Issuu on Google+

GAF-50-V1 Fecha:17-03-09 Página 1 de 19

Módulo Biología I Periodo

ROFESOR. ESTUDIANTE

Elsy Leottau Mendoza GRUPO

PERIODO: I

FECHA DEL PERÍODO

4 Febrero

GRADO 9

MOD No:

No

AREA: 1

Ciencias Naturales

META DE COMPRENSIÓN DEL AÑO El estudiante comprenderá: 1.Los argumentos que sustentan los cambios de la diversidad biológica como consecuencia de eventos evolutivos y dinámicos en seres vivos. TÓPICO GENERADOR ¿Cómo se copia el material genético desde una molécula de ADN? ¿Qué hace posible la formación de proteínas en una célula? CONTENIDOS Replicación Transcripción Traducción METAS DE COMPRENSIÓN DEL PERIODO El estudiante comprenderá: La diferenciación de los procesos relacionados a la replicación, transcripción y síntesis de proteínas en la célula. CRONOGRAMA COMPETENCIA ESTÁNDAR

Explico la diversidad biológica como consecuencia de los cambios ambientales, genéticos y de relaciones dinámicas dentro de los ecosistemas.

DESEMPEÑOS DE COMPRENSIÓN

FECHA

Diferencia los procesos de replicación, transcripción en la célula. 9 Semanas Caracteriza los proceso de síntesis de proteínas en las células

VALORACIÓN CONTINUA Orientaciones del profesor, Seguimiento de Instrucciones Revisión del ejercicio por parte del docente y socialización de los distintos puntos de vista de los educandos alrededor del tema Preguntas de comprensión lectora a fin de verificar el dominio de las principales ideas expuestas en la guía de estudio Revisión y recomendación por parte del profesor de la actividad realizada basada en una información precisa Socialización de los conceptos básicos Pruebas escritas para valorar el grado de comprensión y responsabilidad que han tenido los educandos a lo largo del periodo

NIVELES DE META SUPERIOR Establecer relaciones entre los procesos de replicación, transcripción y traducción asociados a la biología molecular ALTO Describe los procesos de replicación, transcripción y traducción en la célula. BASICO Reconoce las estructuras asociadas a la síntesis de proteínas BAJO

