Page 1

Jesús Roberto García Fernández 161160

Proteínas Secuencia y función

Proteínas simples Albúminas: Las moléculas grandes, solución de sal neutra, soluble en agua y se diluye, se coagula al calentarla. Por ejemplo, la beta-amilasa, la albúmina de huevo, la albúmina del suero sanguíneo, los granos de trigo (Triticum) y las semillas de ricino (Ricinus communis). Es una proteína que se encuentra en gran proporción en el plasma sanguíneo, siendo la principal proteína de la sangre, y una de las más abundantes en el ser humano. Se sintetiza en el hígado Secuencia de ADN TGTCTCCTGAAACCCAATCTGTTTTGTCAGTTAAAGATAAAAATGCCACCCCTAAAAAAGATAT ACAAA AGGTTGTTGGTACATTTTCTACAGTATCATCTCAAACACCCTTAACATCATCGGGAGGCGGAA AAAAACA TATAACATTATTTAAGAAACCTAAGATATCCCAGGGAAAAATAGTTCAAAAAAAACATAAAATC AAATCA AATGTTTTGAAAGAAATTCACTATTTTCAGACACATATTGGATTTCTGATTCCTAAGGCACAAA TGATTC GACTTATTCGAGGAATTGTACAGGAAAAAACTAATTTACCACTTAAATTCACAAGGAGCAGTTT AAATGT ATTACAAGAAGCCTTTGAAGCCCAAATTGTACAAGTATTAGAGTATGCAAACTTAGTTGCAAG ACATGCA AAACGCGTCACTCTATTTCCATCAGATATAAATTTAGTGGTCAAAATTCGTGATAAACTTTAA

Globulina: Las moléculas grandes, neutrales, solubles en agua salada, se coagulan al calentarse a altas temperaturas, por ejemplo, la a-amilasa, los anticuerpos en la sangre, las globulinas de suero, el fibrinógeno sanguíneo, los granos de trigo, semillas de ricino, mostazas, legumina y vicillin de los guisantes, el archin y cornarchin de los cacahuetes y la glicina de la soja. Principales grupos de globulinas Las globulinas se pueden dividir en varios grupos:

globulinas alfa 1 y 2 globulinas beta globulinas gamma. Algunas de las siguientes globulinas se clasifican como "reactante de fase aguda". Esto quiere decir que son proteínas cuya concentración en el plasma aumenta o disminuye en caso de procesos inflamatorios o infecciosos y que por tanto sirven para determinar ciertas patologías.

Globulinas alfa 1


Jesús Roberto García Fernández 161160

La alfa 1 o antitripsina: Es la encargada de controlar la acción de las enzimas lisosomales. Nota: es reactante de fase aguda.

La TBG: Se encarga de fijar la hormona tiroidea. Transporta T3 y T4. La alfa 1 glucoproteína ácida: También conocida como orosomucoide, es un reactante de fase aguda sintetizado en el hígado como respuesta a la inflamación crónica y aguda, quemaduras, tumores y daño del tejido. La RBP: Es la hormona fijadora de retinol, la cual transporta vitamina "A". Normalmente se asocia a la prealbúmina. Globulinas alfa 2 El grupo de las globulinas alfa 2 está compuesto por las siguientes: La macroglobulina (alfa 2): La función primordial de ésta es neutralizar las enzimas proteolíticas. La haptoglobina: Es la encargada de fijar la Hb plasmática de los eritrocitos, y la transporta al hígado para que no se excrete por la orina. La ceruloplasmina: Transporta y fija el 90 por ciento del cobre sérico. El otro 10 por ciento es transportado por la albúmina. La protrombina: participa en el proceso de la coagulación transformándose en trombina que transforma el fibrinogeno en fibrina (coágulo). Globulinas beta La hemopexina: Es la que fija y transporta el grupo hemo de la hemoglobina (Hb) hacia el hígado. La transferrina: Transporta hierro del intestino a depósitos de ferritina en diferentes tejidos, y de allí a donde sean necesarios. Nota: Es un reactivo de fase aguda. El complejo C3 del complemento: Son proteínas séricas que actúan en inmunidad inespecífica, provocando la lisis de distintas bacterias. Globulinas gamma Corresponden a las inmunoglobulinas séricas o anticuerpos (IgA, IgE, IgG, IgM, IgD). Son proteínas de enorme peso molecular. Se encuentran en el plasma realizando funciones defensivas.

