Page 1

cover_1_11

31-03-2011

15:07

Pagina 1

JOURNAL of OSSEOINTEGRATION versione italiana

ISSN 2036-413X

MARZO 2011

www.journalofosseointegration.eu

n.

....

1

vol.

....

3


Ca R ta ich lo ied go i -W eb

L ’ I M P L A N T O L O G I A

Oltre 350 Impianti e 550 Monconi per ogni Esigenza Implantoprotesica

+ del 99% di Successi ...anche nel Tuo Studio! ORALPLANT

Successi in Implantologia TPSS (Titanium Pull Spray Superficial)

*

S E M P L I C E

“una Garanzia di Osteointegrazione”

Rappresentazione grafica in riferimento alla Casistica Clinica-Protesica, media sul venduto, con follow-up dal 1991 ad oggi

19

91 - 2011

tratta dalla ricerca “Osteointegrazione Impian* Immagine to Koni-Plant 3.8 L10” - Università degli Studi “G. D’An-

Implantologia disponibile nei diametri 5.0

3.3

3.8

4.5

7.0

8.0

9.0

R E N D E

nunzio”, Chieti - Pescara

2.5 5.7

ORALPLANT S.r.l.

ISO 9001 e ISO 13485

Sistema Qualità

Prodotti Certificati in accordo alla

Certificato Secondo

Direttiva DDM 93/42/CEE consolidata

P R O D O T T O

MADE IN ITALY

oralplant.com Tel. +39.0434.41333 r.a. info@oralplant.com


colophon

31-03-2011

15:11

Pagina 1

JOURNAL of OSSEOINTEGRATION

Editorial board EDITORS-IN-CHIEF >

Adriano Piattelli Professor of Oral Pathology and Medicine Dental School, University of Chieti Pescara (Italy) apiattelli@unich.it

>

Arthur Belem Novaes Jr. Dental School of Ribeirão Preto, University of São Paulo (Brazil) novaesjr@forp.usp.br

ASSOCIATE EDITORS Clinical Research

Biomaterials

Georgios Romanos

Paulo Coelho New York (USA)

Rochester (USA)

Biomaterials and Tissue Engineering

Implant Science

Jose M. Granjeiro

Marco Degidi Bologna (Italy)

Niterói (Brazil)

Jamil Shibli

Carlo Mangano Gravedona (Italy)

Guarulhos (Brazil)

Basic Research

Clinical Innovations

Devorah Schwartz-Arad Tel Aviv (Israel)

Gabriele Edoardo Pecora Rome (Italy)

ABBONAMENTO Il costo dell’abbonamento annuale (3 numeri) a Journal of Osseointegration è di 25,00 euro, da versarsi sul conto corrente n. 21020201 - intestato ad Ariesdue Srl. Per informazioni: Antonella Lambertoni abbonamenti@ariesdue.it tel. 031.79.21.35 / fax. 031.79.07.43

BOARD OF REVIEWERS Biomaterials Yasumasa Akagawa Hiroshima (JPN) Victor Arana Chavez Sao Paulo (BRA) Carlos Roberto Grandini Ilha Solteira (BRA) Antonio Guastaldi Araraquara (BRA) Adalberto Luiz Rosa Ribeirão Preto (BRA) Lior Shapira Jerusalem (ISR) Paulo Tambasco de Oliveira Ribeirão Preto (BRA) Heverson Tavares Araraquara (BRA) Van P. Thompson New York (USA)

Biomaterials and Tissue Engineering Paolo Amerio Chieti (ITA) Timothy G. Broomage New York (USA) Pablo Galindo Moreno Granada (ESP) Martin Lorenzoni Graz (AUT) Brian Nicholls London (GBR) Mario Raspanti Varese (ITA) Cristina Teixeira New York (USA) Michael Yost Columbia (USA)

Basic Research

ASSISTANT EDITORS >

Vittoria Perrotti Department of Dentistry and Oral Science, Dental School, University of Chieti-Pescara (Italy) v.perrotti@unich.it

>

Nilson T. C. Oliveira Biomaterials Group “IQ”UNESP Araraquara, SP (Brazil) n.oliveira@journalofosseointegration.eu

Publisher: Ariesdue Srl Via Airoldi, 11 22060 Carimate (Co) Tel. +39(0)31792135 Fax +39(0)31790743 www.ariesdue.it email: info@ariesdue.it Direttore responsabile Dino Sergio Porro Marzo 2011; 1(3)

Angela Battaglia a.battaglia@ariesdue.it Barbara Bono b.bono@ariesdue.it Cristina Calchera farma@ariesdue.it Paola Cappelletti p.cappelletti@ariesdue.it Franco De Fazio f.defazio@ariesdue.it Simona Marelli doctoros@ariesdue.it

Luciano Artese Chieti (ITA) Raquel R.M. Barros Ribeirão Preto (BRA) Giuseppe Cardaropoli New York (USA) Francesco Carinci Ferrara (ITA) Magda Feres Guarulhos (BRA) Giovanna Iezzi Chieti (ITA) Ramon Martinez Corrià Lerida (ESP) Gabriella Mincione Chieti (ITA) Raffaella Muraro Chieti (ITA) Gianpaolo Papaccio Naples (ITA) Rachel Sammons Birmingham (GBR)

Pascal Valentini Paris (FRA) Paul Weigl Frankfurt am Main (DEU)

Implant Science Carlos R.P. Araujo Bauru (BRA) Bartolomeo Assenza Chieti (ITA) Luigi Califano Naples (ITA) Jose Luis Calvo Guirado Murcia (ESP) James Doundoulakis New York (USA) Massimo Frosecchi Florence (ITA) Enrico Gherlone Milan (ITA) Ana Becil Giglio New York (USA) Graziano Giglio New York (USA) Luigi Guida Naples (ITA) Giulio Leghissa Milan (ITA) Giuseppe Luongo Naples (ITA) Rogério Margonar Araraquara (BRA) Emeka Nkenke Erlangen (DEU) Marco E. Pasqualini Milan (ITA) Thallita Pereira Queiroz Araraquara (BRA) Lorenzo Ravera Chieti (ITA) Gilberto Sammartino Naples (ITA) Antonio Scarano Chieti (ITA) Tiziano Testori Milan (ITA) Stefano Tetè Chieti (ITA)

Clinical Innovations

Roberto Abundo Turin (ITA) David Anson Beverly Hills (USA) Zvi Artzi Tel Aviv (ISR) Giuseppe Corrente Turin (ITA) Nilton De Bortoli Jr São Paulo (BRA) Paolo Della Casa Genoa (ITA) Stefano Fanali Chieti (ITA) Carlos Ademar Ferreira Tucuruvi (BRA) Luis Fujimoto New York (USA) Clinical Research Heracles Goussias Athens (GRC) Sergio Caputi Chieti (ITA) Robert Horovitz New York (USA) Massimo Del Fabbro Milan (ITA) Fouad Khoury Münster (DEU) Carlo Ercoli Rochester (USA) Francesco German Gomez-Roman Tübingen (DEU) Maggiore Aschaffenburg (DEU) Ole Jensen Denver (USA) Glenn Mascarenhas Mumbai (IDN) Gregorio Laino Naples (ITA) Jorge Mulatinho Sao Paulo (BRA) Voja Lekovic Belgrade (SRB) Georg H. Nentwig Frankfurt (DEU) Elcio Marcantonio Jr Araraquara (BRA) Vula Papalexiou Curitiba (BRA) Ziv Mazor Ra'anana (ISR) Roberto Pistilli Rome (ITA) Valdir Antonio Muglia Ribeirão Waldemar Polido Porto Alegre (BRA) Preto (BRA) Nigel Saynor Woodford (GBR) Joerg Neugebauer Cologne (DEU) Ludovico Sbordone Pisa (ITA) Ana Pontes Barretos (BRA) David Simmons New Orleans (USA) Sérgio L. Scombatti Aris Tripodakis Athens (GRC) de Souza Ribeirão Preto (BRA) Glecio Vaz De Campos Jundiai (BRA) 3


sommario+guidelines

31-03-2011

15:11

Pagina 1

JOURNAL of OSSEOINTEGRATION

ISSN (Print): 2036-413X ISSN (Online): 2036-412I Journal of Osseointegration Vol. 3, N. 1 Marzo 2011 quadrimestrale © 2011 Ariesdue Srl V. Airoldi, 11-22060 Carimate (Co) Grafica e web Michele Moscatelli grafica@ariesdue.it Simone Porro simone@ariesdue.it

journalofosseointegration.eu Journal of Osseointegration è organo ufficiale IAfIL (International Academy for Immediate Loading). Non è permessa la riproduzione di articoli della rivista senza l’autorizzazione scritta dell’editore. Tutti gli articoli pubblicati sulla rivista sono redatti sotto la responsibilità dell’autore. La rivista Journal of Osseointegration è spedita in abbonamento: l’indirizzo in nostro possesso verrà utilizzato per l’invio di questa e di altre pubblicazioni o per l’inoltro di proposte di abbonamento. Ai sensi della legge 675/96 sulla tutela della privacy, è nel diritto del ricevente richiedere la cessazione dell’invio e/o l’aggiornamento dei dati. Registrazione del Tribunale di Como n. 12-08 del 14.4.2008 Stampa: Grafiche SIMA Srl Ciserano (Bg)

Sommario M. U. Shirozaki, E. M. Sampaio, L.-P. Lefebvre, P. T. de Oliveira, M. M. Beloti, A. L. Rosa

ORIGINAL PAPERS Influenza dell’ampiezza del solco sulla stabilità degli impianti in titanio. Uno studio nel coniglio > 17

> 27

CASI AL BIVIO

P. M. Burgos, L. Meirelles, L. Sennerby

Analisi in vitro su cellule staminali di midollo osseo umano su lega Ti-15Mo per applicazioni su impianti odontoiatrici e ortopedici

CASI AL BIVIO

> 43 >

Avulsione dei denti e inserimento differito degli impianti? Avulsione di denti e contemporaneo inserimento degli impianti? Staged approach? M. Frosecchi

N.T.C. Oliveira, V. Perrotti, A. Palmieri, A.C. Guastaldi, A. Pellati, C.L. Scapina, A. Piattelli, F. Carinci

Effetto dello spessore del rivestimento di titanio poroso sull’espressione del fenotipo osteoblastico in vitro > 35

A. Canabarro, G. E. Crippa,

RUBRICHE > 7

Agenda

> 9

Prodotti, aziende, eventi

> 50

Iafil

MANUSCRIPT PREPARATION MANUSCRIPT LENGTH Papers submitted to the Journal of Osseointegration must be typed in a 12-point font and double-spaced; they should not exceed 20 typescript pages (including title page), plus a typical number of figures (about 10 to 15). Italian authors must also supply an Italian translation of the full text.

TITLE PAGE Provide the following data on the title page (in the order given): title, author names, titles and affiliations (where the work was actually done), corresponding author (telephone and fax numbers, with country and area code, e-mail and complete postal address).

ABSTRACT Abstracts must not exceed 250 words and should be structured as follows: Aim, Materials and methods, Results, and Conclusions. Marzo 2011; 1(3)

KEYWORDS Authors should list 4-6 keywords that appropriately represent the contents of the work.

HEADINGS The component parts of the main text of a manuscript will normally be Introduction, Materials and methods, Results, and Discussion. Other parts of the manuscript will normally include a list of references, tables, figure legends, and figures.

STUDIES INVOLVING ANIMALS OR HUMANS When data from animal or human subjects are reported, approval of the protocol by an institutional committee is required and a statement should be included in the "Materials and methods" section of the text. For human subject data, an informed consent of the subjects should be also provided.

REFERENCES References should be listed according to the Vancouver style of referencing, that is numbered in sequence as they are cited in the text. They should be also included on a separate page in the manuscript. Examples for arranging the reference list. JOURNALS Mangano C, Scarano A, Perrotti V, Iezzi G, Piattelli A. Maxillary sinus augmentation with a porous synthetic hydroxyapatite and bovine-derived hydroxyapatite: a comparative clinical and histologic study. Int J Oral Maxillofac Implants 2007;22:980-6. MONOGRAPHS Matthews DE, Farewell VT. Using and understanding medical statistics. Basel: Karger; 1985. Edited books Piattelli A, Misch CE, Farias Pontes AE, Iezzi G, Scarano A, Degidi M. Dental Implant surfaces: a review. In: Carl E. Misch. Contemporary Implant Dentistry. Third edition. Mosby Elsevier 2008:599-620. Authors will be responsible for the accuracy of the references both within the main

text and the reference list.

TABLES AND FIGURES Each table should be typed on a separate page at the end of the manuscript, and numbered consecutively. Be sparing in the use of tables and ensure that the data presented in tables do not duplicate results described elsewhere in the article. Figures, charts, and graphs should be professionally drawn. Text should be large enough to be read after reduction. Resolution must be at least 300 dpi when the image is 3 inches wide. Files saved in TIFF or JPEG format are preferred. Please do not send images embedded in word processing programs (eg, Word) or “office suite”programs (Excel, PowerPoint, etc). Figure legends should be typed as a group on a separate page at the end of the manuscript. There should be an individual legend for each illustration. Detailed captions are encouraged. For microphotographs, specify original magnification and stain. 5


31-03-2011

15:12

Pagina 1

JOURNAL of OSSEOINTEGRATION

agenda

Agenda

APRLE 2011 2

5

Milano Memorial Carlo Merlini. Linee guida in chirurgia orale ambulatoriale www.sicoi.it Pordenone TEvoluzione della radiologia digitale: dai sistemi endorali alla diagnostica odontoiatrcia Cone-Beam Relatori: Roberto Ghiretti, Gabriele Piani www.dentaltrey.it

7

13-14 Firenze

La gestione dei tessuti molli in parodontologia e implantologia www.promoleader.com 18-20 Nizza

(Francia) Journeés dentaires de Nice www.journees-dentaires.com/site/

20 14-15 Sesto

Fiorentino (FI) Corso intensivo di parodontologia Relatore: Francesco Cairo ISO - Leone S.p.A. Tel. 055.304458 - fax 055.304455 iso@leone.it

14-16 Cannes

(Francia) International Symposium Osteology www.osteology-cannes.org

Bologna Protocolli e lembi per gli aumenti di cresta verticali ed orizzontali nella mandibola posteriore Relatori: Marco Ronda De Ore - Tel. 045.6020924 info@deorematerials.com

26-27 Sesto

Fiorentino (FI) Corso intensivo di parodontologia Relatore: Francesco Cairo ISO - Leone S.p.A. Tel. 055.304458 - fax 055.304455 iso@leone.it

14-16 Firenze

e Siena Congresso Nazionale dei Docenti di Discipline Odontostomatologiche. La ricerca scientifica in odontostomatologia: evidenze e controversie http://www.collegiodocentiodonto2011.com/IT/index.xhtml

Como Tecniche di rialzo del seno mascellare www.osteointegrazione.it sio2011@mvcongressi.it

26-28 Rimini

54° Congressso degli Amici di Brugg www.amicidibrugg.it

19

Sesto Fiorentino (FI) Giornate propedeutiche di pratica implantologica su paziente Relatore: Roberto Meli i ISO - Leone S.p.A. Tel. 055.304458 - fax 055.304455 iso@leone.it

GIUGNO 2011 7

28-30 Fiumana

Predappio (FC) Rigenerazione alveolare preimplantare Relatori : Ferdinando D’Avenia, Guerino Paolantoni www.dentaltrey.it

9-11

Marzo 2011; 1(3)

Roma Covegno One Day ARASS Percorsi diagnostici, chirurgici e implantologici in odontostomatologia Segreteria ARASS - Dr.ssa E. Vizzinisi Tel. 06.89683645 (Lun-Ven h. 15-18) segreteria@arass-noprofit-org

Abano Terme (PD) Premium Day 2011 www.sweden-martina.com

11

Rimini Topics nella riabilitazione con impianti nell’edentulo totale www.sicoi.it

11

Milano La bellezza che si svela. Corsi filler Allergan DL Medica Sig.a Laura Bergamaschi Tel. 02.762751 - www.dlmedica.it lbergamaschi@dlmedica.it

MAGGIO 2011 6

Sesto Fiorentino (FI) Giornate propedeutiche di pratica implantologica su paziente Relatore: Roberto Meli i ISO - Leone S.p.A. Tel. 055.304458 - fax 055.304455 iso@leone.it

7


Biomec adv 210x297N4 15_10_10_Layout 1 15/10/10 10:38 Pagina 1

LA NOSTRA SOLUZIONE PER LA TUA IMPLANTOLOGIA LOW COST only one

only one la confezione che contiene tutti i componenti necessari per l'intervento chirurgico e la fase protesica dall'inizio alla fine: • Impianto • Vite chirurgica • Vite guarigione

Inserzione

Osteointegrazione

tà Novi lant p oxyim ort Extra sh

• Transfert • Analogo

D TANDAR TESTA S mm Diam. 4 hezze i Lung - 7 - 8 mm Diametr 5-6 m m - 8 mm 5 4,7 5-6-7 5,25 mm 5 - 6 - 7 - 8 mm 5,75 mm

Guarigione

• Moncone • Vite per moncone

Impronta

Modello

Protesica

Definitiva

,6 mm o spira 0 d - Pass a re h T INT Micro INI TESTA M mm Diam. 3,6

hezze 5 - 17 mm i Lung Diametr 9 - 11 - 13 - 115 - 17 mm m m 30 ,3 3 9 - 11 - 1 3,75 mm D TANDAR TESTA S mm 4 . m Dia hezze 5 - 17 mm i Lung Diametr 9 - 11 - 13 - 115 - 17 mm m m 33,75 9 - 11 - 1 4,25 mm

implant D E N T A L

S Y S T E M

www.oxyimplant.com - info@oxyimplant.com Via Nazionale Nord - 21/A 23823 Colico (Lc) Tel. +39 0341 930166 - Fax +39 0341 930201 by BIOMEC S.r.l.


prodotti_osseointegration

31-03-2011

15:14

Pagina 9

JOURNAL of OSSEOINTEGRATION

Prodotti, aziende, eventi

Intervista al dottor Andrea Edoardo Bianchi presidente SICOI impianti dei pazienti completamente edentuli è in continua crescita...

Quest'anno ricorre il ventennale della fondazione di SICOI, l'associazione di cui Lei è presidente: avete previsto iniziative speciali? Come presidente della Società Italiana di Chirurgia Orale e Implantologia ho previsto nel biennio del mio mandato due importanti congressi internazionali a Milano nella prima settimana di ottobre. Saranno momenti scientifici particolari, dove esperti clinici italiani avranno modo di confrontarsi con illustri colleghi di tutto il mondo su temi eccezionalmente all’avanguardia come la risoluzione delle gravi atrofie ossee o l’eterna linea di confine tra il recupero conservativo di un dente e l’estrazione dello stesso per la sostituzione con un presidio implantoprotesico. In particolare, in occasione dell’appuntamento del 2012, abbiamo ottenuto la possibilità di ospitare in contemporanea il 7° Congresso Europeo dell’EFOSS, cioè dell’European Federation of Oral Surgery Societies di cui la SICOI è società fondatrice. Sarà questo un momento molto importante per la nostra associazione, perché ospiterà i migliori chirurghi orali del mondo occidentale, dando vita ad un momento di crescita professionale e di livellamento delle conoscenze per quello che oggi è ormai l’ambito geografico di riferimento. Parliamo del corso di Rimini: l'interesse dei professionisti verso la riabilitazione con Marzo 2011; 1(3)

Sì, la riabilitazione implantoprotesica del paziente completamente edentulo rimane ancora oggi un argomento di affascinante interesse che merita una discussione circa l’atteggiamento clinico terapeutico da adottare. Il Corso di Aggiornamento della SICOI di giugno a Rimini vuole proprio affrontare questo tema con un ottica a 360°, attraverso valutazioni non solo di ordine squisitamente chirurgico o bio-tecnico, ma anche di normalizzazione estetica del terzo inferiore del volto piuttosto che di ordine funzionale alla luce del rapporto costo-beneficio del trattamento. La giornata congressuale ripete quindi la formula monotematica, che peraltro ho intenzione di proporre durante l’intero biennio del mio mandato di presidenza, e che abbiamo già sperimentato al corso di gennaio a Cavaion Veronese, con un successo inaspettato sull’argomento delle perimplantiti, discusso dall’eziologia al trattamento di queste infezioni che possono portare al fallimento della terapia. Momenti scientifici che si rivolgono quindi alla libera professione, strutturati e pilotati dal punto di vista delle relazioni in modo da fornire notizie spendibili da subito nella quotidianità. Posso quindi affermare che la formula vincente è da ricercarsi non solo nell’argomento “impianti nell’edentulo totale” , che comunque rimane una tematica di grandissima attualità, ma nel connubio tra un titolo particolarmente inserito nella realtà riabilitativa moderna e la formula monotematica del congresso. Secondo Lei vi sono ancora aspetti chirurgici che si prestano a interpretazioni cliniche e terapeutiche soggettive da parte degli operatori? Nonostante che come qualsiasi branca della chirurgica anche la chirurgia orale può essere soggetta a operatività tecniche soggettive, perlomeno nelle mani di chirurghi giunti alla conclusione della curva di apprendimento e con consolidata esperienza personale, diverso è invece 9


prodotti_osseointegration

31-03-2011

15:14

Pagina 10

JOURNAL of OSSEOINTEGRATION >

Prodotti, aziende, eventi

strumentale determina una inderogabile necessità di aggiornamento, rendendo questa disciplina sempre altamente interessante. Ritengo infatti che oggi la vera “sfida” sia conciliare il tempo per poter ancora crescere professionalmente con la non semplice realtà lavorativa che stiamo vivendo.

pensare che l’atteggiamento terapeutico nella formulazione del piano di trattamento possa essere ancora appannaggio di interpretazioni personali. Proprio il Corso di Aggiornamento di Rimini dimostrerà la possibilità di risoluzione dell’edentulia totale con una serie di proposte implantoprotesiche diverse, ma metterà l’accento sull’indicazione all’una o all’altra opzione, evidenziandone i pro e i contro nelle diverse situazioni cliniche.

Quali sono gli obiettivi della SICOI e come intendete perseguirli? L’obiettivo primario della Società Italiana di Chirurgia Orale e Implantologia rimane quello di essere la società di riferimento per tutti gli appassionati della chirurgia orale. Sotto la grande ala di questa disciplina il Direttivo in carica vuole aggregare il mondo professionale e accademico in momenti di accrescimento scientifico e di confronto culturale non solo in chirurgia orale in senso stretto ma anche in quelle tecniche, come ad esempio l’implantologia, che in questo momento destano ancora tanto interesse.

