Page 1

Salvador Millรกn Urquiza 170167 F-204

Proteinas 1- Queratina >S72493.2 keratin=keratin 16 homolog [human, tracheobronchial epithelial cells, mRNA Partial, 976 nt] GTGACCCTGGCCAGGACTGACCTGGAGATGCAGATCGAAGGCCTGAAGGAGGAGCTGGCCTACCTGAGGA AGAACCACGAGGAGGAGATGCTTGCTCTGAGAGGTCAGACCGGCGGAGATGTGAACGTGGAGATGGATGC TGCACCTGGCGTGGACCTGAGCCGCATCCTGAATGAGATGCGTGACCAGTACGAGCAGATGGCAGAGAAA AACCGCAGAGACGCTGAGACCTGGTTCCTGAGCAAGACCGAGGAGCTGAACAAAGAAGTGGCCTCCAACA GCGAACTGGTACAGAGCAGCCGCAGTGAGGTGACGGAGCTCCGGAGGGTGCTCCAGGGCCTGGAGATTGA GCTGCAGTCCCAGCTCAGCACGAAAGCATCCCTGGAGAACAGCCTGGAGGAGACCAAAGGCCGCTACTGC ATGCAGCTGTCCCAGATCCAGGGACTGATTGGCAGTGTGGAGGAGCAGCTGGCCCAGCTACGCTGTGAGA TGGAGCAGCAGAGCCAGGAGTACCAGATCTTGCTGGATGTGAAGACGCGGCTGGAGCATGAGATTGCCAC CTACCGCCGCCTGCTGGANGGCGAGGATGCCCACCTTTCCTCCCAGCAAGCATCTGGCCAATCCTATTCT TCCCGCGAGGTCTTCACCTCCTCCTCGTCCTCTTCGAGCCGTCAGACCCGACCCATCCTCAAGGAGCAGA GCTCATCCAGCTTCAGCCAGGGCCAGAGTTCCTAGAACTGAGCTGCCTCTACCACAGCCTCCTGCCCACC AGCTGGCCTCACCTCCTGAAGGCCCGGGTCAGGACCCTGCTCTCCTGGCGCAGTTCCCAGCTATCTCCCC TNCTCCTCTGCTGGTGGTGGGCTAATAAAGCTGACTTTCTGGTTGATGCAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAA

2- Hemoglobina >AJ131352.1 Trema virgata gene encoding hemoglobin, isolate T5 ATGAGCAGCTCAGAAGTTGACAAAGTTTTCACAGAAGAGCAGGAAGCTCTGGTGGTGAAATCATGGGCTG TAATGAAGAAGAACTCTGCTGAACTGGGTCTTAAATTCTTCCTCAAGTAAGTCAAGATTATAGATAGTAC ACTTTTTATTTACTTTGCTTCTTTTGTAGACTAAGTTTTTGAATCAAAAGGGTACATTTTTTTTCCTGAA AAAAATTGGTTGATATGAAACTTTGCAGGATATTTGAGATTGCACCGTCTGCCAAGAACTTGTTCTCGTA TTTGAAGGACTCTCCGATTCCTTTGGAGCAGAACCCAAAGCTCAAGCCCCATGCTATGACTGTCTTCGTT ATGGTAAAGCCAACTTTTGTTCTCCATTTCCCTTGTCCTAATTTTTACAAGAGTCTAATGTTAATAAAAT AGTATTTTGCCAATTTAAACAATCAAAAATTTAGACACAACTATGTAAAACATTTTAATTCTTGGGGTTT ATGATACATTGATCTATAGTGAATCTAACTTCCCGTGTTACATTTATGAGCTGTGCTAGCAACAGTAGCA TCACAGTCGTCTATTCCTATAAGCAGAATGGACGACTGTGACTGGTGAGACATATCAATGCAAAGCTTTA CAATTTTTATGTTCCTCACTTGCTCTGTTCTTTTTCTCTGGTACTTGTCCTGGAAAGACGTGTGAATCTG CGGTTCAACTTCGGAAAGCCGGAAAAGTAACAGTGAGAGAATCAAACTTGAAAAGACTTGGGGCTATCCA CTTCAAAAATGGCGTAGTTAATGAACATTTTGAGGTACTACCCTGCCCATATAGTAGATATAATTCCATA AGTGTAATCCAAACACTTATTGTTTAGTGTCAAATTACTATTATTCTGTATGGTGGTTCTTGAATAATCG ATCTTATTATGGTATTTACTAATTATATTATGCATTGAAAAAACCGTTTGTAGGTCACAAGGTTTGCACT TTTGGAGACCATAAAGGAAGCGGTACCAGAAATGTGGTCTGCTGAGATGAAGAACGCATGGGGAGAAGCT TATGATCTGTTGGTTGCTGCTATCAAGTTCGAAGTGAAACCCTCCAGTACTTGA

