically undiagnosed malignant tumors found at autopsy. APMIS 98, 496-500. Lippman SM, Benner SE, Hong WK (1994) Cancer Chemoprevention. J Clin Oncol 12, 851-873. Loeb LA, Ernster VL, Warner KE et al (1984) Smoking and lung cancer: an overview. Cancer Res 44, 5940-5958.

Black, WC (2000) Unexpected Observations on Tumor Size and Survival in Stage IA Non-small Cell Lung Cancer. Chest 117, 1532-1534. Carbone PP, Frost JK, Feinstein AR, et al (1970) Lung cancer: early detection, diagnosis and localization. In: Lung cancer: perspectives and prospects. Ann Intern Med 73, 1003-1024. Cohen BH (1980) Chronic obstructive pulmonary disease: a challenge in genetic Epidemiology. Am J epidemiol 112, 247-288.

MacLean CD (1996) Principles of Cancer Screening. Med Clin North Am 80:1-14.

De Mones E, Hans S, Le Pimpec-Barthes F, Riquet M, Laccourreye O, Brasnu D (1999) Squamous cell carcinoma of the head and neck and pulmonary cancer. Report of 50 cases. Ann Otolaryngol Chir Cervicofac 116, 341-350. Diederich S, Wormanns D, Thomas M, Lenzen H, Roos N, Heindel W (2002) Screening for early lung cancer with lowdose spiral CT: prevalence in 817 asymptomatic smokers. Radiology 222, 773-781.

Marcus PM, Bergstralh EJ, Fagerstrom RM (2000) Lung Cancer Mortality in the Mayo Lung Project: Impact of Extended Follow-up. Journal of the NCI 92: 1308-1316.

Earle CC, Chapman RH, Baker CS, Bell CM, Stone PW, Sandberg EA, Neumann PJ (2000) Systematic Overview of Cost-Utility Assessments in Oncology. J Clin Oncol 18,

Melamed MR, Flehinger BJ, Zaman MB, et al (1984) Screening for early lung cancer – Results of the Memorial SloanKettering Study in New York. Chest 86, 44-53.

Mahadevia PJ, Fleisher LA, Frick KD, Eng J, Goodman SN, Powe NR (2003) Lung Cancer Screening with Helical Computed Tomography in Older Adult Smokers: A Decision and Cost-effectiveness Analysis. JAMA 289, 313-322.

McLemore TL, Adelberg S, Liu MC et al (1990) Expression of CYP1A1 gene in patients with lung cancer: evidence for cigarette smoke-induced gene expression in normal lung tissue and for altered gene regulation in primary pulmonary carcinomas. J Natl Cancer Inst 82, 1333-1339.

100


Cancer Therapy Vol 1, page 101 Mountain CF (1997) Revisions in the international system for staging lung cancer. Chest 111, 1710-1717. Mulshine JL (1999) Reducing Lung Cancer Risk – Early detection. Chest 116, 493S-496S.

Robinson MD, Laurent SL, Little JM Jr (1995) Including smoking status as a new vital sign: it works. J Fam Pract 40, 556-563. Sanderson DR (1986) Lung Cancer Screening – The Mayo Study. In: IV World Conference on Lung Cancer. Chest 84, 324S. Sone S, Takashima S, Li F, et al (1998) Mass screening for lung cancer with mobile spiral computed tomography scanner. The Lancet 351, 1242-1245.

Mulshine JL, De Luca LM, Dedrick RL, et al (2000) Considerations in Developing Succseeful, Population-Based Molecular Screening and Prevention of Lung Cancer. Cancer 89, 2465S-2467S. Mulshine JL, Tockman MS, Smart CR (1989) Considerations in the development of lung cancer screening tools. J Natl Cancer Inst 81, 900-905.

Strauss GM (1997) Measuring Effectiveness of Lung Cancer Screening: From Consensus to Controversy and Back. Chest 112, 216S-228S.

Mulshine JL, Treston AM, Scott FM, et al (1991) Lung cancer: rational strategies for early detection and intervention. Oncology 5, 25-32.

Strauss GM (2002) The Mayo Lung Cohort: a Regression Analysis Focusing on Lung Cancer Incidence and Mortality. J Clin Oncol 20, 1973-1983. Strauss GM, Gleason RE, Sugarbaker DJ (1993) Screening for Lung Cancer Re-examined: a Reinterpretation of the Mayo Lung Project Randomized Trial on Lung Cancer Screening. Chest 103, 337S-341S.

National Cancer Institute and American College of Radiology Imaging Network. Randomized Screening Study of LowDose Helical Computed Tomography versus Radiography of the Chest in Participants at High Risk for Lung Cancer. Available at http://cancer.gov/clinicaltrials. Date last modified: December 23, 2003. National Institutes of Health, National Cancer Institute. Fifty thousand current and former smokers needed for National Lung Screening Trial. September 18, 2002. Available at http://cancer.gov/clinicaltrials. Accessibility verified March 24, 2003. Nawa T, Nakagawa T, Kusano S, Kawasaki Y, Sugawara Y, Nakata H (2002) Lung cancer Screening Using Low-Dose Spiral CT: Results of Baseline and 1-Year Follow-up Studies. Chest 122, 15-20. Parkin DM, Pisani P, Ferlay J (1999) Global cancer statistics. CA Cancer J Clin 49, 33-64.

Strauss GM, Gleason RE, Sugarbaker DJ (1997) Screening for Lung Cancer: Another Look; A Different View. Chest 111, 754-768. Swensen SJ, Jett JR, Sloan JA, Midthun DE, Hartman TE, Sykes AM, Aughenbaugh GL, Zink FE, Hillman SL, Noetzel GR, Marks RS, Clayton AC, Pairolero PC (2002) Screening for lung cancer with low-dose spiral computed tomography. Am J Respir Crit Care Med 165, 508-513. Tockman MS (1986) Survival and Mortality from Lung Cancer in a Screened Population – The Johns Hopkins Study. Chest 84, 324S-325S. Tockman MS, Anthonisen NR, Wright EC, Donithan MG (1987) The Intermittent Positive Pressure Trial Group and the Johns Hopkins Lung Project for the Early Detection of Lung Cancer. Ann Intern Med 106, 512-518. Tockman MS, Erozan YS, Gupta P, et al (1994) The early detection of second primary lung cancers by sputum immunostaining. Chest 106, 385s-390s.

Parkin MD, Moss SM (2000) Lung Cancer Screening: Improved Survival But No Reduction in Deaths – The Role of “Overdiagnosis”. Cancer 89, 2369S-2369S. Patz EF Jr, Rossi S, Harpole DH Jr, Herndon JE, Goodman PC (2000) Correlation of tumor size and survival in patients with Stage IA non-small cell lung cancer. Chest 117, 1568-1571. Peto R, Darby S, Deo H, Silcocks P, et al (2000) Smoking, smoking cessation, and lung cancer in the UK since 1950: combination of national statistics with two case-control studies. BMJ 321, 323-329.

Tockman MS, Gupta PK, Myers JD, et al (1988) Sensitive and specific monoclonal antibody recognition of human lung cancer antigen on preserved sputum cells: a new approach to early lung cancer detection. J Clin Oncol 6, 1685-1693. Weiss W (1999) Asbestosis: a marker for the increased risk pf lung cancer among workers exposed to asbestos. Chest 115, 536-549.

Pitman AG, Hicks RJ, Kalff V, Binns DS, Ware RE, McKenzie AF, Ball DL, MacManus MP (2001) Positron emission tomography in pulmonary masses where tissue diagnosis is unhelpful or not possible. Medical Journal of Australia 175, 303-7.

Wolpaw DR (1996) Early Detection in Lung Cancer: Case Finding and Screening. Med Clin North Am 80, 63-82.

101


Bruno and Tester: Screening for lung cancer

102


Cancer Therapy Vol 1, page 103 Cancer Therapy Vol 1, 103-107, 2003.

Expression of RB1CC1, a novel tumor suppressor gene, is inversely correlated with the Ki-67 proliferation index in primary breast cancers Research Article

Koji Teramoto1, Tokuhiro Chano2,3, Yoshitomo Ozaki1, Satoru Sawai1, Noriaki Tezuka1, Keiichi Kontani1*, Shozo Fujino1, Hidetoshi Okabe2 Departments of 1Surgery and 2Clinical Laboratory Medicine, Shiga University of Medical Science, Seta-tsukinowa, Otsu, Shiga 520-2192, Japan, 3PRESTO, Japan Science and Technology Corporation (JST)

__________________________________________________________________________________ *Correspondence: Keiichi Kontani, Department of Surgery, Shiga University of Medical Science, Seta-tsukinowa, Otsu, Shiga 5202192, Japan. Tel.: +81-77-548-2244; Fax: +81-77-544-2901; e-mail address: konbat@belle.shiga-med.ac.jp Key words: RB1CC1, RB1, Ki-67, tumor suppressor gene, breast cancer Received: 14 May 2003; Accepted: 21 May 2003; electronically published: May 2003

Summary Retinoblastoma 1 (RB1)-inducible coiled-coil 1 (RB1CC1) is a key regulator of RB1, and is frequently mutated in breast cancer. We examined RB1CC1 expression using immunohistochemical means and compared it with RB1 and Ki-67 labeling indices as well as estrogen receptor (ER) status in 54 primary breast cancers. RB1CC1 protein expression was absent in 8 cancers (15%), and RB1 protein was significantly decreased or absent in all of the cases lacking RB1CC1. These 8 cases showed no loss of heterozygosity (LOH) at the RB1 locus. Importantly, a loss of RB1CC1 was significantly correlated with a high Ki-67 index (p < 0.0001) and low ER status (p = 0.0123). RB1CC1 expression predicts tumor progression, and its prognostic value should to be established. (Chano, 2002a). We frequently observed RB1CC1 mutations in breast cancer, suggesting that the functional loss of RB1CC1 results in insufficient RB1 expression, which promotes dysregulation of the RB1CC1-RB1 pathway and subsequent tumorigenesis (Chano, 2002c). To clarify the incidence of RB1CC1 anomalies in primary breast cancers, we analyzed RB1CC1 expression by immunohistochemical methods and examined its relationship with various biopathological parameters in breast cancers from 54 patients. The important findings of the present study suggest that a loss of RB1CC1 expression accelerates cell proliferation.

I. Introduction Inactivation of the retinoblastoma 1 (RB1) gene is considered to play a central role in the pathogenesis of many human malignant neoplasms (Kamb, 1995; Taya, 1997; Kaelin et al, 1999). RB1 is also involved in tumorigenesis and tumor progression (Lemoine, 1994; T’Ang, 1998; Kaelin et al, 1999), and its expression is inversely correlated with its proliferative activity in breast cancer (T’Ang and Fung, 1991). The RB1 locus is genetically altered in 3 to 37% of breast cancers (Varley et al, 1989; Thorlacious et al, 1991; Lemoine, 1994; T’Ang, 1998; Kaelin et al, 1999; Bieche and Lidereau, 2000). However, it is not always responsible for the absence of RB1 expression under such conditions (Varley et al, 1989; Bieche and Lidereau, 2000), and other factors are probably involved in this phenomenon. RB1-inducible coiled-coil 1 (RB1CC1) is thought to be a transcription factor because it is in fact localized to the nucleus and it contains a nuclear localization signal, a leucine-zipper motif and a coiled-coil structure (Chano, 2002a,b). RB1CC1 is co-expressed with RB1 in various cancers and normal tissues (Chano, 2002a,b), where it functions as an inducible regulator of RB1 expression

II. Materials and methods A. Specimens We analyzed formalin-fixed and paraffin-embedded primary breast cancer tissues resected from 54 patients at the Shiga University of Medical Science Hospital between July 1996 and December 2001. The Ethics Committee of our institution approved the use of these specimens, which were histologically classified according to the World Health Organization (WHO) guidelines.

103


Teramoto et al: Expression of RB1CC1 in primary breast cancers

B. Immunohistochemical analysis

evaluated abnormalities of the RB1CC1-RB1 pathway in primary breast cancers and examined relationships with various biopathological parameters. RB1CC1 expression was undetectable and associated with a significant decrease or absence of RB1 positive cells in 8 (15%) of the 54 primary breast cancers.

Antigens were retrieved by autoclaving at 120°C for 1 min. Then RB1CC1, RB1, Ki-67 and estrogen receptor (ER) were immunohistochemically stained using a Streptavidin-Biotin Immunoperoxidase Complex System (DAKO Japan, Kyoto, Japan). Primary antibodies were anti-human RB1CC1 rabbit antiserum (anti-RBICC-642) diluted 1:5000, and mouse monoclonal antibodies to RB1 (G3-245, Pharmingen, San Diego, CA) diluted 1:500, to Ki-67 (NCL-Ki87-MMI, Novocastra, New Castle, UK) diluted 1:100, and to ER (NCL-ER-6F11, Novocastra) diluted 1:100, respectively. Labeling indices of Ki67 and RB1 were determined as the ratio (%) of labeled compared with total neoplastic cells in each section.

C. Loss of heterozygosity (LOH) at RB1 locus We extracted tumor DNA from the samples without RB1CC1 expression using DNAzol reagent (Gibco-BRL, Paisley, Scotland) according to the manufacturer’s protocols. We analyzed them using the AFM058xd6 microsatellite markers (UniSTS: 13158). The PCR products were resolved using 7.5% denaturing PAGE and visualized by silver staining.

RB1CC1

D. Statistical analysis We evaluated relationships between RB1CC1 expression and the RB1 and Ki-67 labeling indices using Student’s t-test. Fisher’s exact test determined the relationships between RB1CC1 status, ER status and clinicopathological factors including tumor size, lymph node involvement, histological subtype and post-menopausal status. Statistical significance was assumed at p < 0.05.

RB1

III. Results A. Positive Correlation between RB1CC1 and RB1 RB1CC1 protein was undetectable in 8 (15%) of 54 primary breast cancers and RB1 positive cells were absent or significantly depleted in all of them (Figures 1b and d). In these 8 tumors lacking RB1CC1 expression, they showed no LOH at RB1 locus (Figure 2). Among the 46 specimens expressing RB1CC1, RB1 was co-expressed in 45 (Figures 1a and c) and significantly decreased in only one. RB1CC1 expression was significantly correlated with the RB1 labeling index (RB1CC1-positive versus RB1CC1-negative specimens, 78.6 ± 13.9 versus 13.6 ± 12.1%, p < 0.0001; Student’s t-test) (Figure 3a). RB1CC1 (Figures 1e and f), and the Ki-67 labeling index was significantly higher in RB1CC1-negative tumors (RB1CC1-positive versus RB1CC1-negative specimens, 20.3 ± 12.8 versus 65.0 ± 12.2%, p < 0.0001; Student’s t-test) (Figure 3b).

Ki-67 Case 11

Case 15

Figure 1. Immunohistochemical analysis of RB1CC1, RB1 and Ki-67 in breast cancer. Both RB1CC1 (a) and RB1 (c) proteins are expressed in the nuclei of breast cancer cells from Patient 11, but barely detectable in those from Patient 15 (b and d). Ki-67positive nuclei are abundant in specimens from Patient 15, whose tumor did not express RB1CC1 (f), but less profuse in tumor samples from Patient 11 (e). (Immunoperoxidase staining with hematoxylin counterstain. Magnification, !200.)

Figure 2. Loss of heterozygosity at RB1 locus. DNA samples from 8 tumors without RB1CC1 expression and from matching blood DNAs of Patient 15 and 46 were amplified using primer pairs for the AFM058xd6 microsatellite marker. PCR products were resolved using 7.5% denaturing PAGE and visualized by silver staining. All DNA samples showed no LOH at RB1 locus. M, "X174/Hae III marker; P, genomic DNA sample from matching blood leukocytes.

III. Discussion The novel human gene, RB1CC1, encodes a putative transcription factor implicated in the regulation of RB1 (Chano et al, 2002a) and exhibits the characteristics of a classical tumor suppressor gene (Chano et al, 2002c). RB1CC1 mutations lacking function have been identified in breast cancer and might be involved in their tumorigenesis (Chano et al, 2002c). The present study 104


Cancer Therapy Vol 1, page 105 was usually associated with a loss of RB1CC1 expression in the present study, the absence of the latter seems to be a major cause of depleted expression of RB1 and subsequent breast cancer tumorigenesis. The loss of RB1CC1 expression was significantly correlated with a higher Ki-67 labeling index in our series (p < 0.0001). Since Ki-67 identifies proliferating cells by recognizing a nuclear antigen (Gerdes et al, 1987), our findings suggest that a loss of RB1CC1 expression promotes breast cancer progression through disruption ofits downstream pathways that normally suppress proliferative activity. Other studies have shown that Ki-67 staining levels are positively correlated with tumor size and nodal involvement in breast cancer (Wintzer, 1991; Molino et al, 1997). The level of Ki-67 may be an independent prognostic factor in breast cancer because Ki67 positivity is correlated with disease-free and overall survival rates (Rolio, 1993; Molino et al, 1997). RB1CC1negative cancers tended to show earlier metastasis than RB1CC1-positive ones. In our series, however, we could not conclude the sure relationship between RB1CC1 expression and the prognosis of breast cancer due to the short period of clinical observation and small numbers of cases. Therefore, longer-term clinical studies involving larger numbers of patients are required to confirm this issue. RB1CC1 expression and ER status were positively correlated. Estrogen regulates the proliferation and maturation of normal breast tissue through its receptors. In addition, both RB1CC1 and RB1 may contribute to the development and maturation of human embryonic cells (Chano, 2002d) and the RB1CC1-RB1 cascade may play a role in the maturation of breast tissues involving functional ER expression. About 70% of primary breast cancers are ER-positive (Andersen and Poulsen, 1989; Harvey et al, 1999) and such patients respond more favorably to endocrine therapy and survive longer than those with ER-negative cancer (Andersen and Poulsen, 1989; Harvey et al, 1999). Evaluating RB1CC1 expression in breast cancer may be helpful in predicting responses to adjuvant therapy. In conclusion, our findings suggest that RB1CC1 plays an important role in the RB1 pathway and that the absence of RB1CC1 expression accelerates cell proliferation in breast cancer. In addition, RB1CC1 status may be an important prognostic factor in breast cancer

Figure 3. RB1 and Ki-67 labeling indices in specimens with or without RB1CC1 expression. (a) RB1 labeling index is significantly higher with, than without RB1CC1 expression (RB1CC1-positive versus -negative specimens, 78.6 ± 13.9 versus 13.6 ± 12.1%, p < 0.0001; Student’s t-test). (b) Ki-67 labeling index is significantly higher in RB1CC1-negative than positive tumors (RB1CC1-positive versus -negative specimens, 20.3 ± 12.8 versus 65.0 ± 12.2%, p < 0.0001; Student’s t-test).

The 8 cases lacking RB1CC1 expression, showed no LOH at RB1 locus. These findings support those of previous reports (Chano et al, 2002a,b,c) suggesting that RB1CC1 functions as a key regulator of RB1 expression and that the dysfunction of RB1CC1 results in insufficient RB1 expression. The present study found a suspected RB1 abnormality in only one specimen with RB1CC1 expression, but we could not examine the LOH status at RB1 locus because of no matching tumor DNA. A LOH and other alterations at the RB1 locus were observed in 3% to 37% of breast cancers (Varley et al, 1989; Thorlacious et al, 1991; Lemoine, 1994; T’Ang, 1998; Kaelin et al, 1999; Bieche and Lidereau, 2000). However, irregular RB1 protein expression is not always linked to such RB1 gene derangement (Varley et al, 1989; Bieche and Lidereau, 2000). Since low or absent RB1 expression

Acknowledgements We would like to thank H. Chen, N. Takashima, H. Honjo and M. Sugimoto for excellent technical assistance. This study was partially supported by grant-in-aids for Scientific Research, the Ministry of Education, Science, Sports and Culture, Japan (08671356, 10671249, 13470520, 13671380 and 15591340).

105


Teramoto et al: Expression of RB1CC1 in primary breast cancers Table 1 Association of RB1CC1 expression with clinicopathological variables Variables Sex; male: female Age (y.o.); mean±SD Tumor size (cases ) _2 cm : _2 cm LNs involvement (cases) positive : negative unknown Pathology (cases) non-invasive : invasive ductal : others Menopausal (cases) post : pre male RB1 labeling index (%), mean±SD Ki-67 labeling index (%), mean±SD ER status (cases) positive : negative NS, not significant, a Fisher's exact test, b Student's t test.

RB1CC1 positive 1 : 45 56.2 ± 12.9

RB1CC1 negative 0:8 57.8 ± 12.7

P NSa NSb

10:36

2:6

NSa

24 : 21 1

3:4 1

NSa

1 : 45 44 : 2

0:8 8:0

NSa NSa

29 : 16 1 78.6 ± 13.9

6:2

NSa

13.6 ± 12.1

<0.0001b

20.3 ± 12.8

65.0 ± 12.2

<0.0001b

38 : 8

3:5

0.0123b

endocrine therapy in breast cancer. J Clin Oncol 17, 14741481. Kaelin Jr WG (1999) Functions of the retinoblastoma protein. BioEssays 21, 950-958. Kamb A (1995) Cell cycle regulators and cancers. Trends Genet 11, 136-140. Lemoine NR (1994) Molecular biology of breast cancer. Ann Oncol 5 (Supple), 31-37. Molino A, Micciolo R, Turazza M, Bonetti F, Piubello Q, Bonetti A, Nortilli R, Pelosi G, Cetto GL (1997) Ki-67 immunostaining in 322 primary breast cancers: associations with clinical and pathological variables and prognosis. Int J Cancer 74, 433-437. Rolio M, Nordling S, von Boguslawsky K, Leivonen M, Kyllonen L, von Smitten K (1993) Prognostic value of Ki-67 immunolabelling in primary operable breast cancer. Br J Cancer 68, 579-583. Taya Y (1997) RB kinases and RB-binding proteins: new points of view. TIBS 22, 14-17. Thorlacious S, Jonasdottir O, Eyfjord JE (1991) Loss of heterozygosity at selective sites on chromosomes 13 and 17 in human breast carcinoma. Anticancer Res 11, 1501-1507. T’Ang A, Fung YK (1991) The role of the retinoblastoma gene in breast cancer development. In Dickson RB, Lippman ME, eds. Genes, Oncogenes and Hormones. Advances in Cellular and Molecular Biology of Breast Cancer. Boston, Kluwer Academic Publishers, 59-68. T’Ang A, Varley JM, Chakraborty S, Murphree AL, Fung YK (1998) Structural rearrangement of the human retinoblastoma gene in human breast carcinoma. Science 242, 263-266. Varley JM, Armour J, Swallow JE, Jeffreys AJ, Ponder BA, T'Ang A, Fung YK, Brammar WJ, Walker RA (1989) The retinoblastoma gene is frequently altered leading to loss of

References Andersen J, Poulsen HS (1989) Immunohistochemical estrogen receptor determination in paraffin-embedded tissue. Prediction of response to hormonal treatment in advanced breast cancer. Cancer 64, 1901-1908. Bieche I, Lidereau R (2000) Loss of heterozygosity at 13q14 correlate with RB1 gene underexpression in human breast cancer. Mol Carcinog 29, 151-158. Chano T, Ikegawa S, Kontani K, Okabe H, Baldini N, Saeki Y (2002a) Identification of RB1CC1, a novel gene that can induce RB1 in various human cells. Oncogene 21, 12951298. Chano T, Ikegawa S, Saito-Ohara F, Inazawa J, Mabuchi A, Saeki Y, Okabe H (2002b) Isolation, characterization and mapping of the mouse and human RB1CC1 genes. Gene 291, 29-34. Chano T, Kontani K, Teramoto K, Ikegawa T, Okabe H (2002c) Truncating mutations of RB1CC1 in human breast cancers. Nat Genet 31, 285-288. Chano T, Saeki Y, Serra M, Matsumoto K, Okabe H (2002d) Preferential expression of RB1CC1 in terminal differentiated musculoskeletal cells. Am J Pathol 161, 359-364. Dahiya R, Perinchery G, Deng G, Lee C (1998) Multiple sites loss of heterozygosity on chromosome 8 in human breast cancer has differential correlation with clinical parameters. Int J Oncol 12, 811-816. Gerdes J, Pickartz H, Brotherton J, Hammerstein J, Weitzel H, Stein H (1987) Growth-fractions and estrogen receptors in human breast cancers as determined in situ with monoclonal antibodies. Am J Pathol 129, 486-492. Harvey JM, Clark GM, Osborne CK, Allred DC (1999) Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant

106


Cancer Therapy Vol 1, page 107 expression in primary breast tumors. Oncogene 4, 725-729. Wintzer HO, Zipfel I, Schulte-Monting J, Hellerich U, von Kleist S (1991) Ki-67 immunostaining in human breast tumors and its relationship to prognosis. Cancer 67, 421-428.

Dr. Keiichi Kontani

107


Teramoto et al: Expression of RB1CC1 in primary breast cancers

108


Cancer Therapy Vol 1, page 109 Cancer Therapy Vol 1, 109-120, 2003.

Approaches to the treatment of brain tumors using cytokine-secreting allogeneic fibroblasts Research Article

Terry Lichtor1*, Roberta P Glick1, Edward P Cohen2 1

Department of Neurological Surgery, Rush Medical College and John H Stroger Hospital of Cook County Department of Microbiology and Immunology, University of Illinois at Chicago, Chicago, Illinois

2

__________________________________________________________________________________ *Correspondence: Terry Lichtor, MD, PhD, Department of Neurosurgery, 1835 West Harrison Street, Suite 3202, Chicago, Illinois 60612; Telelphone: 312-633-6328; Fax: 312-633-6494; e-Mail: Terry_Lichtor@rush.edu Key words: gene therapy, glioma, breast cancer, IL-2, tumor vaccine Received: 21 May 2003; Accepted: 30 May 2003; electronically published: May 2003

Summary The prognosis for patients with an intracerebral neoplasm is poor. Conventional treatments such as surgery, radiation therapy and chemotherapy have done little to affect long-term survival, and new methods of treatment are urgently needed. In this report approaches involving cytokine gene therapy in treatment of malignant brain tumors are reviewed and contrasted to a strategy developed in this laboratory involving the use of allogeneic cells genetically modified to secrete cytokines. In our studies, mice with an intracerebral glioma, melanoma or breast carcinoma treated solely by intratumoral injections with allogeneic cells genetically modified to secrete interleukin-2 were found to survive significantly longer than mice in various control groups. The anti-tumor response was mediated predominantly by T cell subsets (CD8+ and NK/LAK cells). The injections resulted in the killing of only the neoplastic cells; non-neoplastic cells were unaffected. Experiments involving treatment of animals with intracerebral tumor using subcutaneous injections of cytokine secreting allogeneic cells in the presence of tumor antigens demonstrated no effect in prolonging survival in spite of the development of a vigorous systemic antitumor immune response. Of special interest, mice injected intracerebrally with the cytokine-secreting allogeneic cells alone exhibited no neurologic defect and there were no adverse effects on survival. The injection of cytokine-secreting allogeneic cells into the microenvironment of an intracerebral tumor is hypothesized to induce an anti-tumor immune response capable of prolonging survival. This preclinical animal data should directly translate into clinical treatments for patients with a malignant intracerebral tumor. Tumor cells may evade immune responses by losing expression of antigens or major histocompatiblity complex (MHC) molecules or by producing immunosuppressive cytokines. In addition T cells that recognize self-antigens may differentiate into suppressor or regulatory cells, which inhibit the activation and/or functions of effector cells. The inhibitory effects of suppressor cells may be mediated by cytokines. In particular interleukin-10 and TGF-! are two examples of such cytokines. Successful methods to induce immunity to TAAs could lead to tumor cell destruction and prolong the survival of cancer patients. A variety of strategies have been used to increase the immunogenetic properties of vaccine therapies for brain tumors. The immune response can be augmented by genetic modification of tumor cells to secrete cytokines including IL-2, GM-CSF and interferon-". One can also alter the MHC of the tumor cells to express allogeneic

I. Introduction The current prognosis for patients with malignant brain tumors remains poor (Mahaley et al, 1989). Malignant gliomas are the most common primary brain tumor. Despite treatment with surgery, radiation and chemotherapy, the 2-year survival remains less than 20%. One emerging strategy in the treatment of tumors involves stimulation of an immunologic response against the neoplastic cells. The hope is that the immune system can be called into play to destroy malignant cells. However, in most instances, proliferating tumors do not provoke antitumor cellular immune responses. The precise mechanisms that enable antigenic neoplasms to escape host immunity are incompletely understood. The cells appear to escape recognition by the immune system in spite of the fact that neoplastic cells form weakly immunogenic tumor associated antigens (TAAs).

109


Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts determinants. Finally one can genetically modify the tumor cells to express co-stimulatory molecules such as B7. In some instances, objective evidence of tumor regression has been observed in patients receiving immunizations only with tumor cell immunogens, suggesting the potential effectiveness of this type of immunotherapy for malignant neoplasms. In addition modification of delivery techniques to treat intracerebral tumors has included intrathecal, intralymphatic, subcutaneous and intratumoral injections of treatment cells. We have utilized many of these techniques to enhance the immune response in the development of our cellular vaccine, as discussed below. Recent advances in our understanding of the biology of the immune system have led to the identification of numerous cytokines that modulate immune responses (Kelso, 1989; Borden and Sondel, 1990; Gabrilove and Jakubowski, 1990). These agents mediate many of the immune responses involved in anti-tumor immunity. Several of these cytokines have been produced by recombinant DNA methodology and evaluated for their anti-tumor effects. In experimental clinical trials, the administration of cytokines and related immunomodulators has resulted in objective tumor responses in some patients with various types of neoplasms (Lotze et al, 1986; Rosenberg et al, 1988; Borden and Sondel, 1990). Interleukin-2 (IL-2) is an important cytokine in the generation of anti-tumor immunity (Rosenberg et al, 1988). In response to tumor antigens, the helper T-cell subset of lymphocytes secretes small quantities of IL-2. This IL-2 acts locally at the site of tumor antigen presentation to activate cytotoxic T-cells and natural killer cells that mediate systemic tumor cell destruction. Intravenous, intralymphatic or intralesional administration of IL-2 has resulted in clinically significant responses in several types of cancer (Lotze et al, 1986; Pizza et al, 1988; Rosenberg et al, 1988; Gandolfi et al, 1989; Sama et al, 1990). However, severe toxicities (hypotension and edema) limit the dose and efficacy of intravenous and intralymphatic IL-2 administration (Lotze et al, 1986; Sama et al, 1990). The toxicity of systemically administered cytokines is not surprising since these agents mediate local cellular interactions, and they are normally secreted in quantities too small to have systemic effects. To circumvent the toxicity of systemic IL-2 administration, several investigators have examined intralesional injection of IL-2 (Bubenik et al, 1988; Gandolfi et al, 1989). This approach eliminates the toxicity associated with systemic IL-2 administration. However, multiple intralesional injections are required to optimize therapeutic efficacy (Bubenik et al, 1988; Gandolfi et al, 1989). These injections will be impractical for many patients without potential significant morbidity, particularly when tumor sites are not accessible for direct injection. Cytokine gene transfer has resulted in significant anti-tumor immune responses in several animal tumor models (Tepper et al, 1989; Watanabe et al, 1989; Fearon et al, 1990; Gansbacher et al, 1990). In these studies, the

transfer of cytokine genes into tumor cells has reduced or abrogated the tumorigenicity of the cells after implantation into syngeneic hosts. The transfer of genes for IL-2 (Fearon et al, 1990; Gansbacher et al, 1990), gamma interferon (IFN-") (Watanabe et al, 1989), and IL-4 (Tepper et al, 1989) significantly reduced or eliminated the growth of several different histological types of murine tumors. Other cytokines capable of producing similar results include granulocyte-macrophage colonystimulating factor (GM-CSF) (Yu et al, 1997) and interleukin-12 (Ehtesham et al, 2002). In the studies employing IL-2 gene transfer, the treated animals also developed systemic anti-tumor immunity and were protected against subsequent tumor challenges with the unmodified parental tumor (Fearon et al, 1990; Gansbacher et al, 1990). Similar inhibition of tumor growth and protective immunity were also demonstrated when immunizations were performed with a mixture of unmodified parental tumor cells and genetically modified tumor cells engineered to express the IL-2 gene. No toxicity associated with expression of the cytokine transgenes was reported in these animal tumor studies (Tepper et al, 1989; Watanabe et al, 1989; Fearon et al, 1990; Gansbacher et al, 1990). An alternative strategy is to genetically modify tumor cells to express an antisense gene to TGF-!, which is a cytokine highly expressed in glioma cells that acts to inhibit the function of cytotoxic T cells (Fakhrai et al 1996). Previous immunotherapy stategies have utilized classical immunologic cell types including activated lymphocytes and LAK cells. More recently, a variety of cells have been investigated for their usefulness in tumor oncology including tumor cells themselves (syngeneic or allogeneic), Dendritic cells or fibroblasts (syngeneic or allogeneic). Although syngeneic tumor cells have the advantage that they express most of the appropriate antigens needed for targeted therapy, many types of tumors are difficult to establish in culture. In addition cytokine gene therapies requiring the transduction of autologous tumor cells may not be practical for many cancer patients. Modification of neoplastic cells taken directly from tumor-bearing patients may be difficult. In particular a primary tumor cell line, required for retroviral modification has to be established. An alternative cell type that can be used for therapeutic immunizations is the Dendritic cell (DC), which is a specialized antigen presenting cell. Pre-clinical studies have indicated that immunizing either mice or rats with DC pulsed using tumor cell antigens can stimulate a cytotoxic T cell response that is tumor-specific and that engenders protective immunity against CNS tumor in the treated animals (Ashley et al, 1997; Heimberger et al, 2002). It is also conceivable that a subpopulation of the primary tumor, selected for its capacity to grow in vitro, may not reflect the tumor cell population as a whole especially since tumors such as glioma are known to be heterogeneous. We have chosen an allogeneic fibroblast cell line as a cellular vaccine for a number of reasons. Fibroblasts obtained from established allogeneic fibroblast cell lines may be readily cultured in vitro and genetically modified 110


Cancer Therapy Vol 1, page 111 Institute for Molecular and Cellular Biology, Osaka University, Japan) (Yamada et al, 1987). The plasmid contains a human IL-2 cDNA and a gene (neor) that confers resistance to the aminoglycoside antibiotic, G418 (Colbere-Garapin et al, 1981) used for selection. To prepare the IL-2/IFN-" double cytokine-secreting cells, the IL-2 secreting cells were co-transfected (lipofectin-mediated; Gibco BRL, Grand Island, NY) with DNA from pZipNeoSVIFN-" (obtained from M.K.L. Collins, Institute of Cancer Research, London, England) along with DNA from pHyg (obtained from L. Lau, University of Illinois, Chicago, Illinois), as previously described (Kim et al, 1995). The plasmid confers resistance to hygromycin (Sugden et al, 1985) used for selection. IFN-" single cytokine-secreting cell-lines were prepared by co-transfection of LM cells with DNA from pZipNeoSVIFN-" along with DNA from pHyg, as previously described (Kim et al, 1995). The cells were maintained for 14 days in growth medium containing 300 µg/ml hygromycin. To maintain cytokinesecretion, every third passage the cells were routinely placed in the relevant selection medium.

to express and secrete cytokines (Kim et al, 1992; Kim et al, 1994; Tahara et al, 1994; Fakhrai et al, 1995; Sobol et al, 1995). The cells can be genetically modified to secrete cytokines and subsequently injected directly into the tumor bed. The use of allogeneic rather than syngeneic cells was initially based upon evidence that allogeneic MHC determinants augment the immunogenic properties of the tumor vaccine (Kim et al, 1992; Kim et al, 1994; Tahara et al, 1994). Application of genetically modified fibroblasts in therapeutic vaccines facilitates titration of single or multiple cytokine doses independent of tumor cell doses. Like other allografts, the allogeneic cytokine-secreting cells are rejected . Furthermore, the number of cells can be expanded as desired for multiple rounds of therapy. In addition, the slow continuous release of cytokines and the eventual rejection of the allograft may be a useful advantage in the treatment of brain tumors where longterm secretion of high concentrations of certain cytokines may be associated with increased morbidity. Thus, an allogeneic cytokine secreting vaccine is readily available, easily expanded, possibly less toxic and more immunogenic. These considerations provide the rationale for examining the use of allogeneic fibroblasts genetically modified to secrete cytokines as a means of enhancing anti-tumor immune responses in treatment of malignant intracerebral tumors (Kim et al, 1992; Kim et al, 1994; Tahara et al, 1994; Fakhrai et al, 1995; Lichtor et al, 1995; Sobol et al, 1995; Lichtor et al 2002).

C. Modification of LM or LM-IL-2 fibroblasts (H-2k) to express H-2Kb class Ideterminants A plasmid (pBR327H-2Kb from Biogen Research Corp, Cambridge, MA) encoding MHC H-2Kb determinants was used to modify LM or LM-IL-2 fibroblasts to express H-2Kb determinants. Ten µg of PBR327H-2Kb and 1 µg of pBabePuro was mixed with Lipofectin (Gibco BRL), according to the supplier’s instructions. The plasmid pBabePuro (obtained from M.K.L. Collins, University College, London, England) conferring resistance to puromycin, was used for selection. The plasmid-mixture was added to 1x106 LM or LM-IL-2 cells in 10 ml of DMEM, without FBS. For use as a control, an equivalent number of LM or LM-IL-2 cells were transfected with 1µg of pBabePuro alone. The cells were incubated for 18 hrs at 370C in a CO2/air atmosphere, washed with DMEM, followed by the addition of growth medium. After incubation for 48 hrs, the cell cultures were divided and replated in growth medium supplemented with 3.0 µg/ml puromycin (Sigma; St Louis, MO) followed by incubation at 370C for 7 additional days. The surviving colonies were pooled and tested by staining with specific FITC-conjugated antibodies for the expression of H2Kb-determinants. One hundred percent of non-transfected fibroblasts maintained in growth medium containing puromycin died during the seven-day period of incubation.

II. Materials and methods A. Cell lines and experimental animals Gl261 is a malignant glial tumor syngeneic in C57BL/6 mice. The tumor was originally obtained from Dr. J. Mayo (DCT, DPT, National Cancer Institute, Frederick, MD); it was maintained by serial transfer in histocompatible C57BL/6 mice. SB-5b cells are a breast adenocarcinoma that formed spontaneously in a C3H/He mouse. These cells were grown by in vivo passage in female C3H/He mice. B16F1 cells are a highly malignant melanoma cell line derived from a melanoma arising spontaneously in C57BL/6 mice (from I. Fidler, M.D. Anderson, Houston, TX). LM cells, a fibroblast cell line of C3H/He mouse origin, were from the American Type Culture Collection (Manassas, VA). The B16F1 and LM cells were maintained at 370C in a humidified 7% CO2/air atmosphere in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FBS (Sigma, St Louis, MO) and antibiotics (Life Technologies) (growth medium). The animals used were eight to ten-week-old pathogen-free C57Bl/6 (H-2b) or C3H/He (H-2k) mice obtained from Charles River Breeding Laboratories (Portage, MI). The mice were maintained in the animal care facilities of the University of Illinois, according to National Institutes of Health Guidelines for the Care and Use of Laboratory Animals. They were 8-12 weeks old when used in the experiments.