Quali sono le sfide che deve affrontare oggi il chirurgo orale? Preferirei parlare di quali sono le sfide che deve affrontare il laureato in odontoiatria che si vuole dedicare alla chirurgia orale. Innanzitutto la volontà di seguire corsi di formazione per il continuo affinamento delle tecniche chirurgiche alla luce di una minor invasività che viene richiesta dai pazienti anche nella chirurgia orale. Inoltre la continua evoluzione merceologica e

Exacone, sistema implantare Leone “Digital Ready” Oggi i professionisti e i loro pazienti richiedono sempre più efficienza e rapidità, soprattutto nelle fasi riabilitative; a tale scopo sono nate le tecnologie digitali. E pertanto si rendono necessari prodotti idonei all’impiego di tali metodiche. Ecco che l’impianto Exacone Leone, grazie alla sua connessione conometrica pura, priva di vite, risulta ideale nel semplificare e ottimizzare l’applicazione delle più recenti tecnologie. L’impronta ottica con videocamere ad alta risoluzione non richiede l’impiego di appositi accessori (scan abutment), ma può essere effettuata direttamente sul moncone Leone (pieno, senza cavità) trattandolo alla stregua di un elemento naturale, sia con scanner intraorali che da laboratorio. I vantaggi in

>

fase protesica derivanti da questa sistematica sono poi esaltati dalle tecniche CAD-CAM, in quanto l’assenza del canale di accesso per la vite agevola le fasi di progettazione e fabbricazione del manufatto. Gli appositi monconi Multi-Tech, con il loro design che ne favorisce la totale individualizzazione, ottimizzano in tal senso le proprietà di tutta la linea protesica. Si ricorda che l’impianto Exacone è presente nelle librerie dei più diffusi software di pianificazione del trattamento implantare: la gestione computerassistita della terapia è così percorribile a tutti gli stadi, dalla chirurgia alla finalizzazione protesica. Le caratteristiche uniche della sistematica Leone, sposandosi alla perfezione con i mezzi tecnologici più all’avanguardia, la rendono pronta a contribuire alla rivoluzione digitale che è già in atto nel mondo dell’odontoiatria.

LEONE S.P.A. Via Ponte a Quaracchi, 50 - 50019 Sesto Fiorentino (FI) Tel. 055.30441 - Fax: 055.374808 - E-mail: info@leone.it - www.leone.it

10

Marzo 2011; 1(3)


prodotti_osseointegration

31-03-2011

15:14

Pagina 11

JOURNAL of OSSEOINTEGRATION Prodotti, aziende, eventi

<

Nuovo logo per La European Association for Osseointegration (EAO) ha recentemente rinnovato il proprio “look” per meglio riflettere il livello sempre più avanzato della conoscenza scientifica e della professione che rappresenta. In occasione del XIX Congresso internazionale EAO, tenutosi lo scorso ottobre a Glasgow alla presenza di oltre 3000 partecipanti, è stato infatti presentato il nuovo logo dell’associazione che, rinunciando alle 12 stelline dell’Unione europea e cambiando i colori in rosso e grigio, ha una connotazione decisamente moderna e accattivante. L’intento, come ha spiegato il past presidente EAO Cristoph Hämmerle, è quello di distinguersi da altre federazioni che utilizzano il motivo europeo e, grazie alla nuova e moderna grafica, trasmettere una immagine più dinamica

dell’associazione, sperando di riflettere quell’energia e quella marcia in più che l’anno resa un punto di riferimento in campo implantologico, al fine di attirare sempre nuovi soci. Ricordiamo che l’obiettivo della EAO è diffondere e condividere le conoscenze e colmare il vuoto tra scienza e pratica clinica. Il prossimo appuntamento EAO è il XX Congresso internazionale che si terrà ad Atene dal 12 al 15 ottobre prossimo.

>

EAO http://www.eao.org

Implant Direct Sybron International, una nuova realtà Implant Direct Sybron Int’l. è la nuova realtà scaturita dalla fusione tra Sybron Dental Specialties, Inc., e Implant Direct International Inc.. La costituzione del nuovo gruppo permette di rafforzare la posizione di Sybron nell’industria implantologica, al tempo stesso Implant Direct avrà la possibilità di far crescere ancora più in fretta le vendite di quella che si è dimostrata essere una società implantologica in forte espansione. Andando a sommare la professionalità specifica delle aziende confluite negli anni all’interno del suo gruppo (quali Oraltronics GmbH, Innova…), Sybron può vantare oltre 100 anni di storia al

servizio della qualità e dell’innovazione nel settore odontoiatrico, e quindi una consolidata esperienza non solo nella fase produttiva, ma anche in quella dello sviluppo e ricerca di soluzioni innovative che hanno permesso all’azienda di introdurre sul mercato prodotti a valore aggiunto per i professionisti, anche in ambiti specifici come l’ortodonzia, l’endodonzia e l’implantologia. Implant Direct International, invece, ha il proprio quartier generale a Las Vegas, la sede produttiva a Los Angeles più una fitta rete di distributori internazionali. L’azienda, fondata nel 2004, ha sempre svolto attività all’avanguardia in campo implantologico con 35 brevetti registrati e offre una linea di impianti disponibili in una pratica confezione all-in-1 per assicurare il massimo di semplicità ed economia. La nuova realtà permetterà di ampliare le opportunità per odontoiatri e pazienti in tutto il mondo che potranno disporre di un vasto range di soluzioni odontoiatriche e implantari di elevata qualità a un ottimo rapporto qualità prezzo.

>

SYMPLA S.R.L. Via Pisacane 5 46100 Mantova www.sympla.it

Marzo 2011; 1(3)

11


prodotti_osseointegration

31-03-2011

15:14

Pagina 12

JOURNAL of OSSEOINTEGRATION >

Prodotti, aziende, eventi

A Cannes con Osteology Symposium Dal 14 al 16 aprile si terrà a Cannes, l’Osteology Symposium 2011. Dopo il successo del 2007 a Montecarlo, la splendida Costa Azzurra è ancora protagonista: del resto, ospitando ogni anno il festival del cinema è inevitabile che a Cannes l’estetica abbia un ruolo fondamentale. E in effetti i padroni di casa, cioè i presidenti nazionali Franck Bonnet e Pascal Valentini, hanno già anticipato che tra gli argomenti del Simposio non mancherà proprio l’estetica; inoltre, si parlerà anche di trattamenti rigenerativi consolidati, con i relativi potenziali e limiti, per meglio chiarire i concetti rigenerativi più attuali grazie ai quali i professionsti possono ottenere risultati estetici e funzionali di lunga durata. Presidenti internazionali della manifestazione sono

Daniel Buser e Mariano Sanz che, insieme al presidente di Osteology Foundation, Christoph Hämmerle, hanno coinvolto alcuni famosi gruppi di studio internazionali per permettere ai partecipanti di conoscere i più recenti risultati scientifici e i nuovi concetti di gestione per poter scegliere la strategia più idonea al singolo paziente. Grazie alla perfetta organizzazione di Osteology Foundation, le più recenti innovazioni cliniche, i risultati della ricerca e i concetti attuali di trattamento saranno presentati e discussi nell’ambito di 24 workshop e 11 sedute scientifiche sull’argomento “Eccellenza clinica, fattori di rischio e complicazioni in odontoiatria rigenerativa”. Si tratta di una manifestazione veramente prestigiosa e di elevato tenore scientifico, testimoniato non solo dai nomi dei Chairman che ne saranno protagonisti, ma anche, e più significativamente, dal fatto che alcuni workshop sono esauriti da gennaio. Segnaliamo che per le sessioni plenarie è prevista la traduzione simultanea anche in italiano.

>

OSTEOLOGY FOUNDATION

info@osteology.org http://www.osteology-cannes.org

TIXOS: polvere di titanio La linea di impianti TIXOS è frutto di anni di ricerche in collaborazione con le migliori Università e Centri di Ricerca nazionali e internazionali. Gli impianti Tixos, ottenuti con l’esclusiva e originale tecnica di microfusione di polvere di titanio tramite laser, vengono progettati in 3D: attorno a un nucleo estremamente compatto viene creata una superficie isoelastica che replica la geometria dell’osso spugnoso; questa struttura risulta essere estremamente mimetica, accelerando la guarigione ossea e favorendo una più rapida osteointegrazione, come dimostrato da diversi studi (bibliografia disponibile su www.leaderitalia.it) in vivo e in vitro. Le proprietà meccaniche di tali impianti risultano più elevate rispetto agli impianti tradizionali, mentre la morfologia della superficie favorisce la guarigione dell’osso, facilitando l’organizzazione 3D del network di fibrina, l’adesione delle cellule e la loro migrazione, gli scambi di fluidi e sostanze nutritive e lo sviluppo di una adeguata vascolarizzazione, 12

per l’organizzazione della matrice ossea. La geometria tridimensionale costituita da micro e macrocavità di dimensioni e forma definite, interconnesse da micropori, sembra favorire l’organizzazione del network di fibrina, promuovendo i processi di formazione ossea. >

LEADER ITALIA SRL via Aquileja 49 - 20092 Cinisello Balsamo (MIi) Tel. 02.618651 - www.leaderitalia.it – info@leaderitalia.it

Marzo 2011; 1(3)


prodotti_osseointegration

31-03-2011

15:14

Pagina 13

JOURNAL of OSSEOINTEGRATION Prodotti, aziende, eventi

<

TePe Implant Kit, la soluzione “tutto in uno” per la cura degli impianti Oltre 5 milioni di impianti dentali vengono inseriti ogni anno in tutto il mondo ed è un fatto ben noto che essi abbiano bisogno di cure attente per durare a lungo. Ma, come molti pazienti hanno sperimentato, una corretta igiene può essere difficile. L’azienda svedese TePe ha introdotto nel mercato il suo Implant Kit costituito da tre prodotti TePe, scovolini e spazzolini, appositamente selezionati per una completa pulizia degli impianti. TePe Implant Care ha un collo angolato e una testina con filamenti sottili per un facile accesso alle superfici linguale e palatale degli impianti. TePe Implant Brush, invece, ha una testina molto stretta e un collo lungo per l’accesso e la pulizia della parte esterna delle superfici dell’impianto. Lo Scovolino TePe, inoltre, pulisce in modo efficiente i lati degli impianti.

Nella confezione è presente la misura 0,5 mm (rosso) o 0,7 mm (giallo). Ogni spazzolino nel kit è stato sviluppato in collaborazione con esperti dentali e scelto per le sue particolari qualità, con un accesso facilitato in zone difficili da raggiungere. Informazioni dettagliate sono disponibili sul nuovo sito di TePe: www.tepe.com/implantcare, che contiene anche suggerimenti e consigli per la pulizia dell’impianto.

>

TEPE ITALIA Tel. 02.93291475 - 02.93595776 infoitalia@tepe.com www.tepe.com

Tutti in Messico al congresso FDI Come sempre, anche quest’anno per il congresso mondiale FDI è stata scelta una meta affascinante: Città del Messico, che ospiterà i congressisti dal 14 al 17 settembre prossimo.

Marzo 2011; 1(3)

Ancora una volta si sono dati appuntamento alla manifestazione i più importanti rappresentanti della professione odontoiatrica. Ricordiamo che in occasione del congresso mondiale si tengono gli incontri del consiglio direttivo FDI e delle 200 associazioni nazionali che a essa fanno capo, rappresentando quasi un milione di professionisti nel mondo, per discutere le posizioni e le politiche globali relative a problemi che vanno dall’etica al controllo delle infezioni, dall’accesso alle terapie alla prevenzione delle malattie e la fluoroprofilassi. Ovviamente la promozione della salute è un obiettivo importantissimo per FDI, che si attiva in tal senso attraverso varie iniziative che vanno dal sostegno ai programmi e politiche dell’OMS al lavoro con l’ONU per assicurare che gli obiettivi di sviluppo del millennio (Development Goals) prevedano componenti legati alla salute orale. Gli organizzatori sperano di raggiungere il record di presenze registrato a Città del Messico nel 1999, che furono ben 19 mila. Con una popolazione di circa 110 milioni di abitanti, oltre 75 mila dentisti e 30 mila studenti, il Mes13


prodotti_osseointegration

31-03-2011

15:14

Pagina 14

JOURNAL of OSSEOINTEGRATION >

Prodotti, aziende, eventi

sico rappresenta una delle realtà economiche più importanti dell’america latina e offre ottime opportunità di affari anche in campo dentale grazie alla rimozione delle barriere commerciali. La città sorge in una zona privilegiata, al centro del paese, in una sona montuosa a un’altezza media di 2300 m sul mare e conta circa 9 milioni di abitanti. La sola Città del Messico produce più di un terzo del

prodotto nazionale lordo dell’intera nazione messicana. >

FDI WORLD DENTAL CONGRESS congress@fdiworldental.org http://www.fdiworldental.org

Impianto conico 3,5 mm Isomed flapless. Inoltre, è indicato nello split crest, sia con scalpelli che con Piezo Surgery, proprio per la sua conicità che ne rende agevole l'inserimento riducendo i rischi di frattura ossea. L’impianto conico 3,5 mm di Isomed è disponibile in diverse lunghezze: 10; 11; 12; 14 e 16 mm; per il carico immediato bisogna utilizzare solo le misure 12;14 e 16 mm. Esso è dotato di un microfiletto per l'aggancio della corticale, di un filetto più aggressivo per la midollare e di un collarino lucido di 1 mm per il tragitto trasmucoso. Per il suo inserimento il professionista può utilizzare le frese specifiche o, in casi estremi, gli espansori ossei conici.

La società Isomed da anni è impegnata nella realizzazione di impianti in titanio e accessori odontoiatrici di elevata tecnologia. Al fine di permettere ai professionisti di affrontare con successo qualsiasi situazione clinica, Isomed ha recentemente introdotto sul mercato l’impianto conico 3,5 mm, concepito per creste mandibolari e mascellari molto sottili, dello spessore di circa 2,5 mm. Il suo profilo conico ed il filetto molto aggressivo lo rendono adatto all'inserimento con gli espansori conici, sia a lembo che con tecnica

>

ISOMED SRL Via G. Mameli, 50 - 35020 Albignasego (PD) Tel. +39 049 8629612 Fax +39 0498629816 info@isomed.it www.isomed.it

Journées Dentaires di Nizza Dal 18 al 20 maggio si tiene la XIX edizione delle Journées Dentaires di Nizza: tre giorni di formazione continua per rispecchiare le esigenze della professione. L’intento degli organizzatori è fornire soluzioni concrete e immediatamente traducibili nella pratica quotidiana alla luce non solo dei progressi scientifici, ma anche della loro applicabilità in termini economici. Le Journées Dentaires sono caratterizzate da sedute che abbracciano tutte le discipline odontoiatriche secondo modalità diverse: interventi in diret14

ta su paziente, sedute interattive, lezioni magistrali o workshop in cui sarà possibile confrontare e perfezionare le proprie conoscenze.

>

JOURNÉES DENTAIRES DE NICE Journées Dentaires de Nice - CMIOM 28, Bd Raimbaldi - 06000 NICE - Francia Tel. +33(0)4 93 13 03 21 www.journees-dentaires.com

Marzo 2011; 1(3)


L’unica matrice extracellulare intatta (ECM) creata per rimodellare il tessuto molle DynaMatrix mantiene sia la struttura tridimensionale che le proteine segnale, importanti per la rigenerazione del tessuto molle. Le proteine segnale, presenti all’interno della membrana, comunicano con l’organismo per stimolare e favorire il naturale processo di guarigione. DynaMatrix favorisce l’angiogenesi

DynaMatrix con Segnali

►► Sottomucosa intatta del piccolo intestino di suino che mantiene una struttura tridimensionale. Il prelievo del tessuto intatto permette di conservare sia il collage che le proteine, contribuendo alla resistenza del tessuto. Queste proteine comprendono i fattori di crescita, le glicoproteine e i glicosaminoglicani (GAGs).

Solo Scaffold

DynaMatrix Favorisce la ricrescita dei tessuti

►► DynaMatrix si rimodella in tessuto naturale del paziente; è accettata dal corpo come tessuto nativo. ►► Il tessuto generato da DynaMatrix è simile al tessuto generato da un innesto autologo. ►► Facile da manipolare; può essere lasciata esposta; facile da tagliare quando è asciutta ma non si lacera quando è umida; flessibile ma resistente.

DynaMatrix con Segnali

Solo Scaffold

Keystone Dental Spa Via A. Fleming 19 - 37135 Verona - Italia Tel. +39 045 8230294

10-1298_Dynamatrix_Ad_IT_A4.indd 1

www.keystonedental.com

17/12/10 15:05


prodotti_osseointegration

31-03-2011

15:14

Pagina 16

JOURNAL of OSSEOINTEGRATION >

Prodotti, aziende, eventi

Congresso Nazionale SIO, un successo Lo scorso febbraio, nelle giornate di venerdì 11 e sabato 12, si è tenuto a Bologna il Congresso Nazionale SIO, il cui titolo “Nuove frontiere in implantologia” non avrebbe potuto essere più consono. Sono state infatti presentate alcune relazioni davvero interessanti. Molto attesa era la giornata di sabato, durante la quale si sono succeduti alcuni degli interventi più applauditi da parte dei partecipanti. Ugo Ripamonti con la relazione su “Induzione ossea da cellule staminali mioendoteliali” ha presentato alcuni dati delle ricerche sulla rigenerazione dei tessuti, a cui si dedica da tempo, in particolare sui fattori di crescita dei biomateriali. Il relatore ha illustrato alcune tecniche di ingegneria tissutale grazie alle quali è possibile ricreare parti importanti del viso, per esempio della mandibola. Carlo Mangano, nel suo intervento su “Direct titanium laser forming: la nuova tecnologia per ottenere impianti con superficie 3D” ha illustrato un nuovo metodo per la realizzazione di impianti tramite sinterizzazione laser delle polveri di titanio (quindi senza l’utilizzo del tornio). Marco Degidi con la relazione “L’impatto biologico del carico immediato sui tessuti perimplantari” ha spiegato alcune

tecniche originali di carico immediato per finalizzare le riabilitazioni implantoprotesiche in tempi brevi con risultati molto incoraggianti. Ricordiamo, infine, l’intervento di Adriano Piattelli su “Il ruolo delle forme e delle superfici”, nel quale è stata proposta un tecnica implantoprotesica che utilizza una particolare connessione conometrica che sta dando risultati molto interessanti e promettenti da un punto di vista biologico. Gli organizzatori si somo mostrati davvero soddisfatti per l’ampia partecipazione: sono intervenuti circa 1200 congressisti da tutta Italia testimoniando, così, l’elevata qualità dell’evento.

>

SIO www.osteointegrazione.it

Premium Day Sweden & Martina

Il Premium Day 2011, XI Congresso Nazionale di Implantoprotesi integrata, organizzato da Sweden & Martina, si terrà come di consueto presso il Centro Congressi Pietro d’Abano, ad Abano Terme (PD), nei giorni 10 e 11 giugno 2011, e sarà preceduto il 9 giugno dai consueti corsi precongressuali. Nel corso dell’evento Sweden & Martina consegnerà il Premio Roberto Cornelini, alla sua prima edizione, al miglior poster selezionato dalla 16

commissione esaminatrice e riguardante i temi: carico immediato, impianti postestrattivi, implantoprotesi software-assistita, impianti associati a terapie rigenerative. Durante il congresso i poster saranno esposti in una sezione dedicata all’interno del Teatro Pietro D’Abano; i quattro migliori lavori saranno nominati e premiati durante l’evento e saranno pubblicati nel magazine dell’azienda. Il vincitore avrà inoltre la possibilità di presentare il lavoro durante le giornate congressuali.

>

SWEDEN & MARTINA www.sweden-martina.com

Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION

>

PATRICIA MIRANDA BURGOS1, LUIZ MEIRELLES1-2, LARS SENNERBY1 Università di Goteborg, Sahlgrenska Academy, Goteborg, Svezia Dipartimento di Biomateriali, Istituto di Scienze Chirurgiche Dipartimento di Protesi, Istituto di Odontoiatria 1 2

Influenza dell’ampiezza del solco sulla stabilità degli impianti in titanio. Uno studio nel coniglio ABSTRACT Scopo Precedenti studi nel coniglio hanno dimostrato la preferenza della formazione di osso in presenza di solchi a livello della filettatura implantare rispetto alla filettatura priva di solchi. Il presente studio su modello animale è stato condotto per analizzare la risposta del tessuto osseo e la stabilità di impianti in titanio ossidati con solchi di ampiezza pari a 80, 110 e 160 μm praticati su un lato della filettatura. Materiali e metodi Sono stati utilizzati 96 impianti in titanio filettati, del diametro di 3,75 mm e lunghi 7 mm (TiUnite, MKIII, Nobel Biocare AB, Goteborg, Svezia): per lo studio sono stati praticati solchi profondi 70 μm con un’ampiezza di 80 (S0), 110 (S1) o 160 (S2) μm, mentre i controlli erano privi di solchi. Gli impianti sono quindi stati posizionati nel condilo femorale distale e nella metafisi tibiale di 12 conigli. Dopo 6 settimane gli impianti sono stati sottoposti all’analisi della frequenza di risonanza (RFA) e al test di torque di rimozione (RTQ) dopo aver ottenuto i campioni di sezioni per l’analisi al microscopio. Risultati È stato riscontrato un aumento significativo (22%) nella stabilità degli impianti S1 nei siti femorali rispetto agli impianti di controllo. La RFA non ha mostrato differenze significative tra gli impianti di studio e quelli di controllo. L’esame istologico ha rivelato che era più frequente il riempimento osseo nei solchi con ampiezza decrescente in parallelo all’aumentata frequenza di frattura ossea all’imbocco del solco in contrapposizione alla separazione all’interfaccia. Conclusioni Il presente studio ha dimostrato una stabilità rotazionale aumentata e massima degli impianti in titanio ossidati con solchi larghi 110 μm su un lato della filettatura rispetto a gli impianti di controllo senza solchi. L’aumentata stabilità osservata può essere spiegata dalla frattura dell’osso all’ingresso del solco in contrapposizione alla separazione dell’interfaccia come si vede nei solchi più ampi e negli impianti di controllo. KEY WORDS Analisi della frequenza di risonanza; Impianti dentari; Istologia; Ossidazione anodica; Osso; Solchi macroscopici; Torque di rimozione.

