Page 1

a

2 SÉRIE ENSINO MÉDIO Volume 2

BIOLOGIA Ciências da Natureza

CADERNO DO ALUNO


GOVERNO DO ESTADO DE SÃO PAULO SECRETARIA DA EDUCAÇÃO

MATERIAL DE APOIO AO CURRÍCULO DO ESTADO DE SÃO PAULO CADERNO DO ALUNO

BIOLOGIA ENSINO MÉDIO 2a SÉRIE VOLUME 2

Nova edição 2014 - 2017

São Paulo


Governo do Estado de São Paulo Governador Geraldo Alckmin Vice-Governador Guilherme Afif Domingos Secretário da Educação Herman Voorwald Secretária-Adjunta Cleide Bauab Eid Bochixio Chefe de Gabinete Fernando Padula Novaes Subsecretária de Articulação Regional Rosania Morales Morroni Coordenadora da Escola de Formação e Aperfeiçoamento dos Professores – EFAP Silvia Andrade da Cunha Galletta Coordenadora de Gestão da Educação Básica Maria Elizabete da Costa Coordenadora de Gestão de Recursos Humanos Cleide Bauab Eid Bochixio Coordenadora de Informação, Monitoramento e Avaliação Educacional Ione Cristina Ribeiro de Assunção Coordenadora de Infraestrutura e Serviços Escolares Dione Whitehurst Di Pietro Coordenadora de Orçamento e Finanças Claudia Chiaroni Afuso Presidente da Fundação para o Desenvolvimento da Educação – FDE Barjas Negri


Caro(a) aluno(a) No volume anterior do Caderno do Aluno, as temáticas envolvendo os estudos da Organização Celular da Vida estiveram presentes ao longo de todo o caderno. Esperamos que você tenha iniciado a compreensão da Vida a partir de uma perspectiva microscópica ampliando, assim, os conhecimentos construídos na 1ª série do Ensino Médio. Conceitos sobre a Transmissão da Vida e da Variabilidade Genética também fizeram parte dessa construção. Além disso, você teve a oportunidade de conhecer os princípios das Leis de Mendel, as quais, até hoje, fundamentam a Genética Clássica e a Molecular. Neste volume 2, o objetivo é aprofundar seus conhecimentos sobre Genética, de modo a compreender não somente os mecanismos de transmissão e de variabilidade genética, mas também como o organismo pode ser controlado pelas proteínas, cujo mecanismo de produção está intimamente associado ao DNA. Para isso, é necessário estudar a estrutura do DNA, compreender os processos de Duplicação, Transcrição e Tradução. Esses mecanismos permitem a transmissão das características e o controle do metabolismo do organismo através das proteínas. Por fim, você terá a oportunidade de consolidar seus conhecimentos sobre alguns assuntos mais recentes em termos de pesquisa científica em Genética, tais como: os testes de identificação através do DNA e a produção dos transgênicos. Estes tópicos ainda são alvo de muita controvérsia na atualidade. Bons estudos!

Equipe Curricular de Biologia Área de Ciências da Natureza Coordenadoria de Gestão da Educação Básica – CGEB Secretaria da Educação do Estado de São Paulo


Biologia – 2ª série – Volume 2

TEMA ɚ DNA: A DECE;TA DA V;DA E SEG CÍD;GO A compreensão atual sobre o funcionamento dos seres vivos baseia-se em alguns fundamentos, sendo que um deles estabelece que as proteínas, macromoléculas de aminoácidos, são responsáveis por muitas das atividades das células e dos organismos. ?

!

S;TGAs¯O DE APDEND;LAGEM 1 A ESTDGTGDA DO DNA

Você, provavelmente, já conhece a sigla DNA. Seja porque já ouviu falar dela na escola, seja porque leu alguma notícia ou assistiu a um programa de televisão que citava a sigla. Nesta Situação de Aprendizagem, você vai se familiarizar com essa molécula, com as diferentes formas de representá-la e com sua organização molecular.

Para começo de conversa – O que você conhece sobre o DNA1

Leitura e análise de imagem Analise a figura a seguir e depois responda às questões.

5


© Macmillan Publishers

Biologia – 2ª série – Volume 2

Capa da revista Nature, de 15 de fevereiro de 2001, que anunciou o sequenciamento do genoma humano. Deprinted bk permission from Macmillan Publishers Ltd: Nature &0+, (*22 (15 8ebruark 2001) Cover.

(


Biologia – 2ª série – Volume 2

1. Como a imagem do DNA foi composta na capa da revista1

2. Na sua opinião, o que signica essa imagem na capa de uma revista que trata sobre o sequenciamento do genoma humano1

%. Quais características da molécula de DNA podem ser observadas nessa imagem1

Leitura e análise de texto Agora você vai ler a letra da música DNA, de José Miguel Wisnik, para responder às questões. DNA José Miguel Wisnik

Quando você nasceu ouvi seu grito Embora longe muito longe de você Meu coração bateu tambor aflito Tambor aflito e tonto de bater

Você nos viu tão bem No fundo de ninguém E o que se revelava a sós: Que elo nos valeu Que elo, ela e eu E a lua absurda sobre nós

De tanto ser demais De tanto ser além De tanto bem e eu não ter paz Gm raio quando cai No medo que me fez Não me sentir capaz de ser seu pai

DNA, DNA Dança sua dança Dança em espirais DNA, DNA Ponte indecifrável Onde nos levais1 Seja onde for

Anos se passaram pela vida e te criaram Noites de lembrar e de esquecer Sonhos que não sei me esconderam e [me mostraram Esse dia em que eu te encontrei moça [e mulher

Onda do mar Mágica tão frágil Ser e nada mais DNA, DNA Daniela

E ali em frente a mim você me disse Que a falta que eu nunca te fiz então se fez E desabando como um edifício Abria um abismo a nossos pés

© Maianga Edições Musicais

7


Biologia – 2ª série – Volume 2

1. Qual é a relação de parentesco entre as personagens da canção1 Justique com elementos presentes no texto.

2. As personagens da canção apresentam um elo que não é a convivência. De acordo com a canção, que elo é esse1

3. Localize, no texto, todas as sequências das letras “D”, “N” e “A” apresentadas nas três últimas estrofes. Liste as palavras que apresentam as três letras simultaneamente.

&. Com as palavras listadas na questão anterior, o autor da música, José Miguel Wisnik, cria um efeito similar a uma das características da molécula de DNA, observável na capa da revista. Que característica é essa1

Revelando a organização da molécula de DNA A substância ácido desoxirribonucleico (ADN ou DNA) é um polímero de nucleotídeos. ;dentifique e escreva os nomes dos componentes de um nucleotídeo na ilustração a seguir.

Nucleotídeo de DNA

+

+

­ 

*

Nucleotídeo


Biologia – 2ª série – Volume 2

Leitura e análise de texto e imagem

Em 1+53, 8rancis Crick e James Watson publicaram um artigo na revista Nature no qual sugeriam um modelo para a molécula do DNA. Segundo esse modelo, a molécula de DNA seria constituída por dois polímeros de nucleotídeos organizados em forma de uma dupla-hélice, como uma escada retorcida. Os corrimãos dessa escada são formados de açúcar e fosfato. A novidade da estrutura proposta, além do formato em dupla-hélice, estava relacionada principalmente à maneira como os elementos estavam dispostos no DNA. De acordo com o modelo, as duas cadeias eram mantidas juntas por quatro bases nitrogenadas, duas purinas (adenina e guanina) e duas pirimidinas (timina e citosina), arranjadas aos pares e dispostas perpendicularmente ao eixo da molécula.

© Samuel Silva

O modelo da molécula da vida

Cadeia de açúcar e fosfato

Adenina

Timina

Guanina

Citosina

;lustração esquemática de uma molécula de DNA.

Essas bases nitrogenadas estariam unidas aos pares por pontes de hidrogênio. Os pares seriam específicos, pois as pontes de hidrogênio só poderiam ocorrer entre uma purina e uma pirimidina. Assim, a adenina (purina) só pode se ligar à timina (pirimidina), e a guanina (purina) só se liga à citosina (pirimidina). ;sso significava que, se em uma das cadeias a base era uma adenina, o elemento correspondente na outra cadeia deveria ser uma timina. O mesmo ocorreria para o par guanina e citosina. Observe a imagem e faça a correspondência entre as características que estão sublinhadas no texto e as estruturas da ilustração.

+


Biologia – 2ª série – Volume 2

© Conexão Editorial

Consolidando os conceitos é a sigla para o

ácido desoxirribonucleico

Desafio! Você já viu um mapa de conceitos1 t um esquema que explica por meio de texto, imagem e fluxo de setas o que acontece em determinado fenômeno. No mapa de conceitos proposto, estão faltando alguns elementos. Converse com seus colegas e descubra a melhor maneira de completá-lo.

é um

é formado por uma

polímero dupla-hélice é constituído por muitos

fosfatos

estão ligados(as) com

que se mantém ligada por

que são formados por

é um tipo de

açúcar

ligam-se entre si por meio de

estão ligados(as) com

bases nitrogenadas não estão ligados(as) com

adenina

citosina

são

forma par com

forma par com

guanina

Mapa de conceitos sobre a estrutura do DNA.

Gtilize as informações do mapa de conceitos que você completou com a ajuda dos colegas, para construir um texto em seu caderno explicando o que é e como está organizada a molécula de DNA. Depois de elaborar o texto, responda à seguinte questão: – Na capa da revista Nature, as bases nitrogenadas estão representadas por cores diferentes. Qual é o signicado disso1

10


Biologia – 2ª série – Volume 2

VOCÅ APDENDEG1 1. Em um segmento de 100 nucleotídeos de uma cadeia de DNA, há 25 adeninas e 15 guaninas; no segmento correspondente da cadeia complementar há 30 adeninas. Com base nesses dados, conclui-se que essa molécula de DNA, considerando as duas cadeias, possui: a) (0 timinas. b) 50 guaninas. c) 30 timinas. d) 25 timinas. e) &5 citosinas. 2. (Enem–200&) A identicação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. Na década de 1+50, um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. Exemplos de materiais analisados

Bases nitrogenadas Adenina

Guanina

Citosina

Timina

Espermatozoide humano

30,7%

1+,3%

1*,*%

31,2%

8ígado humano

30,&%

1+,5%

1+,+%

30,2%

Medula óssea de rato

2*,(%

21,&%

21,5%

2*,5%

Espermatozoide de ouriço-do-mar

32,*%

17,7%

1*,&%

32,1%

Plântulas de trigo

27,+%

21,*%

22,7%

27,(%

Bactéria Escherichia coli

2(,1%

2&,*%

23,+%

25,1%

A comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam: a) pares de mesmo tipo em todas as espécies, evidenciando a universalidade da estrutura do DNA. b) pares diferentes de acordo com a espécie considerada, o que garante a diversidade da vida. c) pares diferentes em diferentes células de uma espécie, como resultado da diferenciação celular. d) pares especícos apenas nos gametas, pois essas células são responsáveis pela perpetuação das espécies. e) pares especícos somente nas bactérias, pois esses organismos são formados por uma única célula. 11


Biologia – 2ª série – Volume 2

3. A publicação do trabalho de 8rancis Crick e James Watson que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucleico (DNA) ocorreu em 1+53. Entre as armativas a seguir, assinale a CODDETA: a) Gma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. b) Os nucleotídeos são ligados entre o fosfato e a base nitrogenada. c) Duas cadeias simples de DNA formam uma dupla-hélice, por meio da formação de ligações de hidrogênio entre as bases nitrogenadas. d) As duas cadeias de uma dupla-hélice possuem a mesma sequência de bases nitrogenadas. e) As ligações de hidrogênio mantêm o fosfato ligado ao açúcar desoxirribose. &. (Comvest!Vestibular Gnicamp – 2005) Em 25 de abril de 1+53, um estudo de uma única página na revista inglesa Nature intitulado “A estrutura molecular dos ácidos nucleicos”, quase ignorado de início, revolucionou para sempre todas as ciências da vida, sejam elas de homem, rato, planta ou bactéria. James Watson e 8rancis Crick descobriram a estrutura do DNA. Watson e Crick demonstraram que a estrutura do DNA se assemelha a uma escada retorcida. Explique a que correspondem os “corrimãos” e os “degraus” dessa escada.

12


Biologia – 2ª série – Volume 2 ?

!

S;TGAs¯O DE APDEND;LAGEM 2 A DGPL;CAs¯O DO DNA

Gma das características mais surpreendentes da molécula de DNA é sua capacidade de se duplicar com o auxílio da enzima DNA polimerase e gerar duas moléculas idênticas.

Leitura e análise de gráfico

2C

C

S

Anáfase

Prófase

Metáfase

G2

Mitose

Telófase e Citocinese

Tempo G1

© Lie =obakashi

Quantidade de DNA

O gráfico a seguir descreve a variação da quantidade de DNA de uma célula ao longo de seu ciclo.

G1

Quantidade de DNA ao longo do ciclo celular.

Com o auxílio de um colega, analise o gráco e responda às questões a seguir descrevendo o que observou. Considere, neste exercício, os conteúdos trabalhados no volume 1 sobre divisão celular. 1. O que está acontecendo durante a mitose1

2. No período chamado de intérfase (G1, S e G2), o que aconteceu com a quantidade de DNA1

3. Ao longo do ciclo celular, a quantidade de DNA por célula começa e termina com que valor1 O que isso signica1

13


Biologia – 2ª série – Volume 2

Gma vez concluído o trabalho, troque-o com o de outra dupla. Verifique se a descrição feita pelos colegas confere com o que está representado no esquema.

© Samuel Silva

Duplicação do DNA 8ase S

Célula Núcleo

G2 Aumento da massa celular

I

ní cio

G1 Aumento da massa celular do cic

lo

Mitose

Divisão celular Etapas do ciclo celular.