Secuencia de ADN GCACACACCCGAGCATATCACAGTGACACTACACGATGGTGAGCGCCAGAATCGTTGTCCTC CTCGCCG TCCTCCTATGCGCTGCCGCCGCAGTCGCGTCGTCCTGGGAGGACGACAACCACCACCACCA CGGGGGCCA CAAGTCCGGGCGATGCGTGCGGCGGTGCGAGGACCGGCCCTGGCACCAGCGCCCCCGGT GCCTGGAGCAG TGCAGGGAGGAGGAGCGGGAGAAGCGGCAAGAGCGGAGCAGGCACGAGGCCGACGACCG CAGCGGCGAGG


Jesús Roberto García Fernández 161160

GCTCGTCGGAGGATGAGCGCGAGCGCGAGCAGGAGAAGGAGGAGAAGCAGAAGGACCGG CGGCCGTACGT GTTCGACCGGCGCAGCTTTCGTCGCGTGGTCCGGAGCGAGCAGGGGTCCCTGAGGGTGCT CCGGCCGTTC GACGAGGTGTCCAGGCTCCTCCGCGGCATCCGGGACTACCGCGTGGCGGTCCTGGAGGCG AACCCGCGCT CGTTCGTGGTGCCCAGCCACACCGACGCGCACTGCATCGGCTACGTGGCGGAAGGCGAGG GAGTGGTGAC GACGATCGAGAACGGCGAGAGGCGGTCGTACACCATCAAGCAAGGCCACGTCTTCGTGGCG CCGGCCGGG GCGGTCACCTACCTGGCCAACACCGACGGCCGGAAGAAACTGGTCATCACCAAGATCCTCC ATACCATCT CCGTGCCTGGCGAGTTCCAGTTCTTCTTCGGCCCCGGCGGGAGGAACCCGGAATCGTTCCT GTCGAGCTT CAGCAAGAGCATCCAGAGAGCTGCGTACAAGACCTCGAGCGACCGGCTGGAGAGGCTGTTC GGGAGGCAT GGGCAGGACAAGGGGATCATCGTGCGTGCCACGGAGGAGCAGACCCGCGAGCTGCGGCGC CACGCCTCGG AGGGCGGCCACGGCCCGCACTGGCCCCTGCCGCCGTTCGGCGAGTCGCGCGGCCCCTACA GCCTCCTGGA CCAGCGGCCCAGCATCGCCAACCAGCACGGGCAGCTCTACGAGGCCGACGCGCGCAGCTT CCACGACCTC GCCGAGCACGACGTCAGCGTCTCCTTCGCCAACATCACCGCGGGGTCCATGAGCGCGCCAT TGTACAACA CCCGTTCGTTCAAGATCGCCTACGTGCCGAACGGCAAGGGCTACGCCGAGATCGTGTGCCC GCACCGCCA GTCGCAGGGCGGCGAGAGCGAGCGCGAGCGCGGCAAGGGCAGGAGGAGCGAAGAAGAAG AAGAATCGTCT GAGGAGCAGGAGGAAGTCGGGCAGGGGTACCACACCATCCGGGCGCGGCTGTCACCGGGC ACGGCGTTCG TGGTGCCCGCGGGCCACCCGTTCGTCGCGGTGGCGTCCCGGGACAGCAACCTCCAGATCG TGTGCTTCGA GGTCCACGCCGACAGGAACGAGAAGGTGTTCCTGGCCGGCGCCGACAACGTGCTGCAGAA GCTCGACCGG GTCGCCAAGGCGCTGTCATTCGCCTCCAAGGCGGAGGAGGTGGACGAGGTGCTCGGCTCG CGGCGCGAGA AGGGGTTCCTTCCTGGCCCCAAGGAGAGCGGCGGCCACGAGGAGCGGGAGCAGGAGGAG GAGGAACGCGA AGAACGCCACGGCGGGCGTGGGGAGAGGGAACGCCACGGACGTGAGGAGCGGGAGAAAG AGGAGGAGGAA CGCGAAGGACGCCACGGCCGCGGGCGCCGCGAGGAAGTGGCGGAGACGCTCCTGAGGAT GGTGACCGCCA GGATGTGAGGCCGGCCGTGCTCGCCAAAACGAGCAGGAAGCAACGAGAGGGTGGCGCGCG ACCGACGTGC GTACGTAGCATGAGCCTGAGTGGAGACGTTGGACGTGTATGTATATACCTCTCTGCGTGTTA ACTATGTA CGTAAGCGGCAGGCAGTGCAATAAGTGTGGCTCTGTAGTATGTACGTGCGGGTACGATGCT GTAAGCTAC TGAGGCAAGTCCATAAATAAATAATGACACGTGCGTGTTCTAT