Marzo 2011; 1(3)

INTRODUZIONE L’assenza di mobilità all’interfaccia tra osso ed impianto in titanio è considerata negativa ai fini del raggiungimento e del mantenimento a lungo termine dell’integrazione degli impianti nell’osso. La stabilità primaria degli impianti è determinata da fattori quali la densità ossea, la tecnica chirurgica ed il disegno implantare e può pertanto essere influenzata dal chirurgo (1-3). La stabilità secondaria si aggiunge alla primaria e anch’essa dipende dalla risposta tissutale alla superficie implantare durante la guarigione (3, 4). Alcuni studi hanno dimostrato gli effetti positivi della modificazione della superficie di impianti in titanio sulla cinetica e la stabilità dell’integrazione. Per esempio, dal confronto tra superfici di titanio modificate e non è risultato che la formazione del contatto diretto tra osso e impianto è più rapida e di grado superiore (5-8), ed anche la resistenza alle forze di taglio è maggiore (9-12). Sebbene l’influenza dei fattori chimici di superficie non sia da sottovalutare, il risultato positivo è probabilmente un effetto della topografia modificata. Rivestimenti al plasma spray, sabbiatura, mordenzatura acida ed ossidazione anodica o la combinazione di queste tecniche di solito danno come risultato strutture a livello micrometrico ed un’area di superficie più ampia (13), che a sua volta offre un’aumentata ritenzione meccanica dovuta alla crescita di osso all’interno (14); ciò può spiegare i torque di rimozione più elevati per gli impianti con superfici ruvide rispetto a quelli con superficie più liscia. Però, è anche evidente che lo schema di integrazione ossea può essere diverso a seconda delle superfici. Generalmente ci si aspetta che le superfici implantari macchinate e relativamente lisce vengano integrate attraverso la cosiddetta osteogenesi a distanza, cioè la crescita di osso dalla osteotomia in direzione della superficie implantare (15), mentre è stato ipotizzato che anche alcuni impianti con superficie modificata presentano formazione di osso direttamente sulla superficie dell’impianto, la cosiddetta osteogenesi da contatto (16, 17). Il 17


JOURNAL of OSSEOINTEGRATION >

Burgos P.M., Meirelles L., Sennerby L.

concetto di osteogenesi da contatto prevede la migrazione e la differenziazione di cellule osteogeniche e la conseguente formazione di osso direttamente su una superficie non a contatto con l’osso circostante. I meccanismi precisi non sono noti, ma la ritenzione del coagulo ematico iniziale e il reticolo di fibrina per permettere la migrazione cellulare all’area dell’interfaccia e l’aggregazione delle piastrine è stata indicata come importante (18). Forse è più probabile che il processo di integrazione proceda con la formazione di osso lungo la superficie dell’impianto da un punto inizialmente a contatto con l’osso circostante, cioè l’osteoconduzione. In ogni caso, la topografia di superficie modificata può determinare forze meccaniche a livello cellulare che stimolano la formazione di gradienti chemiotattici e di altre molecole, che conducono la migrazione cellulare verso o lungo una superficie. Alcune sperimentazioni in vitro hanno mostrato che gli osteoblasti sembrano attaccarsi più saldamente alle superfici rugose rispetto a quelle lisce (19), e perciò le forze meccaniche applicate sulle cellule possono risultare diverse nelle due tipologie di superficie. In uno studio precedente sul coniglio, è stata studiata la risposta tissutale e la stabilità degli impianti in titanio filettati ed ossidati a cui erano stati praticati dei solchi di ampiezza di 110 o 200 µm su un lato della spira (20). È interessante rilevare che le analisi istologiche a sei settimane hanno rivelato un’affinità per la formazione dell’osso all’interno dei solchi rispetto alle superfici senza solco. La maggior parte degli impianti filettati era localizzata nel tessuto osseo midollare e senza contatti ossei primari; i risultati hanno mostrato che il solco ha fornito un ambiente adatto alla formazione ossea, probabilmente dovuto a forze meccaniche, ritenzione del coagulo ematico, presenza di agenti chemiotattici eccetera. Sembra che il tessuto osseo all’interno dei solchi originasse dall’osso corticale e seguisse il percorso del solco. I test di torque di rimozione hanno mostrato un incremento del 30% nella stabilità dei solchi larghi 110 µm rispetto agli impianti di controllo privi di solchi. Una maggiore ampiezza del solco non mostrava un tale incremento nella stabilità. Si è ipotizzato che la differenza fosse dovuta alla localizzazione della frattura ossea, che era sopra l’ingresso dei solchi larghi 110 µm e all’interfaccia tra osso e impianto nei solchi larghi 200 µm. Però in tale studio non è stato possibile verificare l’ipotesi poiché non sono state effettuate le analisi istologiche dopo i test di torque di rimozione. Lo scopo del presente studio è valutare ulteriormente l’influenza di solchi macroscopici sulla stabilità di impianti in titanio a forma di vite, con superficie ossidata misurata con l’analisi di frequenza della risonanza (RFA) e i test RTQ. Nel presente studio sono stati studiati solchi larghi 80, 110 e 160 µm e profondi 70 µm. Inoltre, l’interfaccia tra osso e impianto è stata analizzata istologicamente dopo test RTQ. 18

MATERIALI E METODI Animali e anestesia Nel presente studio sono stati utilizzati 12 conigli bianchi Nuova Zelanda, di almeno 6 mesi di età. Gli animali sono stati tenuti in libertà in una stanza dedicata allo scopo e sono stati alimentati ad libitum con acqua e dieta standard per animali da laboratorio e carote. Prima dell’intervento chirurgico è stata praticata l’anestesia generale tramite iniezione intramuscolare di 0,2 mg/kg di fluanisone e fentanile (Hypnorm, Janssen Pharmaceutica, Bruxelles, Belgio) e iniezione intraperitoneale di diazepam (Stesolid, Dumex, Copenaghen, Danimarca) 1,5 mg/kg di peso corporeo. Ancora Hypnorm è stato aggiunto ove necessario. L’anestesia locale è stata praticata utilizzando 1 ml di 2,0% di una soluzione di lidocaina/epinefrina (Astra AB, Södertälje, Svezia). Dopo l’intervento gli animali sono stati tenuti in gabbie separate fino alla guargione delle ferite (1-2 settimane) e poi rilasciati nella stanza fino al termine della sperimentazione. Dopo l’intervento chirurgico sono stati somministrati antibiotici (Intenpencillin 2.250.000 IE/5 ml, 0,1 ml/kg di peso corporeo, LEO, Helsingborg, Svezia) ed analgesici (Temgesic 0,05 mg/kg, Reckitt & Colman, NJ, USA) come singole iniezioni intramuscolari per tre giorni. Lo studio è stato approvato dal comitato etico per le sperimentazioni sugli animali.

Impianti e analisi di superficie Sono stati utilizzati 96 impianti in titanio filettati, di diametro 3,75 mm e di lunghezza 7 mm (TiUnite, MKIII, Nobel Biocare AB, Goteborg, Svezia), privi di filettatura apicale. I tre gruppi degli impianti di studio presentavano un singolo solco posizionato al centro del lato della filettatura inferiore, cioè di fronte alla testa dell’impianto. I solchi erano profondi 70 µm ed erano larghi 80 (S0), 110 (S1) o 160 µm (S2) (Fig. 1). Gli impianti senza il solco sono stati utilizzati per il gruppo di controllo (C). tutti gli impianti sono stati sottoposti a modificazione di superficie tramite ossidazione anodica (TiUnite, Nobel Biocare AB, Goteborg, Svezia) secondo modalità descritte in precedenza. Gli impianti avevano una caratteristica interna particolare che permetteva l’utilizzo di uno speciale connettore (Stragrip, Nobel Biocare AB, Gothenburg, Svezia) per assicurare una solida presa al momento dell’inserimento dell’impianto e al momento delle misurazioni del torque di rimozione (specificato più sotto). L’analisi topografica è stata effettuata tramite l’interferometria ottica (MicroXAM, PhaseShift, Tucson, USA) con misurazioni di area di 200 x 260 µm (obiettivo da 50 x, fattore di zoom 0,625) e gli errori di forma sono stati eliminati con un filtro digitale gaussiano (dimensione 50x50 µm). Le immagini della sommità della filettatura, della vallata e del lato inferiore della filettatura e del solco sono state ottenute a tre livelli degli impianti: sommità, metà e fondo. Sono state analizzate 36 Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION <

Stabilità degli impianti con solchi macroscopici

Fig. 1 La microscopia a scansione mostra gli impianti di studio utilizzati: i solchi erano profondi 70 μm e avevano un’ampiezzaa di: a) 80 (S0); b) 110 (S1); c) 160 μm (S2). SO Sa Sds Sdr (μm) (/μm2)

S1

S2

Ctr

Sci (%)

Sa

Sds Sdr Sci (μm) (/μm2)

Sa Sds Sdr Sci (%) (μm) (/μm2)

Sa (%)

Sds Sdr Sci (μm) (/μm2) (%)

Sommità

mean 1,2 sd 0,2

0,1 0,0

53,3 1,8 8,1 0,1

1,1 0,1

0,1 0,0

48,3 1,7 5,1 0,2

1,2 0,1

0,1 0,0

52,5 1,8 6,7 0,1

1,0 0,1

0,1 0,0

44,5 5,7

1,7 0,1

Vallata

mean 1,2 sd 0,1

0,0 0,0

58,0 1,9 7,2 0,1

1,2 0,1

0,0 0,0

55,3 1,9 6,9 0,1

1,1 0,1

0,0 0,0

51,4 2,0 6,5 0,1

1,2 0,2

0,1 0,0

57,3 7,9

1,9 0,1

Lato

mean 1,1 sd 0,1

0,1 0,0

47,5 2,0 5,3 0,1

1,2 0,1

0,1 0,0

53,2 1,9 6,5 0,1

1,3 0,1

0,1 0,0

58,2 1,8 9,0 0,1

1,3 0,0

0,1 0,0

56,3 2,4

1,8 0,1

Solco

mean 1,1 sd 0,1

0,0 0,0

51,7 1,9 5,4 0,1

1,3 0,1

0,0 0,0

64,0 1,8 2,7 0,1

1,1 0,1

0,0 0,0

52,4 2,0 3,6 0,1

-

-

-

-

Tab. 1 Risultati delle misurazioni topografiche degli impianti utilizzati. aree per ciascun campione e sono stati calcolati i seguenti parametri tridimensionali. Sa (µm), cioè la media aritmetica della deviazione dell’altezza da un piano medio. Sds (µm-2), cioè la densità dei vertici. Sdr (%), cioè la percentuale di superficie sviluppata . Sci, cioè indice di ritenzione del fluido. Le descrizioni matematiche dei parametri possono essere reperite in letteratura (21).

Chirurgia Come siti di impianto sono stati scelti entrambe le metafisi tibiali ed i condili femorali distali. Sono stati inseriti 4 impianti, uno da ciascun gruppo, rispettivamente nei siti tibiali e femorali in base a uno schema alternato. In tal modo in ciascun animale sono stati inseriti 8 impianti. Le aree sperimentali sono state esposte attraverso una incisione cutanea mediale all’arMarzo 2011; 1(3)

ticolazione del ginocchio ed incisioni separate attraverso i fasci ed il periostio al di sopra di ciascun sito. Sono stati praticati due fori attraverso uno strato corticale in ciascuna metafisi tibiale e condilo femorale sotto abbondante raffreddamento con soluzione salina. Gli impianti sono stati posizionati dopo la preparazione con punte elicoidali da 2,0 e 3,0 mm e, poi, la vite è stata avvitata. Gli impianti sono stati inseriti con un torque di 30 Ncm. Non sono state utilizzate punte per svasatura, poiché le teste degli impianti poggiavano sull’osso corticale. Tutti gli impianti sono stati posizionati in maniera monocorticale. Il lembo fascioperiosteo e la cute sono stati richiusi in strati separati con suture riassorbibili. Dopo un periodo di guarigione di 6 settimane gli animali sono stati anestetizzati per le misurazioni di stabilità (specificate più avanti). Gli animali sono stati sacrificati tramite overdose di pentobarbitale (Mebumal, ACO Läkemedel, Solna, Svezia). 19


JOURNAL of OSSEOINTEGRATION >

Burgos P.M., Meirelles L., Sennerby L.

Analisi della frequenza di risonanza Tutti gli impianti sono stati sottoposti a misurazioni per l’analisi della frequenza di risonanza al momento del posizionamento e dopo sei settimane di guarigione utilizzando uno strumento Osstell (Integration diagnostics, Göteborg, Svezia). Il trasduttore per la frequenza di risonanza è stato collegato all’impianto perpendicolarmente all’asse lungo della tibia e del femore ed è stato registrato il valore ISQ (Implants Stability Quotient).

Test di torque di rimozione La resistenza al torque di rimozione è stata testata con un trasduttore di torque elettrico e consisteva in una barra di torsione montata su una struttura metallica stabile. L’osso con gli impianti è stato fissato in una morsa per assicurare l’applicazione del carico perpendicolare durante il test. La barra è stata collegata a ciascun impianto con il connettore sopra descritto. Un motorino elettronico ha esercitato il torque al valore massimo, che è stato registrato e conservato tramite un microprocessore. Al punto del cedimento dell’interfaccia tra l’osso e l’impianto, il picco di forza diminuiva e si osservava un leggero movimento rotatorio degli impianti.

Istologia Tutti gli impianti sono stati rimossi per l’esame istologico dopo le misurazioni di stabilità, cioè RTQ e RFA. Gli impianti ed i tessuti ossei circostanti sono stati rimossi in blocchi e fissati per immersione in formaldeide tamponata al 4%. I campioni sono stati disidratati con etanolo in sequenze graduali e poi inglobati in resina plastica fotopolimerizzabile (Technovit 7200 VCL, Kulzer, Friedrichsdorf, Germania). Le sezioni sono state tagliate lungo l’asse longitudinale e molate (Exakt Apparatebau,

Norderstedt, Germania). Le sezioni, di spessore di circa 10 µm, sono state colorate con blu di toluidina e pironina-G all’1%. Gli esami sono stati effettuati con microscopio Nikon Eclipse 80i (Teknoptik AB, Huddinge, Svezia) munito di sistema Easy Image 2000 (Teknoptik AB, Huddinge, Svezia) per le misurazioni morfometriche. La valutazione istometrica ha previsto quanto segue. > Misurazioni dello spessore dell’osso di supporto. Questo è stato definito come l’altezza del tessuto osseo proiettato verso la superficie dell’impianto dai tessuti circostanti (Fig. 2). > Quantificazione della proporzione dei solchi con e senza tessuto osseo. > Quantificazione della proporzione dei solchi con osso che mostrava fratture all’ingresso del solco. > Quantificazione della proporzione dei solchi con osso che non mostrava segni di frattura ma una separazione tra osso e superficie implantare.

Statistiche I test Wilcoxon Signed Rank e Spearman Rank Correlation sono stati utilizzati per le valutazioni statistiche del materiale. Veniva considerata differenza un valore di p<0,05.

RISULTATI Gli animali hanno risposto bene alla chirurgia e non sono state rilevate complicazioni durante il periodo di guarigione postoperatorio. Tutti i 96 impianti, 24 da ciascun gruppo, sono stati successivamente sottoposti a misurazioni RTQ e RFA. Una tipica sezione istologica di un sito di tibia comprendeva l’impianto e la corticale triangolare della tibia

Fig. 2 Immagini al microscopio. Le parentesi mostrano le altezze dell’osso di supporto. a) Visione di un sito di tibia in cui un sottile osso corticale protrude nel tessuto midollare dell’osso. b) Visione di un sito femorale che mostra un impianto circondato da osso sia corticale sia trabecolare. 20

Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION Stabilità degli impianti con solchi macroscopici

<

Fig. 3 Risultati delle misurazioni morfometriche degli impianti S0, S1 e S2 nei siti tibiali che mostrano una distribuzione dei solchi senza (blu) e con (rosso/giallo) tessuto osseo all’interno. Inoltre, le barrette rosse indicano solchi riempiti da osso che mostrano una separazione tra il tessuto osseo e la superficie dell’impianto alla fine del solco, mentre le barette gialle indicano solchi riempiti di osso che mostrano frattura dell’osso all’ingresso del solco. Vi era una correlazione statisticamente significativa tra frattura ossea e solchi di dimensioni minori e anche riempimento osseo (separazione ossea + frattura ossea) e solchi di dimensioni minori.

Fig. 4 Risultati delle misurazioni morfometriche degli impianti S0, S1 e S2 nei siti femorali che mostrano una distribuzione dei solchi senza (blu) e con (rosso/giallo) tessuto osseo all’interno. Inoltre, le barrette rosse indicano solchi riempiti da osso che mostrano una separazione tra il tessuto osseo e la superficie dell’impianto alla fine del solco, mentre le barrette gialle indicano solchi riempiti di ossocon frattura all’ingresso del solco. Vi era una correlazione statisticamente significativa tra frattura ossea e solchi di dimensioni minori e anche riempimento osseo (separazione ossea + frattura ossea) e solchi di dimensioni minori.

con midollo osseo all’interno (Fig. 2a). Occasionalmente si potevano osservare le trabecole ossee dalla parte laterale della tibia sporgersi verso la superficie implantare. L’impianto era fissato con una o due spire nel passaggio corticale, mentre le spire rimanenti erano situate nella cavità midollare. La rottura dell’interfaccia era evidente a causa del test RTQ distruttivo. Ciononostante, la formazione ossea era evidente a livello e vicino alla superficie implantare. L’osso corticale mostrava segni di rimodellamento sulle superfici sia del periostio sia dell’endostio. I siti femorali consistevano nello strato corticale esterno e varie quantità di osso spugnoso e midollo osseo (Fig. 2b). La maggior parte della superficie implantare era avvolta da osso trabecolare. Apicalmente era possibile osservare frammenti ossei spostati dalla procedura di perforazione. La formazione ed il rimodellamento osseo erano evidenti a livello e vicino

alla superficie implantare. La valutazione istomorfometrica mostrava in media 1,4 mm (SD 0,3) di osso di supporto negli impianti provenienti dalle tibie. Gli impianti femorali erano sostenuti da osso di 4,0 mm (SD 1,6). I siti anteriori del femore mostravano una quantità di osso di supporto leggermente superiore rispetto ai siti posteriori, mentre non vi erano differenze nei siti tibiali. Sia gli impianti femorali sia quelli tibiali mostravano un grado aumentato di riempimento osseo nei solchi di minore ampiezza (Fig. 3, 4). La frattura determinata dalle misurazioni RTQ era più spesso collocata all’interno dell’osso all’imbocco del solco per gli impianti S0 e S1 (Fig. 5 a-b). L’analisi statistica ha mostrato una correlazione significativa tra minore dimensione del solco e riempimento osseo e anche tra minor dimensione del solco e numero di fratture all’imbocco del solco per gli impianti sia femorali sia tibiali. In generale sono stati

Fig. 5 Immagini al microscopio. dei campioni dopo test RTQ che mostrano: a) solchi S0 con frattura ossea (freccia); b) solchi S1 con frattura ossea (freccia) e c) solchi S2 con separazione tra osso e superficie dell’impianto (freccia). Marzo 2011; 1(3)

21


JOURNAL of OSSEOINTEGRATION >

Burgos P.M., Meirelles L., Sennerby L.

rilevati valori di RTQ più elevati nei siti femorali rispetto a quelli tibiali. Vi era una correlazione tra valori RTQ e altezza dell’osso di sostegno sia nei siti femorali sia in quelli tibiali. Gli impianti femorali mostravano valori più elevati in maniera statisticamente significativa per S1, ma non altrettanto per gli impianti S0 e S2 rispetto a quelli di controllo (Tab. 2). La differenza percentuale media tra gli impianti di studio e quelli di controllo era 22,0% (SD 28,2), per gli impianti S1, 8,5% (SD 19,3) per gli impianti S0 e -3,7% (SD 22,2) per il gruppo S2. Per gli impianti tibiali non vi erano differenze statisticamente significative tra gli impianti test e quelli di controllo (Tab. 3). La differenza percentuale media tra impianti test e di controllo era del 19,6% (SD 50,2) per gli impianti S2, dello 0,3% (SD 36,5) per gli S1 e -1,9% (SD 28) per gli S0. Non vi erano differenze tra siti implantari anteriori e posteriori. Le misurazioni RFA hanno mostrato un aumento numerico dei valori di ISQ per tutti i gruppi di impianti. Non vi erano differenze statisticamente significative al confronto tra stabilità primaria, stabilità secondaria o modifiche di stabilità negli impianti di studio e in quelli di controllo (Tab. 4, 5).

Il presente studio sperimentale è stato condotto per

valutare l’influenza di varie ampiezze di solchi macroscopici sulla stabilità di impianti a vite in titanio valutata per mezzo delle analisi RTQ e RFA. I risultati delle misurazioni RTQ hanno mostrato che gli impianti nell’osso femorale con solchi di ampiezza di 110 µm (impianti S1) erano più stabili in maniera statisticamente significativa rispetto ai controlli privi di solco, circa il 22,0% (p<0,05). Tale dato è in linea con un precedente studio per il quale è stato utilizzato lo stesso modello animale (20). Però nel presente studio non sono state rilevate differenze statisticamente significative nell’osso della tibia, mentre lo studio precedente mostrava un aumento del 30% per gli impianti S1 in tale sito. Le differenze morfologiche tra la tibia e il femore possono spiegare le più elevate misurazioni di RTQ rilevate negli impianti femorali nel presente studio e anche le differenze tra gli impianti nella tibia in questo e nel precedente studio. Solo una o due spire erano localizzate nell’osso corticale della tibia. Piccole differenze nell’estensione del solco all’interno del sottile osso corticale possono dare come risultato variazioni notevoli nei valori di RTQ misurati. Pertanto, i valori sono fortemente dipendenti dallo spessore dell’osso corticale e della posizione verticale dell’impianto nella tibia. Il condilo femorale è composto sia dall’osso corticale sia da quello trabecolare sottostante, mentre la tibia ha solamente un sottile strato corticale. Le misurazioni

Gruppo

Valori picco Ncm (SD)

Differenza da Statistica controlli % (SD)

Gruppo

Valori picco Ncm (SD)

Differenza da Statistica controlli % (SD)

Controlli, n=12 S0, n=12 S1, n=12 S2, n=12

72,4 (18,5) 76,6 (13,5) 87,1 (23,4) 69,1 (19,4)

8,5 (19,3) 22,0 (28,1) -3,7 (22,2)

Controlli, n=12 S0, n=12 S1, n=12 S2, n=12

46,8 (11,2) 45,0 (13,6) 49,9 (12,7) 52,6 (13,2)

-2,0 (28) 0,3 (36,5) 19,6 (50,2)

DISCUSSIONE

NS 0,03 NS

Tab. 2 Risultati delle misurazioni RTQ degli impianti femorali.

NS NS NS

Tab. 3 Risultati delle misurazioni RTQ degli impianti tibiali.

Gruppo

RFA in ISQ (SD)

Statistica ISQ (SD)

RFA da ISQ (SD)

Statistica

Cambio ISQ (SD)

Statistica

Controlli, n=12 S0, n=12 S1, n=12 S2, n=12

66,8 (5,5) 67,3 (4,1) 70,8 (6,2) 66,3 (5,1)

NS NS NS

73,3 (5,7) 77,2 (6,3) 75,6 (9,6) 74,6 (5,1)

NS NS NS

6,8 (6,0) 10,4 (7,4) 4,8 (13,7) 8,3 (8,6)

NS NS NS

Tab. 4 Risultati delle misurazioni RFA degli impianti femorali.