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 2 de 19

Se le dificulta establecer relaciones entre los procesos de transcripción y síntesis de proteínas. ORIENTACIONES DIDÁCTICAS Lee cuidadosamente cada uno de los numerales del Módulo Búscalos en tus libros y respóndelos expresándolos en palabras sencillas. Responde con responsabilidad y honestidad. Aprovecha el tiempo del trabajo personal para el desarrollo de las actividades asignadas y consulta con tu profesor las dudas al respecto. Debes llevar hojas de complemento y correcciones para un mejor aprendizaje. Baja de Internet las actualizaciones que encuentres sobre el tema y socialízalo con tus compañeros. Tener en cuenta la actitud y disposición para el trabajo. Cuando se realice una actividad se tienen en cuenta criterios como: creatividad, presentación y contenido. Cuando se realicen prácticas de laboratorio debes elaborar un informe teniendo en cuente las especificaciones dadas por el docente. Cuando el profesor lo indique se hará una evaluación escrita de los temas vistos en ella. RECURSOS REQUERIDOS (AMBIENTES PREPARADOS PARA EL PERIODO) Salón organizado y aseado, sillas dispuestas según momentos de trabajo, que facilitarán la comprensión de los educandos, de los temas a tratar, además de algunas actividades extra clase sugeridas en páginas web de consulta y el trabajo individual en el Módulo de estudio. LA BASE NOLECULAR DE LA GENÉTICA Las características o propiedades que debe reunir cualquier molécula para ser el material hereditario se deducen de la observación de las propiedades que tienen los organismos vivos. entre las que tenemos:.  ALMACENAR INFORMACIÓN BIOLÓGICA DE UNA FORMA ESTABLE.  REPLICARSE Y TRANSMITIRSE DE UNA CÉLULA A OTRA Y DE UNA GENERACIÓN A LA SIGUIENTE.  LLEVAR INFORMACIÓN PARA OTRO TIPO DE MOLÉCULAS Y ESTRUCTURAS.  MUTACIÓN Y RECOMBINACIÓN. La genética molecular estudia la naturaleza molecular de los genes, cómo se expresan y cómo se pueden manipular. El dogma central de la biología molecular. Un gen era un fragmento de ADN que contenía la información necesaria para sintetizar una proteína. Pero este proceso no era directo, sino que la información de un gen se copiaba (trascripción) en una molécula de ácido ribonucleico (ARN) y a partir de esta se fabricaba (traducción) una proteína. Fuente Primaria de variabilidad genética: mutación. Las alteraciones o cambios en la molécula que contiene la información se denominan mutaciones. La mutación es la fuente primaria de variabilidad genética, si no existiera la mutación, no habría sido posible observar la enorme variabilidad existente de especies diferentes, ni la variabilidad dentro de cada especie. Sin la mutación no se podría haber producido el proceso evolutivo. Fuente secundaria de variabilidad genética: recombinación. La producción de nuevas combinaciones genéticas a partir de las generadas inicialmente por mutación se produce cuando dos moléculas de material hereditario intercambian información mediante el proceso de la recombinación. Dos mutaciones diferentes que se encontraban en moléculas de material hereditario distintas pueden reunirse en la misma molécula mediante la recombinación. Por consiguiente, la recombinación genera variabilidad produciendo combinaciones nuevas de mutaciones. ADN: LA MOLÉCULA DE LA HERENCIA Un poco de historia: Alrededor de 1870, el bioquímico suizo Friedrich Miescher, investigando los glóbulos blancos obtenidos del pus de unos vendajes, encontró que en el núcleo de las células se hallaba una sustancia a la que llamó nucleína. Posteriormente, halló la misma sustancia en los espermatozoides del salmón. Su descubrimiento no alcanzó demasiada repercusión en su época, pero las investigaciones continuaron. Para comienzos del siglo XX, ya se sabía que los cromosomas estaban formados por proteínas y esa sustancia descubierta por Miescher, rebautizada como ácido nucleico, y que los cromosomas eran a responsables de la herencia; la duda era si la información estaba contenida en el ácido nucleico o en las proteínas.Phoebus Levene, en 1920, identificó que el ADN estaba constituido por nucleótidos, compuestos por un grupo fosfato, una molécula de desoxirribosa y una base nitrogenada, de las cuales había cuatro: adenina, timina, citosina y guanina. Numerosos científicos continuaron investigando; para 1952 se sabía que: el ADN es la molécula de la herencia, todas las células del organismo tienen la misma cantidad de ADN, excepto los gametos, que tienen exactamente la mitad, y que la cantidad de adenina es igual que la de timina, así como la cantidad de citosina es igual a la de guanina. La preocupación por ese entonces estaba en el mecanismo de transmisión hereditaria y en la duplicación del ADN. Maurice Wilkins y Rosalind Franklin obtienen imágenes de la molécula por difracción de rayos X, en las cuales se sugiere una forma helicoidal. James Watson y Francis Crick, quienes por su lado estaban tratando de descifrar la estructura de la molécula de ADN, en 1953, publican los resultados de su trabajo: la molécula de ADN es en realidad una doble hélice, y consta de dos cadenas enroscadas como si fuera una escalera de caracol. Watson, Crick y Wilkins recibieron el Premio Nobel de Medicina en 1962 (Rosalind Franklin no fue galardonada dado que falleció en 1958).

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 3 de 19

Watson, Crick y la doble hélice La investigación acerca de la molécula de la herencia continúa hasta hoy; en la actualidad, se ha llegado a descifrar el genoma de diferentes especies, entre ellas la nuestra (el Proyecto Genoma Humano llevó años de investigación por parte de científicos de varios países), y la manipulación genética es cada vez más frecuente, tanto es así que los organismos modificados genéticamente forman parte de nuestra alimentación diaria. Y al final... ¿Qué es el ADN? El ácido desoxirribonucleico es la molécula que contiene la información de las características de cada individuo, de cada especie, capaz de autoduplicarse y de ese modo pasar de una generación a la siguiente. En las células, la molécula de ADN no se encuentra "desenrollada", sino que está unida a proteínas, y muestra distintos grados de compactación, según la fase del ciclo en que se encuentre la célula. Estructura de la molécula: Está formada por dos hebras o cadenas de nucleótidos. Cada uno de ellos está compuesto por:  Un grupo fosfato  Una pentosa (monosacárido de 5 carbonos), llamada desoxirribosa  Una base nitrogenada, de las cuales existen cuatro: las purinas ADENINA y GUANINA, y las pirimidinas TIMINA y CITOSINA

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 4 de 19

En verde, el grupo fosfato; en azul, la pentosa; en rojo, la base nitrogenada (en este caso, citosina) Se numeran los átomos de carbono de la pentosa, comenzando por el que se enlaza con la base nitrogenada, al que se designa con el número 1', y se continúan numerando en sentido horario hasta el número 5', que enlaza con el fosfato:

El grupo fosfato de un nucleótido se une a la pentosa de otro, y esa pentosa se une con otro grupo fosfato... formando así una larga cadena de fosfato-pentosa, con bases que “sobresalen”.