3- Colageno >AH002560.3 Gallus gallus collagen a2 mRNA gene, partial sequence; and precollagen alpha-2, collagen alpha-2, collagen alpha 2, collagen a2, and collagen alpha-2 genes, partial cds CCCCCGGACAGCTCCCGCTCCGACAGCCGTCGCGCTTACCGGCGCGCCCGCCGCCGGCGGGCAACAAAGC AGGGCGAGGGGCGGGGAACGTCTGAAAAAAAAAAAAAAAATCAGACGGCGAGTCAGATTTTCCTCCTGAA AGCCTCAAAGTGTCCACGTCCTCGAAGCATGGAACCAATTTAGCGCCGCCGCCGCCTTCCTCTTCCCTCC CTTCCTCCCTCCCTCGCCCCCCCCTCCGACCCCGCAGCCGAGCAGCGCCGGGCTGGGGCCGGTGGGCACG TGACAGCGCTGGGAGCCGCGCGGGCCCCGCGGCGCCGCGCGCCCATTGCTGCAGCGCCGCCGGTGCCCGC AGCCGCGGGACCCCCTGCGGTATAAATACGGCGGAGCGGGGCTTGATTAATTTAGCATCCCGGGCAGCAG GTTTCTGCTAAGTTTGGAGTTACTCCTCGCGACTGTATGCCTGCGTCCTGCAGGTAATAGCCAACCACGT CCGGGGGCTCTGCAACACAAGGAGTCTGCATGTCTAGCAAGTAGACATGCTCAGCTTTGTGGATACGCGG ATTTTGTTGCTGCTCGCAGTAACTTCATACCTAGCAACAAGCCAACGTAAGTGCTTTCGCTTGTTCGTGG


Salvador Millรกn Urquiza 170167 F-204 CATGGGTGGCGGCAGGGGGTGGCTGTCCTCGCTCCTGCGCGCTCAGGAAANNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNATGTGAGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGTGGAGATGGCCAGTC TGCCAGGCTAAATTTCATTGCACGGAAGGATTATGAGAGAACTCAGGTGTGATTTTCATTTATGCTATAT TTGTAGGCTATAATAAGTATAAAATTGCCACCTTTCAACAGAAGGTCTAATGTGGTACATATATATTCAC TATATAATAAACTCTTAACCTTGCTAGTAATTTAAAGAGCACAGGGCATGCTTAAGTATAGGGTGCTGAC AGAAATTGTAGGGTTGAAAGGAGATGACGAATTTAAGTTTGTACATTGTATTTTTTTTAAAAAACTGATA ATTTGTACCTTTTTTTTCCTAATTCTCTGCCTTATCTCTTCCAGGCATCTGCAGGGCGGAAGGTAAGCAG CTGCGTTTTTCTTGTGTGGAGATGTAGATGACATCTAAATATTCCTGAACAGAGTAATATTTTGTGGAAT GTTGGATGACAAAGTGGACTAAAGTTGTTATTTCCCAGTGCTCACTGAGATGAGTAAGAATGATAAGGAG AGAACAATGGGGTGCATTAGCTTAGCAAAACGGTAAATGCAAGCTTAGGATTTAAGCTGCTTTATCCAAG AGCAGAACTAAGCATACTGAGAACCCAACTGCATCAAGAAAGAATTCTTGTTCAACAGGAGTTTCTTTGG AAGGGTTTCATGAGTTGAACAGTACAGCAGTATCCATACAGATCTGAAGGGATAAGTAGATAACCACTTT ATTTTGAGAAGCGTCTCTGTTAAATAACAGACAGTTATCATGGAGAACAAAACAAACTGCCAGAGTACTT CTGTGCAGTGATTATTCAGCTGATGCAGTGGTGACAGTAACTAATTTATTTCTAGTAGCATATCGAGGCT AAAGATACACCGTGGAAAATAAGTGTAGGACCTATCCTTGCAGTCTTCTTTTCTTTTCTCATGTACACCA ATGATTCTTCGTTTTCCTGTATCATCCTAGTTTCTGTGGTAACTAAGTTCTGTTTTCTTCCAACAGGGCC CTAGAGGAGACAAAGGGCCACAGGGAGAAAGGGTAAGGAAGTAGATTGACATTTATTTATTTGTGGTCTT TGAACAGTTGTTGGAAGATCAGTAGGAAAAAGCTAAGTTTAGCTATTAATAAGTTTAATGTACTTGTNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNACGGCGGACGGGCAAGGCAGTGTAAACTCAGGCTATGCTCATT TTCTGACATTAGCCATATATGTGATATTACGCATATAGCAGTGCTACAGTATGTGCTGTAGGTACCTGAT TGTCTCATCACTGCAGGTTTCATAAGCTACTTTTAATGTTCACTTTATAATCCTCGTTTTGTCTCTAGGG TCCACCAGGTCCACCAGGCAGAGATGGTGAAGACGGCCCACCAGGTCCTCCAGGCCCCCCTGGTCCTCCA GGTCTTGGCGGAGTAAGACATGCAAACTTTTTATTACTGAAATTGATAATTTTTGCTTTGTGATGACTAA AGACTAAATGTATATTTACTGGCACGCTGACATTCAACTGGAGAGTAGAGCAAGCAATCTTGTGTCATTG GCATCAGATTAGTGGTCTCAGTTCCAGTGCAACTCTCCTTAGGATCTGTATCTTCCTCAGCAACTTTGGA TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCTTCCTACTGAATCAAGTCTTTCTGGAAACAGATGA ATAGAAATGTATTTGTAAAAGGGTCATGTGTACTGAGTTTTAAGTATGTTGCTTCAACATACTGTCTAGC AAATGAGGTAATGGATACATGTAGAATGAGGGTTATCAGTGCTTTCTGAAGTAAGAATTGTAGTGACTTT TATTTCAAATTTTTGTCATCTACAGAATTTTGCTGCTCAGTATGATCCATCTAAAGCGGCTGACTTTGGC CCCGGACCTATGGTAAGTATATGATTTAACACTTGGTAACTTGCATAAACATGTATTTAAGTGTACTCCA GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAACAGGGTCCCCAAGGTCCTCGTGGTCCCCCTGGTC CTCCAGGAAAGGCTGGTGAAGATGTAAGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTAGG GTCACCCTGGCAAACCTGGAAGACCTGGTGAGAGGGGTGTTGCTGGTCCTCAAGTAAGTAANNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNGGGCCATTCTGTGATTCTGTGTGATTATAATGTCAGGCTAATGAAGTTA CTCTGCAATTGCCCTAACACTCTGGATACTGATACAGAGCTTTATCCTTTTCTCAAACAGGGTGAAATCG GACCTGCTGGTAATGAAGGCCCTACTGGTCCTGCTGGTCCAAGAGGAGAGATTGGACTTCCTGGTTCCAG TGGTCCTGTTGGCCCTCCCGTGAGTACCTTGCCAGTCTTTATCTATTGTCAGATGGATGCATTTGAGACT GAATTAACCAGTATAATTCTTTTCTGCCTCCATAGGGCAACCCTGGTGCTAATGGTCTTCCTGGGGCTAA AGGTGCAGCTGTAAGTATAGCCACATGCACACTTATTTACTTTAAGATTAAAAAAAAATAACAACAACAC ACCACATTTCAGTTAATGGATCACAAAAGATAATGAACTTACAGTAGACTTTCTCTGTTTGGAACAGGGT CTTCCTGGTGTTGCTGGTGCTCCTGGTCTGCCTGGGCCCCGTGGTATTCCTGGTCCTCCTGGCCCTGCTG GTCCAAGTGGTGCTAGGGGACTTGTTGTAAGTGACTTTGTTTACTGCATGTCTTCATTTGAAAACTGGAT ACAGCATCCATCATTGTAAAATATTTCTTCTAGATATGTTCCTTCATTGAATGCAGACACTTTTGTTGCT TCAGTATAATTAAGCATTGTGAGCTTGTTTCTGTCTCTCAGTGAGACTGAAGAGGTTCACTTTGTACTCC CTTTGGCTGCAAGAACTATTAAGCTCTGACCCTCTTGATGGTATCAACAGAGATGTGACAGCAGTCTCAC AATCAGAACCTCAAGGGGTATCCCCAGTAGAGGAACCAGCCCAGAGCGTTTCTTAATTCAATTACTGTAA TTTCTAAACATCTTCAACATGTTTGTTTTCATGCCTATTAAACCTAAAGTGCAGTTACATTAACTGACTA TATCAAAATAGAGTCAGGCATGACACTGGATGATTAGAGATGGTTGTGATTCATGATAATGTTGTACAGG TAGAAGAAAGATCTGTAGAATGGTGCTTAATTCTAGAATCTCTTTTTATGTTGGACTCTAGGGTGAACCA GGCCCTGCTGGTGCCAAGGGAGAAAGTGGTAACAAGGGTGAGCCTGTAAGTATGGCAATTTGTGAGTGTT