D. Assays for cytokine secretion IL-2 secretion by the G418-resistant cells was assayed with the use of the IL-2-dependent cell-line CTLL-2, as previously described (Gillis et al, 1978). One unit of IL-2 gave halfmaximal proliferation of CTLL-2 cells under these conditions (Gillis et al, 1978). IL-2 and IFN-" secretion by the transfected cells were assayed by the use of a human IL-2 or a mouse IFN-" ELISA kit (Genzyme, Cambridge, MA).

E. The detection of mRNAs specifying IL-2 or IFN-" by transfected LM cells by the reverse transcription-polymerase chain reaction (RTPCR)

B. Preparation of cytokine (IL-2 and/or IFN") secreting mouse fibroblasts IL-2 secreting mouse fibroblasts were prepared as described previously (Kim et al, 1992). The gene for IL-2 was transduced into LM fibroblasts with a retroviral plasmid (pZipNeoSV-IL-2) (obtained originally from T. Taniguchi,

RT-PCR was used as a further confirmation of the expression of the transferred cytokine genes. Total cellular RNA

111


Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts was prepared from the relevant cell types (Chomczynski et al, 1987) and then transcribed into cDNA and amplified, as previously described (Kim et al, 1995).

injected i.c. with an equivalent number of LM-IL-2 cells alone lived for more than three months and showed no evidence of ill effects or neurologic deficit. Immunocytotoxic studies demonstrated a significantly elevated cromium release from Gl261 cells co-incubated with spleen cells from mice injected i.c. with glioma cells and the cyotkine secreting fibroblasts (Table 1). Thus, therapy with an immunogen that combined the expression of allogeneic antigens and the secretion of cytokines led to the most significant benefit in mice with an intracerebral glioma.

F. Spleen cell-mediated cytotoxicity by 51Crrelease assay Mononuclear cells from the spleens of C57BL/6 mice immunized with the various cell constructs were used as sources of effector cells for the cytotoxicity studies using a standard 4 hour cromium release assay, as previously described (Kim et al, 1995).

B. Specificity of the immune response

G. In vitro determination of the classes of effector cells activated for the anti-glioma cytotoxicity

The specificity of the immunocytotoxic response was evaluated against a variety of tumor cell lines (Table 2). Only spleen cells from immunized animals demonstrated an immunocytotoxic response. The response, although somewhat non-specific when tested against a variety of tumor cell lines, was markedly enhanced when tested against the same tumor cells with which the animal was initially injected.

The effect of monoclonal antibodies (mAbs) for T-cell subsets or NK/LAK cells on the anti-tumor response was used to identify the predominant cell-types activated for anti-tumor cytotoxicity in mice immunized with the cytokine-secreting cells.

H. Statistical analysis Student’s t test was used to determine the statistical differences between the survival of mice in various experimental and control groups. A P value below 0.05 was considered significant.

III. Results A. Simultaneous intracerebral injection of glioma and cytokine secreting allogeneic cells We measured the survival of C57Bl/6 mice injected intracerebrally (i.c.) with a mixture of Gl261 glioma cells and cytokine secreting LM cells. Gl261 cells are a glioma cell-line of C57Bl/6 mouse origin (H-2b). LM fibroblasts are derived from C3H/He mice and express H-2k determinants. We initially evaluated the immunotherapeutic effects of single cytokine-secreting LM-IL-2 cells and double cytokine-secreting LM-IL2/interferon-" cells in mice bearing an i.c. glioma. A mixture of G1261 cells and the single or double cytokinesecreting cells were injected i.c. into the right frontal lobe of C57BL/6 mice, syngeneic with G1261 cells (Figure 1). Mice injected i.c. with the mixture of glioma and LM-IL-2 cells survived significantly longer (P<0.025) than control mice injected i.c. with an equivalent number of glioma cells alone. Somewhat more dramatic results were obtained for mice injected i.c. with a mixture of glioma cells and LM-IL-2/interferon-" double cytokine-secreting cells. In addition, the survival of this group was statistically prolonged relative to either untreated mice with glioma or those animals injected with Gl261 cells and LM-IL-2 cells. The survival time of mice injected with a mixture of glioma cells and LM-Interferon-" cells was not significantly different from that of mice injected with glioma cells alone (P>0.1). Of special interest, mice

Figure 1. Graph showing the survival rate of mice injected i.c. with a mixture of glioma cells and fibroblasts (LM cells) engineered to secrete cytokines. The C57Bl/6 mice (8 per group) were injected i.c. with a mixture of 106 cells of one of the cell types and 105 Gl261 glioma cells. The median lengths of survival were as follows (in days): mice with nonimmunized glioma cells, 16.9 ± 1.9; glioma plus LM cells, 20.0 ± 4.5; glioma plus LM-IL2 cells, 23.4 ± 6.8; glioma plus LM-IFN-" cells, 18.0 ± 1.8; glioma plus LM-IL-2/IFN-" cells, 28.1 ± 5.8. Probability values were: nonimmunized vs. LM-IL-2, p < 0.025; nonimmunized or LM vs LM-IL-2/IFN-", p < 0.005; LM-IL-2 vs LM-IL-2/IFN-(, p < 0.05.

112


Cancer Therapy Vol 1, page 113 Table 1

a

C57BL/6 mice received a single i.c. injection of (105) glioma cells together with one of the modified fibroblast cell-types (106 cells). Three weeks after the injection, mononuclear cells from the spleens of the immunized mice obtained through Ficoll-Hypaque centrifugation were used for the 51Cr-release assay. All values represent the mean Âą SD of triplicate determinations. b P < 0.005 relative to 51Cr release for spleen cells from animals immunized with glioma. c P < 0.05 relative to 51Cr release for spleen cells from animals immunized with glioma + LM cells. d P < 0.025 relative to 51Cr release for spleen cells from animals immunized with glioma. e P < 0.05 relative to 51Cr release for spleen cells from animals immunized with glioma + LM-IL-2 cells.

Table 2

a

C57BL/6 mice received a single i.c. injection of (2.0 X 105) Gl261 glioma cells together with one of the modified fibroblast cell-types (106 cells). Two weeks after the injection, mononuclear cells from the spleens of the immunized mice obtained through Ficoll-Hypaque centrifugation were used for the 51Cr-release assay using 4 different 51Cr-labeled cell types as tumor targets including Gl261 glioma, B16F1 melanoma, EL-4 lymphoma and LL/2 Lewis lung carcinoma cells. All tumor cells are of C57Bl/6 origin (H-2b haplotype). All values represent the mean Âą SD of triplicate determinations.

113


Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts in control mice injected with LM (non-cytokine secreting) fibroblasts (data not shown). Thus, modified allogeneic cells fail to survive in the CNS beyond 14 days as evidenced by PCR. The animals implanted with the genetically modified cells were observed daily for evidence of neurologic deficit and other morbidity or mortality for over 60 days, and at no time did the mice exhibit neurologic deficits or adverse effects on survival.

C. Intracerebral survival and toxicity of the cytokine-secreting allogeneic cells The toxicity of the allogeneic cell based cytokine gene therapy for tumors is likely to depend in part on the ability of the genetically modified cells to survive in the CNS. The intracerebral distribution and survival of the cytokine secreting cells was investigated using both allogeneic C57BL/6 and syngeneic C3H/He mice. As a means of assessing survival of the allogeneic cells in the CNS, PCR analysis was performed to identify the presence of the neomycin gene in the brain sections at various time intervals (2-60 days). In brief, high molecular weight DNA was isolated using techniques described previously (Gillis et al, 1978). PCR amplification of the DNA was subsequently performed in a reaction mixture consisting of 0.4 µM of primer for the Neor gene, 3-5 µl of the DNA samples, 1.5 mM MgCl2, 0.5 mM of each dNTP, and 2.0 U Taq polymerase (Gibco). The sequences of the Neo gene primers are as follows: 5’ primer, 5'GCTGTGCTCGACGTTGTCAC3'; 3' primer, 5'CTCTTCGTCCAGATCATCCTG3'. The reactions were run for 38 cycles of 94oC (1 min), 55oC (1 min), 72oC (1 min) using a Perkin-Elmer Cetus thermal cycler. After amplification, 5 µl of the reaction mixture was removed and analyzed by electrophoresis in a 2.0% agarose gel. DNA sequences specific for the neomycin gene were found in DNA isolated from allogeneic mice on days 8, 14, but were no longer detected on days 28 and 60 (Figure 2). Similar experiments in syngeneic mice detected DNA sequences specific for the neomycin gene at 55 days. DNA sequences specific for the neomycin gene were not found

D. Evaluation of the therapeutic benefits of LM cells modified to secrete interleukin-2 in mice with an established pre-existing glioma To determine if the cytokine secreting cells could be effective in treating a clinically relevant model of mice with an established glioma, naïve C57Bl/6 mice bearing cannulas were first injected with Gl261 glioma followed two days later with injection of either non-IL-2-secreting allogeneic LM fibroblasts or syngeneic/allogeneic LM-IL2/Kb cells. The animals received two more injections of the same type of cells as first injected through the cannulas at weekly intervals for a total of three injections. The animals with an established glioma treated with IL-2 secreting syngeneic/allogeneic fibroblasts survived significantly longer in comparision to either untreated animals (P < 0.05) or animals treated with allogeneic LM fibroblasts (P < 0.025) (Figure 3). This experiment was repeated one additional time with similar results.

Figure 2. PCR anaylsis for the survival of modified fibroblasts in the CNS. PCR analysis was performed for the presence of the neomycin resistance gene in brain sections taken at various time intervals (0-60 days) after implantation of modified fibroblasts into the CNS in allogeneic and syngeneic mice. DNA sequences for the neomycin resistance gene were observed on Days 8 and 14 but not on Days 28 or 60 after implantation in allogeneic mice, and up to 55 days in syngeneic mice. Lane 1, low-mass molecular marker (Life Technologies); Lane 2, 8 days after injection into allogeneic mice; Lane 3, 14 days after injection into allogeneic mice; Lane 4, 28 days after injection into allogeneic mice; Lane 5, 60 days after injection into allogeneic mice; Lane 6, 55 days after injection into syngeneic mice; Lane 7, 10 3 LM-IL-2 cells; Lane 8, pZipNeo plasmid. Arrow indicates the location of the 249 – base pair Neor gene.

Figure 3. Treatment of an established glioma with IL-2 secreting cells. C57Bl/6 mice (nine animals/group) were injected i.c. through a cannula with 5.0 X 104 Gl261 cells followed two days later by the first of three weekly injections of 1.0 X 106 LM-IL2/Kb cells. As controls, animals received an equivalent number of tumor cells followed by treatment with either LM cells or media alone at the same time intervals as described previously. MST (days): media alone, 23.4 ± 4.1; LM, 22.3 ± 4.3; LM-IL-2/Kb, 26.7 ± 4.6. P values: media alone versus LM-IL-2/Kb, P < 0.05; LM versus LM-IL-2/Kb, P < 0.025.

114


Cancer Therapy Vol 1, page 115 with spleen cells from mice immunized with RLBA-IL2/interferon-" cells either intracerebrally (Table 3) or subcutaneously (Table 4) was significantly higher than non-immunized mice (p<.005). In addition the cellular anti-melanoma response was mediated primarily by NK/LAK and CD8+ cells. In summary, we find a significantly increased survival time and specific immunocytotoxic responses in mice with CNS melanoma treated intracerebrally with allogeneicfibroblasts modified to secrete IL-2 and IFN-".

E. Intracerebral versus subcutaneous immunization with allogeneic fibroblasts genetically engineered to secrete interleukin-2 in the treatment of central nervous system tumor The purpose of this study was to determine the optimal route of delivery of gene therapy for an intracerebral tumor. Systemic delivery of gene therapy is of significant clinical interest. In this study, allogeneic fibroblasts engineered to secrete interleukin-2 were administered either subcutaneously (in the presence or absence of Gl261 cells) or intracerebrally to C57Bl/6 mice with intracerebral (i.c.) glioma. The results indicate a significant prolongation of survival in mice with i.c. glioma treated intracerebrally with LM-IL-2 cells, relative to the survival of mice with i.c. glioma treated subcutaneously with LM-IL-2 cells (either alone or mixed with Gl261 cells) or untreated mice with glioma (P < 0.05). The specific release of isotope from 51Cr-labeled glioma cells co-incubated with spleen cells from animals treated either subcutaneously or intracerebrally with LMIL-2 cells was significantly greater than the release of isotope from glioma cells co-incubated with spleen cells from nonimmunized mice (P < 0.005). Direct i.c. administration of fibroblasts genetically engineered to secrete IL-2 was more effective in prolonging survival than peripheral subcutaneous administration in the treatment of mice with i.c. glioma even though both treatments stimulated a strong antiglioma immune response (data not shown). Similar studies were carried out using an intracerebral melanoma model to determine the possible immunotherapeutic benefits of IL-2 cells in mice with an intracerebral melanoma. In these studies B16F1 cells were stereotactically implanted into the right frontal lobes of C57BL/6 mice. The mice were treated with intracerebral (i.c.) or subcutaneous (s.c.) immunizations of allogeneic fibroblasts genetically engineered to express melanoma associated antigens and secrete IL-2 and/or gamma interferon. For controls, mice were injected i.c. with an equivalent number of B16 cells and treated with non IL-2secreting RLBA-ZipNeo cells (MAA(+);IL-2(-)). The results indicate that the mice that were injected i.c. with B16 melanoma cells and RLBA-IL-2 cells survived significantly longer (P<0.005) than mice injected i.c. with B16 cells alone or with a mixture of B16 and RLBAZipNeo cells (Figure 4). Similar significant (P<0.005) therapeutic responses were observed in mice injected intracerebrally with a mixture of B16 cells and RLBA-IL2/interferon-" double cytokine-secreting cells. There was no increase in survival in the mice immunized subcutaneously with the cytokine secreting cells. Histopathological evaluation of tumors from treated and untreated mice was performed on all animals at the time of cromium release studies (2 weeks) and at the time of death (3-4 weeks). The most extensive lymphocytic infiltration was in mice treated with the IL-2 secreting cells. Using a standard 51Cr release assay, the specific release of isotope from labeled B16 cells co-incubated

Figure 4. A. Graph showing the survival of mice injected intracerebrally with a mixture of B16F1 melanoma cells and RLBA-IL2 cells. C57Bl/6 mice were injected intracerebrally with a mixture of B16F1 melanoma cells (103) and one of the cell types (106). Mean survival times in days were as follows: B16 cells alone, 14.0 ± 2.6; B16 + RLBA-IFN-" cells, 17.4 ± 3.7; B16 + RLBA-IL-2 cells, 24.6 ± 4.0; B16 +RLBA-IFN-"/IL-2 cells, 23.1 ± 3.4. P Values: nonimmunized or RLBA-IFN-" versus RLBA-IL-2, P < 0.005; nonimmunized or RLBA-IFN-" versus RLBA-IFN-"/IL-2, P < 0.005.B. Graph showing the survival of mice injected intracerebrally with B16F1 melanoma cells and subcutaneously with cytokine secreting cells. C57Bl/6 mice were injected intracerebrally with B16F1 cells (10 3) and subcutanously with one of the cell types (106 cells). Mean survival time (days): B16 cells alone, 22.7 ± 3.0; B16 + RLBA-IFN-", 21.7 ± 3.6; B16 + RLBA-IL-2, 23.3 ± 3.4; B16 + RLBA-IFN-"/IL-2, 22.0 ± 1.9.

115


Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts Table 3

a

C57BL/6 mice received a single i.c. injection of a mixture of 103 melanoma cells together with one of the modified fibroblast cell-types (106 cells). Two weeks afterward, mononuclear cells from the spleens of the injected mice (Ficoll-Hypaque) were used for the 51 Cr-release assay. All values represent the mean Âą SD of triplicate determinations. b Toward 51Cr-labeled B16F1 cells; E: T ratio = 100 : 1. c P < 0.005 relative to 51Cr-release for spleen cells from mice injected i.c. with B16F1 cells alone.

Table 4

a

C57BL/6 mice received a single i.c. injection of (103) B16F1 melanoma cells and a s.c. injection of one of the modified fibroblast cell-types (107 cells). Two weeks afterward, mononuclear cells from the spleens of the injected mice (Ficoll-Hypaque) were used for the 51 Cr-release assays. All values represent the mean Âą SD of triplicate determinations. b

E : T ratio = 100 : 1. P < 0.005 relative to 51Cr-release from B16F1 cells co-incubated with spleen cells from mice injected i.c. with B16F1 cells alone. d P < 0.0005 relative to 51Cr-release from B16F1 cells co-incubated with spleen cells from mice injected i.c. with B16F1 cells alone, and P < 0.005 versus 51Cr-release from B16F1 cells co-incubated with spleen cells from mice injected i.c. with RLBA-IL-2 cells. c

116


Cancer Therapy Vol 1, page 117 There was no increase in survival in animals treated subcutaneously, despite a significant systemic immunocytotoxic response.

G. Pretreatment of mice with allogeneic cytokine secreting cells prior to i.c. injection of tumor cells

F. Survival of C3H/He mice when injected i.c. with a mixture of intracerebral breast carcinoma and IL-2 secreting allogeneic fibroblasts

We found previously that the survival of C57Bl/6 mice injected with Gl261 glioma cells mixed with allogeneic IL-2 secreting fibroblasts is significantly prolonged in comparision to various control groups. In previous studies, we also found that allogeneic LM-IL-2 fibroblasts modified to express H-2Kb determinants (syngeneic in C57Bl/6 mice) to form semiallogeneic LMIL-2/Kb cells are more effective than IL-2-secreting fibroblasts that express allogeneic determinants alone in treating mice with Gl261 glioma. In order to investigate the mechanism involved in using these genetically engineered cells for treatment of an intracerebral tumor, cannulas were placed into the right frontal lobe of C57Bl/6 mice. The animals were subsequently injected two times at weekly intervals with LM-IL-2/Kb cells through the cannulas prior to injection of glioma cells. The tumor cells were mixed with the vaccine and introduced through the cannulas one week following the second injection. The results demonstrate a significant delay in the development of glioma (P < 0.005) in the animals treated with either non-secreting cells or IL-2-secreting syngeneic/allogeneic fibroblasts (Figure 6).

On the basis of previous experiments, 106 cytokine secreting cells were chosen as the treatment dose. Confirmation of IL-2 secretion by the LM-IL-2/Kb cells was detected by an enzyme-linked immunoadsorbent assay. Next C3H/He mice (eight mice/group) were injected i.c. with a mixture of 106 IL-2 secreting fibroblasts and 104 SB-5b breast carcinoma cells. LM fibroblasts which are syngeneic with C3H/He mice were modified to express H-2Kb class-I allogeneic MHC determinants (LM-Kb or LM-IL-2/Kb) to provide a potent immune adjuvant. The results indicated that the mean survival time of mice injected with the mixture of breast carcinoma cells and the LM-IL-2/Kb cells was significantly longer than mice injected i.c. with an equivalent number of breast carcinoma cells alone (P < 0.01), or mice injected i.c. with breast cancer cells and non-cytokine secreting LM-Kb fibroblasts (P < 0.05) (Figure 5). Thus, the presence of IL-2 secreting fibroblasts in the tumor bed prolonged survival in mice with intracerebral breast carcinoma.

Figure 6 . Pre-treatment with allogeneic fibroblasts prevents the development of a glioma. C57Bl/6 mice (twelve animals/group) were injected with 1.0 X 10 6 LM-IL-2/Kb cells through a cannula on two occasions separated by one week. One week following the second injection the animals were injected a third time with a mixture of 1.0 X 106 LM-IL-2/Kb cells and 5.0 X 104 Gl261 cells. As controls, animals were injected through the cannula with either 1.0 X 106 LM cells or media at the same time points along with an equivalent number of Gl261 cells at the time of the third injection. MST (days): media alone, 25.4 ± 1.6; LM, 39.6 ± 12.2; LM-IL-2/Kb, 53.9 ± 10.3. P values: media alone versus LM, P < 0.005; media alone versus LM-IL-2/Kb, P < 0.0005; LM versus LM-IL-2/Kb, P < 0.005.

Figure 5. Treatment of C3H/He mice with intracerebral SB-5b breast carcinoma with LM-IL-2/Kb cells. C3H/He mice (eight animals/group) were injected with a mixture of 1.0 X 10 6 LM-IL2/Kb cells and 1.0 X 104 SB-5b cells or, as controls, with an equivalent number of SB-5b cells and either 1.0 X 106 LM-Kb cells or media alone. MST (days): media alone, 15.6 ± 2.7; LMKb, 19.6 ± 8.2; LM-IL-2/Kb, 27.8 ± 11.5. P values: media alone versus LM-IL-2/Kb, P < 0.01; LM-Kb versus LM-IL-2/Kb, P < 0.05

117


Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts Six animals in the IL-2 treated group that survived for over three months were then re-challenged with an intracerebral injection into the same site as the previous injections of 5 X 104 Gl261 glioma cells alone to determine if a long-term resistance toward glioma had been established in these animals. The results demonstrated a significant prolongation of survival (P < 0.01) for those animals that had been previously injected with a mixture of tumor and LM-IL2/Kb cells in comparison to the naïve animals injected with glioma cells alone (Figure 7). There were four long-term survivors (> 90 days) of the six total animals in the group previously treated with LM-IL2/Kb cells after receiving a second tumor challenge. These results suggest that a longterm immunity was established at the injection site in the animals that underwent multiple intracerebral injections of LM-IL-2/Kb cells prior to tumor injection. Whether or not a more generalized systemic immunity against glioma was established in these animals has not been determined.

with enhanced anti-tumor effectiveness by transducing LM cells, a mouse fibroblast cell-line expressing defined MHC-determinants (H-2k), with a modified retroviral vector that specified the gene for IL-2. C57BL/6 mice (H2b) injected intracerebrally (i.c.) with a mixture of Gl261 glioma cells and LM cells (H-2k) modified for IL-2 secretion (LM-IL-2) survived significantly longer than mice in various other treatment groups. The anti-tumor immune responses in the tumor-bearing mice were mediated predominantly by CD8+ and NK/LAK cells. Of special interest, mice injected i.c. with the cytokinesecreting allogeneic cells alone exhibited no neurologic deficit and there were no adverse effects on survival. The injection of cytokine-secreting allogeneic cells into the microenvironment of an intracerebral tumor is hypothesized to induce an anti-tumor immune response capable of prolonging survival. The toxic effects of cytokines in the CNS may limit the quantity that can be administered (Robinson et al, 1987; Birchfield et al, 1992; Kim et al, 1994). Neurologic effects have been seen in animals injected intracranially with syngeneic cytokine-secreting cells. The coimplantation into the rat brain of syngeneic (RG-2) glioma cells and RG-2 cells modified by retroviral transduction to secrete IL-2 or IFN-" resulted in short-term cell mediated anti-glioma responses. However the survival of the tumor bearing rats was not prolonged, and the animals died from secondary effects including severe cerebral edema (Tjuvajev et al, 1995). The toxicity of a cellular-based cytokine gene therapy for tumors is likely to depend in part on the survival of the genetically modified cells in the CNS. We investigated the survival of an allogeneic IL-2 secreting vaccine in the CNS by two different means: PCR and bioassay (Griffitt et al, 1998). We found that the survival of allogeneic cells in the CNS was less than 28 days. The cells like other allografts were rejected. The cells were well tolerated, and the animals did not demonstrate any significant neurologic or systemic toxicity. This suggests that cytokine-secreting allogeneic cells may serve as a useful vehicle for the safe delivery of cytokines into brain tumors, and supports the possibility and safety of using a monthly retreatment schedule in a clinical protocol. Most of the systemic toxicities of IL-2 therapy should be avoided by the introduction of the gene for IL-2 directly into the tumor mass, resulting in primarily local concentrations of the cytokine. This form of treatment is particularly attractive in the treatment of primary gliomas, since these tumors usually only recur locally and are rarely metastatic. More recently, the use of a small intracerebral cannula enables one to inject the treatment cells directly into the tumor bed on numerous occasions (Lichtor et al, 2002). This allows us to investigate both protective vaccine strategies using pretreatment via the cannula prior to tumor injection as well as the effect of the vaccine on the treatment of an established tumor. One of the major concerns related to the immunologic treatment of brain tumors is the effect of the blood brain barrier on the development of a host immune response in the CNS. Studies using IL-4 secreting plasmacytoma cells implanted into the brains of nude mice along with human glioma

IV. Discussion The efficacy of active tumor immunotherapy with cytokine-transduced syngeneic or allogeneic fibroblasts has been reviewed in this paper. Intracerebral injections with IL-2 transduced allogeneic fibroblasts generated systemic anti-tumor immunity capable of eradicating brain tumors. In particular we constructed a cellular vaccine

Figure 7. Long-term immunity in mice with glioma that survived prior treatment with IL-2 secreting allogeneic fibroblasts. Six C57Bl/6 mice surviving 90 days after prior injection of Gl261 cells and LM-IL-2/Kb fibroblasts were injected through the same right frontal burr hole a second time with 5.0 X 104 Gl261 cells alone. As a control, eight naïve C57Bl/6 mice were injected intracerebrally with an equivalent number of Gl261 cells alone. MST for the untreated naïve animals injected with tumor cells was 23.4 ± 4.1 days, and 36.2 ± 7.2 for the animals that had previously been vaccinated with LMIL-2/Kb cells and re-challenged with tumor cells. The four animals that were still alive at the conclusion of this experiment all of which had previously been treated with LM-IL2/Kb cells survived for longer than 90 days without evidence of any neurologic deficit. P < 0.01 for the difference in survival of mice in the two groups.

118


Cancer Therapy Vol 1, page 119 antisense gene therapy. Proc Natl Acad Sci USA 93, 29092914. Fakhrai H, Mantil J, Gramatikova S, Nicholson G, MurphySatter C, Krauss G, Poelstra R, Ruppert J, Sequeira P, Satter M, Kruse CA (2000) Gene therapy of human gliomas with TGF-!2 antisense gene modified autologous tumor cells. A Phase I trial. Proc Am Ass Cancer Res 41, 543. Fakhrai H, Shawler DL, Gjerset R, Naviaux RK, Koziol J, Royston I, Sobol RE (1995) Cytokine gene therapy with interleukin-2 transduced fibroblasts, effects of IL-2 dose on anti-tumor immunity. Hum Gene Ther 6, 591-601. Fearon ER, Pardoll DM, Itaya T, Golumbek P, Levitsky M, Simons JW, Karasuyama H, Vogelstein B, Frost P (1990) Interleukin-2 production by tumor cells bypasses T helper function in the generation of an anti-tumor reponse. Cell 60, 387-403. Gabrilove JL, Jakubowski A (1990) Hematopoietic growth factors, biology and clinical application. Monogr J Natl Cancer Inst 10, 73-77. Gandolfi L, Solmi L, Pizza GC, Bertoni F, Muratori R, DeVinci C, Bacchini P, Morelli MC, Corrado G (1989) Intratumoral echo-guided injection of interleukin-2 and cytokine-activated killer cells in hepatocellular carcinoma. HepatoGastroenterology 36, 352-356. Gansbacher B, Zier K, Daniels B, Cronin K, Bannedi R, Gilboa E (1990) Interleukin-2 gene transfer into tumor cells abrogates tumorigenicity and induces protective immunity. J Exp Med 172, 1217-1223. Giezeman-Smits, KM, Okada H, Brissette-Storkus CS, Villa LA, Attanucci J, Lotze MT, Pollack IF, Bozik ME, Chambers WH (2000) Cytokine gene therapy of gliomas, induction of reactive CD4+ T cells by interleukin-4-transfected 9L gliosarcoma is essential for protective immunity. Cancer Research 60, 2449-2457. Gillis S, Ferm MM, Ou W, Smith KA (1978) T cell growth factors, parameters of production and a quantitative microassay for activity. J Immunol 120, 2027-2032. Glick RP, Lichtor T, Kim TS, Ilangovan S, Cohen EP (1995) Fibroblasts genetically engineered to secrete cytokines suppress tumor growth and induce antitumor immunity to a murine glioma in vivo. Neurosurgery 36, 548-555. Griffitt W, Glick RP, Lichtor T, Cohen EP (1998) Survival and toxicity of an allogeneic cytokine-secreting fibroblast vaccine in the central nervous system. Neurosurgery 42, 335-340. Heimberger AB, Archer GE, Crotty LE, McLendon RE, Friedman AH, Friedman HS, Bigner DD, Sampson JH (2002) Dendritic cells pulsed with a tumor-specific peptide induce long-lasting immunity and are effective against murine intracerebral melanoma. Neurosurgery 50, 158-164. Kelso A (1989) Cytokines, structure function and synthesis. Curr Opin Immunol 2, 215-225. Kim TS and Cohen EP (1994) Interleukin-2-secreting mouse fibroblasts transfected with genomic DNA from murine melanoma cells prolong the survival of mice with melanoma. Cancer Res 54(10)2531-2535. Kim H, Rosenberg SA, Steinberg SM, Cole DJ, Weber JS (1994) A randomized double blind comparison of the antiemetic efficacy of ondansetron and dropidol in patients receiving high dose interleukin-2. J Immunother Emphasis Tumor Immunol 16, 60-65. Kim TS, Russell SJ, Collins MK, Cohen EP (1992) Immunity to B 16 melanoma in mice immunized with IL-2- secreting allogeneic mouse fibroblasts expressing melanomaassociated antigens. Int J Cancer 51, 283-9. Kim TS, Xu WS, Cohen EP (1995) Immunization with interleukin-2/interferon-" double cytokine-secreting

cells demonstrated a dramatic eosinophilic infiltrate in regions of necrotic tumor, suggesting that an immune response can take place against a tumor of the central nervous system in situ. The response, however, was non T-cell dependent (Yu et al, 1993). We found that a specific and significant systemic immunocytotoxic response (by 51 cromium release assay) was present in animals with glioma treated with allogeneic IL-2 secreting fibroblasts (Glick et al, 1995; Lichtor et al, 1995). Thus the secretion of IL-2 by the cellular immunogen, or an immunogenic derivative of the cells, may have altered the blood brain barrier (BBB) enabling the immunogen to reach the spleen and lymph nodes in the periphery (Watts et al, 1989; Zhang et al, 1992). Although preclinical studies with cytokine gene therapy appear promising (Sampson et al, 1997; Yu et al, 1997; Natsume et al, 1999; Giezeman-Smits et al, 2000, Okada et al, 2001; Lichtor et al, 2002), clinical trials for brain tumors have been limited. These trials have involved immunization with tumor cells modified with the IL-2 gene (Sobol et al, 1995), the IL-4 gene (Okada et al, 2000) or TGF-!2 antisense gene (Fakhrai et al, 2000). In summary, our studies suggest that Immuno-Gene therapy using IL-2 secreting fibroblasts as a cellular vaccine can be useful as a new therapeutic approach in treatment of a primary or metastatic intracerebral tumor especially when the tumor burden is small or at the time of tumor resection. The use of cytokine secreting tumor vaccines as a protective treatment introduced following tumor resection hopefully will play an important role in delaying tumor recurrence. We believe that this is where immunotherapy is most promising.

References Ashley DM, Faiola B, Nair S, Hale LP, Bigner DD, Gilboa E (1997) Bone marrow-generated dendritic cells pulsed with tumor extracts or tumor RNA induce antitumor immunity against central nervous system tumors. J Exp Med. 186, 1177-1182. Birchfield GR, Rodgers GM, Girodias KW, Ward JH, Samlowski WE (1992) Hypoprothrobinemia associated with interleukin2 therapy. J lmmunother 11, 71-75. Borden EC; Sondel PM (1990) Lymphokines and cytokines as cancer treatment. Immunotherapy realized. Cancer 65 (3 Suppl) 800 - 814. Bubenik J, Viotenok NN, Kieler J, Prassolov VS, Chumakov PM, Bubenikova D, Simova F, Jandlova T (1988) Local administration of cells containing an inserted IL-2 gene and producing IL-2 inhibits growth of human tumors in nu/nu mice. Immunol Lett 19, 279-282. Chomczynski P, Sacchi N (1987) Single step method of RNA isolation by acid guanidinium-thiocyanate-phenolchloroform extraction. Anal Biochem 162, 156-159. Colbere-Garapin F, Horodniceanu F, Kouritsky P, Garapin AC (1981) A new dominant hybrid selective marker for higher eukaryotic cells. J Mol Biol 150, 1-14. Ehtesham M, Kabos P, Kabosova A, Neuman T, Black KL, Yu JS (2002) The use of interleukin 12-secreting neural stem cells for the treatment of intracranial glioma. Cancer Res 62, 5657-5663. Fakhrai H, Dorigo O, Shawler DL, Lin H, Mercola D, Black KL, Royston I, Sobol RE (1996) Eradication of established intracranial rat gliomas by transforming growth factor !

119


Lichtor et al: Approaches to the treatment of brain tumor using cytokine-secreting allogeneic fibroblasts allogeneic fibroblasts prolongs the survival of mice with melanoma. Melanoma Res 5, 217-227. Lichtor T, Glick PP, Kim TS, Hand R, Cohen EP (1995) Prolonged survival of mice with glioma injected intracerebrally with double cytokine-secreting cells. J Neurosurgery 83, 1038-1044. Lichtor T, Glick RP, Tarlock K, Moffett S, Mouw E, Cohen EP (2002) Application of Interleukin-2 Secreting Syngeneic/Allogeneic Fibroblasts in the Treatment of Primary and Metastatic Brain Tumors. Cancer Gene Therapy; 9, 464-469. Lotze MT, Chang A.E, Seipp CA, Simpson C, Vetto JT, Rosenberg SA (1986) High-dose recombinant interleukin-2 in the treatment of patients with disseminated cancer, responses, treatment-related morbidity and histologic findings. JAMA 256, 3117-3124. Mahaley MS, Mettlin C, Natarajan N, Laws ER, Peace BB (1989) National survey of patterns of care for brain-tumor patients. J Neurosurg 71, 826-836. Natsume A, Mizuno M, Ryuke Y, Yoshida J (1999) Antitumor effect and cellular immunity activation by murine interferonbeta gene transfer against intracerebral glioma in mouse. Gene Therapy 6, 1626-1633. Okada H, Pollack IF, Lotze MT, Lunsford LD, Kondziolka D, Lieberman F, Schiff D, Attanucci J, Edington H, Chambers W, Robbins P, Baar J, Kinzler D, Whiteside T, Elder E (2000) Gene therapy of malignant gliomas, a phase I study of IL-4-HSV-TK gene-modified autologous tumor to elicit an immune response. Hum Gene Ther 11, 637-653. Okada H, Villa L, Attanucci J, Erff M, Fellows WK, Lotze MT, Pollack IF, Chambers WH (2001) Cytokine gene therapy of gliomas, effective induction of therapeutic immunity to intracranial tumors by peripheral immunization with interleukin-4 transduced glioma cells. Gene Therapy 8, 1157-1166. Pizza G, Viza D, DeVince C, Vichi-Pascuuchi JM, Busutti L, Bergami T (1988) Intralymphatic administration of interleukin-2 (IL-2) in cancer patients, a pilot study. Cytokine Res 7, 45-48. Robinson WA, Lobe K, Stevens R (1987) Central nervous system metastases in malignant melanoma. Cancer Treat Res 35, 155-163. Rosenberg SA, Lotze MT, Mule JJ (1988) New approaches to the immunotherapy of cancer. Ann Intern Med 108, 853-864. Sama G, Collins J, Figlin R, Robertson P, Altrock B, Abels R (1990) A pilot study of intralymphatic interleukin-2. II Clinical and biological effects. J Biol Response Modif 9, 81-86. Sampson JH, Ashley DM, Archer GE, Fuchs HE, Dranoff G, Hale LP, Bigner DD (1997) Characterization of a spontaneous murine astrocytoma and abrogation of its

tumorigenicity by cytokine secretion. Neurosurgery 41, 1365-1372. Sobol RE, Fakhrai H, Shawler DL, Gjerset R, Dorigo O, Carson C, Khaleghi T, Kozio J, Shiftan TA, Royston I (1995) Interleukin-2 gene therapy in a patient with glioblastoma. Gene Therapy 2, 164-167. Sugden B, Marsh K, Yates J (1985) A vector that replicates as a plasmid and can be efficiently selected in B-lymphoblasts transformed by Epstein-Barr virus. Mol Cell Biol 5, 410413. Tahara H; Zeh HJ 3rd; Storkus WJ, Pappo I, Watkins SC, Gubler U, Wolf SF, Robbins PD, Lotze MT (1994) Fibroblasts genetically engineered to secrete interleukin 12 can suppress tumor growth and induce antitumor immunity to a murine melanoma in vivo. Cancer Res 54: 182-189. Tepper RI, Pattengale PK, Uder P (1989) Murine interleukin-4 displays potent anti-tumor activity in vivo. Cell 57, 503-512. Tjuvajev J, Gansbacher B, Desai R, Beattie B, Kaplitt M, Matie C, Koutcher J, Gilboa E, Blasberg P (1995) RG-2 glioma growth attenuation and severe brain edema caused by local production of interleukin-2 and interferon-". Cancer Res 55, 1902-1910. Watanabe Y, Kuribayashi K, Miyatake S, Nishihara K, Nakayama IL, Taniyama T, Sakata TA (1989) Exogenous expression of mouse interferon gamma cDNA in mouse neuroblastoma C1300 cells results in reduced tumorigenicity by augmented anti-tumor immunity. Proc Natl Acad Sci USA 86, 9456-9460. Watts RG, Wright JL, Atkinson LL, Merchant RE (1989) Histopathological and blood-brain barrier changes in rats induced by intracerebral injection of human recombinant interleukin-2. Neurosurgery 25, 202-208. Yamada G, Kitamura Y, Sonoda H, Harada H, Taki S, Mulligan RC, Osawa H, Diamanststein T, Yokoyama S, Taniguchi T (1987) Retroviral expression of the human IL-2 gene in a murine T cell line results in a cell growth autonomy and tumorigenicity. EMBO J 6, 2705-2709. Yu JS, Burwick JA, Dranoff G, Breakefield XO (1997) Gene therapy for metastatic brain tumors by vaccination with granulocyte-macrophage colony-stimulating factortransduced tumor cells. Hum Gene Ther 8, 1065-1072. Yu JS, Wei MX, Chiocca A, Martuza RL, Tepper RI (1993) Treatment of glioma by engineered interleukin-4-secreting cells. Cancer Res 53, 3125-3128. Zhang RD, Price JE, Fujimaki T, Bucana CD, Fidler IJ (1992) Differential permeability of the blood brain barrier in experimental brain metastases produced by human neoplasms implanted into nude mice. Am J Pathol 141, 1115- 1124.

120


Cancer Therapy Vol 1, page 121 Cancer Therapy Vol 1, 121-131, 2003.