Jesús Roberto García Fernández 161160

Prolaminas: Insolubles en agua pero solubles en soluciones salinas y alcohol del 70-80%, por ejemplo, la gliadina de trigo, la cebada y herdein de zeína de maíz. Estos están casi ausente en dicotyle-dones. son un grupo de proteínas vegetales con gran contenido en prolina. Se encuentra en los cereales, recibiendo diversos nombres en función del mismo: gliadinas en el caso del trigo, hordeínas en la cebada, las secalinas en el centeno y las aveninas a la avena. Secuencia de ADN AATTCGGCACGAGGCGCGGTTCAACATCAAGAGCAAATACAGATGCAGTGACACGCTTCTCA TTATAAGC AGAGACAGTAGGTTTTGCACCTTCGCTTCTGTCGGTTCCGGTTTGCCCTCCTTGTGCTCCTTG CTCTTTC AGCGAGCGCTACAACTGCGGTCATTATTCCGCAGTGCTCACTTGCTCCTACTGCTGCTATTAT TCCGCGG TTCCTCCCACATGTTTCTGCTATAGGGTTCGAACACCCAGCAGTACAGGCCTACAGGCTACA ACAGGCGC TTGCGGCAAGCATCTTACAACAACCACTTGCCCAATTGCAACAACAGTCCTCGGCTCATCTAA CCATACA GACAATCGCAGCACAACAACAACAGTTCCTGCCATCACTCAGTCAACAAGCAGCCGTGAACC CAGCTGCA TACTTGCAACAACAGCTGCTTGCATCCAACCCACTCGCTGTGCCGAACGCTATTGCATACCA GCAACAAC AACAGCTGCAACAGTTCTTGCCAGCGCTCAGTCAACTTGCCGTGGCAAACCCTGCTGCCTAT CTGCAATC ACAACTGTTTCCATGCAACCCACTAGTCGCCAATGCCGCTGCATACCTGCAGCAACAGCAGC TACAACAG ATCCTACCGGCGCTAAGTCAACTAGCCGTGGCGAACCCTAACTCCTACTTGCAACAACAACA ACTTCTTC CATTCAACCAAGTGGCTGTGGCGAACAACGCTGTATACGAGCAACAACATCAGCTGCTGCAA GTTAACCC


Jesús Roberto García Fernández 161160

ATTGGCTGCCGCCTTCCTACAGCAGCAGCAACGGCAACTACTTCCATTCAACCAGATGTCTTT GATGAAC CCTGCCTTGTCGTGGCAGCAACCCATCGTTGGAGGTGTCGGCTTCTAAATTAAATATGAGTT GTACTTGA TGAAAAAAAGCTCTCATGCCGGCGTGTGCAACTTCCTAGAAATAATCAATATATAGATTGAGA TTTATCA GAAAAAAAAAAAAAAAAAAA

Glutelinas: Insolubles en agua, pero solubles en un ácido débil o una base. Por ejemplo, el oryzenin de arroz y la hordenina en la cebada Son proteínas, pertenecientes a la categoría de esferoproteínas y se encuentran mayoritariamente en los cereales (trigo, avena, centeno, cebada). Las glutelinas, no se dispersan uniformemente en toda la superficie del grano, sino que el 80% se condensa prácticamente en el endospermo junto con las prolaminas.

Secuencia de ADN .GTCGTCTTCTTCGCGGCGGCGCTCATGGCGGCCATGGTGGCCATCTCCGGCGCGCACGTG AGCGAGTCGG AGATGAGGTTCAGGGACAGGCAGTGCCAGCGGGAGGTGCAGGACAGCCCGCTGGACGCGT GCCGGCAGGT GCTCGACCGGCAGCTCACCGGCCGGGAGAGGTTCCAGCCGATGTTCCGCCGCCCGGGCGC GCTCGGCCTG CGGATGCAGTGCTGCCAGCAGCTGCAGGACGTGAGCCGCGAGTGCCGCTGCGCCGCCATC CGCCGGATGG TGAGGAGCTACGAGGAGAGCATGCCGATGCCCCTGGAGCAAGGCTGGTCGTCGTCGTCGTC GGAGTACTA CGGCGGCGAGGGGTCGTCGTCGGAGCAGGGGTACTACGGCGAGGGGTCGTCGGAGGAGG GCTACTACGGC GAGCAGCAACAGCAGCCGGGGATGACCCGCGTGAGGCTGACCAGGGCGAGGCAGTACGCG GCGCAGCTGC