Gruppo

RFA in ISQ (SD)

Statistica ISQ (SD)

RFA da ISQ (SD)

Statistica

Cambio ISQ (SD)

Statistica

Controlli, n=12 S0, n=12 S1, n=12 S2, n=12

69,1 (5,4) 66,7 (3,7) 70,0 (1,8) 69,2 (5,4)

NS NS NS

74,5 (4,1) 73,8 (6,0) 72,6 (4,7) 72,9 (5,0)

NS NS NS

5,4 (6,1) 7,1 (7,3) 2,6 (5,6) 3,8 (8,4)

NS NS NS

Tab. 5 Risultati delle misurazioni RFA degli impianti tibiali. 22

Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION Stabilità degli impianti con solchi macroscopici

morfometriche hanno mostrato mediamente osso di sostegno circa tre volte maggiore negli impianti femorali rispetto a quelli tibiali. Ciò significa che gli impianti femorali ed i solchi presentavano una maggiore quantità di osso, che era evidenziata dai valori RTQ superiori, rispetto alla tibia al confronto con gli impianti di controllo. Sebbene l’osso di sostegno fosse tre volte maggiore, il valore RTQ era solo 1,6 volte maggiore negli impianti femorali. Ciò rispecchia probabilmente le proprietà biomeccaniche dell’osso trabecolare dei siti femorali. Il fatto che i siti femorali anteriori mostravano una maggiore presenza di osso di sostegno rispetto a quelli posteriori, senza che però vi fossero differenze nei valori RTQ, sarebbe da interpretare a sostegno di questa teoria. Lavori precedenti in cui sono stati utilizzati i test RTQ e l’analisi istologica hanno mostrato una correlazione tra la quantità di osso corticale e picchi nei valori RTQ (22-24). Inoltre, poiché in ciascun femore sono stati posizionati due impianti e l’osso spugnoso diminuisce in direzione mediale, la quantità di osso di sostegno variava in base alla posizione dell’impianto. Ciò si manifestava come una deviazione standard elevata per l’osso di sostegno nel condilo femorale distale. Le misurazioni RFA non hanno rivelato alcuna differenza tra gli impianti di studio e quelli di controllo relativamente alla stabilità, primaria o secondaria. È interessante notare che non vi sono chiare differenze nei valori di ISQ tra i siti tibiali e quelli femorali nonostante la diversa morfologia e il livello di osso di sostegno. Le tecniche RFA prevedono la misurazione della stabilità laterale (4) e gli studi hanno mostrato che la densità ossea è un fattore determinante per la stabilità primaria, purché il disegno implantare e la tecnica di inserimento utilizzati siano gli stessi (1-3). Sebbene i siti femorali contengano più osso, la densità dell’osso marginale sembra simile durante la perforazione. La frequenza applicata è probabilmente ridotta da 1-2 mm di osso denso, e ciò potrebbe spiegare l’assenza di differenze. In un precedente studio sugli impianti con solchi macroscopici è stato suggerito che i valori di RTQ più elevati riscontrati negli impianti con i solchi ampi 110 µm rispetto a quelli da 200 µm potrebbero essere spiegati dai diversi schemi di frattura/separazione all’interfaccia fra osso e impianto (20). L’analisi istologica effettuata dopo i test RTQ nel presente studio ha confermato l’ipotesi che l’osso si fratturasse a livello e al di fuori dell’imbocco del solco più frequentemente in presenza di solchi di ampiezza minore. In parallelo, un aumentato riempimento di osso è stato riscontrato nei solchi di minore ampiezza. Se vi è una correlazione lineare tra questi parametri e il risultato dei test RTQ, ci sarebbe da attendersi un aumento dei valori di RTQ con il diminuire dell’ampiezza del solco e non a un massimo di 110 µm. Però tale evenienza in presenza del massimo può essere spiegata nel modo seguente. > Per i solchi più ampi, cioè quelli di ampiezza di 160 µm (S2) in questo studio e quelli ampi 200 µm (S3) Marzo 2011; 1(3)

<

nello studio precedente, i valori delle misurazioni di RTQ sono determinati da una frattura localizzata a livello dell’interfaccia tra osso e impianto. > Per i solchi più stretti, il numero di fratture all’interno dell’osso all’imbocco del solco aumenta e diminuiscono le fratture all’interfaccia. Se la forza richiesta per fratturare l’osso è più intensa rispetto a quella necessaria per fratturare l’interfaccia, allora i valori di RTQ dovrebbero aumentare. Però, con il restringersi del solco diminuiscono le forze necessarie per fratturare l’osso all’imbocco del solco ed è prevedibile una riduzione dei valori di RTQ, avvicinandosi ai valori degli impianti di controllo privi di solchi. Perciò la curva dei valori RTQ in funzione dell’ampiezza del solco deve essere massima, che in questo esperimento sembra avere un picco vicino ai solchi ampi 110 µm (S1). Il presente studio ha confermato i nostri risultati precedenti, cioè che la formazione ossea si è verificata più spesso all’interno del solco rispetto alle superfici prive di solco, stante a indicare che il microambiente del solco ha favorito la formazione di osso. È interessante notare che le analisi istomorfometriche hanno rivelato anche un’aumentata affinità per la formazione di osso in presenza dei solchi di ampiezza ridotta. La risposta cellulare e tissutale alle superfici implantari con solchi è stata studiata in molte sperimentazioni in vitro (19) e in modello animale, nella fattispecie il coniglio (25). Da studi sulle colture cellulari è stato coniato il termine guida di contatto, in base all’osservazione che le cellule si orientano e migrano nella direzione dei solchi sul substrato. I solchi del presente studio erano molto più larghi di quelli generalmente utilizzati nelle sperimentazioni sopra menzionate e sembra improbabile che le differenze in riempimento dell’osso tra i solchi stretti e quelli più ampi possa essere spiegata solo dalla guida di contatto. La concentrazione e i gradienti degli agenti chemiotattici e di altro tipo nel processo di guarigione è una spiegazione più plausibile. Inoltre, è noto anche che la forma dell’impianto può influire sulla risposta del tessuto osseo ai biomateriali in seguito alla costrizione di popolazioni cellulari in uno spazio limitato che sembrerebbe favorire la differenziazione e la formazione ossea. Gli studi in vivo, comprese le osservazioni iniziali, possono aiutare a comprendere il meccanismo della crescita ossea di preferenza all’interno dei solchi più sottili. Tali studi sono in fase di realizzazione. In generale le analisi di superficie hanno mostrato una simile topografia per tutti gli impianti e tra le diverse parti degli impianti. La superficie all’interno del solco degli impianti S1 mostrava valori Sa e Sdr leggermente più elevati, indicando una maggiore rugosità che potrebbe aver contribuito ai risultati. Però, poiché le misurazioni sono state effettuate solo su un impianto per ciascun gruppo, questa differenza potrebbe non essere statisticamente verificata e potrebbe così dipendere da variazioni tra gli impianti. 23


JOURNAL of OSSEOINTEGRATION >

Burgos P.M., Meirelles L., Sennerby L.

In conclusione, il presente studio ha dimostrato un valore massimo di torque di rimozione dall’osso femorale negli impianti con solchi ampi 110 µm praticati su un fianco della filettatura. Il valore di RTQ massimo era significativamente diverso dai valori RTQ misurati nei solchi più ampi e più stretti. Una spiegazione del valore massimo è basata sull’osservazione che le fratture dell’osso al di sopra dell’imbocco del solco erano più frequenti nei solchi stretti rispetto a quelli ampi. L’analisi istologica ha rivelato un’affinità mai osservata in precedenza per la formazione di osso all’interno dei solchi di ampiezza minore.

RINGRAZIAMENTI Il presente studio ha ricevuto sovvenzioni da Stiftelsen Hjalmar Svenssons Forskningsfond e da Nobel Biocare AB, Goteborg, Svezia. Ringraziamo sentitamente le signore Petra Johansson e Ann Albrektsson per l’esperta assistenza. Si ringrazia anche il signor Jan Hqall, di Nobel Biocare AB, Goteborg, Svezia, per l’assistenza.

REFERENCES 1. Ostman PO, Hellman M, Wendelhag I, Sennerby L. Resonance frequency analysis measurements of implants at placement surgery. Int J Prosthodont 2006;19(1):77-83; discussion 84. 2. O'Sullivan D, Sennerby L, Meredith N. Measurements comparing the initial stability of five designs of dental implants: a human cadaver study. Clin Implant Dent Relat Res 2000;2(2):85-92. 3. Friberg B, Sennerby L, Meredith N, Lekholm U. A comparison between cutting torque and resonance frequency measurements of maxillary implants. A 20-month clinical study. Int J Oral Maxillofac Surg 1999;28(4):297-303. 4. Meredith N. Assessment of implant stability as a prognostic determinant. Int J Prosthodont 1998;11(5):491-501. 5. Ivanoff CJ, Hallgren C, Widmark G, Sennerby L, Wennerberg A. Histologic evaluation of the bone integration of TiO(2) blasted and turned titanium microimplants in humans. Clin Oral Implants Res 2001;12(2):128-34. 6. Ivanoff CJ, Widmark G, Johansson C, Wennerberg A. Histologic evaluation of bone response to oxidized and turned titanium micro-implants in human jawbone. Int J Oral Maxillofac Implants 2003;18(3):341-8. 7. Larsson C, Thomsen P, Lausmaa J, Rodahl M, Kasemo B, Ericson LE. Bone response to surface modified titanium implants: studies on electropolished implants with different oxide thicknesses and morphology. Biomaterials 1994;15(13):1062-74. 8. Zechner W, Tangl S, Furst G, Tepper G, Thams U, Mailath G, Watzek G. Osseous healing characteristics of three different implant types. Clin Oral Implants Res 2003;14(2):150-7. 9. Wennerberg A. On surface roughness and implant incorporation (PhD thesis) [PhD]. Göteborg: Göteborg University; 1996. 10. Gotfredsen K, Berglundh T, Lindhe J. Anchorage of titanium implants with different surface characteristics: an 24

experimental study in rabbits. Clin Implant Dent Relat Res 2000;2(3):120-8. 11. Carlsson L, Rostlund T, Albrektsson B, Albrektsson T. Implant fixation improved by close fit. Cylindrical implantbone interface studied in rabbits. Acta Orthop Scand 1988;59(3):272-5. 12. Buser D, Schenk RK, Steinemann S, Fiorellini JP, Fox CH, Stich H. Influence of surface characteristics on bone integration of titanium implants. A histomorphometric study in miniature pigs. J Biomed Mater Res 1991;25(7):889902. 13. Albrektsson T, Wennerberg A. Oral implant surfaces: Part 1--review focusing on topographic and chemical properties of different surfaces and in vivo responses to them. Int J Prosthodont 2004;17(5):536-43. 14. Schupbach P, Glauser R, Rocci A, Martignoni M, Sennerby L, Lundgren A, Gottlow J. The human bone-oxidized titanium implant interface: A light microscopic, scanning electron microscopic, back-scatter scanning electron microscopic, and energy-dispersive x-ray study of clinically retrieved dental implants. Clin Implant Dent Relat Res 2005;7 Suppl 1:S36-43. 15. Sennerby L, Thomsen P, Ericson LE. Early tissue responses to titanium implants inserted in the rabbit cortical bone. part 1. Light microscopic observations. Journal of materials Science: Materials in Medicine 1993;4(3):240-250. 16. Osborn JF, Newesely H. Dynamic aspects of the implantbone-interface. In: Heimke G, editor. Dental implant: Materials and systems; 1979; Munchen. Hanser. p 111123. (Dental implant: Materials and systems). 17. Davies JE. Understanding peri-implant endosseous healing. J Dent Educ 2003;67(8):932-49. 18. Park JY, Davies JE. Red blood cell and platelet interactions with titanium implant surfaces. Clin Oral Implants Res 2000;11(6):530-9. 19. Brunette DM. Principle of cell behaviour on titanium surfaces and their application to implanted devices. In: Brunette DM, Tengvall P, Textor M, Thomsen P, editors. Titanium in medicine. Berlin: Spinger Verlag; 2001. p 485-512. 20. Hall J, Miranda-Burgos P, Sennerby L. Stimulation of directed bone growth at oxidized titanium implants by macroscopic grooves: an in vivo study. Clin Implant Dent Relat Res 2005;7 Suppl 1:S76-82. 21. Stout K-J SP, Dong WP, Mainsah E, Luo N, Mathia T, Zahouani H. The development of methods for characterization of roughness in three dimensions. EUR 15178 EN of commision of the European Communities, University of Birmingham, Birmingham, 1993. 22. Ivanoff CJ, Sennerby L, Johansson C, Rangert B, Lekholm U. Influence of implant diameters on the integration of screw implants. An experimental study in rabbits. Int J Oral Maxillofac Surg 1997;26(2):141-8. 23. Ivanoff CJ, Sennerby L, Lekholm U. Influence of monoand bicortical anchorage on the integration of titanium implants. A study in the rabbit tibia. Int J Oral Maxillofac Surg 1996;25(3):229-35. 24. Sennerby L, Thomsen P, Ericson LE. A morphometric and biomechanic comparison of titanium implants inserted in rabbit cortical and cancellous bone. Int J Oral Maxillofac Implants 1992;7(1):62-71. 25. Hallgren C, Sawase T, Ortengren U, Wennerberg A. Histomorphometric and mechanical evaluation of the bone-tissue response to implants prepared with different orientation of surface topography. Clin Implant Dent Relat Res 2001;3(4):194-203. Marzo 2011; 1(3)


lasermade

The Laser Microfused

Tixos è una superficie porosa caratterizzata da cavità interconnesse, con geometria predeterminata, che favoriscono una rapida formazione ossea*.

Titanium Surface by LEADER

implants

Rapida crescita ossea all’interno delle cavità della superficie di

titanio microfuso Eccezionale

c r e s c i ta o s s e a

n e l l e c o n c av i t à d e l l ’ i m p i a n t o

titanio

osso

100 µm * Bibliografia disponibile a richiesta

L E AD E R I

T

A

L

I

A

LEADER ITALIA s.r.l. Via Aquileja, 49 - 20092 Cinisello Balsamo (MI) tel. 02 618651 - fax 02 6181397 - www.leaderitalia.it - info@leaderitalia.it


La tecnologia al servizio

dell’estetica

Laser-Lok® impianto ad 8 anni dalla sua protesizzazione: dimostra ottimo livello osseo coronale ed un eccellente mantenimento tissutale

Si ringraziano Dr. Cary A. Shapoff, DDS (parte chirurgica); Dr Jeffrey A. Babushkin, DDS (parte restaurativa)

Laser-Lok

®

Microscanalature La BioHorizons si avvale della scienza e dell’innovazione per realizzare impianti unici dai risultati chirurgici ed estetici senza precedenti. Le microscanalature Laser-Lok sono un esempio di tale dedizione nella ricerca e sviluppo. L’efficacia del Laser-Lok è stata comprovata da oltre 15 anni di studi in vitro, animali ed umani svolti presso le maggiori università.† Questo trattamento di superficie laser brevettato è l’unico nel settore ad inibire il downgrowth* epiteliale, ad indirizzare l’attacco del tessuto connettivo su zone predeterminate dell’impianto ed a preservare il livello osseo coronale a lungo termine.‡ Il trattamento Laser-Lok è disponibile su impianti: Tapered Internal, Single-stage, ed Internal.

Per maggiori informazioni: Class Implant Srl Tel 06/8744031-Fax 06/99698355 www.classimplant.com classimplant@classimplant.com

Referenze cliniche disponibili. *Riduzione cono fisiologico di riassorbimento Human Histologic Evidence of a Connective Tissue Attachment to a Dental Implant. M Nevins, ML Nevins, M Camelo, JL Boyesen, DM Kim. The International Journal of Periodontics & Restorative Dentistry. Vol. 28, No. 2, 2008. † ‡

SPMP09244 REV A OCT 2009

Italy aesthetics.indd 1

10/27/2009 11:54:06 AM


JOURNAL of OSSEOINTEGRATION

>

N.T.C. OLIVEIRA1-2, V. PERROTTI2, A. PALMIERI3, A.C. GUASTALDI1, A. PELLATI4, C.L. SCAPIN1, A. PIATTELLI2, F. CARINCI3 Biomaterials Group, IQ – Universidade Estadual Paulista - UNESP, Araraquara, Brasile Dipartimento di Stomatologia, Scuola di Odontoiatria, Università di Chieti-Pescara, Chieti 3 Dipartimento di Chirurgia Maxillo-Facciale, Università di Ferrara 4 Dipartimento di Morfologia ed Embriologia, Divisione di Istologia, Università di Ferrara, Ferrara 1 2

Analisi in vitro su cellule staminali di midollo osseo umano su lega Ti-15Mo per applicazioni su impianti odontoiatrici e ortopedici ABSTRACT Scopo Al giorno d'oggi, la ricerca sulle protesi ortopediche e dentali si concentra su leghe di titanio di tipo ‚ a causa delle loro caratteristiche proprieta’meccaniche e della loro resistenza alla corrosione nel corpo umano. Un altro aspetto importante da analizzare è la topografia di superficie, che è molto importante per l'osteointegrazione. Utilizzando un fascio di radiazione laser per rendere ruvida la superficie degli impianti, si ottiene un controllo più facile della micro-topografia, ed è evitata la contaminazione di superficie. Lo scopo di questo studio e’ stato valutare la risposta delle cellule staminali di midollo osseo umano ad una lega di titanio di tipo ‚ di nuova concezione, Ti-15Mo con topografia di superficie modificata mediante radiazione di fascio laser. Materiali e Metodi Sono stati preparati un totale di 10 dischi Ti (controllo), 10 dischi Ti-15Mo e 10 dischi Ti-15Mo trattati con radiazione laser. Per studiare come la topografia di superficie di Ti-15Mo possa indurre la differenziazione delle cellule staminali mesenchimali in osteoblasti, sono stati analizzati i livelli di espressione dei geni correlati all’osso e i marcatori delle cellule staminali mesenchimali, utilizzando in tempo reale la reazione di trascrizione inversa della catena della polimeras.. Risultati Nel Test 1 (confronto tra dischi Ti-15Mo e dischi Ti) la realtime RT-PCR quantitativa ha mostrato una significativa induzione di ALPL, FOSL1 e SPP1, che aumentano del 20% o più. Nel test 2 (confronto tra dischi Ti-15Mo e dischi Ti) sono stati studiati tutti i geni sovra-regolati. Confrontando il Test 1 e il Test 2 è stato rilevato che COL1A1, COL3A1, FOSL1 e ENG hanno aumentato sensibilmente la loro espressione mentre l’espressione di RUNX2, ALPL e SPP1 e’rimasta sostanzialmente invariata. Discussione e Conclusioni Il presente studio ha dimostrato che le leghe Ti-15Mo trattate con laser sono promettenti materiali per l'applicazione di impianti. PAROLE CHIAVE Cellule staminaliColtura cellulare; Leghe Ti15Mo; Immunofluorescenza; Trattamento superfici metalliche.

Marzo 2011; 1(3)

INTRODUZIONE Recentemente è stato osservato un crescente interesse nello sviluppo di una nuova generazione di materiali biocompatibili, resistenti alla corrosione e all'usura (1). Negli ultimi decenni il titanio e le sue leghe sono state ampiamente utilizzate come materiale per protesi ortopediche, impianti dentali e dispositivi medici (2). Il titanio e le sue leghe sono auspicabili per i materiali biomedici per la loro qualità superiore, come il basso peso specifico, l’elevata resistenza alla corrosione, il basso modulo di elasticità e la buona biocompatibilità. L'elevata resistenza alla corrosione del titanio e delle sue leghe è dovuta in parte ad una pellicola protettiva di biossido di titanio che si formata spontaneamente sulla sua superficie. Le proprietà fisicochimiche ed elettrochimiche del film di ossido e la sua stabilità a lungo termine in ambienti biologici svolgono un ruolo decisivo per la biocompatibilità delle protesi al titanio, inoltre, tale film migliora il processo di osteointegrazione (1-3). Inoltre, la superficie di TiO offre il sottofondo ideale per la formazione dei cristalli di fosfato di calcio, attraverso specifici processi di scambio chimico con i costituenti dei liquidi corporei, e questo si traduce in uno strato di interfaccia modificato e più spesso, il che può spiegare la provata biocompatibilità del film di ossido (3). Tuttavia, per un biomateriale metallico, è anche essenziale disporre di eccellenti proprietà meccaniche. In generale, le leghe Ti superano le proprietà meccaniche del Ti puro (4). Sono stati fatti diversi tentativi per sviluppare leghe di titanio di varia composizione, a base di elementi non tossici come Nb, Ta, Zr, Mo e Sn (4-5), per ottenere prestazioni migliori in termini di compatibilità biomeccanica (riducendo il modulo di Young) e di compatibilità biochimica (escludendo elementi tossici) (2). Negli ultimi anni, sono state studiate le leghe Ti-Mo applicate come biomateriali, con particolare attenzione alla loro 2

27


JOURNAL of OSSEOINTEGRATION >

Oliveira N.T.C. et al.

microstruttura e alle loro proprietà meccaniche (con diversi studi sulle trasformazioni di fase, sulla distribuzione dello stress, e sulle proprietà meccaniche) e sul loro comportamento elettrochimico (stabilità elettrochimica e resistenza alla corrosione nella media fisiologica simulata) (1, 2 e riferimenti ivi contenuti). Oliveira et al. (6), per mezzo di un'analisi elettrochimica, hanno trovato che le leghe di Ti-Mo sono promettenti materiali per dispositivi ortopedici, poiché la loro stabilità elettrochimica è direttamente associata alla biocompatibilità, soprattutto nel caso di Ti-15Mo. Inoltre, il design della superficie ideale è fondamentale per assicurare l'ancoraggio di lunga durata degli impianti. È noto che l'osso si forma direttamente sulla superficie degli impianti per mezzo dell'adesione di osteoblasti. Così, la formazione di osso è fortemente correlata con la composizione chimica della superficie dell'impianto, l'energia di superficie, e la morfologia della superficie. Pertanto, è molto importante un adeguato trattamento della superficie dell'impianto al fine di controllare la chimica dell'impianto stesso e le caratteristiche morfologiche (7). L’alterazione nella topografia di superficie, a causa del posizionamento fisico di solchi e depressioni lungo le superfici di titanio, ha dimostrato influenzare l'orientamento delle cellule attraverso l'orientamento del contatto (8-10). A questo proposito la sabbiatura, il plasma spray e l’acid etching sono diventati i tre metodi più comunemente utilizzati per modificare la topografia di superficie e aumentare la superficie degli impianti. Tuttavia, il problema principale del trattamento di superficie è la contaminazione durante la procedura di irruvidimento (11, 12). Mettendo a confronto impianti che presentano diversi processi di modifica di superficie attualmente sul mercato, come quelli meccanici (lavorazioni meccaniche e sabbiatura abrasiva), quelli chimici (acido etching e ossidazione), e quelli termici (plasma spray), è stato osservato che la superficie risultante dalla radiazione a raggi laser, presenta caratteristiche molto simili, senza il verificarsi di contaminazioni, in quanto si tratta di un processo pulito e riproducibile, inoltre, consente un migliore controllo delle variabili coinvolte in tale procedura (13). Utilizzando tecniche laser per irruvidire la superficie degli impianti si evita la contaminazione perché il laser permette il trattamento della superficie implantare senza contatto diretto, e si ottiene un controllo più facile della microtopografia, con rugosità sufficiente per una buona osteointegrazione (11, 12, 14). Lo scopo di questo studio è stato quello di valutare la risposta delle cellule staminali del midollo osseo umano (BM-hMSCs) ad una lega di titanio di nuova concezione, Ti-15Mo, con topografia di superficie modificata mediante radiazione con fascio laser. Inoltre, sono stati analizzati i livelli di espressione dei geni correlati all’osso e i marcatori delle cellule staminali mesenchimali. 28

MATERIALI E METODI Preparazione della lega Il peso percentuale della lega Ti-15Mo (Ti-15Mo wt.%) è stato ottenuto dalla fusione di elementi chimici di elevata purezza in un forno ad arco di fusione, attraverso un W elettrodo non consumabile e un focolare di rame raffreddato ad acqua in atmosfera ultrapura di argon, a seguito di una procedura ben nota descritta in letteratura (1, 15). La lega Ti-15Mo è stata studiata in condizioni controllate. Prima della preparazione dei dischi, i lingotti sono stati analizzati mediante EDX e XRF e sono stati trovati essere abbastanza vicini ai valori nominali. L’ analisi al SEM ha rivelato superfici prive di difetti del processo di fusione, mentre la mappatura di Mo mostra una distribuzione omogenea di questo elemento per tutte le leghe (questi dati non sono riportati nel presente articolo).