Safety, feasibility and clinical benefit of localized chemotherapy using microencapsulated cells for inoperable pancreatic carcinoma in a phase I/II trial Research Article

Matthias Löhr1,2, Jens-Christian Kröger4, Anne Hoffmeyer2,6, Mathias Freund3, Johannes Hain6, Albrecht Holle 2, Wolfram T. Knöfel8, Stefan Liebe 2, Horst Nizze 5, Matthias Renner6,9, Robert Saller6, Petra Müller2,6, Thomas Wagner10, Karlheinz Hauenstein4, Brian Salmons6,9 and Walter H. Günzburg7* 1

Department of Medicine II, Medical Faculty Mannheim, University of Heidelberg, Germany; 2Division of Gastroenterology, 3Division of Hematology & Oncology, Department of Medicine, 4Department of Diagnostic and Interventional Radiology and 5Department of Pathology, University of Rostock, Rostock, Germany; 6Bavarian Nordic GmbH, Martinsried, Germany, 7Institute of Virology, University of Veterinary Sciences, Vienna, Austria, 8Department of Surgery, University of Hamburg, Hamburg, Germany; 9Austrianova, Veterinärplatz 1, Vienna, Austria; 10Division of Hematology & Oncology, Medical University Lübeck, Lübeck, Germany

__________________________________________________________________________________ *Correspondence: Prof. Walter H. Günzburg, Institute of Virology, University of Veterinary Medicine, Veterinaerplatz 1, A-1210 Vienna, Austria; Tel.: +43-1-25077-2301; Fax: +43-1-25077-2390; e-mail: walter.guenzburg@vu-wien.ac.at Key Words: Pancreatic carcinoma, cell therapy, gene therapy, ifosfamide, microcapsules, angiography Received: 10 June 2003; Accepted: 25 June 2003; electronically published: June 2003

Summary Previous preclinical studies suggested that implantation of encapsulated, genetically modified cells converting a chemotherapeutic agent in the vicinity of tumors may represent an effective treatment for pancreatic cancer. A phase I/II clinical trial was performed to determine safety, feasability and efficacy of such a targeted, low dose, chemotherapy in 14 advanced-stage pancreatic cancer patients. Genetically modified allogeneic cells expressing the enzyme cytochrome P450 2B1 encapsulated in cellulose sulfate polymers were delivered angiographically via catheter into blood vessels leading to the tumor. These cells locally activate systemically administered ifosfamide to its active metabolites, whilst remaining immuno-isolated. Although adverse events were experienced by all patients, none of these were related to the treatment, with the possible exception of increased serum lipase 15 days after CapCell instillation in one patient. According to the NCI tumor response classification, at the final observation within the study, 2 of the 14 patients treated had partial remissions (14.3%), 11 patients had stable disease (78.6%) and one patient died after 8 days. Median survival was doubled compared to a historic control group (p=.008) and 50% more than usually achieved with gemcitabine. One year survival, at 36%, was three fold that of the control group (p=.047) and twice that reported for gemcitabine. Of 13 evaluable patients, 4 patients reported improvements in pain assessment, with 6 remaining unchanged (4 of these experienced no pain) and 3 patients experiencing slightly more pain. Using a worst case scenario, 50% of patients experienced a clinical benefit whereas in a best case scenario benefit was experienced by 71% of patients. significantly prolonged survival or reduced tumor load (Heinemann 2002; Rosenberg 2000). Even the newly introduced chemotherapeutic agent gemcitabine only marginally prolongs the survival of patients (Burris et al, 1997). Nevertheless, this agent has rapidly become a standard treatment because of the additional palliative effect and its ability to improve the clinical benefit response and quality of life of patients with pancreatic cancer. Thus, there is a need for new treatment regimes to

I. Introduction Pancreatic carcinoma ranks as the eighth most frequent solid cancer in industrialized countries but is the fifth leading cause of cancer-related deaths (Greenlee et al, 2001). Radical surgery can only be applied in about 10% of diagnosed cases (Huguier and Mason 1999; Neoptolemos et al, 2001) and, to date, all efforts to control tumor growth by radiation and/or chemotherapy have not 121


Löhr et al: Pancreatic cancer cell/chemotherapy treat pancreatic cancer (Hawes et al, 2000). Along with more classical types of treatment, attempts also have been made to employ gene therapy approaches such as using suicide genes encoding enzymes that are able to convert a prodrug to it’s active, tumor toxic form (Aspinall and Lemoine 1999; Günzburg et al, 2002; Rosenberg 2000). The chemotherapeutic agent, ifosfamide, has been shown to have potentially therapeutic effects for pancreatic cancer (Loehrer et al, 1985). In a phase II trial in which 1.6g/m2/day ifosfamide was administered for 5 days to 21 evaluable patients, 7 Stable Diseases with mostly none severe, grade 1-2 toxicity was reported (Wils et al, 1993). In another study (Keizer et al, 1995), where up to 1.5g/m2/day ifosfamide was given as a 10 day continuous i.v. infusion to patients with various tumor types, of six patients with pancreatic cancer, one showed a partial response and a second evidenced a tumor reduction of 45%. Major side effects observed were leukopenia with granulocytopenia, whilst subjective side-effects included nausea/vomiting and fatigue (probably related to neurotoxicity). More encouraging clinical effects have been observed in other trials where medium doses of ifosfamide (1-2g/ml) have been investigated, but this is accompanied by medium grade toxicity profiles. In an initial study by Gad-El-Mawla and colleagues, where 2g/m2 were given for 5 days, all but two patients developed haemorrhagic cystitis. However there were 6 partial responses in 10 patients (Gad-El-Mawla and Ziegler 1981). A further study revealed that of 25 patients receiving daily doses of 1.8g for five days, 1 patient showed a complete remission and 14 patients showed partial remision (Gad-El-Mawla 1986). However, these patients suffered from grade 3 alopecia (100%), grade 1 anaemia (100%) and leukopenia (30%). Thus, it is to be expected that higher doses (2-3g/ml) of ifosfamide may show even greater efficacy, but that this will be associated with possibly unacceptable levels of toxicity. Ifosfamide is a prodrug that requires activation by liver specific cytochrome enzymes, such as the 2B1 isoform (CYP2B1) to generate tumor toxic metabolites (Dirven et al, 1996). Unfortunately, the short half-life of these metabolites in plasma (Cerny et al, 1991b; Kurowski and Wagner 1993), coupled with the distance that they have to travel, require high systemic levels of ifosfamide to achieve therapeutic levels in the tumor. Indeed, these levels are so high as to lead to unacceptable side effects (Loehrer et al, 1985). Local activation of ifosfamide at the site of the tumor should, in contrast, result in good local cytotoxic activity, and at the same time low systemic ifosfamide concentrations, thus resulting in only minimal systemic side effects (Chen and Waxman 2002). Local activation may be achieved by introducing encapsulated human 293 cells genetically modified to overexpress CYP2B1 at the site of the tumor. Encapsulation in cellulose sulfate allows allogeneic cells to survive in vivo, by protecting them from host immune attack as well as by physically constraining them to the site where they are required (Dautzenberg et al, 1999). Previous experiments had revealed that injection of such encapsulated CYP2B1 expressing cells into pre-established tumors in a nude mouse model of human pancreatic carcinoma (Löhr et al,

1994), resulted in complete tumor regression in about 20% of mice and a significant anti-tumor effect in the remaining mice (Löhr et al, 1998). Nevertheless, this route of application may not be suitable for patients and so a further study was performed to demonstrate the feasibility of intra-arterial placement of micro-encapsulated cells into blood vessels leading to the pig pancreas (Kröger et al, 1999; Löhr et al, 2003). Based upon these encouraging preclinical data, a phase I/II clinical trial was initiated involving patients with inoperable pancreatic carcinoma to assess the feasibility, safety, and tolerability of this new treatment modality (Löhr et al, 1999). We have recently described the results obtained concerning safety and efficacy in a brief report (Löhr et al, 2001). Here, data is presented concerning the outcome and clinical benefit of this treatment.

II. Patients and methods A. Patients, trial design and approval The study was planned as an open, prospective, single-arm, single center phase I/II-study, following the German gene therapy working group (DAG-GT) recommendations. The protocol was approved by the state ethics committee, the gene therapy board of the German Medical Association and published (Löhr et al, 1999), in line with the recommendation of the German working party on gene therapy indicating the approval of all regulatory bodies. The study was opened on the 28th July 1998 and closed on the 20th September 1999. The trial was conducted in full accordance with good clinical practice guidelines (ICH-GCP).

B. Patient enrollment A total of 17 patients were enrolled in the trial between July 1998 and April 1999 (Table 1) from the 51 patients screened during the study period. Reasons for non-enrolment were previous chemotherapy (n = 8), pancreatic surgery (n = 13), poor general condition (n = 18), unwillingness to participate (n = 5), or death (n = 7). Criteria for entering the study included an inoperable pancreatic adenocarcinoma stage III-IV (UICC) (Hermanek et al, 1997), as determined by histology and measured by CAT scan and only patients who had not received prior chemotherapy were enrolled (Löhr et al, 1999). During the preparation period, clinical data were collected and a baseline CAT scan of the abdomen was performed. The patients were scheduled for the initial celiac angiography with capsule placement (day 0). On day 1, the patients were monitored for evidence of any clinically relevant adverse reactions, e.g. allergic, and/or pancreatitis. The levels of serum amylase, lipase, lactate, lactate dehydrogenase, and liver enzymes, as well as complete blood cell count were determined. Systemic chemotherapy commenced on day 2 with 1g/m2 body surface of ifosfamide (Holoxan®) in 250 ml 0.9% normal saline being given as a 1-hour intravenous infusion on three consecutive days. This was accompanied by a 60% dose equivalent of the uroprotector MESNA (Uromitexan®) given as three i.v. injections. This regimen was repeated at days 23-25 for all patients except 5 and 17 who only received one round of ifosfamide. Toxicity was measured based on the WHO/NCI guidelines on common toxicity criteria. Control CAT scans were scheduled for weeks 10 and 20, respectively. During the final visit, a control angiography was performed. On the initial CAT scan, the scan demonstrating the largest diameter of the primary tumor was identified and the area measured. Using appropriate

122


Cancer Therapy Vol 1, page 123 landmarks, an identical scan was used for comparison. CAT scans were evaluated by two unrelated radiologists, one of whom was not involved in the study. Standard NCI criteria for evaluating tumor growth were used to assess stable disease (SD), partial remission (PR), and minor response (MR). After formally finishing the study, patients were followed up on an ambulatory basis with three-monthly visits. Besides measuring tumor size by CAT scan, the need for pain medication and the quality of life was monitored using questionnaires established for pancreatic diseases (Bloechle et al, 1995). A clinical benefit score based upon variables including Karnofsky score, body weight, pain and analgesic consumption was also calculated from this data. Pain intensity was measured on a visual analogue scale ranging from 0 (no pain) to 100 (the most imaginable intensive pain), in steps of 10. Analgesics consumption was assessed using another scale in which 0 indicated no regular administration of analgesic, whereas scores of 25, 50 and 75 indicated administration of nonsteroidal anti-inflammatory drugs (NSAID) or opiates several times per year (25), per month (50) or per week (100) (Bloechle et al, 1995).

the transfemoral approach (Seldinger technique). Digital subtraction angiography of the celiac trunk, superior mesenteric artery, splenic artery, common hepatic artery and, if necessary for identification of tumor leading vessels, of the gastroduodenal artery, was performed with a 4 French introducer system (Terumo), 4 French visceral catheters with a inner diameter of 0,038" (Cordis) and a monomer nonionic contrast medium (Imeron 300, BYK, Gulden). The most appropriate tumor access was determined by relating tumor localization in CAT scans to the vessel anatomy. Supraselective catheterization of an artery leading into the tumor was performed with a coaxial 2.3 French microcatheter system (Cordis) (Kröger et al, 1999; Löhr et al, 2003). The optimal approach to the tumor vasculature was gained through the inferior pancreatoduodenal artery, the dorsal pancreatic artery and/or the superior pancreatic head branches of the gastroduodenal artery. After documentation of the correct microcatheter placement in a non-occluding position, 300 CapCells were instilled slowly one by one with the blood flow in 13 patients. An additional patient received 250 capsules due to limited space in the tumor artery. The patency of the cannulated vessel was controlled periodically by fluoroscopy, followed by a control angiography of the target vessel region. The catheter and introducer systems were then removed, the puncture site compressed for 15 minutes, and a compression tape put in place for 6 hours. Diagnostic angiography visualising the peritumoral vessels was repeated in the same manner during the final visit (week 20).

C. Historical patient collective Survival data of a retrospective (historic) control group and the treatment group of this study were compared. A historic control group was established from an evaluation of all patients (n=35) with pancreatic carcinoma admitted to the Division of Gastroenterology, Rostock during the years 1996 to 1998 who were not treated by tumor resection. Of these patients, 1 had UICC stage I, 2 stage III, and 33 stage IV pancreatic carcinoma, respectively. Seven underwent palliative surgery, 10 received palliative chemotherapy, 24 needed biliary drainage (ERCP or PTCD), and 19 received best supportive care (in addition to biliary drainage or surgery). One stage IV patient was excluded since no date of death was available for this patient. Though the selection criteria for treated patients could not be applied completely to the historic control group, the historic controls and the treated patients were comparable in clinical diagnoses and initial symptoms of the disease (jaundice, abdominal pain were most frequent) and also with respect to median age (63 years in both cohorts) and gender (male patients: 74.3% in historic controls and 64.3% in treated patients).

F. Quality of Life A quality of life core questionnaire for cancer patients, QLQ-C30, has been validated in several languages (Aaronson et al, 1993; Fayers et al, 1999; Hjermstad et al, 1998; Klee et al, 1997; Sprangers et al, 1993), but the module for pancreatic carcinoma is still under development with respect to reliability, sensibility against changes, and multicultural validation (Fayers et al, 1999). Therefore, in this study an unauthorised version of the core questionnaire and a German quality of life scale for pancreas patients was used which had been published (Bloechle et al, 1995). The quality of life-data were documented independently from the safety and efficacy data by filling-out an independent questionnaire by the patient. Thus, the assessment of the quality of life data did not interfere with the routine documentation of the adverse events that were reported by the patient. The quality of life core questionnaire was analyzed in analogy to the prescriptions of the EORTC (Fayers et al, 1999). Quality of Life data were available from the baseline evaluation for all 14 patients and for analysis of change from 8 patients. The analysis was strictly performed according to the EORTC recommendations (Fayers et al, 1999).

D. Production of clinical grade CapCell® The cytochrome P450 2B1 (CYP2B1) expression construct (Löhr et al, 1998), as well as the good laboratory practice (GLP) production and characterization of the CYP2B1 expressing 293 cell clone (22P1G) (Gunzburg et al, 1999) have been described previously. Cells were amplified under good manufacturing practice (GMP) conditions (Q-One, Glasgow, Scotland, UK) and encapsulated in polymers of cellulose sulphate using an apparatus from Inotech (Dottikon, Switzerland) (Dautzenberg et al, 1999). The encapsulated cells (CapCell®) were washed twice with plain RPMI cell culture medium (Gibco/BRL) and stored at 4ÆC. Cell viability was determined using the Life&Dead viability kit (MobiTec, Braunschweig, Germany). Necessary quality control tests required for release included sterility and a demonstration that the CapCell® were both mycoplasma and endotoxin free. The mechanical stability of the capsules was determined and the potency of the encapsulated cells was determined in a cell toxicity bioassay (Löhr et al, 2002).

III. Results Each patient enrolled in the trial received 300 cellulose sulfate capsules (CapCell“) except patient 12 who received 250 CapCell® by angiographic placement (day 0) into a suitable artery feeding a primary, inoperable tumor (stage III-IV). Each capsule had an average diameter of 0.8 mm and contained around 104 cells (Löhr et al, 1999). An appropriate artery leading into the tumor could be supraselectively cannulated (Figure 1) in 14 of the 17 patients entering the study (Table 1). Two patients developed severe infections before the start of the trial and had to be treated by other means, whilst angiography was not successful in one patient.

E. Angiography Visualization of the vasculature leading to the pancreatic tumor was performed by angiography in a standard manner with

123


Löhr et al: Pancreatic cancer cell/chemotherapy Table 1: Patients entering the CT-PCA-1 study Sex Age TNM Stage 1st Symptom Survival wks Metastases Tumor m 48 T4N1Mx IV abd. Pain 102 n SD m 76 T4N1Mx IV abd. Pain 39 n PR m 67 T4NxMx IV Jaundice 64 n MR m 57 T3NxM1 IV Diarrhea 29 y SD m 74 T3N1M1 IV abd. Pain 67 y MR m 65 T4N1M1 IV abd. Pain 20 y SD f 61 T4N1M0 IV abd. Pain 65 n SD m 65 T4N1M1 IV incidental1 28 y PR f 58 T4N1M0 IV abd. Pain m 64 T3NxM1 IV abd. Pain m 53 T3NxMx IV Jaundice 44 n SD f 57 T3N0M0 III Jaundice 33 n SD f 61 T4N1M0 IV abd. Pain 112 n SD f 68 T4N1M1 IV abd. Pain 6 y SD f 70 T3N0M0 III abd. Pain 35 y SD f 60 T4NxM0 IV abd. Pain n m 52 T4N1Mx IV abd. Pain 41 n SD 1 detected on ultrasound, y = yes, n = no SD=stable disease, PR=partial response (more than 50% tumor regression), MR=minor response (between 25 and 50% tumor regression). abd.Pain = abdominal pain

Immediately after instillation of the CapCell®, a transient spasm could be observed (Figure 1D) but this did not significantly impair blood flow. At the trial endpoint, 20 weeks after CapCell® instillation, angiographic visualisation of the targeted vessels was performed. No or only minor alterations to the tumor vessels, such as reduction of diameter or increased compression as compared to day 0, were observed (data not shown). Subsequent to CapCell® instillation, each patient received low dose (1g/m2 body surface) ifosfamide (Holoxan®) on days 2-4 and 23-25, respectively (Löhr et al, 1999). Although 11 serious adverse events (SAEs) were recorded in 7 patients during the study period, none of these were treatment related (i.e. due to CapCell® instillation or ifosfamide treatment) (Löhr et al, 2001) and were attributed to the underlying disease and/or the effects thereof (Table 2). Administration of CapCell® did not result in any obvious allergic or inflammatory response and none of the patients developed pancreatitis at any time during the course of the study. Although elevated amylase levels were detected in some patients, presumably as a result of the tumor infiltration of the pancreas and limited obstructive (chronic) pancreatitis (van Gulik et al, 1997), no further increase was measured after angiography and CapCell® placement (Figure 2). Only one AE (increased lipase activity observed on day 15 after instillation) may have been possibly related to CapCell® administration. The concentration of ifosfamide in the patients blood plasma were monitored 30 to 60 minutes after administration and revealed levels of 100-200 µmol/L (Figure 3).

Figure 1. Angiographic placement of microcapsules in patient #2 with pancreatic carcinoma. (A) Digital subtraction angiography of celiac and mesenteric axis (Acunas and Rozanes 1999). (B) Supraselective cannulation of the A. transversalis (indicated by arrow) with the coaxial 2.3 French microcatheter. (C) Injection of the microcapsules. Arrow points to the area of contrast medium exclusion resulting from the capsules. (D) Celiac axis angiography directly after the capsule instillation indicating the spasm in the vessel filled with the capsules (arrow).

124


Cancer Therapy Vol 1, page 125 Table 2 Percentage of patients experiencing adverse events Adverse events

Grade 1*

Grade 2*

Grade 3*

Total

Pain

2%

12 %

2%

16 %

Malignant pancreas neoplasm

9%

5%

0%

14 %

Aggravated condition

2%

7%

4%

13 %

Decreased weight

7%

0%

0%

7%

Cholestatic hepatitis

0%

2%

4%

6%

Diarrhea

5%

0%

0%

5%

Vomiting

0%

5%

0%

5%

Nausea

0%

4%

0%

4%

Anemia

0%

4%

0%

4%

Anorexia

0%

2%

0%

2%

Ascites

2%

0%

0%

2%

Constipation

2%

0%

0%

2%

Pulmonary embolism

0%

0%

2%

2%

Enzyme abnormality

2%

0%

0%

2%

Gastrointestinal hemorrhage

0%

0%

2%

2%

Other hemorrhage

0%

0%

2%

2%

Hypertension

2%

0%

0%

2%

Subileus

0%

2%

0%

2%

Fungal infection

0%

2%

0%

2%

Intestinal obstruction

0%

0%

2%

2%

Jaundice

0%

2%

0%

2%

Kidney neoplasm

0%

2%

0%

2%

Nervousness

2%

0%

0%

2%

Pleural effusion

0%

2%

0%

2%

Sepsis

0%

0%

2%

2%

Vertigo

2%

0%

0%

2%

response (PR), characterised by a more than 50% reduction in tumor volume, was recorded; the remaining 12 patients showed a stable disease (SD) with tumor sizes in the range of 50-125% of initial size (LĂśhr et al, 2001). Of these 12 patients, 2 demonstrated a minor response (MR), i.e. tumor reduction by 25 to 50%. Kaplan-Meier analysis of the survival of the patients enrolled in the trial showed that the median survival time from the time of diagnosis is 39 weeks (Figure 5). In contrast, data from a historic control group of patients of similar age as well as disease symptoms and stage from the same medical center showed a median survival of 20 weeks (Figure 5). A second survival parameter, the percentage of patients that survived for one year or more was also monitored in long term follow-up of the patients beyond the period defined for the clinical trial. The one year survival for the treatment group was 36 % (i.e. 5 of the 14 patients treated), compared to 11 % (4 out of 35 patients) for the historic control group (LĂśhr et al, 2001). Within the 20 week study period, three patients died from disease progression (on days 9, 85 and 132). The patient who died on day 9, from a recurrent pulmonary embolism, underwent a postmortem examination. Gross pathology (Figure 6A) revealed tumor necrosis. This was confirmed by histological examination demonstrating the well differentiated adenocarcinoma and extensive necrotic tissue (Figure 6B). The capsules could not be localized in serial sections of the pancreas, spleen and liver. Thus it is not strictly possible to rule out that the effects observed were not due to the placement of the capsules and the local chemotherapeutic conversion of ifosfamide. However, sampling difficulties associated with finding tiny, almost transparent, capsules in such large organs have also experienced in pig preclinical studies (Lohr et al, 2003). In the period beyond the 20 weeks defined as the study period, a further 10 patients died. It should be noted that all three patients who died during the trial as well as three of the patients who died after the 20 week observation already had distant (liver) metastasis (Table 1) before beginning the trial.

* NCI â&#x20AC;&#x201C; common toxicity criteria

The chemotherapy regimen was well tolerated with no toxicity beyond grade II being detected in any of the 14 patients treated in this trial (not shown). The data thus strongly suggest that there is no obvious specific treatment-related risk. In addition to safety and tolerability, the efficacy of the treatment was examined. The size of the primary tumor was measured prior to starting the treatment and at weeks 10 and 20 post treatment (Figure 4). The tumor did not grow any further during this observation period in any of the treated patients. In two of the 14 patients, a partial

Figure 2 Serum amylase values of the patient cohort. The course of amylase levels in 14 patients before (d0) and after (day 1 to day 24:d1-d24; week 10, 20: w10, w20) instillation of CapCells. The individual endpoints after completion of study are indicated as ind. end. The normal range for amylase is between 20 and 120 U/L.

125


Lรถhr et al: Pancreatic cancer cell/chemotherapy

Figure 3. Ifosfamide plasma levels in pancreatic carcinoma patients carrying microencapsulated CYP2B1 producing cells in a tumor vessel after 1 g/m2 body surface given IV over 1 hour.

Figure 4. CAT scan of pancreatic tumor (A) before (0), (B) 10 weeks and (C) 20 weeks after instillation of CYP2B1-expressing, microencapsulated cells into the pancreas and low-dose ifosfamide treatment. The area of the tumor is outlined.

Figure 5. Kaplan-Meier analysis of patients treated with microencapsulated, CYP2B1-expressing cells and low-dose ifosfamide (!; n = 14) vs. a historical control group ("; n = 33).

126


Cancer Therapy Vol 1, page 127

Figure 6 . Gross pathology (A) and histology (B) of pancreatic tumor from patient who died on day 9 of treatment from a pulmonary embolism. Gross tumor necrosis (A) was confirmed by histological examination (B) demonstrating the well differentiated adenocarcinoma and extensive necrotic tissue.

"worst case scenario" required a pain relief of 20 points or more to be judged as an improvement and a decrease in the Karnofsky index of 10 points or more taken to indicate worsening. In this scenario, 7 patients (50%) experienced a clinical benefit, 3 were neutral (21.4%, benefits were offset by impairments) and 4 patients (including those dying before the average survival time) had no clinical benefit (28.6%). The second, "best case scenario" assumes a pain relief of 10 points or more as an improvement and a decrease in the Karnofsky index of 20 points or more is taken to indicate worsening. Using these criteria, 10 patients (71.4%) had clinical benefit, 2 patients showed no benefit but no deterioration either (14.3%), and 2 patients had definitely no benefit.

A postmortem examination of the patient who died at week 53 (i.e. outside the study period) confirmed a widespread pancreatic tumor. The information gathered from the patients with respect to clinical benefit is shown in Table 3. If a clinical benefit is considered to be either no increase or a decrease in pain intensity then 10 of the 14 patients show a benefit (Table 3, Pain Intensity, bold). This could be confirmed for 7 of the patients by analgesic consumption (Table 3, Analagesic Consumption, bold). It should be noted that none of the benefiting patients registered an increase in pain medication both in terms of dosage or WHO level. While none of the patients showed an increased Karnofsky score after treatment, 7 of the 14 patients remained stable at the week 10 assessment and 4 of those were stable even at week 20 (Table 3, Karnofsky Score, bold). One patient (patient 1) showed an increase in body weight at week 10 and at week 20 and patient 12 had a weight increase at week 10 (this patient dropped out and so no week 20 weight value could be obtained). A further two patients (7 and 11) showed stable body weight at week 10 but patient 7 dropped out and patient 11 showed weight loss at week 20 (Table 3, Body Weight, bold). Taken together, two of the patients (5 and 11) had stable measurements for all four criteria (italics), with only marginal (4kg) weight loss at week 20. Two scenarios were made to establish the overall (i.e integrative) clinical benefit response, where each patient was given a +2 for an improved value, +1 for a stable value and -1 for a worsened value for each of the 4 criteria (pain, analgesic consumption, Karnofsky index and body weight) compared to the relevant week 0 values. The

IV. Discussion Chemotherapy has previously only been marginally effective for the treatment of pancreatic carcinoma despite the introduction of new cytotoxic agents such as gemcitabine (Carmichael et al, 1996; Storniolo et al, 1999). Gemcitabine acts by multiple mechanisms, including inhibition of ribonucleoside diphosphate reductase, dCMP deaminase and dCTP incorporation into DNA and RNA thereby disrupting DNA synthesis leading to apoptosis (Rieger et al, 1999). Clinical responses are achieved in 5.4-11% of pancreatic cancer patients, with a median survival time of between 5.6 and 6.3 months (Burris et al, 1997; Carmichael et al, 1996; Casper et al, 1994). However, in the face of a general median survival of patients with pancreatic carcinoma of around 4 months (Carmichael 1997), new treatment modalities for single or combinatorial therapy approaches are desperately needed.

127


Löhr et al: Pancreatic cancer cell/chemotherapy

Table 3: Analysis of measures of clinical benefit Pain Intensity(0-100)

Patient

Analgesics Consumption(0-100)

week 0

week 10

week 20

week 0

week 10

week 20

Karnofsky Score(0100) week 0

Body weight (Week 0) and Variation (in kg)

week 10

week 20

week 0

week 10

week 20

1

C

40

0

0

100

100

100

100

80

80

63

3

2

2

C

20

40

30

0

100

100

100

100

90

67

-1

-9

3

C

0

0

0

0

0

0

80

80

80

76

-9

-11

4

nC

0

0

nd

0

0

nd

100

90

nd

55

-5

nd

5

C

0

0

0

0

0

0

100

100

100

78

-6

-4

6

D

30

30

-

75

75

-

100

70

-

73

-1

nd

7

nC

50

40

40

50

75

100

100

100

90

63

0

0

8

D

0

0

-

0

0

-

100

90

-

73

-1

nd

11

C

0

0

0

0

0

0

100

100

100

79

0

-4

12

nC

20

20

nd

50

100

nd

100

90

nd

61

1

nd

13

C

30

20

20

50

75

75

100

100

100

60

-2

-4

14

D

50

-

-

100

-

-

70

-

-

55

nd

nd

15

C

40

50

50

50

100

100

80

80

70

79

-10

-14

17

nC

10

nd

nd

100

nd

nd

80

nd

nd

68

nd

nd

Abbreviations: C: completion of trial; nC: noncompletion of trial; D: discontinued/death; nd:not done BOLD: fulfils benefit criteria; Italic: fulfils benefit criteria in all sections with just marginal weight loss (4kg) at week 20

in nude mice (Löhr et al, 1998) as well as into mammary tumors in immunocompetent mice (Kammertöns et al, 2000). In these experiments, the activated metabolites that diffused from the encapsulated cells to the surrounding tumor cells were sufficient to result in a clear anti-tumor effect in both instances. Therefore, we reasoned that a similar approach might prove feasible in patients. Local intratumoral activation holds the promise of good efficacy coupled with low systemic side effects due to reduced concentrations of the chemotherapeutic agent. Direct injection of the capsules, however, brings with it the risk of bleeding as well as the danger of metastatic cells seeding along the needle track. The pancreas is located deep in the retroperitoneum, also making it difficult for repeated transcutaneous injections. The possibility for future repeated intra-arterial instillations of CapCell® was supported by the finding(s) that (i) only 2 patients showed occluded vessels and (ii) only one other patient displayed evidence that the tumor had affected the blood vessels that lead to it. Another potential route of application of CapCell® would be by endoscopic delivery. However, the pancreatic duct is occluded in the majority of tumors, limiting the use of this route of delivery (Schmid et al, 1994).

Oxazaphosphorines such as ifosfamide are naturally activated in the liver and also have been used for the chemotherapy of pancreatic cancer (Cerny et al, 1991a). However, the high systemic concentrations required for effective chemotherapy are associated with significant side effects especially in elderly patients (Loehrer et al, 1985). The response rates reported range between 0 and 30% (Cerny et al, 1991a; Loehrer et al, 1985). Nevertheless, preclinical studies on other tumor types have shown the utility of the local expression of cytochrome enzymes such as the isoform 2B1, in combination with oxazaphosphorines, as reviewed by Chen and Waxman (Chen and Waxman 2002). However, in many of the previous studies, the gene encoding cytochrome P450 was introduced directly into the tumor cells prior to establishing tumors in nude mice and subsequent oxazaphosphorine treatment. Thus, although these studies elegantly demonstrate proof of principle, they represent a situation that is clinically not applicable, given that gene transfer efficacies directly to tumors in vivo are relatively poor, regardless of the vector system used. We have previously demonstrated the efficacy of the intratumoral injection of encapsulated cells expressing cytochrome P450 2B1 into pre-formed pancreatic tumors

128


Cancer Therapy Vol 1, page 129 The relatively non-invasive interventional angiography approach (Dondelinger 1999) was used to deliver 300 CapCell®. Comparable delivery of almost identical size solid particles did not result in substantial occlusion of the blood vessels leading to primary and metastatic hepatic masses (Talamonti et al, 1998; Trinchet 1995). The delivery of CapCell® via the angiographic route was shown to be both feasible and safe. No treatment related Serious Adverse Events (SAEs) were recorded during the study period. The ifosfamide dose was well tolerated, as was the capsule instillation, which could be performed under local anesthesia in 15 minutes on average. Thus the primary objectives of the study, the evaluation of the safety and tolerability of the treatment were met. The efficacy of the treatment was also examined in this trial. In contrast to the usual progression of the disease, in which the tumor mass continues to grow, all the treated patients showed a stabilization of tumor size and 4/14 (28%) showed a reduction in tumor size of more than 25%, suggesting a clear tumor killing effect. Our cell culture studies suggested that the toxic metabolites of ifosfamide act by inducing cell necrosis, rather than apoptosis (Karle et al, 2001). In this light it is of interest that in our preclinical animal studies extensive necrosis was observed after tumor treatment (Löhr et al, 1998) as well as in the one patient treated in this trial whose tumor could be examined retrospectively at postmortem, although it should also be noted that these tumors have a tendency to be necrotic. Especially for pancreatic cancer patients, a decrease in the primary tumor size is of clinical benefit in terms of increased survival time and decreased pain. This was confirmed in our study in which a comparably large increased median survival time after diagnosis of more than 44 weeks and no impaired or even an increased quality of life including no requirement for increased pain medication was noted. Although this is a phase I/II study with a relatively small patient collective, these results compare very favourably with those obtained with gemcitabine, in which a median survival of around 28 weeks was reported (Burris et al, 1997; Carmichael et al, 1996; Casper et al, 1994). The one-year survival rate was also higher in the treated group (36%) as compared to the historic control group (11%). Although the two cohorts of historic controls and treated patients might differ in potential risk factors for survival (Löhr et al, 1999), the difference in survival rate of 25% cannot be explained only by selection bias, and may indicate a possible superior efficacy of the CapCell® treatment. In comparison, the one year survival rate for gemcitabine in a large compassionate use setting in which a comparable 80% of patients were stage IV (86% of patients in our trial were stage IV) was 15% (Storniolo et al, 1999). A phase III trial of gemcitabine yielded a 1 year survival of 18% (Burris et al, 1997). It is possible that with optimisation and/or additional rounds of treatment, higher survival rates may be obtainable after CapCell® therapy, for example in a phase II or III trial. In order to uphold the principle laid down in the declaration of Helsinki stating that the interests of the subject must prevail over the interests of science and

society the effects of clinical trials on quality of life should be determined (Hope-Stone et al, 1997). This is particularly applicable to a devastating disease like pancreatic cancer and, in this light, gemcitabine received approval because of its ability to improve the quality of life of patients (Carmichael 1997). Thus clinical benefit responses were also examined in this phase I/II clinical trial. A best case and a worst case scenario were examined. Even in a worst case scenario, some clinical benefit was experienced by 50% of patients and this was extended to 71% in the best case scenario. It is clear that in it’s present form, this kind of treatment is directed towards the treatment of the primary tumor rather than metastases and that even if the primary tumor could be effectively treated in those patients without obvious metastases, occult micrometastases may later become a problem. One hypothetical outcome of the treatment that has yet to be analysed is that tumor cell death may lead to better tumor antigen presentation and the induction of anti-tumor and metastases responses. There are a number of ways in which this issue may be dealt with including the use of combination chemotherapies, for example capsules with low dose ifsofamide to deal with nonresectable tumors, followed by gemcitabine to treat potential metastases. Other protential strategies include the use of viral vectors that are ideally targeted to deliver the cytochrome P450 gene to metastatic cells (Chen and Waxman, 2002; Kan et al, 2002) or the implantation of encapsulated retroviral vector producing cells (Saller et al, 2002).

Acknowledgements This work was supported in part by a Vaekstfond grant from the Danish Government. The authors thank Prof. R. Kohnen, IMEREM GmbH for professional monitoring of this clinical trial.

References Aaronson NK, Ahmedzai S, Bergman B, Bullinger M, Cull A, Duez NJ, Filiberti A, Flechtner H, Fleishman SB, de Haes JC, et al. (1993) The European Organization for Research and Treatment of Cancer QLQ-C30: a quality-of-life instrument for use in international clinical trials in oncology. J Natl Cancer Inst 85, 365-76 Acunas B, Rozanes I (1999) Hepatocellular carcinoma: treatment with transcatheter arterial chemoembolization. Eur J Radiol 32, 86-89 Aspinall RJ, Lemoine NR (1999) Gene therapy for pancreatic and biliary malignancies. Ann Oncol 10 (Suppl. 4), S188192 Bloechle C, Izbicki JR, Knoefel WT, Kuechler T, Broelsch CE (1995) Quality of life in chronic pancreatitis - results after duodenum-preserving resection of the head of the pancreas. Pancreas 11, 77-85 Burris HA, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, Cripps MC, Portenoy RK, Storniolo AM, Tarassoff P, Nelson R, Dorr FA, Stephens CD, von Hoof DD (1997) Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced

129


Löhr et al: Pancreatic cancer cell/chemotherapy pancreatic cancer: a randomized trial. J Clin Oncol 15, 2403-2413 Carmichael J (1997) Clinical response benefit in patients with advanced pancreatic cancer. Role of gemcitabine. Digestion 58, 503-507 Carmichael J, Fink U, Russell RCG, Spittle MF, Harris AL, Spiessi G, Blatter J (1996) Phase II study of gemcitabine in patients with advanced pancreatic cancer. Br J Cancer 73, 101-105 Casper ES, Green MR, Kelsen DP, Heelan RT, Brown TD, Flombaum CD, Trochanowski B, Tarassoff PG (1994) Phase II trial of gemcitabine (2,2'-difluorodeoxycytidine) in patients with adenocarcinoma of the pancreas. Invest New Drugs 12, 29-34 Cerny T, Martinelli G, Goldhirsch A, Terrier F, Joss R, Fey MF, Brunner KW, Küpfer (1991a) Continuous 5-day infusion of ifosfamide with mesna in inoperable pancreatic cancer patients: a phase II study. J Cancer Res Clin Oncol 117, S135-S138 Cerny T, Martinelli G, Goldhirsch A, Terrier F, Joss R, Fey MF, Brunner KW, Küpfer A (1991b) Continuous 5-day infusion of ifosfamide with mesna in inoperable pancreatic cancer patients: a phase II study. J Cancer Res Clin Oncol 117 (Suppl. IV), S135-S138 Chen L, Waxman DJ (2002) Cytochrome P450 Gene-directed Enzyme Prodrug Therapy (GDEPT) for Cancer. Curr Pharm Des 8, 1405-16 Dautzenberg H, Schuldt U, Grasnick G, Karle P, Müller P, Löhr M, Pelegrin M, Piechaczyk M, von Rombs K, Günzburg WH, Salmons B, Saller RM (1999) Development of cellulose sulphate based polyelectrolyte complex microcapsules for medical applications. Ann NY Acad Sci 875, 46-63 Dirven H, van Ommen B, van Blaederen PJ (1996) Glutathione conjugation of alkylating cytostatic drugs with a nitrogen mustard group and the role of glutathione S-transferases. Chem Res Toxicol 9, 351-360 Dondelinger R (1999) Advances in abdominal interventional radiology. Lancet 353, SI15-SI18 Fayers P, Aaronson N, Bjordal K, Curran D, Groenveld M (1999) on behalf of the EORTC Quality of Life Study Group. EORTC QLQ-C30 Scoring Manual. 2nd Edition, Brussels Gad-El-Mawla N (1986) Ifosfamide in advanced pancreatic cancer. Cancer Chemother Pharmacol 18 (Suppl.2), 55-56 Gad-El-Mawla N, Ziegler JL (1981) Ifosfamide treatment of pancreatic cancer. Cancer Treat Rep 65, 357-8 Greenlee RT, Hill-Harmon MB, Murray T, Thun M (2001) Cancer Statistics 2001. CA Cancer J Clin 51, 16-36 Günzburg WH, Karle P, Renz R, Salmons B, Renner M (1999) Characterisation of a human cell clone expressing cytochrome P450 for safe use in human somatic cell therapy. Ann. N.Y. Acad. Sci. 880, 326-336 Günzburg WH, Löhr M, Salmons B (2002) Novel treatments and therapies in development for pancreatic cancer. Expert Opin Investig Drugs. 769-786 Hawes RH, Xiong Q, Waxman I, Chang KJ, Evans DB, Abbruzzese JL (2000) A multispecialty approach to the diagnosis and management of pancreatic cancer. Am J Gastroenterol 95, 17-31 Heinemann V (2002) Gemcitabine-based combination treatment of pancreatic cancer. Semin Oncol 29 (1 Suppl. 3), 25-35 Hermanek P, Hutter RVP, Sobin LH, Wagner G, Wittekind C (1997) TNM atlas, illustrated guide to the TNM/pTNM classification of malignant tumors.