A duplicação do DNA 1. Com base no que você e seus colegas já conhecem, responda: Como a molécula de DNA consegue se duplicar1 As células formadas ao término da mitose são iguais ou diferentes1

Atividade coletiva: simulando a duplicação do DNA Nessa atividade, seu professor vai organizá-los de acordo com as fileiras da classe. Siga as instruções para dramatizar a duplicação de uma molécula de DNA. 1&


Biologia – 2ª série – Volume 2

Cada aluno deve escrever em uma folha de papel a base nitrogenada que representa. Cada fileira de carteiras será uma cadeia de DNA. As fileiras 2 e 3 iniciam a atividade definindo qual será a sequência de bases nitrogenadas: adenina (A), timina (T), citosina (C) ou guanina (G). Você e seus colegas podem definir a ordem, porém é importante lembrar da complementaridade das cadeias. Terminada a dramatização, escreva em seu caderno um resumo do que ocorreu. 1. Agora, retome o gráco do início da Situação de Aprendizagem e compare os fenômenos que ocorrem na variação de DNA de uma célula ao longo de seu ciclo com as etapas de dramatização que a classe acabou de realizar.

2. Complete a gura a seguir indicando o que representa cada cadeia da imagem de DNA em relação às leiras que a classe formou durante a dramatização.

leira

leira

tas originais

1o Passo derivadas da duplicação

leira

leira

leira

leira © Samuel Silva

2o Passo

leira

leira 3o Passo

Duplicação do DNA de acordo com a dramatização realizada.

leira

leira 15


Biologia – 2ª série – Volume 2

L;s¯O DE CASA 1. Elabore um texto em seu caderno explicando como a complementaridade das bases nitrogenadas permite a duplicação do DNA.

Atenção! Nesse texto, você deve apresentar: – a descrição da estrutura do DNA; – a complementaridade das bases nitrogenadas; – o processo de duplicação do DNA durante o ciclo celular; – a relação entre os eventos anteriores e a produção de duas células idênticas.

PESQG;SA ;ND;V;DGAL O que é necessário para que o DNA se duplique? Consulte seu livro didático e identifique o papel da enzima polimerase do DNA (em alguns livros, você encontra o termo DNA polimerase) no processo de duplicação do DNA e as condições para que ela atue.

O exercício a seguir requer que você pense no processo de duplicação como algo dinâmico que ocorre na interação entre o DNA e diversas proteínas. Em primeiro lugar, observe o quadro com a estimativa do número de pares de base (em bilhões) do DNA de diferentes espécies. 1(


Biologia – 2ª série – Volume 2

Espécie

Pares de base do DNA

Jiboia

2 100 000 000

Ser humano

3 100 000 000

Gafanhoto

+ 300 000 000

Cebola

1* 000 000 000

Salamandra

1(0 000 000 000

Ameba

(70 000 000 000

Agora, pense no seguinte problema: Para duplicar o DNA, antes da divisão celular, a enzima polimerase do DNA adiciona novos nucleotídeos a uma velocidade aproximada de *00 nucleotídeos por segundo. Quantos dias seriam necessários para uma célula de cada uma das espécies listadas duplicar o seu DNA1

Espécie

Jiboia

Ser humano

Gafanhoto

Cebola

Salamandra

Ameba

Dias

t possível que você e seus colegas de classe tenham chegado a um número elevado de dias necessários para a duplicação de uma célula de DNA de cada uma das espécies. Sabe-se, no entanto, que o tempo médio de duplicação de uma célula eucariota é de 12 horas. Tendo em vista que a enzima polimerase do DNA apresenta uma velocidade de reação constante para todas as espécies analisadas, converse com seus colegas e apresente uma hipótese para explicar essa aparente contradição.

17


Biologia – 2ª série – Volume 2

VOCÊ APRENDEU? 1. Durante a intérfase da célula, pode-se armar que: a) praticamente não há atividade metabólica celular. b) ocorrem alterações no formato da célula. c) ocorre duplicação da célula. d) ocorre duplicação do DNA. e) a dupla-ta do DNA se separa. 2. A sequência de nucleotídeos CTGACCTTCG forma um segmento de DNA dupla-hélice ao se ligar à ta complementar: a) CTGACCTTCG b) GCTTCCAGTC c) GACTGGAAGC d) CTGACCTGCG e) AGCTTCCAGT 3. Para duplicar o DNA antes da divisão celular, existe uma proteína, a enzima DNA polimerase, cuja velocidade de reação é equivalente a aproximadamente *00 nucleotídeos por segundo. Quantos dias seriam necessários para uma célula de mosca-da-fruta duplicar seu DNA, sabendo que cada célula dessa espécie apresenta aproximadamente1*0 milhões de pares de base de DNA? a) 10 b) 5 c) 1 d) 7 500 e) 125 &. Algumas células não se multiplicam ao longo de sua vida. Entre elas, podem ser citados os neurônios. Para esse tipo celular especíco, como caria o gráco apresentado a seguir?

1*


Biologia – 2ª série – Volume 2

5. (8uvest – 200&) Bactérias (Escherichia coli) foram cultivadas durante várias gerações em um meio de cultura no qual toda a fonte de nitrogênio era o isótopo pesado 15N. De uma amostra destas bactérias (amostra A), extraiu-se o DNA que foi submetido a uma técnica de centrifugação que permite separar moléculas de DNA de acordo com sua densidade. O restante das bactérias foi transferido para um meio de cultura em que todo o nitrogênio disponível era o isótopo normal 1&N. Retirou-se uma segunda amostra (amostra B), quando as bactérias completaram uma divisão celular neste novo meio, e uma terceira amostra (amostra C), quando as bactérias completaram duas divisões celulares. O DNA das bactérias das amostras B e C foi também extraído e centrifugado. B

C

© Samuel Silva

A

Densidade do DNA apenas com 1&N Densidade do DNA apenas com 15N

A figura mostra o resultado da centrifugação do DNA das três amostras de bactérias. a) Por que, na amostra B, todo o DNA tem uma densidade intermediária entre o que é constituído apenas por 1&N e o que contém apenas 15N?

b) Considerando que, na amostra C, a quantidade de DNA separada na faixa inferior é X, que quantidade de DNA há na faixa superior?

APRENDENDO A APRENDER Existe uma série de recursos, disponíveis na internet, que representam o processo de duplicação do DNA de forma dinâmica e animada. Entre em um site de busca e procure pelos termos: – replicação DNA; – DNA replication animation. 1+


Biologia – 2ª série – Volume 2

Dica! ;nicie sua pesquisa pelos sites (acessos em: 27 fev. 201&): – O DNA vai ao supermercado. Disponível em: .http:!!cib.org.br!ip-content! uploads!2011!10!dnaQsupermercado.pdf0; – DNA from the beginning. Disponível em: .http:!!iii.dnaftb.org0. Site em língua inglesa com várias animações relacionadas ao tema.

20


Biologia – 2ª série – Volume 2 ?

!

S;TUAs¯O DE APREND;LAGEM 3 DO DNA ® PROTEÉNA

Nesta Situação de Aprendizagem, você vai relacionar as características da molécula de DNA com a síntese de RNAs e de proteínas e compreender como esses três tipos de substâncias estão envolvidos com a manifestação das características.

PESQU;SA ;ND;V;DUAL O papel das macromoléculas t comum referir-se às proteínas como componentes importantes para a organização e o funcionamento da célula. No entanto, para o desenvolvimento desta Situação de Aprendizagem, é necessário ter essa noção mais clara e aprofundada. Para isso, pesquise em seu livro didático e na internet, converse com seus colegas e preencha a tabela a seguir:

Funções das proteínas Função Enzimática

Descrição Atuam no metabolismo catalisando reações químicas.

Exemplo Pepsina, catalase, ATP sintetase.

Estrutural Movimento Defesa Comunicação celular ;denticação das células Transporte

Características do DNA e do RNA DNA e RNA são ácidos nucleicos, por isso apresentam algumas semelhanças e algumas diferenças. Para estabelecer critérios claros que permitam comparar DNA e RNA, preencha a tabela a seguir consultando seu livro didático ou outra fonte de informação, como a internet. 21


Biologia – 2ª série – Volume 2

DNA

RNA

1. Qual é o signicado da sigla?

2. O nucleotídeo desse ácido nucleico é formado por qual tipo de açúcar? 3. Quais são as bases nitrogenadas que podem formar um nucleotídeo desse ácido nucleico? &. A molécula desse ácido nucleico é formada por ta simples ou dupla-ta? 5. Quais podem ser as funções desempenhadas por moléculas desse ácido nucleico? (. Em uma célula humana, onde são encontradas as moléculas desse ácido nucleico?

Confira com seus colegas o preenchimento da tabela.

O RNA mensageiro A seguir, você realizará a leitura da história em quadrinhos (HQ) Lembranças de um RNA mensageiro. Antes dessa leitura, reflita sobre a questão a seguir e registre que informações você espera encontrar nessa HQ. – Como as informações contidas no DNA, que passam de uma geração para outra, podem resultar em uma característica?

22


© Karmo

Biologia – 2ª série – Volume 2

23


© Karmo

Biologia – 2ª série – Volume 2

2&


Biologia – 2ª série – Volume 2

Após a leitura da HQ, discuta com um colega e responda às questões a seguir: 1. Quais são, a partir das informações da HQ, os três tipos de RNA? Pesquise em seu livro didático ou em outras fontes quais são suas respectivas funções.

2. Pelo texto, a tradução do RNA mensageiro começa sempre em uma mesma sequência. Que sequência é essa?

3. Em que local da célula eucariota ocorre a fabricação de RNA mensageiro?

&. Em que local da célula eucariota ocorre a tradução do RNA mensageiro?

5. De acordo com o texto, quando é encerrada a tradução do RNA mensageiro?

(. Que palavras podem substituir a expressão “sequências de aminoácidos”?

7. Com base na HQ, redija um texto que descreva a síntese de proteínas.

25


Biologia – 2ª série – Volume 2

Decifrando o código genético Agora, você vai estudar com mais profundidade como uma informação presente no DNA pode se transformar em uma característica. Para isso, discuta com seus colegas a manchete a seguir, tomando como base as seguintes questões:

Cientistas mapeiam o código genético da praga da laranja 8inalizado o maior projeto de pesquisa biológica do País, o Genoma Xylella, que pretende acabar com o amarelinho.

1. O que é um código?

2. O que signica código genético?

3. O que os cientistas mapearam?

&. O que é o “amarelinho”?

5. O que é o “Genoma Xylella”?

2(


Biologia – 2ª série – Volume 2

(. O que é genoma?

Leitura e análise de tabela O quadro a seguir resume o que a Ciência define como código genético. Com o auxílio de seu professor e do livro didático ou de outras fontes de consulta, procure compreender como o código genético é lido. Em seguida, procure pelo significado do termo “códon” e escreva no espaço a seguir. Códon:

O código genético dos seres vivos 1ª- letra do códon

2ª- letra do códon U

C

A

G

3ª- letra do códon

U

fenilalanina fenilalanina leucina leucina

serina serina serina serina

tirosina tirosina parada parada

cisteína cisteína parada triptofano

U C A G

C

leucina leucina leucina leucina

prolina prolina prolina prolina

histidina histidina glutamina glutamina

arginina arginina arginina arginina

U C A G

A

isoleucina isoleucina isoleucina metionina

treonina treonina treonina treonina

asparagina asparagina lisina lisina

serina serina arginina arginina

U C A G

G

valina valina valina valina

alanina alanina alanina alanina

ácido aspártico ácido aspártico ácido glutâmico ácido glutâmico

glicina glicina glicina glicina

U C A G

27


Biologia – 2ª série – Volume 2

Leitura e análise de texto O código genético dos seres vivos Uma notícia publicada no ano 2000 apresentava o seguinte título: “Anunciada decifração do código genético da espécie humana”. No entanto, o código genético começou a ser decifrado em 1+(1, quando Marshall Nirenberg produziu um RNA mensageiro apenas com nucleotídeos uracila. A proteína formada por Nirenberg era composta apenas de aminoácidos fenilalanina. Antes do término da década de 1+(0, o código genético estava completamente decifrado. Para cada trinca de bases nitrogenadas, um aminoácido correspondente já havia sido identificado, conforme mostra o quadro do código genético dos seres vivos. Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola.

1. Depois de conversar com os colegas sobre o título da reportagem Cientistas mapeiam o código genético da praga da laranja e de observar o quadro que resume o código genético, escreva como a notícia publicada em 2000 pode ser interpretada. Em seguida, reescreva o título da reportagem com base no que você aprendeu.

2. Retome a HQ Lembranças de um RNA mensageiro e descubra: a) Qual a trinca de nucleotídeos (códon) que inicia a síntese de uma proteína.

b) Quais os três primeiros aminoácidos codicados pelo RNA mensageiro da história.

3. Na HQ, o códon UAG desempenha papel importante na síntese de proteínas. Que papel é esse?

&. Procure no quadro O código genético dos seres vivos outros códons que exerçam a mesma função do códon UAG.

2*


Biologia – 2ª série – Volume 2

5. Quais códons correspondem ao aminoácido arginina e quais codicam o aminoácido triptofano?

(. O que pode representar a diferença entre as formas como os aminoácidos arginina e triptofano são codicados?

7. O que signica dizer que o código genético é universal?

*. Consultando o quadro O código genético dos seres vivos, traduza a sequência de DNA apresentada a seguir.