Preparazione dei dischi I lingotti ottenuti sono stati attivati su un tornio in formato cilindrico e poi tagliati con un disco di diamante in dischi (Ø 10mm x 2 mm di spessore). I campioni sono stati puliti con acetone per 10 minuti in un bagno a ultrasuoni e poi in acqua deionizzata. Sono stati ottenuti un totale di 20 dischi della lega che sono stati divisi in due gruppi: 10 superfici macchinate e 10 modificati mediante irradiazione laser. Inoltre, sono stati utilizzati come gruppo di controllo, 10 di puro Ti commerciale (Ti cp) con superficie lavorata. La procedura di irradiazione laser per i gruppi è stata effettuata con laser pulsato Yb (DML-100, Violin System Omnimark Laser,- Yb pulsata, 20W) nella normale atmosfera ambientale utilizzando i seguenti parametri: potenza 140%, velocità di scansione 100 mm/s; ripetizione tasso del 20 KHz, potenza di picco di 14,5 KW.

Preparazione delle staminali Le BM-hMSCs sono state ottenute da volontari adulti sani (età media 45 anni). Il midollo osseo è stato raccolto in provette eparinizzate, è stato diluito 1:3 con soluzione salina tamponata (PBS) (Lonza, Basilea, Svizzera) e stratificato su un gradiente di Ficoll-Histopaque (1.077g/ml; Sigma, St. Louis, MO). Le cellule mononucleate a bassa densità sono state lavate due volte in PBS, contate e placcate in 106/ cm2 in fiasche di coltura cellulare (Falcon BD, Bedford, MA, USA) in Dulbecco's Modified Eagle's Medium (DMEM) (Lonza, Basilea, Svizzera) integrate con 20% di siero fetale bovino (FBS) (Lonza, Basilea, Svizzera) inattivato dal calore e antibiotici (100 U/ml di Penicillina, 100 µg/ml di Streptomicina) (Sigma Aldrich, Inc., St. Louis, MO, USA), e incubate a 37° C in atmosfera umidificata con 5% di CO2. Dopo 1 settimana, le cellule non aderenti sono state rimosse, sostituendo il terreno supplementato con il 10% di FBS. Quando le colture sono state vicine alla confluenza (dopo 2 settimane) le cellule sono state recuperate, Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION <

Cellule staminali del midollo osseo umano su leghe Ti-15Mo in vitro per applicazioni implantologiche

mediante trattamento con 1X tripsina/soluzione di EDTA (Sigma Aldrich, Inc., St Louis, MO, USA), per l'analisi citometrica e per i test funzionali.

Immunofluorescenza Le cellule sono state lavate tre volte con PBS e fissate con metanolo freddo per 5 min a temperatura ambiente. Poi sono state bloccate con albumina bovina 3% (Sigma Aldrich, Inc., St. Louis, MO, USA) per 30 min a temperatura ambiente e sono state incubate per tutta la notte sequenziale a 4° C con anticorpi primari sollevati contro CD105 1:200, topo (BD Biosciences, San Jose, CA, USA), CD73 1:200, topo (Santa Cruz Biotecnologie, Inc., Santa Cruz, CA, USA), CD90 1:200, topo (Santa Cruz Biotecnologie, Inc., Santa Cruz, CA, USA), CD34 1:200, topo (Santa Cruz Biotecnologie, Inc., Santa Cruz, CA, USA). Sono state lavate con PBS e incubate per 1 ora a temperatura ambiente con anticorpi secondari coniugato-Rodamine anti- topo 1:200 (Santa Cruz Biotecnologie, Inc., Santa Cruz, CA, USA). Successivamente, le cellule sono state montate con il montaggio Vectashield medio con DAPI (Vector Laboratories, Inc., Burlingame, CA, USA) e osservate con un microscopio a fluorescenza (Eclipse TE 2000-E, Nikon Instruments Spa, Firenze).

Coltura cellulare Al quarto passaggio le BM-hMSCs sono state coltivate in un terreno di Alphamem (Sigma Aldrich, Inc., St. Louis, Mo, USA) supplementato con 10% di siero fetale bovino, antibiotici (Penicillina 100 U/ml e Streptomicina 100 µg/ml - Sigma Aldrich, Inc., St Louis, Mo, USA) e amminoacidi (L-Glutammina - Sigma Aldrich, Inc., St. Louis, Mo, USA). Le cellule sono state mantenute in atmosfera di CO2 del 5% umidificata a 37° C. Per lo studio, le cellule sono state raccolte e seminate a una denGene symbol SPP1 COL1A1 RUNX2 ALPL COL3A1 CD105 FOSL1 RPL13A

Gene name

sità di 1x105 cellule/ml in 9 cm2 (3 ml) di pozzetti utilizzando tripsina 0,1%, 0,02% EDTA in mezzo di Eagle senza ioni Ca + + - e Mg - per il rilascio delle cellule. Una serie di pozzetti sono stati coltivati su dischi di Titrattati (controllo), uno su dischi trattati Ti-15Mo (test 1) e uno su dischi Ti-15Mo trattati con laser (test 2). L’ambiente è stato cambiato ogni 3 giorni. Dopo 7 giorni, quando le culture sono state sub-confluenti, le cellule sono state trattate per l'estrazione dell'RNA.

Elaborazione dell’RNA La trascrizione inversa di cDNA è stata effettuata direttamente dal lisato di cellule in coltura con il TaqMAN Gene Expression Celle-to-Ct Kit (Ambion Inc., Austin, TX, USA), seguendo le istruzioni del produttore. Brevemente, le cellule in coltura sono state lisate con buffer di lisi e RNA rilasciato in questa soluzione. Il lisato cellulare è stato retrotrascritto in cDNA utilizzando la RT Enzyme Mix e opportuno buffer RT (Ambion Inc., Austin, TX, USA). Infine, il cDNA è stato amplificato dalla PCR realtime utilizzando il TaqMan Gene Expression Master Mix e i test specifici progettati per i geni studiati.

Real time PCR L’espressione è stata quantificata mediante real time RT-PCR. I livelli di espressione genica sono stati normalizzati per l'espressione del gene housekeeping RPL13A e sono stati indicati come variazioni rispetto all’espressione delle non trattate BM-hMSCs. La quantificazione è stata fatta con il metodo di calcolo delta/delta (16). I primer di Forward e Reverse e le sonde per i geni selezionati sono stati progettati utilizzando primer Software Express (Applied Biosystems, Foster City, CA, USA) e sono elencati nella tabella 1. Tutte le reazioni di PCR sono state eseguite in un volu-

Primer sequence (5’>3’)

F-GCCAGTTGCAGCCTTCTCA R-AAAAGCAAATCACTGCAATTCTCA collagen type I alpha1 F-TAGGGTCTAGACATGTTCAGCTTTGT R-GTGATTGGTGGGATGTCTTCGT runt-related transcription factor 2 F-TCTACCACCCCGCTGTCTTC R-TGGCAGTGTCATCATCTGAAATG alkaline phospatasi F-CCGTGGCAACTCTATCTTTGG R-CAGGCCCATTGCCATACAG collagen, type III, alpha 1 F-CCCACTATTATTTTGGCACAACAG R-AACGGATCCTGAGTCACAGACA endoglin F-TCATCACCACAGCGGAAAAA R-GGTAGAGGCCCAGCTGGAA FOS-like antigen 1 F-CGCGAGCGGAACAAGCT R-GCAGCCCAGATTTCTCATCTTC ribosomal protein L13 F-AAAGCGGATGGTGGTTCCT R-GCCCCAGATAGGCAAACTTTC

Probe sequence (5’>3’)

osteopontin

CCAAACGCCGACCAAGGAAAACTCAC CCTCTTAGCGGCCACCGCCCT ACTGGGCTTCCTGCCATCACCGA CCATGCTGAGTGACACAGACAAGAAGCC ATGTTCCCATCTTGGTCAGTCCTATGCG TGCACTGCCTCAACATGGACAGCCT ACTTCCTGCAGGCGGAGACTGACAAAC CTGCCCTCAAGGTCGTGCGTCTG

Table 1 Primer e sonde utilizzati nella real-time PCR. Marzo 2011; 1(3)

29


JOURNAL of OSSEOINTEGRATION >

Oliveira N.T.C. et al.

me di 20 µl utilizzando l'ABI PRISM 7500 (Applied Biosystems, Foster City, CA, USA). Ogni reazione conteneva 10 µl 2X TaqMan universal PCR master mix (Applied Biosystems, Foster City, CA, USA), 400 nM di ciascun primer e 200 nM della sonda e del cDNA. Il profilo di amplificazione è stato iniziato attraverso una incubazione di 10 minuti a 95° C, seguito da due stadi di amplificazione di 15 secondi a 95° C e di 60 secondi a 60° C per 40 cicli. Tutti gli esperimenti sono stati eseguiti includendo anche i controlli non-template per escludere la contaminazione dei reagenti. Le PCR sono state effettuate con due repliche biologiche.

RISULTATI Le BM-hMSCs sono state caratterizzate con immunofluorescenza. Le superfici delle cellule erano positive per marcatori di cellule staminali mesenchimali, CD105, CD90 e CD73 e negative per i marcatori di origine ematopoietica, CD34 (Fig. 1). Le espressioni trascrizionali di diversi geni osteoblasticorrelati (ALPL, COLIA1, COL3A1, ENG, FOSL1RUNX2, SPP1) e i marcatori delle cellule staminali mesenchimali (ENG) sono stati esaminati dopo 7 giorni di coltura su dischi di Ti-macchinato, dischi Ti-15Mo macchinato e

dischi Ti-15Mo trattati con laser. Nel Test 1 (confronto tra i dischi Ti-15Mo-macchinato vs dischi Ti-macchinato) la real-time RT-PCR quantitativa ha mostrato una significativa induzione di Alpl, FOSL1 e SPP1, che aumentano del 20% o più. Inoltre COL1A1, e RUNX2 sono stati sovra-regolati, ma ad un livello inferiore. Invece COL3A1 era sotto-regolato (Fig. 2) come ENG. La quantificazione è stata fatta con il metodo di calcolo delta/delta (come descritto nei materali e metodi). Non è stato possibile applicare l’ANOVA test dato che abbiamo eseguito la replicazione biologica (per esempio abbiamo effettuato pozzetti diversi trattati allo stesso tempo nello stesso modo). Nel Test 2 (dischi Ti-15Mo trattati con laser vs. dischi Ti macchinato) sono stati studiati tutti i geni sovra-regolati (Fig. 3).

DISCUSSIONE Il successo delle più attuali protesi ortopediche e dentali dipende dall’osteointegrazione; il desiderio e la necessità di aumentarla ha portato allo sviluppo di nuovi materiali e design implantari (17). La risposta degli osteoblasti agli impianti Ti dipende non solo dalla chimica dell'impianto, ma anche dalle

Fig. 1 BM-hMSCs mediante immunofluorescenza indiretta (Rodamine). Le cellule in coltura sono risultate positive per il marker CD73 delle cellule mesenchimali staminali (b), CD90 (c), CD105 (d) e negative per i marcatori ematopoietici CD34 (a). I nuclei sono stati colorati con DAPI. 40 x. 30

Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION <

Cellule staminali del midollo osseo umano su leghe Ti-15Mo in vitro per applicazioni implantologiche

Fig. 2 Analisi di espressione genica di BM-hMSCs coltivate su dischi TI trattati vs dischi trattati Ti-15Mo.

Fig. 3 Analisi di espressione genica di BM-hMSCs coltivate su dischi Ti-15Mo trattati con laser vs dischi Ti trattati.

proprietà fisiche della superficie dell'impianto, come la microtopografia e la rugosità. La natura dell'osso circostante, la formazione di tessuti duri intorno agli impianti è profondamente influenzata dalla superficie dell'impianto stesso (18). Gli impianti interagiscono fisicamente e chimicamente con i tessuti in cui essi si trovano e inducono la produzione di mediatori sistemici che hanno notevoli ripercussioni sui tessuti a più sedi lontane (18). Il titanio è un materiale ideale per indurre l'osteointegrazione, mentre un certo numero di altri materiali, quali l’acciaio inossidabile, tendono a promuovere la formazione di tessuto fibroso. Questo metallo è oggi uno dei materiali di impianto biocompatibile più utilizzato in clinica. Le leghe di titanio sono superiori al titanio puro in forza e, quindi, hanno sostituito il titanio puro in molti dispositivi ortopedici (18). Al fine di analizzare come le BM-hMSCs rispondono alla lega Ti-15Mo, con superficie modificata mediante radiazione da fascio laser, nel presente studio sono stati studiati i cambiamenti dell'espressione dei marcatori genici ossei correlati (RUNX2, SPP1, COLIA1, COL3A1, Marzo 2011; 1(3)

ALPL e FOSL1) e dei marcatori delle cellule staminali mesenchimali (ENG). Le cellule staminali mesenchimali sono definite come auto-rinnovabili, cellule progenitrici multipotenti con la possibilità di differenziare, sotto gli stimoli adeguati, in diverse linee mesenchimali, tra cui gli osteoblasti (19). Nel presente studio, le BM-hMSCs sono state isolate e caratterizzate per morfologia e immunofenotipo. Le BM-hMSCs isolate hanno mostrato morfologia fibroblasto-simile e sono risultate positive per le molecole di superficie MSC (CD90, CD105, CD73) e negative per i marcatori di cellule progenitrici ematopoietiche (CD34). Dopo 7 giorni di coltura i livelli di espressione di osteodifferenziazione genica sono stati misurati con metodi di quantificazione relativa utilizzando la realtime RT-PCR. Nel Test 1 (confronto tra dischi Ti-15Mo macchinato e dischi Ti- macchinato) la quantitativa real-time RT-PCR ha dimostrato che ALPL era significativamente sovraregolato nelle cellule staminali trattate rispetto al controllo. ALPL è ampiamente utilizzato come marcatore di 31


JOURNAL of OSSEOINTEGRATION >

Oliveira N.T.C. et al.

differenziazione degli osteoblasti, un aumento di espressione ALPL dovrebbe essere associato alla differenziazione degli osteoblasti. Il Ti-15Mo macchinato comporta anche significative sovra-regolazioni di SPP1. Questo gene codifica per l'osteopontina, che è una fosfoglicoproteina della matrice ossea, ed è la più rappresentativa componente non collagene delle matrice extracellulare ossea (20). L’osteopontina è attivamente coinvolta nei processi riassorbitivi dell’osso diretti dagli ostoclasti (21). L’osteopontina prodotta dagli osteoblasti, mostra alta affinità per le molecole di idrossiapatite presenti nella matrice extracellulare ed è chemiotattica nei confronti degli osteoclasti (22). FOSL1, un altro importante gene sovra-regolato nelle cellule staminali trattate, codifica per Fra-1, un componente del fattore dimerico di trascrizione attivatore della proteina-1 (Ap-1), che è composto principalmente da Fos (c-Fos, FosB, Fra-1 e Fra-2) e Jun proteine (cJun, JunB e JunD). I siti di AP-1 sono presenti nei promotori di molti geni che regolano gli osteoblasti, che includono anche la fosfatasi alcalina, il collagene I, l’osteocalcina. McCabe et al. (23) hanno dimostrato che l'espressione differenziale dei membri della famiglia Fos e Jun potrebbe svolgere un ruolo nella regolazione dell'espressione genica di sviluppo specifica per l'osso e, di conseguenza, può essere funzionalmente importante per la differenziazione degli osteoblasti. Kim et al. (24), studiando l'effetto di un nuovi agenti anabolizzanti che stimolano la formazione ossea, hanno trovato che questo gene si attiva in fase avanzata di differenziazione, durante la deposizione di calcio. ENG (CD105), un marker di superficie utilizzato per definire una popolazione di cellule stromali del midollo osseo in grado di differenziarzi in molte linee cellulari (25), non è risultato influenzato nelle cellule BMhMSCs trattate quando è stato confrontato con un controllo a 7 giorni. I Ti-15Mo macchinato modulano anche l'espressione dei geni che codificano per le proteine collagene della matrice extracellulare come collagene di tipo 1·1 (COL1A1). COL1A1 è risultato sovra-regolato come rispetto al controllo, quando è stato esposto ai Ti-15Mo macchinato. Invece, COL3A1 è risultato sotto-regolato, probabilmente perché questo gene si attiva in fase avanzata di differenziazione ed è legato alla sintesi della matrice extracellulare. L’espressione non ha avuto cambiamenti significativi nelle cellule trattate rispetto alle cellule di controllo dopo 7 giorni di trattamento. Il fattore trascrizionale RUNX2 era sovra-regolato, ma ad un livello inferiore. Questo gene è un modulatore chiave trascrizionale di differenziazione degli osteoblasti, che svolge un ruolo fondamentale nella maturazione degli osteoblasti e nell'omeostasi. I topi privi di RUNX2, nonostante il normale patterning scheletrico, non hanno osteoblasti e conseguentemente tessuto osseo. RUNX2 nella fase precoce della embriogenesi 32

determina la stirpe degli osteoblasti da cellule staminali mesenchimali multipotenti (26). Nel Test 2 (dischi Ti-15Mo trattati con laser vs dischi Ti macchinato) sono stati studiati tutti i geni sovra-regolati (Figura 3). Il risultato ha mostrato che i Ti macchinato hanno maggiori proprietà osteoinduttive rispetto a Ti-15Mo macchinato. Il presente studio ha mostrato l'effetto della modifica del laser su leghe di Ti-15Mo su BM-hMSCs nelle fasi differenziazione precoce. In particolare, la lega Ti15Mo ha dimostrato essere induttore di osteogenesi sulle cellule staminali umane. Confrontando il Test 1 e il Test 2, le leghe Ti-15Mo macchinato e laser-trattate rispettivamente, è stato rilevato che COL1A1, COL3A1, FOSL1 e ENG aumentato sensibilmente la loro espressione mentre l’espressione di RUNX2, ALPL e di SPP1 rimane sostanzialmente invariata. Questo studio dimostra che la rugosità superficiale di Ti-15Mo colpisce la proliferazione degli osteoblasti e l'espressione genica.

CONCLUSIONI In conclusione, il presente studio ha dimostrato che le leghe Ti-15Mo trattate con laser sono promettenti materiali per l'applicazione di impianti.

RINGRAZIAMENTI Questo lavoro è stato parzialmente supportato dalla Fondazione Cassa di Risparmio di Ferrara, Ferrara, Italia. Gli autori sono grati a FAPESP per borse di studio (Proc. 04/11751-8 e 08/04867-0) e sovvenzioni s (Proc. 2005/04050-6) che hanno reso possibile questo lavoro. Questo lavoro è stato in parte sostenuto dal Consiglio Nazionale delle Ricerche (CNR), Roma, Italia, dal Ministero dell'Istruzione, dell'Università e della Ricerca (MIUR), Roma, Italia.

BIBLIOGRAFIA 1. Oliveira NTC, Aleixo G, Caram R, Guastaldi AC. Development of Ti-Mo alloys for biomedical applications: Microstructure and electrochemical characterization. Mater Sci Eng A 2007;452-453:727-731. 2. Oliveira NT, Guastaldi AC. Electrochemical stability and corrosion resistance of Ti-Mo alloys for biomedical applications. Acta Biomater 2009;5(1):399-405. 3. Traini T, Mangano C, Sammons RL, Mangano F, Macchi A, Piattelli A. Direct laser metal sintering as a new approach to fabrication of an isoelastic functionally graded material for manufacture of porous titanium dental implants. Dent Mater 2008 Nov;24(11):1525-1533. 4. Lopez MF, Gutierrez A, Jimenez JA. In vitro corrosion behaviour of titanium alloys without vanadium. Electrochim Acta 2002;47(9):1359-1364. Marzo 2011; 1(3)


JOURNAL of OSSEOINTEGRATION Cellule staminali del midollo osseo umano su leghe Ti-15Mo in vitro per applicazioni implantologiche

5. Kuroda D, Niinomi M, Morinaga M, Kato Y, Yashiro T. Design and mechanical properties of new ‚ type titanium alloys for implant materials. Mater Sci Eng A 1998;243:244-249. 6. Oliveira NTC, Guastaldi AC, Piazza S, Sunseri C. PhotoElectrochemical Investigation of Anodic Oxide Films on ascast Ti-Mo Alloys. I. Anodic behaviour and effect of Alloy Composition. Electrochim. Acta 2009;54:1395-1402. 7. Bathomarco RV, Solorzano G, Elias CN, Prioli R. Atomic force microscopy analysis of different surface treatments of Ti dental implant surfaces. Appl Surf Sci 2004;233:29-34. 8. MacDonald DE, Rapuano BE, Deo N, Stranick M, Somasundaran P, Boskey AL. Thermal and chemical modification of titanium-aluminum-vanadium implant materials: effects on surface properties, glycoprotein adsorption, and MG63 cell attachment. Biomaterials 2004;25(16):3135-3146. 9. Rivera-Denizard O, Diffoot-Carlo N, Navas V, Sundaram PA. Biocompatibility studies of human fetal osteoblast cells cultured on gamma titanium aluminide. J Mater Sci Mater Med 2008;19(1):153-158. 10. Götz HE, Müller M, Emmel A, Holzwarth U, Erben RG, Stangl R. Effect of surface finish on the osseointegration of lasertreated titanium alloy implants. Biomaterials 2004;25(18):4057-4064. 11. Marticorena M, Corti G, Olmedo D, Guglielmotti MB, Duhalde S. Laser surface modification of Ti implants to improve osseointegration. J Phys Conf Ser 2007;59:662-665. 12. Gaggl A, Schultes G, Müller WD, Kärcher H. Scanning electron microscopical analysis of laser-treated titanium implant surfaces--a comparative study. Biomaterials 2000;21(10):1067-1073. 13. Braga FJC, Marques RFC, Filho EdA, Guastaldi AC. Surface modification of Ti dental implants by Nd:YVO4 laser irradiation. Appl Surf Sci 2007;253:9203-9208. 14. Cho SA, Jung SK. A removal torque of the laser-treated titanium implants in rabbit tibia. Biomaterials 2003;24(26):4859-4863. 15. Oliveira NTC, Biaggio SR, Piazza S, Sunseri C, Di Quarto F. Photo-electrochemical and impedance investigation of passive layers grown anodically on titanium alloys. Electrochim Acta 2004;49:4563-4576. 16. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25(4):402-408.