Salvador Millรกn Urquiza 170167 F-204 GTTTCAATGAATATAGTCTCATAGTACCTAGTAGCTCAGCTCTAATTTATTCTTTTCCTCTTGGCTGAGG TAGGGTGCTGCTGGCCCCCCTGGCCCTCCTGGTCCAAGTGGTGAGGAAGGCAAGAGAGGCAGCAATGGTG AACCTGGCTCTGCTGGTCCCCCTGGCCCTGCTGGTCTAAGAGTAAGGTTTTTTTTCATGTTCCAGAAGAA AAAAACAAAAAGGAAAGAAGAAATAAAGCTATATCTGCAAAGGGAAATTAAATAATTATAAATGACTACA TTTGTGTTAATGCAACTAGGCAAAGGTCATTTTGCTGTTCTGTGCCTTTTGATTTGCTGGGACCACCCTA ATTTTTGTTTTGCATTAATGATGTTTATTATCTTATCCCTGAATTAATTTAAGGTTGCTTTGTGTTATCC ACTGATTAATATTTAGAGAAATAGCACTAACTTTGCTGTGAAGCTTGAGATATAAGTGCTCGAAAGAGAT AGTTGGCTCACATGTAATGTTTGGGAGAGGTTTAAGTTCAGTGCCTTCGAGGGTATCTGTAGTACGCTTA TCACAGGGCGAGGAAACAACACAATGTCTTTCAGGAGGCACGTAGCTTTGAGCAGGTGCAGGTGTAGGAA NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGGGAACAGAGTTTTCTTTCCTTTTTCAGATTTAATTT GTATTCACTTGCAGGGCGAGCCTGGATCTCGTGGTCTCCCTGGAGCTGATGGCAGAGCTGGTGTCATGGT AAGGCTTGTCTCTGAATCATTATTTCTAAACCATCTTCTTTTATATACAAATGTGTGATGCTTTTTGCTA CCTATTCCTAATTTTATTTATTTCTTTTGTTGTTAGGGACCTGCTGGTAACCGTGGTGCTAGTGGACCTG TTGGTGCTAAGGGTCCTAATGGTGATGCTGGCCGTCCTGGTGAACCTGGTCTTATGGGTCCAAGAGTAAG TCTAGAACTGTGCAAAAAGAAACTACTTGTATTTGTGGTAAATTATCAGAAATCCAATTGCAGGAAGTTC TATTCAAGCCACAATTAGACTGTTTCTATCAGCCCACTGAAAAAACATCCGTGAGGGAATGATTAAGCAG CATCAAAATGTTTATTGAAATTCATTTCTTTAGTAATCTGGTGGCATCTAATTGCCTTGGCCATGGNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTAGGGTTTCCCTGGAGCAGATGGTAGGGTTGGGCCAATC GGTCCAGCCGGTAATAGAGGTGAACCTGGCAACATTGGATTCCCTGGACCAAAAGGTCCCACTGTAAGTA CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTTCAGGGTGAGCCTGGCAAACCTGGTGAAAAAGGCA ATGTCGGTCTTGCTGGCCCACGGGTACGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAAACCA GGCGAAAGGGGTCTCCATGGTGAATTTGGTGTCCCTGGTCCTGCTGGCCCAAGGGGCNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNTTCAACAGGGCAATCCTGGAAATGATGGTCCTCCAGGCCGTGATGGTGCTCCT GGCTTCAAGGTAGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCACAGGGTGAGCGTGGTGCT CCTGGTAACCCAGGTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCTTCTGGAAAGCCTGGAA ACCGTGGTGATCCTGTAAGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTCCAGGGTCCTGTTG GTCCTGTTGGTCCTGCTGGTGCTTTTGGCCCAAGAGGTCTCGCTGTAAGTCTNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNGGATTAACACTTTTCATGGGTGTCTTAACAGAATACACATAAATATATCAGGGGCCAC CTGTGGCAATGCAGAACACTTAATTCATTCTTTGTCAGTAATATCTAATTCAGGCCTTCTCTGGCATGTA TATCCTTTCCTAGGGCCCACAAGGTCCACGTGGTGAGAAAGGTGAACATGGTGATAAGGGACATAGAGGT CTGCCTGGCCTGAAGGGACACAATGGGTTGCAGGGTCTTCCTGGTCTTGCTGTAAGTAAATGATTTTCAG TAATTTTTTTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAAGATCCAAACACTCGGTCTCCACA TAATAGAGATGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAGTCTCTTATTTTAAAGGCTTT ACTGGAAACCCTAAGAGACAATACAAGAGACTACTATAGGTTATACCTTTAAATAACTTTTTTACTCACT TTCCTCCCACATTTTATATCCCAACTCCACTAATGCCAGTTGCCCAAGATTTCAGTTCTCTGAACCCAAA TATGTCTGCTGATCCCCTCTTGAATCATGTTAATACAATGTGTGGCATTGCATTTTTTAATGATGCATTT CTTTTCCCAATAGGGCCAACATGGTGATCAAGGTCCTCCTGGTAACAACGGTCCAGCTGGCCCAAGGGTA TGTGAATTCAAGAGTATATGCAAATAATTCTCCTATTCCTTTTATGGAATATATTTGTACACTGTCCTTT GTATGAANNNNNNATTTGTAGTGTTCCCTACTGTTGTTAAACTGTTCAAGTTTTCTTCTAGGGTCCTCAT GGTCCTTCTGGTCCTCATGGTAAGGATGGTCGCAATGGTCTCCCTGGACCCATTGGCCCTGCTGGTGTAC GTGGATCTCATGGTAGCCAAGGCCCTGCTGTGAGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTA TGGCCAGCCAGTATAAGCACAAAGGTTTGGTAGTTCCACACAGTGTATCTTCTGCTTCAGTTCACAGGAG TTACCACAGAGCAGGTCCATAGGTCCTTCCTCAGATTATTGTTGAGGGTTCTAAGACTTCAGAAGGACAA CGCATGTGTGGAAATAGTCAGCTGAAAGTATCATAAATGTGATAGAATACTAATTGTCTTTTGCTTTTGA AAAACTTTAGGGCCCTCCTGGCCCTCCTGGTCCCCCCGGCCCCCCTGGTCCCAATGGTGGCGGATATGAA


