Page 1

Annals of Sri Lanka Department of Agriculture. 2007.9:27-33.

IDENTIFICATION OF BIOTYPES OF BROWN PLANTHOPPER USING MICROSATELLITE MARKERS K.K.S. FERNANDO1, E.M.D.S.B. EKANAYAKE2 and Y. KETIPEARACHCHI2 1 Seed Certification and Plant Protection Center, Gannoruwa, Peradeniya 2 Plant Genetic Resources Center, Gannoruwa, Peradeniya

ABSTRACT Brown Planthopper (BPH), Nilaparvata lugens (Stål) is a serious insect pest of rice in Sri Lanka causing direct economic losses. Bg 379-2 is a rice variety released by the Department of Agriculture in 1980 for commercial cultivation which was resistant to BPH. However, recently BPH outbreaks in some districts showed breaking down of the resistance in Bg 379-2. This may be due to emergence of a virulent BPH population, which can be a new biotype capable of breaking the resistance of Bg 379-2. Bg 379-2 cultivated in most of the districts was resistant to BPH where the existing biotype is prevalent. Local populations of BPH on susceptible variety (TN-1) and resistant variety (Bg 379-2) were collected from Rice Research and Development Institute (RRDI) at Batalagoda and Kegalle areas respectively. Polymerase Chain Reaction (PCR) amplifications were carried out using microsatellite markers for each population of BPH. Analysis of PCR products of marker 7314 by gel electrophoresis showed polymorphism between virulent and avirulent BPH populations. Therefore, it can be concluded that recently emerged BPH population is a genetic variant. KEYWORDS: Biotypes, Brown planthopper, Microsatellite, Polymerase chain reaction (PCR).

INTRODUCTION Nilaparvata lugens (Stål), commonly known as Brown Planthopper (BPH), causes damage to rice plant directly by piercing and sucking the phloem sap and oviposition. Further, it transmits viral diseases such as rice grassy stunt (RGSV), rice ragged stunt and wilted stunt. BPH infestation also leads to significant reduction of nutrient uptake, especially phosphorus (P) and potassium (K) (Peng et al., 2006). Severe BPH infestations cause complete drying and characteristic yellowing of tissues followed by death of the plants and this condition is known as “Hopperburn” (Denno and Roderick, 1990; Backus et al., 2005). Brown Planthopper is one of the major pests especially in irrigated rice in Sri Lanka. Annually it affects an average extent of 5-10% of total rice cultivation. There were major outbreaks of this pest in maha 1997/1998 (Nugaliyadda et al., 2001a), maha 2004/2005 and maha 2006/2007 (Plant Protection Service, Department of Agriculture). Although there are several chemical and Bio-control methods available, resistant varieties are considered the most practical solution for BPH control (Chao et al., 2006). The continued research efforts so far have


28 FERNANDO et al.

successively replaced rice varieties with several BPH resistance genes. As a result, a large number of varieties with different resistance genes have been bred and used for extensive cultivation in different rice growing countries during the past three decades (Chao et al., 2006; Chen et al., 2006 and Nugaliyadde et al., 2001b). However, these varieties have become ineffective in a few years after their introduction and continuous cultivation, often within ten generations due to emergence of new biotypes (Denno and Roderick, 1990). BPH biotypes have specific phenotypes with respect to their ability or inability to survive on and infect host varieties with specific genes for resistance (Tanaka, K., 1998; Claridge and Hollander, 1980). BPH also migrates to other countries through natural air currents and reports indicate certain shifts or changes in biotype properties in the geographical BPH populations due to migration (Mun et al., 2004). Thus, the occurrence of biotype populations or biotype shifting has become a major threat for long-term use and stability of resistant varieties. Bg 379-2 was bred and released by Rice Research and Development Institute (RRDI), Batalagoda as a resistant rice variety for BPH in year 1980, which powers BPH resistant genes derived from Ptb 33 (Nugaliyadde et al., 2001b). Occurrence of BPH infestations have been reported in field cultivations of Bg 379-2 variety in some locations of Kegalle district since maha 2005/2006. These occurrences were suspected as emergence of virulent biotypes. Morphological characters or phenotypic indications alone are not sufficient to differentiate biotype populations. Molecular analysis of populations has made it possible to assess the genetic differences at DNA level. Microsatellite markers based on the variation in the number of simple sequence DNA repeats (SSRs) have become the marker of choice for a wide spectrum of genetic, population and evolutionary studies (Jarne and Lagoda, 1996; Powell et al., 1996). The objective of the present study was to carry out molecular analysis of BPH collected from RRDI at Batalagoda and from Kegalle. MATERIALS AND METHODS Collection of insects Avirulent BPH samples were taken from the culture of natural BPH population reared continuously on a susceptible variety TN-1 at RRDI Batalagoda. Virulent BPH sample was collected from a “Hopperburn” in Bg 379-2 cultivated rice field at Kegalle. Collected samples were stored at 4°C in 99.5% Ethanol.