Jesús Roberto García Fernández 161160

CGTCGATGTGCCGGGTTGAGCCCCAGCAGTGCAGCATCTTCGCCGCCGGCCAGTACTAGGC TAGCTGGCT TGCCTCATAGCTAGTAGGATCACACCGTTGCTGTGTTGCATGCAACGAGATCCATTCCTCCAA ACACAAT TTCACCACCTTCTCCTTCATCAGAATGACGGTTGAACCAGAAGGAGAAAACAGGCTCACTGA CAAGACCT TGCTCTACCATCTTATACCACACAGGTACTGCATCTCCAACGGATATTTCCTGAAATCCAAGC CCAAGAA TGCCATCGAATTTTGCAACCATGAAAGTAAGACCTGGCTCCTTGGTAGCTTCAAT

Histonas: Moléculas pequeñas con más proteínas básicas, solubles en agua, pero no se coagulan fácilmente por el calor, por lo general se encuentran asociadas con los ácidos nucleicos, como en nucleoproteínas. Secuencia de ADN ATGTCTCCTGAAACCCAATCTGTTTTGTCAGTTAAAGATAAAAATGCCACCCCTAAAAAAGATA TACAAA AGGTTGTTGGTACATTTTCTACAGTATCATCTCAAACACCCTTAACATCATCGGGAGGCGGAA AAAAACA TATAACATTATTTAAGAAACCTAAGATATCCCAGGGAAAAATAGTTCAAAAAAAACATAAAATC AAATCA AATGTTTTGAAAGAAATTCACTATTTTCAGACACATATTGGATTTCTGATTCCTAAGGCACAAA TGATTC GACTTATTCGAGGAATTGTACAGGAAAAAACTAATTTACCACTTAAATTCACAAGGAGCAGTTT AAATGT ATTACAAGAAGCCTTTGAAGCCCAAATTGTACAAGTATTAGAGTATGCAAACTTAGTTGCAAG ACATGCA AAACGCGTCACTCTATTTCCATCAGATATAAATTTAGTGGTCAAAATTCGTGATAAACTTTAA


Jesús Roberto García Fernández 161160

Prolaminas: Contienen aminoácidos básicos, solubles en agua y no se coagulan con el calo. Se encuentra en los cereales, recibiendo diversos nombres en función del mismo: gliadinas en el caso del trigo, hordeínas en la cebada, las secalinas en el centeno y las aveninas a la avena Secuencia de ADN ATGGCTAAGCGGTTGGTCCTCTTTGCGGCGGTAGTCGTCGCCCTCGTGGCTCTCACCGCCG CTGAAGGTG GGGCCTCTGGGCAACTACAGTGTGAGCGCGAGCTCCAGGAGAGCTCGCTCGAGGCGTGCC GGCGGGTCGT GGACCAGCAGCTGGCCGGCCAGCTGCCATGGAGCACGGGGCTCCAGATGCGGTGCTGCCA GCAGCTCCGA GACGTTAGCCCCGAGTGCCGCCCCGTCGCCGTCAGCCAGGTCGCGAGACAATACGAGCAG CAAACCGCGG TGCCGCCCAAGGGCGGATCCTTCTACCCCGGCGAGGCCACGCCACCGCAGCAACTCCAACA AAGAATATT TTGGGGAAGATCTTCACAAACAGTACAAGGGTATTACCCAAGCGTAACTTCTCCGCAGCCGG GGTCATAC TATCCAGGCCAAGCTTCTCCGCAACAGCCAGGACAAGGGCAACAACAAGGACAATGGCAAG AACCAGGAC AAGGTCAACAGCAGGGACAATGGCAACAACCAGGACAAGGGCAACAAGGGTACTACCCAAC TTCTCCGCA GCAGCCAGAACAAGGGCAACAAGGGTACTACCCAACTTCTCTGCAGCAGCCAGGACAAGGG CAACAGCCA GGACAATGGCAACGACCAGGACAAGGGCAACAAGGGTACTACCCAACTTCTCTGCAGCAGC CAGGACAAG GGCAACAGCCAGGACAATGGCAACAACCAGGACAAGGGCAACAAGGGTACTACCCAACTTC TCCGCAGCA GCCAAGACAAGGGCAACAACCAGGACAAGGGCAACAGCCGGGACAATGGCAGCAACCAAGA CAAGGGCAA CAAGGGTACTACCCAACTACTCCGCAACAGCCAGGACAAGGGCAACAAGGGTACTACCCAA CTTCTCCGC AACAGCCAGGACAAGGGAAACAGCCAGGACAATGGCAACAACCAGGACAAGGGCAACAGCC AGGACAATG GCAACAACCAGGACAAGCGCAACAAGGGAACTACCCAACTTCTCCGCAGCAGTCAGGACAA GGGCAACAA CCAGGACAATGGCAACAATCAGGACAATGGCAACAACCAGGACAAGGGCAACAAGGGTACT ACCCAACTT CTCTGCAGCAACCAGCACAAGGGCAACAACCAGGACAACGGCAGCAATCAGGACAAGAGCA ACAAGGCTA CGGCAGCCCATACCATGTTAGCGCGGAGCAGCAGGTGGCCAGCCTAAAGGTGGCAAAGGC GCAGCAGCTC GCGGCACAGCTGCCGGCAATGTGCCGGCTGGAGGAGTGCAGCGCATTGTCGGCTAGCCAG TGATAG