Salvador Millรกn Urquiza 170167 F-204 GTTGGCTTTGATGCAGAATACTACCGGGCTGATCAGCCTTCTCTCAGACCCAAGGATTATGAAGTTGATG CCACTCTGAAAACATTGAACAACCAAATTGAGACCCTGCTGACCCCAGAAGGCTCCAAAAAGAATCCGGC TCGCACCTGCCGTGACCTCAGACTTAGCCACCCAGAATGGAGCAGCGGTACGTGGTGCCAGATGTTTCCT CTTTCTGGCTCAGCATAGTTATTTTCAGCTTATTAGCTTTCTTTTGGTNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNCCGCGAGGCGCCTCTCGTCCTCAAGGGTTTCTCCTGGATTGCGCCTAACCACGGCTGTACTG CAGATGCCATTAGAGCATACTGTGACTTTGCTACTGGTGAGACTTGCATCCATGCTAGCCTTGAAATAAT TCCGACTAAGACATGGTATGTCAGCAAGAACCCCAAGGACAAAAAGCACATATGGTTCGGTGAAACTATC AATGGTGGTACTCAGGTATGTGATGCATTGGAGGATGATTGTTTCCTACAGTGCTTTTTAAGAATTTGCT ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTCAGTGAGCTTAACTCATTTTTTAATCTCTTAGAG GAGAAATACAAAATGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATTTCTAACGGAATCCTGTC TGGAATATGCTACTTTAGTACAAAGACAGTCCAGAAACAGAGAAAGTAATGAAATAATTTTTGCAATCTT TTAAATTGGGATTTATTTTTGACATATTGTGCTAGTTCAAAGGAATTGATATTTTTATTACACTGAAACT TGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTACTAGTATGTTAGATATTGTTACCAAGCCTGCT GGAAAGTCCTTTCTGTACAATTAAGAAGAACTAATTTCATAATTTTTAAAAGAAATTGAGTTAGTCTTAT GATGAAATCCCAATTTACAAGTTCTTCAATATAAAAACAAAGTTTATCACTGGGTCAGAACAAGGACCCA AGGTACTCTANNNNNNNNNNGATCATATTTCTCACATTGGCTGAAAGCGTTGCTGGTAAAGAATATAAGG AAGCAAATATTCATAACATCCACAGACACTACTCTAAAACTAAAATAAGAAATAAAAAATCAGGGCTTTC TTGAGCTTGGGCATTGTCTATATTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGTGGTGGTTT CTTGTCTTTTTCAGTTTGAATACAATGGTGAAGGTGTGACCACAAAGGACATGGCCACCCAACTTGCCTT CATGCGTCTGCTGGCCAACCATGCCCCTCAGAACATCACCTACCACTGCAAGAACAGCATTGCCTACATG GATGAGGAGACTGGAAACCTTAAAAAGGCTGTTATACTCCAGGGATCCAATGATGTTGAACTACGAGCTG AAGGCAACAGCAGATTCACTTTCAGTGTTCTTGTGGATGGCTGCTCTGTAAGTAACACAGAAAGCATGGG CAGTATGATTGTATTAAAGACAGTTCTACTTTGATTCAGAACTAGATTATCAGGCAGACCAGAAACATTT TATCCAGTGAGGATAAATAGCCTGTAGAACCAACTACGCCATGTCTTTAATGAGTGGCAAAGACTGGTGT ACTAACAGATCCTTCCTGCACTGTGCAATGTGGCAAAGAAAAGANNNNNNNNNNGCTTTTCTGAAGAACC AGACCCAAATTCCGTGGAAACCGAAGCATGCCGAGAAAGTAGCACAAAAGGTGCAGGAGGGCAGAGTCGA GTCGAGTCTTCAAAAGATCAGGCAAGGTTCTCTGAGGTTCAATCAGCACGAATAATACGGAAATATAGAA CACACATGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTAATACTGCTTCTCTTGCAGAAAAAGA ACAACAAATGGGGCAAAACGATCATTGAGTACAGAACAAATAAGCCGTCTCGCTTGCCCATCCTTGACAT TGCACCTTTGGACATTGGTGGCGCTGACCAAGAATTCGGTTTGCACATTGGCCCAGTCTGTTTCAAATGA ATGAACTAAAATTAACTTAAAGGCCCCCCCCTCAGAATTATTCTTTGTCATTTCTTTTTGTAATGAGAGC TGACTCCTTCCATTTTTTTTCTGTTCA