BROWN PLANTHOPPER BIOTYPES IN SRI LANKA 29

Genomic DNA isolation Genomic DNA was extracted by a modification of the method of Sambrook et al., (1989). Adult BPH (1-4 in number) were homogenized using a sterile micro pestle in 1.5ml microfuge tubes on ice. Homogenization buffer was made of 300µl of TEN-extraction buffer, 2% SDS (9:1) and 0.1 volume of proteinase K (20mg/ml) mix solutions. Homogenate was incubated at 37°C overnight and extracted in 200µl of phenol (pH 8.0) and 200µl of chloroform/iso amyl alcohol (24:1) by shaking for 10 minutes. The samples were centrifuged at 13000rpm for 10min using minicentrifuge. The upper phase was separated and re extracted with 300µl of chloroform/iso amyl alcohol (1:1) for 10 minutes. After centrifugation, 0.1 volumes of 3M sodium acetate (pH 5.6) and 1ml of ice cold ethanol (100%) were added to the separated supernatant, inverted several times and placed in ice at -20 °C. Then, samples were centrifuged at 13,000rpm for 5 minutes. The supernatant was discarded and the pellet washed with 1ml 70% ethanol twice. Thereafter, the DNA pellet was air dried for 30 minutes and resuspended in 20µl TE buffer. Microsatellite (SSR) analysis PCRs were performed with following forward and reverse SSR primers (Table 1) in a final volume of 10 µl with following components, 10 x PCR buffer, 2.5mM each dNTPs, 0.25mM each reverse and forward SSR primers, 25ng of stock genomic DNA (Negative control without DNA) and 5 U/µl Taq DNA Polymerase. Table 1. SSR Primer pairs tested. Marker Forward primer name (5'-3')

Reverse primer (5'-3')

Expected size (bp)

Repeat structure

6020

cagtccagtcgcaatagtg

cttcgttcaatagtataatcc

210

(ACT) 10

7314

gacagtctgacagtggatc

acgatttccatgtgtgtat

220

(CA) 11

26009

aatttcaatacgtttcaagg

tgtgggataaaatgatgtgg

175

27305

atgacggcgatgtagataaa

gcagctccaaacactcaaat

160

28305

tgtggtagattatgaagggag

agttttctatacgtttcaagg

200

(GTCT) 11 (CT) 12 (TGT) 10TG (CCCT) 6 (CTG) 9

Source: Mun et al. 2004.

The cycling parameters were as follows: 1 cycle at 94°C for 2 min (initial denaturation), 5 cycles at 94°C for 30 sec, 70°C for 30 sec, and 72°C for 30 sec followed by 35 cycles at 96°C for 10 sec, 55°C for 10 sec, and 72°C for 30 sec. Final extension was carried out at 72°C for 5 min. Amplified products were loaded on to 1.4% Agarose gels and 10% Acrylamide gels and subject to electrophoresis in 1xTBE buffer. Following the electrophoresis gel


30 FERNANDO et al.

was stained with 0.2-µg/ml Ethidium Bromide. Seedling bulk test To test the virulence of the Nilaparvata lugens (Stål) population, collected from RRDI Batalagoda and BPH population collected from Kegalle, Bg 379-2 and TN1 were sown in a plastic tray (4.0’ x 3.5’ x 2.0’). Seven days after sowing, when plants were at the second or third leaf stage, each seedling was infested with 3rd instar nymphs. When all the TN1 plants were killed, the damage grade for Bg 379-2 was recorded as based on the standard evaluation system (Heinrichs et al., 1985). RESULTS AND DISCUSSION Amplified products of each SSR forward and reverse primers were observed to detect polymorphism. According to the figures 1 and 2, only marker 7314 gave the polymorphism between 200 and 300Kb. According to Mun et al. (2004) genetic diversity based on allele frequencies was higher at the 7314 locus of Nilaparvata lugens (Stål). Although there were no significant allelic frequency differences among biotypes, Mun et al. (2004) have suggested that there are differences among three biotypes, biotype 1, 2 and 3 which can be detected using SSR marker 7314.

Figure 1. Amplified products of BPH DNA using SSR primers (10% Acrylamide gel) A - BPH -RRDI Batalagoda, B- BPH -Kegalle, lane N-negative control.


BROWN PLANTHOPPER BIOTYPES IN SRI LANKA 31

Figure 2. Detection of Polymorphism using SSR primer 7314 (1.4% Agarose gel), 1-BPH collected from Kegalle area, 2- BPH collected from RRDI Batalagoda, L-Wide range DNA ladder.