Do DNA à proteína 8ita do DNA a ser transcrita

TAC GGA GTA GCT ATA ATT

RNA mensageiro Proteína

VOCÊ APRENDEU? 1. Um professor de Biologia, procurando explicar de maneira mais simplicada para seus alunos o processo de síntese de proteínas, utilizou as seguintes analogias: 2+


Biologia – 2ª série – Volume 2

; – ;magine que você queira fazer um bolo. A primeira coisa de que você vai precisar é uma receita. O mesmo ocorre em relação à síntese de proteínas. ;; – Para produzir um bolo, além da receita, você precisará de ingredientes. Da mesma forma, a célula precisa de certos ingredientes para produzir proteínas. ;;; – Suponha que sua mãe guarde todas as receitas no computador, que ca no escritório ou no quarto de estudos. Para utilizar a receita, você terá de imprimi-la. ;V – Para fazer o bolo, você se dirige à cozinha com a receita impressa. Lá estão, além dos ingredientes, o forno e os objetos para fazer o bolo. Em uma célula, também há um local onde ocorre a síntese de proteínas. Analise as alternativas e assinale aquela que indica uma correspondência verdadeira: a) O computador com as receitas seria o RNA das células. b) O quarto de estudos é o citoplasma da célula e o computador representa os ribossomos. c) O aluno, ao ler a receita e fazer o bolo na cozinha, representa o processo de tradução. d) A receita impressa corresponde ao RNA transportador. e) O bolo feito corresponde ao gene. 2. (8uvest – 1+++) Existe um número muito grande de substâncias com funções antibióticas. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. Assim, a TETRAC;CL;NA liga-se aos ribossomos e impede a ligação do RNA transportador; a M;TOM;C;NA inibe a ação da polimerase do DNA e a ESTREPTOM;C;NA causa erros na leitura dos códons do RNA mensageiro. Essas informações permitem armar que: ; – A TETRAC;CL;NA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. ;; – A M;TOM;C;NA, por inibir a duplicação do DNA, impede a multiplicação da célula bacteriana. ;;; – A ESTREPTOM;C;NA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. Das alternativas acima, a) apenas ; é correta. b) apenas ; e ;; são corretas. c) apenas ;; e ;;; são corretas. d) apenas ; e ;;; são corretas. e) ;, ;; e ;;; são corretas. 30


Biologia – 2ª série – Volume 2

3. Se coletássemos proteínas em um ovo fóssil de certa espécie de dinossauro, seria possível reconstituir o DNA desses animais? Justique.

&. (8uvest – 2005) A seguir está representada a sequência dos 13 primeiros pares de nucleotídeos da região codicadora de um gene. --- A T G A G T T G G C C T G ----- T A C T C A A C C G G A C --A primeira trinca de pares de bases nitrogenadas à esquerda corresponde ao aminoácido metionina. A tabela a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles. Códon do RNAm

Aminoácido

ACC

treonina

AGU

serina

AUG

metionina

CCU

prolina

CUG

leucina

GAC

ácido aspártico

GGC

glicina

UCA

serina

UGG

triptofano

a) Escreva a sequência de bases nitrogenadas do RNA mensageiro transcrito a partir desse segmento de DNA.

b) Utilizando a tabela de código genético fornecida, indique a sequência dos três aminoácidos seguintes à metionina, no polipeptídio codicado por esse gene.

31


Biologia – 2ª série – Volume 2

c) Qual seria a sequência dos três primeiros aminoácidos de um polipeptídio codicado por um alelo mutante desse gene, originado pela perda do sexto par de nucleotídeos (ou seja, a deleção do par de bases T / A)?

Efeito das mutações O termo “mutação” é bastante popular e, normalmente, as pessoas o associam com o surgimento de organismos com características aberrantes. Em Biologia, no entanto, mutações gênicas são alterações permanentes na sequência de nucleotídeos do DNA. Essas alterações podem ter diferentes resultados, de acordo com o efeito que produzem na proteína final. Descubra algumas dessas situações resolvendo as questões: 1. Este é o trecho de um gene (ta molde) fundamental para todos nós, o gene da proteína beta-hemoglobina. Essa proteína é de extrema importância no transporte de gás oxigênio para o corpo e sua função depende de sua estrutura espacial, que por sua vez depende da sequência de aminoácidos que a compõe. … CAC GTG GAC TGA GGA CTC CTC TTC… Lembrando que os códons se referem ao RNAm, consulte o quadro com o código genético para dizer qual é a sequência de aminoácidos correspondente.

2. Suponha que ocorra a seguinte mutação: … CAT GTG GAC TGA GGA CTC CTC TTC… Agora indique qual seria seu possível efeito.

3. Suponha agora a seguinte mutação: … TAC GTG GAC TGA GGA CTC CTC TTC… ;ndique as consequências em relação à sequência inicial.

32


Biologia – 2ª série – Volume 2

&. Considere agora as duas mutações a seguir e seus efeitos. a) … CAC GTG GAC TGA GGA ATC CTC TTC…

b) … CAC GT GAC TGA GGA CTC CTC TTC…

5. Para concluir, faça uma pesquisa sobre a anemia falciforme e sua causa genética.

33


Biologia – 2ª série – Volume 2 ?

!

S;TUAs¯O DE APREND;LAGEM & DO DNA ® CARACTERÉST;CA

A proposta para esta Situação de Aprendizagem é rever alguns conceitos de Genética relacionados às ideias de Mendel sobre a herança biológica e, a partir deles, estabelecer relações com os conteúdos trabalhados sobre a molécula de DNA e a tradução da informação genética.

Para começo de conversa Você se lembra do trabalho de Mendel estudado no volume 1?

© Samuel Silva

Para iniciar esta Situação de Aprendizagem, será necessário retomá-lo. ;nterprete o esquema e o mapa conceitual e, a seguir, redija um texto mostrando o que você entendeu. Ao concluir seu texto, troque-o com o de um colega para análise. Ao receber o texto do colega, verifique se os conceitos do mapa foram empregados corretamente para explicar o trabalho de Mendel com as ervilhas.

Esquema do trabalho de Mendel com as ervilhas.

3&


© Adesign

Biologia – 2ª série – Volume 2

ORGAN;SMOS V;VOS são formados por

CtLULAS possuem são transmitidas entre as gerações pelos

estão contidas em um

;N8ORMAs°ES GENtT;CAS em seu conjunto no indivíduo, constituem o

GENE GAMETAS formam-se por

GENÍT;PO em interação com o ambiente produz o

ME;OSE 8ENÍT;PO possibilita a SEGREGAs¯O fundamenta a

ocorre nos

PR;ME;RA LE; DE MENDEL

ALELOS podem ser

pode apresentar formas alternativas chamadas RECESS;VOS

se expressam na condição

HOMOL;GÍT;CA

DOM;NANTES

se expressam na condição

HETEROL;GÍT;CA

pode originar as proporções

3:1 Mapa conceitual sobre Genética.

35


Biologia – 2ª série – Volume 2

Leitura e análise de texto Para integrar os conceitos de Biologia Molecular aos conceitos de Genética Clássica, será apresentado como exemplo o trabalho de pesquisadores ingleses. Esses cientistas trabalharam com uma das sete características de ervilha (Pisum sativum) estudadas por Mendel: a textura da semente, em que o estado liso é dominante sobre o rugoso. Do genótipo ao fenótipo Ao pesquisar a causa do fenótipo rugoso, pesquisadores ingleses suspeitaram de que esse fenótipo fosse consequência da grande quantidade de um açúcar simples (amido não ramificado) no cotilédone, o que resultaria no acúmulo de grande quantidade de água. Quando a semente amadurece, ela seca, ou seja, perde água. Como nessa semente há grande acúmulo de água, ela fica muito volumosa e, ao secar, sua película se enruga. A semente lisa possui açúcares com muitas ramificações, não acumulando água, e, como consequência, não tem rugosidade. Esses pesquisadores descobriram que o alto índice de açúcar simples na semente rugosa se deve a um defeito na síntese de amido, o que ocorre em razão da ausência de uma enzima ramificadora do amido (SBE-1, starch-branching enzyme ou enzima ramificadora do amido). Além disso, notaram que as células do cotilédone das ervilhas que acumulam amido não ramificado, por pressão osmótica, retêm mais água. O alelo “R”, que codifica a semente lisa, é um fragmento de DNA com 3,3 mil pares de bases. Esse alelo codifica a enzima SBE-1, responsável pela produção do amido ramificado. O alelo “r”, que codifica a semente rugosa, é um fragmento de DNA com uma inserção de *00 pares de bases, portanto o gene possui &,1 mil pares de bases, e a enzima SBE-1 produzida não é funcional. Assim, não há produção de amido ramificado, o que leva ao maior acúmulo de água; quando a semente seca, torna-se rugosa. Elaborado por Rodrigo Venturoso Mendes da Silveira especialmente para o São Paulo faz escola.

Após a leitura, responda às questões a seguir: 1. Qual é o papel da enzima SBE-1 na semente lisa?

3(


Biologia – 2ª série – Volume 2

2. Segundo o texto, qual a relação entre o fato de uma ervilha ser lisa ou rugosa e a osmose?

3. A seguir, você vai encontrar duas simulações hipotéticas de sequências obtidas na análise do DNA de dois tipos diferentes de ervilhas puras (homozigóticas): com sementes lisas e com sementes rugosas. Qual a sequência complementar do DNA em cada caso? Sementes lisas puras apresentam esta sequência: TAC TCT ATG AAC CTC GTT AAA GTA CTA AAC ACT Sequência complementar:

Sementes rugosas puras apresentam a seguinte sequência: TAC TCT ATG AAC CTC GTT AAA GTA CTA AAT AGA AAA ACT TT Sequência complementar:

&. A seguir, forme o RNA mensageiro, utilizando como molde as sequências apresentadas nos quadros da questão anterior.

5. Para nalizar, faça a tradução das moléculas de RNA mensageiro e escreva no quadro quais são as proteínas formadas para cada tipo de semente. Para isso, consulte o quadro O código genético dos seres vivos apresentado na Situação de Aprendizagem anterior. 37


Biologia – 2ª série – Volume 2

Tipo de semente

Sequência de aminoácidos

lisa

rugosa

(. Qual das sequências de DNA corresponde ao alelo “r”, responsável pelo caráter semente rugosa?

7. Qual das sequências de DNA corresponde ao alelo “R”, responsável pelo caráter semente lisa?

*. Considere, agora, uma planta de ervilha heterozigótica para a característica textura da ervilha. Quais tipos de alelos ela possui?

+. Uma ervilha heterozigótica (Rr) apresenta o mesmo fenótipo de uma ervilha homozigótica dominante (RR): ambas são lisas. Esses dois tipos de ervilha são idênticos do ponto de vista molecular? Comente.

3*


Biologia – 2ª série – Volume 2

10. Considerando o texto Do genótipo ao fenótipo e o gráco apresentado a seguir, discuta com seus colegas de classe se a sequência dos aminoácidos de uma proteína pode inuenciar no funcionamento dela. 100 90 80 70 60 50 40 30 20 10 0

I

II

III

IV

V

Porcentagem de amido ramicado na presença de diferentes proteínas. Dados ctícios.

11. Se a ervilha apresenta 50% de proteínas do tipo ;, ela tem qual fenótipo?

12. Procure em seu livro didático as diferenças entre as estruturas primária, secundária e terciária de uma proteína. – Estrutura primária:

– Estrutura secundária:

– Estrutura terciária:

Integrando conceitos As ideias de Mendel foram o ponto de partida para a compreensão atual de como as características biológicas são herdadas e se manifestam. Acontece, entretanto, que em seu tempo Mendel não tinha acesso a uma série de informações conhecidas hoje. Assim, se for feito um paralelo entre as ideias dele, que datam de 1*((, e o que se sabe agora, pode-se construir o quadro a seguir: 3+


Biologia – 2ª série – Volume 2

Mendel, em 1866, deduziu que:

Mendel, hoje, saberia que:

As plantas possuem fatores hereditários.

As plantas híbridas (81) para semente lisa e rugosa possuem os dois alelos (“R” e “r”), que Mendel chamou de fatores.

Os fatores são transmitidos de uma geração à outra.

A meiose explica como os alelos se separam na formação dos gametas.

Os fatores podem ser representados por letras: Durante a meiose, os cromossomos homólogos se maiúscula (R) para o dominante e minúscula separam. (r) para o recessivo. As plantas híbridas (81) possuem os dois fatores (Rr); só assim podem produzir dois tipos de descendentes (82).

Os cromossomos são constituídos por DNA e proteínas.

Os fatores na planta híbrida não se misturam. O DNA é formado por uma cadeia dupla de nucleotídeos. Os fatores na planta híbrida devem se separar A partir do DNA, uma molécula de RNA é sinna formação dos gametas, para que cada game- tetizada (RNA mensageiro), codicando uma ta possua apenas um dos fatores. proteína. Obs.: é importante ressaltar que nessa época nada se sabia sobre cromossomos e meiose.

A textura da semente é determinada pela presença da enzima SBE-1 (strach-branching enzyme ou enzima ramificadora do amido). A enzima funcional, que permite o acúmulo de água tornando a semente lisa, é codificada pelo alelo R, um fragmento de DNA constituído por 3,3 mil pares de bases. A enzima codificada pelo alelo r (formado por &,1 mil pares de bases, contendo um trecho de *00 pares adicionais em sua sequência) não é funcional e impede o acúmulo de água, de modo que a semente torna-se rugosa.

Agora, o professor vai organizar a turma, e você deve articular os conceitos apresentados na tabela na forma de um mapa de conceitos. O objetivo desse mapa é integrar os conceitos de Biologia Molecular e de Genética Clássica. Para a construção do mapa, utilize o conjunto de palavras apresentadas na página seguinte e o espaço em branco disponível. Caso o espaço não seja suficiente, faça o mapa em seu caderno. Em seguida, trace linhas, orientadas por setas, relacionando os vários conceitos por meio das expressões de ligação. Se for necessário, crie novas expressões para relacionar os conceitos. 8aça correlações múltiplas, de modo que o mapa final fique com o aspecto de rede, evitando relações lineares simples. Para isso, o mesmo conceito pode ser conectado a vários outros. Para ter uma noção de como é um mapa de conceitos, retome outros mapas que foram apresentados ao longo deste Caderno. Depois de construir seu mapa de conceitos, avalie os mapas dos colegas, verificando as diferenças e indicando possíveis relações equivocadas. &0


Biologia – 2ª série – Volume 2

Conceitos I

Conceitos II

Expressões de ligação

RR Rr rr R r fatores dominante recessivo ervilha lisa ervilha rugosa fenótipo genótipo heterozigoto homozigoto

DNA sem inserção DNA com inserção dupla-hélice de DNA cromossomo proteína SBE-1 funcional proteína SBE-1 não funcional água alelo gene amido ramicado RNA mensageiro

não produz produz perde muita perde pouca é são codica acumula muita acumula pouca faz composto de

&1


Biologia – 2ª série – Volume 2

VOCÊ APRENDEU?