Hjermstad MJ, Fayers PM, Bjordal K, Kaasa S (1998) Healthrelated quality of life in the general Norwegian population assessed by the European Organization for Research and Treatment of Cancer Core Quality-of-Life Questionnaire: the QLQ=C30 (+ 3). J Clin Oncol 16, 1188-96 Hope-Stone LD, Napier MP, Begent RH, Cushen N, O'Malley D (1997) The importance of measuring quality of life in phase I/II trials of cancer therapy: the effects of antibody targeted therapy: Part I Eur J Cancer Care 6, 267-272 Huguier M, Mason NP (1999) Treatment of cancer of the exocrine pancreas. Am J Surg 177, 257-265 Kammertöns T, Gelbmann W, Karle P, Saller R, Salmons B, Günzburg WH, Uckert W (2000) Combined chemotherapy of murine mammary tumors by local activation of the prodrugs ifosfamide and 5-fluorocytosine. Cancer Gene Therapy 7, 629-636 Kan O, Kingsman S, Naylor S (2002) Cytochrome P450-based cancer gene therapy: current status. Expert Opin Biol Ther 2, 857-68 Karle P, Renner M, Salmons B, Günzburg WH (2001) Necrotic, rather than apoptotic, cell death caused by cytochrome P450 activated ifosfamide. Cancer Gene Therapy 8, 220-230 Keizer HJ, Ouwerkerk J, Welvaart K, van der Velde CJH, Cleton FJ (1995) Ifosfamide treatment as a 10-day continuous intravenous infusion. J Cancer Res Clin Oncol 121, 297302 Klee M, Groenvold M, Machin D (1997) Quality of life of Danish women: population-based norms of the EORTC QLQ-C30. Qual Life Res 6, 27-34 Kröger JC, Benz S, Hoffmeyer A, Bago Z, Bergmeister H, Günzburg WH, Karle P, Klöppel G, Losert U, Müller P, Nizze H, Obermaier R, Probst A, Renner M, Saller R, Salmons B, Schwendenwein I, von Rombs K, Wiessner R, Wagner T, Hauenstein K-H, Löhr M (2003) Intra-arterial instilattion of microencapsulated, ifosfamide-activating cells in the pig pancreas for chemotherapeutic targeting. Pancreatology 3, 55-63 Kurowski V, Wagner T (1993) Comparative pharmacokinetics of ifosfamide, 4-hydroxyifosfamide, chloracetaldehyde, and 2and 3-dechloroethylifosfamide in patients on fractionated intravenous ifosfamide therapy. Cancer Chemother Pharmacol 33, 36-42 Loehrer PJ, Williams SD, Einhorn LH, Ansari R (1985) Ifosfamide: an active drug in the treatment of adenocarcinoma of the pancreas. J Clin Oncol 3, 367-372 Löhr JM, Bago ZT, Bergmeister H, Ceijka M, Freund M, Gelbmann W, Günzburg WH, Hain J, Hauenstein K, Henniger W, Hoffmeyer A, Karle P, Kröger J-C, Kundt G, Liebe S, Losert U, Müller P, Probst A, Püschel K, Renner M, Renz R, Saller R, Salmons B, Schuh M, Schwendenwein I, von Rombs K, Wagner T, Walter I (1999) Cell therapy using microencapsulated 293 cells transfected with a gene contruct expressing CYP2B1, an ifosfamide converting enzyme, instilled intra-arterially in patients with advanced stage pancreatic carcinoma: a phase I/II study. J Mol Med 77, 393-398 Löhr JM, Hoffmeier A, Kröger J-C, Freund M, Hain J, Holle A, Karle P, Knöfel WT, Lieber S, Müller P, Nizze H, Renner M, Saller R, Wagner T, Hauenstein K, Günzburg WH, Salmons B (2001) Microencapsulated cell mediated therapy of inoperable pancreatic carcinoma: a phase I/II study. Lancet 357, 1591-1592 Löhr M, Müller P, Karle P, Stange J, Mitzner S, Jesnowski R, Nizze H, Nebe B, Liebe S, Salmons B, Günzburg WH (1998)

130


Cancer Therapy Vol 1, page 131 Targeted chemotherapy by intratumour injection of encapsulated cells engineered to produce CYP2B1, an ifosfamide activating cytochrome P450. Gene Therapy 5, 1070-1078 Löhr M, Saller RM, Salmons B, Gunzburg WH (2002) Microencapsulation of genetically engineered cells for cancer therapy. Methods in Enzymology 346, 603-618 Löhr M, Trautmann B, M G, Peters S, Zauner I, Maillet B, Klöppel G (1994) Human ductal adenocarcinomas of the pancreas express extracellular matrix proteins. Br J Cancer 69, 144-151 Neoptolemos JP, Stocken DD, Dunn JA, Almond J, Beger HG, Pederzoli P, Bassi C, Dervenis C, Fernandez-Cruz L, Lacaine F, Buckels J, Deakin M, Adab FA, Sutton R, Imrie C, Ihse I, Tihanyi T, Olah A, Pedrazzoli S, Spooner D, Kerr DJ, Friess H, Buchler MW (2001) Influence of resection margins on survival for patients with pancreatic cancer treated by adjuvant chemoradiation and/or chemotherapy in the ESPAC-1 randomized controlled trial. Ann Surg 234, 75868 Rieger J, Durka S, Streffer J, Dichgans J, Weller M (1999) Gemcitabine cytotoxicity of human malignant glioma cells and modulation by antioxidants, Bcl-2 and dexamethasone. Eur J Pharmacol 365, 301-308 Rosenberg L (2000) Pancreatic cancer. A review of emerging therapies. Drugs 59, 1071-1089 Saller RM, Indraccolo S, Coppola V, Esposito G, Stange J, Mitzner S, Heinzmann U, Amadori A, Salmons B, WH G (2002) Encapsulated cells producing retroviral vectors for in vivo gene transfer. J Gene Med 4, 150-160 Schmid RM, Weidenbach H, Lerch MM, Liptay S, Schorr J, Beckh KH, Adler G (1994) Liposome mediated in vivo gene transfer into different tissues of the gastrointestinal tract. Z Gastroenterol 32, 665-670 Sprangers MA, Cull A, Bjordal K, Groenvold M, Aaronson NK (1993) The European Organization for Research and Treatment of Cancer. Approach to quality of life assessment: guidelines for developing questionnaire modules. EORTC Study Group on Quality of Life. Qual Life Res 2, 287-95 Storniolo AM, Enas NH, Brown CA, Voi M, Rothenberg ML, Schilsky R (1999) An investigational new drug treatment program for patients with gemcitabine: results for over 3000 patients with pancreatic carcinoma. Cancer 85, 1261-8 Talamonti M, Tellez C, Benson A (1998) Local-regional therapy for metastatic liver tumors. Cancer Treat Res 98, 172-199 Trinchet JC (1995) A comparison of lipiodol chemoembolization and conservative treatment for unresectable hepatocellular carcinoma. N Engl J Med 332, 1256-1261 van Gulik TM, Reeders JW, Bosma A, Moojen TM, Smits NJ, Allema JH, Rauws EA, Offerhaus GJ, Obertop H, Gouma DJ (1997) Incidence and clinical findings of benign, inflammatory disease in patients resected for presumed

pancreatic head cancer. Gastrointest Endosc 46, 417-23 Wils JA, Kok T, Wagener DJT, Francois E, Selleslags J, Duez N (1993) Phase II trial with ifosfamide in pancreatic cancer. Eur J Cancer 29A, 290

Walter H. Günzburg

131


Lรถhr et al: Pancreatic cancer cell/chemotherapy

132


Cancer Therapy Vol 1, page 133 Cancer Therapy Vol 1, 133-142, 2003.

Electrochemotherapy: advantages and drawbacks in treatment of cancer patients Review Article

Gregor Sersa*, Maja Cemazar, and Zvonimir Rudolf Institute of Oncology, Zaloska 2, 1000 Ljubljana, Slovenia.

__________________________________________________________________________________ *Correspondence: Prof. Gregor Sersa, Ph.D.: Institute of Oncology Ljubljana, Zaloska 2, SI-1000 Ljubljana, Slovenia; Phone/Fax: +386-1-433-74-10; e-mail: gsersa@onko-i.si Key words: electrochemotherapy, bleomycin, cisplatin, malignant tumors, melanoma Received: 17 June 2003; Accepted: 30 June 2003; electronically published: July 2003

Summary Electrochemotherapy combines administration of nonpermeant or poorly permeant chemotherapeutic drugs with application of electric pulses to the tumors in order to facilitate the drug delivery into the cells. Thus, enhanced drug delivery can substantially potentiate chemotherapeutic drug effectiveness, locally at the site of the cell electroporation by electric pulses, without affecting drug effectiveness in the tissues that were not exposed to electric pulses. Vast amount of information gathered on effectiveness and mechanisms of action of electrochemotherapy facilitated clinical trials using bleomycin and cisplatin in electrochemotherapy protocols. All studies provided evidence that electrochemotherapy is effective treatment for local tumor growth in patients with different cancer types. In this review we gathered the data of the clinical trials that have been published so far, and presented our latest clinical experience on electrochemotherapy with cisplatin at the Institute of Oncology in Ljubljana, pointing out the advantages and drawbacks of this treatment. treated by electrochemotherapy (Heller et al, 1999; Mir, 2000).

I. Introduction What is electrochemotherapy? Electrochemotherapy consists of chemotherapy followed by local application of electric pulses to the tumor to increase drug delivery into the cells. In late eighties were published the first reports using different sets of electric pulses, both exponential and square wave, with high amplitude, demonstrating that antitumor effectiveness of chemotherapeutic drug bleomycin can be potentiated, resulting in tumor cures (Belehradek et al, 1991; Mir et al, 1991a; Okino and Mohri, 1987). The idea was to apply electric pulses through a set of metal plate electrodes to the limited area of the tissue, i.e. tumor, in order to permeabilize the membrane of tumor cells and increase uptake and effectiveness of the drug injected before the application of electric pulses. The drug that was used in these first studies, bleomycin, is a hydrophilic drug, that has very limited transport through the cell membrane, but is very cytotoxic once bound to DNA (Mir et al, 1996). Consequently, for good antitumor effectiveness, drug doses could be drastically reduced, because electroporation increased drug effectiveness several fold, locally at the site of electric pulses application. As a result of reduced drug dosage minimal or no side effects were observed in animals and patients

II. Preclinical studies on electrochemotherapy Some review papers have already dealt with this subject, but briefly we will summarize again (Mir, 2000; Sersa, 2000a). In vitro studies tested several chemotherapeutic drugs for potential application in combination with electroporation of the cells (Cemazar et al, 1998a; Gehl et al, 1998; Jaroszeski et al, 2000a; Orlowski et al, 1988; Sersa et al, 1995). Since electroporation can facilitate drug transport through cell membrane for only those molecules that are poorly or nonpermeant, the selection is limited to those drugs that are hydrophilic, and lack transport systems in the membrane. The result of these studies was that only two drugs have been identified as potential chemotherapeutic drugs for electrochemotherapy. The first being bleomycin, that is hydrophilic, has very restricted transport through the cell membrane, but its cytotoxicity could be potentiated several 1000 times with electroporation of cells (Cemazar et al, 1998b; Gehl et al, 1998; Jaroszeski et al, 2000a; Kambe et al, 1996; Kuriyama et al, 2000; Orlowski et al,

133


Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients 1988). The second being cisplatin that has also hampered transport through the cell membrane (Gately and Howell, 1993). The exact mechanisms of the transport for cisplatin are not fully understood. However, electroporation of cells demonstrated increased cisplatin cytotoxicity up to 80 fold (Cemazar et al, 1998a, 2001; Gehl et al, 1998; Jaroszeski et al, 2000a; Kambe et al, 1996; Kuriyama et al, 2000; Melvik et al, 1986; Sersa et al, 1995). Besides these two drugs other platinum containing compounds, actinomycin D, adriamycin, mitomycin C, 5-FU and cyclophosphamide showed promising results in in vitro studies and in some in vivo studies, but didnâ&#x20AC;&#x2122;t reach clinical testing (Kambe et al, 1996; Kuriyama et al, 2000; Orlowski et al, 1988; Yabushita et al, 1997). Both drugs, bleomycin and cisplatin, have been tested on animal models in vivo. Their effectiveness was demonstrated on several tumor models, in mice, rats, rabbits, cats, dogs, horses and guinea pigs. In these studies solid subcutaneous tumors, in muscle, liver and brain, being either sarcomas, carcinomas, melanoma or neuroblastoma were used to demonstrate antitumor effectiveness of electrochemotherapy (Rols et al, 2002; Mir et al, 1995; Sersa, 2000a). It was established that electric pulses have to be applied at the time of maximal drug concentration in the tumor, in order to achieve the best antitumor effect. Depending on the route of the drug administration, the best timing for intravenous injection of the drug is 3 minutes before application of electric pulses, and for intratumoral administration electric pulses should be applied immediately after drug injection (Cemazar et al, 1998c; Domenge et al, 1996; Heller et al, 1997; Sersa et al, 1995). Electroporation of the tissue before drug administration has minimal or no antitumor effectiveness. In addition, drug dosage dependency of antitumor effectiveness and dependency on amplitude, number of pulses and electric field distribution in the tissues were elaborated in the preclinical studies (Cemazar et al, 1998c; Heller et al, 1997; Jaroszeski et al, 2001; Miklavcic et al, 1998; Mir et al, 1991a; Sersa et al, 1995). Furthermore, elaborated were also other electrical parameters such as the threshold for reversible and irreversible permeabilization of the tissue and frequency of the pulses (Gehl et al, 1999; Macek Lebar et al, 2002; Miklavcic et al, 2000; Pucihar et al, 2002). Based on all these data, we can summarize that for good antitumor effectiveness using plate electrodes with the distance from 4 to 8 mm between them, optimal set of pulses is 8 pulses with amplitude 1100 to 1300 V/cm, pulse duration 100 Âľs, and frequency 1Hz. For better effect 8 electric pulses should be delivered in two perpendicular directions in two sets of 4 pulses (Cemazar et al, 1995; Miklavcic et al, 1998; Sersa et al, 1996a). Application of electric pulses only or treatment with the drug only had minimal or no effect on tumor growth. Needle electrodes with different configuration of the needles were also developed for electrochemotherapy (Gehl et al, 1999; Gilbert et al, 1997; Mir et al, 1997). Due to the different setup of the electrodes it is difficult to prescribe optimal electric pulses parameters for good antitumor effect of electrochemotherapy. However, basically, these types of electrodes require lower electric field intensity than plate electrodes. This is because with

needle electrodes there is no need to overcome the resistance of stratum corneum, since these electrodes are inserted directly in the tumor tissue. Basic mechanism of action of electrochemotherapy is electroporation of cells in tumors, which increases drug effectiveness by enabling the drugs to reach intracellular targets (Belehradek et al, 1994; Cemazar et al, 1998c, 1999). Besides this principal one, other mechanisms that are involved in antitumor effectiveness of electrochemotherapy were described. Application of electric pulses to the tissues induces transient but reversible reduction of blood flow. Restoration of blood flow in normal tissue is much faster than in tumors (Gehl et al, 2002; Sersa et al, 1999a). The decrease in tumor blood flow induces drug entrapment in the tissue, providing more time for drug action (Sersa et al, 1999a,b). Besides, this phenomenon prevents bleeding from the tissue (Gehl and Geertsen, 2000). The effect of electrochemotherapy is not only on tumor cells in the tumors, but also on stromal cells, including endothelial cells in the lining of tumor blood vessels. Therefore, another mechanism involved in antitumor effectiveness of electrochemotherapy is its vascular targeted effect (Cemazar et al, 2001; Sersa et al, 1999b, 2002). Due to the massive tumor antigen shedding in the organisms, electrochemotherapy can induce also some systemic immunity, that can be up-regulated by additional treatment with biological response modifiers like IL-2 and TNF-! (Heller et al, 2000; Mir et al, 1992, 1995; Sersa et al, 1996b, 1997). Summarizing, electrochemotherapy protocols were optimized in preclinical studies in vitro and in vivo, and basic mechanisms elucidated, such as electroporation of cells, tumor drug entrapment, antivascular effect and involvement of immune response. Based on all these data, electrochemotherapy with bleomycin and cisplatin was promptly evaluated in clinical trials.

III. Overview of clinical studies The first report of L.M. Mir on treatment of head and neck patients with electrochemotherapy using bleomycin, published in 1991, stimulated other groups that have already tested electrochemotherapy in preclinical studies, to launch their own clinical studies (Belehradek M et al, 1993; Domenge et al, 1996; Glass et al, 1996ab, 1997; Heller et al, 1996; Mir et al, 1991; Reintgen et al, 1996; Rudolf et al, 1995). At that time, groups from Villejuif and Toulouse in France, and groups in Tampa, USA and Ljubljana, Slovenia were involved in electrochemotherapy studies. Based on the first experience, a joint clinical paper was published, summarizing clinical results (Mir et al, 1998). The results of the joint study indicated that electrochemotherapy with bleomycin in patients, given either intravenously or intratumorally, is feasible, effective and without side effects. The treatment was performed on skin tumor nodules originating from different malignant tumors; however predominant tumor type was malignant melanoma and squamous cell carcinoma. Observed were 85% objective responses, with high percentage (56%) of

134


Cancer Therapy Vol 1, page 135 long lasting complete responses. Thereafter, other groups reported on effectiveness of electrochemotherapy with bleomycin, with similar results as published in the joint study (Burian et al, 2003; Gehl et al, 2000; Heller et al, 1998; Kubota et al, 1998; Panje et al, 1998; Rodriguez et al, 2001; Rols et al, 2000; Sersa et al, 2000b) (Table 1). Our group published the first clinical data on electrochemotherapy with intratumorally injected cisplatin in 1998 and thereafter with intravenous injection (Rebersek et al, 2000; Sersa et al, 1998; 1999c, 2000c, d). The study with intravenously given cisplatin was designed to verify whether electroporation of tumors in patients with progressive disease of malignant melanoma can increase antitumor effectiveness of a standard cisplatin based chemotherapy protocol (Sersa et al, 2000d). Good antitumor effectiveness was observed, but not very high percentage of objective responses, predominantly because big tumor nodules were included, where electrochemotherapy was less effective (Table 2). However, the study demonstrated that electrochemotherapy could be used as an adjunct to systemic ongoing cisplatin treatment, predominantly in patients in whom antitumor effectiveness needs to be potentiated locally. Compared to electrochemotherapy with intratumorally injected cisplatin, electrochemotherapy with intravenously injected cisplatin was less effective (Table 2). Electrochemotherapy with intratumorally injected cisplatin was equally or more effective compared to electrochemotherapy with bleomycin given intratumorally (Glass et al, 1996b, 1997; Heller et al,

1998; Mir et al. 1998; Sersa et al, 1998, 1999c, 2000c). Furthermore, the data obtained on electrochemotherapy with cisplatin demonstrated that when cisplatin was given intravenously it was less effective compared to electrochemotherapy with bleomycin given either intravenously or intratumorally (Glass et al, 1996a, b, 1997; Heller et al, 1998; Mir et al, 1998; Sersa et al, 2000d). Studies on electrochemotherapy with intratumorally injected cisplatin were carried out on patients with squamous cell carcinoma of the neck, basal cell carcinoma and adenocarcinoma of the breast and tubae, however the predominant group was 10 patients with malignant melanoma (Sersa et al, 1998, 2000c). The results on malignant melanoma patients proved that electrochemotherapy with cisplatin is effective in controlling local tumor growth, and that it has a much higher probability for local tumor control than intratumoral cisplatin injection (78% and 19%, respectively) (Sersa et al, 2000c). Table 2 summarizes results of these studies. Long lasting complete responses of the treated nodules up to two years were induced, without scaring of the tissue and good cosmetic effect. Nodules that were bigger than the distance between the electrodes were treated by consecutive application of electric pulses to the tumor nodules, until the whole tumor area was covered in one or in consecutive sessions. If the tumors regrew it was possible to retreat the nodules in the next session with equal effectiveness.

Table 1. Results of clinical studies on electrochemotherapy with bleomycin, given intravenously or intratumorally. Tumor

No. Pts.

No. Tumors

OR (%)

CR (%)

Head and neck squamous cell carcinoma Malignant melanoma Basal cell carcinoma Adenocarcinoma (breast, salivary gland, hypernephroma)

17

77

62

43

14 2 4

94 6 31

89 100 100

34 17 97

Total

37

208

62-100

17-97

Head and neck tumors

14

14

86

50

Squamous, adeno and adenid cystic carcinoma Malignant melanoma Squamous cell carcinoma Kaposi sarcoma Breast cancer Bladder; trans. cell ca.

11 1 1 2 1

106 1 4 14 17

95 100 100 100 100

60 0 100 58 82

Total

25

116

80-100

0-100

Intravenous BLM dose: 10-15 mg/m2 or 18-27 U/m2

Intratumoral BLM dose: 0.2-0.55 mg/cm3 or 0,25-1.0 U/cm3

135


Sersa et al: Electrochemotherapy – advantages and drawbacks in treatment of cancer patients Table 2. Results of clinical studies on electrochemotherapy with cisplatin, given intravenously or intratumorally. Tumor

No. Pts.

No. Tumors

OR (%)

CR (%)

9

27

48

11

Head and neck

1

2

100

100

squamous ca. Malignant melanoma Basal cell carcinoma Adenocarcinoma (breast, ovary)

10 1 2

82 4 6

78 100 100

68 100 78

Total

14

94

78-100

68-100

Intravenous Cisplatin based chemotherapy protocol Malignant melanoma Intratumoral Cisplatin 1mg/cm3

tumor. In the case of bigger nodules cisplatin was injected in several different locations in the tumor area in order to obtain better distribution of the drug. Cumulative dose was adjusted to the size of the tumor nodule. Intratumoral injection was in most cases successful, without leakage from the tumor. Electric pulses were applied first with custom-made plate electrodes, later with IGEA s.r.l. (Carpi, Modena) made plate electrodes. The distance between the electrodes was 4 or 7 mm. Electric pulses generator Jouan GHT 1287 (Jouan Saint Herblaine, France) was used, which delivered 8 electric pulses, amplitude/distance ratio 1300 V/cm, 100 µs long, with frequency 1 Hz. In order to assure good contact between the electrodes and the skin, ultrasonographic paste was used (Figure 1). Tumor nodules that were treated were of varying size, from 4 mm up to 3 cm in diameter. Electric pulses were delivered in two sets of four pulses in perpendicular direction with 1-second pause in-between. Nodules that were bigger than the distance between the electrodes were treated by consecutive application of electric pulses to the tumor nodules until the whole tumor area was covered. Immediate effects of the treatment were marks of the electrodes on the skin that disappeared after few minutes, and unpleasant sensation, predominantly caused by muscle contractions. The pain was bearable, therefore patients did not require special pain control, and the pain dissipated immediately after application of electric pulses. The patients were regularly checked for the response to the treatment in 2-4 weeks intervals. Some tumors needed retreatment. If the tumors were big, retreatment was needed every 2-4 weeks in order to eradicate the whole tumor mass. In the case of tumor regrowth after complete response, retreatment was performed at the time of tumor progression. The observation time of the patients varied, depending on the time of inclusion into the study, from few weeks to up to one and a half years. In Table 3 are listed the patients that were treated in this study. The number of lesions that were treated in the patient, number of the consecutive treatment sessions, response to the

Many of the patients were treated as out-patients, since they tolerated the treatment well. The patients described the sensation of applied electric pulses as painful. But, the pain dissipated immediately after application of electric pulses and it could be alleviated by xylocaine. Nevertheless none of the patients demanded to stop the treatment, or refused the treatment in the next session.

IV. Our experience with electrochemotherapy with cisplatin from 2000 to 2002 After some of the initial studies that have compared the effectiveness of electrochemotherapy with cisplatin to antitumor effectiveness of cisplatin only given intratumorally, we initiated another clinical study that had three goals: ñTo use electrochemotherapy with cisplatin given intratumorally to treat patients with progressive disease in order to alleviate side effects to the patients. ñTo re-evaluate the effectiveness of electrochemotherapy on similar group of patients as in the previous study (Sersa et al, 2000c). ñTo gain experience in order to be able to further optimize treatment procedure based on assessment of advantages and drawbacks of electrochemotherapy. The study was performed on 14 patients with progressive disease of malignant melanoma. The enrolled patients had local recurrent disease and all standard treatments had been exhausted. Before enrolment, the patients were informed about the principles and procedure of the treatment, and signed an informed consent. The treatment was performed on outpatient basis, without any pre or post medication, or need for hospitalization after the treatment. Before, and in regular intervals after the treatment, tumor nodules were measured and photographed. The treatment was performed by intratumoral injection of cisplatin using hypodermic needle. The dose of cisplatin was app. 1mg/cm3 of the 136


Cancer Therapy Vol 1, page 137 treatment, and observation time are indicated. In most cases the response to the treatment after 4 weeks was partial or complete regression of the treated nodules (objective response: 82%). New electrochemotherapy sessions were needed in order to treat tumor nodules that regrew in the time between the sessions or to treat new tumor nodules that emerged between the two visits. Therefore, in some patients up to 13 consecutive sessions were needed in order to control tumor growth locoregionally. In some cases electrochemotherapy was

effective in controlling growth of specific nodules, however patient’s disease progressed to other sites. Results of the treatment in these 14 patients are in accordance with our previously published results. In our previous study on 10 malignant melanoma patients, 82 tumor nodules were treated with electrochemotherapy with intratumorally injected cisplatin; 78% of the treated nodules were in objective response, from these 68% were in complete response.

Figure 1. Electrochemotherapy treatment procedure on the patient. A.– Electric pulses generator with oscilloscope for the control of the applied electric pulses. B. – two sets of electrodes with 4 mm and 7 mm distance between the plate electrodes. C. – Intratumoral injection of cisplatin in tumor nodule. Noticeable is whitening of the tumor area in cases with successful drug administration. D. – Application of electric pulses to the tumors by placing the electrodes to the tumor, possibly embracing the tumor mass between the electrodes for better electric field distribution.

Table 3. Summary of electrochemotherapy with cisplatin in malignant melanoma patients; in the years 2000-2002. Treatment Patients

No. of treated lesions

No. of treatment sessions

Response to treatment PD

No. 1 No. 2 No. 3 No. 4 No. 5 No. 6 No. 7 No. 8 No. 9 No. 10 No. 11 No. 12 No. 13 No. 14

6 8 3 2 5 7 18 26 34 21 19 16 1 45

1 4 2 2 2 3 5 11 7 9 5 3 1 9

Total

211

64

NC

PR

CR

1

5 8

21

1 16

8

4-8 64 - 66 7 6 16 - 18 2–6 2 – 15 6 – 36 42 3 – 33 7 - 57 4 – 54 2 2 – 21

24 11.4%

23 10.9%

148 70.1%

2 – 66 median - 13

3 1 3 8 1

1

1 1

4

1

16 7.6%

137

Observation time (weeks)

5 4 5 24 34 21 18 16


Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients Electrochemotherapy with cisplatin was successful in controlling the growth of the treated nodules. Tumors regressed in most cases within 4-6 weeks, when superficial scab fell off. Good cosmetic effect was observed, with light depigmentation of the skin (Figure 2). During regression of smaller tumor nodules there was no exulceration, therefore no special wound dressing was required, and also no extra visits to the supervising oncologist. Most of the tumor nodules that were up to 1 cm in diameter regressed completely after single treatment, and remained in complete response for a long period of time, the longest that could be followed was 66 weeks, almost 1.5 year. In one treatment session it was feasible to treat up to 15 tumor nodules. It was possible to retreat tumor nodules that did not show typical signs of regression or progressed within 2-4 weeks after therapy. On bigger tumor nodules, it was possible to control tumor growth or reduce the size of the nodules by consecutive treatments in 2- 4 weeks interval (Figure 3). The treatment can be performed on any part of the body. In our study most of the tumor lesions were located on the limbs. However we have treated also tumor nodules that were located on the thorax, stomach, back and head and neck region. The only experience that was demanding abrogation of the treatment was in a patient that was treated in the early beginning of our studies.

Only 7% of nodules were in progressive disease and 15% in no change (Sersa et al, 2000c). Therefore, we can conclude that the described protocol for electrochemotherapy is effective and reproducible, confirmed on two groups of patients in two separate clinical studies. However, we have gained additional experience that we can summarize in two categories: advantages and drawbacks that will be discussed in the next two subheadings.

A. Advantages of electrochemotherapy Concerning the treatment procedure, electrochemotherapy is easy and quick to perform, and is inexpensive. The requirements are a suitable room for patient preparation and treatment, and an electric pulse generator with different sets of electrodes that are used for different sizes of tumor nodules. After the treatment, patients do not require special attention or post-treatment medication. They can wait for a while in the hospital in order to be in the position to obtain medical attention, if needed, but so far no side effects were observed or medical attention of the patients required. Concerning the personnel, a M.D. in charge, a nurse and an assistant trained in handling the electric pulses generator are required to perform the treatment.

Figure 2. Example of good local tumor control in a patient with two tumor nodules on the leg. The first tumor nodule (No. 1) was treated once and tumor regressed, after one year there is no recurrence and good cosmetic effect. The second tumor nodule (No. 2) was treated three times in a two-month interval and each time good response was obtained although the tumor in the intervals grew substantially.

138


Cancer Therapy Vol 1, page 139

Figure 3. Retreatment of the nodules can provide good local tumor control. A plaque on the back of the malignant melanoma patient was treated by electrochemotherapy with cisplatin in 9 consecutive sessions in 2 to 4 weeks intervals. After 8 months, good local tumor growth was obtained.

in one session. Electrochemotherapy is however effective on those nodules that were treated, but has no effect on the general progression of the disease. Furthermore, because of occasional quick progression of the disease, new nodules emerge, that were not detectable in previous sessions. Electrochemotherapy can be performed on these new nodules, and taken collectively it can be effective in local control of the disease, but cannot affect general progression of the disease. Currently, the electrodes that are used are effective in treatment of superficial nodules, whereas they are not quite appropriate for deeper seeded or big nodules. Bigger nodules need application of several sets of electric pulses, and also several treatment sessions, in order to cover the whole tumor area and to be able to remove deeper layers of the tumor. The problems have to be solved, if electrochemotherapy is to be applied to the treatment of nodules that are more than 3 cm in diameter and thicker than 0.5 cm. This issue has been already addressed in the studies performed in Tampa and Villejuif, where they used needle electrodes (Gilbert et al, 1997; Mir et al, 1997).

A patient had a tumor nodule on the back in the region of the diaphragm. During application of the electric pulses, spasm of the diaphragm occurred and breathing was interrupted. After the abrogation of the treatment the patient recovered within a few minutes.

B. Disadvantages of electrochemotherapy Besides the advantages, there are also some disadvantages of electrochemotherapy. Pain is a limiting factor in most of the patients. Pain can be avoided by lifting the treated tumor nodule while applying electric pulses. In addition, it was observed that patients that were obese had less sensation, because adipose tissue prevented electric field distribution deeper into the underlying tissue, therefore less muscle contractions were observed. There was also a difference in sensations between the electrodes that had smaller gap (4 mm) than those that had bigger gap (7 mm), because electrodes with smaller gap required lower electric field intensity for electroporation of the tissue. Electrochemotherapy is local treatment that can be effective in treatment of limited number of tumor lesions that are not bigger than 3 cm in diameter. Therefore, it can be effective in those patients that have few or up to 15 skin metastases in transit. In the case of more nodules electrochemotherapy cannot be performed on all nodules

V. Conclusion Electrochemotherapy cannot be the only biomedical application of tissue electroporation. It has to be envisioned as the first step toward a broader use of

139


Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients Gehl J, Sorensen T-H, Nielsen K, Raskmark P, Nielsen SL, Skovsgaard T, and Mir L-M (1999) In vivo electroporation of skeletal muscle: threshold, efficacy and relation to electric field distribution. Biochim Biophys Acta 1428, 233-240. Gehl J, and Geertsen (2000) Efficient palliation of haemorrhaging malignant melanoma skin metastases by electrochemotherapy. Melanoma Res 10, 585-589. Gehl J, Skovsgaard T, and Mir L-M (2002) Vascular reactions to in vivo electroporation: characterization and consequences for drug and gene delivery. Biochim Biophys Acta 1569, 51-58. Gilbert R, Jaroszeski M, and Heller R (1997) Novel electrode designs for electrochemotherapy. Biochim Biophys Acta 1334, 9-14. Glass L-F, Fenske N-A, Jaroszeski M, Perrott R, Harvey D-T, Reintgen D-S, and Heller R (1996a) Bleomycin-mediated electrochemotherapy of basal cell carcinoma. J Am Acad Dermatol 34, 82-86, Glass L-F, Pepine M-L, Fenske N-A, Jaroszeski M, Reintgen DS, and Heller R (1996b) Bleomycin-mediated electrochemotherapy of metastatic melanoma. Arch Dermatol 132, 1353-1357. Glass L-F, Jaroszeski M, Gilbert R, Reintgen D-S, and Heller R (1997) Intralesional bleomycin-mediated electrochemotherapy in 20 patients with basal cell carcinoma. J Am Acad Dermatol 37, 596-599. Heller R, Jaroszeski M-J, Glass L-F, Messina J-L, Rapaport D-P, DeConti R-C, Fenske N-A, Gilbert R-A, Mir L-M, and Reintgen D-S (1996) Phase I/II trail for the treatment of cutaneous and subcutaneous tumors using electrochemotherapy. Cancer 77, 964-971. Heller R, Jaroszeski M, Perrott R, Messina J, and Gilbert R (1997) Effective treatment of B16 melanoma by direct delivery of bleomycin using electrochemotherapy. Melanoma Res 7, 10-18. Heller R, Jaroszeski M-J, Reintgen D-S, Puleo C-A, DeConti RC, Gilbert R-A, and Glass L-F (1998) Treatment of cutaneous and subcutaneous tumors with electrochemotherapy using intralesional bleomycin. Cancer 83, 148-157. Heller R, Gilbert R, and Jaroszeski M-J (1999) Clinical application of electrochemotherapy. Adv Drug Deliver 35, 119-129. Heller L, Pottinger C, Jaroszeski M-J; Gilbert R, and Heller R (2000) In vivo electroporation of plasmids encoding GMCFS or interleukin-2 into existing B16 melanomas combined with electrochemotherapy induces long-term antitumour immunity. Melanoma Res 10, 577-583. Jaroszeski M-J, Dang V, Pottinger C, Hickey J, Gilbert R, and Heller R (2000a) Toxicity of anticancer agents mediated by electroporation in vitro. Anticancer Drugs 11, 201-208. Jaroszeski M, Heller R, and Gilbert R (2000b) Electrochemotherapy, electrogenetherapy and transdermal drug delivery Electrically mediated delivery of molecules to cells. First ed. New Jersey: Humana Press. Jaroszeski M-J, Copolla D, Pottinger C, Benson K, Gilbert R-A, and Heller R (2001) Treatment of hepatocellular carcinoma in a rat model using electrochemotherapy. Eur J Cancer 37, 422-430. Kambe M, Arita D, Kikuohi H, Funato T, Tezuka F, Gamo M, Murakawa Y, and Kanamaru R (1996) Enhancing the effect of anticancer drugs against the colorectal cancer cell line with electroporation. Tahoku J Exp Med 180, 161-171.

electroporation in clinical use, predominantly in electrogene therapy and transdermal drug delivery (Jaroszeski et al, 2000b).

Acknowedgements The authors wish to thank Simona Kranjc, Mira Lavric and Lea Tabakovic. This study was supported by the Ministry of Education, Science and Sport of the Republic of Slovenia.

References Belehradek J-Jr, Orlowski S, Poddevin B, Paoletti C, and Mir LM (1991) Electrochemotherapy of spontaneous mammary tumours in mice. Eur J Cancer 27, 73-76. Belehradek J-Jr, Orlowski S, Ramirez LH, Pron G, Poddevin B, and Mir L-M (1994) Electropermeabilization of cells and tissues assessed by the qualitative and quantitative electroloading of bleomycin. Bichim Biophys Acta 1190; 155-163. Belehradek M, Domenge C, Luboinski B, Orlowski S, Belehradek J Jr, and Mir L-M (1993) Electrochemotherapy, a new antitumour treatment. First clinical phase I-II trial. Cancer 72, 3694-3700. Burian M, Formanek M, and Regele H (2003) Electroporation therapy in head and neck cancer. Acta Otolaryngol 123, 264-268. Cemazar M, Miklavcic D, Vodovnik L, Jarm T, Rudolf Z, Stabuc B, Cufer T, and Sersa, G (1995) Improved therapeutic effect of electrochemotherapy with cisplatin by intratumoral drug administration and changing of electrode orientation for electropermeabilization on EAT tumors in mice. Radiol Oncol 29, 121-127. Cemazar M, Sersa G, and Miklavcic D (1998a) Electrochemotherapy with cisplatin in the treatment of tumor cells resistant to cisplatin. Anticancer Res 18, 4463-4466. Cemazar M, Miklavcic D, and Sersa G (1998b) Intrinsic sensitivity of tumor cells to bleomycin as an indicator of tumor response to electrochemotherapy. Jpn J Caner Res 89, 328-333. Cemazar M, Milacic R, Miklavcic D, Dolzan V, and Ser_a G (1998c) Intratumoral cisplatin administration in electrochemotherapy: antitumor effectiveness, sequence dependence and platinum content. Anti-Cancer Drugs 9, 525-530. Cemazar M, Miklavcic D, Scancar J, Dolzan V, Golouh R, and Sersa G (1999) Increased platinum accumulation in SA-1 tumour cells after in vivo electrochemotherapy with cisplatin. Br J Cancer 79, 1386-1391. Cemazar M, Parkins C-S, Holder A-L, Chaplin D-J, Tozer G-M, and Sersa G (2001) Electroporation of human microvascular endothelial cells: evidence for an anti-vascular mechanism of electrochemotherapy. Br J Cancer 84, 565-570. Domenge C, Orlowski S, Luboinski B, De Baere T, Belehradek J-Jr, and Mir L-M (1996) Antitumor electrochemotherapy. New advances in the clinical protocol. Cancer 77, 956-963. Gately D-P, and Howell S-B (1993) Cellular accumulation of the anticancer agent cisplatin: a review. Brit J Cancer 67, 11711176. Gehl J, Skovsgaard T, and Mir L-M (1998) Enhancement of cytotoxicity by electro-permeabilization: an improved method for screening drugs. Anticancer Drugs 9, 319-325.