Jesús Roberto García Fernández 161160

Proteínas conjugadas Nucleoproteínas (proteínas + ácidos nucleicos) se encuentran en el núcleo (en su mayoría constituyen los cromosomas). Los ribosomas son partículas de ribonucleoproteínas en esencia. Su característica fundamental es que forman complejos estables con los ácidos nucleicos, a diferencia de otras proteínas que sólo se unen a éstos de manera transitoria, como las que intervienen en la regulación, síntesis y degradación del ADN. Secuencia de ADN ACACAAGATGGCGGCAGCGGCGCTGGGGAGGGCGAGGCGGAGGCGGCAAAACGGGCGGT CGAGCAGAACG TGTAGCCGCGTCCCCTCCAGTCCGCTCCGGGCAGCTGCTGATGCAAGGAATCCCCTGGGCT CCCGTCCAC TCCACTGCTGACCAGCCCATTCGCCTGTGCTGAGTCTTCCTGCAGGCCTTTCCTTGCCTCTG TGGGACCC TGTGGGGGTCCATCCGGCTGGAGAAGAAAAGCCTCTCATGCTAACGTTGCAGACCCCAGAG GGTCCTGTG TGGGTGTGGAGATGGCCAATGAGAATCACGGCAGCCCCCGGGAGGAAGCGTCCCTGCTGA GTCACTCCCC AGGTACCTCCAATCAGAGCCAGCCCTGTTCTCCAAAGCCAATCCGCCTGGTTCAGGACCTCC CAGAGGAG CTGGTGCATGCAGGCTGGGAGAAGTGCTGGAGCCGGAGGGAGAATCGTCCCTACTACTTCA ACCGATTCA CCAACCAGTCCCTGTGGGAGATGCCCGTGCTGGGGCAGCACGATGTGATTTCGGACCCTTT GGGGCTGAA TGCGACCCCACTGCCCCAAGACTCAAGCTTGGTGGAAACTCCCCCGGCTGAGAACAAGCCC AGAAAGCGG CAGCTCTCGGAAGAGCAGCCAAGCGGCAATGGTGTGAAGAAGCCCAAGATTGAAATCCCAG TGACACCCA