1. (8uvest – 2003) Qual das alternativas se refere a um cromossomo? a) Um conjunto de moléculas de DNA com todas as informações genéticas da espécie. b) Uma única molécula de DNA com informação genética para algumas proteínas. c) Um segmento de molécula de DNA com informação para uma cadeia polipeptídica. d) Uma única molécula de RNA com informação para uma cadeia polipeptídica. e) Uma sequência de três bases nitrogenadas do RNA mensageiro correspondente a um aminoácido na cadeia polipeptídica. 2. (8uvest – 2002) Em seu trabalho com ervilhas, publicado em 1*((, Mendel representou os fatores hereditários determinantes dos estados amarelo e verde do caráter cor da semente pelas letras A e a, respectivamente. O conhecimento atual a respeito da natureza do material hereditário permite dizer que a letra A usada por Mendel simboliza: a) um segmento de DNA com informação para uma cadeia polipeptídica. b) um segmento de DNA com informação para um RNA ribossômico. c) um aminoácido em uma proteína. d) uma trinca de bases do RNA mensageiro. e) uma trinca de bases do RNA transportador. 3. (8uvest – 2001) O anúncio do sequenciamento do genoma humano, em 21 de junho de 2000, signica que os cientistas determinaram: a) a sequência de nucleotídeos dos cromossomos humanos. b) todos os tipos de proteína codicados pelos genes humanos. c) a sequência de aminoácidos do DNA humano. d) a sequência de aminoácidos de todas as proteínas humanas. e) o número correto de cromossomos da espécie humana. &. (Comvest!Vestibular Unicamp – 1++*) O metabolismo celular é controlado por uma série de reações em que estão envolvidas inúmeras proteínas. Uma mutação gênica pode determinar a alteração ou a ausência de algumas dessas proteínas, levando a mudanças no ciclo de vida da célula.

&2


Biologia – 2ª série – Volume 2

a) Explique a relação que existe entre gene e proteína.

b) Por que podem ocorrer alterações nas proteínas quando o gene sofre mutação?

c) Em que situação uma mutação não altera a molécula proteica?

5. (8uvest – 1++() Uma doença genética de herança dominante é causada por mutações em um gene localizado em um autossomo. Os indivíduos A, B e C têm mutações em um segmento de DNA desse gene, cuja sequência normal está representada a seguir: Sequência normal

Indivíduo B

CAA AAC TGA GGA ATG CAT TTC (m)

CAT AAC TGA GGA ATG CAT TTC (m)

GTT TTG ACT CCT TAC GTA AAG

GTA TTG ACT CCT TAC GTA AAG

Indivíduo A

Indivíduo C

CAA AAC TGA GGA ATT CAT TTC (m)

CAA TAC TGA GGA ATG CAT TTC (m)

GTT TTG ACT CCT TAA GTA AAG

GTT ATG ACT CCT TAC GTA AAG

&3


Biologia – 2ª série – Volume 2

Códon

Aminoácido

Códon

Aminoácido

AAA

lisina

CUA

leucina

AAC

asparagina

GAU

ácido glutâmico

AAG

lisina

GCC

alanina

ACU

treonina

GUA

valina

AGU

serina

GUU

valina

AUG

metionina

UAA

de parada

CAA

glutamina

UAC

tirosina

CAU

histidina

UGA

de parada

CCU

prolina

UUG

leucina

Usando a tabela que relaciona alguns códons aos respectivos aminoácidos e considerando que a ta molde a ser transcrita é aquela assinalada com a letra m, responda: a) Quais serão os segmentos de proteínas produzidos, respectivamente, pelos indivíduos A, B e C?

b) Como será o fenótipo (normal ou afetado) dos indivíduos A, B e C? Por quê?

(. O esquema a seguir representa uma simplicação da relação entre genótipo e fenótipo. Com base nele e em outras informações trabalhadas ao longo deste ano, escreva um texto no caderno com o título: Do DNA à característica.

&&


Biologia – 2ª série – Volume 2

transcrição

DNA

tradução

RNA

Proteínas

duplicação

Característica biológica

&5


Biologia – 2ª série – Volume 2

PARA SABER MA;S Livros – PERE;RA, Lkgia V. Sequenciaram o genoma humano... e agora? São Paulo: Moderna, 2001. A autora explica as bases do sequenciamento de DNA e discute os impactos desse conhecimento. – STRATHERN, Paul. Crick, Watson e o DNA em 90 minutos. Rio de Janeiro: Jorge Lahar, 2001. O livro conta a história do trabalho de Watson e Crick e explica a estrutura do DNA. Sites (Acessos em: 27 fev. 201&.) – GENtT;CA NA ESCOLA. Disponível em: .http:!!iii.sbg.org.br0. O site apresenta atividades relacionadas aos conteúdos de Genética e Biologia Molecular. – PROJETO GENOMA HUMANO. Disponível em: .http:!!iii.videolog.tv!video. php?id/311+7+0. Neste endereço, está disponível um vídeo que aborda conteúdos de Biologia Molecular.

&(


Biologia – 2ª série – Volume 2

TEMA ɚ DNA: TECNOLOG;AS DE MAN;PULAs¯O Neste Caderno, você e seus colegas vão trabalhar com algumas das aplicações tecnológicas desenvolvidas a partir do conhecimento acumulado sobre os mecanismos de herança. Entre elas estão a identificação por perfil de DNA e a produção de organismos transgênicos. ?

!

S;TUAs¯O DE APREND;LAGEM 5 TESTE DE ;DENT;8;CAs¯O PELO DNA

Para começo de conversa: montagem da molécula de DNA Nas páginas finais deste Caderno, você vai encontrar um esquema com modelos de nucleotídeos para recortar e montar moléculas de ácidos nucleicos. Com a orientação do professor, monte, com um colega, uma molécula de DNA com dez pares de nucleotídeos, considerando que 30% da molécula deve ser formada por adeninas. Depois duplique essa molécula com os nucleotídeos restantes. Por fim, transcreva essa molécula de DNA utilizando apenas uma das fitas como molde para produzir um RNA. Dica: os desoxirribonucleotídeos formam as moléculas de DNA e os ribonucleotídeos formam moléculas de RNA. A seguir, continuaremos o trabalho com biotecnologia mostrando como são feitos os testes de identificação pelo DNA. Trata-se de um tema bastante atual que contribui para a resolução de inúmeros casos de paternidade duvidosa, muitos deles divulgados pela mídia. Além disso, é uma técnica de amplo uso nas diversas áreas de Ciência e Tecnologia. O mistério de Dom Casmurro seria resolvido pelo teste de DNA? Um dos aspectos mais sedutores da obra Dom Casmurro, de Machado de Assis (1*++), é o mistério sobre a possível traição da personagem Capitu com Escobar, o melhor amigo de Bentinho, que é o protagonista e narrador da trama. Machado de Assis constrói um personagem atormentado pelo ciúme, colocando em dúvida, inclusive, a paternidade de seu filho, Ezequiel. Após a morte de Escobar, Bentinho começa a suspeitar da esposa, ao notar o grande sofrimento que ela demonstrou durante o enterro do amigo. A desconfiança de Bentinho chega ao ponto de provocar o rompimento e o fim do casamento. O filho, porém, fica sob a guarda do pai, que, a cada dia, acha que a criança fica mais parecida com Escobar. Essa é uma dúvida que o protagonista não tem como esclarecer; nem consegue provar se Capitu de fato o traiu. Se o romance Dom Casmurro estivesse ambientado nos dias de hoje, talvez não fosse tão encantador. O culpado? O teste de DNA. &7


Biologia – 2ª série – Volume 2

1. Como o teste de DNA poderia elucidar esse mistério?

2. Possivelmente, você já ouviu falar em teste de DNA. Em quais veículos de comunicação você tomou contato com esse assunto? Em que situações? Quais são os materiais biológicos coletados dos indivíduos envolvidos para fazer o teste de DNA?

Desvendando o mistério de Capitu Para resolver o mistério de Dom Casmurro, seria necessário realizar um teste de DNA. A primeira etapa seria coletar material biológico dos envolvidos: Capitu, Bentinho, Escobar (o melhor amigo de Bentinho) e Ezequiel (o filho). Geralmente, os pesquisadores empregam células presentes no sangue ou na mucosa da boca, mas podem utilizar células da pele ou presentes na raiz do cabelo. O DNA é extraído das células, isolado das demais estruturas celulares e purificado. Depois ele passa por um processo de clonagem molecular. Aqui, o termo “clonagem” refere-se à produção de cópias idênticas da sequência de DNA utilizando nucleotídeos livres e uma enzima já estudada neste volume: a polimerase do DNA. Atualmente, uma das técnicas mais adotadas para aumentar a quantidade de cópias (amplificar) de trechos específicos do DNA é a reação em cadeia da polimerase (PCR). Essa técnica permite que, em curto espaço de tempo, trechos específicos do DNA possam ser amplificados milhões de vezes. Depois de aumentar a quantidade de DNA por meio da clonagem molecular, os pesquisadores utilizam enzimas de restrição, proteínas capazes de cortar o DNA em pontos definidos, ou melhor, em sequências específicas. As “tesouras moleculares” foram descobertas em diferentes bactérias e, para cada uma delas, é quebrada uma sequência específica do DNA. No quadro a seguir, são apresentados algumas enzimas e seus pontos de corte. &*


Biologia – 2ª série – Volume 2

Sequência reconhecida

Nome

Origem

5’ GGATCC 3’ 3’ CCTAGG 5’

BamH;

Bacillus amyloliquefaciens H

5’ GAATTC 3’ 3’ CTTAAG 5’

EcoR;

E. coli RK 13

5’ GGCC 3’ 3’ CCGG 5’

Hae;;;

Haemophilus aegyptius

5’ CTGCAG 3’ 3’ GACGTC 5’

Pst;

Providencia stuartii

5’ CTCGAG 3’ 3’ GAGCTC 5’

Xho;

Xanthomonas holcicola

Especicidade de algumas endonucleases de restrição. As setas indicam o ponto de clivagem na cadeia de DNA. 8onte: LAHA, Arnaldo; 8ERRE;RA, Henrique B.; PASSAGL;A, Luciane M.P. (orgs.). Biologia molecular básica. &. ed. Porto Alegre: Artmed, 2012. p. 33&.

As setas que aparecem na primeira coluna do quadro simbolizam os pontos de quebra da ligação entre um nucleotídeo e outro. Quando isso acontece, os trechos se separam, formando fragmentos de DNA. Simulação do teste de DNA Para simular o teste de paternidade de Ezequiel, você terá acesso a algumas sequências fictícias de DNA humano. Sua tarefa será utilizar a enzima fictícia MDA para produzir os padrões de DNA característicos de cada pessoa. Essa proteína quebra as ligações apenas quando encontra a sequência de DNA apresentada a seguir. As ligações entre o T!G e o A!C são quebradas nesse local.

t t tat gggc aaa t a c c c g Esquema para localizar o sítio de restrição da enzima utilizada.

&+


50

cacccgacccgtatggaatggcacccg t c c c gaccgacgggccgatgggcccgtcgggcccgtcg gtgggctgggcatacc t t accgt gggcagggctggc t ccccggctgcccgggcagcccgggcagc

tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacgta c c t c g g g gaggggctgaggcgagaggctt a cc g c g g g a c t t t g g c t c g t

tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttacc g c g g g a c t t t g g c t c g t

cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccg t c g gtgggcagctcgtgggcatacct g g g t t accgtgggcaggtaccggtaccgcctgcccgggcagc

gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc c g t t a c c gtgggcaaaat a c c c g a c c t t a c c g g g g a g g g t t a c c g t g g g c a g t g g g c a a a t t t g g

tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca agcgtgggcatacctggctcggggaggggctgaggcgagaggcttacc g c g g g a c t t t g g c t c g t

gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc c g t t a c c gtgggcaaaat a c c c g a c c t t a c c ggggagggt t a c c g t g g g c a g t g g g c a a a t t t g g

ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc ga t a c c c g a c c c t t a g g t a c c g g c g c g c g t t a c c g t g g g c a a a t t t t t a c c g g g a g g g g c t g a g g

Biologia – 2ª série – Volume 2

A seguir, cada dupla-fita de nucleotídeos faz parte de um cromossomo dos personagens de Dom Casmurro. Você deve utilizar a enzima de restrição MDA para separar o DNA dos envolvidos em fragmentos menores. Para isso, localize no quadro os sítios de restrição da enzima MDA no DNA de todos os indivíduos. Ezequiel Bentinho Escobar Capitu

Simulação de sequências de DNA dos personagens.


Biologia – 2ª série – Volume 2

Depois de localizar e indicar os locais de corte pela enzima, confira seus resultados com os dos colegas da classe.

©ÞJurandir Ribeiro

Medindo fragmentos de DNA

de

po lo

gela tina

po sit ivo

ivo at g ne

ba nd a

lo po

DN A

+

SASSON, Sezar; S;LVA JUN;OR, Cesar da. Biologia – volume único. São Paulo: Saraiva, 2007. p. 5*5.

Esquema simplicado da eletroforese.

Após a produção dos fragmentos de diversos tamanhos, é preciso comparar o DNA dos envolvidos. Para isso, vamos usar uma técnica conhecida como eletroforese. – Após as explicações de seu professor sobre a técnica de eletroforese, descreva-a no espaço a seguir.