4- Insulina >M57671.1 Octodon degus insulin mRNA, complete cds GCATTCTGAGGCATTCTCTAACAGGTTCTCGACCCTCCGCCATGGCCCCGTGGATGCATCTCCTCACCGT GCTGGCCCTGCTGGCCCTCTGGGGACCCAACTCTGTTCAGGCCTATTCCAGCCAGCACCTGTGCGGCTCC AACCTAGTGGAGGCACTGTACATGACATGTGGACGGAGTGGCTTCTATAGACCCCACGACCGCCGAGAGC TGGAGGACCTCCAGGTGGAGCAGGCAGAACTGGGTCTGGAGGCAGGCGGCCTGCAGCCTTCGGCCCTGGA GATGATTCTGCAGAAGCGCGGCATTGTGGATCAGTGCTGTAATAACATTTGCACATTTAACCAGCTGCAG AACTACTGCAATGTCCCTTAGACACCTGCCTTGGGCCTGGCCTGCTGCTCTGCCCTGGCAACCAATAAAC CCCTTGAATGAG


Salvador Millรกn Urquiza 170167 F-204

5- Caseina >X00374.1 Guinea-pig mRNA sequence for casein A ACCTGGCCTTCTTGTCTTCCACTTGGGAAATAAGGACTCAGTAACCATGAAGCTCTTCATCTTCACCTGC CTCTTGGCTGTGGCTCTCGCAAAGCACAAGTCAGAGCAACAGTCCTCCAGTGAGGAATCTGTCAGCATCT CCCAGGAAAAATTTAAGGACAAGAATATGGACACTATTTCTAGTGAGGAGACCATTTGTGCCTCCCTCTG CAAGGAAGCTACAAAGAACACACCTAAAATGGCATTCTTTAGCAGATCTTCTAGCGAGGAATTTGCTGAC ATTCACAGAGAGAACAAAAAAGATCAACTTTATCAGAAGTGGATGGTACCCCAGTATAACCCGGATTTTT ACCAACGTCCCGTTGTCATGAGCCCGTGGAATCAGATTTACACAAGACCCTACCCCATTGTGCTTCCCAC TTTGGGCAAAGAACAGATCTCCACCATTGAGGACATCCTAAAGAAGACTACTGCTGTGGAATCCTCTAGC AGTTCATCTACGGAGAAATCCACTGACGTATTTATTAAGAAAACTAAGATGGATGAAGTACAAAAGCTTA TCCAAAGTCTCCTGAACATAATTCATGAATATTCCCAGAAGGCCTTCTGGTCCCAGACCCTAGAAGATGT TGACCAGTATCTGAAATTTGTAATGCCGTGGAATCACTATAATACAAATGCTGACCAAGTCGATGCCTCT CAGGAGAGACAAGCTTGATTCTTGGATTAACTGTTTTTACCTTGTCTTGGTTTAACTGGAAAATCTACCC TCTACAGTCTCTTTCTCTGCCTTTTAACTTCACGCTCCCAGCATATTTAGACAGACTTACAGACAAGACA GAAATCCTGAGCCAAAGAAGACCCCACAGGGCGCCTTCGGAATTCCAGTCTTTCTGCTGGTCCGTGTCAA ATCTGTTGGATCCGTATTGTTGCATAGGAGCTGCGTTGATAACTAATTTAACGTGTTTCTGCAACTTTTT TTTCTGTTAAACCACATTACTTTTCCTCGCAAAATAAAACTCTAAGTGCATCCCTT