140


Cancer Therapy Vol 1, page 141 Kubota Y, Mir L-M, Nakada T, Sasagawa I, Suzuki H, and Aoyama N (1998) Successful treatment of metastatic skin lesions with electrochemotherapy. J Urol 160, 1426. Kuriyama S, Matsumoto M, Mitoro A, Tsujinoue H, Nakatami T, Fukui H, and Tsujii T (2000) Electrochemotherapy for colorectal cancer with commonly used chemotherapeutic agents in a mouse model. Digest Dis Sci 45, 1568-1577. Macek Lebar A, Sersa G, Kranjc S, Grosel A, and Miklavcic D (2002) Optimization of pulse parameters in vitro for in vivo electrochemotherapy. Anticancer Res 22, 1731-1736. Melvik J-E, Pettersen E-O, Gordon P-B, and Seglen P-O (1986) Increase in cis-dichlorodiammineplatinum (II) cytotoxicity upon reversible electro-permeabilization of the plasma membrane in cultured human NHIK 3025 cells. Eur J Cancer Clin Oncol 22,1523-1530. Miklavcic D, Beravs K, Semrov D, Cemazar M, Demsar F, and Sersa G (1998) The importance of electric field distribution for effective in vivo electroporation of tissues. Biophysical J 74, 2152-2158. Miklavcic D, Semrov D, Mekid H, and Mir L-M (2000) A validated model of in vivo electric field distribution in tissues for electrochemotherapy and for DNA electrotransfer for gene therapy. Biochim Biophys Acta 1523, 73-82. Mir L-M, Belehradek M, Domenge C, Orlowski S, Poddevin B, Belehradek J Jr, Schwaab G, Luboinski B, and Paoletti C (1991) Electrochemotherapy, a new antitumor treatment: first clinical trial. C R Acad Sci III 313, 613-618. Mir L-M, Orlowski S, Belehradek J-Jr, Paoletti C (1991) Electrochemotherapy potentiation of antitumour effect of bleomycin by local electric pulses. Eur J Cancer 27, 68-72. Mir L-M, Orlowski S, Poddevin B, and Belehradek J-Jr (1992) Electrochemotherapy tumor treatment is improved by interleukin-2 stimulation of the host's defenses. Eur Cytokine Netw 3, 331-334. Mir L-M, Orlowski S, Belehradek J-Jr, Teissie J, Rols M-P, Sersa G, and Miklavcic D, Gilbert R, and Heller R (1995) Biomedical applications of electric pulses with special emphasis on antitumor electrochemotherapy. Bioelectroch Bioener, 38, 203-207. Mir L-M, Roth C, Orlowski S, Quintin-Colonna F, Fradelizi D, and Belehradek J-Jr (1995) Systemic antitumor effects of electrochemotherapy combined with histoincompatible cells secreting interleukin-2. J Immunother Emphasis Tumor Immunol 17, 30-38. Mir L-M, Tounekti O, and Orlowski S (1996) Bleomycin: revival of an old drug. Gen Pharmacol 27, 745-748. Mir L-M, Devauchelle P, Quintin-Colonna F, Delisle F, Doliger S, Fradelizi D, Belehradek Jr-J, and Orlowski S (1997) First clinical trial of cat soft-tissue sarcomas treatment by electrochemotherapy. Brit J Cancer 76, 1617-1622. Mir L-M, Glass L-F, Sersa G, Teissie J, Domenge C, Miklavcic D, Jaroszeski M-J, Orlowski S, Reintgen DS, Rudolf Z, Belehradek M, Gilbert R, Rols M-P, Belehradek J-Jr, Bachaud J-M, DeConti R, Stabuc B, Cemazar M, Coninx P, and Heller R (1998) Effective treatment of cutaneous and subcutaneous malignant tumours by electrochemotherapy. Brit J Cancer 77, 2336-2342. Mir L-M (2000) Therapeutic perspectives of in vivo cell electropermeabilization. Bioelectrochem 53, 1-10. Okino M, and Mohri H (1987) Effects of a high-voltage electrical impulse and an anticancer drug on in vivo growing tumors. Jpn J Cancer Res 78,1319-1321.

Orlowski S, Belehradek J-Jr, Paoletti C, and Mir L-M (1988) Transient electro-permeabilization of cells in culture. Increase of the cytotoxicity of anticancer drugs. Biochem Pharmacol 37, 4727-4733. Panje W-R, Hier M-P, Garman G-R, Harrel E, Goldman A, and Bloch I (1998) Electroporation therapy of head and neck cancer. Am Otol Rhinol Laryngol 107, 779-785. Pucihar G, Mir L-M, and Miklavcic D (2002) The effect of pulse repetition frequency on the uptake into electropermeabilized cells in vitro with possible applications in electrochemotherapy. Bioelectrochemistry 57, 167-172. Rebersek M, Cufer T, Rudolf Z, and Sersa G (2000) Electrochemotherapy with cisplatin of breast cancer tumor nodules in a male patient. Radiol Oncol 34, 357-361. Reintgen D-S, Jaroszeski M-J, and Heller R (1996) Electrochemotherapy, a novel approach to cancer. The Skin Cancer Foundation Journal 14, 17-19. Rodriguez-Cuevas S, Barroso- Bravo S, Almanza- Estrada J, Cristobal- Martinez L, and Gonzales-Rodriguez E (2001) Electrochemotherapy in primary and metastatic skin tumors: Phase II trial using intralesional bleomycin. Arch Med Res 32, 273-276. Rols M-P, Bachaud J-M, Giraud P, Chevreau C, Roche H, and Teissie J (2000) Electrochemotherapy of cutaneous metastases in malignant melanoma. Melanoma Res 10, 468474. Rols M-P, Tamzali Y, and Teissie Y (2002) Electrochemotherapy of horses. A preliminary clinical report. Bioelectrochemistry 55, 101-105. Rudolf Z, Stabuc B, Cemazar M, Miklavcic D, Vodovnik L, and Sersa G (1995) Electrochemotherapy with bleomycin: The first clinical experience in malignant melanoma patients. Radiol Oncol 29: 229-235. Sersa G, Cemazar M, and Miklavcic D (1995) Antitumor effectiveness of electrochemotherapy with cisdiamminedichloroplatinum(II) in mice. Cancer Res 55, 3450-3455. Sersa G, Cemazar M, Semrov D, and Miklavcic D (1996a) Changing electrode orientation improves the efficacy of electrochemotherapy of solid tumors in mice. Bioelectrochem Bioenerg 39, 61-66. Sersa G, Kotnik V, Cemazar M, Miklavcic D, and Kotnik A (1996b) Electrochemotherapy with bleomycin in SA-1 tumor-bearing mice-natural resistance and immune responsiveness. Anti-Cancer Drug 7, 785-791. Sersa G, Cemazar M, Menart V, Gaberc-Porekar V, and Miklavcic D (1997) Anti-tumor effectiveness of electrochemotherapy with bleomycin is increased by TNFalpha on SA-1 tumors in mice. Cancer Lett 116, 85-92. Sersa G, Stabuc B, Cemazar M, Jancar B, Miklavcic D, and Rudolf Z (1998) Electrochemotherapy with cisplatin: potentiation of local cisplatin antitumour effectiveness by application of electric pulses in cancer patients. Eur J Cancer 34, 1213-1218. Sersa G, Cemazar M, Parkins C-S, and Chaplin D-J (1999a) Tumour blood flow changes induced by application of electric pulses. Eur J Cancer 35, 672-677. Sersa G, Cemazar M, Miklavcic D, and Chaplin D-J (1999b) Tumor blood flow modifying effect of electrochemotherapy with bleomycin. Anticancer Res 19(5B), 4017-4022. Sersa G, Cemazar M, Rudolf Z, and Fras A-P (1999c) Adenocarcinoma skin metastases treated by

141


Sersa et al: Electrochemotherapy â&#x20AC;&#x201C; advantages and drawbacks in treatment of cancer patients electrochemotherapy with cisplatin combined with radiation. Radiol Oncol 33, 291-296. Sersa G. (2000a) Electrochemotherapy: Animal work review. In: Jaroszeski MJ, Heller R, Gilbert R, editors. Electrochemotherapy, electrogenetherapy and transdermal drug delivery. Electrically mediated delivery of molecules to cells. Totowa: Humana Press; 119-136. Sersa G, Cufer T, Cemazar M, Rebersek M, and Zvonimir R (2000b) Electrochemotherapy with bleomycin in the treatment of hypernephroma metastasis: case report and literature review. Tumori 86,163-165. Sersa G, Stabuc B, Cemazar M, Miklavcic D, and Rudolf Z (2000c) Electrochemotherapy with cisplatin: clinical experience in malignant melanoma patients. Clin Cancer Res 6, 863-867. Sersa G, Stabuc B, Cemazar M, Miklavcic D, and Rudolf Z (2000d) Electrochemotherapy with cisplatin: the systemic antitumour effectiveness of cisplatin can be potentiated locally by aplication of electric pulses in the treatment of malignant melanoma skin metastases. Melanoma Res 10, 381-385. Sersa G, Krzic M, Sentjurc M, Ivanusa T, Beravs K, Kotnik V, Coer A, Swartz HM, and Cemazar M (2002) Reduced blood flow and oxygenation in SA-1 tumors after electrochemotherapy with cisplatin. Brit J Cancer 87, 10471054. Yabushita H, Yosikawa K, Hirata M, Furuya H, Hojyoh T, Fukatsu H, Noguchi M, and Nakanishi M (1997) Effects of electrochemotherapy on CaSki cells derived from a cervical squamous cell carcinoma. Gynecol 65, 297-303.

Dr. Gregor Sersa

142


Cancer Therapy Vol 1, page 143 Cancer Therapy Vol 1, 143-151, 2003.

p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells Research Article

Yi Lu1,2*, Jun Zhang1,2, Derrick J. Beech3, Linda K. Myers2, and Lisa K. Jennings1,2 1

Vascular Biology Center of Excellence, 2Department of Medicine, 3Department of Surgery, University of Tennessee Health Science Center, Memphis, TN

__________________________________________________________________________________ *Correspondence: Yi Lu, Ph.D., Vascular Biology Center of Excellence, Department of Medicine, College of Medicine, University of Tennessee Health Science Center, 956 Court Avenue, H300, Memphis, TN 38163, USA; Tel: (901) 448-5436; Fax: (901) 448-5496; email: ylu@utmem.edu Key words: breast cancer, VEGF, tumor angiogenesis, CDK inhibitor, adenovirus Received: 18 June 2003; Accepted: 19 August 2003; electronically published: August 2003

Summary One of the major causes of failure in the treatment of breast cancer is the occurrence of metastasis. It is thus important to intervene at a key step such as angiogenesis for breast cancer treatment and prolongation of patient survival Vascular endothelial growth factor (VEGF) plays a pivotal role in tumor angiogenesis. Tumor suppressor gene p16 is a cyclin-dependent kinase inhibitor and a negative cell cycle regulator. It was observed that the degree of tumor malignancy correlates with angiogenic capacity and the loss of p16 activity. To examine whether p16 overexpression decreases VEGF gene expression and inhibits tumor angiogenesis in breast cancer cells, human breast cancer cell line MDA-MB-231 was transduced with recombinant adenovirus expressing p16. Our study showed that p16 downregulated VEGF expression and inhibited in vivo angiogenesis induced by MDA-MB-231 cells in nude mice. toward the growing tumor. The endothelial cells then migrate together forming tubular structures that are ultimately encapsulated by recruiting periendothelial support cells to establish a vascular network that facilitates tumor growth and metastasis (Hanahan and Folkman, 1996). Angiogenesis is driven by a balance between different positive and negative effector molecules (or socalled angiogenic stimulators and inhibitors) that influence the growth rate of capillaries. The angiogenic stimulators include VEGF, basic fibroblast growth factor (Goldfarb, 1990), matrix metalloproteinases (John and Tuszynski, 2001), and angiopoietin-1 (Zetter, 1998). The angiogenic inhibitors include thrompbospondin-1 (TSP-1) (Tuszynski and Nicosia, 1996), angiostatin (Oâ&#x20AC;&#x2122;Reilly et al, 1994), and endostatin (Shichiri and Jirata, 2001). Normal vessel growth results from balanced and coordinated expression of these opposing factors. A switch from normal to uncontrolled vessel growth can occur by upregulating angiogenesis stimulators or downregulating angiogenesis inhibitors (Bouck et al, 1996). Angiogenesis is an essential prerequisite for aggressive tumor proliferation and spreading (Folkman, 1971) and it requires several angiogenic factors during the malignant transformation (Brem et al, 1978; Jensen et al, 1982; Brem et al, 1997). Among these angiogenic factors, VEGF plays a pivotal role in tumor angiogenesis

I. Introduction Breast cancer is the leading type of cancer in women living in the United States today. It is estimated that there will be 211,300 new cases of breast cancer and 39,800 breast cancer death in American women in year 2003 (Jemal et al, 2003). Metastasis, the spread of tumor cells from a primary site to distant organs to form secondary tumors, is a major cause of deaths of breast cancer patients (Marshall, 1993). Metastasis is a complex process including primary tumor growth, invasion through basement membrane and extracellular matrix, dissemination to lymphatic and/or blood circulation, motility to distant organs, angiogenesis and colonization in the secondary site (Steeg et al, 1998). It is thus important to intervene at key steps of metastatic process for breast cancer treatment and prolongation of patientsâ&#x20AC;&#x2122; survival One of the most promising avenues of breast cancer research is the development of biologically based therapies to thwart the progression of metastatic disease. However, not all aspects of the metastatic process may be equally clinical applicable. Therapies targeting angiogenesis and colonization that involve in micrometastatic outgrowth may be one of the most clinically applicable (Steeg et al, 1998). In the angiogenesis process, endothelial cells initially respond to changes in the local environment and migrate 143


Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells described (Steiner et al, 2000). Briefly, a human wild-type p16 cDNA gene was subcloned under the control of a RSV promoter into an E1 deleted adenoviral shuttle vector pAvs6a (Genetic Therapy, Inc., Gaithersburg, MD). The resultant adenoviral shuttle vector was cotransfected into 293 cells with pJM17 (Microbix Biosystems Inc., Toronto, Canada), an adenoviral type 5 genome plasmid, by the calcium phosphate method. The individual plaques were screened by direct plaque screening PCR method (Lu et al, 1998) using primers specific for RSV promoter and p16 cDNA gene. The resultant AdRSVp16 is a replicationdefective, recombinant adenoviral vector. Control virus AdRSVlacZ was generated by a similar method (Lu et al, 1999).

(Hanahan and Folkman, 1996; Klagsbrun and D’Amore, 1996; Risau, 1996; Grunstein et al, 1999; Neufeld et al, 1999). VEGF is a dimeric glycoprotein secreted by cells that is able to induce permeability and angiogenesis in tumor-associated blood vessels (Senger, 1983; Ferrara and Henzel, 1989). The VEGF family comprises five isoforms, including polypeptides of 121, 145, 165, 189, and 206 amino acids that are produced by the alternate splicing of a single gene containing eight exons (Leung et al, 1989; Tischer et al, 1989; Houck et al, 1991; Poltorak et al, 1997). VEGF165 is the one most commonly secreted by tumor cells and acts most strongly on endothelial cells to lead them to form new capillaries (Keyt et al, 1996; Soker et al, 1997). The expression of VEGF, which markedly contributes to tumor-associated neovascularization, is correlated with the malignant transformation of breast cancer and the poor prognosis in the patients (Gasparini et al, 1997; Obermair et al, 1997; Linderholm et al, 1998; Hefflfinger et al, 1999; Salven et al, 1999). VEGF has been shown to be present in breast tumors at levels that are, on average, 7-fold higher than in normal adjacent tissue (Yoshiji et al, 1996). Correspondingly, two VEGF receptors, Flt-1 and KDR/Flk-1 (Shibuya et al, 1990; Terman et al, 1992; Mustonen and Alitalo, 1995), are preferentially expressed in invading and proliferating endothelial cells (Plate and Risau, 1995). Combining results from several studies have showed that angiogenesis is a necessary step for breast cancer progression and metastasis (Liotta et al, 1974; Weidner et al, 1991; McCulloch et al, 1995; Zhang et al, 1995; O’Reilly et al, 1996; Berm et al, 1997). Tumor suppressor gene p16 (also called MTS1, CDKN2 and INK4A) is a cyclin-dependent kinase inhibitor and a negative cell cycle regulator (Shapiro and Rollins, 1996). The inactivation of p16 appears to be a common event in many cancers (Caldas et al, 1994; Hussussian et al, 1994; Jen et al, 1994; Cairns et al, 1995; Chen et al, 1996; Hatta et al, 1995; Li et al, 1995; Mao et al, 1995; Xiao et al, 1995). Angiogenic capacity correlates with the degree of malignancy and the loss of p16 activity in high-grade gliomas (Harada et al, 1999). In this study, we examined the effects of p16 expression on regulation of VEGF gene expression and vascularization of breast cancer cells.

C. Adenovirus preparation, titration and transduction Individual clones of AdRSVp16 and AdRSVlacZ were obtained by three times plaque purification method. Single viral clones were propagated in 293 cells. The culture medium of the 293 cells showing the complete cytopathic effect was collected and adenovirus was purified and concentrated by twice CsCl2 gradient ultracentrifugation. The viral titration and transduction were performed as previously described (Graham and Prevec, 1991).

D. Immunohistochemistry The procedure followed the method as described previously (Steiner et al, 2000). Briefly, for immunohistochemical staining, culture cells were grown on SlideFlasks with bottom detachable slides (Nalge Nunc, Naperville, IL) that could be used for immunohistochemistry staining directly later. The samples (slides) were first incubated with 1% H 2O2 for 30 min. The samples were incubated with first antibody against human p16 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) for 16 h at 40C, then by corresponding second antibody and the Universal Elite ABC Kit (Vector Laboratories, Inc., Burlingame, CA) according to the manufacturer's protocol. The reaction was visualized with DAB solution (75 mg 3,3’Diaminobenzidine and 30 µl 50% H 2O2 in 150 ml PBS) for 3-10 min.

E. RT-PCR Cells were extracted and total RNA was isolated by RNeasy Total RNA Kit (Qiagen, Santa Clarita, CA). After treatment of total RNA with RNase-free DNase I (Gibco BRL), reverse transcriptase reaction was carried out using Superscript II RT (Gibco BRL) according to the manufacturer's protocol. An aliquot of the RT mixture was subsequently used for the PCR reaction. The primers were specific to VEGF gene: primer 1 was and primer 2 was 5’GGATGTCTATCAGCGCAGCTAC3’ 5’TCACCGCCTCGGCTTGTCACATC3’. This primer set could detect mRNA encoding three molecular species of VEGF, giving rise to 322-, 454-, and 526-bp bands for VEGF121, VEGF 165, and VEGF189, respectively (Houck et al, 1991). PCR was performed in 50 µl total volume containing one fifth of above RT mixture, in a final concentration of 2 mM MgCl2, 50 mM KCl, 0.2 mM each of dNTPs, 20 mM Tris-HCl (pH 8.4), 1 µM each of the primers, and 2.5 units of Taq DNA polymerase (Gibco BRL). The reaction was carried out at 94 0C for 4 min; then for 30 cycles at 94 0C for 1 min, 610C for 2 min, and 720C for 2 min; followed by at 720C for 10 min. To ensure the quality of total RNA samples, the same RT mixture mentioned above was used for PCR of housekeeper gene ß-actin. The primers specific to ß-actin gene were and 5’TCCTGTGGCATCCACGAAACT3’ 5’GAAGCATTTGCGGTGGACGAT3’ which resulted a 314-bp PCR product. The PCR conditions followed the methods described previously (Kuo et al, 2002).

II. Materials and methods A. Cell culture and medium Dulbecco’s modified Eagle medium (D-MEM) and RPM11640 were purchased from Gibco BRL (Gaithersburg, MD). Fetal bovine serum (FBS) was from Hyclone Laboratories (Logan, UT). Human embryonic kidney 293 cells (American Type Culture Collection, Rockville, MD) were grown in DMEM with 10% heat inactivated FBS. Breast cancer cell line MDA-MB-231 (ATCC) was grown in RPM1-1640 medium with 10% FBS. All cell lines were grown in medium containing 100 units/ml penicillin, 100 µg/ml streptomycin at 370C in 5% CO2.

B. Generation of recombinant adenovirus AdRSVp16 The construction of the adenovirus containing p16 cDNA under the control of RSV promoter (AdRSVp16) was previously

144


Cancer Therapy Vol 1, page 145

F. Northern blot

III. RESULTS

Cells were extracted and total RNA was isolated by RNeasy Total RNA Kit (Qiagen, Santa Clarita, CA) according to the manufacturer's protocol. Total RNA (10 µg) was loaded on a 1.2% polyacrylamide gel and processed by electrophoresis. The standard Northern blot transfer to a Nylon membrane (HybondN+, Amersham Life Science, Buckinghamshire, England) was performed. The cDNA probe (p16 and VEGF165) was labeled by !-32P-dCTP using random primer method (Prime-It II Kit, Stratagene, La Jolla, CA). The membrane was hybridized with the probe in Rapid-hyb buffer (Amersham Life Science) according to the manufacturer's protocol. The membrane was exposed to a Kodak X-ray film between two intensifying screens at -800C for autoradiography. The cDNA probe of housekeeper gene "-actin was labeled as described above and used as an internal control for normalization.

A. Adenovirus AdRSVp16 expresses high level p16 protein in breast cancer cells To facilitate induction of p16 expression, a replication-defective recombinant adenovirus expressing human wild-type p16 under the control of a Rous sarcoma virus promoter (AdRSVp16) has been generated (Steiner et al, 2000). To demonstrate that AdRSVp16 is able to transfer and express p16 protein in cancer cells, MDAMB-231 cells were transduced with AdRSVp16 in vitro at multiplicity of infection (moi) of 200. Three days later the cells were processed for immunohistochemical staining for p16 protein using primary antibody against p16. As shown in Figure. 1, cells transduced by AdRSVp16 expressed a positive staining for p16 protein (Figure. 1B) while control untreated cells did not have the p16 staining (Figure. 1A).

G. ELISA for detecting VEGF Cells will be grown in 10-cm culture dishes and either untreated or transduced with AdRSVlacZ or AdRSVp16 (at moi=200). After 90-min viral infection, viral medium will be replaced with an exact 10 ml fresh medium to each sample dish. The cell medium (supernatant) will be collected 72 hr after viral transduction, and cell number attached on the culture dish will be counted. The supernatant will be processed to determine the secreted amount of VEGF165 protein by VEGF immunoassay kit (Quantikine VEGF ELISA Kit, R&D Systems, Minneapolis, MN). The procedures will follow the methods according to the manufacturers’ manual The results will be normalized based on the same amount of cells analyzed.

H. Matrigel in vivo angiogenesis assay Human breast cancer MDA-MB-231 cells were transduced by AdRSVp16 at moi of 200, two days later, the cells were harvested. A matrigel (BD Biosciences, San Jose, CA) mixture containing 1x10 7 transduced cells was injected s.c. into the flank of mice (6-week-old female nude mice, Harlan). Three days later, the mice were sacrificed, the undersurfaces of the injected site of mice were examined and photographed. Untreated control group and AdRSVlacZ control virus treated group were used as controls for comparison.

I. Dorsal air sac assay Cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. Forty-eight hours later the cells were harvested and suspended in PBS at a concentration of 1x10 8 cells/ml. This suspension (0.1 ml in PBS) was injected into a chamber (Millipore, Bedford, MA) consisting of a ring with a filter (pore size, 0.22 µm) on both sides. The semipermeable membrane chamber allowed for diffusion of growth factor, such as VEGF, but not cells. The chamber was implanted into a dorsal air sac produced by the injection of 10 ml of air in the dorsum of a female 6-week-old nude mouse (Harlan SpragueDawley, Indianapolis, IN). The mouse was sacrificed on day 3 and the implanted chamber was removed. A ring without filters was placed on the same site and then photographed. The newly formed blood vessels in the air sac fascia were morphologically distinguishable from the preexisting background vessels by their zigzagging characters.

Figure 1. In vitro p16 expression in human breast cancer MDA-MB-231 cells after AdRSVp16 transduction. MDAMB-231 cells were grown in culture dish and transduced by AdRSVp16 at moi=200. Seventy-two hrs later the cells were harvested and subjected to immunohistochemistry using primary antibody (mouse anti-human p16 antibody) followed by goat anti-mouse secondary antibody coupled with horseradish peroxidase. Shown are p16-immunostaining for control untreated cells (A), and cells transduced by AdRSVp16 (B). The original magnification was 66X for both images.

145


Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells To demonstrate that the adenovirus can effectively transduce and express the transgene in vivo inside the breast tumor, AdRSVlacZ, an adenovirus carrying E.coli ß-galactosidase (lacZ) reporter gene (Lu et al, 1999), was used to transduce a JygMC(A) breast tumor growing in nude mice.As shown in Figure. 2A, the ß-galactosidase (lacZ) transgene-expressing cells exhibit blue color after X-gal staining. A dose of 1x1010 pfu (plaque forming unit) can effectively transduce breast tumor cells in vivo. Similarly, to demonstrate that AdRSVp16 is able to transduce and express p16 protein in breast cancer cells in vivo, JygMC(A) breast tumors growing in nude mice were transduced by AdRSVp16. The immunohistochemical staining of breast tumor sections by anti-p16 antibody showed p16 expression in vivo (Figure. 2B). These results indicate that AdRSVp16 is able to efficiently transfer and express p16 protein in cancer cells both in vitro and in vivo.

B. p16 downregulates VEGF expression By using primers specific to VEGF gene that would result three RT-PCR (reverse transcription polymerase chain reaction) products corresponding to isoforms VEGF121, VEGF 165, and VEGF189 (Houck et al, 1991), our RT-PCR results showed that there was a decreased expression of VEGF at the mRNA level after induction of p16 (Figure. 3). MDA-MB-231 cells were either untreated or transduced with control virus AdRSVlacZ (AdlacZ) or AdRSVp16 (Adp16) at moi of 200. The cells were harvested at 24 hr and 48 hr after viral transduction and total RNA was isolated for detecting VEGF mRNA expression by RT-PCR. As shown in Figure. 3, all three isoforms of VEGF, including VEGF121 (322-bp), VEGF165 (454-bp), and VEGF189 (526-bp), were dramatically reduced by p16 expression, with a more significant reduction of VEGF expression over the time. In contrast, the control virus (AdlacZ) transduced cells at both 24 hr and 48 hr (lane 3 and 5 from the left in Figure. 3) had no changes of VEGF mRNA expression compared to that of the untreated control (lane 2 from the left in Figure. 3).

Figure 3. RT-PCR of VEGF gene in human breast cancer cell line MDA-MB-231. Total RNA were isolated from cells which were untransduced or transduced with control virus or Adp16 (moi=200) at 24 hr and 48 hr post viral transduction. Reverse transcriptase reaction using total RNA was carried out. An aliquot of the RT mixture was subsequently used for the PCR reaction. The primers specific to VEGF gene which resulted three specific RT-PCR products, 526 bp, 454 bp, and 332 bp, corresponding to VEGF121, VEGF 165, and VEGF189, respectively. To ensure the quality of total RNA samples and equal measurement, the same RT mixture mentioned above was used for PCR of housekeeper gene ß-actin which resulted a 314 bp PCR product.

Figure 2. Adenoviral vectors effectively transduce and express transgene inside the breast tumor. Breast tumors were established in nude mice by subcutaneously injection of 1x107 mouse breast cancer JygMC(A) cells in the flank of nude mice. When tumors reached about 200 mm3, 1x1010 pfu AdRSVlacZ (A) or AdRSVp16 (B) was injected directly into the tumors, respectively. The tumors were harvested at 72 h and processed to either for X-gal staining for ß-galactosidase (lacZ) transgene expression (A, blue-color cells) or immunohistochemistry for p16 expression (B, dark brown-color cells), respectively. Untreated tumor showed neither endogenous lacZ nor p16 staining (not shown).

146


Cancer Therapy Vol 1, page 147 The similar results were also observed in another breast cancer cell line JygMC(A) by RT-PCR assay (our unpublished results). Consistently, our Northern blot analysis results also showed that there was a significant reduction of VEGF mRNA expression in MDA-MB-231 cells transduced by AdRSVp16, compared to untreated control and control virus AdRSVlacZ transduced cells (Figure. 4). To determine whether p16 modulates VEGF gene expression at the protein level, MDA-MB-231 cells were either untreated or transduced by control virus or AdRSVp16, and 72 hrs later the cell culture medium were collected to analyze the secreted form of VEGF protein by ELISA assay. The ELISA results showed that AdRSVp16transduced MDA-MB-231 cells had significantly less VEGF protein secreted into the medium (about 66% reduction compared to the untreated control cells at the same amount of cells) (Figure. 5). These data indicate that p16 decreases VEGF expression at both mRNA and protein levels in MDA-MB231 cells, implying that p16 downregulated VEGF gene expression in breast cancer cells.

transduced with control virus AdRSVlacZ and AdRSVp16, 48 hrs later, the cells were harvested and injected subcutaneously (s.c.) into the flank of the nude mice. Three days after the tumor cell injection, the mice were sacrificed and the blood vessels of undersurface of the injection site were examined and photographed. AdRSVp16-treated MDA-MB-231 cells induced much less newly formed blood vessels (Figure. 6B) compared to its control-virus treated (Figure. 6A) and untreated control (not shown) counterparts. The latter two induced significantly higher amount of newly-formed blood vessels, as demonstrated by their characteristic zigzag and bifurcation/trifurcation forms (arrows in Figure. 6A). These results demonstrate that p16 inhibits angiogenesis induced by injected breast cancer cells. The effects of p16 on neovascularization of tumor surrounding cells were examined by dorsal air sac assay. MDA-MB-231 cells were transduced with AdRSVp16. Forty-eight hrs later the cells were harvested and injected into a chamber that was wrapped with semi-permeable membrane allowing for diffusion of growth factor, such as VEGF, but not cells. The chamber was implanted into a dorsal air sac in nude mice, and the newly formed blood vessels in the undersurface of the chamber will be examined 3 days later after chamber implantation. As shown in Figure. 7, PBS-treated mice (as a negative control) did not have any obvious neovascularization (Figure. 7A). However, the mice injected with MDA-MB231 cells developed tumor cell-induced neovascularization as evidenced by the newly-formed â&#x20AC;&#x153;zigzagging-shapeâ&#x20AC;? small vessels in the air sac fascia (Figure. 7B).

C. p16 inhibits angiogenesis To determine whether p16 inhibits tumor cellinduced angiogenesis, the effects of p16 on tumor cell neovascularization were assessed by "Matrigel in vivo angiogenesis assay" (see Materials and Methods section), in which MDA-MB-231 cells were either untreated or

Figure 5. p16 overexpression decreased VEGF secretion of MDA-MB-231 cells. MDA-MB-231 cells were grown in medium containing charcoal-stripped serum. Cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. The cell medium were collected 72 hrs after viral transduction and subjected to VEGF determination by ELISA assay using a kit designated for human VEGF165 immunoassay (Quantikine VEGF ELISA Kit, R&D Systems). The data represent the results from two independent experiments, each performed in triplicate.

Figure 4. p16 overexpression decreased VEGF expression at mRNA level in MDA-MB-231 cells. MDA-MB-231 cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. The cell extracts were harvested at 48 hrs after viral transduction and mRNA expressions of VEGF165, p16 and internal control GAPDH were determined by Northern blot analysis by using corresponding cDNA probes.

147


Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells

Figure 7. p16 suppressed neovessel formation in air sac model. The mouse in air sac model was sacrificed on day 3 after chamber implantation and the implanted chamber was removed from the s.c. air fascia, a ring without filters was placed on the same site and then photographed. The newly formed blood vessels were morphologically distinguishable from the preexisting background vessels by their zigzagging characters (see representative arrows). Shown are undersurface images of sites from chamber contains PBS only as negative control (A), MDA-MB-231 cells (B), AdRSVlacZ-transduced MDA-MB-231 cells (C), and AdRSVp16 transduced MDA-MB-231 cells (D).

IV. Discussion In summary, our studies showed that adenoviralmediated overexpression of p16 decreased VEGF expression at both mRNA and protein levels in human breast cancer MDA-MB-231 cells. In vivo angiogenesis assay and dorsal air sac assay on nude mice showed that p16 inhibited angiogenesis of MDA-MB-231 cells. These results together strongly demonstrate that p16 downregulates VEGF gene expression and suppresses tumor cell angiogenesis and neovascularization, suggesting that p16 expression may have a potential to suppress metastasis in breast cancer cells. Thus, AdRSVp16 may be useful to suppress breast cancer metastasis as a gene therapy approach. Likewise, other tumor suppressor genes p53 (Bouvet et al, 1998) and Rb2/p130 (Claudio et al, 2001) were reported to downregulate VEGF expression and inhibit angiogenesis in colon and lung cancer cells, respectively. Rb2/p130 seems to downregulate VEGF expression at the transcriptional level (Claudio et al, 2001). p53 was also shown to inhibit angiogenesis by stimulating TSP-1 gene and positively regulate TSP-1 promoter (Dameron et al, 1994). Despite all these associations, however, the link between tumor suppressor genes and angiogenesis remains obscure, in particular, how p16 exactly regulates VEGF expression is not clear. It is speculated that p16 may regulate VEGF gene expression at the transcriptional level or via stabilization of VEGF mRNA, or both. Our ongoing study of evaluation of VEGF promoter activity in cells, that are transiently cotransfected with p16 expression vector and a series of VEGF promoter/CAT

Figure 6. p16 inhibited angiogenesis. MDA-MB-231 cells were either untreated or transduced with control virus AdRSVlacZ or AdRSVp16 at moi of 200. Cells were harvested 48 hrs post viral transduction, and 1x107 cells were mixed with Matrigel in 1:1 volume and s.c. injected into the flanks of 6-week-old female nude mice. Three days later, the mice were sacrificed, the undersurfaces of the injected site of mice were examined and photographed. Shown are undersurface blood vessels of mice injected with (A) AdRSVlacZ-treated cells, and (B) AdRSVp16treated cells. Mouse injected with untreated MDA-MB-231 cells gave the similar results as (A) (not shown). The newly formed blood vessels are morphologically distinguishable from the preexisting background vessels by their zigzag characters, some of them are representatively pointed by the arrows (A). Each figure represents a typical image from 3 mice in the same group.

In contrast, mice with AdRSVp16-transduced MDAMB-231 cells induced much less newly-formed blood vessels (Figure. 7D) compared to mice injected with MDA-MB-231 cells alone (Figure. 7B) or mice injected with control viral transduced MDA-MB-231 cells (Figure. 7C); both of the latter two induced a more extensive capillary network. These results suggest that breast cancer cells can induce neovascularization around the tumor by molecules (such as VEGF) secreted from tumor cells to the surrounding environment; and p16 can inhibit this tumor cell-induced neovascularization to the surrounding environment by impairing or blocking this secreted angiogenesis-inducer from the tumor cells.

148


Cancer Therapy Vol 1, page 149 (chloramphenicol acetyltransferase) reporter gene chimeric constructs (a generous gift from Dr. M. Kuwano, Kyushu University, Japan) (Ryuto et al, 1996), will determine whether p16 modulates VEGF gene expression at the transcriptional level. If p16 indeed regulates VEGF expression at the transcriptional level, the transactivation response element within VEGF promoter will be defined. Together with the gel shift assay, we may also find out whether it is due to a direct p16 binding to VEGF promoter or by an indirect p16 regulation, i.e., by binding of a p16-regulated component to the promoter for this transactivation. While research studies focusing on breast cancer treatment have been increased dramatically in recent years and some therapies of local control appear to be effective, there is still no effective approach to prevent and cure tumor metastasis -- the fatal cause for the death of breast cancer patients. The relative success at local control has been confounded by a general failure to progressively and substantially reduce breast cancer death rates. Thus, a critical need exists to understand and develop effective treatments for those parameters contributing to breast cancer metastasis. This study has provided an innovative approach to combat and prevent breast cancer metastasis by using tumor suppressor gene p16, which downregulates VEGF gene expression, suppresses angiogenesis and may have a potential inhibition on secondary tumor formation of breast cancer.

methylthioadenosine phosphorylase, and the !- and ßinterferons in human pancreatic cell carcinoma lines and its implications for chemotherapy. Cancer Res 56, 1083-1090. Claudio, P. P., Stiegler, P., Howard, C. M., Bellan, C., Minimo, C., Tosi, G. M., Rak, J., Kovatich, A., De Fazio, P., Micheli, P., Caputi, M., Leoncini, L., Kerbel, R., Giordano, G. G., and Giordano, A (2001) RB2/p130 gene-enhanced expression down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in vivo. Cancer Res 61, 462-468. Dameron KM, Volpert OV, Tainsky MA, and Bouck N (1994) Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1. Science 265, 1582-1584. Folkman J (1971) Tumor angiogenesis: therapeutic implications. N Engl J Med 285, 1182-1186. Ferrara N, and Henzel WJ (1989) Pituitary follicular cells secrete a novel heparin-binding growth factor specific for vascular endothelial cells. Biochem Biophys Res Commun 161, 851858. Gasparini, G., Toi, M., Gion, M., Verderio, P., Dittadi, R., Hanatani, M., Matsubara, I., Vinante, O., Bonoldi, E., Boracchi, P., Gatti, C., Suzuki, H., and Tominaga, T (1997) Prognostic significance of vascular endothelial growth factor protein in node-negative breast carcinoma. J Natl Cancer Inst 89, 139-144. Goldfarb M (1990) The fibroblast growth factor family. Cell Growth Differ 1, 439-445. Graham FL, and Prevec L (1991) Manipulation of adenovirus vectors. In: E.J. Murray (ed.), Methods in Molecular Biology. Vol. 7: Gene transfer and expression protocols, pp. 109-128. Clifton: The Human Press Inc. Grunstein J, Roberts WG, Mathieu-Costello O, Hanahan D, and Johnson RS (1999) Tumor-derived expression of vascular endothelial growth factor is a critical factor in tumor expansion and vascular function. Cancer Res 59, 1592-1598.

Acknowledgments This research was supported by University of Tennessee Vascular Biology Center of Excellence Partnership Grant and University of Tennessee Vascular Biology Center of Excellence Pilot Grant.

Harada H, Nakagawa K, Iwata S, Saito M, Kumon Y, Sakaki S, Sato K, and Hamada K (1999) Restoration of wild type p16 down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human gliomas. Cancer Res 59, 3783-3789.

References

Hatta Y, Hirama T, Miller CW, Tomonaga M, and Koeffler HP (1995) Homozygous deletions of the p15 (MTS2) and p16 (CDKN2/MTS1) genes in adult T-cell leukemia. Blood 85, 2699-2704. Heffelfinger, S. C., Miller, M. A., Yassin, R., and Gear, R (1999) Angiogenic growth factors in preinvasive breast disease. Clin Cancer Res 5, 2867-2876.

Bouck N, Stellmach V, and Hsu SC (1996) How tumors become angiogenic. Adv Cancer Res 69, 135-174. Bouvet M, Ellis LM, Nishizaki M, Fujiwara T, Liu W, Bucana CD, Fang B, Lee JJ, and Roth JA (1998) Adenovirusmediated wild-type p53 gene transfer down-regulates vascular endothelial growth factor expression and inhibits angiogenesis in human colon cancer. Cancer Res 58, 22882292.

Houck KA, Ferrara N, Winer J, Cachianes G, Li B, and Leung DW (1991) The vascular endothelial growth factor family: identification of a fourth molecular species and characterization of alternative splicing of RNA. Mol Endocrinol 5, 1806-1814.

Brem SS, Gullino PM, and Medina D (1997) Angiogenesis: a marker for neoplastic transformation of mammary papillary hyperplasia. Science 195, 880-881. Brem SS, Jensen HM, and Gullino PM (1978) Angiogenesis as a marker of preneoplastic lesions of the human breast. Cancer 41, 239-244. Cairns P, Polascik TJ, Eby Y, and Sidransky D (1995) High frequency of homozygous deletion at p16/CDKN2 in primary human tumors. Nature Genet 11, 210-212. Caldas C, Hahn SA, De Costa LT, Redston MS, Schutte M, Seymour AB, Weistein CL, Hruban RH, Yeo CJ, and Kern SE (1994) Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma. Nature Genet 8, 27-32.