51


52

cacccgacccgtatggaatggcacccg t c c c gaccgacgggccgatgggcccgtcgggcccgtcg 14 5 46 gtgggctgggcatacc t t accgt gggcagggctggc t ccccggctgcccgggcagcccgggcagc

Bentinho

tcgcacccgtatgcatggagcccctccccgactccgctctccgaatggcgccctgaaaccgagca 16 30 19 agcgtgggcatacgtacctcggggaggggctgaggcgagaggcttacc g c g g g a c t t t g g c t c g t

tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca a g c12 g t g g g c a t a c c t g g c t c g g g g a g g34 g g c t g a g g c g a g a g g c t t a c c g c g g g a c t t19 t g g c t c g t

Ezequiel

cacccgtcgagcacccgtatggacccaatggcacccgtccatggccatggcggacgggcccg t c g g t g g g c a 20 g c t c g t g g g c a t a c c t g9g g t t a c c g t g g13 g c a g g t a c c g6g t a c c g c c t g c c 17 cgggcagc

gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc 23 c5 g t t a c c g t g g14 g c a a a a t a c c c g10 a c c t t a c c g g g g13 agggttaccgtgggcagtgggc aaatttgg

Capitu

tcgcacccgtatggaccgagcccctccccgactccgctctccgaatggcgccctgaaaccgagca 12 34 19 agcgtgggcatacctggctcggggaggggctgaggcgagaggcttacc g c g g g a c t t t g g c t c g t

gcaatggcacccgttttatgggctggaatggcccctcccaatggcacccgtcacccgtttaaacc c5 g t t a c c g t g g14 g c a a a a t a c c c g 10 a c c t t a c c g g g g 13 a g g g t t a c c g t g g g c a g t g g g c23 aaatttgg

ctatgggctgggaatccatggccgcgcgcaatggcacccgtttaaaatggcccctccccgactcc 17 g a t4a c c c g a c c15 c t t a g g t a c c g g c g13 c g c g t t a c c g t g g g 16 caaattttt a c cgggaggggctgagg

Biologia – 2ª série – Volume 2

O quadro a seguir representa os sítios de restrição do DNA dos envolvidos no caso. Na tabela da próxima página, você deve indicar as bandas de cada um dos envolvidos, de acordo com os números dos pares de nucleotídeos de seu DNA. Escobar

Quadro indicando os sítios de restrição para enzima do DNA dos personagens.


Biologia – 2ª série – Volume 2

Com base no padrão de bandas de DNA de todos os envolvidos é possível determinar as relações de parentesco entre eles. Considere que, em caso de paternidade, deve-se, inicialmente, comparar o perfil de fragmentos de DNA da criança com o da mãe e identificar todos os possíveis fragmentos de DNA da criança que também estão presentes no da mãe. Depois, compare os fragmentos de DNA da criança que sobraram (que não têm correspondência com o DNA da mãe) com os perfis de DNA dos possíveis pais. O provável pai será aquele cujo perfil de DNA contenha todos os fragmentos de DNA complementares aos fragmentos de DNA da criança que não estão presentes no DNA da mãe.

Escala em pares de base (pb)

Envolvidos Capitu

Ezequiel

Bentinho

Escala em pares de base (pb)

Escobar

1 2 3 & 5 ( 7 * + 10 11 12 13 1& 15 1( 17 1* 1+ 20 21 22 23 2&

25 2( 27 2* 2+ 30 31 32 33 3& 35 3( 37 3* 3+ &0 &1 &2 &3 && &5 &( &7

53

Envolvidos Capitu

Ezequiel

Bentinho

Escobar


Biologia – 2ª série – Volume 2

Agora, a partir da leitura do padrão de bandas de todos os indivíduos, responda às questões: 1. Quais são as bandas presentes na mãe e no lho?

2. Quais bandas sobraram no padrão do lho sem correspondência com o padrão da mãe?

3. Quem possui todas essas bandas que não têm correspondência com o padrão da mãe?

&. De acordo com a simulação feita, quem é o provável pai de Ezequiel?

5. Elabore uma história em quadrinhos propondo um desfecho para a obra de Machado de Assis, Dom Casmurro, com base em um suposto teste de DNA. Esse teste não precisa ter o mesmo resultado da simulação feita, ou seja, o pai de Ezequiel pode ser outro personagem de Dom Casmurro.

5&


Biologia – 2ª série – Volume 2

L;s¯O DE CASA

Etapas para obtenção e análise do DNA 1. Complete o quadro a seguir com informações sobre cada uma das etapas, a partir das explicações de seu professor e de consultas ao livro didático.

Extração

Quantificação

Amplificação

Separação

Análise e interpretação 2. Pesquise em seu livro o que são enzimas de restrição e como elas atuam.

55


Biologia – 2ª série – Volume 2

VOCÊ APRENDEU? 1. Cinco casais procuraram a polícia e armaram ser os verdadeiros pais de Gabriela. A garota teria sido roubada de uma maternidade em 1++0. Ao assistir à entrevista da garota na TV, esses casais desconaram de que poderiam ser os pais. Todos se submeteram ao teste de identicação pelo DNA e os resultados são apresentados a seguir. Quem são os verdadeiros pais de Gabriela? Assinale a alternativa correta. Gabriela

a) Pai

Mãe

b) Pai

Mãe

c) Pai

Mãe

d) Pai

Mãe

e) Pai

Mãe

2. Com relação às enzimas de restrição, é correto armar que: a) os sítios de restrição nunca acontecem dentro de um gene. b) para um ser vivo, os sítios de restrição são úteis apenas para a técnica inventada para analisar o DNA. c) todo sítio de restrição marca também o início da síntese de proteínas. d) indivíduos de uma mesma espécie possuem o mesmo número de sítios de restrição. e) irmãos sempre apresentam a mesma quantidade de sítios de restrição. 3. (8uvest – 1++7) Enzimas de restrição são fundamentais à Engenharia Genética porque permitem: a) a passagem de DNA através da membrana celular. b) inibir a síntese de RNA a partir de DNA. 5(


Biologia – 2ª série – Volume 2

c) inibir a síntese de DNA a partir de RNA. d) cortar DNA onde ocorrem sequências especícas de bases. e) modicar sequências de bases do DNA. &. Explique se as armações seguintes, sobre o teste de DNA, são verdadeiras ou falsas: a) “O exame de DNA só pode ser feito com sangue.”

b) “O resultado mostrou que nós possuímos algumas bandas do mesmo tamanho; logo, está provado que ele é o meu pai.”

5. Com as técnicas estudadas, podemos vericar se existem regiões de interesse na ta de DNA. Chamamos essas regiões de marcadores, já que podemos associá-las a alguma característica em particular. A presença de um marcador no genoma de um indivíduo pode ser visualizada como uma banda de DNA em um gel de eletroforese. Dessa forma, podemos descobrir se um embrião poderá apresentar determinada característica ou doença genética com base na análise de seus marcadores. O esquema a seguir representa a análise de marcadores de DNA de quatro embriões humanos (;, ;;, ;;; e ;V). Apenas a presença de duas bandas (A e B) indica que o indivíduo pode apresentar certa doença quando adulto.

DNA dos embriões II

III

IV

+ eletroforese

I Banda A Banda B

Observe o padrão de bandas do DNA de cada embrião e responda: a) Entre os embriões analisados, quais N¯O deverão apresentar a doença quando adultos? 57


Biologia – 2ª série – Volume 2

b) Supondo que os quatro embriões sejam irmãos, qual é o padrão de bandas (;, ;;, ;;; e ;V) mais provável PARA CADA UM de seus pais?

c) Qual banda é formada por fragmentos de DNA de MENOR tamanho? Justique.

(. A síndrome de Doin é ocasionada por uma trissomia do cromossomo 21. Em uma situação hipotética, um casal teve uma criança com a síndrome (C1) e, na segunda gravidez, resolveu submeter-se a um teste de DNA para vericar se a segunda criança (C2) também teria a síndrome. O teste de DNA analisa marcadores para os diferentes cromossomos presentes nas células das pessoas e foi feito a partir do DNA extraído de células sanguíneas dos pais e do primeiro filho (C1) e de uma punção do líquido amniótico (amniocentese) para analisar o segundo filho (C2). Mãe

Pai

Mãe

C1

7 Kb

Pai

C2

7

6

Kb

6

5

5

4

4

Com base na análise dos resultados expressos na ilustração, responda: a) Qual a origem do cromossomo extra da criança?

b) A segunda criança apresenta ou não a síndrome? Justique.

c) 8aça uma pesquisa e descubra qual a principal razão para que se forme um embrião com trissomia do cromossomo 21.

5*


Biologia – 2ª série – Volume 2

APRENDENDO A APRENDER

Há diferentes situações nas quais o teste de identificação por DNA pode ser aplicado. Para cada uma das situações a seguir, encontre um exemplo real ou descreva de que forma esse teste é útil. – Criminalística

– Crimes ambientais

– Tráfico de animais silvestres

– Pedigree de animais

– Doenças hereditárias

– ;dentificação de vírus e bactérias causadores de doenças

5+


Biologia – 2ª série – Volume 2

(0


Biologia – 2ª série – Volume 2

?

!

S;TUAs¯O DE APREND;LAGEM ( COMO PRODUL;R UM TRANSGÊN;CO?

Eles estão entre nós. Se perguntar aos outros alunos da escola se já viram um organismo transgênico, é provável que a maioria diga que não. No entanto, é possível que a maioria, se não todos, já tenha tido algum contato com produtos derivados de organismos transgênicos. Muitos alimentos industrializados, por exemplo, usam produtos desse tipo em seu processo de fabricação. Da mesma forma, há diversos medicamentos feitos a partir de organismos transgênicos. – 8aça uma pesquisa em seu livro didático ou em outras fontes de informação confiáveis e descubra exemplos de alimentos e medicamentos produzidos a partir de transgênicos.

© Alexandre Camanho

Leitura e análise de imagem 1. Quais são os organismos representados nessa imagem?

2. Os organismos estão representados do modo como os conhecemos? Comente.

3. Se a imagem sugerir a representação de um transgênico, que características dos organismos podem ter sido combinadas para gerar um organismo desse tipo?

(1


Biologia – 2ª série – Volume 2

Leitura e análise de texto Troca-troca genético Já viu porco com patas e focinho coloridos? E cabra que dá leite capaz de acelerar a cicatrização de ferimentos? Ao contrário do que você possa estar pensando, não estamos falando de criaturas de filmes de ficção. Esses animais são resultado de experimentos científicos de verdade! Se você tiver curiosidade, podemos conversar sobre como essas e outras modificações nos seres vivos são possíveis e por que os cientistas fazem isso. Que tal? A cabra e o porco citados na abertura deste texto são apenas exemplos curiosos de seres vivos que receberam características de outras espécies. O porco ganhou a coloração de um tipo de alga marinha. Já na cabra foi introduzida uma característica do sangue responsável pela coagulação, isto é, por evitar hemorragias em cirurgias ou quando você se corta. Como assim? Bem, todos os animais e plantas têm dentro de suas células um conjunto de códigos que os fazem ser do jeito que são. Nos seres humanos, por exemplo, esse conjunto de códigos é responsável por termos dois braços, duas pernas, dois olhos, duas orelhas, um nariz, uma boca, um coração, dois rins... Enfim, por tudo que nos faz ter aparência humana por dentro e por fora. No caso de uma galinha, seu conjunto de códigos é responsável pelas características físicas que ela apresenta. E, assim, cada ser vivo tem o seu próprio conjunto de códigos, que se chama DNA. Guardou isso? Então, vamos adiante porque a conversa só está esquentando! Você, agora, precisa saber que cada código que forma esse conjunto recebe o nome de gene e que cada gene tem sua função. De novo, vamos pensar em nós, humanos: temos genes responsáveis pelo formato das nossas orelhas; pela cor dos nossos olhos; pela produção de substâncias que nos permitem digerir os alimentos... Enfim, como temos muitas características, nosso DNA é formado por milhares de genes. Pense bem: se cada espécie de animal e de planta tem características próprias determinadas pelo conjunto de seus genes – isto é, pelo seu DNA –, o que acontece se os cientistas transferirem genes de uma espécie para outra? A espécie que receber os genes irá desenvolver uma ou mais características que não eram suas naturalmente, certo? Pois foi exatamente isso que aconteceu com a cabra ao receber o gene do homem responsável pelo desenvolvimento do fator de coagulação humano no seu leite. E também com o porco, que recebeu da alga marinha o gene responsável pela sua cor. Quando um ser vivo recebe um gene de outra espécie de animal ou vegetal, ele é chamado transgênico. Mas os cientistas podem, também, transferir genes entre seres da mesma espécie; estes são chamados organismos geneticamente modificados. ODA, Leila M.; CARNE;RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: ;nstituto Ciência Hoje, mar. 2002.

(2


Biologia – 2ª série – Volume 2

1. Quais relações você faz entre a imagem anterior e o título do texto Troca-troca genético?

2. Utilize os termos “seres vivos”, “células”, “DNA”, “genes”, “características biológicas”, “transgênicos” e “organismos geneticamente modicados” (OGMs) e construa um mapa de conceitos. Para isso, explore as informações do texto e pesquise também em seu livro didático ou em outras fontes conáveis.