Marzo 2011; 1(3)

<

17. Zhang H, Ahmad M, Gronowicz G. Effects of transforming growth factor-beta 1 (TGF-beta1) on in vitro mineralization of human osteoblasts on implant materials. Biomaterials 2003;24(12):2013–2020. 18. Kim HJ, Kim SH, Kim MS, Lee EJ, Oh HG, Oh WM, Park SW, Kim WJ, Lee GJ, Choi NG, Koh JT, Dinh DB, Hardin RR, Johnson K, Sylvia VL, Schmitz JP, Dean DD. Varying Ti-6Al4V surface roughness induces different early morphologic and molecular responses in MG63 osteoblast-like cells. J Biomed Mater Res A 2005;74(3):366–373. 19. Alhadlaq A, Mao JJ. Mesenchymal stem cells: isolation and therapeutics. Stem Cells Dev 2004;13(4):436-448. 20. McKee MD, Farach-Carson MC, Butler WT, Hauschka PV, Nanci A. Ultrastructural immunolocalization of noncollagenous (osteopontin and osteocalcin) and plasma (albumin and alpha 2HS-glycoprotein) proteins in rat bone. J Bone Miner Res 1993;8(4):485-496. 21. Dodds RA, Connor JR, James IE, Rykaczewski EL, Appelbaum E, Dul E, Gowen M. Human osteoclasts, not osteoblasts, deposit osteopontin onto resorption surfaces: an in vitro and ex vivo study of remodeling bonee. J Bone Miner Res 1995;10(11):1666-1680. 22. Ohtsuki C, Kamitakahara M, Miyazaki T. Bioactive ceramicbased materials with designed reactivity for bone tissue regeneration. J R Soc Interface 2009 Jun 6;6 Suppl 3:S349360. 23. McCabe LR, Banerjee C, Kundu R, Harrison RJ, Dobner PR, Stein JL, Lian JB, Stein GS. Developmental expression and activities of specific fos and jun proteins are functionally related to osteoblast maturation: role of Fra-2 and Jun D during differentiation. Endocrinology 1996;137(10): 43984408. 24. Kim JM, Lee SU, Kim YS, Min YK, Kim SH. Baicalein stimulates osteoblast differentiation via coordinating activation of MAP kinases and transcription factors. J Cell Biochem 2008 Aug 1;104(5):1906-17. 25. Jin HJ, Park SK, Oh W, Yang YS, Kim SW, Choi SJ. Downregulation of CD105 is associated with multi-lineage differentiation in human umbilical cord blood-derived mesenchymal stem cells. Biochem Biophys Res Commun 2009 Apr 17;381(4):676-681. 26. Ducy P, Starbuck M, Priemel M, Shen J, Pinero G, Geoffroy V, Amling M, Karsenty G. A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev 1999 Apr 15;13(8):1025-1036.

33


art_Rosa_it

31-03-2011

15:33

Pagina 35

JOURNAL of OSSEOINTEGRATION

>

ANTONIO CANABARRO1, GRASIELE E. CRIPPA2, MARIANA U. SHIROZAKI2, EDUARDO M. SAMPAIO3, LOUIS-PHILIPPE LEFEBVRE4, PAULO T. DE OLIVEIRA2, MARCIO M. BELOTI2, ADALBERTO L. ROSA2 1

2 3 4

Dipartimento di Parodontologia, Scuola di Odontoiatria dell’Università Statale di Rio de Janeiro, RJ, Brasile Dipartimento di Parodontologia, Scuola di Odontoiatria dell’Università Veiga de Almeida, RJ, Brasile Laboratorio di Coltura cellulare, Scuola di Odontoiatria di Ribeirao Preto, Università di San Paolo, SP, Brasile Laboratorio di adesione e aderenza, Dipartimento di Ingegneria meccanica dell’Università Statale di Rio de Janeiro, RJ, Brasile Consiglio Nazionale di Ricerca Canadese, Istituto di Materiali Industriali, Boucherville, Canada

Effetto dello spessore del rivestimento di titanio poroso sull’espressione del fenotipo osteoblastico in vitro

ABSTRACT Scopo Il presente studio era finalizzato a determinare l’effetto di spessori differenti (0,5; 1,0 e 1,5 mm) del rivestimento di titanio (Ti) poroso (PC-0,5, PC-1,0 e PC-1,5) sull’espressione del fenotipo osteoblastico. Materiali e metodi Per mezzo del processo di metallurgia delle polveri sono stati ottenuti dischi di titanio denso ricoperti da uno strato di titanio poroso dello spessore di 0,5; 1,0 e 1,5 mm (rispettivamente PC-0,5; PC-1,0 e PC-1,5) avenei pori di diametro tra i 50 e i 400 μm e una porosità del 6%. Le cellule di osteoblasti ottenute da osso alveolare umano sono state coltivate sui dischi di titanio denso (D-Ti) e su quelli rivestiti di titanio poroso (PC-Ti) per periodi fino a 17 giorni. Risultati Le colture su PC-Ti hanno mostrato una percentuale di proliferazione più elevata rispetto a quelle su D-Ti. Il confronto tra i gruppi PC-Ti ha permesso di osservare differenze statisticamente significative sulle colture solo in decima giornata (PC 0,5 <PC-1,0 e PC-1,5). Le cellule coltivate su PC-1,5 presentavano la più elevata espressione genica di collagene di tipo 1 (COL), fosfatasi alcalina (ALP) e osteocalcina (OC). Il contenuto di calcio era significativamente maggiore sui PC-1,5 rispetto a tutti gli altri gruppi. Conclusioni Questi risultati indicano che il PC-Ti ha favorito la proliferazione delle cellule osteoblastiche. Inoltre, ha aumentato l’espressione genica dei marker osteoblastici ed è stato osservato un contenuto più elevato di matrice mineralizzata nei campioni con lo spessore PC-Ti maggiore (PC-1,5). Pertanto, dovrebbero essere effettuate ulteriori valutazioni in vivo al fine di investigare se questa struttura possa essere presa in considerazione per l’applicazione clinica in implantologia. KEY WORDS Coltura cellulare; Interazione di cellule e materiali; Osso; Rivestimento poroso; Titanio.

Marzo 2011; 1(3)

INTRODUZIONE Il titanio (Ti) è il biomateriale maggiormente utilizzato per gli impianti ortopedici e odontoiatrici grazie alle sue buone proprietà meccaniche e alla elevata biocompatibilità, che permette il contatto diretto tra osso e impianto, definito osteointegrazione (1-6). Gli impianti sono generalmente prodotti in forma densa, che potrebbe determinare un limite, come l’instabilità all’interfaccia con i tessuti ospiti e la mancanza di ancoraggio biologico per la crescita di tessuto all’interno (7-10). In tale contesto sono stati analizzati diversi approcci di fissazione tra osso e impianto e i biomateriali porosi con una struttura tridimensionale sono stati proposti come alternativa per ottenere l’ancoraggio biologico attraverso la crescita di osso all’interno dei pori (11-13). Per queste strutture tridimensionali la dimensione ottimale del poro affinché si verifichi la crescita di osso all’interno è in genere tra i 50 e i 500 µm. La presenza di pori interconnessi consente lo sviluppo del sistema vascolare, che è necessario per la progressione della crescita ossea (8). Recentemente è stato sviluppato un nuovo processo di metallurgia delle polveri per la fabbricazione delle schiume di Ti con una microstruttura particolare. Il processo rende possibile la regolazione della dimensione del poro nei limiti del range necessario per la crescita ossea (14, 15). Attraverso la coltura di cellule preosteoblastiche MC3T3-E1 su questo tipo di Ti poroso preparato con tre dimensioni medie del poro, St. Pierre et al. hanno osservato che le cellule sono in grado di crescere e di differenziarsi senza che la dimensione del poro abbia un effetto rilevante nell’ambito dell’intervallo analizzato (15). Inoltre, abbiamo mostrato che le cellule derivanti dall’osso alveolare umano sono in grado di sviluppare il fenotipo osteoblastico e di produrre matrice extracellulare mineralizzata se coltivate su Ti poroso realizzato 35


art_Rosa_it

31-03-2011

15:33

Pagina 36

JOURNAL of OSSEOINTEGRATION >

Canabarro A. et al.

attraverso questo procedimento con dimensione del poro variabile tra i 50 e i 400 µm (16). Per quanto riguarda le applicazioni cliniche, gli impianti possono essere sia completamente porosi sia rivestiti da uno strato poroso. Poiché in vitro la crescita del tessuto può essere limitata alle regioni superficiali delle strutture porose del Ti e una struttura completamente porosa può mostrare ridotte proprietà meccaniche, gli impianti con rivestimento poroso sono spesso utilizzati per l’applicazione clinica (8). Sulla base di ciò, abbiamo ipotizzato che non solo la percentuale di porosità e la dimensione del poro, ma anche lo spessore dello strato poroso potrebbero influenzare il comportamento delle cellule ossee. Poiché fino a ora non figurano in letteratura lavori che focalizzano questo argomento, abbiamo deciso di analizzare nel nostro studio gli effetti di tre spessori di Ti poroso sullo sviluppo in vitro del fenotipo osteoblastico.

MATERIALI E METODI Realizzazione dei campioni di Ti Le schiume di Ti poroso sono stare realizzate secondo una procedura descritta in precedenza (14). La polvere di Ti è stata mischiata a secco con un legante in polietilene e un agente schiumogeno chimico (p,p’-oxybis[benzenesulfonyl hydrazide*). Questa miscela in polvere è stata versata in uno stampo e poi tramutata in schiuma con argon a 210° C. Il materiale risultante è stato separato a 450°C e presinterizzato a 800° C con argon. Dopo la tornitura i dischi di Ti poroso nei diversi spessori (0,5; 1,0 e 1,5 mm) sono stati lavati per 15 min in acetone in una vasca a ultrasuoni (Bandelin Sonorex, Amtrex Technologies Inc., St. Laurent, Quebec, Canada), i dischi sono stati poi messi a contatto con dischi di Ti denso (diametro 12 mm) e sinterizzati a 1400° C sotto vuoto per ottenere dischi di Ti rivestiti di Ti poroso di diversi spessori (rispettivamente PC-0,5, PC-1,0 e PC-1,5). Il rivestimento che ne è risultato presenta pori di dimensione variabile tra 50 e 400 µm e una porosità del 60%. Tutti i campioni sono stati autoclavati a 120° C per 40 min prima dell’utilizzo nelle sperimentazioni sulle colture cellulari.

Analisi di superficie La topografia di entrambe le tipologie di superficie, DTi e PC-Ti, è stata analizzata tramite microscopio elettronico a scansione (SEM - Jeol JSM 6301F, MA, USA). Le analisi della ruvidità di superficie sono state effettuate utilizzando uno strumento di scansione a contatto concepito per le misurazioni tridimensionali (Talyscan 150, Taylor Hobson, Leicester, England). Le misurazioni sono state effettuate su tre campioni di ciascun gruppo. Tre aree da 5,04 x 5,0 mm ciascuna sono state scannerizzate utilizzando un filtro gaussiano con una lunghezza d’onda di cutoff di 0,8 mm. Da ciascun cam36

pione sono stati tratti 121 profili che sono stati analizzati utilizzando il programma TalyMap (Taylor Hobson). Sono stati valutati i parametri di ampiezza della rugosità (Sa e St), che rappresenta la profondità dei solchi. I parametri spaziali (Str) e ibridi (Sdr) sono stati utilizzati per identificare la forza di consistenza (uniformità dell’aspetto della struttura) e per verificare il rapporto tra l’area di superficie (prendendo in considerazione l’altezza z) e rispettivamente l’area della x piatta e il piano y. Inoltre, sono stati analizzati anche i parametri bidimensionali Ra, Rt e Rz.

Coltura di cellule osteoblastiche derivate da osso alveolare umano I frammenti di osso alveolare umano (espianti) sono stati ottenuti da donatori sani in occasione di interventi di estrazione di terzi molari utilizzando i protocolli di ricerca approvati dal comitato etico di ricerca della scuola di odontoiatria di Ribeirao Preto dell’Università d San Paolo (Brasile). Le cellule osteoblastiche sono state ottenute da tali espianti per mezzo della digestione enzimatica utilizzando collagenasi di tipo II (Gibco – Life Technologies, Grand Island, NY, USA) come descritto in precedenza (17, 18). Queste cellule sono state coltivate in un mezzo essenziale minimo (Gibco), integrato con siero bovino fetale al 20% (Gibco), 50 µg/ml di gentamicina (Gibco), 0,3 µg/ml di fungizone (Gibco), 10-7 M desametazone (Sigma, St. Louis, MO, USA), 5 µg/ml di acido ascorbico (Gibco) e 7 mM di β-glicerofosfato (Sigma). Le cellule subconfluenti nella coltura primaria sono state prelevate dopo il trattamento con 1 µm di acido etilendiamminotetraacetico (EDTA) (Gibco) e 0,25% di tripsina (Gibco) e tenute in sottocoltura in 24 piastre per coltura (Falcon, Franklin Lakes, NJ, USA) su D-Ti e CP-Ti a una densità cellulare d 2x104 cellule per campione. Sono state tenute sottoculture di cellule su polistirene come controlli delle condizioni di coltura. Durante il periodo di coltura le cellule sono state incubate a 37° C in atmosfera umidificata con Co2 al 5% e aria al 95%; il mezzo è stato cambiato ogni 3 o 4 giorni.

Crescita cellulare La crescita cellulare è stata valutata attraverso l’analisi 3-[4,5-dimethylthiazol-2-yl]-2,5- difenil tetrazolio bromidio (MTT) ai giorni 1, 3, 7 e 10 (19). Le cellule sono state incubate con 100 µl di MTT (5 mg/ml) in PBS a 37° C per 4 ore. Il mezzo è stato poi aspirato dal pozzo e a ciascuno di essi è stato aggiunto 1 ml di acido isopropanolo (0.04 N HCl in isopropanolo). Le piastre sono state poi agitate su un apposito scuotitore per 5 min e 100 µl di tale soluzione sono stati trasferiti in un pozzetto formato 96 tramite piastre con pareti opache e fondo trasparente (Fisher Scientific, Pittsburgh, PA, USA). La densità ottica è stata letta a 570-650 nm sul lettore della piastra (Quant, Biotek, Winooski, VT, USA) e i dati sono stati espressi come assorbanza. I campioni Marzo 2011; 1(3)


art_Rosa_it

31-03-2011

15:33

Pagina 37

JOURNAL of OSSEOINTEGRATION Spessore del rivestimento di titanio ed espressione del fenotipo osteoblastico

di D-Ti e PC-Ti sono stati incubati in un mezzo di coltura privo di cellule, analizzati e l’assorbanza è stata sottratta dall’assorbanza degli esperimenti effettuati con le cellule per eliminare qualsiasi artefatto.

Estrazione dell’RNA e Real-Time PCR Le espressioni geniche di collagene di tipo I (COL), fosfatasi alcalina (ALP), osteocalcina (OC) e osteopontina (OPN) sono state analizzate attraverso la Real-Time PCR in settima giornata. I primer gene-specifici sono stati realizzati con Primer Express 2.0 (Applied Biosystems, Foster City, CA, USA) e sono presentati nella tabella 1. La RNA totale è stata estratta dalle cellule utilizzando il kit di estrazione RNA Promega (Promega, Madison, WI, USA), secondo le istruzioni del produttore. La concentrazione di RNA è stata determinata con la densità ottica a una lunghezza d’onda di 260 Nm, utilizzando lo spettrofotometro Biomate 3 (Thermospectronic, Rochester, NY, USA). Il DNA complementare (cDNA) è stato sintetizzato utilizzando 2 µg di RNA attraverso una reazione di trascrizione inversa (M–MLV reverse transcriptase, Promega). La Real-Time PCR è stata effettuata con sistema di rilevazione della sequenza ABI prism 7000 utilizzando il sistema SybrGreen (Applied Biosystems, Warrington, UK). In ciascuna reazione sono stati utilizzati i primer specifici SybrGreen PCR MasterMix (Applied Biosystems) e 2,5 ng cDNA. Le condizioni standard di PCR erano 95° C (10 min) e 40 cicli a 94° C (10 min), 56° C (1 min) e 72° C (2 min) seguiti dalla curva di denaturazione standard. Per le analisi mRNA, il relativo livello di espressione genica è stato calcolato in relazione all’espressione della β-glucuronidasi (β-GUS) e normalizzato dall’espressione genica di cellule in sottocoltura su D-Ti utilizzando il metodo della soglia del ciclo (Ct) (20).

Geni

Sequenza del primer Sequenza del primer inversa

TF (°C)

bp

COL

AATCACCTGCGTACAGAACGG CAGATCACGTCATCGCACAAC

84

114

ALP

CGAGCTGAACAGGAACAACGT CCACCAGCAAGAAGAAGCCTT

84

104

OC

CAAAGGTGCAGCCTTTGTGTC TCACAGTCCGGATTGAGCTCA

85

150

OPN

AGACACATATGATGGCCGAGG GGCCTTGTATGCACCATTCAA

79

154

‚-GUS

CGTCCCACCTAGAATCTGCTG ACATACGGAGCCCCCTTGTC

82

130

*COL collagene tipo I; ALP fosfatasi alcalina; OC osteocalcina; OPN osteopontina; β−GUS, β− glucuronidase

Tab. 1 Sequenze del primer, temperatura di fusione (TF) e dimensione del prodotto (bp) per le reazione realtime PCR. Marzo 2011; 1(3)

<

Mineralizzazione della matrice extracellulare La mineralizzazione della matrice è stata rilevata a 17 giorni tramite rosso di Alizarina S (Sigma), che colora aree ricche di calcio. Le cellule adese erano fissate in formalina 10% per 2 h a temperatura ambiente. Dopo la fissazione i campioni sono stati disidratati attraverso una serie di passaggi graduali in alcol e colorati con rosso di Alizarina S (Sigma) al 2%, pH 4,2 per 10 min. Il contenuto di calcio è stato valutato utilizzando un metodo colorimetrico descritto in precedenza (21). Brevemente, 280 µl di soluzione al 10% di acido acetico sono stati aggiunti a ciascun pozzetto contenente i campioni di Ti marcati con rosso di Alizarina S e la piastra è stata incubata a temperatura ambiente per 30 min durante i quali è stata agitata. Questa soluzione è stata trasferita a un tubo per microcentrifuga e dopo aver vorticato per 1 min, l’impasto è stato coperto con 100 µl di olio minerale (Sigma), riscaldato a esattamente 85° C per 10 min e trasferito nel ghiaccio per 5 min; l’impasto è stato poi centrifugato a 20000 g per 15 min e 150 µl del supernatante sono stati trasferiti in un nuovo tubo per microcentrifuga. Poi, sono stati aggiunti 60 µl di una soluzione al 20% di idrossido di ammonio per neutralizzare l’acido e 210 µl contenenti questa soluzione sono stati letti a 405 nm in un pozzetto di formato 96 utilizzando piastre con pareti opache e fondo trasparente (Fisher Scientifici) tramite lettore di piastre Quant (Biotek). I dati sono espressi come assorbanza. I campioni di D-Ti e PC-Ti sono stati incubati in un mezzo di coltura senza cellule, saggiato e l’assorbanza è stata sottratta dagli esperimenti di assorbanza effettuati con cellule per eliminare qualsiasi artefatto.

Analisi statistica I dati quantitativi degli esperimenti di coltura cellulare presentati in questo articolo sono risultati rappresentativi di tre esperimenti distinti in cui sono state utilizzate tre serie di colture cellulari ottenute da tre donatori. La crescita delle colture e la mineralizzazione della matrice extracellulare sono stati valutati in quattro copie (n=4) e l’espressione genica in tre copie (n=3). I confronti sono stati effettuati utilizzando l’analisi della varianza (ANOVA) seguita dal test del range multiplo di Duncan, o test di Kruskal-Wallis, seguito dal test di Fisher basato sul grado, ove appropriato (livello di significatività: 5%).

RISULTATI Le microfotografie al SEM delle superfici D-Ti e PC-Ti sono mostrate nella figura 1. La superficie di Ti denso non era perfettamente liscia e potevano essere osservate delle linee di taglio (Fig. 1). La natura sferica e a poro aperto della polvere impiegata per produrre la schiuma era chiaramente visibile sulle superfici di PC-Ti (Fig. 37


art_Rosa_it

31-03-2011

15:33

Pagina 38

JOURNAL of OSSEOINTEGRATION >

Canabarro A. et al.

Fig. 1 Microfotografie al SEM ad alta risoluzione di Ti denso (D-Ti) e Ti con rivestimento poroso (PC-Ti). La superficie D-Ti (A) mostra una lieve rugosità con alcune linee di taglio. La struttura OC-Ti (B9 mostrava una topografia singolare, caratterizzata da un reticolo di particelle sferiche.

Fig. 2 Immagini di superficie generate al computer, profili di rugosità originari e profili di di funzione dell’autocorrelazione delle superfici di Ti denso (D-Ti) e con rivestimento poroso (PC-Ti). D-Ti /a, e E i), profili di scala (μm), rivestimento poroso 0,5 mm (PC-0,5 – B, F e J), profili di scala (mm), rivestimento poroso 1,0 mm (PC-1,0 – C, G e K), profili di scala (mm), rivestimento poroso 1,5mm (PC-1,5 – D, H e L), profili di scala (mm).