However, according to the study, polymorphism was observed between two geographically distinct BPH populations. Lane 7314A and 7314B in figure 1 and lane 1 and 2 in figure 2, showing clear genetic differences in the total genomic DNA of the two populations suggesting emergence of a new biotype. The genetic differences in the two BPH populations are reflected in the damage grades scored at preliminary screening test (Table 2). Table 2. Seedling bulk tests for virulence of Nilaparvata lugens (St책l) populations. Insect populations Rice variety collected from TN-1 Bg 379-2 RRDI Batalagoda S Kegalle S S = Susceptible, MR = Moderately resistant

MR S

The preliminary screening carried out with avirulent BPH population collected from RRDI, Batalagoda showed moderately resistant grade for Bg 379-2 rice variety and susceptible grade for TN1 while both Bg 379-2 and TN1 were susceptible to virulent BPH population collected from Kegalle.


32 FERNANDO et al.

CONCLUSIONS Evidences indicated the occurrence of virulent BPH populations on cultivated resistant rice (especially Bg 379-2) varieties. Bg 379-2 is moderately resistant to BPH population collected from RRDI, Batalagoda and susceptible to BPH population collected from Kegalle. According to the molecular analysis it could be confirmed that there is a distinct molecular variation between virulent BPH population collected from Kegalle area, and avirulent BPH population collected from RRDI Batalagoda. This molecular variation can be due to breakdown of resistance genes and emergence of a new BPH biotype. ACKNOWLEDGEMENTS The authors wish to acknowledge SL-USDA programme for providing funds. Dr. R.M.T. Rajapakshe, Dr. P.K. Samarajeewa, Dr. W.L.G. Samrasinghe, Mr. S. Wanigadewa and staff of Biotechnology Laboratory, PGRC, Gannoruwa. Staff of Entomology division, RRDI, Batalagoda for the cooperation given to conduct this study. REFERENCES Backus, E.A., M.S. Serrano and C.M. Ranger. 2005. Mechanisms of Hopperburn: An Overview of Insect Taxonomy, Behavior, and Physiology. Annual Review of Entomology 50:125-51. Chao, S.C., Z. Hu-Qu, W. Chun-Ming, S. Li-Hong and W. Jian-Min. 2006. SSR Mapping of Brown Planthopper Resistance Gene Bph9 in Kaharamana, an Indica Rice (Oryza sativa L.). Acta Genetica Sinica 33 (3): 262-268. Chen, J.W., L. Wang, X.F. Pang and Q.H. Pan. 2006. Genetic analysis and fine mapping of a rice brown planthopper (Nilaparvata lugens Stal) resistance gene bph19 (t). Molecular Genetics and Genomics 275: 321–329. Claridge, M.F. and J. Den Hollander. 1980. The “Biotypes” of the Rice Brown Planthopper, Nilaparvata lugens. Entomologia Experimentalis et Applicata 27: 23-30. Denno, R.F. and G.K. Roderick. 1990. Population biology of Planthoppers. Annual Review of Entomology 35:489-520. Heinrichs, E.A., F.G. Medrano and H.R. Rapusas. 1985. Genetic evaluation for insect resistance in rice. International Rice Research Institute, Manila, Philippines Jarne, P. and P.J.L. Lagoda. 1996. Microsatellites, from molecules to populations and back. Trends in Ecology and Evolution 11: 424-429. Mun, J., Y.H. Song and G.K. Roderick. 2004. Isolation and Characterization of microsatellites in the Brown Planthopper, Nilaparvata lugens Stal. Korean Journal of Applied Entomology 43 (4): 311-315.


BROWN PLANTHOPPER BIOTYPES IN SRI LANKA 33 Nugaliyadde, L., A.A.A.L. Amarasinghe and T. Hidaka. 2001a. The Rice Brown Planthopper outbreak in 1997/1998-maha season: Strategies to improve Rice pest management in Sri Lanka. Annals of the Sri Lanka Department of Agriculture 3: 185-194. Nugaliyadde, L., D.S.dez. Abeysiriwardena, L.G.A. Samanmalee, R. Pathirana and R.M. Wilkins. 2001b. Inheritance of Resistance in rice to Brown Planthopper: Its implications on rice varietal improvement in Sri Lanka. Annals of the Sri Lanka Department of Agriculture 3: 167-175. Peng, W., W. Jin-Cai, X. Shan, W. Fang, L. Jing-Lan, Y. Yue-Shu and G. Hainan. 2006. Responses in nutrient uptake in rice roots to infestation of brown planthopper, Nilaparvata lugens (St책l) (Homoptera: Delphacidae). International Journal of Pest Management 52:97-107(11). Powell, W., G.C. Machray and J. Provan. 1996. Polymorphism revealed by simple sequence repeats. Trends Plant Science 1:215-222. Sambrook, J., E.F. Fritsch and T. Maniatis. 1989. Molecular cloning: A laboratory Manual.2 nd Ed.Cold Spring Harbor, New York. Tanaka, K. 1999. Quantitative genetic analysis of biotypes of the brown Planthopper Nilaparvata lugens: heritability of virulence to resistant rice varieties. Entomologia Experimentalis et Applicata 90:279-287.

Identification of biotypes of brown planthopper using microsatellite markers  

Annual Symposium of Department of Agriculture - 2007 - Sri Lanka

Read more
Read more
Similar to
Popular now
Just for you