Hussussian CJ, Struewing JP, Goldstein AM, Higgins PAT, Ally DS, Sheahan MD, Clark WH, Tucker MA, and Dracopoli NC (1994) Germline p16 mutations in familial melanoma. Nature Genet 8, 15-21. Jemal A, Thomas A, Murray T, Samuels A, Ghafoor A, Ward E, and Thun MJ (2003) Cancer Statistics, 2003. CA Cancer J Clin 53, 5-26. Jen J, Harper JW, Bigner SH, Bigner DD, Papadopoulos N, Markowitz S, Wilson JKV, Kinzler KW, and Vogelstein B (1994) Deletion of p16 and p15 genes in brain tumors. Cancer Res 54, 6353-6358.

Chen Z-H, Zhang H, and Savarese T (1996) Gene deletion

Jensen HM, Chen I, DeValut MR, and Lewis AE (1982) Angiogenesis induced by “normal” human breast tissues; a

INK4

chemoselectivity; Codeletion of the gene for p16

,

149


Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells probable marker for precancer. Science 218, 293-295. John A, and Tuszynski G (2001) The role of matrix metalloproteinases in tumor angiogenesis and tumor metastasis. Pathol Oncol Res 7, 14-23, 2001.

Plate KH, and Risau W (1995) Angiogenesis in malignant gliomas. Glia 15, 339-347. Shapiro GI, and Rollins BJ (1996) p16INK4A as a human tumor suppressor. Biochem Biophys Acta 1242, 165-169.

Keyt, B. A., Berleau, L. T., Nguyen, H. V., Chen, H., Heinsohn, H., Vandlen, R., and Ferrara, N (1996) The carboxylterminal domain (111-165) of vascular endothelial growth factor is critical for its mitogenic potency. J Biol Chem 271, 7788-7795.

Poltorak Z, Cohen T, Sivan R, Kandelis Y, Spira G, Vlodavsky I, Keshet E, and Neufeld G (1997) VEGF145, a secreted vascular endothelial growth factor isoform that binds to extracellular matrix. J Biol Chem 272, 7151-7158. Risau W (1996) What, if anything, is an angiogenic factor? Cancer Metastasis Rev 15, 149-151. Ryuto M, Ono M, Izumi H, Yoshida S, Weich HA, Kohno K, and Kuwano M (1996) Induction of Vascular Endothelial Growth Factor by tumor necrosis factor ! in human glioma cells. J Biol Chem 45, 28220-28228.

Klagsbrun M, and D'Amore PA (1996) Vascular endothelial growth factor and its receptors. Cytokine Growth Factor Rev 7, 259-270. Leung DW, Cachianes G, Kuang WJ, Goeddel DV, and Ferrara N (1989) Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306-1309. Li YJ, Hoang-Xuan K, Delattre JY, Poisson M, Thomas G, and Hamelin R (1995) Frequent loss of heterozygosity on chromosome 9, and low incidence of mutations of cyclindependent kinase inhibitors p15 (MTS2) and p16 (MTS1) genes in gliomas. Oncogene 11, 597-600. Linderholm B, Tavelin B, Grankvist K, and Henriksson R (1998) Vascular endothelial growth factor is of high prognostic value in node-negative breast carcinoma. J Clin Oncol 16, 3121-3128.

Salven P, Perhoniemi V, Tykka H, Maenpaa H, and Joensuu H (1999) Serum VEGF levels in women with a benign breast tumor or breast cancer. Breast Cancer Res Treat 53, 161166. Senger DR, Galli SJ, Dvorak AM, Perruzzi CA, Harvey VS, and Dvorak HF (1983) Tumor cells secrete a vascular permeability factor that promotes accumulation of ascites fluid. Science 219, 983-985. Shibuya M, Yamaguchi S, Yamane A, Ikeda T, Tojo A, Matsushime H, and Sato M (1990) Nucleotide sequence and expression of a novel human receptor-type tyrosine kinase gene (flt) closely related to the fms family. Oncogene 5, 519524.

Liotta LA, Kleinerman J, and Saidel GM (1974) Quantitative relationships of intravascular tumor cells, tumor vessels, and pulmonary metastases following tumor implantation. Cancer Res 34, 997-1004.

Shichiri M, and Hirata Y (2001) Antiangiogenesis signals by endostatin. FASEB J 15, 1044-1053. Soker S, Gollamudi-Payne S, Fidder H, Charmahelli H, and Klagsbrun M (1997) Inhibition of vascular endothelial growth factor (VEGF)-induced endothelial cell proliferation by a peptide corresponding to the exon 7-encoded domain of VEGF165. J Biol Chem 272, 31582-31588.

Lu Y, Carraher J, Zhang Y, Armstrong, J., Lerner, J., Roger, W., and Steiner, M.S (1999) Delivery of adenoviral vectors to the prostate for gene therapy. Cancer Gene Ther 6, 64-72. Lu Y, Zhang Y, and Steiner MS (1998) Efficient identification of recombinant adenoviruses by direct plaque-screening. DNA Cell Biol 17, 643-645. Mao L, Merlo A, Bedi G, Shapiro GI, Edwards CD, Rollins BJ, and Sidransky D (1995) A novel p16INK4A transcript. Cancer Res 55, 2995-2997.

Steeg PS, Hartsough MT, and Clare SE (1998) Nm23, breast differentiation, and cancer metastasis. In; Breast Cancer. Bowcock AM (ed). Humana Press: Totowa, New Jersey. pp. 267-283. Steiner, M. S., Zhang, Y., Farooq, F., Lerner, J., Wang, Y., and Lu, Y (2000) Adenoviral vector containing wild type p16 suppresses prostate cancer growth and prolongs survival by inducing cell senescence. Cancer Gene Ther 7, 360-372.

Marshall E (1993) Breast cancer research: a special report. Search for a killer: focus shifts from fat to hormones. Science 259, 618-621. McCulloch P, Choy A, and Martin L (1995) Association between tumor angiogenesis and tumor cell shedding into effluent venous blood during breast cancer surgery. Lancet 346, 1334-1335.

Terman BI, Dougher-Vermazen M, Carrion ME, Dimitrov D, Armellino DC, Gospodarowicz D, and Bohlen P (1992) Identification of the KDR tyrosine kinase as a receptor for vascular endothelial cell growth factor. Biochem Biophys Res Commun 187, 1579-1586. Tischer E, Gospodarowicz D, Mitchell R, Silva M, Schilling J, Lau K, Crisp T, Fiddes JC, and Abraham JA (1989) Vascular endothelial growth factor: a new member of the plateletderived growth factor gene family. Biochem Biophys Res Commun 165, 1198-1206. Tuszynski GP, and Nicosia RF (1996) The role of thrombospondin-1 in tumor progression and angiogenesis. Bioessays 18, 71-76.

Mustonen T, and Alitalo K (1995) Endothelial receptor tyrosine kinases involved in angiogenesis. J Cell Biol 129, 895-898. Neufeld G, Cohen T, Gengrinovitch S, and Poltorak Z (1999) Vascular endothelial growth factor (VEGF) and its receptors. FASEB J 13, 9-22. Obermair, A., Kucera, E., Mayerhofer, K., Speiser, P., Seifert, M., Czerwenka, K., Kaider, A., Leodolter, S., Kainz, C., and Zeillinger, R (1997) Vascular endothelial growth factor (VEGF) in human breast cancer: correlation with diseasefree survival Int J Cancer 74, 455-458. Oâ&#x20AC;&#x2122;Reilly MS, Holmgren L, Chen C, and Folkman J (1996) Angiostatin induces and sustains dormancy of human primary tumors in mice. Nature Med 2, 689-692. Oâ&#x20AC;&#x2122;Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, Lane WS, Cao Y, Sage EH, and Folkman J (1994) Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315-328.

Weidner N, Semple JP, Welch WR, and Folkman J (1991) Tumor angiogenesis and metastasis_correlation in invasive breast carcinoma. N Engl J Med 324, 1-8. Xiao S, Li D, Corson JM, Vijg J, and Fletcher JA (1995) Codeletion of p15 and p16 genes in primary non-small cell lung carcinoma. Cancer Res 55, 2968-2971. Yoshiji H, Gomez DE, Shibuya M, and Thorgeirsson UP (1996) Expression of vascular endothelial growth factor, its

150


Cancer Therapy Vol 1, page 151 receptor, and other angiogenic factors in human breast cancer. Cancer Res 56, 2013-2016. Zetter BR (1998) Angiogenesis and tumor metastasis. Annu Rev Med 49, 407-424. Zhang, H.-T., Craft, P., Scott, P. A. E., Ziche, M., Welch, H. A., Harris, A. L., and Bicknell, R (1995) Enhancement of tumor growth and vascular density by transfection of vascular endothelial cell growth factor into MCF-7 human breast carcinoma cells. J Natl Cancer Inst 87, 213-219.

Dr. Yi Lu

151


Lu et al: p16 downregulates VEGF and inhibits angiogenesis in breast cancer cells

152


Cancer Therapy Vol 1, page 153 Cancer Therapy Vol 1, 153-162, 2003.

Basic fibroblast growth factor antisense oligonucleotides inhibit renal cell carcinoma cell growth and angiogenesis Research Article

Wenyin Shi* and Dietmar W. Siemann Department of Radiation Oncology, Shands Cancer Center, University of Florida, Gainesville, FL 32610

__________________________________________________________________________________ *Correspondence: Wenyin Shi, Department of Radiation Oncology, University of Florida, 2000 SW Archer Road Box 100385, Gainesville, FL 32610, USA; Tel: 352-392-0655; Fax: 352-392-5743; e-mail: wshi@ufl.edu Key Words: renal cell carcinoma, fibroblast growth factor, angiogenesis, antisense, oligodeoxynucleotides Received: 8 July 2003; Accepted: 20 August 2003; electronically published: September 2003

Summary Renal cell carcinoma (RCC) is the most common malignancy of the kidney. A characteristic feature of RCC is evidence of abundant angiogenesis and abnormal blood vessel development. Basic fibroblast growth factor (bFGF) is a known contributor in the regulation of RCC initiated angiogenesis. In the present studies we evaluated the effects of blocking bFGF production by antisense phosphorothioate oligodeoxynucleotides (PS-ODNs) on the growth and angiogenic activity of a pre-clinical model of RCC (Caki-1). In vitro studies showed that treating Caki-1 cells with antisense PS-ODNs directed against bFGF mRNA led to a reduction in the levels of bFGF expression sufficient to impair the proliferation and migration of endothelial cells. In addition, such treatments exerted a direct effect on Caki-1 cell growth. The observed effects were antisense sequence specific, dose dependent, and could be achieved at a low, non-toxic concentration of PS-ODNs. When bFGF antisense treated Caki-1 cells were injected into nude mice and evaluated for their angiogenesis potential in an intradermal angiogenesis assay, the number of vessels initiated were approximately half that initiated by untreated Caki-1 cells. To test the antitumor effect of bFGF antisense, PS-ODNs were administrated to nude mice bearing macroscopic Caki-1 xenografts. The results showed that the systemic administration of two doses of bFGF antisense PS-ODNs given 1 and 4 days after the tumors reached a size of ~200 mm3 doubled the time required for tumors to grow to 5 times the size at the start of treatment. carcinoma tissues and renal cell carcinoma cell lines (Mydlo et al, 1988; Gospodarowicz et al, 1986; Mydlo et al, 1993). Serum levels of bFGF often are elevated in RCC patients (Fujimoto et al, 1991) and renal cell carcinoma bFGF mRNA levels have been reported to be 2 - 3 fold higher than those found in surrounding normal tissues (Eguchi et al, 1992). In addition, elevated serum/urine bFGF levels have been shown to be associated with malignant progression and poor treatment outcome (Nanus et al, 1993; Nguyen et al, 1994; Duensing et al, 1995; Miyake et al, 1996; Yoshimura et al, 1996). Taken together, these findings strongly suggest an important role for bFGF in renal cell carcinoma associated angiogenesis. Currently, there is considerable interest in developing angio-suppressive therapies for RCC. For example, interferon-!, a peptide known to have anti-angiogenic effects likely due to suppression of bFGF expression (Singh et al, 1995), has been shown to prolong survival in patients with RCC(1999). Interleukin-12, a cytokine with immuno-regulatory and anti-angiogenic activity (Voest et

I. Introduction Renal cell carcinoma (RCC) is the most common malignancy of the kidney and accounts for about 2% of all adult malignancies (McLaughlin and Lipworth, 2000). Unless discovered at an early stage, at a time when it is a still a resectable neoplasm, RCC has a very unfavorable treatment outcome to conventional measures. Unfortunately, RCC is characterized by a lack of early warning signs resulting in a high proportion of patients with metastases at diagnosis and significant relapse rates following nephrectomy. As a consequence RCC remains fatal in nearly 80% of its patients (Tsui et al, 2000). Histopathologic evaluations of RCC reveal it to be a highly vascularized neoplasm demonstrating clear evidence of abundant angiogenesis and abnormal blood vessel development (Yoshimura et al, 1996). Not surprisingly, several studies have pointed to an important role for pro-angiogenic growth factors in RCC. Basic fibroblast growth factor (bFGF) has often been implicated. This factor has been shown to be expressed in renal cell 153


Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Sonic Dismembrator (Fisher Scientific, Pittsburgh, PA) for 1 min at room temperature to form homogenized liposomes. The particle-size distribution of liposomes was measured using a NICOMP 380 ZLS instrument (Santa Barbara, CA). The average diameter was 144.0 ± 77.0 nm. Liposomes were stored at 4°C and used within 3 months.

al, 1995), also has demonstrated antitumor activity in RCC (Motzer et al, 1998). Other drugs developed principally as angiogenesis inhibitors and studied in RCC include the fumigillin analog TNP-470, thalidomide, and a monoclonal antibody to VEGF (Gordon et al, 1998; Stadler et al, 1999). In the present investigations, antisense phosphorothioate oligodeoxynucleotides (PS-ODNs) complementary to bFGF mRNA were designed and tested for their efficacy to block RCC angiogenesis and growth in vitro and in vivo. The therapeutic potential of bFGF antisense treatments in RCC xenografts also was evaluated.

C. Enzyme immunoassay of bFGF Caki-1 cells (1x10 5) were set in 60 mm dishes and allowed to attach overnight. The medium then was removed and replaced with PS-ODNs in serum free medium with liposome (DOTAP:DOPE) and incubate for 5 hr. Fresh medium containing 10% FBS then was added. Caki-1 cells were collected on day 2, washed and suspended 1x106 in PBS containing protease inhibitors (100 µg/ml Phenylmethanesulphonyl fluoride, 20 µg/ml leupeptin, 3 µg/ml aprotinin). The suspension was subjected to 3 freeze-thaw cycles, ultrasonication for 5 s (100 W) on ice, and centrifugation at 14,000 g for 10 min. The supernatant containing the intracellular bFGF was used for the bFGF concentration determination (human bFGF immunoassay kit, R & D Systems, Minneapolis, MN).

II. Materials and methods A. Cell culture The clear cell RCC cell line Caki-1 was a gift from Dr. Susan Knox (Stanford University). Caki-1 cells were grown in Dulbecco's modified minimum essential medium (DMEM, Invitrogen, Grand Island, NY) supplemented with 10% fetal bovine serum (FBS, Invitrogen, Grand Island, NY), 1% penicillin-streptomycin (Invitrogen, Grand Island, NY) and 1% 200 mmol/L L-glutamine (Invitrogen, Grand Island, NY). The mouse heart endothelial cell line (MHE) was a gift from Dr. Robert Auerbach (University of Wisconsin). MHE cells were grown in Dulbecco's modified minimum essential medium supplemented with 10% heat inactivated fetal bovine serum, 1% penicillin-streptomycin and 1% 200 mmol/L L-glutamine. Human microvascular endothelial cells of the lung (HMVEC-L) were obtained from Clonetics (San Diego, CA). HMVEC-L cells were grown in EBM-2-MV (Clonetics, San Diego, CA) supplemented with 5% FBS. Phosphorothioate Oligodeoxynucleotides (PS-ODNs): Antisense and control PS-ODNs (20-mers) were custom synthesized by Gemini Biotech (Alachua, FL). PS-ODNs B460 was complementary to the translation start site (AUG codon) of bFGF mRNA: 5´ TCC CGG CTG CCA TGG TCC CT 3´; PSODNs B471 was complimentary to the coding region of bFGF mRNA: 5´ CGT GGT GAT GCT CCC GGC TG 3´; PS-ODNs B931 was complimentary to the 3´ UTR: 5´ GAT GTG GCC ATT AAA ATC AG 3´ A random nonsense sequence: 5´ GCC TGG ACC CTG GCT CTC TC 3'; sense sequence: 5´ AGG GAT GGC TGC CGG GA 3´ and an inverted sequence: 5´ TCC CTG GTA CCG TCG GCC CT 3´, were used as PS-ODNs controls. In the tumor distribution studies, the PS-ODNs were labeled at the 5´ end with FITC. All PS-ODNs were suspended in sterile and endotoxin free water at a concentration of 1 mM, aliquoted and stored at -20ÆC.

C. bFGF Relative quantitative RT-PCR Caki-1 cells were set at 3x105 in 100 mm dishes and allowed to attach overnight. The cells were then treated with bFGF antisense or control PS-ODNs as described. 24 hr later the cells were collected and the total RNA was isolated using a RNeasy Mini Kit (Qiagen, Valencia, CA) and RNA concentrations were determined by UV spectrophotometry. A 2 µg total RNA sample was used to reverse synthesize cDNA using Superscript II reverse transcriptase (Invtrogen, Grand Island, NY). A 2.5 µl aliquot of the reverse transcriptase reaction product then was used for the PCR reaction. BFGF PCR reactions were carried out using a forward primer and a reverse primer with a relative RT-PCR Kit (Ambion, Austin, TX). The PCR reactions were run for 22 cycles (denature 94°C 30s, anneal 60°C 60s, extension 72°C 60s) in a DNA Engine 200 (MJ research, Waltham, MA). PCR products then were run on 2% agarose gels and stained by ethidium bromide. The gels were visualized and analyzed using a Gel Doc 2000 gel documentation system (Bio-Rad, Hercules, CA).

D. FGFR1-4 RT-PCR Caki-1 cell total RNA was isolated using an RNeasy Mini Kit (Qiagen, Valencia, CA) and RNA concentrations were determined by UV spectrophotometry. A 2.5 µl aliquot of the reverse transcriptase reaction product then was used for the PCR reaction. Primers for human FGFR 1-4 were used (Tartaglia et al, 2001). The PCR reactions were run for 30 cycles (denature 94°C 30 s, anneal 60°C 60 s, extension 72°C 60s) in a DNA Engine 200 (MJ research, Waltham, MA). The specificities of the cDNA amplifications were then verified by endonuclease restriction analyses. All PCR preparations were carried out in a laminar flow hood using aerosol resistant plugged pipette tips. Negative controls without template DNA were included in each assay. An 18S primer set (Ambion, Austin, TX) was used as a positive control.

B. DOTAP: DOPE liposomes Cationic liposomes were prepared using the method described by Tang (Tang and Hughes, 1999). Briefly, cationic lipid 1,2-dioleoyloxy-3-(trimethylammonium) propane (DOTAP) was dissolved in chloroform and mixed with a helper lipid 1,2dioleoyl-3-sn-phosphatidylethanolamine (DOPE) at a molar ratio of 1:1 (Avanti Polar-Lipids, Alabaster, Al). The mixture was evaporated to dryness in a round-bottomed flask using a rotary evaporator at room temperature. The resulting lipid film was dried by nitrogen for an additional 10 min to evaporate any residual chloroform. The lipid film was re-suspended in sterile water to a final concentration of 1 mg/ml based on the weight of cationic lipid. The resultant mixtures were shaken in a water bath at 35°C for 30 min. The suspensions then were sonicated using a

E. Cell cycle analysis Caki-1 cells were plated in 60 mm dishes (2x10 5 cells/dish) and allowed to attach overnight. The cells were then treated with 1 µM B460 or control PS-ODNs complexed with DOTAP:DOPE as described above. 48 hr later the cells were trypsinized,

154


Cancer Therapy Vol 1, page 155 counted, and fixed in 50% ethanol overnight. Prior to FACS analysis the cells were treated with 1 mg/ml RNase (in PBS) for 30 min. The samples were then washed with PBS twice and resuspended in 25 mg/ml propidium iodine (PI) in PBS at a volume of 1x10 6 cells/ml. The cells were stained in the dark with PI (15 min) and their cell cycle distributions were analyzed using a Beckman Dickinson flow cytometer (University of Florida Flow Cytometry Core Facility).

J. Caki-1 xenografts Female nude mice (NCR, nu/nu), age 8 - 10 weeks were maintained under specific-pathogen-free conditions (University of Florida Health Science Center) with food and water supplied ad libitum. Animals were inoculated subcutaneously in a single flank with 5x10 6 tumor cells. When the tumors reached a size of ~200 mm3, animals were randomly assigned to the different treatment groups.

F. Apoptosis measurement

K. bFGF western blot preparation and analysis

Caki-1 cells were set in 2-well chamber slides and treated with 1 µM B460 or control PS-ODNs as described earlier. 48 hr later, the cells were fixed in 4% para-formaldehyde solution for TdT-mediated dUTP Nick-End labeling (TUNEL) assay. Briefly, the cells were permeabilized in 0.2% Triton X-100 solution, (5 min), DNA strand breaks were labeled with Fluorescein-12dUTP in TdT incubation buffer (37°C for 1 hr), and counterstained with 1 mg/ml PI. Localized green fluorescence of apoptotic cells (Fluorescein-12-dUTP) in a red background (PI) was detected by fluorescence microscopy. The percentage of apoptotic cells was determined by dividing the number of green fluorescent cells by the total number of cells examined. A minimum of 300 cells was counted for each condition.

bFGF antisense PS-ODNs B460 were injected via tail vein at a dose of 10 mg/kg. At various times after injection (24, 48 and 72 hr), the mice were killed, the tumors excised and frozen in liquid nitrogen. The tumors were then homogenized (Dounce tissue grinder, Wheaton, Millville, NJ) and the homogenates were lysed on ice for 30 min with 1 ml of hypotonic buffer (20 mm Tris-HCl, pH 6.8, 1 mm MgCl 2, 2 mm EGTA, 0.5% Nonidet P-40, 2 µM Phenylmethanesulphonyl fluoride (PMSF), 200 U/ml Approtinin, 2 µg/ml leupetin) (Giannakakou et al, 1998) per 0.1 g tissue. Following a brief but vigorous vortex the samples were centrifuged at 14,000 rpm for 10 min at 4_C. A 30 µl aliquot of each sample was mixed with 10 µl 4x SDS-PAGE sample buffer (0.3 M Tris-HCl, pH 6.8, 45% glycerol, 20% "-mercaptoethanol, 9.2% SDS and 0.04 g/100ml bromophenol blue) and heated at 100_C for 10 min. 30 µl of each sample was then analyzed by SDS-PAGE on a 12% separating gel and 3% stacking gel. Following transfer, the membrane was immunoblotted using a bFGF primary antibody (Upstate Biotechnology, Lake Placid, NY) 1:1000 diluted in antibody solution (3% dry milk, 25 mm Tris, pH 7.5, 0.5 M NaCl, 0.05% Tween 20) overnight at 4°C. After washing, a secondary antibody labeled with horseradish peroxidase was applied and incubated at room temperature for 1 hr. Protein bands were visualized and densitometry was performed.

G. Co-culture conditions Transwell 6-well dishes (Corning, Corning, NY) with a membrane pore size of 0.4 µM were used. Caki-1 cells were seeded at 5x104 in the transwell inserts. After allowing the cells to attach overnight, the Caki-1 cell medium was replaced with serum free medium containing 1 µM B460 PS-ODNs or control PS-ODNs complexed with liposome (DOTAP:DOPE). 5 hr later, medium containing 10% heat inactivated FBS was added to yield a final FBS concentration of 2.5%. The transwells containing treated Caki-1 cells were inserted into the 6-well dishes containing MHE or HMVEC-L cells (5x104) and incubated at 37°C for 48 hr. The number of endothelial cells then was determined by hemocytometer count.

L. Tumor response assessments Once the Caki-1 xenografts reached a size of ~200 mm3, animals were assigned randomly to various treatment groups. B460 or control PS-ODNs were administrated via the tail vein with DOTAP:DOPE liposomes at a dose of 5 mg/kg or 10 mg/kg 1 and 4 days later. Tumors were measured using calipers and volumes were approximated by the formula, volume=1/6(#ab2), with a and b represent two perpendicular tumor diameters. The times for the tumors in the various treatment groups to grow from 200 to 1000 mm3 were recorded and compared.

H. Endothelial cell migration Caki-1 cells were set at 1x105 per well in 24-well dishes and allowed to attach overnight. The Caki-1 cells then were treated with 1 µM control or B460 PS-ODNs for 24 hr. HTS FluoroBlok inserts (Becton Dickinson, Franklin Lakes, NJ) with a pore size of 8.0 µm were assembled into the 24-well dish with the Caki-1 cells. MHE or HMVEC-L cells (5x104) were plated into the FluoroBlok inserts. These endothelial cells had been previously stained in medium containing 10 µg/ml Di-I (Molecular Probes, Eugene, OR) for 24 hr and washed 4 times with PBS. After a 24 hr incubation period, the number of migrated endothelial cells was determined by direct measurement of the fluorescence in the bottom well using a CytoFluor 4000 plate reader (Perceptive BioSystems, St. Paul, MN).

III. Results Caki-1 cell bFGF levels were significantly reduced from a normal of 720 pg/106 cells after treatment with 1 µM antisense PS-ODNs (Figure 1). This effect was sequence and target region specific. The antisense PSODNs complimentary to the start codon (AUG) region (B460) was found to be the most effective. For example, the cellular bFGF levels of B460 treated Caki-1 cells were found to be about 41% of those found in control or untreated cells (p<0.05). In comparison, the antisense PSODNs complimentary to the 3´ UTR (B931) or coding region (B471) were less effective at down regulating bFGF expression (57% and 65% of control respectively, p<0.05).

I. Tumor cell-induced angiogenesis Caki-1 cells (5x104) were inoculated (10 µl) intradermally at 4 sites in the ventral surface of mice. Three days later, the mice were killed, the skin carefully separated from the underlying muscle and the number of vessels entering the scoring area was counted under a dissecting microscope (Sidky and Auerbach, 1976).

155


Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Figure 1. Cellular bFGF levels in Caki-1 tumor cells treated with different antisense PS-ODNs. The cells were either untreated (Control), liposome vehicle treated (DOTAP), or treated with a 1 µM dose of control PS-ODNs antisense sequences (Scramble, Sense, Inverted) or a 1 µM dose of PS-ODNs antisense sequences targeted to different regions of bFGF mRNA. Each bar represents the mean ± S.E. of at least 3 different experiments. Stars indicate significant differences (p<0.05) from the untreated control group.

mitogenic effects on renal cells (Gospodarowicz et al, 1986; Issandou and Darbon, 1991), the influence of antisense and control PS-ODNs treatment on Caki-1 cell growth was investigated. Control PS-ODNs or liposome vehicles showed no effect on Caki-1 cell growth (Figure 4). However, Caki-1 cell growth was inhibited by PSODNs targeted against different regions of bFGF mRNA. B460 was found to be the most effective while antisense PS-ODNs targeting the 3´UTR (B931) or coding region (B471) showed less cell growth inhibition. When comparing these data to those illustrated in Figure 1, it is readily apparent that the extent of Caki-1 cell growth inhibition by different antisense PS-ODNs is closely related to their potency in down regulating bFGF expression.

Treating Caki-1 cells with control scramble PS-ODNs or liposome vehicles did not affect bFGF levels in Caki-1 cells. Similarly, treatment with sense or inverted sequence PS-ODNs failed to reduce bFGF expression. Because B460 treatment led to the greatest inhibition of bFGF expression, this PS-ODN was used in all subsequent investigations. The results of Figure 2 illustrate that the inhibitory effect of B460 was clearly dose dependent with doses as low as 0.5 µM leading to significant reductions in the cellular bFGF levels. When higher doses of B460 were applied, bFGF levels could be suppressed to 20% of control values. Levels of bFGF mRNA in Caki-1 cells treated with PS-ODNs also were determined (Figure 3). The results indicated a marked inhibition of bFGF mRNA after treatment with B460 that was absent in cells treated with scramble PS-ODNs. Because bFGF can have

Figure 2. Effect of different doses of bFGF antisense PS-ODNs (B460) on Caki-1 cell bFGF expression level. The 0 µM dose corresponds to cells treated with scramble control oligomers. The bFGF levels were determined after 3-day treatment; each datum point represents the mean ± S.E. of 3 independent experiments. Stars indicate significant differences (p<0.05) from untreated cells.

156


Cancer Therapy Vol 1, page 157

Figure 3. Message RNA levels in Caki-1 cells which were either untreated (Control), liposome vehicle treated (DOTAP) or treated with a 1 µM dose of control PS-ODNs antisense sequence (Scramble) or bFGF antisense PS-ODNs (B460). A. Representative relative RT-PCR results, each group was performed in duplicate; B Relative bFGF mRNA levels of Caki-1 cells treated with different PS-ODNs. Each bar shows the mean ± S.E. of 3 independent experiments. The star indicates a significant difference (p<0.05) from the untreated control group.

Figure 4. Percentage of Caki-1 cells 3 days after treatment with liposome vehicle (DOTAP), 1 µM control PSODNs sequences (Scramble, Sense, Inverted), or different PS-ODNs sequences targeted to bFGF mRNA (B460, B471, B931). Control cells were untreated. Data are the mean ± S.E. of 3 different experiments. Stars indicate significant differences (p<0.05) from the untreated control group.

To gain a better understanding of the underlying mechanisms involved in the observed growth inhibitory effects, the expression of FGF receptors on Caki-1 cells was determined. The results (Figure 5a) showed that Caki-1 cells expressed 3 of 4 FGF receptors involved in the bFGF signal transduction pathway. B460 treatment also led to small but significant changes in cell cycle (Figure 5b) and induction of apoptosis (Figure 5c). Clonogenicity of Caki-1 cells was not however affected by B460 treatment (data not shown).

Since the ultimate goal of bFGF antisense therapy is to inhibit cancer cell induced angiogenic signaling, experiments designed to mimic the in vivo paracrine interaction between tumor and endothelial cells were conducted using a Transwell co-culture system to evaluate the effect of bFGF expression in Caki-1 cells on endothelial cell growth and migration. Caki-1 tumor cells, which had been pretreated with bFGF antisense, were grown in transwells inserts while endothelial cells (MHE and HMVEC-L) were set on the bottom of the wells.

157


Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Figure 5a. FGF receptors expression by Caki-1 cells. Caki-1 cells express FGFR 1-3 but not FGFR4.

Figure 5b. Caki-1 cell cycle analysis performed 72 hr after treatment with a 1 µM dose of B460 or scramble PSODNs. The control group was untreated. Each bar represents the mean + S.E. of 3 experiments. The star indicates a significant difference (p<0.05) compared to the untreated control group.

Figure 5c. Apoptosis rate of Caki-1 cells after B460 treatment. Caki-1 cells were untreated (Control), treated with liposome vehicle (DOTAP), or treated with a 1 µM dose of either scramble PS-ODNs (Scramble) or B460 for a period of 72 hr. Each bar shows the results of 3 experiments + S.E. The star indicates a significant difference (p<0.05) from the untreated control group.

endothelial cell proliferation whereas treating the tumor cells with scramble antisense PS-ODNs had no effect on MHE or HMVEC-L cell growth. Media derived from B460 treated tumor cells also impaired the migration rate of both MHE and HMVEC-L cells whereas media from

The two cell types were separated by a membrane with 0.4 µm pores, chosen to allow the exchange of growth factors while preventing any direct cell-cell interactions. The results (Figure 6) showed that Caki-1 cells pre-treated with B460 significantly inhibited

158


Cancer Therapy Vol 1, page 159 control or scramble treated tumor cells did not (Figure 7). To demonstrate that bFGF antisense treatments could affect the induction of angiogenesis by Caki-1 cells in vivo, tumor cells pretreated with B460 were injected into mice and the number of blood vessels induced 3 days later was determined. The results (Figure 8) showed that untreated or scramble sequence PSODNs treated Caki-1 cells had very similar angiogenic potency, inducing ~45 new vessels in the assay period. In contrast, the angiogenic potency of Caki-1 cells pretreated with B460 was found to be severely impaired; only ~26 new blood vessels were observed.

In order to investigate whether the in vivo administration of bFGF antisense could lead to reductions in tumor bFGF expression levels, B460 PS-ODNs were mixed with cationic liposome DOTAP:DOPE in 5% dextrose and injected (10 mg/kg) via tail vein into Caki-1 xenograft-bearing mice. Western blot analysis of tumor samples collected at various times after B460 injection showed significant reductions in bFGF levels 24, 48 and 72 hr after treatment, with the maximum suppression occurring between 48 hr to 72 hr post B460 administration (Figure 9).

Figure 6. Effect of Caki-1 cell coculture on the growth of MHE and HMVEC-L cells. Caki-1 cells were untreated (Control) or pre-treated with either liposome vehicle (DOTAP), 1 µM control antisense PS-ODNs (Scramble) or 1 µM bFGF antisense PS-ODNs (B460). Cells were counted at the end of a 4-day treatment period. Each bar represents the mean ± S.E. of 3 experiments. Stars indicate significant differences (p<0.05) from the untreated control group.

Figure 7. Effect of conditioned media derived from Caki-1 cells on MHE and HMVEC-L cell migration. Media were obtained from Caki-1 cells which were not treated (Control), liposome vehicle treated (DOTAP), control PSODNs treated (Scramble) or bFGF antisense PS-ODNs (B460) treated. Each treatment was carried out in quadruplicate and the data shown are the mean ± S.E. Stars indicate significant differences (p<0.05) from the untreated control group.

159


Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Figure 8. Number of blood vessels induced 3 days after injecting 5 x 104 Caki-1 cells intradermally at 3-4 sites per mouse. Caki-1 cells were either untreated (Control) or pretreated with a 1 ÂľM dose of PS-ODNs for 2 hr prior to injection. The Scramble group refers to cells pretreated with scramble sequence PS-ODNs whereas the B460 group represents Caki-1 cells pretreated with bFGF antisense PSODNs. Each circle represents one injection site; the bar shows the median of 16 sites. Results for B460 treated cells are significantly different (p<0.05, Wilcoxon rank test) from untreated or scramble PS-ODNs treated cells.

A

B Figure 9. bFGF protein levels in Caki1 tumors at different times after treatment with 10 mg/kg bFGF antisense PD-ODNs (B460). A Representative bFGF western blot results, showing two tumor samples per group; B Relative bFGF protein levels of Caki-1 tumors in mice treated bFGF antisense PD-ODNs (B460). Each bar represents the mean Âą S.E. of 6 tumors. The stars indicate significant differences from time zero (p<0.05).

Subsequent experiments were designed to determine the antitumor efficacy of the systemic delivery of bFGF antisense PS-ODNs by examining the effect of such treatments on Caki-1 tumor growth. Caki-1 xenograftbearing mice were treated with two doses of bFGF antisense PS-ODNs B460 (5 or 10 mg/kg) 1 and 4 days after the tumors reached a size of ~200 mm3. The time for the tumors to grow from 200 to 1000 mm3 then was recorded (Figure 10). The data show that the median time for the tumors to grow to 5 times the original starting size was significantly prolonged in the bFGF antisense PSODNs (B460) treated groups, and that this increase in growth delay was treatment dose dependent.

IV. Discussion Evidence exists to strongly implicate bFGF as an important growth-promoting and angiogenic factor in RCC. First described in this disease 10 to 15 years ago (Mydlo et al, 1988; Mydlo et al, 1993) higher bFGF mRNA levels now have been noted in RCC than adjacent normal kidney (Eguchi et al, 1992). Associations between serum and urine bFGF levels and malignant progression as well as treatment outcome also have been made (Nanus et al, 1993; Nguyen et al, 1994; Duensing et al, 1995; Miyake et al, 1996; Yoshimura et al, 1996). The RCC model used in the present investigations (Caki-1) expresses 3 of 4 FGF receptors involved in bFGF signal transduction (Figure 5a). Blocking the production of bFGF by antisense PS-ODNs treatment causes a 160


Cancer Therapy Vol 1, page 161 moderate inhibition of RCC growth in vitro (Figure 4). This result was sequence specific, dose dependent and achieved at low concentrations (Figures 1-3). In general, the effects of different antisense PS-ODNs appeared to be directly related to their ability to suppress bFGF expression (Figure 4 vs. 1). The most probable explanation for the observed growth inhibition associated with the bFGF treatment is the small but significant modulation of the cell cycle (increase in G2-M, decrease in S (Figure 5b) coupled with the induction of apoptosis (Figure 5c)). To evaluate whether bFGF mRNA targeted PSODNs could inhibit tumor cell induced angiogenesis, both in vitro and in vivo assessments of this process were made. Since endothelial cell proliferation and migration are key elements in angiogenesis, the ability of Caki-1 cells to induce these components after bFGF antisense PS-ODNs treatment was investigated under conditions that allowed growth factor exchange between tumor and endothelial cells or by exposing endothelial cells to media collected from antisense treated tumor cells. These in vitro experiments were conducted under reduced serum conditions to minimize interference of other growth factors. The results showed that the inhibition of bFGF production in tumor cells by antisense PS-ODNs treatment significantly reduced endothelial cell proliferation (Figure 6) and migration (Figure 7). Subsequent studies demonstrated that inhibiting the production of bFGF by pre-treating Caki-1 cells with bFGF antisense PS-ODNs could significantly impair their ability to induce the angiogenic process in vivo (Figure 8). While these results support the role of bFGF as an important pro-angiogenic growth factor in Caki-1 cellinduced angiogenesis, the direct effect of B460 treatment on Caki-1 cell proliferation (Figure 4) may also be contributing to the reduced vessel counts observed in vivo (Figure 8). When administered in vivo, B460 not only significantly reduced bFGF expression levels in

established Caki-1 xenografts (Figure 9) but also resulted in a dose-dependent tumor growth delay (Figure 10). Previous studies had already shown that down regulating bFGF expression by antisense treatment could inhibit endothelial and tumor cell proliferation (Masood et al, 1997). For example, transfection of bFGF antisense cDNA or treatment with bFGF antisense PS-ODNs led to growth inhibition in several malignant cell types in vitro (Becker et al, 1989; Murphy et al, 1992; Ensoli et al, 1994; Redekop and Naus, 1995). Also, pretreating Kaposiâ&#x20AC;&#x2122;s sarcoma cells with bFGF antisense oligomers prior to injecting them into nude mice led not only to a reduction in the number of KS-like lesions present 4 days later but also to a reduced histopathology and lower levels of bFGF in those lesions that did occur (Ensoli et al, 1994). However, the present investigations provide the first experimental evidence that the systemic administration of bFGF antisense PS-ODNs to mice bearing macroscopic tumors can have significant antitumor efficacy. Indeed, the tumor growth delays observed (Figure 10) were achieved without overt toxicity and with doses well below the LD10 dose. In summary, the results of this study indicate that bFGF is an important factor for the growth and angiogenic potential of Caki-1 cells. Treatment with the novel bFGF antisense PS-ODNs (B460) proved to be an effective means of down-regulating bFGF production and impairing both Caki-1 growth and angiogenic signaling in vitro and in vivo. Moreover, the systemic administration of bFGF antisense PS-ODNs resulted in a significant inhibition of tumor growth when mice bearing established Caki-1 xenografts were treated. Taken together, these findings suggest that the application of an antisense treatment strategy based on targeting the angiogenic growth factor bFGF may have utility in the management of renal cell carcinoma.