Jesús Roberto García Fernández 161160

CAGGCCAGTCGGTGCCCAGCTCCCCCAGTATCCCAGGAACCCCAACGCTGAAGATGTGGGG TACGTCCCC TGAAGATAAACAGCAGGCAGCTCTCCTACGACCCACTGAGGTCTACTGGGACCTGGACATCC AGACCAAT GCTGTCATCAAGCACCGGGGGCCTTCAGAGGTGCTGCCCCCGCATCCCGAAGTGGAACTGC TCCGCTCTC AGCTCATCCTGAAGCTTCGGCAGCACTATCGGGAGCTGTGCCAGCAGCGAGAGGGCATTGA GCCTCCACG GGAGTCTTTCAACCGCTGGATGCTGGAGCGCAAGGTGGTAGACAAAGGATCTGACCCCCTG TTGCCCAGC AACTGTGAACCAGTCGTGTCACCTTCCATGTTTCGTGAAATCATGAACGACATTCCTATCAGG TTATCCC GAATCAAGTTCCGGGAGGAAGCCAAGCGCCTGCTCTTTAAATATGCGGAGGCCGCCAGGCG GCTCATCGA GTCCAGGAGTGCATCCCCTGACAGTAGGAAGGTGGTCAAATGGAATGTGGAAGACACCTTTA GCTGGCTT CGGAAGGACCACTCAGCCTCCAAGGAGGACTACATGGATCGCCTGGAGCATCTGCGGAGGC AGTGTGGCC CCCACGTCTCGGCCGCAGCCAAGGACTCCGTGGAAGGCATCTGCAGTAAGATCTACCACAT CTCCCTGGA GTACGTCAAACGGATCCGAGAGAAGCACCTTGCCATCCTCAAGGAAAACAACATCTCAGAGG AGGTGGAG GCCCCTGAGGTGGAGCCCCGCCTAGTGTACTGCTACCCAGTCCGGCTGGCTGTGTCTGCAC CGCCCATGC CCAGCGTGGAGATGCACATGGAGAACAACGTGGTCTGCATCCGGTATAAGGGAGAGATGGT CAAGGTCAG CCGCAACTACTTCAGCAAGCTGTGGCTCCTTTACCGCTACAGCTGCATTGATGACTCTGCCTT TGAGAGG TTCCTGCCCCGGGTCTGGTGTCTTCTCCGACGGTACCAGATGATGTTCGGCGTGGGCCTCTA CGAGGGGA CTGGCCTGCAGGGATCGCTGCCTGTGCATGTCTTTGAGGCCCTCCACCGACTCTTTGGCGTC AGCTTCGA GTGCTTCGCCTCACCCCTCAACTGCTACTTCCGCCAGTACTGTTCTGCCTTCCCCGACACAG ACGGCTAC TTTGGCTCCCGCGGGCCCTGCCTAGACTTTGCTCCACTGAGTGGTTCATTTGAGGCCAACCC TCCCTTCT GCGAGGAGCTCATGGATGCCATGGTCTCTCACTTTGAGAGACTGCTTGAGAGCTCACCGGA GCCCCTGTC CTTCATCGTGTTCATCCCTGAGTGGCGGGAACCCCCAACACCAGCGCTCACCCGCATGGAG CAGAGCCGC TTCAAACGCCACCAGTTGATCCTGCCTGCCTTTGAGCATGAGTACCGCAGTGGCTCCCAGCA CATCTGCA AGAAGGAGGAAATGCACTACAAGGCCGTCCACAACACGGCTGTGCTCTTCCTACAGAACGAC CCTGGCTT TGCCAAGTGGGCGCCGACGCCTGAACGGCTGCAGGAGCTGAGTGCTGCCTACCGGCAGTC AGGCCGCAGC CACAGCTCTGGTTCTTCCTCATCGTCCTCCTCGGAGGCCAAGGACCGGGACTCGGGCCGTG AGCAGGGTC CTAGCCGCGAGCCTCACCCCACTTAACATATCCTGCGGGGAGGAGGAGCCCCAGGGGTGCT AGTCTGGAC TGCTGGGACTCGGGCCCCTGGGGCCTCAGAGGGACCCCGGCTGCCACTGACATATGAAGAT TATGGTTCT GCCAGGGCTCCCCTCCCTGCCTGTCCCCAAGTCCTCACCTCAAACTCCCTCCAAGTCCCATG TATATAGG


Jesús Roberto García Fernández 161160

TCCTGATGCCTTCCCAACCCCGCCCCTCACCCTGTTGCCACCTTGTTTCATTTGTAAAAGGAA ATACAGA AACCCCCCC

Lipoproteínas: (proteínas + lípidos) se encuentran en las membranas y las superficies de la membrana y toman parte en la organización de la membrana y sus funciones. Son complejos macromoleculares compuestos por proteínas y lípidos que transportan masivamente las grasas por todo el organismo. Son esféricas, hidrosolubles, formadas por un núcleo de lípidos apolares (colesterol esterificado y triglicéridos) cubiertos con una capa externa polar de 2 nm formada a su vez por apoproteínas, fosfolípidos y colesterol libre. Muchas enzimas, antígenos y toxinas son lipoproteínas Secuencia de ADN La secuencia es muy larga por lo cual lo dejare en el siguiente link. https://www.ncbi.nlm.nih.gov/nuccore/LT906451.1?report=fasta


