Page 1

Escuela superior politécnica de Chimborazo Facultad de ciencias pecuarias Escuela de ingeniería zootécnica


¿Cómo pueden los investigadores esperan identificar y estudiar todos los cambios que se producen en muchas enfermedades diferentes?

¿Cómo pueden explicar por qué algunas personas (ANIMALES) responden al tratamiento y no a otros?

"SNP" es la respuesta a estas preguntas ... Entonces, ¿qué son exactamente los SNPs? ¿Cómo están involucrados en muchos aspectos diferentes de la salud?

Un haplotipo en genética es una combinación de alelos de diferentes loci de un cromosoma que son trasmitidos juntos En un segundo significado, un haplotipo es un conjunto de polimorfismo de un solo nucleótido (SNPs) en un cromosoma particular que están estadísticamente asociados.

Que es el SNPs Un SNP se define como un único cambio de base en una secuencia de ADN que se produce en una proporción significativa (más de 1 por ciento) de una población grande.

es una variación en la secuencia de ADN que afecta a una sola base de un gen(adenina (A), timina (T), citosina (C) o guanina (G)) de una secuencia del genoma, con respecto al mismo gen en otro individuo

En genética los SNP siglas de single nucleotyde polymorphysms, son polimorfismos de un gen que ocurren por variación en una letra (nucleótido) de la secuencia de ADN

Los SNP contribuyen a las diferencias entre los individuos.

A pesar de que todos los individuos comparten el 99,9 e la secuencia genómica, cada persona tiene un genoma único. Es el 0,1 % restante el responsable de la diversidad genética.Muchas diferencias se deben a sólo la sustitución de un par de bases

No se parte de la hipótesis de que la enfermedad sea heredable, se parte de la pregunta de si en la población en general existe una asociación positiva, o lo que es lo mismo, una predisposición, o por el contrario una asociación negativa (protección)de determinado haplotipo con la enfermedad.

Los SNPs pueden estar en regiones codificantes o intergénicas.

Se dice que tienen más impacto aquellas que se encuentran en las regiones codificantes aunque todas pueden tener relación con la enfermedad. Si una enfermedad multifactorial es heredable, muchas de sus variantes estarán asociados a SNPs específicos

La ventaja con estos estudios es que como existe una media de 1

SNP cada 200

pb, podemos mapear muy estrechamente donde se encuentra nuestra mutación.


Single (Simple) Nucleotide Polymorphisms (SNPs) GCTGTATGACTAGAAGATCGAT GCTGTATGACGAGAAGATCGAT SNPs se utilizan para la identificación y análisis forense SNPs se utilizan para la cartografía y los estudios de asociación de todo el genoma de enfermedades complejas SNPs se utilizan para la estimación de la predisposición a la enfermedad SNPs se utilizan para predecir los rasgos genéticos específicos SNPs se utilizan para clasificar los pacientes en los ensayos clínicos


DNA Sequence

1 2 3 4


5 6









También puede ser considerado como el cambio de unos pocos nucleótidos, de pequeñas inserciones o de deleciones. Pero para que estas variaciones puedan ser consideradas como SNP’s deben darse por lo menos en un 1% de la población, si no se considerara una mutación como tal.

Con lo anterior se concluye que un SNP no es más que una mutación puntual con un éxito evolutivo importante que le ha hecho tener una incidencia significativa en la población, por lo que tienen la capacidad de funcionar como marcadores moleculares.

La cadena de ADN en 1 difiere de la del ADN en 2 en un sólo par de bases


ATTGCCCGTGTGAT puede variar en algunas personas a una forma alternativa (o alelo) de


En la segunda secuencia se nota la sustituci贸n de una C por una A en una ubicaci贸n espec铆fica.

VENTAJAS (USOS) Los SNP’s son el tipo de marcador genético más común que se encuentra en los seres humanos, ya que varían cada 1300 bases nitrogenadas en promedio, por lo que constituyen el 90% de las variaciones genómicas humanas. Estos son utilizados en

• Algunos tipos de pruebas genéticas • Su estudio es de gran utilidad en las investigaciones médicas para el desarrollo de fármacos • Debido a que no cambian mucho de una generación a otra, es posible seguir su evolución en estudios de poblaciones

DESVENTAJAS En general las variaciones en la secuencia del ADN pueden afectar a la respuesta de los individuos a enfermedades, bacterias, virus, productos químicos, fármacos, entre otros. Por más que esto sea una desventaja también ha sido de gran ayuda ya que los SNP estudian la variación de la secuencia del DNA pero únicamente de un solo nucleótido, es decir, es muy específico, y de esta manera permiten ayudar en las investigaciones que busquen dar solución de cómo tratar enfermedades.

Gracias al conocimiento de los SNP´s en el 2007 se pudieron desarrollar investigaciones que lograron informar sobre la

• • • • • • • •

fibrilación auricular, el trastorno bipolar, el cáncer de mama, el cáncer colorrectal, la diabetes tipo I y II, los problemas cardíacos, la hipertensión, la esclerosis múltiple la artritis reumatoide.

Observation of Haplotypes

Un haplotipo en gen茅tica es una combinaci贸n de alelos de diferentes loci de un cromosoma que son trasmitidos juntos

ventajas SNPs son la forma más frecuente de variaciones en el ADN ELLOS SON LA ENFERMEDAD QUE CAUSAN mutaciones en muchos genes Son abundantes y TENER SLOW tasas de mutación FÁCIL DE PUNTUACIÓN PUEDE TRABAJAR COMO LA NUEVA GENERACIÓN DE MARCADORES GENÉTICOS

Snp s genética 2014[1] [solo lectura]  
Read more
Read more
Similar to
Popular now
Just for you