Figure 10. The effect of antisense PSODNs targeted to bFGF mRNA treatment on the growth of Caki-1 xenografts. Anti-bFGF (B460) or control PS-ODNs (Scramble) were administered with cationic liposomes (DOTAP:DOPE) via the tail vein 1 and 4 days after the tumors reached a size of ~200 mm3. Control mice were untreated. Liposome vehicle administration on its own had no effect on Caki-1 tumor growth (data not shown). Each circle represents a single tumor; the bar shows the response of the median tumor in each group of 10 mice. The stars show significant differences (p<0.05, Wilcoxon rank test) from control or scramble PS-ODNs treated mice.

161


Shi and Siemann: bFGF antisense ODNs in cancer and angiogenesis Motzer RJ, Rakhit A, Schwartz LH, Olencki T, Malone TM, Sandstrom K, Nadeau R, Parmar H, Bukowski R (1998) Phase I trial of subcutaneous recombinant human interleukin12 in patients with advanced renal cell carcinoma. Clin Cancer Res 4, 1183-1191 Murphy PR, Sato Y, Knee RS (1992) Phosphorothioate antisense oligonucleotides against basic fibroblast growth factor inhibit anchorage-dependent and anchorage-independent growth of a malignant glioblastoma cell line. Mol Endocrinol 6, 877884 Mydlo JH, Heston WD, Fair WR (1988) Characterization of a heparin-binding growth factor from adenocarcinoma of the kidney. J Urol 140, 1575-1579 Mydlo JH, Zajac J, Macchia RJ (1993) Conditioned media from a renal cell carcinoma cell line demonstrates the presence of basic fibroblast growth factor. J Urol 150, 997-1001 Nanus DM, Schmitz-Drager BJ, Motzer RJ, Lee AC, Vlamis V, Cordon-Cardo C, Albino AP, Reuter VE (1993) Expression of basic fibroblast growth factor in primary human renal tumors, correlation with poor survival. J Natl Cancer Inst 85, 1597-1599 Nguyen M, Watanabe H, Budson AE, Richie JP, Hayes DF, Folkman J (1994) Elevated levels of an angiogenic peptide, basic fibroblast growth factor, in the urine of patients with a wide spectrum of cancers. J Natl Cancer Inst 86, 356-361 Redekop GJ, Naus CC (1995) Transfection with bFGF sense and antisense cDNA resulting in modification of malignant glioma growth. J Neurosurg 82, 83-90 Sidky YA, Auerbach R (1976) Lymphocyte-induced angiogenesis in tumor-bearing mice. Science 192, 1237-1238 Singh RK, Gutman M, Bucana CD, Sanchez R, Llansa N, Fidler IJ (1995) Interferons alpha and beta down-regulate the expression of basic fibroblast growth factor in human carcinomas. Proc Natl Acad Sci U S A 92, 4562-4566 Stadler WM, Kuzel T, Shapiro C, Sosman J, Clark J, Vogelzang NJ (1999) Multi-institutional study of the angiogenesis inhibitor TNP-470 in metastatic renal carcinoma. J Clin Oncol 17, 2541-2545 Tang F, Hughes JA (1999) Synthesis of a single-tailed cationic lipid and investigation of its transfection. J Controlled Release 62, 345-358 Tartaglia M, Fragale A, Battaglia PA (2001) A competitive PCRbased method to measure human fibroblast growth factor receptor 1-4 (FGFR1-4) gene expression. DNA Cell Biol 20, 367-379 Tsui KH, Shvarts O, Smith RB, Figlin RA, deKernion JB, Belldegrun A (2000) Prognostic indicators for renal cell carcinoma, a multivariate analysis of 643 patients using the revised 1997 TNM staging criteria. J Urol 163, 1090-1095 Voest EE, Kenyon BM, O'Reilly MS, Truitt G, D'Amato RJ, Folkman J (1995) Inhibition of angiogenesis in vivo by interleukin 12. J Natl Cancer Inst 87, 581-586 Yoshimura K, Eto H, Miyake H, Hara I, Arakawa S, Kamidono S (1996) Messenger ribonucleic acids for fibroblast growth factors and their receptor in bladder and renal cell carcinoma cell lines. Cancer Lett 103, 91-97

Acknowledgements This work was supported by USPNS grant CA89655.

References Becker D, Meier CB, Herlyn M (1989) Proliferation of human malignant melanomas is inhibited by antisense oligodeoxynucleotides targeted against basic fibroblast growth factor. EMBO J 8, 3685-3691 Duensing S, Grosse J, Atzpodien J (1995) Increased serum levels of basic fibroblast growth factor (bFGF) are associated with progressive lung metastases in advanced renal cell carcinoma patients. Anticancer Res 15, 2331-2333 Eguchi J, Nomata K, Kanda S, Igawa T, Taide M, Koga S, Matsuya F, Kanetake H, Saito Y (1992) Gene expression and immunohistochemical localization of basic fibroblast growth factor in renal cell carcinoma. Biochem Biophys Res Commun 183, 937-944 Ensoli B, Markham P, Kao V, Barillari G, Fiorelli V, Gendelman R, Raffeld M, Zon G, Gallo RC (1994) Block of AIDSKaposi's sarcoma (KS) cell growth, angiogenesis, and lesion formation in nude mice by antisense oligonucleotide targeting basic fibroblast growth factor. A novel strategy for the therapy of KS. J Clin Invest 94, 1736-1746 Fujimoto K, Ichimori Y, Kakizoe T, Okajima E, Sakamoto H, Sugimura T, Terada M (1991) Increased serum levels of basic fibroblast growth factor in patients with renal cell carcinoma. Biochem Biophys Res Commun 180, 386-392 Giannakakou P, Villalba L, Li H, Poruchynsky M, Fojo T (1998) Combinations of paclitaxel and vinblastine and their effects on tubulin polymerization and cellular cytotoxicity, characterization of a synergistic schedule. Int J Cancer 75, 57-63 Gordon MS, Talpaz, and Margolin K. (1998) Phase I trial of recombinant humanized monoclonal anti-vascular endothelial growth factor in patients with metastatic cancer. Proc Am Soc Clin Oncol 17, 210a. Gospodarowicz D, Neufeld G, Schweigerer L (1986) Fibroblast growth factor. Mol Cell Endocrinol 46, 187-204 Issandou M, Darbon JM (1991) Basic fibroblast growth factor stimulates glomerular mesangial cell proliferation through a protein kinase C-independent pathway. Growth Factors 5, 255-264 Masood R, Cai J, Zheng T, Smith DL, Naidu Y, Gill PS (1997) Vascular endothelial growth factor/vascular permeability factor is an autocrine growth factor for AIDS-Kaposi sarcoma. Proc Natl Acad Sci U S A 94, 979-984 Medical Research Council Renal Cancer Collaborators (1999) Interferon-alpha and survival in metastatic renal carcinoma, early results of a randomized controlled trial. Lancet 353, 14-17 McLaughlin JK, Lipworth L (2000) Epidemiologic aspects of renal cell cancer. Semin Oncol 27, 115-123 Miyake H, Hara I, Yoshimura K, Eto H, Arakawa S, Wada S, Chihara K, Kamidono S (1996) Introduction of basic fibroblast growth factor gene into mouse renal cell carcinoma cell line enhances its metastatic potential. Cancer Res 56, 2440-2445

162


Cancer Therapy Vol 1, page 163

Cancer Therapy Vol 1, 163-171, 2003.

Antitumoral cell-based therapies Review Article

Javier GarcĂ­a-Castro*, Daniel Rubio, Ricardo de la Fuente, Antonio Bernad Department of Immunology and Oncology, Centro Nacional de BiotecnologĂ­a (CSIC), Madrid, Spain

__________________________________________________________________________________ *Correspondence: Javier GarcĂ­a-Castro; Phone: +34 915854656, Fax:+34 913720493, e-mail: jgarcia@cnb.uam.es Key Words: Antitumoral cell-based therapies, cellular vehicles, immune cells, NK and T cells, macrophages, dendritic cells, tumor cells, stem cells Received: 29 July 2003; Accepted: 27 August 2003; electronically published: September 2003

Summary Cell therapies are based on biological agents involving cells to be administered to patients with diverse diseases. Examples of cell-based therapies include implantation of cells as an in vivo source of an enzyme, cytokine or factor; infusion of immune cells such as lymphocytes, or transplant of cell populations such as hematopoietic cells, hepatocytes or pancreatic islet cells to perform a complex biological function. A similar concept can be applied to cancer in a new antitumor approach. In this case, carrier cells are usually modified ex vivo by vectors or by preloading with bioactive materials such as toxins or viruses. Several cell types target naturally to the tumor mass, or are engineered to improve this preferential homing. SDF-1 can induce integrin upregulation, aiding adhesion and ligand-dependent transmigration of vascular endothelial cells (Zou et al, 2001). In contrast to systemic drugs currently in use, cells do not distribute randomly via the circulation, but have an intrinsic program for trafficking through the body and entry into organs (Figure 2). A heterogeneous cell population in solid tumors resides in a common stromal microenvironment that is defined by interaction of this population with neighboring cells and local factors such as cytokines, molecules and extracellular matrix (Mareel and Leroy, 2003). Little is known of the interactions among these components that support tumor growth or are involved in tumor rejection (Stetler-Stevenson et al, 1993). Despite this lack of knowledge, it is possible to use cells as carriers to induce tumor inhibition. If a cell could be loaded with antitumor agents, a more specific cell-based therapeutic strategy would be possible, inducing powerful local action on the tumor. Here we will summarize some of the recent progress using cells as carriers of therapeutic products, focusing mainly on review of recent clinical trials.

I. Introduction Current cancer treatments are based on systemic drug administration. It is often difficult to obtain high intratumor concentration of these agents because of unacceptable secondary effects. Significant advances have been made in the development of new therapies with specific tumor targeting, as is the use of antibodies or viral vectors (Viti et al, 2002; Galanis et al, 2001). These agents nonetheless do not home specifically to the tumor and are affected by problems including limited half-life in the bloodstream, non-specific adhesion, as well as difficulty in extravasation and immune response. An ideal candidate would thus be a carrier with properties for specific tumor targeting, capacity for extravasation, which does not present problems to the immune system. Tumors may comprise different cell types: fibroblasts, stroma, immune cells, endothelial progenitors, and the heterogeneous cancer cells themselves (Figure 1). Since cancer cells may produce a variety of factors, a tumor can recruit certain cells (e.g., lymphocytes, macrophages or endothelial progenitors) during its development. During the hyperproliferative stage, tumors induce surrounding tissue to support new blood vessel formation, mainly through production of vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) (Rafii et al, 2002). Other factors secreted by malignant cells, such as stromal-derived factor-1 (SDF-1), induce migration of certain immune system cells to the tumor. This migration can be produced indirectly, since

II. Cellular vehicles Cells of the immune system including T cells, macrophages, NK cells and eosinophils or cells related to tumor neoangiogenesis are the most obvious choices as vehicles, but other cell types such as tumor or stem cells could also be used. 163


García-Castro et al: Antitumoral cell-based therapies

Figure 1. Cellular diversity in the tumoral microenvironment. Schematic overview of different cellular types related to the progression of cancer cells. Many of these cells could be used as cellular vehicles in antitumoral therapies in base to their properties related with a specific recruitment to tumor sites.

Figure 2. Physiological models of distribution through the body of the therapeutic agents. In “systemic therapies”, classic drugs or new therapeutics, as viral vectors or antibodies, are administered to the patient and quickly they are distributed by all the body. They reach a homogenous concentration, which can have therapeutic effects but also, sometimes, undesirable secondary effects. By contrast, with “targeted therapies”, using carrier cells loaded with antitumoral agents, we could deliver therapeutics without problems of systemic dilution, minimizing collateral damage and with highly locoregional concentration in base to natural properties of tumor-homing cells.

164


Cancer Therapy Vol 1, page 165 injection to reduce systemic toxicity, or the need to select patients with low tumor burden and a large number of harvested NK cells. Nonetheless, results of clinical trials using LAK cells have shown efficacy in treatment of micrometastases, although not in large tumors (Kimura and Yamaguchi, 1997). Tumor-infiltrating lymphocytes (TIL) are T cells with unique tumor activity, which infiltrate some tumors and can be expanded ex vivo with IL-2 (Mukai et al, 1999). Although data on the physiological behavior of TIL are limited, these cells have already been used clinically in antitumor therapies, especially in melanomas (Rosenberg et al, 1994). TILs were recovered from patient tumors, cultured ex vivo with IL-2, selected and expanded based on their tumor-specific reactivity, then reinfused to the patient. Nonetheless, most common â&#x20AC;&#x153;tumor-specificâ&#x20AC;? antigens are in fact specific for the tissue or cell types that compose it; these antigens can also be expressed by normal tissues or cells of the same type (Song, 1998).

The ideal features of a candidate are a) immunological silence, b) a large number of easily-obtained cells, c) susceptibility to vector transduction (Table 1), d) lack of non-specific adhesion in the bloodstream, e) specific extravasation and homing to the tumor site. No perfect cell vehicle is currently available, although many approaches have been tested.

A. Immune cells Despite the theoretical suitability of immune system cells as vehicles to transport therapeutic products to the heart of the tumor, most studies using these cells center mainly on activating their innate immune capacity. Activation of the immune system is nonetheless a complex process. It requires not only immune cell localization to the tumor, but also an effective immune cell:tumor cell ratio, and adequate signaling through the TCR/CD3 complex plus a co-stimulatory signal (via ligands of the B7 family). In addition, the effect of suppressor cytokines must be avoided, since cytokines such as TGF-! and IL-10 can be secreted by the tumor cell, by surrounding stromal cells, or even by the activated immune cells themselves. The results of clinical studies in immunotherapy will be outlined below, although additional work will be required to determine the validity of immune cells as bystander therapeutic carriers.

Table 1. Vectors for gene and cell therapy. Efficient gene transfer requires the use of a vector and, depending upon the strategy, advantages and disadvantages of each one have to be considered. Type

Vector

Expression

Characteristics

Non-viral

Liposomes

Transitory

Low transfection efficiency. Good safety profile.

Naked DNA or RNA

Transitory

Low transfection efficiency. Simple and cheap production.

Molecular conjugates

Transitory

Flexible design. Unstable in vivo.

Oncovirus

Prolonged

Integrated in proliferating cells.

Lentivirus

Prolonged

Integrated in proliferating and non-proliferating cells.

Adenovirus

Transitory

Very high transfection efficiency. No integrating. Generates immune response.

Poxvirus (vaccinia)

Transitory

Great clinical experience.

Adenoassociates virus (AAV)

Prolonged

Insert-size limit of 4.5 Kb.

Herpes simplex virus

Transitory

Very efficient in vivo.

1. NK and T cells Tumor immunotherapy is a growing field, thanks to recent descriptions of factors implicated in the immune response to tumors and tumor-associated antigens, and reports on the need for lymphocyte activation by dendritic cells. Nevertheless, tumor cells often fail to induce a specific immune response due to the lack of a tumorassociated antigen, lack of a costimulatory signal, or by producing immunological inhibitors (Song, 1998). Absence of adhesion receptors on tumor vessels may also prevent lymphocyte infiltration and contact with tumor cells (Oppenheimer-Marks et al, 1990). In spite of this, experiments in mice showed that T cells can inhibit tumor growth, although few clinical studies have been conducted and the clinical benefits of such treatments have not been clearly documented (Greten and Jafee, 1999). Peripheral blood leukocytes can be cultured in vitro in the presence of several cytokines, particularly IL-2, to obtain lymphokine-activated killer (LAK) cells (Melder et al, 1989). Although some tissue-resident lymphocytes may have spontaneous LAK activity, normal blood mononuclear cells show no LAK activity, which is acquired only after incubation with IL-2 (Phillips et al, 1987). LAK cells have a wide spectrum of lytic activity against tumor cells in both autologous and allogeneic settings, whereas normal tissues are resistant to LAKmediated lysis (Fox and Rosenberg, 1989). Combined infusion of LAK cells and IL-2 has been evaluated in clinical trials, in which antitumor effects correlated with IL-2 dose and the number of LAK cells administered (Yano et al, 1999). Certain aspects remain to be modified, such as use of continuous IL-2 infusion rather than bolus

Viral

165

Retrovirus


GarcĂ­a-Castro et al: Antitumoral cell-based therapies The activity of the TILs used in this protocol, selected for their ability to recognize tumor-associated antigens, may thus be less specific than desired. A major obstacle in TIL-based therapies is that they can be cultured only from 50% of patients and several weeks of culture are required. Various authors nonetheless reported partial clinical responses in patients treated with TIL infusions, although their data also indicate that tumor size and the number of antigenic targets are essential for the success of TIL-based immunotherapy (Lister et al, 1995; Basse et al, 2000; deMagalhaes-Silverman et al, 2000). In these clinical trials, TIL localization within tumors was demonstrated after infusion, although there is also TIL homing to other organs such as liver and spleen, with potential autoreactivity. Moreover, when peripheral blood lymphocytes (PBL) were infused in patients as a control, no preferential trafficking pattern to the tumor was found for TIL versus PBL (Economou et al, 1996). All together, these data place the central hypothesis of preferential TIL homing to the tumor in doubt. NK cells can also lyse tumor cells, and have the advantage that they are easily obtained from patient peripheral blood (Whiteside et al, 1998). Following systemic injection, these cells were found in large numbers, primarily in the tumor and in lung (Melder et al, 2001). NK cells do not require a second costimulatory signal for complete activation (Hombach et al, 1993), an additional advantage for immunotherapy. In contrast to TIL, however, there is no evidence of benefits in clinical trials using NK cells, although accumulation was demonstrated within tumor metastases (deMagalhaesSilverman et al, 2000). These clinical protocols are based on the innate capacity of T and NK cells to home to the tumor and trigger an immune response. Several groups have focused on strategies based on enhancement of T cell cytotoxicity through gene transfer (van de Winkel et al, 1997; Weiner et al, 1997). Two main strategies are being tested to increase cytotoxicity in T cells. One is based on screening sequences for improved peptide-MHC binding and/or to increase the affinity of this complex with the TCR (Brocker et al, 1996; Chung et al, 1994). A second strategy focuses on activation of costimulatory signals, based on B7 and TNF family molecules (Hurwitz et al, 2000). Different lymphocyte subsets vary in their ability to extravasate and reach sites of tumor growth. This capacity is dictated by their physiological properties and is independent of their immunological specificity (Economou et al, 1996). NK cell populations may have high affinity for tumor vessel regions, but may be limited to a single passage through the tumor vasculature due to entrapment in other organs. In contrast, T lymphocytes may have lower adhesion efficiency to tumor vessels, but are not limited to single-pass delivery (Jain, 2001). Due to these features, several groups are studying improvement of T cell tumor homing. The approach consists mainly of construction of chimeric receptors encoding a peptide or protein able to recognize tumor antigens. The extracellular moiety of this artificial receptor is generally a single-chain antibody or ligand of endothelial and/or tumor cell

receptors. Alternatively, the TCR can be modified, although this requires functional assembly with the endogenous signaling machinery (Goverman et al, 1990; Brocker et al, 1996). Other groups have incorporated an intracellular domain that allows certain activation signals to promote rolling or immune functions (Hombach et al, 2002). Engineering T cells is a promising strategy, but efficacy in clinical trials remains to be demonstrated.

2. Macrophages Macrophages are phagocytic cells distributed throughout the body. Under normal conditions, they circulate without tissue retention, but under pathological circumstances they are mobilized and concentrated in damaged areas. Low oxygen tension (hypoxia) is another signal for macrophage recruitment, for example to areas of tumor necrosis (Goerdt et al, 1999). A significant proportion of cells in tumors are macrophages, apparently rendering them good candidates for cell-based therapies (Ohno et al, 2002). The ability of macrophages to kill tumor cells is controversial. Some groups have reported that activated macrophages kill tumor cells by direct cytotoxicity and by antibodydependent cytotoxicity, although others question the reality of these activities. Activated macrophages could kill tumor cells by secreting superoxide anions, hydrogen peroxide, nitric oxide or proteolytic enzymes, although tumor cell destruction by macrophages requires cell-to-cell contact and is dependent on contact duration, target cell type, and other poorly understood mechanisms (Obening, 1997). Previous studies showed the safety of protocols based on the infusion of large numbers of macrophages into patients. Activated macrophages were effective in treatment of metastases, around which they accumulated; in contrast, primary tumors did not regress (Fidler et al, 1985). Once their tumor homing capacity has been demonstrated, macrophage efficacy could be improved if they carried therapeutic genes to be expressed near or within a tumor. Engineered receptors and hypoxiaregulated promoters have been used to obtain higher specific targeting in some vectors in preclinical models (Griffiths et al, 2000).

3. Dendritic cells Dendritic cells are bone marrow-derived antigenpresenting cells able to migrate to local lymph nodes, where they activate T cells. In addition, the presence of tumor-infiltrating dendritic cells (TIDC) in a tumor has been correlated as a good prognostic factor for several tumor types (Bell et al, 1999). TIDC capture and process tumor cell-derived antigens, then migrate to lymph nodes to activate anti-tumor immune responses (Randolph et al, 1999). Early clinical trials involving immunization of patients with dendritic cells are now in progress. These trials show considerable variation as to the source of these cells and their route of administration, although all are based on an immunization strategy (MulĂŠ, 2000). Little 166


Cancer Therapy Vol 1, page 167 information is available about TIDC use in cell-based local therapies. An indirect approach is based on injection into tumors of gene-modified TIDC expressing IFN-". This chemoattractant promotes a sustained T cell influx into the tumor mass, potentially improving therapeutic efficacy (Kirk et al, 2001). Zou et al, (2001) defined a dendritic cell subpopulation specifically recruited to the tumor microenvironment, and reported that local regeneration or proliferation were not important mechanisms for accumulation. They also suggested a role for VLA-5 in migration to tumor tissue, and speculated that SDF-1 may be the major tumor-related chemoattractant for dendritic cells. This dendritic cell subpopulation may thus be a good candidate for loading with therapeutic agents to target the tumor microenvironment.

C. Stem cells Pluripotent stem cells, derived from human fetal tissues, have the ability to differentiate into almost any cell type found in embryonic germ layers. It was believed until recently that adult organ-specific stem cells were lineagerestricted, but recent studies have questioned this idea, and multipotent stem cells have been found in many adult tissues (Preston et al, 2003). Several groups have reported that some stem cells can target tumors and differentiate into diverse cell types, particularly into blood vessel endothelial cells (Carmeliet, 2003). Tumor growth requires neovascularization, and tumors thus promote remodeling of pre-existing capillaries and mobilization of bone marrow-derived cells through secretion of VEGF and other angiogenic factors (Bergens and Benjamin, 2003). As there are few active angiogenesis sites in a healthy adult, this capacity to home to the tumor site could be used to deliver therapeutic agents following ex vivo manipulation of adult stem cells. Endothelial progenitor cells (EPC) are highly proliferative cells derived from bone marrow; at difference from mature, differentiated circulating endothelial cells, they are incorporated into new tumor vessels (Asahara et al, 1999). Certain hematopoietic cell subsets also contribute to angiogenesis. Human bone marrow-derived EPC, inoculated into tumor-bearing immunodeficient mice, were detected in newly-formed tumor vessels, although with considerable variation among animals. This finding provides additional justification for the use of EPC and/or bone marrow stem cells as carriers in cell-based anti-tumor strategies. This approach has been used by several groups to express angiogenesis inhibitors or suicide genes in mouse models; they inhibited tumor growth and prolonged animal survival (Rafii et al, 2002; Ferrari et al, 2003). A conditioning regime (such as bone marrow transplantation), nonetheless, seems to be necessary for the success of the experiments (Lyden et al, 2001), probably because irradiation suppresses endogenous EPC and/or enhances EPC uptake into tumor vasculature. De Palma et al, (2003) recently reported a bone marrow-derived population that homes to tumors and interacts closely with vascular endothelial cells. This population was termed Tie-2-expressing mononuclear (TEM) cells, as their description is based on expression of a marker gene directed by a Tie-2 promoter. After transplant of hematopoietic cells transduced with Tie-2 promoter-lentiviral vectors, several tumors were injected and their angiogenesis analyzed. TEM expressed CD45 and CD11b, and were associated with small blood vessels assembled into a stromal framework in close association with endothelial cells. Finally, TEM were transduced with a suicide gene; tumor-bearing animals treated with the pro-drug showed delayed tumor appearance and slower tumor growth (De Palma et al, 2003). TEM cells thus appear to be a suitable vehicle for tumor-directed cell therapy. Mesenchymal stem cells (MSC) are the progenitors of several mesenchymal lineages, are present in various tissues and can be expanded in culture without losing their

B. Tumor cells The use of tumor cells as anti-tumor agents is based on several observations suggesting their potential utility. In their respective models, Coukos et al, (1999) and Namba et al, (1998) reported that infused tumor cells bind preferentially to tumor masses of the same histological type. When they loaded a tumor cell carrier line with a therapeutic vector, significant reduction of pre-existing tumor size was observed, although their models were based on tumors implanted in localized areas such as brain and peritoneal cavity. Some researchers have developed a model of spontaneous metastasis, with which they hypothesized that intravenously (IV) injected tumor cells would home to the organs with metastases (Garc_a-Castro et al, unpublished data). Metastases arise from local growth of malignant cells that have separated from the primary tumor, reached the blood and/or the lymphatic circulation and localized in distant organs. In this process, tumor cells traveling in the bloodstream respond to factors produced by or present in the different organs, an interaction that results in a specific metastatic pattern for each tumor. Genetically transduced tumor cells injected IV localize in pre-existing metastatic lesions, and demonstrated that cells carrying an antitumor agent such as a suicide gene or an oncolytic virus could deliver a localized therapeutic effect with negligible systemic toxicity. In vitro experiments using three-dimensional matrices suggested that invading tumor cells leave signals in their wake that drive migration of other cancer cells into the matrix (Horino et al, 2001). It is interesting that the cells following the invasive front in the matrices had a non-invasive phenotype. Tumor cells injected IV would thus participate in this interaction with the microenvironment, and target invading metastases independently of their invasive capacity. Although our experiments were performed with autologous tumor cells, it is possible that the cell carrier could be non-autologous to the patient, and a standard tumor cell line could be even developed with the aim of simplifying use in clinical trials.

167


GarcĂ­a-Castro et al: Antitumoral cell-based therapies phenotype or multilineage potential (Minguell et al, 2001) (Figure 3). Although MSC are currently recovered from bone marrow, they are distinct from hematopoietic stem cells and have a different expression marker profile. Moreover, MSC can be isolated from muscle, cord blood, cartilage or adipose tissue (Young et al, 2001; Zuk et al, 2001). MSC can be used in therapeutic strategies, as they can target organs (especially when implicated in pathological cases) and are easily transduced with viral vectors. In vivo transgene expression was reported following transplant of retrovirally transduced MSC (Deans and Moseley, 2000). Studeny et al, (2002) reported that when MSC were administered IV into mice with melanoma, these cells were detected inside tumors as stromal fibroblasts. In addition, survival was prolonged when engineered MSC were induced to secrete IFN!. There is a pluripotent cell population that co-purifies with MSC, termed multipotent adult progenitor cells (MAPC). A single MAPC injected into an early blastocyst contributes to mesodermic, neuroectodermic and endodermic tissues (Jiang et al, 2002). MAPC are able to differentiate into endothelial cells in vitro and in vivo. In vitro-generated MAPC-derived endothelial cells respond

to angiogenic stimuli by migrating to tumor sites and contributing to tumor vascularization (Reyes et al, 2002). These characteristics indicate that both MSC and MAPC could thus be used as therapeutic carriers to express antitumor factors at the site of neoplasms. Pharmacological agents for tumors derived from cells of the central nervous system must cross the blood-brain barrier; due to the immune-privileged nature of this tissue, the use of cellular vehicles might overcome this problem. Previous studies using fibroblasts, myoblasts, macrophages and endothelial cells (Schinstine et al, 1991; Jiao et al, 1992; Messina et al, 1992, Lal et al, 1994) encountered specific problems, as they were limited to the injection site due to the lack of motility or potential physiology problems because they are not normal brain components. Nonetheless, a new strategy using neural stem cells (NSC) has recently been reported. NSC have exceptional migratory ability; Aboody et al, (2000) showed that NSC can target invasive primary brain tumors, a behavior not displayed by cells of non-neural origin.

Figure 3. Differentiation potential of mesenchymal stem cells. (A) Mesenchymal stem cells (MSC) have the capacity to differentiate, at least, into osteoblasts, chrondoblast, myoblast, adipocytes and neurons when they are cultured in the induction medium and certain substances are added. (B) Appearance of human bone marrow-derived MSC after several days of culture. (C) Oil Red staining of human MSC after two weeks of culture in adipogenic differentiation medium. Lipid droplets are staining in red. (D) Alkaline phosphatase detection (in red), indicating an osteogenic differentiation of human MSC.

168


Cancer Therapy Vol 1, page 169 (1999) Use of carrier cells to deliver a replication-selective herpes simplex virus-1 mutant for the intraperitoneal therapy of epithelial ovarian cancer. Clin Cancer Res 5, 1523-1537. Chung S, Wucherpfennig KW, Friedman SM, Hafler DA and Strominger JL (1994) 654-8. Functional three-domain singlechain T-cell receptors. Proc Natl Acad Sci USA 91, 12. Deans RJ and Moseley AB (2000) Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 28, 875884.

These authors also showed reduction of established tumors when suicide gene-transduced NSC were used as a therapeutic approach. NSC also appear to follow infiltrating tumor cells that escape from normal tissue, although no reports have yet described the possibility that NSC injected into systemic circulation target intracerebral tumors. Herrlinger et. al, (2000) used replicationconditional vectors to transduce NSC and observed distribution throughout a glioma tumor. These studies thus indicated that NSC may provide a powerful cell-based antitumor therapy.

deMagalhaes-Silverman M, Donnenberg A, Lembersky B, Elder E, Lister J, Rybka W, Whiteside T and Ball E (2000) Posttransplant adoptive immunotherapy with activated natural killer cells in patients with metastatic breast cancer. J Immunother 23, 154-160.

III. Conclusions

De Palma M, Venneri MA, Roca C and Naldini L (2003) Targeting exogenous genes to tumor angiogenesis by transplantation of genetically modified hematopoietic stem cells. Nat Med 9, 789-795. Economou JS, Belldegrun AS, Glaspy J, Toloza EM, Figlin R, Hobbs J, Meldon N, Kaboo R, Tso CL, Miller A, Lau R, McBride W and Moen RC (1996) In vivo trafficking of adoptively transferred interleukin-2 expanded tumorinfiltrating lymphocytes and peripheral blood lymphocytes. Results of a double gene marking trial. J Clin Invest 97, 515-21. Ferrari N, Glod J, Lee J, Kobiler D and Fine HA (2003) Bone marrow-derived, endothelial progenitor-like cells as angiogenesis-selective gene-targeting vectors. Gene Ther 10, 647-566. Fidler IJ (1985) Macrophages and metastasis--a biological approach to cancer therapy. Cancer Res. 45, 4714-4726.

The use of cells as carriers for antitumor agents is a very attractive therapeutic strategy, although many aspects of this approach remain to be elucidated. Further knowledge is, nonetheless, needed of specific tumortargeting mechanisms and the in vivo physiological behavior of in each carrier cell type. Preclinical researchers must define the properties of these cells and find ways of manipulating them to produce a clinically appropriate outcome. Quality control is necessary in the manufacturing process as well as of the final product. Clinicians will need to adapt therapeutic regimens in accordance with the biology of these cells, their route of administration and the dose to be employed. In conclusion, within a few years these â&#x20AC;&#x153;Trojan horseâ&#x20AC;? cells may offer an alternative therapeutic strategy for certain tumor types.

Fox BA and Rosenberg SA (1989) Heterogeneous lymphokineactivated killer cell precursor populations. Development of a monoclonal antibody that separates two populations of precursors with distinct culture requirements and separate target-recognition repertoires. Cancer Immunol Immunother 29, 155-166.

References Aboody KS, Brown A, Rainov NG, Bower KA, Liu S, Yang W, Small JE, Herrlinger U, Ourednik V, Black PM, Breakefield XO and Snyder EY (2000) Neural stem cells display extensive tropism for pathology in adult brain: evidence from intracranial gliomas. Proc Natl Acad Sci USA 97, 1284612851.

Galanis E, Vile R and Russell SJ (2001) Delivery systems intended for in vivo gene therapy of cancer: targeting and replication competent viral vectors. Crit Rev Oncol Hematol 38, 177-192. Goerdt S, Politz O, Schledzewski K, Birk R, Gratchev A, Guillot P, Hakiy N, Klemke CD, Dippel E, Kodelja V and Orfanos CE (1999) Alternative versus classical activation of macrophages. Pathobiology 67, 222-226.

Asahara T, Masuda H, Takahashi T, Kalka C, Pastore C, Silver M, Kearne M, Magner M and Isner JM (1999) Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85, 221-228. Basse PH, Whiteside TL and Herberman RB (2000) Use of activated natural killer cells for tumor immunotherapy in mouse and human. Methods Mol Biol 121, 81-94. Bell D, Chomarat P, Broyles D, Netto G, Harb GM, Lebecque S, Valladeau J, Davoust J, Palucka KA, Banchereau J (1999) In breast carcinoma tissue, immature dendritic cells reside within the tumor, whereas mature dendritic cells are located in peritumoral areas. J Exp Med 190, 1417-1426. Bergers G and Benjamin LE (2003) Angiogenesis: Tumorigenesis and the angiogenic switch. Nat Rev Cancer 3, 401-410.

Goverman J, Gomez SM, Segesman KD, Hunkapiller T, Laug WE and Hood L (1990) Chimeric immunoglobulin-T cell receptor proteins form functional receptors: implications for T cell receptor complex formation and activation. Cell 60, 929-939. Greten TF and Jaffee EM (1999) Cancer vaccines. J Clin Oncol 17, 1047-1060. Griffiths L, Binley K, Iqball S, Kan O, Maxwell P, Ratcliffe P, Lewis C, Harris A, Kingsman S, Naylor S (2000) The macrophage - a novel system to deliver gene therapy to pathological hypoxia. Gene Ther 7, 255-262.

Brocker T, Riedinger M and Karjalainen K (1996) Redirecting the complete T cell receptor/CD3 signaling machinery towards native antigen via modified T cell receptor. Eur J Immunol 26, 1770-1774. Carmeliet P (2003) Angiogenesis in health and disease. Nat Med 9, 653-660. Coukos G, Makrigiannakis A, Kang EH, Caparelli D, Benjamin I, Kaiser LR, Rubin SC, Albelda SM and Molnar-Kimber KL

Herrlinger U, Woiciechowski C, Sena-Esteves M, Aboody KS, Jacobs AH, Rainov NG, Snyder EY and Breakefield XO (2000) Neural precursor cells for delivery of replicationconditional HSV-1 vectors to intracerebral gliomas. Mol Ther 1, 347-357. Hombach A, Jung W, Pohl C, Renner C, Sahin U, Schmits R, Wolf J, Kapp U, Diehl V and Pfreundschuh M (1993) A CD16/CD30 bispecific monoclonal antibody induces lysis of

169


GarcĂ­a-Castro et al: Antitumoral cell-based therapies Hodgkin's cells by unstimulated natural killer cells in vitro and in vivo. Int J Cancer 55, 830-836. Hombach A, Heuser C and Abken H (2002) The recombinant T cell receptor strategy: insights into structure and function of recombinant immunoreceptors on the way towards an optimal receptor design for cellular immunotherapy. Curr Gene Ther 2, 211-226.

the intact capillary wall in the rat. Proc Natl Acad Sci USA 89, 12018-12022. Minguell JJ, Erices A and Conget P (2001) Mesenchymal stem cells. Exp Biol Med 226, 507-520. Mukai S, Kjaergaard J, Shu S and Plautz GE (1999) Infiltration of tumors by systemically transferred tumor-reactive T lymphocytes is required for antitumor efficacy. Cancer Res 59, 5245-5249. Mule JJ (2000) Dendritic cells: at the clinical crossroads. J Clin Invest 105, 707-708 Namba H, Tagawa M, Iwadate Y, Kimura M, Sueyoshi K and Sakiyama S (1998) Bystander effect-mediated therapy of experimental brain tumor by genetically engineered tumor cells. Hum Gene Ther 9, 5-11.

Horino K, Kindezelskii AL, Elner VM, Hughes BA and Petty HR (2001) Tumor cell invasion of model 3-dimensional matrices: demonstration of migratory pathways, collagen disruption, and intercellular cooperation. FASEB J 15, 932939. Hurwitz AA, Kwon ED and van Elsas A (2000) Costimulatory wars: the tumor menace. Curr Opin Immunol 12, 589-596. Jain RK (2001) Delivery of molecular medicine to solid tumors: lessons from in vivo imaging of gene expression and function. J Control Release 74, 7-25.

Oberling F (1997) Monocyte/macrophages as effector cells in cancer immunotherapy. Transfus Sci 18, 243-250. Ohno S, Inagawa H, Soma G and Nagasue N (2002) Role of tumor-associated macrophage in malignant tumors: should the location of the infiltrated macrophages be taken into account during evaluation? Anticancer Res 22, 4269-4275. Oppenheimer-Marks N, Davis LS and Lipsky PE (1990) Human T lymphocyte adhesion to endothelial cells and transendothelial migration. Alteration of receptor use relates to the activation status of both the T cell and the endothelial cell. J Immunol 145, 140-148. Phillips JH, Gemlo BT, Myers WW, Rayner AA and Lanier LL (1987) In vivo and in vitro activation of natural killer cells in advanced cancer patients undergoing combined recombinant interleukin-2 and LAK cell therapy. J Clin Oncol 5, 19331941.

Jiang Y, Jahagirdar BN, Reinhardt RL, Schwartz RE, Keene CD, Ortiz-Gonzalez XR, Reyes M, Lenvik T, Lund T, Blackstad M, Du J, Aldrich S, Lisberg A, Low WC, Largaespada DA and Verfaillie CM (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, 41-49. Jiao S, Schultz E and Wolff JA (1992) Intracerebral transplants of primary muscle cells: a potential 'platform' for transgene expression in the brain. Brain Res 575, 143-147. Kimura H and Yamaguchi Y (1997) A phase III randomized study of interleukin-2 lymphokine-activated killer cell immunotherapy combined with chemotherapy or radiotherapy after curative or noncurative resection of primary lung carcinoma. Cancer 80, 42-49. Kirk CJ, Hartigan-O'Connor D, Mule JJ (2001) The dynamics of the T-cell antitumor response: chemokine-secreting dendritic cells can prime tumor-reactive T cells extranodally. Cancer Res 6, 8794-8802. Lal B, Indurti RR, Couraud PO, Goldstein GW and Laterra J (1994) Endothelial cell implantation and survival within experimental gliomas. Proc Natl Acad Sci USA 91, 96959699.