Jesús Roberto García Fernández 161160

glicoproteínas: (proteínas + hidratos de carbono) juegan un papel importante en los sistemas de reconocimiento de las células y los mecanismos celulares de defensa contra los microorganismos. Se encuentran en la superficie de la membrana y en las paredes celulares. El término se usa en general para referirse a una molécula de dimensiones específicas, integrada normalmente por uno o más oligosacaridos unidos de modo covalente a cadenas laterales específicas de polipéptidos. Suelen tener un mayor porcentaje de proteínas que de glúcidos. Los términos proteoglicano y peptidoglicano designan agregados masivos formados por glúcidos y proteínas o séptimos péptidos, para los cuales la palabra molécula no tiene significado preciso. Las partículas de proteoglicanos tienen un mayor porcentaje de glúcidos que de proteínas. Secuencia de ADN AGCACCAAGGACAACTTCAATGTCTATAAAGCCACAAGACCATACTTAGCTCACTGTCCCGAC TGTGGAG AAGGGCACTCGTGCCATAGTCCCGTAGCACTAGAACGCATCAGAAATGAAGCGACAGACGG GACGCTGAA AATCCAGGTCTCCTTGCAAATCGGAATAAAGACGGATGACAGCCACGATTGGACCAAGCTGC GTTATATG GACAACCACATGCCAGCAGACGCAGAGAGGGCGGGGCTATTTGTAAGAACATCAGCACCGT GTACGATTA CTGGAACAATGGGACACTTCATCCTGGCCCGATGTCCAAAAGGGGAATCTCTGACGGTGGG ATTCACTGA CAGTAGGAAGATTAGTCATTCATGTACGCACCCATTTCACCACGACCCTCCTGTGATAGGTCG GGAAAAA TTCCATTCCCGACCGCAGCACGGTAAAGAGCTACCTTGCAGCACGTACGTGCAGAGCACCG CCGCAACTA CCGAGGAGATAGAGGTACACATGCCCCCAGACACCCCTGATCGCACATTAATGTCACAACAG TCCGGCAA CGTAAAGATCACAGTCAATGGCCAGACGGTGCGGTATAAGTGTAATTGCGGTGGCTCAAATG AAGGACTA ACAACTACAGACAAAGTGATTAATAACTGCAAGGTTGATCAATGTCATGCCGCGGTCACCAAT CATAAAA AGTGGCAGTATAACTCCCCTCTGGTCCCGCGTAATGCTGAACTTGGGGACCGACAAGGAAAA ATTCACAT


Jesús Roberto García Fernández 161160

CCCGTTTCCGCTGGCAAATGTAACATGCAGGGTGCCTAAAGCAAGGATCCCCACCGTGACGT ACGGGAAA AACCAAGTCATCATGCTACTGTATCCTGACCACCCAACACTCCTGTCCTACCGGAATATGGGA GAAGAAC CAAACTATCAAGAAGAGTGGGTGATGCATAAGAAGGAAGTCGTGCTAACCGTGCCGACTGAA GGGCTCGA GGTCACGTGGGGCAACAACGAGCCGTATAAGTATTGGCCGCAGTTATCTACAAACGGTACAG CCCATGGC CACCCGCATGAGATAATTCTGTATTATTATGAGCTGTACCCTACTATGACTGTAGTAGTTGTAT CAGTGG CCACGTTCATACTCCTGTCAATGGTGGGTATGGCAGCGGGGATGTGCATGTGTGCACGACG CAGATGCAT CACACCGTATGAACTGACACCAGGAGCTACCGTCCCTTTCCTGCTTAGCCTAATATGCTGCAT CAGAACA GCTAAAGCGGCCACATACCAAGAGGCTGCGATATACCTGTGGAACGAGCAGCAACCTTTGTT TTGGCTAC AAGCCCTTATTCCGCTGGCAGCCCTGATCGTTCTATGCAACTGTCTGAGACTCTTACCATGCT GTTGTAA AACGTTGGCTTTTTTAGCCGTAATGAGCGTCGGTGCCCACACTGTGAGCGCGTACGAACACG TAACAGTG ATCCCGAACACGGTGGGAGTACCGTATAAGACTCTAGTCAATAGACCTGGCTACAGCCCCAT GGTATTGG AGATGGAACTACTGTCAGTCACTTTGGAGCCAACACTATCGCTTGATTACATCACGTGCGAGT ACAAAAC CGTCATCCCGTCTCCGTACGTGAAGTGCTGCGGTACAGCAGAGTGCAAGGACAAAAACCTAC CTGACTAC AGCTGTAAGGTCTTCACCGGCGTCTACCCATTTATGTGGGGCGGCGCCTACTGCTTCTGCGA CGCTGAAA ATACGCAGTTGAGCGAAGCACATGTGGAGAAGTCCGAATCATGCAAAACAGAATTTGCATCA GCGTACAG GGCTCATACCGCATCTGCATCAGCTAAGCTCCGCGTCCTTTACCAAGGAAATAACATCACTGT AACTGCC TATGCAAACGGCGACCATGCCGTCACAGTTAAGGACGCCAAATTCATTGTGGGGCCAATGTC TTCAGCCT GGACACCTTTCGACAACAAAATTGTGGTGTACAAAGGTGACGTCTATAACATGGACTACCCG CCCTTTGG CGCAGGAAGACCAGGACAATTTGGCGATATTCAAAGTCGCACACCTGAGAGTAAAGACGTCT ATGCTAAT ACACAACTGGTACTGCAGAGACCGGCTGTGGGTACGGTACACGTGCCATACTCTCAGGCAC CATCTGGCT TTAAGTATTGGCTAAAAGAACGCGGGGCGTCACTGCAGCACACAGCACCGTTTGGCTGCCAA ATAGCAAC AAACCCGGTAAGAGCGGTGAACTGCGCCGTAGGGAACATGCCCATCTCCATCGACATACCG GAAGCGGCC TTCACTAGGGTCGTCGACGCGCCCTCTTTAACGGACATGTCGTGCGAGGTACCAGCCTGCAC CCATTCCT CAGACTTTGGGGGCGTCGCCATTATTAAATATGCAGCCAGCAAGAAAGGCAAGTGTGCGGTG CATTCGAT GACTAACGCCGTCACTATTCGGGAAGCTGAGATAGAAGTTGAAGGGAATTCTCAGCTGCAAA TCTCTTTC TCGACGGCCCTAGCCAGCGCCGAATTCCGCGTACAAGTCTGTTCTACACAAGTACACTGTGC AGCCGAGT GCCACCCCCCGAAGGACCACATAGTCAACTACCCGGCGTCACATACCACCCTCGGGGTCCA GGACATCTC