(3


Biologia – 2ª série – Volume 2

Leitura e análise de texto Para que trocar genes? Ao transferir genes de uma espécie para outra, os cientistas não estão pensando apenas em produzir porcos coloridos ou cabras com genes humanos. Experimentos como esses são válidos para testar se a troca genética é realmente possível. Se for, plantas podem receber genes de vírus, por exemplo. Este é o caso da alface transgênica, desenvolvida recentemente. Ela recebeu o gene que produz o antígeno do vírus da hepatite B e que pode virar uma vacina! Você comeria uma alface dessas? Pense duas vezes antes de dizer que não, porque o antígeno é a parte do vírus usada nas vacinas. Quando ele entra em nosso corpo, estimula o organismo a se defender da doença causada pelo vírus. Logo, a alface transgênica funciona como uma vacina para a hepatite B. Então, você prefere alface ou injeção? Gostou da vacina de alface? Melhor é a bebida láctea transgênica! Você sabe do que se trata: são aquelas pequenas garrafinhas que contêm leite fermentado com lactobacilos, bactérias que ajudam a proteger o intestino. Em breve, teremos lactobacilos transgênicos, com os antígenos de seis vírus diferentes. A vacina de leite fermentado vai combater doenças como a difteria, a coqueluche, o tétano, a caxumba, a rubéola e o sarampo, entre outras. No futuro, é provável que as vacinas sejam todas assim. Como é bom sonhar com o adeus às agulhadas... Podemos, ainda, citar as chances de os organismos transgênicos se tornarem substitutos de remédios, vitaminas e outras substâncias que nosso organismo necessita. Veja: em 1+*5, começou a ser vendido o primeiro produto proveniente de um transgênico – a insulina, substância que controla a quantidade de açúcar no sangue. O gene humano responsável pela produção de insulina foi retirado de uma célula do pâncreas de uma pessoa saudável e transferido para uma bactéria, que começou a produzir a substância. Hoje, a insulina transgênica ajuda a salvar vidas de pessoas que têm diabetes, uma doença causada pela falha do corpo na produção dessa substância. Quer saber um pouco mais sobre a cabra que pode ser usada para melhorar a saúde das pessoas? Pois anote: a cabra transgênica (a vaca também pode ser usada), que recebe o gene humano responsável pela coagulação do sangue, produz no próprio leite a substância que possibilita a cicatrização de cortes e machucados nas pessoas. Essa substância é muito importante para tratar os hemofílicos, que não a produzem em quantidades suficientes e podem ter grandes hemorragias a partir do mais simples sangramento. ODA, Leila M.; CARNE;RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: ;nstituto Ciência Hoje, mar. 2002.

(&


Biologia – 2ª série – Volume 2

1. ;dentique, no texto, exemplos de uso dos transgênicos.

2. O que esses exemplos apresentam em comum?

Leitura e análise de imagem A imagem a seguir é um esquema que busca explicar como se produz insulina transgênica. Após a leitura, responda às questões a seguir. Célula humana

1

© Aeroestudio

Bactéria Isolamento do DNA bacteriano e do DNA humano DNA da bactéria 2

3

4

1

Corte de ambos os DNAs com enzima de restrição

Mistura de ambos os DNAs. Eles se juntam, formando uma molécula de DNA recombinante

1 2

3

8ragmento de DNA humano com o gene responsável pela produção de insulina

;nsulina transgênica produzida pela bactéria 4

O DNA recombinante é introduzido em bactérias

Esquema da produção de insulina.

(5


Biologia – 2ª série – Volume 2

1. Elabore um texto descrevendo os eventos representados.

2. Como são produzidos os fragmentos de DNA de interesse?

3. Por que o fragmento de interesse pode se ligar ao DNA da bactéria?

&. Como é possível aumentar o número de cópias desse DNA recombinante?

((


Biologia – 2ª série – Volume 2

Consolidando os conceitos

Leitura e análise de texto Troca entre iguais Agora, vamos falar da troca de genes entre seres da mesma espécie: os organismos geneticamente modificados! Alguém poderia perguntar: para que trocar genes entre seres iguais? Que diferença isso pode fazer? t hora de dizer que, embora organismos da mesma espécie tenham DNA exageradamente semelhante, existem mínimas diferenças que fazem cada ser ter o seu próprio código genético. Por isso, mesmo tendo dois braços, duas pernas, um nariz etc. etc. etc. como o seu vizinho, você é diferente dele! Com os bichos e as plantas também é assim: mesmo tendo um DNA que os caracteriza como sendo de determinada espécie, cada ser tem um código genético só seu. O uso de plantas geneticamente modificadas também pode aumentar a produção agrícola, o que traz vantagens para o meio ambiente. Quando as lavouras produzem mais vegetais de melhor qualidade, diminui a necessidade de desmatar novas áreas para plantações. Além disso, as plantas podem ser modificadas para que consumam menos água durante o crescimento. Assim o planeta economiza, pois cerca de dois terços de toda a água doce do mundo são consumidas na agricultura. A transferência de genes entre iguais também pode melhorar a qualidade dos alimentos, tornando-os mais nutritivos. t o caso, por exemplo, de um arroz transgênico chamado golden rice (ou “arroz dourado”, em português). Ele é mais rico em vitamina A e ferro do que o arroz comum. A carência dessas substâncias no organismo pode causar problemas sérios, como cegueira e anemia. Olha que os animais também podem ser modificados para melhorar sob o ponto de vista alimentar. Cuba, por exemplo, criou uma tilápia transgênica e o Canadá, o salmão transgênico. Esses peixes tiveram alterado o gene responsável pelo crescimento e, por isso, crescem mais e concentram maior quantidade de proteínas. Apesar das vantagens, muitas pessoas temem as consequências do consumo de produtos transgênicos ou geneticamente modificados. Afinal de contas, esses experimentos são muito recentes. Os próprios cientistas trabalham com cautela, avaliando, a cada nova descoberta, se ela não oferece riscos ao homem e à natureza. E é normal que muitas pessoas tenham receio das novas tecnologias; as maiores descobertas científicas da História também encontraram resistência na sua época. Mas quem sabe? Talvez esse troca-troca genético não pareça nada estranho daqui a um tempo. ODA, Leila M.; CARNE;RO, Júlia D. Troca-troca genético. Revista Ciência Hoje das Crianças. Rio de Janeiro: ;nstituto Ciência Hoje, mar. 2002.

(7


Biologia – 2ª série – Volume 2

Após a leitura do texto, responda às questões: 1. Qual o termo mais apropriado para substituir a expressão “código genético” no texto?

2. Com base no texto, faça uma lista de benefícios decorrentes do uso de transgênicos.

3. As autoras se posicionam em relação aos transgênicos ou são imparciais?

Criação de um título para o texto O texto a seguir trata do tema que estamos estudando. Leia com atenção e crie um título. Lembre-se de que, nesse caso, além de indicar o assunto tratado, o título deve ser atraente para o leitor.

Título:

Ocorreu em um dos melhores hospitais de São Paulo. 8azia menos de 2& horas que ele havia nascido quando me apresentaram um papel para assinar autorizando o procedimento. Consultei o médico, que me assegurou que era o recomendado. 8azer o quê? Autorizei. A injeção foi indolor e logo depois me entregaram a carteira de vacinação. 8iquei feliz, meu filho havia sido vacinado contra o vírus da hepatite B. Se você acha que isso é uma grande novidade, ainda em fase experimental, está enganado. Neste ano, o Ministério da Saúde adquiriu milhões de doses dessa vacina e agora ela faz parte do programa de imunização do governo brasileiro. Nos próximos anos, praticamente todas as crianças recém-nascidas serão imunizadas com esta vacina “recombinante”, um nome mais “delicado” e que sofre menos discriminação que “transgênica”, apesar de significar exatamente a mesma coisa. (*


Biologia – 2ª série – Volume 2

O termo significa que o produto injetado foi produzido por um organismo geneticamente modificado (OGM), assim como o óleo de soja que consumimos, o algodão de muitas das roupas que vestimos ou a insulina que a maioria dos diabéticos recebe todos os dias. Ao contrário da hepatite A, que geralmente não deixa sequelas, uma infecção pelo vírus da hepatite B é muito mais séria. Ela pode deixar sequelas crônicas no fígado e uma parte dos pacientes pode desenvolver câncer. Como é difícil produzir grandes quantidades desse vírus, o desenvolvimento de uma vacina eficaz e segura só foi possível devido aos avanços da biotecnologia. A partir do sequenciamento do genoma do vírus, foi identificado o gene que codifica a proteína capaz de tornar as pessoas imunes ao próprio vírus. Esse gene foi retirado do vírus e transferido para um fungo (semelhante àquele que utilizamos para fazer cerveja). O fungo modificado, por ter em seu genoma um gene originário do vírus, é denominado transgênico. Ele se torna capaz de produzir grandes quantidades da proteína viral. O fungo é cultivado, a proteína purificada e utilizada na produção da vacina. Se neste ano estamos comemorando nossa autossuficiência em petróleo, nos últimos anos deveríamos ter comemorado nossa autossuficiência na produção dessa vacina. A vacina recombinante contra o vírus da hepatite B foi desenvolvida no ;nstituto Butantan com a ajuda de um cientista que emigrou da ex-União Soviética, na década de +0. A adoção em larga escala dessa vacina nos programas de vacinação do governo vai permitir diminuir a incidência da doença e, de quebra, diminuir o número de casos de câncer de fígado. Espero que ela também ajude a diminuir a desinformação que ronda os transgênicos e os OGMs, afinal é um produto comercial, desenvolvido, aprovado e distribuído pelo governo brasileiro. Quando recebi meu filho na saída da maternidade, tive a curiosidade de verificar se tinham pendurado nele um “rótulo” com a advertência “pode conter transgênicos”, como exigido pelo governo brasileiro para qualquer produto contendo derivados da soja transgênica. Não encontrei. Tampouco vejo a frase “contém transgênico” tatuada nos diabéticos que devem sua sobrevivência exatamente ao fato de receber, todos os dias, uma dose de insulina transgênica. RE;NACH, 8ernando. ;njetaram proteína transgênica no meu lho! São Paulo. O Estado de S.Paulo, 2( abr. 200(. Vida . Disponível em: .http:!!iii.reinach.com!Estado!Colunas!200(!7+---2(-abr-200(.doc0. Acesso em: 27 fev. 201&.

1. Qual parece ser a posição do autor em relação ao uso dos transgênicos?

(+


Biologia – 2ª série – Volume 2

2. O conceito de organismo geneticamente modicado apresentado no terceiro parágrafo do texto é semelhante ao apresentado no texto Troca-troca genético?

3. O que signica “autossuciência” em vacinas?

&. Qual é a posição do autor em relação à legislação brasileira de identicação dos produtos que contêm transgênicos?

5. Qual é a principal ideia do texto Troca-troca genético? E do texto de 8ernando Reinach?

70


Biologia – 2ª série – Volume 2

(. Do que você mais gostou nos textos?

L;s¯O DE CASA

Construção de um texto argumentativo

Leitura e análise de texto Consumo de organismos transgênicos No blog do jornalista Marcelo Leite (disponível em: .http:!!cienciaemdia.folha. blog.uol.com.br0; acesso em: 27 fev. 201&), ele comenta o artigo do cientista 8ernando Reinach reproduzido neste Caderno. O jornalista considera que o cientista usou apenas exemplos em que produtos extraídos de organismos transgênicos são isolados antes de ser utilizados. Por exemplo, quando o bebê citado no texto recebe a vacina contra hepatite, nada proveniente do fungo transgênico é consumido, apenas a vacina purificada. ;sso, segundo o jornalista, é bem diferente de um produto como biscoitos ou bolachas feitos com farinha de soja. Para a produção da farinha, a semente de soja transgênica inteira é triturada e consumida. Todas as proteínas da semente, bem como todo o DNA de cada célula, serão consumidas também. Apesar da visão crítica do jornalista, sua posição quanto aos alimentos transgênicos não fica evidente. Ele critica que Reinach tenha usado um exemplo que subestima o problema dos alimentos transgênicos, afinal, ingerir DNA transgênico não é igual a se alimentar de um produto obtido desse material. Para Marcelo Leite, a adoção da vacina seria comparada ao uso do óleo de soja, mas não à ingestão do alimento contendo a semente da soja, como o salgadinho. Elaborado por Paulo Cunha especialmente para o São Paulo faz escola.

71


Biologia – 2ª série – Volume 2

– Tomando por base as considerações do jornalista, faça uma redação analisando o artigo do cientista 8ernando Reinach. No primeiro parágrafo, você deve apresentar o texto que será analisado. No segundo, você pode destacar os aspectos positivos do texto. No terceiro, seus aspectos negativos. Ao longo da redação, deve estar bem explícito o que é fato, o que é opinião do cientista e o que é sua opinião.

72


Biologia – 2ª série – Volume 2

VOCÊ APRENDEU?

1. Pesquisadores inseriram dois genes bacterianos na Arabidopsis thaliana, uma espécie de agrião, e criaram uma planta que não tolera solos contaminados. Nesse caso, é correto armar que: a) houve melhoramento genético e, além da qualidade desejada, outras qualidades foram transferidas, porque, invariavelmente, a planta resultante é melhor. b) a planta recebeu naturalmente os genes, pois o próprio ar ou os insetos realizam a troca do pólen contido nas ores das plantas. c) foi realizada uma transformação genética e apenas os genes de interesse foram transferidos, o que resultou em uma bactéria transgênica. d) os pesquisadores construíram uma bactéria e uma planta transgênicas com os dois genes de interesse. e) foi realizada uma transformação genética e apenas os genes de interesse foram transferidos, o que resultou em uma planta transgênica. 2. Com relação aos organismos transgênicos, é correto armar que: a) são seres cuja informação genética provém de outra espécie. b) são seres que possuem parte de sua informação genética proveniente de outra espécie. c) são seres que apresentam substâncias mais saudáveis e devem ser consumidos por toda a população. d) devem ser evitados, uma vez que, por apresentarem composição química modicada, não são produtos saudáveis. e) são seres que, durante o processo de alimentação, incorporam material genético das espécies ingeridas. 3. (Enem – 2012) O milho transgênico é produzido a partir da manipulação do milho original, com a transferência, para este, de um gene de interesse retirado de outro organismo de espécie diferente. A característica de interesse será manifestada em decorrência: a) do incremento do DNA a partir da duplicação do gene transferido. b) da transcrição do RNA transportador a partir do gene transferido. c) da expressão de proteínas sintetizadas a partir do DNA não hibridizado. d) da síntese de carboidratos a partir da ativação do DNA do milho original. e) da tradução do RNA mensageiro sintetizado a partir do DNA recombinante. 73


Biologia – 2ª série – Volume 2

© Jornal da Ciência

&. Analise a charge a seguir:

Mariano. Jornal da Ciência, ed. 515, 10 out. 2003.