6- Fibrina >HV190859.1 JP 2006223316-A/34: Recombinant Fibrin Chains, Fibrin and FibrinHomologs AATTTCGTTAACAAGCGCGGCCCACGCGTTGTGGAA

7- Albumina >M28276.1 Frog albumin mRNA, partial cds CACTGCTGTGCCGTACCTGAAAATCAAAGGATGCCATGTGCAGAAGGAGACCTTACCATTCTCATTGGAA AAATGTGTGAAAGGCAAAAGAAGACATTTATAAATAACCACGTTGCTCATTGCTGCACTGACTTATATTC TGGGATGCGTTCATGCTTTACTGCTCTTGGTCCAGATGAGGACTATGTACCACCCCCAGTTACTGATGAC ACATTTGACTTTGACGACAAGATATGCACTGCTAATGATAAAGAAAAACAGCATATCAAACAGAAATTCC TTGTGAAGCTGATTAAA

8- Prolactina >X76049.1 C.hircus caprine pituitary gland prolactin mRNA GGAGGACGAGAGCTTCCTGGTGAAGTGTGTTTCTTGAAATCATCACCACCATGGACAGCAAAGGTTCAGC GCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGTCAGGGTGTGGTCTCC ACCCCCGTCTGTCCCAATGGGCCTGGCAACTGCCAGGTGTCCCTTCGAGACCTGTTTGACCGGGCAGTCA TGGTGTCCCACTACATCCATAACCTCTCCTCGGAAATGTTCAATGAATTTGATAAACGGTACGCCCAGGG CAAAGGGTACATTACCATGGCCCTCAACAGCTGCCATACCTCCTCCCTTCCTACCCCTGAAGACAAAGAA CAAGCCCAACAGACCCACCATGAAGTCCTTATGAGCTTGATTCTTGGGTTGCTGCGCTCCTGGAATGACC CTCTGTATCACCTAGTCACAGAGGTGCGGGGTATGAAAGGAGTCCCAGATGCTATCCTATCGAGGGCCAT AGAGATTGAGGAAGAAAACAAACGACTTCTGGAAGGCATGGAGATGATATTGGGCCAGGTTATTCCTGGA GCCAAAGAGACTGAGCCCTACCCTGTGTGGTCAGGACTCCCATCCCTGCAAACTAAGGATGAAGAGGCAC GTCATTCTGCTTTTTACAACCTGCTCCACTGCCTGCGCAGGGATTCAAGCAAGATTGACACTTACCTTAA GCTCCTGAATTGCAGAATCATCTACAACAACAACTGCTAAGCCCACATTCATCCTATCCATTTCTGAGAT GGTTCTTAATGATCCATTCCCTGGCAAACTTCTCTGAGCTTTATAGCTTTTTAATGCATGCTTGGCTCTA ATGGTTT