Jesús Roberto García Fernández 161160

CGCTACGGCGATGTCATGGGTGCAGAAGATCACGGGAGGTGTGGGACTGGTTGTTGCTGTT GCCGCACTG ATTCTAATCGTGGTGCTATGCGTGTCGTTCAGCAGGCACTAA

Cromoproteínas: (proteínas + pigmentos) que se encuentra en flavoproteína, la hemoglobina, chloroplastin (con clorofila en tilacoides). Una cromoproteína es una proteína conjugada que contiene un grupo prostético pigmentado. Por ejemplo, la hemoglobina es una cromoproteína ya que contiene el grupo prostético hemo, un complejo organometálico que tiene una molécula de hierro unido a un anillo tetrapirrólico porfirínico que da el color rojo a la sangre oxigenada Secuencia de ADN TGGAGGGCGGCCCCGCCCTGTTCCAGAGCGACATGACCTTCAAAATCTTCATCGACGGCGT GGTGAACG GCCAGAAGTTCACCATCGTGGCCGACGGCAGCAGCAAGTTCCCCCACGGCGACTTCAACGT GCACGCCGT GTGCGAGACCGGCAAGCTGCCCATGAGCTGGAAGCCCATCTGCCACCTGATCCAGTACGGC GAGCCCTTC TTCGCCCGCTACCCCAACGGCATCAGCCACTTCGCCCAGGAGTGCTTCCCCGAGGGCCTGA GCATCGACC GCACCGTGCGCTTCGAGAACGACGGCACCATGACCAGCCACCACACCTACGAGCTGGACGG CACCTGCGT GGTGAGCCGCATCACCGTGAACTGCGACGGCTTCCAGCCCGACGGCCCCATCATGCGCGAC CAGCTGGTG GACATCCTGCCCAACGAGACCCACATGTTCCCCCACGGCCCCAACGCCGTGCGCCAGCTGG CCTTCATCG GCTTCACCACCGCCGACGGCGGCCTGATGATGAGCCACTTCGACAGCAAGATGACCTTCAA CGGCAGCCG CGCCATCAAGATCCCCGGCCCCCACTTCGTGACCACCATCACCAAGCAGATGAAGGACACC AGCGACAAG


Jesús Roberto García Fernández 161160

CGCGACCACGTGTGCCAGCGCGAGGTGACCTACGCCCACAGCGTGCCCCGCATCACCAGC GCCATCTGA

Hemoproteínas

Insulina

Oxitocina


Jesús Roberto García Fernández 161160

ATPasa

Tirotropina


Jesús Roberto García Fernández 161160

Coticotropina

Miosina


Jesús Roberto García Fernández 161160

Caseína

Queratina

Zeina


Jesús Roberto García Fernández 161160

Prolactina

Blast  
Blast  
Advertisement