– Qual deve ser a opinião do autor da charge sobre a liberação das plantações de soja transgênica? A partir dos elementos presentes na imagem, elabore um texto justicando sua resposta.

5. A soja transgênica resistente a uma marca de herbicida foi produzida pela Empresa Brasileira de Pesquisa Agropecuária (Embrapa) e está passando por testes de segurança alimentar e ambiental. Esse processo dura aproximadamente três anos e consiste na produção de 200 plantas resistentes ao herbicida. A partir desse lote, os pesquisadores escolhem as dez plantas com maior capacidade de gerar descendentes também resistentes. Esses lhotes do lote inicial são expostos a doses de herbicida três vezes maiores que as aplicadas convencionalmente. Por m, as melhores são separadas e apenas uma delas é levada a testes de segurança. Não existe a possibilidade de cruzamento dessas plantas com outras e o risco de polinização cruzada com outro tipo de soja é de apenas 1%. Por isso, os riscos ambientais causados pela soja transgênica são pequenos. Com base no texto, explique por que a soja transgênica apresenta baixo risco ambiental.

7&


Biologia – 2ª série – Volume 2

75


Biologia – 2ª série – Volume 2

?

!

S;TUAs¯O DE APREND;LAGEM 7 DEBATE SOBRE TRANSGÊN;COS

Construindo argumentos e aprofundando o conhecimento Neste Caderno, tratamos das tecnologias do DNA e de suas possíveis aplicações. Acontece que a utilização dessas e de outras tecnologias não é um assunto que deve ficar restrito à comunidade científica. t necessário que diferentes segmentos da sociedade opinem, atuem e ajudem a regularizar a aplicação e o uso de novas tecnologias. t com essa intenção que convidamos você e seus colegas a organizar um debate cujo tema é a implantação da unidade de uma empresa de biotecnologia (fictícia) que utiliza diferentes tipos de organismo transgênico no município de Ecoli (também fictício).

Leitura e análise de texto Caros cidadãos de Ecoli, Gostaria de solicitar a participação de todos em um debate muito importante para a nossa cidade. A Transbio, que é uma empresa de biotecnologia, acaba de inaugurar suas instalações em Ecoli. Ela utiliza organismos transgênicos para a produção de diversos materiais. Nessa nova unidade, a empresa atua na área alimentícia, produzindo óleo de soja transgênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. Além de plantar esses organismos na região, ela quer vender tais produtos para nossa população. Gostaria de contar com a ajuda de vocês, representantes de diversos setores de nossa sociedade, para elaborar uma carta manifestando a posição dos cidadãos de Ecoli sobre alguns questionamentos: 1. Devemos liberar a produção de todos esses materiais? E a venda? Quais condições devem ser atendidas pela empresa? 2. Que cuidados devemos ter com a saúde de nossa população? 3. Quais são os benefícios dessa atividade para nossa cidade? E os riscos? Conto com a colaboração de todos. Atenciosamente, O prefeito. Elaborado especialmente para o São Paulo faz escola.

7(


Biologia – 2ª série – Volume 2

Depois de ler a carta, siga a orientação de seu professor a respeito da organização do debate. A turma será dividida em equipes que representarão os diferentes grupos sociais envolvidos na situação.

Grupos sociais Cada grupo vai elaborar uma pesquisa, selecionar e organizar argumentos para defender seu ponto de vista durante o debate. Essa pesquisa pode ser feita em sites, em revistas ou em livros didáticos. Seu professor vai marcar uma data para que os grupos apresentem os resultados dessa pesquisa. Veja os grupos participantes do debate.

Empresa de biotecnologia 8ormado por administradores e técnicos em biotecnologia, este grupo representa os interesses da indústria Transbio. Seus principais produtos são: na área alimentícia, óleo de soja transgênica e arroz com vitamina B; na área da saúde, insulina humana transgênica; e, na área agropecuária, agrotóxico e soja transgênica resistente a esse agrotóxico. A empresa paga todos os seus impostos e está instalada em cidades do interior de São Paulo com baixa renda per capita, como Ecoli. Suas plantações transgênicas são acompanhadas por órgãos de fiscalização e estão de acordo com as regras estabelecidas até o momento. Profissionais de saúde 8ormado por médicos, nutricionistas, enfermeiros e outros profissionais ligados à saúde humana, este grupo representa os interesses da população relacionados ao bem-estar físico. Preocupados com a presença da indústria Transbio na região, esses profissionais começaram a levantar dados sobre a população local para verificar os efeitos do trabalho em plantações transgênicas e, principalmente, as consequências do consumo de alimentos e medicamentos transgênicos. Além da toxicidade de produtos utilizados pela indústria, os profissionais de saúde preocupam-se com as taxas de alergia dos moradores locais. Setor agropecuário 8ormado por proprietários de fazendas de pequeno, médio e grande portes e por trabalhadores rurais, este grupo representa os interesses dos produtores agrícolas, que visam aumentar a produtividade do setor. Segundo eles, a indústria Transbio traria benefícios para a cidade por meio da geração de empregos e de maior atividade econômica na região. No entanto, o setor agropecuário está preocupado com os gastos com matéria-prima e com a rejeição do mercado consumidor. Poder público 8ormada por vereadores e secretários municipais, esta parte do poder público deve avaliar quais seriam os benefícios das atividades da Transbio para a economia local assim como analisar 77


Biologia – 2ª sÊrie – Volume 2

as relaçþes comerciais entre a empresa e o setor agropecuårio, principalmente no que diz respeito aos royalties ou direitos intelectuais. A legislação sobre a venda de transgênicos ao consumidor Ê responsabilidade deste setor. Cabe tambÊm ao poder público propor às empresas estratÊgias de investimento na qualidade de vida da população, como investir nos hospitais da região parte do dinheiro que pagariam em impostos. Pesquisadores da årea de ecologia 8ormado por biólogos, ambientalistas e ONGs de preservação do meio ambiente, este setor estå preocupado com os impactos das atividades da Transbio na årea natural da cidade. Ecoli apresenta uma vegetação de cerrado e de mata atlântica, dois importantes biomas no Brasil que estão em risco, pois se encontram muito reduzidos. Este setor deve avaliar os impactos em espÊcies nativas da região, pensando em como monitorå-los, e levantar informaçþes sobre pesquisas na årea. Elaborado especialmente para o São Paulo faz escola.

Apresentando os resultados da pesquisa Após a pesquisa, você e seus colegas de grupo devem discutir seus argumentos e elaborar uma resposta à solicitação do prefeito, considerando o ponto de vista que representam. t importante que vocês esgotem todas as dúvidas e verifiquem a exatidão das informaçþes dos colegas de grupo para que os dados e os argumentos sejam consistentes. No espaço a seguir, anote resumidamente os argumentos apresentados separadamente pelos grupos sociais. t &NQSFTBEFCJPUFDOPMPHJB

t 1SPGJTTJPOBJTEFTBĂžEF

7*


Biologia – 2ª sÊrie – Volume 2

t 4FUPSBHSPQFDVĂˆSJP

t 1PEFSQĂžCMJDP

t 1FTRVJTBEPSFTEBĂˆSFBEFFDPMPHJB

Agora a turma serå reorganizada para iniciar o debate entre os representantes dos diferentes grupos. Após o debate, os representantes devem elaborar uma carta de consenso. Nela, os diferentes pontos de vista devem ser incorporados caso não seja possível uma proposta única. Registre, no espaço a seguir, a carta de consenso elaborada pela turma.

7+


Biologia – 2ª série – Volume 2

PARA SABER MA;S Livros – BRAS;L. M;N;STtR;O DA AGR;CULTURA, PECUÁR;A E ABASTEC;MENTO. Produtos orgânicos: o olho do consumidor. Secretaria de Desenvolvimento Agropecuário e Cooperativismo. Brasília: Mapa!ACS, 200+. Trata-se de uma cartilha do Ministério da Agricultura produzida para orientar o consumidor sobre o novo selo de certificação de produtos orgânicos, o Sistema Brasileiro de Avaliação da Conformidade Orgânica (Sisorg). A publicação é ilustrada pelo cartunista Liraldo e explica o que é produto orgânico, suas qualidades e como ele deve ser produzido para ganhar o selo. – LE;TE, Marcelo. Os alimentos transgênicos. São Paulo: Publifolha, 2000. O jornalista explica os diferentes aspectos do tema. – LORETO, tlgion L.S.; SEPEL, Lenira M.N. Atividades experimentais e didáticas de Biologia Molecular e Celular. São Paulo: Editora da Sociedade Brasileira de Genética, 2003. v. 1. Esta obra apresenta materiais simples que podem ser utilizados na produção de atividades práticas sobre o tema.

Site e revista – REV;STA DE B;OTECNOLOG;A. Disponível em: .http:!!biotecnologia.com.br0. Revista eletrônica com atualidades em biotecnologia. Acesso em: 27 fev. 201&. – RUMJANEK, 8ranklin D.; R;NLLER, Conck M.C. Os exames de DNA nos tribunais. Revista Ciência Hoje, Rio de Janeiro, v. 2+, n. 1(+, mar. 2001.

Documentários e filme – Gattaca: a experiência genética (Gattaca). Direção: Andrei Niccol. EUA, 1++7. 112 min. 1& anos. 8icção científica sobre uma sociedade organizada com base nas características genéticas das pessoas. – Genoma humano: decodificando a vida (Decoding life: the blueprint of the human body). Produção: Télé ;mages. 8rança, 1+++. 50 min. Série transmitida pela TV Escola que apresenta diferentes situações relacionadas ao estudo do genoma humano (câncer, herança e envelhecimento, entre outras). – Mendel e a manipulação dos genes (Big questions: Mendel and the gene splicers). Produção: Channel & Learning England. ;nglaterra, 200(. 1+ min. Exibido pela TV Escola, este episódio da série Ciência em foco retrata o trabalho de Mendel e seus desdobramentos no conhecimento atual sobre a herança biológica. *0


P

Ribose

P

P

P

Ribose

C

U

Desoxirribose

C

Ribose

P

Ribose P

C

Ribose

P

Ribose

Desoxirribose

P

U

P

P

P Ribose

T

P T

C

C

Desoxirribose

P

Ribose

P

Ribose

G

Desoxirribose

Desoxirribose

Desoxirribose

G

C

P

Ribose

P

P

Desoxirribose

G

Desoxirribose

T

P

Ribose

G

P

P

P

P

Ribose

P

Desoxirribose

A

P G

T

C

G

Desoxirribose

G

P

Ribose

Desoxirribose

Desoxirribose

Desoxirribose

Desoxirribose

A

A

Ribose

P

C

P

P

Desoxirribose

Desoxirribose

T

P

Desoxirribose

A

P

Desoxirribose

A

P P

P

P

P

P

Ribose

G

P

U

C

U

G

A

*1

A

G

T

C



A

Desoxirribose

P

Desoxirribose

Desoxirribose

Desoxirribose

A

A

Desoxirribose

P

P

Desoxirribose

Ribose

Biologia – 2ª série – Volume 2

Desafio!

Conforme proposto no início da Situação de Aprendizagem 1, recorte os nucleotídeos do esquema a seguir e monte as moléculas de DNA e de RNA complementar. Seu professor vai orientá-lo nessa tarefa. Boa sorte!


Biologia – 2ª série – Volume 2

*3


Biologia – 2ª série – Volume 2

*&


Biologia – 2ª série – Volume 2

*5


Biologia – 2ª série – Volume 2

*(


CONCEPÇÃO E COORDENAÇÃO GERAL NOVA EDIÇÃO 2014-2017 COORDENADORIA DE GESTÃO DA EDUCAÇÃO BÁSICA – CGEB Coordenadora Maria Elizabete da Costa Diretor do Departamento de Desenvolvimento Curricular de Gestão da Educação Básica João Freitas da Silva Diretora do Centro de Ensino Fundamental dos Anos Finais, Ensino Médio e Educação Profissional – CEFAF Valéria Tarantello de Georgel Coordenadora Geral do Programa São Paulo faz escola Valéria Tarantello de Georgel Coordenação Técnica Roberto Canossa Roberto Liberato Suely Cristina de Albuquerque Bomfim EQUIPES CURRICULARES Área de Linguagens Arte: Ana Cristina dos Santos Siqueira, Carlos Eduardo Povinha, Kátia Lucila Bueno e Roseli Ventrella. Educação Física: Marcelo Ortega Amorim, Maria Elisa Kobs Zacarias, Mirna Leia Violin Brandt, Rosângela Aparecida de Paiva e Sergio Roberto Silveira. Língua Estrangeira Moderna (Inglês e Espanhol): Ana Beatriz Pereira Franco, Ana Paula de Oliveira Lopes, Marina Tsunokawa Shimabukuro e Neide Ferreira Gaspar. Língua Portuguesa e Literatura: Angela Maria Baltieri Souza, Claricia Akemi Eguti, Idê Moraes dos Santos, João Mário Santana, Kátia Regina Pessoa, Mara Lúcia David, Marcos Rodrigues Ferreira, Roseli Cordeiro Cardoso e Rozeli Frasca Bueno Alves. Área de Matemática Matemática: Carlos Tadeu da Graça Barros, Ivan Castilho, João dos Santos, Otavio Yoshio Yamanaka, Rosana Jorge Monteiro, Sandra Maira Zen Zacarias e Vanderley Aparecido Cornatione. Área de Ciências da Natureza Biologia: Aparecida Kida Sanches, Elizabeth Reymi Rodrigues, Juliana Pavani de Paula Bueno e Rodrigo Ponce. Ciências: Eleuza Vania Maria Lagos Guazzelli, Gisele Nanini Mathias, Herbert Gomes da Silva e Maria da Graça de Jesus Mendes. Física: Anderson Jacomini Brandão, Carolina dos Santos Batista, Fábio Bresighello Beig, Renata Cristina de Andrade Oliveira e Tatiana Souza da Luz Stroeymeyte.