Salvador Millรกn Urquiza 170167 F-204

9- Elastina >AH001137.2 Bos taurus elastin gene, partial cds; elastin gene, partial cds, alternatively spliced; and elastin gene, complete sequence GGAGGACTGGGCCCTGGAGTCAAACCAGCTAAGCCAGGTGTCGGAGGGCTTGTCGGCCCTGGCCTTGGAG CAGGGCTCGGGGCTTTGCCCGGCGCCTTCCCAGGGGCTCTGGTGCCCGGTGGCCCGGCTGGCGCTGCTGC AGCCTATAAAGCCGCTGCCAAGGCCGGTGCTGCTGGTCTCGGGGTCGGCGGCATTGGTGGTGTTGGCGGC TTAGGAGTGTCTACAGGTGCAGTGGTGCCTCAACTTGGAGCCGGAGTCGGGGCTGGAGTGAAGCCTGGGA AAGTGCCAGGTGTGGGGCTCCCAGGTGTGTACCCGGGCGGAGTGCTTCCAGGCGCAGGAGCTCGGTTCCC GGGTATAGGGGTGCTCCCCGGGGTTCCCACTGGAGCAGGAGTCAAGCCCAAGGCCCCAGGTGGGGGCGGA GCTTTTGCTGGAATCCCAGGAGTTGGACCCTTCGGAGGGCAGCAGCCTGGAGTCCCGCTGGGATACCCCA TCAAGGCACCCAAGCTGCCAGCTGGCTATGGACTGCCCTACAAAACGGGGAAACTGCCCTATGGCTTTGG GCCTGGAGGAGTGGCTGGCTCCGCGGGCAAGGCTGGGTATCCAACGGGGACAGGGGTTGGCCCCCAGGCT GCAGCAGCAGCGGCTAAAGCAGCAGCGAAGCTTGGTGCTGGAGGAGCCGGAGTTCTCCCTGGCGTTGGCG TCGGTGGTGCTGGCATTCCTGGTGCGCCTGGCGCAATTCCTGGCATCGGAGGCATTGCAGGGGTCGGGGC TCCAGATGCTGCTGCTGCCGCCGCCGCCGCCGCTAAAGCAGCCAAATTCGGTGCTGCTGGAGGCTTCCCA GGAGTTGGAGTCCCTGGTGTCGGGGTCCCTGGTGTCGGGGTTCCAGGTGTCGGGGTCCCTGGTGTCGGGG TTCCAGGTGTCGGAGTCCCAGGTGTTGGAGTCCCAGGTGTTGGAGTCCCTGGTGTTGGGGTCCCTGGTGT TGGGGTCCCTGGTGTTGGAGTTCCAGGGGCCGTGTCCCCAGCCGCAGCTGCTAAAGCAGCAGCCAAAGCA GCCAAATTCGGGGCCAGAGGCGGAGTGGGAATTGGAGGCATTCCCACATTTGGGGTTGGCCCTGGGGGCT TTCCTGGCATCGGAGACGCAGCAGCAGCTCAGGCAGCTGCCGCCGCCAAGGCAGCCAAAATCGGTGCTGG GGGAGTAGGAGCCCTGGGAGGGCTGGTGCCAGGCGCCCCAGGAGCAATACCAGGCGTGCCAGGTGTTGGA GGGGTGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTGCAGGTCGACGGATCCTTAATCTTCGC CTTTCCAGGGGGTCGGGATTCCAGCAGCTGCAGCCGCCAAAGCTGCCGCCAAAGCCGCCCAGTTTGGTAA GAGTTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCTTCTGTCCTCCTTGGTTAGGATTCGGT TAAGGACTGGCTCTGCTCGCTTTTGCAGGATTAGGCCCTGGAGTCGGCGTGGCTCCCGGCGTTGGCGTGG TTCCTGGCGTCGGTGTGGTTCCCGGTGTCGGCGTGGCTCCCGGCATTGGCCTGGGCCCCGGTGGTGTCAT AGGTAAGCCGTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGGGTGCTCTGAATCCTCCATGGG TGCCGTCCTTAAACCTCATCCTCTCCCCTACAAGGAGCAGGGGTCCCAGCTGCAGCCAAGTCTGCTGCTA AGGCCGCCGCCAAAGCCCAGTTCCGTGAGTGTCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCC CCAAAAGGGCCTTGTTCCTGCCTGCCGTTGTCACCTTACCCCCCCATCTCCCGCAGGGGCTGCTGCTGGC CTTCCCGCTGGTGTTCCTGGCCTTGGAGTGGGCGTTGGAGTTCCTGGCCTTGGAGTGGGCGTTGGTGTTC CTGGCCTTGGAGTCGGGGCCGGAGTTCCTGGATTTGGGGCAGGTAAGGGGCCTTNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNTCCCAGGCACAGAGCTCAGCTACTGACCTCCCCAACTATTCCTTTTGCCCTTTTCC CCAGTACCTGGAACCCTGGCCGCAGCTAAAGCAGCCAAGTTCGGTAAGAGCCCCTNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNTGGGGAAGCCTCGTCCTTCAGAAGGGGGGGAAGGACTGACTTTCCGCCCTCTCTC CACAGGACCAGGAGGGGTCGGGGCCCTTGGAGGGGTTGGAGATCTTGGTGGAGCCGGCATTCCAGGTGGT GTGGCAGGTGAGTTGAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAAGAGGGAGACTGACCTG TGGAGACCTCCCTGTCCCTGAGCTCCCTCTGTGTCCCAGGAGTCGGACCTGCTGCCGCGGCCGCCGCCAA AGCTGCCGCCAAAGCCGCCCAATTTGGTGAGCACGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC CGCGGACAGAGCCAGCTGCACACAACTTTCAGGGTTTAATACACAGCTCTCTCCACAGGCCTGGGGGGAG TCGGAGGCCTGGGAGTTGGTGGGCTTGGAGCTGTCCCAGGGGCTGTGGGCCTTGGAGGTAAAGTGTGTTN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGACACGACTCTGGGAGGGAGGAGATATTCCTAAGCCCTC CTGCTCCCCATCTTTCCAGGTGTGTCTCCAGCTGCAGCTGCTAAAGCAGCCAAATTCGGTGAGTTACTCC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGATGCTCAGGGCCCCTTACGCTGTGCCTCATCCCGACC CCCATCTGCCCTCTTCTCAGGTGCCGCTGGCCTCGGAGGTGTCCTAGGAGCTGGCCAGCCGTTCCCAATT


Salvador Millรกn Urquiza 170167 F-204 GGAGGTAGGGGCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCCCACACCACCCCACGCCCC CACACCCCCACGGCCAACCCCAAACCCCTCCTGCAGGAGTCGCAGCAAGGCCTGGCTTCGGACTCTCTCC TATTTTCCCAGGTAACGGCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGCTTGGTGGGCTT CTTAGAGGCGCGCACCCTCACCTCCCCTCTGCTTGCCTTGCAGGTGGAGCTGGGGGCCTGGGAGTTGGTG GTGAGTCTACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGCTGGTAGAGGTGGGGGGGCCAGGC CACCTCCCCAACCCCCTGCCTTCCCTCCACAGGCAAACCTCCCAAGCCCTTCGGAGGGGCCCTGGGAGCC CTGGGATTCCCAGGTGAGTAGACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGAGCACCAGCGG CCAGGACTGACTACTGACTGGGGGGCGTGCCTCCCCTGCACCCAGGTGGGGCCTGCCTGGGGAAATCCTG TGGCCGGAAGAGAAAGTGA