1B). Tutti i campioni di PC-Ti hanno dimensioni dei pori simili e l’unica differenza era lo spessore del rivestimento di Ti poroso. L’immagine generata al computer delle superfici D-Ti e PC-Ti confermava le caratteristiche osservate alle immagini al SEM (Fig. 2A-D). I profili di D-Ti (Fig. 2E) mostravano una morfologia periodica in un rapporto inferiore rispetto alle superfici PC (Fig. 2F-H). L’autocorrelazione delle superfici Ti presentava una componente non periodica che significa un pattern omogeneo (Fig. 2I-L). tutti i parametri della rugosità sono risultati maggiori sulle superfici PC-Ti rispetto ai campioni D-Ti (Tab. 2). Inoltre, non era possibile rilevare differenze significative nella rugosità tra le superfici PC-Ti (Tab. 2). Queste superfici erano abbastanza omogenee (Fig. 2F-H), come indicano i bassi valori di dispersione di 38

Rz (Tab. 2). Però, l’ampiezza dei valori di rugosità delle superfici PC-Ti erano significativamente maggiori rispetto alle superfici D-Ti. Le superfici PC-Ti mostravano anche l’isotropia più elevata, dato che i valori di Str tendono verso l’1, che significa una struttura spazialmente isotropica, cioè uniforme in tutte le direzioni senza un orientamento definito (Fig. 2B-D, Tab. 2). Al contrario, i campioni D-Ti presentavano una superficie con schema dominante (Fig. 2) e un valore Str inferiore (Tab. 2), stanti a indicare una struttura direzionale più forte. Abbiamo considerato PC-0,5, PC-1,0 e PC-1,5 come superfici isotropiche ruvide e le D-Ti come superfici anisotropiche lisce. Le analisi della coltura cellulare indicano che il numero delle cellule aumentava dal giorno 1 al giorno 110, a prescindere dalla superficie di substrato (p<0,0001) e vi Marzo 2011; 1(3)


art_Rosa_it

31-03-2011

15:33

Pagina 39

JOURNAL of OSSEOINTEGRATION <

Spessore del rivestimento di titanio ed espressione del fenotipo osteoblastico

Superfici Ti Ra (μm)

Rt (μm)

Rz (μm)

Sa (μm)

St

SsK

Str

Sdr (%)

D-Ti PC-0.5 PC-1.0 PC-1.5

1.70±0.36 135.00±5.57 138.00±6.08 132.00± 2.65

1.29±0.26 105.67±4.04 106.33±4.04 102.67±1.53

0.17±0.04 36.00±0.70 35.30±1.20 34.73±1.72

5.31±0.49 313.67±10.69 315.67±14.36 328.33±46.001

-0.01±0.031 -0.36±0.07 -0.33±0.05 -0.41±0.09

0.00±0.00 0.78±0.09 0.81±0.08 0.82±0.08

0.14±0.04 43.17±0.75 42.57±0.67 43.10±0.36

0.15±0.03 22.00±0.72 21.63±0.57 20.87±0.40

Ra deviazione media aritmetica del profilo di rugosità; Rt altezza totale del profilo di rugosità; Rz massima altezza del profilo di rugosità; Sa deviazione media aritmetica della superficie; St altezza totale della superficie; Ssk asimmetria della distribuzione dell’altezza della topografia; Str rapporto dell’aspetto della consistenza della superficie; Sdr rapporto dell’area sviluppata all’interfaccia; Valori parametrici presentati come media ± deviazione standard Statisticamente significativo (p<0,05) – PC-1,5; PC-1,0 e PC-0,5>D-Ti

Table 2 Parametri di rugosità misurati sulle superfici Ti dense ((D-Ti) e con rivestimento poroso (PC-Ti) (PC-0,5; PC-1,0 e PC-1,5).

Fig. 3 Curve di crescita (assorbanza) delle cellule osteoblastiche in sottocolture di Ti denso (D-Ti) e con rivestimento poroso (PC-Ti) ai giorni 1; 3; 7 e 10. Si notano cellule significativamente più numerose (p<0,0001) nelle colture cresciute su superfici PC-Ti nei giorni 3; 7 e 10 rispettoa D-Ti. Tra i gruppi PC-Ti, si osservano differenze statisticamente significative nelle colture solo a 10 giorni (PC-0,5 e PC-1,0<pc-1,5). Dati riportati come deviazione standard ± media (N=4).

Fig. 4 Espressione genica di collagene tipo I (COL), fosfatasi acalina (ALP), osteocalcina (OC) e osteopontina (OPN) nelle cellule osteoblastiche in sottocolture su Ti denso (D-Ti) e con rivestimento poroso (PC-Ti) per 7 giorni. Le cellule in sottocoltura su superfici con rivestimento poroso da 1,5 mm (PC-1,5) presentavano l’espressione più elevata (p<0,05) di tutti i geni valutati in confronto alle altre superifici Ti. I dati sono riportati come deviazione standard ± media (n=3). sono notate differenze statisticamente significative sulle colture cellulari solo a 10 giorni (PC-0,5 e PC1,0<PC1,5) (Fig. 3). Il fenotipo osteoblastico è stato confermato a livello di trascrizione dall’espressione di mRNA dei marcatori ossei nelle colture cresciute su superfici D-Ti e PC-Ti a 7 giorni. Nell’insieme, le cellule coltivate su PC-1,5 presentavano la più alta espressione (p<0,05) di COL, ALP e OC (Fig. 4). Il contenuto di calcio misurato dall’estrazione di rosso di Alizarina S dalla matrice mineralizzata era significativamente maggiore (p<0,05) su PC-1,5 rispetto a tutti gli altri gruppi (Fig. 5).

Fig. 5 Contenuto di calcio estratto dalla matrice extracellulare mineralizzata delle colture osteoblastiche cresciute su Ti denso (D-Ti) e Ti con rivestimento poroso (PC-Ti) per 17 giorni. La quantità di calcio era significativamente maggiore (p<0,05) sullle superfici con rivestimento poroso da 1,5 mm (PC-1,5) rispetto a tutte le altre superfici Ti. I dati sono riportati come deviazione standard ± media (n=4). erano significativamente più cellule (p<0,0001) nelle colture cresciute sulle superfici PC-Ti ai giorni 3, 7 e 10 rispetto a quelle di D-Ti. Confrontando i gruppi PC-Ti, si Marzo 2011; 1(3)

DISCUSSIONE La letteratura è generalmente concorde sul fatto che le proprietà di superficie di un impianto influenzino la risposta delle cellule ossee e, in definitiva, il processo di osteointegrazione. Sebbene il Ti presenti un successo clinico eccellente come biomateriale implantare, un numero rilevante di studi ha focalizzato le modificazioni di superficie per migliorare e/o accelerare la forma39


art_Rosa_it

31-03-2011

15:33

Pagina 40

JOURNAL of OSSEOINTEGRATION >

Canabarro A. et al.

zione di osso a diretto contatto con gli impianti in Ti. Il presente studio è stato concepito per investigare lo sviluppo del fenotipo osteoblastico di cellule derivate da osso alveolare umano coltivate su Ti denso e Ti ricoperto da uno strato di Ti poroso in tre spessori (0,5; 1,0 e 1,5 mm). In effetti, a conferma delle nostre ipotesi, i risultati indicano che lo spessore del rivestimento in Ti poroso ha un effetto sul comportamento delle cellule osteoblastiche. Inoltre, è stato osservato che l’espressione del fenotipo osteoblastico e la produzione di matrice extracellulare mineralizzata erano più elevate nei rivestimenti porosi di spessore maggiore (PC-1,5). Una possibile spiegazione per questi risultati è la maggiore superficie disponibile per l’apposizione di osso con l’aumentare dello spessore del rivestimento. Il rivestimento di Ti poroso utilizzato in questo studio aveva pori di dimensioni variabili tra 50 e 400 µm, che rientravano nel range di dimensione del poro ottimale ai fini della crescita ossea (7, 8, 22, 23). Per tutti i campioni, la topografia è stata analizzata utilizzando i parametri di ampiezza e frequenza e anche quelli di topografia di superficie utilizzati in precedenza per caratterizzare impianti finalizzati ad applicazioni ortopediche e odontoiatriche (24, 25). I valori di rugosità erano mediamente più elevati su PC-Ti rispetto a D-Ti (Sa era 200 volte maggiore sulle superfici PC-Ti). Relativamente alla distribuzione dell’altezza topografica, il valore di asimmetria di una superficie gaussiana con forma simmetrica è pari a zero. Per una distribuzione asimmetrica delle altezze di superficie, l’asimmetria potrebbe essere negativa o positiva. Tutte le superfici valutate in questo studio presentavano valori negativi, che stavano a indicare che la distribuzione ha una coda più lunga nella parte inferiore del piano medio, che significa più avvallamenti che picchi. Inoltre, le superfici PC-Ti mostravano la più elevata isotropia, dato che i valori Str tendono verso 1, stanti a significare una consistenza uniforme in tutte le direzioni senza un orientamento definito. In contrasto, i campioni D-Ti presentavano una superficie con uno schema dominante e i valori Str inferiori stavano a significare una struttura con una direzione decisa. Poiché la composizione chimica e la maggior parte dei parametri di superficie erano simili tra le superfici PC-Ti, è possibile ipotizzare che le differenze nelle risposte cellulari a queste superfici siano essenzialmente legate allo spessore del rivestimento di Ti poroso. Lo sviluppo del fenotipo osteoblastico è specifico per il sito scheletrico ed è più facilmente correlato a origini e funzioni embriologiche diverse di ciascun sito (26). Pertanto, negli studi sull’interazione tra cellule e biomateriali bisognerebbe tener conto della provenienza delle cellule. Avendo preso in considerazione le applicazioni odontoiatriche degli impianti, abbiamo deciso di condurre il presente studio utilizzando cellule osteoblastiche derivate da osso alveolare umano, che rappresenta il sito osseo più attivo di tutto il corpo umano (27). È 40

stato dimostrato che l’architettura dei biomateriali porosi può fornire un ambiente favorevole per la crescita cellulare. Le colture di cellule osteoblastiche derivate da osso alveolare umano presentavano una percentuale di proliferazione più elevata sul Ti poroso rispetto al Ti denso (16). Inoltre, le colture di cellule preosteoblastiche MC3T3-E1 derivate da calvaria di topo neonato e cellule MG63 cresciute su Ti poroso mostravano un maggior numero di cellule rispetto alla superficie di Ti, rispettivamente, denso o trattata (15-28). Per corroborare questi risultati, nel presente studio abbiamo dimostrato che la proliferazione cellulare valutata attraverso la riduzione del MTT dalla deidrogenasi mitocondriale di cellule vitali era significativamente aumentata nelle colture cresciute su superfici di PC-Ti. Oltre alla struttura tridimensionale che riproduce l'architettura dell'osso trabecolare e sostiene la crescita dell'osso all'interno, l'effetto positivo dei biomateriali porosi sulla proliferazione poteva anche essere attribuito alla più ampia area di superficie disponibile per l'apposizione cellulare (16, 29-31). Confrontando i gruppi PC-Ti, è stata solo rilevata una differenza statisticamente significativa sulla crescita delle colture a 10 giorni (PC-0,5 e PC-1,0<PC-1,5). Una possibile spiegazione è la ridotta penetrazione delle cellule nella struttura delle schiume, come dimostrato in precedenza utilizzando test simili in vitro in cui la crescita cellulare era limitata alle regioni superficiali della superficie porosa (16). Sono state inoltre osservate differenze significative tra Ti denso e Ti poroso relativamente alla differenziazione degli osteoblasti (15, 16). Un nostro studio precedente mostrava un ritardo nello sviluppo del fenotipo osteoblastico nelle colture sui dischi di Ti poroso dello spessore di 2 mm (16). I presenti risultati dimostrano che l'espressione genica di COL, ALP e OC, marker chiave del fenotipo osteoblastico, e la produzione di matrice extracellulare mineralizzata erano superiori nelle colture sul rivestimento di Ti poroso più spesso (PC-1,5) rispetto agli altri rivestimenti di Ti poroso (PC-0,5 e PC1,0) e superfici di Ti denso. Nell'insieme i risultati del nostro studio precedente su dischi di Ti poroso dello spessore di 2 mm e i presenti risultati con rivestimenti dello spessore di 0,5; 1,0 e 1,5 mm suggeriscono che lo spessore di 1,5 mm ha permesso in vitro una migliore risposta delle cellule osteoblastiche in termini di proliferazione, espressione del fenotipo osteoblastico e mineralizzazione della matrice extracellulare. In conclusione, il presente studio conferma che le superfici di PC-Ti prodotto attraverso un innovativo processo di metallurgia delle polveri ha permesso a cellule derivate da osso alveolare umano di aderire, proliferare, differenziarsi e produrre matrice extracellulare mineralizzata. Inoltre vengono presentati nuovi dati che indicano che lo spessore del rivestimento di Ti poroso esercita una influenza rilevante su tali eventi. Infine, il rivestimento di Ti poroso con uno spessore di Marzo 2011; 1(3)


art_Rosa_it

31-03-2011

15:33

Pagina 41

JOURNAL of OSSEOINTEGRATION Spessore del rivestimento di titanio ed espressione del fenotipo osteoblastico

1,5 mm sembra favorire la crescita degli osteoblasti, la differenziazione e la mineralizzazione della matrice cellulare. In tal modo dovrebbero essere effettuati ulteriori studi in vivo per verificare se tale struttura è la più adatta per le applicazioni cliniche in implantologia.

14.

RINGRAZIAMENTI

16.

Il presente studio è stato sostenuto dal Consiglio Nazionale per lo Sviluppo Scientifico e Tecnologico (CNPq, Brazil; Grant 151396/2007-8). Vorremmo ringraziare Roger Rodrigo Fernandes (USP, Brazil), Junia Ramos (USP, Brazil) e Hiata Anderson (IPRJ/UERJ, Brazil), per l’aiuto fornito durante gli esperimenti di coltura cellulare e nelle misurazioni della rugosità.

BIBLIOGRAFIA 1. Brama M, Rhodes N, Hunt J, Ricci A, Teghil R, Migliaccio S, et al. Effect of titanium carbide coating on the osseointegration response in vitro and in vivo. Biomaterials 2007;28(4):595-608. 2. de Oliveira PT, Zalzal SF, Beloti MM, Rosa AL, Nanci A. Enhancement of in vitro osteogenesis on titanium by chemically produced nanotopography. J Biomed Mater Res A 2007;80(3):554-64. 3. de Oliveira PT, Nanci A. Nanotexturing of titanium-based surfaces upregulates expression of bone sialoprotein and osteopontin by cultured osteogenic cells. Biomaterials 2004;25(3):403–13. 4. Carvalho DR, Carvalho PS, Magro Filho O, de Mello JD, Beloti MM, Rosa AL. Characterization and in vitro cytocompatibility of an acid-etched titanium surface. Braz Dent J 2010;21(1):3-11. 5. Rosa AL, de Oliveira CS, Beloti MM, Xavier SP, Oliveira PT. Effect of microcapsules containing TAK-778 on bone formation around osseointegrated implants: histomorphometric analysis in dogs. Implant Dent 2006;15(1):97-103. 6. Raines AL, Olivares-Navarrete R, Wieland M, Cochran DL, Schwartz Z, Boyan BD. Regulation of angiogenesis during osseointegration by titanium surface microstructure and energy. Biomaterials 2010;31(18):4909-17. 7. Li JP, Habibovic P, van den Doel M, Wilson CE, de Wijn JR, van Blitterswijk CA, de Groot K. Bone ingrowth in porous titanium implants produced by 3D fiber deposition. Biomaterials 2007;28(18):2810-20. 8. Li JP, Li SH, Van Blitterswijk CA, de Groot K. A novel porous Ti6Al4V: characterization and cell attachment. J Biomed Mater Res A 2005;73(2):223-3. 9. Pilliar RM. Powder metal-made orthopedic implants with porous surface for fixation by tissue ingrowth. Clin Orthop Relat Res 1983;(176):42-51. 10. Pilliar RM, Cameron HU, Welsh RP, Binnington AG. Radiographic and morphologic studies of load-bearing porous-surfaced structured implants. Clin Orthop Relat Res 1981;(156):249-57. 11. Wang X, Li Y, Hodgson PD, Wen C. Biomimetic modification of porous TiNbZr alloy scaffold for bone tissue engineering. Tissue Eng Part A 2010;16(1):309-16. 12. Maniatopoulos C, Pilliar RM, Smith DC. Threaded versus poroussurfaced designs for implant stabilization in bone-endodontic implant model. J Biomed Mater Res 1986;20(9):1309-33. 13. Singh R, Lee PD, Jones JR, Poologasundarampillai G, Post T, LinMarzo 2011; 1(3)

15.

17.

18. 19. 20. 21.

22. 23. 24. 25.

26.

27. 28. 29. 30. 31.

<

dley TC, Dashwood RJ. Hierarchically structured titanium foams for tissue scaffold applications. Acta Biomater 2010;6(12):4596604. Lefebvre LP, Thomas Y. Method of making open cell material. US Patent No. 6660224, 2003. St-Pierre JP, Gauthier M, Lefebvre LP, Tabrizian M. Three-dimensional growth of differentiating MC3T3-E1 pre-osteoblasts on porous titanium scaffolds. Biomaterials 2005;26(35):7319-28. Rosa AL, Crippa GE, de Oliveira PT, Taba M Jr, Lefebvre LP, Beloti MM. Human alveolar bone cell proliferation, expression of osteoblastic phenotype, and matrix mineralization on porous titanium produced by powder metallurgy. Clin Oral Implants Res 2009;20(5):472-81. De Assis AF, Beloti MM, Crippa GE, de Oliveira PT, Morra M, Rosa AL. Development of the osteoblastic phenotype in human alveolar bone-derived cells grown on a collagen type I-coated titanium surface. Clin Oral Implants Res 2009;20(3):240-6. Mailhot JM, Borke JL. An isolation and in vitro culturing method for human intraoral bone cells derived from dental implant preparation sites. Clin Oral Implants Res 1998;9(1):43–50. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65(1-2):55-63. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 22DDCT method. Methods 2001;25(4):402–8. Gregory CA, Gunn WG, Peister A, Prockop DJ. An Alizarin redbased assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Anal Biochem 2004;329(1):77–84. Ishaug-Riley SL, Crane-Kruger GM, Yaszemski MJ, Mikos AG. Three-dimensional culture of rat calvarial osteoblasts in porous biodegradable polymers. Biomaterials 1998;19(15):1405–12. Bobyn JD, Pilliar RM, Cameron HU, Weatherly GC. The optimum pore size for the fixation of porous-surfaced metal implants by the ingrowth of bone. Clin Orthop Relat Res 1980;(150):263-70. Anselme K, Bigerelle M. Topography effects of pure titanium substrates on human osteoblast long-term adhesion. Acta Biomater 2005;1(2):211-22. Bigerelle M, Anselme K, Noël B, Ruderman I, Hardouin P, Iost A. Improvement in the morphology of Ti-based surfaces: a new process to increase in vitro human osteoblast response. Biomaterials 2002;23(7):1563-77. Akintoye SO, Lam T, Shi S, Brahim J, Collins MT, Robey PG. Skeletal site-specific characterization of orofacial and iliac crest human bone marrow stromal cells in same individuals. Bone 2006;38(6):758–68. Xiao Y, Qian H, Young WG, Bartold PM. Tissue engineering for bone regeneration using differentiated alveolar bone cells in collagen scaffolds. Tissue Eng 2003;9(6):1167–77. Simon M, Lagneau C, Moreno J, Lissac M, Dalard F, Grosgogeat B. Corrosion resistance and biocompatibility of a new porous surface for titanium implants. Eur J Oral Sci 2005;113:(6):537-45. Holy CE, Fialkov JA, Davies JE, Shoichet MS. Use of a biomimetic strategy to engineer bone. J Biomed Mater Res A 2003;65(4):447–53. Pilliar RM. Powder metal-made orthopedic implants with porous surface for fixation by tissue ingrowth. Clin Orthop Relat Res 1983;(176):42-51. Wazen RM, Lefebvre LP, Baril E, Nanci A. Initial evaluation of bone ingrowth into a novel porous titanium coating. J Biomed Mater Res B Appl Biomater 2010;94(1):64-71. 41


Isomed Kono The Perfection of Konometric Implants Isomed Plus Overdenture with self-tapping screws with ball attachement

Corso di Implantologia a carico immediato e differito con il patrocinio di

The Perfection of Immediate Loading

ITALIAN ASSOCIATION OF NEW YORK UNIVERSITY COLLEGE OF DENTISTRY

16 Marzo - 5 Maggio - 9 Giugno 24 Marzo - 14 Aprile - 17 Maggio 15/16 Aprile - 1/2 Luglio 23/24 Settembre - 28/29 Ottobre 8-9 Luglio

>> Padova (Corso su Paziente) >> Firenze (Corso su Paziente) >> Padova (Corso di Gnatologia >> e Postura) >> Padova (Corso sui Tessuti Molli)

0/52 e l i , 5 Italy . Mam (Pd) Via G 12 Albign asego 86296 6 35020 049 +39 62981 tel. 49 8 39 0 d . i t fax + . i s o m e it omed. w w w trazione@is is ammin

iImplantar Sistemi

System - Implants Implantari Sistemi

ISOMED

Per ricevere il catalogo completo o la visita di un nostro agente contattate i nostri uffici

System Implant

ISOMED

Prof. Dt. Romanos - Rochester University

ISOMED S.r.l. - Via G. Mameli, 50/52 35020 ALBIGNASEGO (Pd) - Italy tel. +39 049 8629612 - fax +39 049 8629816 www.isomed.it - amministrazione@isomed.it


casi al bivio

31-03-2011

14:49

Pagina 43

JOURNAL of OSSEOINTEGRATION

>

1

MASSIMO FROSECCHI

Avulsione dei denti e inserimento differito degli impianti? Avulsione di denti e contemporaneo inserimento degli impianti? Staged approach?

CASI AL BIVIO LA SCHEDA Situazione clinica iniziale Necessità di riabilitazione dell’arcata superiore in un quadro clinico di parodontite cronica dell’adulto con cospicua perdita di attacco

Esami strumentali Sono stati realizzati i modelli di studio e gli esami radiografici bidimensionali: OPT e radiografie endorali

Possibili soluzioni terapeutiche dei denti in arcata e inserimento di impianti differito > Avulsione e contemporaneo inserimento degli impianti > Staged approach > Avulsione

Soluzione terapeutica adottata Il trattamento a stadi, permettendo di monitorare la situazione funzionale in tutte le fasi, garantisce un’adeguata estetica e fonetica

SITUAZIONE CLINICA INIZIALE Paziente FP, di sesso femminile, età 60 anni, nessuna patologia generale, fumatrice (<20 sigarette/die). La paziente è giunta all’osservazione in studio con la richiesta di eseguire la riabilitazione dell’arcata superiore. La paziente presentava un quadro clinico di parodontite cronica dell’adulto con cospicua perdita di attacco. Si evidenzava una notevole perdita di attacco a carico di quasi tuta la dentatura superiore e un sondaggio parodontale maggiore di 6 mm attorno alla maggioranza degli elementi superiori. I numerosi restauri protesici e conservativi si presentavano deteriorati e in parte infiltrati o decementati. Molte delle terapie canalari si presentavano insoddisfacenti e alcuni elementi presentavano segni di Marzo 2011; 1(3)

Fig. 1 Situazione clinica iniziale.

lesioni periapicali (Fig. 1). La paziente è stata sottoposta ad un ciclo di terapia causale della malattia parodontale consistente in sedute di motivazione, di igiene professionale e di levigatura radicolare nei quattro quadranti.