Química: Ana Joaquina Simões S. de Mattos Carvalho, Jeronimo da Silva Barbosa Filho, João Batista Santos Junior, Natalina de Fátima Mateus e Roseli Gomes de Araujo da Silva. Área de Ciências Humanas Filosofia: Emerson Costa, Tânia Gonçalves e Teônia de Abreu Ferreira. Geografia: Andréia Cristina Barroso Cardoso, Débora Regina Aversan e Sérgio Luiz Damiati. História: Cynthia Moreira Marcucci, Maria Margarete dos Santos Benedicto e Walter Nicolas Otheguy Fernandez. Sociologia: Alan Vitor Corrêa, Carlos Fernando de Almeida e Tony Shigueki Nakatani. PROFESSORES COORDENADORES DO NÚCLEO PEDAGÓGICO Área de Linguagens Educação Física: Ana Lucia Steidle, Eliana Cristine Budiski de Lima, Fabiana Oliveira da Silva, Isabel Cristina Albergoni, Karina Xavier, Katia Mendes e Silva, Liliane Renata Tank Gullo, Marcia Magali Rodrigues dos Santos, Mônica Antonia Cucatto da Silva, Patrícia Pinto Santiago, Regina Maria Lopes, Sandra Pereira Mendes, Sebastiana Gonçalves Ferreira Viscardi, Silvana Alves Muniz. Língua Estrangeira Moderna (Inglês): Célia Regina Teixeira da Costa, Cleide Antunes Silva, Ednéa Boso, Edney Couto de Souza, Elana Simone Schiavo Caramano, Eliane Graciela dos Santos Santana, Elisabeth Pacheco Lomba Kozokoski, Fabiola Maciel Saldão, Isabel Cristina dos Santos Dias, Juliana Munhoz dos Santos, Kátia Vitorian Gellers, Lídia Maria Batista Bomfim, Lindomar Alves de Oliveira, Lúcia Aparecida Arantes, Mauro Celso de Souza, Neusa A. Abrunhosa Tápias, Patrícia Helena Passos, Renata Motta Chicoli Belchior, Renato José de Souza, Sandra Regina Teixeira Batista de Campos e Silmara Santade Masiero. Língua Portuguesa: Andrea Righeto, Edilene Bachega R. Viveiros, Eliane Cristina Gonçalves Ramos, Graciana B. Ignacio Cunha, Letícia M. de Barros L. Viviani, Luciana de Paula Diniz, Márcia Regina Xavier Gardenal, Maria Cristina Cunha Riondet Costa, Maria José de Miranda Nascimento, Maria Márcia Zamprônio Pedroso, Patrícia Fernanda Morande Roveri, Ronaldo Cesar Alexandre Formici, Selma Rodrigues e Sílvia Regina Peres. Área de Matemática Matemática: Carlos Alexandre Emídio, Clóvis Antonio de Lima, Delizabeth Evanir Malavazzi, Edinei Pereira de Sousa, Eduardo Granado Garcia, Evaristo Glória, Everaldo José Machado de Lima, Fabio Augusto Trevisan, Inês Chiarelli Dias, Ivan Castilho, José Maria Sales Júnior, Luciana Moraes Funada, Luciana Vanessa de Almeida Buranello, Mário José Pagotto, Paula Pereira Guanais, Regina Helena de Oliveira Rodrigues, Robson Rossi, Rodrigo Soares de Sá, Rosana Jorge Monteiro,

Rosângela Teodoro Gonçalves, Roseli Soares Jacomini, Silvia Ignês Peruquetti Bortolatto e Zilda Meira de Aguiar Gomes. Área de Ciências da Natureza Biologia: Aureli Martins Sartori de Toledo, Evandro Rodrigues Vargas Silvério, Fernanda Rezende Pedroza, Regiani Braguim Chioderoli e Rosimara Santana da Silva Alves. Ciências: Davi Andrade Pacheco, Franklin Julio de Melo, Liamara P. Rocha da Silva, Marceline de Lima, Paulo Garcez Fernandes, Paulo Roberto Orlandi Valdastri, Rosimeire da Cunha e Wilson Luís Prati. Física: Ana Claudia Cossini Martins, Ana Paula Vieira Costa, André Henrique Ghelfi Rufino, Cristiane Gislene Bezerra, Fabiana Hernandes M. Garcia, Leandro dos Reis Marques, Marcio Bortoletto Fessel, Marta Ferreira Mafra, Rafael Plana Simões e Rui Buosi. Química: Armenak Bolean, Cátia Lunardi, Cirila Tacconi, Daniel B. Nascimento, Elizandra C. S. Lopes, Gerson N. Silva, Idma A. C. Ferreira, Laura C. A. Xavier, Marcos Antônio Gimenes, Massuko S. Warigoda, Roza K. Morikawa, Sílvia H. M. Fernandes, Valdir P. Berti e Willian G. Jesus. Área de Ciências Humanas Filosofia: Álex Roberto Genelhu Soares, Anderson Gomes de Paiva, Anderson Luiz Pereira, Claudio Nitsch Medeiros e José Aparecido Vidal. Geografia: Ana Helena Veneziani Vitor, Célio Batista da Silva, Edison Luiz Barbosa de Souza, Edivaldo Bezerra Viana, Elizete Buranello Perez, Márcio Luiz Verni, Milton Paulo dos Santos, Mônica Estevan, Regina Célia Batista, Rita de Cássia Araujo, Rosinei Aparecida Ribeiro Libório, Sandra Raquel Scassola Dias, Selma Marli Trivellato e Sonia Maria M. Romano. História: Aparecida de Fátima dos Santos Pereira, Carla Flaitt Valentini, Claudia Elisabete Silva, Cristiane Gonçalves de Campos, Cristina de Lima Cardoso Leme, Ellen Claudia Cardoso Doretto, Ester Galesi Gryga, Karin Sant’Ana Kossling, Marcia Aparecida Ferrari Salgado de Barros, Mercia Albertina de Lima Camargo, Priscila Lourenço, Rogerio Sicchieri, Sandra Maria Fodra e Walter Garcia de Carvalho Vilas Boas. Sociologia: Anselmo Luis Fernandes Gonçalves, Celso Francisco do Ó, Lucila Conceição Pereira e Tânia Fetchir. Apoio: Fundação para o Desenvolvimento da Educação - FDE CTP, Impressão e acabamento Plural Indústria Gráfica Ltda.


GESTÃO DO PROCESSO DE PRODUÇÃO EDITORIAL 2014-2017

CONCEPÇÃO DO PROGRAMA E ELABORAÇÃO DOS CONTEÚDOS ORIGINAIS

FUNDAÇÃO CARLOS ALBERTO VANZOLINI

COORDENAÇÃO DO DESENVOLVIMENTO DOS CONTEÚDOS PROGRAMÁTICOS DOS CADERNOS DOS PROFESSORES E DOS CADERNOS DOS ALUNOS Ghisleine Trigo Silveira

Presidente da Diretoria Executiva Mauro de Mesquita Spínola GESTÃO DE TECNOLOGIAS APLICADAS À EDUCAÇÃO Direção da Área Guilherme Ary Plonski Coordenação Executiva do Projeto Angela Sprenger e Beatriz Scavazza Gestão Editorial Denise Blanes Equipe de Produção Editorial: Amarilis L. Maciel, Ana Paula S. Bezerra, Angélica dos Santos Angelo, Bóris Fatigati da Silva, Bruno Reis, Carina Carvalho, Carolina H. Mestriner, Carolina Pedro Soares, Cíntia Leitão, Eloiza Lopes, Érika Domingues do Nascimento, Flávia Medeiros, Giovanna Petrólio Marcondes, Gisele Manoel, Jean Xavier, Karinna Alessandra Carvalho Taddeo, Leslie Sandes, Mainã Greeb Vicente, Maíra de Freitas Bechtold, Marina Murphy, Michelangelo Russo, Natália S. Moreira, Olivia Frade Zambone, Paula Felix Palma, Pietro Ferrari, Priscila Risso, Regiane Monteiro Pimentel Barboza, Renata Regina Buset, Rodolfo Marinho, Stella Assumpção Mendes Mesquita, Tatiana F. Souza e Tiago Jonas de Almeida. Direitos autorais e iconografia: Beatriz Fonseca Micsik, Dayse de Castro Novaes Bueno, Érica Marques, José Carlos Augusto, Juliana Prado da Silva, Marcus Ecclissi, Maria Aparecida Acunzo Forli, Maria Magalhães de Alencastro, Vanessa Bianco e Vanessa Leite Rios. Edição e Produção editorial: Adesign, Jairo Souza Design Gráfico e Occy Design (projeto gráfico).

CONCEPÇÃO Guiomar Namo de Mello, Lino de Macedo, Luis Carlos de Menezes, Maria Inês Fini (coordenadora) e Ruy Berger (em memória). AUTORES Linguagens Coordenador de área: Alice Vieira. Arte: Gisa Picosque, Mirian Celeste Martins, Geraldo de Oliveira Suzigan, Jéssica Mami Makino e Sayonara Pereira. Educação Física: Adalberto dos Santos Souza, Carla de Meira Leite, Jocimar Daolio, Luciana Venâncio, Luiz Sanches Neto, Mauro Betti, Renata Elsa Stark e Sérgio Roberto Silveira. LEM – Inglês: Adriana Ranelli Weigel Borges, Alzira da Silva Shimoura, Lívia de Araújo Donnini Rodrigues, Priscila Mayumi Hayama e Sueli Salles Fidalgo. LEM – Espanhol: Ana Maria López Ramírez, Isabel Gretel María Eres Fernández, Ivan Rodrigues Martin, Margareth dos Santos e Neide T. Maia González. Língua Portuguesa: Alice Vieira, Débora Mallet Pezarim de Angelo, Eliane Aparecida de Aguiar, José Luís Marques López Landeira e João Henrique Nogueira Mateos. Matemática Coordenador de área: Nílson José Machado. Matemática: Nílson José Machado, Carlos Eduardo de Souza Campos Granja, José Luiz Pastore Mello, Roberto Perides Moisés, Rogério Ferreira da Fonseca, Ruy César Pietropaolo e Walter Spinelli.

Ciências Humanas Coordenador de área: Paulo Miceli. Filosofia: Paulo Miceli, Luiza Christov, Adilton Luís Martins e Renê José Trentin Silveira. Geografia: Angela Corrêa da Silva, Jaime Tadeu Oliva, Raul Borges Guimarães, Regina Araujo e Sérgio Adas. História: Paulo Miceli, Diego López Silva, Glaydson José da Silva, Mônica Lungov Bugelli e Raquel dos Santos Funari. Sociologia: Heloisa Helena Teixeira de Souza Martins, Marcelo Santos Masset Lacombe, Melissa de Mattos Pimenta e Stella Christina Schrijnemaekers. Ciências da Natureza Coordenador de área: Luis Carlos de Menezes. Biologia: Ghisleine Trigo Silveira, Fabíola Bovo Mendonça, Felipe Bandoni de Oliveira, Lucilene Aparecida Esperante Limp, Maria Augusta Querubim Rodrigues Pereira, Olga Aguilar Santana, Paulo Roberto da Cunha, Rodrigo Venturoso Mendes da Silveira e Solange Soares de Camargo. Ciências: Ghisleine Trigo Silveira, Cristina Leite, João Carlos Miguel Tomaz Micheletti Neto, Julio Cézar Foschini Lisbôa, Lucilene Aparecida Esperante Limp, Maíra Batistoni e Silva, Maria Augusta Querubim Rodrigues Pereira, Paulo Rogério Miranda Correia, Renata Alves Ribeiro, Ricardo Rechi Aguiar, Rosana dos Santos Jordão, Simone Jaconetti Ydi e Yassuko Hosoume. Física: Luis Carlos de Menezes, Estevam Rouxinol, Guilherme Brockington, Ivã Gurgel, Luís Paulo de Carvalho Piassi, Marcelo de Carvalho Bonetti, Maurício Pietrocola Pinto de Oliveira, Maxwell Roger da Purificação Siqueira, Sonia Salem e Yassuko Hosoume. Química: Maria Eunice Ribeiro Marcondes, Denilse Morais Zambom, Fabio Luiz de Souza, Hebe Ribeiro da Cruz Peixoto, Isis Valença de Sousa Santos, Luciane Hiromi Akahoshi, Maria Fernanda Penteado Lamas e Yvone Mussa Esperidião. Caderno do Gestor Lino de Macedo, Maria Eliza Fini e Zuleika de Felice Murrie.

A Secretaria da Educação do Estado de São Paulo autoriza a reprodução do conteúdo do material de sua titularidade pelas demais secretarias de educação do país, desde que mantida a integridade da obra e dos créditos, ressaltando que direitos autorais protegidos*deverão ser diretamente negociados com seus próprios titulares, sob pena de infração aos artigos da Lei no 9.610/98. * Constituem “direitos autorais protegidos” todas e quaisquer obras de terceiros reproduzidas no material da SEE-SP que não estejam em domínio público nos termos do artigo 41 da Lei de Direitos Autorais.

* Nos Cadernos do Programa São Paulo faz escola são indicados sites para o aprofundamento de conhecimentos, como fonte de consulta dos conteúdos apresentados e como referências bibliográficas. Todos esses endereços eletrônicos foram checados. No entanto, como a internet é um meio dinâmico e sujeito a mudanças, a Secretaria da Educação do Estado de São Paulo não garante que os sites indicados permaneçam acessíveis ou inalterados. * Os mapas reproduzidos no material são de autoria de terceiros e mantêm as características dos originais, no que diz respeito à grafia adotada e à inclusão e composição dos elementos cartográficos (escala, legenda e rosa dos ventos).


Validade: 2014 – 2017

Caderno do aluno volume 2 série 2  
Read more
Read more
Similar to
Popular now
Just for you