Preston SL, Alison MR, Forbes SJ, Direkze NC, Poulsom R and Wright NA (2003) The new stem cell biology: something for everyone. Mol Pathol 56, 86-96. Rafii S, Lyden D, Benezra R, Hattori K and Heissig B (2002) Vascular and haematopoietic stem cells: novel targets for anti-angiogenesis therapy? Nat Rev Cancer 2, 826-835. Randolph GJ, Inaba K, Robbiani DF, Steinman RM, Muller WA (1999) Differentiation of phagocytic monocytes into lymph node dendritic cells in vivo. Immunity 11, 753-7561. Reyes M, Dudek A, Jahagirdar B, Koodie L, Marker PH and Verfaillie CM (2002) Origin of endothelial progenitors in human postnatal bone marrow. J Clin Invest 109, 337-346.

Lister J, Rybka WB, Donnenberg AD, deMagalhaes-Silverman M, Pincus SM, Bloom EJ, Elder EM, Ball ED and Whiteside TL (1995) Autologous peripheral blood stem cell transplantation and adoptive immunotherapy with activated natural killer cells in the immediate posttransplant period. Clin Cancer Res 1, 607-614.

Rosenberg SA, Yannelli JR, Yang JC, Topalian SL, Schwartzentruber DJ, Weber JS, Parkinson DR, Seipp CA, Einhorn JH and White DE (1994) Treatment of patients with metastatic melanoma with autologous tumor-infiltrating lymphocytes and interleukin 2. J Natl Cancer Inst 86, 11591166. Schinstine M, Kawaja MD and Gage FH (1991) Intracerebral delivery of growth factors: potential application of genetically modified fibroblasts. Prog Growth Factor Res 3, 57-66.

Lyden D, Hattori K, Dias S, Costa C, Blaikie P, Butros L, Chadburn A, Heissig B, Marks W, Witte L, Wu Y, Hicklin D, Zhu Z, Hackett NR, Crystal RG, Moore MA, Hajjar KA, Manova K, Benezra R and Rafii S (2001) Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth. Nat Med 7, 1194-11201. Mareel M, Leroy A (2003) Clinical, cellular, and molecular aspects of cancer invasion. Physiol Rev 83, 337-376. Melder RJ, Rosenfeld CS, Herberman RB and Whiteside TL (1989) Large-scale preparation of adherent lymphokineactivated killer (A-LAK) cells for adoptive immunotherapy in man. Cancer Immunol Immunother 29, 67-73. Melder RJ, Kristensen CA, Munn LL and Jain RK (2001) Modulation of A-NK cell rigidity: In vitro characterization and in vivo implications for cell delivery. Biorheology 38, 151-159.

Sogn JA (1998) Tumor immunology: the glass is half full. Immunity 9, 757-763. Stetler-Stevenson WG, Liotta LA, Kleiner DE Jr (1993) Extracellular matrix 6: role of matrix metalloproteinases in tumor invasion and metastasis. FASEB J. 7, 1434-1441. Studeny M, Marini FC, Champlin RE, Zompetta C, Fidler IJ and Andreeff M (2002) Bone marrow-derived mesenchymal stem cells as vehicles for interferon-beta delivery into tumors. Cancer Res 62, 3603-3608.

Messina LM, Podrazik RM, Whitehill TA, Ekhterae D, Brothers TE, Wilson JM, Burkel WE and Stanley JC (1992) Adhesion and incorporation of lacZ-transduced endothelial cells into

van de Winkel JG, Bast B and de Gast GC (1997) Immunotherapeutic potential of bispecific antibodies.

170


Cancer Therapy Vol 1, page 171 Immunol Today 18, 562-574. Viti F, Giovannoni L and Neri D (2002) Recombinant antibodies for the selective targeting of tumor neovasculature. Curr Opin Drug Discov Devel 5, 204-213.

K, Thomas K, Austin T, Edwards C, Cuzzourt J, Duenzl M, Lucas PA and Black AC Jr (2001) Human reserve pluripotent mesenchymal stem cells are present in the connective tissues of skeletal muscle and dermis derived from fetal, adult, and geriatric donors. Anat Rec 264, 51-62.

Weiner LM, Alpaugh RK and von Mehren M (1997) Redirected cellular cytotoxicity employing bispecific antibodies and other multifunctional binding proteins. Cancer Immunol Immunother 45, 190-192. Whiteside TL, Vujanovic NL and Herberman RB (1998) Natural killer cells and tumor therapy. Curr Top Microbiol Immunol 230, 221-244.

Zou W, Machelon V, Coulomb-L'Hermin A, Borvak J, Nome F, Isaeva T, Wei S, Krzysiek R, Durand-Gasselin I, Gordon A, Pustilnik T, Curiel DT, Galanaud P, Capron F, Emilie D, Curiel TJ (2001) Stromal-derived factor-1 in human tumors recruits and alters the function of plasmacytoid precursor dendritic cells. Nat Med. 7:1339-1346. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP and Hedrick MH (2001) Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7, 211-228.

Yano T, Sugio K, Yamazaki K, Kase S, Yamaguchi M, Ondo K, Yoshino I and Sugimachi K (1999) Postoperative adjuvant adoptive immunotherapy with lymph node-LAK cells and IL-2 for pathologic stage I non-small cell lung cancer. Lung Cancer 26, 143-148. Young HE, Steele TA, Bray RA, Hudson J, Floyd JA, Hawkins

171


GarcĂ­a-Castro et al: Antitumoral cell-based therapies

172


Cancer Therapy Vol 1, page 173 Cancer Therapy Vol 1, 173-178, 2003.

Can mortalin be a candidate target for cancer therapy? Review Article

Renu Wadhwa*, Kazunari Taira and Sunil C Kaul National Institute of Advanced Industrial Science & Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan

__________________________________________________________________________________ *Correspondence: Renu Wadhwa, Gene Function Research Center, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8562, Japan; Phone: +81 29 861 9464; Fax: +81 29 861 3019, e-mail: renuwadhwa@aist.go.jp Key Words: mortalin, localization, p53, inactivation, tumors, therapy Received: 29 July 2003; Accepted: 27 August 2003; electronically published: August 2003

Summary Differential staining pattern of mortalin (mot-2/mthsp70/PBP74/GRP75) is a reliable marker for normal and cancerous phenotype of cells. It is an essential protein, sojourns multiple subcellular sites while residing predominantly in mitochondria. It has multiple binding partners and performs multiple functions including mitochondrial import, intracellular trafficking, receptor internalization and inactivation of the tumor suppressor protein p53. The present article updates our understanding on its functions in cellular senescence and immortalization and proposes its use as a target for cancer therapy. alleles in mouse (Kaul et al, 2000b). The mot-1 cDNA encoding the pancytoplasmic form of mouse mortalin when introduced into NIH 3T3 cells induced cellular senescence like phenotype in these cells (Wadhwa et al, 1993c). In contrast, the mot-2 cDNA that encoded perinuclear protein resulted in malignant transformation of NIH 3T3 cells (Kaul et al, 1998). Differential cellular distribution of mortalin in normal and transformed cells was also endorsed by human system. In more than 50 different human immortal cell lines examined, mortalin was observed as nonpancytoplasmically distributed (Wadhwa et al, 1995) (Figure 1) in contrast to the normal cells that showed pancytoplasmic staining. Cloning and analyses of mortalin cDNA from normal and transformed human cells, however, revealed no significant difference (Kaul et al, 1998) proposing that there are, at least, two mechanisms operating for differential distribution of mortalin in normal and transformed cells. One is by distinct cDNAs, mot-1 and mot-2, and is found in mouse. The other may involve protein modifications, binding partners or other cellular factors and operates in mouse and human. Such mechanism(s) remains to be elucidated. Human mortalin cDNA clone when expressed in mouse immortal cells led to their malignant transformation similar to the one caused by mouse mot-2 cDNA. Both mouse mot-2 cDNA and human mortalin also led to lifespan extension of normal human fibroblasts (Kaul et al, 2000a). Based on these functional data, human mortalin cDNA was called hmot-2 and its overexpression was suggested to have proproliferative function.

I. Introduction Mortalin is a member of hsp70 family of proteins. It was first cloned from the cytoplasmic fraction of normal mouse fibroblasts; the immortal cells lack this protein in their cytoplasmic fraction (Wadhwa et al, 1993a). Subsequently, by immunostaining its differential subcellular distribution was recognized in normal and immortal mouse cells (Wadhwa et al, 1993b). A large variety of human normal and immortal cells were demonstrated to have pancytoplasmic and perinuclear cellular distribution of mortalin, respectively. As discussed below, its mutliple subcellular sites and binding partners signify its multiple roles, some of which are crucial for continued proliferation of cells.

II. Cancerous mouse and human cells lack the pancytoplasmic distribution of mortalin Immunostaining of normal and immortal cells with a mortalin specific antibody revealed that it is widely distributed in the cytoplasm of normal cells and is restricted to the perinuclear region in immortal mouse cells. cDNAs encoding the cytoplasmically distributed protein (mot-1) and the perinuclear protein (mot-2) were cloned from normal and immortal mouse fibroblasts, respectively (Wadhwa et al, 1993c). These were shown to be different by two amino acids (Wadhwa et al, 1993c), have contrasting biological activity and coded by two

173


Wadhwa et al: Can mortalin be a candidate target for cancer therapy?

Figure 1. Mortalin immunostaining in normal (skin fibroblasts, TIG-1) and transformed (osteogenic sarcoma, U2OS) human cells.

antibodies in a variety of cell lines revealed its existence in multiple subcellular sites that includes mitochondria, endoplasmic reticulum, cytoplasmic vesicles and cytosol (Dahlseid et al, 1994; Domanico et al, 1993; Poindexter et al, 2002; Ran et al, 2000; Singh et al, 1997; Soltys and Gupta, 1999, 2000; Wadhwa et al, 1995; Webster et al, 1994). These data suggest its involvement in multiple cellular functions. In support to its localization at multiple subcelluar sites, mortalin was shown to bind to residents of different organelles by a variety of protocols. Far-western screening identified glucose regulated ER chaperone (GRP94) as one of its binding partners. Mortalin-GRP94 interactions were confirmed by mammalian two-hybrid assays, in vitro and in vivo coimmunoprecipitations (Takano et al, 2001). Mortalin was also isolated as FGF-1 binding protein by FGF-1 affinity chromatography and was shown to aid in its intracellular trafficking (Mizukoshi et al, 1999), mediated by its cell cycle specific phosphorylation (Mizukoshi et al, 2001). ATP-sensitive association of mortalin with IL-1 receptor type was also detected and predicted to have a role in receptor internalization (Sacht et al, 1999). Yeast interactive screen for mortalin binding proteins isolated the mitochondrial proteins hsp60, NADH dehydrogenase, Tim44, Tim23 (unpublished data) and the peroxisomal protein MPD (Wadhwa et al, 2003a) as its binding partners. It appears that mortalin routes through multiple subcellular sites and thus interacts with different proteins therein. Recently, it has been recognized that protein distribution in a cell is more dynamic than was earlier thought. Many other proteins have been detected in subcellular localizations that were considered foreign previously (Soltys and Gupta, 1996, 1997, 1999). The studies warrant further analyses to elucidate the kinetics of mortalin binding to its binding partners, their temporal and special relevance to cellular mortal, immortal and stressed phenotypes including apoptosis.

Subcellular distribution of mortalin shifted from the perinuclear to the pancytoplasmic type when cancerous cells were induced to senescence. For example, introduction of human chromosome 7 to carcinogentransformed liver fibroblasts (SUSM-1) resulted in their senescence in culture as determined by their proliferation, senescence associated !-gal activity. The senescent cells showed pancytoplasmic distribution of mortalin (Nakabayashi et al, 1999). In a similar approach when chromosome-fragments and genes from human chromosome 4 were introduced into cervical carcinoma (HeLa) cells, resulted in an induction of senescence phenotype that was accompanied by a shift in the subcellular distribution of mortalin from a perinuclear to pancytoplasmic type (Bertram et al, 1999). Induction of senescence like growth arrest by bromodeoxyuridine (Michishita et al, 1999) or MKT-077 (a rhodacyanine dye that is selectively toxic to cancer cells) also caused shift of subcellular distribution of mortalin from perinuclear to pancytoplasmic type, characteristic of normal cells (Wadhwa et al, 2000). On the other hand, Simian Virus 40 large T antigen (SV40 LTAg) - induced cellular transformation of human lung fibroblast (MRC-5) cells resulted in shift of pancytoplasmic mortalin staining in normal cells to the nonpancytoplasmic staining in its immortal derivatives. Taken together, these studies showing the absence of pancytoplasmic mortalin staining pattern in cancerous cells have assigned mortalin staining as a reliable marker of cellular normal and transformed phenotypes.

III. Multiple subcellular sites and binding partners of mortalin Mortalin is a highly conserved member of hsp70 family of proteins. It was also cloned as a peptide binding protein (PBP74) (Dahlseid et al, 1994; Domanico et al, 1993), mitochondrial heat shock protein 70 (mthsp70) (Bhattacharyya et al, 1995) glucose regulated protein 75 (GRP75) (Webster et al, 1994) and was found in multiple subcellular sites by a variety of protocols. Confocal laser microscopy of the native protein with protein-specific

174


Cancer Therapy Vol 1, page 175 of these include breast carcinomas, glioblastomas and teratocarcinomas.

IV. Mortalin-p53 interactions and p53 function Mortalin binds to p53 in transformed human cells (Wadhwa et al, 1998). These interactions result in cytoplasmic sequestration of p53 and inhibition of its transcriptional inactivation function (Wadhwa et al, 1998; 2002b). Such inactivation of p53 function could account for lifespan extension of normal human cells. Recently, it has been shown that telomerase in cooperation with mortalin could accelerate the immortalization of normal human cells (Kaul et al, 2003). Binding studies using deletion mutants have demonstrated that an N-terminal region of mortalin binds to the C-terminus of p53, previously shown to be involved in cytoplasmic sequestration of p53 (Kaul et al, 2001; Moll et al, 1992; Wadhwa et al, 2002b). Most recently, it has been shown that p53 also exists in the mitochondria (also a predominant localization of mortalin) and interacts with mortalin/mthsp70, Bcl-2 and hsp60 (Dumont et al, 2003; Mihara et al, 2003) and these interactions are involved in p53-mediated apoptosis by a pathway independent to its nuclear function. In this scenario, if mortalin could interfere with the p53-Bcl-2 interactions it may act as an antiapoptotic factor (Figure 2). Such possibilities remain to be tested. On the other hand, abrogation of moratlin-p53 interaction by a cationic rhodacyanine dye analogue (MKT-077) resulted in nuclear translocation and reactivation of p53 function sufficient to cause growth arrest of transformed human cells (Wadhwa et al, 2000; 2002a). In tumors with wild type p53, the abrogation of mortalin-p53 interactions and reactivation of p53 function could be valid for cancer therapy. Most common examples

V. Mortalin functions other than p53 inactivation Expression of mortalin could be suppressed in malignant human fibroblasts using specifically designed active hammerhead ribozymes. The cells with decreased expression of mortalin undergo growth arrest and show reactivation of wild type p53 function (Wadhwa et al, 2003b). However, the cells that lack p53 function also experienced growth arrest suggesting that mortalin is involved in functions other than p53 inactivation and are crucial for continued proliferation of cancerous cells. One possibility could be due to its role as mitochondrial importer as demonstrated in yeast with its homologue, SSC1p. The yeast homologue of mortalin, SSC1p, was shown to be vital for mitochondrial import (Geissler et al, 2001; Krimmer et al, 2000) and its knock-out resulted in cell death (Craig et al, 1989). SSC1p was shown to bind to Tim-44, an inner mitochondrial membrane anchor, and forms an essential component of mitochondrial import machinery (Krimmer et al, 2000; Strub et al, 2001). Other proposed functions of SSC1p include unfolding of proteins outside mitochondria, unidirectional translocation across mitochondrial membranes initiated by membrane potential M"#, completion of import by acting as an ATP-driven motor and degradation of misfolded peptides by m-AAA and PIM1 proteases in mitochondria (Lim et al, 2001; Liu et al, 2001). These functions may be critical for continued proliferation of cancerous cells and thus targeting of mortalin may arrest the growth of these cells.

Figure 2. Predictive anti-apoptotic function of mortalin. Its interaction with p53 in mitochondria may lead to abrogation of p53-Bcl-2 association resulting in maintenance of anti-apoptotic functioning of Bcl-2 protein.

175


Wadhwa et al: Can mortalin be a candidate target for cancer therapy? protein family, is a mitochondrial protein. Mol Biol Cell 5, 1265-1275. Domanico SZ, DeNagel DC, Dahlseid JN, Green JM, Pierce SK (1993) Cloning of the gene encoding peptide-binding protein 74 shows that it is a new member of the heat shock protein 70 family. Mol Cell Biol 13, 3598-3610. Dumont P, Leu JI, Della Pietra AC, George DL, Murphy M (2003) The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet 33, 357365. Geissler A, Rassow J, Pfanner N, Voos W (2001) Mitochondrial import driving forces: enhanced trapping by matrix hsp70 stimulates translocation and reduces the membrane potential dependence of loosely folded preproteins. Mol Cell Biol 21, 7097-7104. Ibi T, Sahashi K, Ling J, Marui K, Mitsuma T (1996). [Immunostaining of mitochondrial heat shock proteins (mtHSPs) in skeletal muscle fibers of mitochondrial cytopathy]. Rinsho Shinkeigaku Clinical Neurol 36, 61-64. Kaul SC, Duncan EL, Englezou A, Takano S, Reddel RR, Mitsui Y, Wadhwa R (1998) Malignant transformation of NIH3T3 cells by overexpression of mot-2 protein. Oncogene 17, 907911. Kaul SC, Reddel RR, Sugihara T, Mitsui Y, Wadhwa R (2000a). Inactivation of p53 and life span extension of human diploid fibroblasts by mot-2. FEBS Lett 474, 159-164. Kaul SC, Duncan E, Sugihara T, Reddel RR, Mitsui Y, Wadhwa R (2000b) Structurally and functionally distinct mouse hsp70 family members mot-1 and mot-2 proteins are encoded by two alleles. DNA Res 7, 229-231. Kaul SC, Reddel RR, Mitsui Y, Wadhwa R (2001) An Nterminal region of mot-2 binds to p53 in vitro. Neoplasia 3, 110-114. Kaul SC, Yaguchi T, Taira K, Reddel RR, Wadhwa R (2003). Overexpressed mortalin (mot-2)/mthsp70/GRP75 and hTERT cooperate to extend the in vitro lifespan of human fibroblasts. Exp Cell Res 286, 96-101. Krimmer T, Rassow J, Kunau WH, Voos W, Pfanner N (2000) Mitochondrial protein import motor: the ATPase domain of matrix hsp70 is crucial for binding to Tim44, while the peptide binding domain and the carboxy-terminal segment play a stimulatory role. Mol Cell Biol 20, 5879-5887. Lim JH, Martin F, Guiard B, Pfanner N, Voos W (2001) The mitochondrial Hsp70-dependent import system actively unfolds preproteins and shortens the lag phase of translocation. EMBO J 20, 941-950. Liu Q, Krzewska J, Liberek K, Craig EA (2001) Mitochondrial Hsp70 Ssc1: role in protein folding. J Biol Chem 276, 61126118. Marchenko ND, Zaika A, Moll UM (2000) Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J Biol Chem 275, 16202-16212. Merrick BA, Pence PM, He C, Patterson RM, Selkirk JK (1995) Phosphor image analysis of human p53 protein isoforms. Biotechniques 18, 292-299. Michishita E, Nakabayashi K, Suzuki T, Kaul SC, Ogino H, Fujii M, Mitsui Y, Ayusawa D (1999) 5-Bromodeoxyuridine induces senescence-like phenomena in mammalian cells regardless of cell type or species. J Biochem 126, 10521059. Mihara M, Erster S, Zaika A, Petrenko O, Chittenden T, Pancoska P, Moll UM (2003) p53 has a direct apoptogenic role at the mitochondria. Mol Cell 11, 577-590.

Independent studies have assigned multiple functions to mortalin. They range from stress response (Craig et al, 1998; Merrick et al, 1995; Sadekova et al, 1997; Carette et al 2002; Resendez et al, 1986; Schneider and Hood, 2000; Wu et al, 1999), muscle activity (Ibi et al, 1996), mitochondrial biogenesis (Ornatsky et al, 1995; Takahashi et al, 1998), intracellular trafficking (Mizukoshi et al, 1999; 2001; Sacht et al, 1999), antigen processing (Domanico et al, 1993), control of cell proliferation (Kaul et al, 1998; 2000a), differentiation (Xu et al, 1999), fate determination (Rivolta and Holley, 2002), tumorigenesis (Bini et al, 1997; Kaul et al, 1998; Takahashi et al, 1994; Takano et al, 1997) and apoptosis (Marchenko et al, 2000; Taurin et al, 2002; Dumont et al, 2003; Mihara et al, 2003). As expected, an overexpression of mortalin and accentuation of such functions may impart growth or proliferative advantage to cells. Comparative studies on the expression level of mortalin in normal and tumor cells indeed revealed its upregulation in tumors and its decrease during replicative senescence of fibroblasts (unpublished observations). Complete understanding of its various functions and their precise contribution to normal and cancerous phenotypes warrant further studies. Nevertheless there is an evidence showing that the abrogation of one or more functions of mortalin may compromise cell proliferation and thus could serve as a cancer therapeutic tool. The next challenge is to validate this therapeutic approach by analyzing the expression of mortalin in a variety of clinical tumor tissues and to unravel ways to target these functions specifically in cancerous cells without affecting normal cells.

References Bertram MJ, Berube NG, Swanson XH, Pereira-Smith OM (1999) Assembly of a BAC contig of the complementation group B cell senescence gene candidate region at 4q33-q34.1 and identification of expressed sequences. Genomics 56, 353-354. Bini L, Magi B, Marzocchi B, Arcuri F, Tripodi S, Cintorino M, Sanchez JC, Frutiger S, Hughes G, Pallini V, et al. (1997). Protein expression profiles in human breast ductal carcinoma and histologically normal tissue. Electrophoresis 18, 28322841. Bhattacharyya T, Karnezis AN, Murphy SP, Hoang T, Freeman BC, Phillips B, Morimoto RI (1995) Cloning and subcellular localization of human mitochondrial hsp70. J Biol Chem 270, 1705-1710. Carette J, Lehnert S, Chow TYK (2002) Implication of PBP74/mortalin/GRP75 in the radio-adaptive response. Int J Radiat Biol 78, 183-190. Craig EA, Kramer J, Shilling J, Werner-Washburne M, Holmes S, Kosic-Smithers J and Nicolet CM (1989) SSC1, an essential member of the yeast HSP70 multigene family, encodes a mitochondrial protein. Mol Cell Biol 9, 30003008. Craig EE, Chesley A and Hood DA (1998) Thyroid hormone modifies mitochondrial phenotype by increasing protein import without altering degradation. Am J Physiol 275, C1508-1515. Dahlseid JN, Lill R, Green JM, Xu X, Qiu Y, Pierce SK (1994) PBP74, a new member of the mammalian 70-kDa heat shock

176


Cancer Therapy Vol 1, page 177 Mizukoshi E, Suzuki M, Loupatov A, Uruno T, Hayashi H, Misono T, Kaul SC, Wadhwa R, Imamura T (1999) Fibroblast growth factor-1 interacts with the glucoseregulated protein GRP75/mortalin. Biochem J 343, 461-466. Mizukoshi E, Suzuki M, Misono T, Loupatov A, Munekata E, Kaul SC, Wadhwa R, Imamura T (2001) Cell-cycle dependent tyrosine phosphorylation on mortalin regulates its interaction with fibroblast growth factor-1. Biochem Biophys Res Commun 280, 1203-1209. Moll UM, Riou G, Levine AJ (1992) Two distinct mechanisms alter p53 in breast cancer: mutation and nuclear exclusion. Proc Natl Acad Sci USA 89, 7262-7266. Nakabayashi K, Ogino H, Michishita E, Satoh N, Ayusawa D (1999) Introduction of chromosome 7 suppresses telomerase with shortening of telomeres in a human mesothelial cell line. Exp Cell Res 252, 376-382. Ornatsky OI, Connor MK, Hood DA (1995) Expression of stress proteins and mitochondrial chaperonins in chronically stimulated skeletal muscle. Biochem J 311, 119-123. Poindexter BJ, Pereira-Smith O, Wadhwa R, Buja LM, Bick RJ. (2002) 3D Reaconstruction and localization of mortalin by deconvolution microscopy. Micros Anal 89, 21-23. Ran Q, Wadhwa R, Kawai R, Kaul SC, Sifers RN, Bick RJ, Smith JR, Pereira-Smith OM (2000) Extramitochondrial localization of mortalin/mthsp70/PBP74/GRP75. Biochem Biophys Res Commun 275, 174-179. Resendez E Jr, Ting J, Kim KS, Wooden SK, Lee AS (1986) Calcium ionophore A23187 as a regulator of gene expression in mammalian cells. J Cell Biol 103, 2145-2152. Rivolta MN, Holley MC (2002) Asymmetric segregation of mitochondria and mortalin correlates with the multi-lineage potential of inner ear sensory cell progenitors in vitro. Brain Res Dev Brain Res 133, 49-56. Sacht G, Brigelius-Flohe R, Kiess M, Sztajer H, Flohe L (1999) ATP-sensitive association of mortalin with the IL-1 receptor type I. Biofactors 9, 49-60. Sadekova S, Lehnert S, Chow TY (1997) Induction of PBP74/mortalin/Grp75, a member of the hsp70 family, by low doses of ionizing radiation: a possible role in induced radioresistance. Int J Radiat Biol 72, 653-660. Schneider JJ, Hood DA (2000) Effect of thyroid hormone on mtHsp70 expression, mitochondrial import and processing in cardiac muscle. J Endocrinol 165, 9-17. Singh B, Soltys BJ, Wu ZC, Patel HV, Freeman KB, Gupta RS (1997) Cloning and some novel characteristics of mitochondrial Hsp70 from Chinese hamster cells. Exp Cell Res 234, 205-216. Soltys BJ, Gupta, R. S. (1996). Immunoelectron microscopic localization of the 60-kDa heat shock chaperonin protein (Hsp60) in mammalian cells. Exp Cell Res 222, 16-27. Soltys BJ, Gupta RS (1997) Cell surface localization of the 60 kDa heat shock chaperonin protein (hsp60) in mammalian cells. Cell Biol Int 21, 315-320. Soltys BJ, Gupta RS (1999) Mitochondrial-matrix proteins at unexpected locations: are they exported ? Trends Biochem Sci 24, 174-177. Soltys BJ, Gupta RS (2000) Mitochondrial proteins at unexpected cellular locations: export of proteins from mitochondria from an evolutionary perspective. Int Rev Cytol 194, 133-196. Strub A, Lim JH, Pfanner N, Voos W (2001) The mitochondrial protein import motor. Biol Chem 381, 943-949.

Takahashi S, Mikami T, Watanabe Y, Okazaki M, Okazaki Y, Okazaki A, Sato T, Asaishi K, Hirata K, Narimatsu E, et al. (1994) Correlation of heat shock protein 70 expression with estrogen receptor levels in invasive human breast cancer. Am J Clin Pathol 101, 519-525. Takahashi M, Chesley A, Freyssenet D, Hood DA (1998) Contractile activity-induced adaptations in the mitochondrial protein import system. Am J Physiol 274, C1380-1387. Takano S, Wadhwa R, Yoshii Y, Nose T, Kaul SC, Mitsui Y (1997) Elevated levels of mortalin expression in human brain tumors. Exp Cell Res 237, 38-45. Takano S, Wadhwa R, Mitsui Y, Kaul SC (2001) Identification and characterization of molecular interactions between glucose-regulated proteins (GRPs) mortalin/GRP75/peptidebinding protein 74 (PBP74) and GRP94. Biochem J 357, 393-398. Taurin S, Seyrantepe V, Orlov SN, Tremblay TL, Thibault P, Bennett MR, Hamet P, Pshezhetsky AV (2002) Proteome analysis and functional expression identify mortalin as an antiapoptotic gene induced by elevation of [Na+]i/[K+]i ratio in cultured vascular smooth muscle cells. Circ Res 91, 915922. Wadhwa R, Kaul SC, Ikawa Y, Sugimoto Y (1993a) Identification of a novel member of mouse hsp70 family. Its association with cellular mortal phenotype. J Biol Chem 268, 6615-6621. Wadhwa R, Kaul SC, Mitsui Y, Sugimoto Y (1993b) Differential subcellular distribution of mortalin in mortal and immortal mouse and human fibroblasts. Exp Cell Res 207, 442-448. Wadhwa R, Kaul SC, Sugimoto Y, Mitsui Y (1993c) Induction of cellular senescence by transfection of cytosolic mortalin cDNA in NIH 3T3 cells. J Biol Chem 268, 22239-22242. Wadhwa R, Pereira-Smith OM, Reddel RR, Sugimoto Y, Mitsui Y, Kaul SC (1995) Correlation between complementation group for immortality and the cellular distribution of mortalin. Exp Cell Res 216, 101-106. Wadhwa R, Takano S, Robert M, Yoshida A, Reddel RR, Nomura H, Mitsui Y, Kaul SC (1998) Inactivation of tumor suppressor p53 by mot-2, an hsp70 family member. J Biol Chem 273, 29586-29591. Wadhwa R, Sugihara T, Yoshida A, Nomura H, Reddel RR, Simpson R, Maruta H, Kaul SC (2000) Selective toxicity of MKT-077 to cancer cells is mediated by its binding to the hsp70 family protein mot-2 and reactivation of p53 function. Cancer Res 60, 6818-6821. Wadhwa R, Colgin L, Yaguchi T, Taira K, Reddel RR, Kaul SC (2002a) Rhodacyanine dye MKT-077 inhibits in vitro telomerase assay but has no detectable effects on telomerase activity in vivo. Cancer Res 62, 4434-4438. Wadhwa R, Yaguchi T, Hasan MK, Mitsui Y, Reddel RR, Kaul SC (2002b) Hsp70 family member, mot-2/mthsp70/GRP75, binds to the cytoplasmic sequestration domain of the p53 protein. Exp Cell Res 274, 246-253. Wadhwa R, Yaguchi T, Taira K, Kaul SC (2003a) MortalinMPD (mevalonate pyrophosphate decarboxylase) interactions and their role in control of cellular proliferaction. Biochem Biophys Res Commun 302, 735-742. Wadhwa R, Ando H, Kawasaki H, Taira K, Kaul SC (2003b) Targeting mortalin using and RNA-helicase-coupled hammerhead ribozymes. EMBO Reports 4, 595-601. Webster TJ, Naylor DJ, Hartman DJ, Hoj PB, Hoogenraad NJ (1994) cDNA cloning and efficient mitochondrial import of pre-mtHSP70 from rat liver. DNA Cell Biol 13, 1213-1220.

177


Wadhwa et al: Can mortalin be a candidate target for cancer therapy? Wu R, Zhao YH, Plopper CG, Chang MM, Chmiel K, Cross JJ, Weir A, Last JA, Tarkington B (1999) Differential expression of stress proteins in nonhuman primate lung and conducting airway after ozone exposure. Am J Physiol 277, L511-522. Xu J, Xiao HH, Sartorelli AC (1999) Attenuation of the induced differentiation of HL-60 leukemia cells by mitochondrial chaperone HSP70. Oncol Res 11, 429-435. Dr. Renu Wadhwa, Dr. Kazunari Taira,

178

Dr Sunil Kaul


Cancer Therapy Vol 1, page 179 Cancer Therapy Vol 1, 179-190, 2003.

Therapeutic potential of antinuclear autoantibodies in cancer Review Article / Hypothesis

Vladimir P. Torchilin1*, Leonid Z. Iakoubov2**, Zeev Estrov3 1

Department of Pharmaceutical Sciences, Bouve College of Health Sciences, Northeastern University, Boston, MA; 2c/o Procyon Biopharma, Dorval, Canada; 3Department of Bioimmunotherapy, The University of Texas M.D.Anderson Cancer Center, Houston, TX

__________________________________________________________________________________ *Correspondence: Vladimir Torchilin, Ph.D., D.Sc., Department of Pharmaceutical Sciences, Northeastern University, Mugar Building, Room 312, 360 Huntington Avenue, Boston, MA 02115, USA; Tel: 617-373-3206; Fax: 617-373-8886; e-mail: v.torchilin@neu.edu ** Current address: Chronix Biomedical, Inc., Benicia, CA, USA Key Words: cancer immunotherapy, autoimmunity, natural antitumor antibodies, antinuclear autoantibodies, nucleosomes Abbreviations: MRD, minimal residual disease; AIDS, aquired immunodeficiency syndrome; NHL, non-Hodgkin’s lymphoma; mAb, monoclonal antibody; ANA, antinuclear autoantibody; IgM, immunoglobulin M; IgG, immunoglobulin G; ADDC, antibody-dependent cellular cytotoxicity; NK, natural killer; NS - nucleosome; BSA, bovine serum albumin; Kd – dissociation constant. Received: 19 August 2003; Accepted: 22 August 2003; electronically published: August 2003

Summary We review the numerous data supporting an anticancer function of certain antinuclear autoantibodies (ANAs). Circulating ANAs are well known to accompany certain pathological (autoimmunity) and physiological (aging) conditions and can be artificially induced by immunization. The pathogenic role of ANAs in autoimmunity is established; but the non-pathogenic ANAs, are generally believed not to possess any functional activity. However, important research and clinical data permit to hypothesize a definite connection between cancer and ANAs. The idea of inducing autoimmunity as an approach to enhance the immune component in cancer therapy has been proposed recently (Pardoll, D 1999, Proc Natl Acad Sci USA 10, 5340-5342). Based on the available data, we hypothesize that exogenous ANAs may be used as anticancer therapeutics. Among these ANAs, nucleosome-specific ANAs of the aged may be particularly useful since, at least in the aged, they exist as a non-pathogenic moiety, which suggests they will have minimal adverse effects when used as anticancer therapeutics. patients who have undergone allogeneic stem cell transplantation for chronic myelogenous leukemia and in patients with acute myeloid leukemia (Chang et al, 1993; Nucifora et al, 1993; Radich et al, 1995; Kenchtli et al, 1998) and childhood leukemia (Vora et al, 1998), suggesting that leukemia cells may survive for more than a decade in a dormant state. “Ultra-late” recurrences of solid tumors have been described over the years (Tsao et al, 1997; Karrison et al, 1999). Recent reports on the detection of MRD in hematological malignancies such as lymphomas as well as in solid tumors (Corradini et al, 1999; Sharp and Chan, 1999; Gath and Brakenhoff 1999; Kvalheim et al, 1999; Maguire et al, 2000) indicate that long-lasting MRD is not disease- or tissue-specific. The capability to confine tumor cells is not limited to the state of MRD. Asymptomatic occult neoplasms such as prostate cancer have been detected in elderly patients who died of unrelated causes (Gatling 1990), and “diseasespecific” fusion gene products including BCR-ABL, BCL2IgH, MLL-AF4, and the partial tandem duplications of MLL have been detected in healthy individuals who did not develop cancer during the follow-up period (Biernaux et al, 1995; Dolken et al, 1996; Uckun et al, 1998). Thus,

I. Introduction Natural control over neoplasia Studies over the past two decades have revealed the presence of neoplastic cells in cancer patients who were considered cured or who had attained complete remission following successful therapy. Tumor cells detected at a level below the resolution of conventional microscopy have been termed MRD (reviewed in Moss 1999; Faderl et al, 1999, 1999a). When MRD persists asymptomatically for years without any increment in tumor mass, the tumor is thought to be “dormant” (Uhr et al, 1997). Modern sensitive techniques such as flow cytometry, fluorescence in situ hybridization, and polymerase chain reaction have increased the sensitivity of MRD detection. Molecular evidence of residual leukemia cells has been detected in the bone marrow for as long as 9 years following completion of therapy for acute lymphoblastic leukemia (Potter et al, 1993). Low levels of MRD were found in 15 of 17 acute lymphoblastic leukemia patients who remained in complete remission 2-to-35 months after completion of all treatments (Roberts et al, 1997). Long-term persistence of MRD without clinical relapse has been observed in

179


Torchilin et al: Therapeutic potential of antinuclear autoantibodies in cancer neoplastic cells may remain dormant for years (Faderl et al, 1999, 1999a; Estrov and Freedman 1999) while the human organism successfully confines them, keeping them at a “subclinical” level. For this reason, the benefits of therapeutic intervention in patients with MRD remain questionable (Faderl et al, 1999, 1999a, 2000; Estrov and Freedman 1999). Finally, the spontaneous remission of cancer, though extremely rare (1 in 60,000 - 140,000 cancer cases) (Chang 2000), is a well-established clinical phenomenon that provides additional evidence that the human organism is capable of combating cancer. Spontaneous remission has been reported in leukemia (Bernard and Bessis 1983, Paul 1994; Bhatt et al, 1995; Dinulos et al, 1997; Grundy et al, 2000), malignant melanoma (Barr 1994) and other skin tumors (Barnetson and Halliday 1997), brain tumors (Bowles and Perkins 1999), breast cancer (Jena et al, 2000), lung cancer, and other neoplasms (Kappauf et al, 1997). This phenomenon is not age-restricted or diseaseor tissue-specific. What mechanisms does the human organism recruit to confine neoplasia, and how can they be used clinically? The data on increased tumor frequency in immunocompromised hosts indicate that immune surveillance plays an important role in tumor growth suppression. The sporadic occurrence of both virusdependent and -independent opportunistic tumors has been reported in immune-deficient patients (Ioachim 1990; Filipovich et al, 1994; Penn 2000) such as those who are immunosuppressed owing to organ or bone marrow transplantation (Penn 1993, Restrepo et al, 1999, Sobecks et al, 1999, Swinnen 2000, Kwok and Hunt 2000, Angel et al, 2000, Rinaldi et al, 2001, Haagsma et al, 2001, Bhatia et al, 2001), severe combined immunodeficiency (McClain 1997; Elenitoba-Johnson and Jaffe 2001), or AIDS (Fiegal 1999; White et al, 2001; Frisch et al, 2001). Perhaps the most compelling data are from patients with AIDS. The incidences of NHL, central nervous system NHL, and Hodgkin’s disease are approximately 100-fold, 3000-fold, and 10-fold higher in AIDS patients than the incidences in the overall population (Straus 2001). Similarly, AIDS patients have an increased risk of developing B-cell and Tcell lymphomas of all types (Biggar et al, 2001). In addition, neoplasms thought not to be immunodeficiencyrelated or virally induced, such as carcinomas of the rectum, rectosigmoid, trachea, bronchus, lung, skin, connective tissues, brain, and central nervous system have been found in AIDS patients up to 7 times more frequently than in the general population (Gallagher et al, 2000; Phelps et al, 2001; Clarke and Glaser 2001). One may assume that other, slower growing tumors might remain undetected in these patients because of their shortened life span. Of the two branches of the immune system, cellular and humoral, cellular immunity has been investigated most extensively and utilized clinically (Pardoll 2001). Donor lymphocyte infusion has been utilized to suppress tumor cell re-growth in patients treated with marrow or blood stem cell transplantation (Appelbaum 2001), and exvivo-expanded dendritic cells were successfully used in

clinical trials in patients with various neoplasms (Baggers et al, 2000). Recent success in using certain mAbs as anticancer agents has re-attracted investigators’ attention to the role of antibodies in antitumor immunity. This