10- Zeina >M60835.1 Z.mays zein mRNA, 3' end GCTTCCCTTCTTCCCCCATACCTTCCATCAATTATAGCTTCAGTATGTGAAAACCCAACTCTTCAGCCCT ATAGGCTCCAACAAGCAATCGCAGCAAGCAACATACCTTTATCACCCTTGTTTCAACAATCGCCAGCCCT ATCTTTGGTGCAGTCATTGGTACAAACCATCAGGGCACAGCAGCTACAGCAACTCGTGCTACCTGTGATC AACCAAGTAGCTCTGGCAAACCTTTCTCCCTACTCTCAACAACAACAATTTCTTCCATTCAACCAACTGT CTACACTGAACCTTGCTGCTTATTTGCAGCAACAACTATTACCATTCAGCCAGCTAGCTACTGCCTACTC TCAGCAACAACAATTTCTTCCATTTAACCAATTGGCCGCACTGAACCCCTCTGCTTATTTCCAGCAGCAA ATACTACTACCATTTAGCCAGCTAGCTGCAGCAAGCCGTGCTTCCTTCTTGACACAGCAACAGTTGCTGC CTTTCTACCAGCAGTTTGCGGCTAACCCCGCAACCCTCTTACAACTACAACAATTGTTGCCCTTTGTCCA ACTTGCTTTGACACACCCAGCAGCCTCCTACCAACAACCCATCATTGGTGGTGCCCTCTTTTAGATTGCT TATTAGTTGTAATTCAATAATAAAGTTTTTTGGATGATGTATGTGGCCAACCAGAAATAAGAAGTTACAT TTCCAGATTTT


Salvador Millán Urquiza 170167 F-204

NCBI

(Centro

Nacional

para

la

Información

Biotecnológica)

Es una rama de los Institutos Nacionales de Salud. Está localizado en Bethesda, Maryland y fue fundado el 4 de noviembre de 1988 con la misión de ser una importante fuente de información de biología molecular. El NCBI ofrece además algunas herramientas bioinformáticas para el análisis de secuencias de ADN, ARN y proteínas, siendo BLAST una de las más usadas. NCBI nos ayuda a comprender el lenguaje mudo pero elegante de las células vivas de la naturaleza, en la búsqueda de la biología molecular moderna. Nos enseña un alfabeto de solo cuatro letras que representa las subunidades químicas del ADN que emerge de una sintaxis de los procesos de la vida cuya expresión más compleja es el hombre. Desentrañar y usar este "alfabeto" para formar nuevas "palabras y frases" es un enfoque central del campo de la biología molecular. El asombroso volumen de datos moleculares y sus patrones crípticos y sutiles han llevado a un requisito absoluto para bases de datos computarizados y herramientas de análisis. La misión es encontrar nuevos enfoques para lidiar con el volumen y la complejidad de los datos y proporcionar a los investigadores un mejor acceso a herramientas de análisis e informática para avanzar en la comprensión de nuestro legado genético y su papel en la salud y la enfermedad.

Nucleótido Es un compuesto orgánico fundamental de los ácidos nucleicos. El ADN y ARN están compuestos principalmente de estos. Algunas funciones son la señalización celular, el metabolismo y las reacciones enzimáticas. Los nucleótidos se componen de tres partes, un grupo de fosfato, un azúcar de 5 carbonos y una base nitrogenada. Los 5 tipos de bases nitrogenadas que se encuentran en los nucleótidos se llaman adenina, citosina, guanina, timina y uracilo (A menudo se abrevian A, C, G, T y T).

Dogma

central

de

Biología

molecular

El dogma central de la biología molecular se refiere a los tres procesos llevado por los ácidos nucleicos, tanto AND como ARN ; replicación, transcripción y traducción. Ilustra los mecanismos de transmisión y expresión de la herencia genética. Son procesos vitales para la vida, y tienen gran importancia biológica. Pero para comprender mejor el funcionamiento de estos mecanismos, es necesario saber algo sobre el ARN. El ARN es un tipo de ácido nucleico que posibilita la síntesis de proteínas. Es el que permite que la información genética que contiene el ADN sea comprendida por las células. Como ya se conoce, hay tres tipos de funciones de ARN, estas son: -ARNm o mensajero, que contiene una secuencia complementaria a una de las dos cadenas de ADN. -ARNt o transferente, este relaciona secuencias de tres bases nitrogenadas con aminoácidos.


Salvador Millán Urquiza 170167 F-204

-ARNr o ribosómico, forma parte de los ribosomas.

Gen El gen es una parte pequeña del ADN. Los genes ayudan a nuestro cuerpo a producir proteínas específicas que sirven para el metabolismo. Los rasgos genéticos, como el color de ojos, la estatura incluso enfermedades pueden ser definidas por los genes. Para ello hay dominantes o recesivos: -Los rasgos dominantes son controlados por un gen en el par de cromosomas. -Los rasgos recesivos requieren que ambos genes en par con otros genes trabajen juntos.


Salvador Millán Urquiza 170167 F-204

Bibliografía https://medlineplus.gov/spanish/ency/article/002371.htm https://arribasalud.com/nucleotido/#.Wn5U6qjibIU https://www.universidadviu.es/adn-arn/ https://www.ncbi.nlm.nih.gov/home/about/mission/

Proteinas  
Proteinas  
Advertisement