ESAMI STRUMENTALI Al termine di questa fase iniziale, sono stati realizzati i modelli di studio e gli esami radiografici bidimensionali (OPT e radiografie endorali). 43


casi al bivio

31-03-2011

14:49

Pagina 44

JOURNAL of OSSEOINTEGRATION >

CASI AL BIVIO

CASI AL BIVIO

SOLUZIONI TERAPEUTICHE PRESE IN CONSIDERAZIONE In accordo con la paziente, anche allo scopo di correggere la situazione estetica, è stata decisa la pianificazione di una riabilitazione implantoprotesica a carico dell’arcata superiore. Questo tipo di soluzione poteva essere perseguita secondo 3 modalità principali: 1) avulsione di tutti gli elementi dentari dell’arcata, applicazione di una protesi totale rimovibile provvisoria, esecuzione differita degli impianti e successiva protesizzazione; 2) avulsione di tutti gli elementi dentari dell’arcata e contemporaneo inserimento degli impianti, con eventuali interventi accessori (rialzo di seno, correzione di deficit ossei trasversali eccetera) e protesizzazione degli stessi mediante carico immediato; 3) approccio a stadi o “staged approach”, cioè estrazione di alcuni elementi dentali e protesizzazione fissa estesa supportata dagli elementi residui, inserimento di fixture ed esecuzione di interventi accessori in uno o più tempi chirurgici, successiva protesizzazione definitiva previa avulsione degli elementi dentari residui.

Fig. 2 Provvisorio esteso supportato da 4 elementi dentari residui.

Fig. 3 Radiografia al termine dell’inserimento di 4 fixture.

SOLUZIONE TERAPEUTICA ADOTTATA Allo scopo di garantire un’adeguata estetica e fonetica durante tutte le fasi del trattamento, monitorando la situazione funzionale, è stata scelta la soluzione di trattamento a stadi o “staged approach”. La scelta è stata fondamentalmente dettata dall’imprevedibilità di conseguire un’adeguata stabilità primaria di impianti postetrattivi immediati e un loro posizionamento in sedi tali da consentire un adeguato splintaggio. La quantità ossea nei settori late44

Fig. 4 rovvisorio supportato dai 4 impianti inseriti nella prima fase e 4 fixture inserite con interventi di incremento osseo (sinus lift). ro-posteriori non consentiva l'inserimento di impianti senza la realizzazione di tecniche di innesto. In particolare si sono resi

necessari interventi di rialzo di seno, rispettivamente con approccio crestale nella emiarcata di destra e con approccio laterale in Marzo 2011; 1(3)


casi al bivio

31-03-2011

14:49

Pagina 45

JOURNAL of OSSEOINTEGRATION CASI AL BIVIO

CASI AL BIVIO

Fig. 5 Radiografia di controllo della precisione dell’adattamento degli abutment implantari inglobati in una chiave in resina.

Fig. 6 Protesi definitiva in sede.

<

posizione utile a sostenere un provvisorio esteso (Fig. 2). Il provvisorio è stato realizzato prima delle estrazioni programmate e adattato ai suddetti elementi residui dopo la loro preparazione, al momento delle estrazioni. Dopo aver atteso la guarigione dei tessuti, sono stati posizionati 4 impianti nell’arcata, escludendo il settore superiore sinistro sede in cui era stato stabilito il rialzo di seno per via laterale (Fig. 3). Al termine della fase di osseointegrazione dei 4 impianti, è stato realizzato un secondo provvisorio, stavolta unicamente ad appoggio implantare, avvitato, in grado di sostituire il supporto dentale. All’applicazione dello stesso, sono stati estratti i 4 elementi dentari residui. Ad avvenuta guarigione dei tessuti molli, cioè 4 settimane dopo le avulsioni, sono state inserite altre 4 fixture, di cui 2 in sede degli incisivi laterali e 2, a sinistra, in contemporanea all’esecuzione del grande rialzo di seno (Fig. 4). Dopo aver atteso 6 mesi e accertata l’avvenuta osseointegrazione dei 4 impianti inseriti, è stata realizzata la protesi definitiva in lega di cromo, cobalto e composito, con metodica avvitata (Fig. 5, 6 e 7). La realizzazione di questo definitivo è stata caratterizzata da una relativa facilità nel conseguire elevati standard di estetica, fonetica e funzione grazie al percorso effettuato con i vari provvisori nel corso del trattamento.

CONCLUSIONI

Fig. 7 Arcata superiore avvitata in sede.

quella di sinistra. Sono stati quindi mantenuti degli elementi dentari "strategici" al solo scopo di mantenere in sede un restauro Marzo 2011; 1(3)

provvisorio nell’area estetica. In questo caso sono stati mantenuti 4 elementi dentari che presentavano una ridotta mobilità e una

Nella valutazione di come effettuare la transizione tra la dentatura residua, che sta andando incontro a perdita, e una riabilitazione impiantoprotesica devono essere valutati attentamente una serie di fattori. 1) Età del paziente. 2) Cause della compromissione degli elementi naturali. 3) Aspettative, desideri e aspetti 45


casi al bivio

31-03-2011

14:49

Pagina 46

JOURNAL of OSSEOINTEGRATION >

4)

5) 6) 7)

8)

CASI AL BIVIO

CASI AL BIVIO

psicologici riguardo la condizione di edentulia e all’importanza di mantenere soluzioni fisse durante tutte le fasi di trattamento. Possibilità di conseguire sufficiente stabilità primaria tale da consentire un trattamento di carico immediato. Sede e importanza degli elementi dentari residui. Evidenze scientifiche riguardo le possibilità di recupero e mantenimento. Capacità personali e di team per eseguire trattamenti dentali complessi e di lungo termine. Tempo e fattori economici.

Il cosiddetto staged approach permette di affrontare riabilitazioni estese in maniera sicura e prevedibile attraverso una stadiazione dei tempi chirurgici al fine di affrontare le fasi protesiche solo al momento in cui se ne è accertata l’attuabilità.

Il paziente, in questo tipo di approccio, riceve sempre una protesizzazione fissa, migliorando l’aspetto psicologico correlato al trattamento. Con questo approccio, il tempo totale del trattamento risulta sensibilmente aumentato, ma il paziente tende a mantenere livelli di comfort e di sicurezza elevati.

BIBLIOGRAFIA 1. Cordaro L, Torsello F, Ribeiro CA. Transition from a failing dentition to a removable implant-supported prosthesis: a staged approach. Quintessence Int. 2010 May;41(5):371-8. 2. Cordaro L, Torsello F, Ercoli C, Gallucci G. Transition from failing dentition to a fixed implant-supported restoration: a staged approach. Int J Periodontics Restorative Dent.

2007 Oct;27(5):481-7. 3. Jivraj S, Chee W. Transitioning patients from teeth to implants. Br Dent J. 2006 Dec 9;201(11):699-708. Links 4. Greenstein G, Cavallaro J Jr. Serial extraction protocol: transitioning a hopeless dentition to a full-arch reconstruction. Compend Contin Educ Dent. 2008 NovDec;29(9):526-34; quiz 535-6. 5. Amet EM. Management of unscheduled anterior tooth or prosthesis loss with extraction and immediate implant placement: a clinical report. J Oral Implantol. 2010;36(3):209-17. 6. Cooper LF, Rahman A, Moriarty J, Chaffee N, Sacco D. Immediate mandibular rehabilitation with endosseous implants: simultaneous extraction, implant placement, and loading. Int J Oral Maxillofac Implants. 2002 JulAug;17(4):517-25.

L’AUTORE Massimo Frosecchi si è laureato in Odontoiatria e Protesi Dentaria presso L'Università degli Studi di Firenze nel 1992. Corso di perfezionamento postlaurea in “Chirurgia Pre-protesica e Implantoprotesi”presso la stessa università, cattedra di Chirurgia Maxillo-facciale nell’anno 1994. Corso "Advanced Course in

46

Implantology and Bone Graft Harvesting" presso la New York State University at Buffalo, USA, nel 1995. Socio ITI (International Team for Implantology), dal 2005 relatore internazionale ITI, dal 2008 Fellow della sezione italiana. Dal 2006 al 2010 svolge attività didattica presso le Università di

Guarulhos, Sao Paulo, Brasile e presso la Università Uninove, Sao Paulo, Brasile. Nel 2007, relatore, presso la stessa Università nel corso di perfezionamento di implantologia. Relatore a corsi Master di Chirurgia Orale, Microscopia e Protesi presso le Università di Pisa, Firenze e Chieti dal 2006 al 2009.

Docente a contratto presso l’Università degli Studi di Chieti in Implantologia. Svolge l'attività libero-professionale presso il proprio studio in Firenze e attività di consulenza in campo implantologico.

Marzo 2011; 1(3)


ariesdue_corsi_2011_osseo

11-03-2011

11:43

Pagina 2

La formazione a distanza (FAD) permette l’aggiornamento tramite internet: quando (24 ore su 24), dove (casa, studio ecc...) come (accessibilità per un numero illimitato di volte) vuoi.

COUPON DI PAGAMENTO COMPILARE IN STAMPATELLO INDICARE CORSO/I PRESCELTI  Attualità nelle riabilitazioni implantoprotesiche [...]  La riabilitazione implantoprotesica dei settori posteriori [...]  Protesi fissa su dente naturale: dalla diagnosi [...]

Al superamento del test puoi stampare subito l’attestato con i crediti ECM.

Verso l’importo di euro

PAGAMENTO CON BONIFICO BANCARIO

DISPONIBILE DAL

DISPONIBILE DAL

DISPONIBILE DAL

10/02/2011AL 16/12/2011

10/03/2011AL 16/12/2011

10/01/2011AL 16/12/2011

CREDITI

CREDITI

CREDITI

CATEGORIA

ORE

CATEGORIA

ORE

CATEGORIA

ORE

ODONTOIATRI

6

ODONTOIATRI

6

ODONTOIATRI

6

ATTUALITÀ NELLE RIABILITAZIONI IMPLANTOPROTESICHE DEL MASCELLARE ATROFICO

LA RIABILITAZIONE IMPLANTOPROTESICA DEI SETTORI POSTERIORI DEL MASCELLARE ATROFICO

PROTESI FISSA SU DENTE NATURALE: DALLA DIAGNOSI ALLA GESTIONE DEL PROVVISORIO

RESPONSABILE SCIENTIFICO

RESPONSABILE SCIENTIFICO

RESPONSABILE SCIENTIFICO

Prof. Enrico Gherlone

Dott. Stefano Zandonella Necca

Dott. Loris Prosper

........................................................

nome cognome

.................................................................

ragione sociale

..................................................................

codice fiscale partita IVA

....................................................................

.........................................................................

indirizzo per fatture

............................................................

città

.................................................................................

cap

.....................................

tel. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Nello svolgimento del corso si prenderanno in considerazione le diverse situazioni cliniche di edentulia mascellare posteriore caratterizzate dai vari gradi di riassorbimento osseo. L’estrema variabilità dei quadri clinici di comune riscontro rende necessario un approccio diagnostico attento e articolato. Durante il corso verranno indicate le metodiche procedurali idonee per determinare un corretto inquadramento diagnostico e verranno prese in esame le possibilità terapeutiche. Partendo da cenni di anatomia e fisiologia del seno mascellare, si analizzeranno le metodiche di intervento sulle strutture proprie del seno paranasale e dell’osso alveolare al fine di rigenerare il tessuto osseo necessario alla riabilitazione impiantare. Tali metodiche comprendono il “rialzo per via crestale”, il “rialzo con antrostomia laterale” e le loro diverse varianti. Di pari passo si tratteranno concetti di implantologia protesicamente guidata e tecniche di programmazione protesica, con specifico riferimento alle problematiche determinate dall’atrofia ossea posteriore e dalle alterazioni dei rapporti intermascellari. Obiettivo del corso è quello di fornire semplici e razionali linee guida per il trattamento riabilitativo delle edentulie mascellari posteriori, laddove i fenomeni di riassorbimento alveolare e pneumatizzazione del seno mascellare, rendono problematiche le consuete tecniche di implantologia.

RELATORI*

RELATORI*

RELATORI*

Enrico Agliardi, Enrico Gherlone

Stefano Zandonella Necca,Paolo Folegatti

Loris Prosper, Marco Maria Cappello, Maura Mocchi, Edoardo Valenti

*Istituto Scientifico Universitario San Raffaele, Milano, Dipartimento di Odontoiatria, Direttore: Prof. E. Gherlone

Il corso suddiviso in tre moduli svilupperà alcuni aspetti inerenti la protesi fissa su denti naturali. Il primo modulo sarà incentrato sulla diagnosi e sulla valutazione approfondita del singolo caso clinico, aspetti fondamentali ed indispensabili per la formulazione di un piano di trattamento corretto. Verranno trattati quindi i parametri che definiscono gli aspetti estetici del sorriso, i concetti fondamentali dell’occlusione e le correlazioni ed interazioni tra le differenti branche della moderna odontoiatria. Il secondo modulo tratterà un aspetto prettamente più pratico, vale a dire la preparazione degli elementi dentali naturali. Verranno affrontati i principi generali di preparazione, nel rispetto dei fattori biologici, meccanici ed estetici. Il terzo modulo sarà invece dedicato alla gestione del restauro provvisorio, fornendo le linee guida sulla scelta del materiale più idoneo, sulle tecniche di fabbricazione, sulla ribasatura, sulla rifinitura e sull’importanza del provvisorio stesso per il raggiungimento di un risultato protesico finale ottimale. L’obiettivo formativo di questo corso è quello di trasmettere e far comprendere ai partecipanti alcuni degli aspetti determinanti nella realizzazione di una protesi fissa su dente naturale. Verranno fornite nozioni teoriche approfondite riguardanti l’aspetto diagnosticodecisionale, le differenti possibilità terapeutiche e le procedure cliniche nella preparazione dei denti naturali e nella gestione del provvisorio. Nozioni teoriche utili per creare un protocollo operativo per la protesi fissa che sia pratico, semplice e ripetibile e soprattutto che possa essere applicato ogni giorno nella propria attività lavorativa.

e-mail . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

IMPORTANTE Inviare via fax allo 031.79.07.43 allegando copia del bonifico

QUOTE DI PARTECIPAZIONE



La rivoluzione delle procedure implanto-protesiche a cui abbiamo assistito negli ultimi anni ha avuto come conseguenza una sempre crescente necessità formativa professionale, tramite aggiornamenti sia teorici che pratici. Lo sviluppo di nuove tecniche chirurgiche quali all-on-4, V-II-V e chirurgia computer assistita, ha portato una riduzione significativa dei tempi chirurgici e protesici, consentendo agli odontoiatri di soddisfare le richieste di risoluzione immediata da parte dei propri pazienti. Gli evidenti vantaggi di una chirurgia semplice e minimamente invasiva, unita alla possibilità di evitare il ricorso ad innesti ossei, anche nei casi più estremi, e l’utilizzo di un carico immediato, sono solo alcuni dei punti di forza sui cui si basano tali metodiche. I relatori del corso sono il dottor Enrico Agliardi, ideatore della tecnica V-II-V, e il professor Enrico Gherlone, tra i massimi esperti in campo implantoprotesico. Nonostante il conflitto di interesse, essendo ideatori ed utilizzatori delle metodiche stesse, i relatori offrono ai discenti un’opportunità unica di avvicinarsi a una tale evoluzione nel campo odontoiatrico, divenuta ormai una necessità alla luce degli evidenti dati scientifici di questi ultimi anni. Obiettivo del corso è quello di fornire al clinico le conoscenze teoriche dalle quali partire per un utilizzo quotidiano di tali tecniche, i principi scientifici alla loro base e la letteratura scientifica che li supporta. Verranno inoltre messi in evidenza i risultati estetici e funzionali a lungo termine e spiegate le metodologie di mantenimento nel tempo che hanno permesso di raggiungere un success rate negli anni prossimo al 100%.

CORSI PER ODONTOIATRI (acquistabili solo da abbonati a DOCTOR OS): › 1 CORSO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80,00 € › 2 CORSI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 150,00 € › 3 CORSI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200,00 € MODALITÀ DI PAGAMENTO Bonifico bancario intestato a: Ariesdue srl Cassa Rurale ed Artigiana di Cantù filiale di Carimate IBAN: IT 42 G 08430 51090 000000021586 Carta di credito e Paypal www.ariesdue.it

ARIESDUE Via Airoldi 11, 22060 Carimate (CO) tel. +39 031.79.21.35 fax. +39 031.79.07.43 www.ariesdue.it


La nostra storia parla da sempre di qualità e innovazione nella lotta al rischio di infezioni. Da oltre 20 anni, garantiamo sicurezza e protezione a voi e ai vostri pazienti, con prodotti all’avanguardia e di provata affidabilità. Strumenti di lavoro che rappresentano la soluzione ideale per chi opera nei settori dell’odontoiatria, dell’implantologia orale e della chirurgia generale. Con Omnia sicuri di essere sicuri.

by

OMNIA S.p.A. Via F. Delnevo, 190 - 43036 Fidenza (PR) Italy

www.omniaspa.eu OMNIA 210x297 ITA.indd 1

Tel. +39 0524 527453 - Fax +39 0524 525230 P.Iva /C.F. IT 01711860344 - R.E.A. PR 173685 Capitale sociale i.v. € 200.000,00

12/02/2010 9.54.50


pagina_iafil

31-03-2011

15:15

Pagina 1

JOURNAL of OSSEOINTEGRATION

IAFIL International Academy For Immediate Loading

Ing. Cinzia Della Valle

Incontro culturale IAFIL

S

abato 27 novembre 2010 presso il Novotel di Caserta, si è tenuto un convegno patrocinato dalla IAFIL e dalla sede casertana dell’AIO dal titolo: “Moderni approcci minimamente invasivi in Implantologia Orale”. Dopo i saluti di rito da parte del presidente della Commissione Albo degli Odontoiatri di Caserta, dottor Pietropaolo Schiavone, del presidente AIO Caserta e Campania dottor Generoso Del Piano e del Presidente IAFIL professor Stefano Fanali, il dottor Domenico Carbone, vicepresidente AIO Caserta e consigliere della Commissione Albo Odontoiatri di Caserta, ha presentato i relatori e gli argomenti. È stato il dottor Luigi Grivet Brancot ad aprire il convegno con una magistrale lezione di anatomia umana a fini implantari. Il professor Stefano Fanali, dopo brevi cenni storici sull’implantologia, ha descritto i fattori che concorrono all’integrazione di un impianto in titanio inserito nel mascellare, introducendo, nel contempo, l’intervento dell’ingegnere Cinzia Della Valle, ricercatrice del Politecnico di Milano, che ha presentato all’assemblea una metodica personale di trattamento della superficie impiantare, che è stata registrata come brevetto del Politecnico di Milano, e che è attualmente una delle superfici implantari più promettenti, per l’alta capacità di osteointegrazione mostrata in vari test in vivo e in vitro. Ha poi ripreso la parola il professor Fanali che ha illustrato una serie di casi clinici nei quali è stata utilizzata la metodica di “Implantologia Integrale”, definizione a lui cara e che mirabilmente esprime il carattere di universalità che una corretta implantologia a 360° dovrebbe avere. Tale metodica consente, in una sola seduta, di sostituire gli elementi dentali mancanti o irrimediabilmente danneggiati, mediante impianti in titanio elettrosolidarizzati che possono venire caricati in sicurezza immediatamente al termine dell’intervento. I vantaggi di tale tecnica consistono nell’inserimento prevalente, anche se non esclusivo, di impianti monolitici/monofasici, con tecnica flapless, e nel carico immediato degli stessi mediante una protesi provvisoria. Il fatto che siano impianti monolitici, rende molto più semplice la successiva presa dell’impronta per la realizzazione del manufatto protesico definitivo. Altro vantaggio della metodica è costituito dall’utilizzo di impianti di calibro ridotto, ma dotati di ampie spire, utilissimi in pazienti con scarsa quantità e qualità dell’osso, nei quali l’alternativa sarebbe quella di ricorrere a lunghi, costosi e non altrettanto sicuri processi di rigenera50

zione ossea. La presenza della barra in titanio elettrosaldata garantisce, inoltre, un’elevata stabilità primaria e uno scarico delle forze funzionali distribuito omogeneamente su tutti gli impianti. Una non trascurabile conseguenza della presenza della barra è costituita, inoltre, dall’assenza del cono di riassorbimento corticale, presente costantemente negli impianti bifasici di scuola svedese. L’impianto monolitico elimina la presenza di molte componenti (moncone, vite tappo, vite di guarigione, vite passante impianto-moncone, serie di cacciavite, chiavi a cricchetto, adattatori vari, eccetera), rendendo più semplice l’assortimento del kit chirurgico e riducendo notevolmente le complicanze postoperatorie che si presentano con gli impianti bifasici tradizionali, come per esempio lo svitamento del moncone, la rottura della vite di serraggio, eccetera. Ultimo ma non meno importante vantaggio è il costo inferiore della protesi, reso possibile dall’utilizzo di un minor numero di componenti, da una maggiore semplificazione nelle procedure di preparazione dei monconi e presa d’impronta e dalla riduzione dei tempi complessivi necessari al posizionamento degli impianti e alla successiva protesizzazione degli stessi, alla possibilità del carico immediato, alla riduzione o eliminazione delle tecniche di rigenerazione ossea e/o di trapianto osseo. La giornata di aggiornamento professionale è stata possibile grazie alla tenacia di persone che hanno fatto della loro professione un impegno, volto a rendere sempre meno impegnativa e dispendiosa questa branca dell’odontoiatria. Stefano Fanali Gentile socio, al fine di assicurarci che la rivista le sia stata recapitata, la invitiamo gentilmente a darcene conferma; verificando inoltre l’esattezza del suo indirizzo di spedizione la preghiamo di comunicare qualsiasi eventuale variazione a: info@iafil.eu, oppure chiamando la nostra infoline: 329-0493781 Marzo 2011; 1(3)


blossom_dental_tracc.indd 1

18/02/11 11.54


The Innovation is in the Conditioning. Uso intuitivo. Maggiore stabilità. Migliore osteointegrazione.

APLIQUIQ ®

INICELL®

Design funzionale.

L’evoluzione della superficie.

Basta spingere la cartuccia e agitare per condizionare

Permette un’eccezionale umettabilità e un incremento

l’impianto subito prima del posizionamento.

del 20% della zona di contatto osso-impianto, per una maggiore stabilità e una migliore osteointegrazione*.

Servizio riservato ai clienti del sistema implantare SPI

®

* Come dimostrato da test condotti su animali. I primi risultati delle ricerche sono stati presentati al Congresso EAO di Varsavia nel 2008. Controllate la disponibilità dei prodotti con il distributore del vostro paese. APLIQUIQ® e INICELL® sono marchi registrati di Thommen Medical AG e/o dei suoi affiliati. Tutti i diritti riservati. Per saperne di più: www.inicell.info

Distributore Italia Dental Trey S.r.l. Via Partisani, 3 | 47016 Fiumana - Predappio (FC) Tel. +39 0543 929111 | Fax +39 0543 940659 implantologia@dentaltrey.it | www.dentaltrey.it

Thommen Inicell European Journal of I_21x29,7.indd 1

SWISS PRECISION AND INNOVATION. www.thommenmedical.com

09/04/10 15:55

Journal of Osseointegration 2011_#1  

La rivista è stampata in lingua italiana ed è disponibile on-line in lingua inglese. Direttore schientifico è il professor Adriano Piattelli...

Read more
Read more
Similar to
Popular now
Just for you