GAF-50-V1 Fecha:17-03-09 Página 5 de 19

Módulo Biología I Periodo

  

Las dos cadenas son antiparalelas u opuestas porque se enfrenta el extremo 5' de una con el extremo 3' de la otra Las bases nitrogenadas se enlazan por puentes de hidrógeno Siempre se enlazan Adenina con Timina (A=T) y Citosina con Guanina (C=G); nuestro ADN contiene unos ¡3.000.000.000 de pares de bases!  Las dos cadenas se enroscan entre sí formando una doble hélice  Cada 10 pares de bases, la molécula da un giro Ácidos nucleicos Los ácidos nucleicos (AN) fueron descubiertos por Freidrich Miescher en 1869. En la naturaleza existen solo dos tipos de ácidos nucleicos: El ADN (ácido desoxirribonucleico) y el ARN (ácido ribonucleico) y están presentes en todas las células. Su función biológica no quedó plenamente confirmada hasta que Avery y sus colaboradores demostraron en 1944 que el ADN era la molécula portadora de la información genética. Los ácidos nucleicos tienen al menos dos funciones: trasmitir las características hereditarias de una generación a la siguiente y dirigir la síntesis de proteínas específicas. Tanto la molécula de ARN como la molécula de ADN tienen una estructura de forma helicoidal. Químicamente, estos ácidos están formados, como dijimos, por unidades llamadas nucleótidos: cada nucleótido a su vez, está formado por tres tipos de compuestos: 1. Una pentosa o azúcar de cinco carbonos: se conocen dos tipos de pentosas que forman parte de los nucleótidos, la ribosa y la desoxirribosa, esta última se diferencia de la primera por que le falta un oxígeno y de allí su nombre. El ADN sólo tiene desoxirribosa y el ARN tiene sólo ribosa, y de la pentosa que llevan se ha derivado su nombre, ácido desoxirribonucleico y ácido ribonucleico, respectivamente.

Freidrich Miescher

Las dos pentosas 2. Una base nitrogenada: que son compuestos anillados que contienen nitrógeno. Se pueden identificar cinco de ellas: adenina, guanina, citosina, uracilo y timina.

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 6 de 19

Las cinco bases nitrogenadas 3. Un radical fosfato: es derivado del ácido fosfórico (H3PO4-).

Los AN son polímeros lineales en los que la unidad repetitiva, llamada nucleótido (figura de la izquierda), está constituida por: (1) una pentosa (la ribosa o la desoxirribosa), (2) ácido fosfórico y (3) una base nitrogenada (purina o pirimidina). La unión de la pentosa con una base constituye un nucleósido (zona coloreada de la figura). La unión mediante un enlace éster entre el nucleósido y el ácido fosfórico da lugar al nucleótido.

La secuencia de los nucleótidos determina el código de cada ácido nucleico particular. A su vez, este código indica a la célula cómo reproducir un duplicado de sí misma o las proteínas que necesita para su supervivencia.

El ADN y el ARN se diferencian porque: - el peso molecular del ADN es generalmente mayor que el del ARN - el azúcar del ARN es ribosa, y el del ADN es desoxirribosa - el ARN contiene la base nitrogenada uracilo, mientras que el ADN presenta timina La configuración espacial del ADN es la de un doble helicoide, mientras que el ARN es un polinucleótido lineal, que ocasionalmente puede presentar apareamientos intracatenarios Ácido Desoxirribonucleico (ADN) El Ácido Desoxirribonucleico o ADN (en inglés DNA) contiene la información genética de todos los seres vivos.

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 7 de 19

Cada especie viviente tiene su propio ADN y en los humanos es esta cadena la que determina las características individuales, desde el color de los ojos y el talento musical hasta la propensión a determinadas enfermedades. Es como el código de barra de todos los organismos vivos que existen en la tierra, que está formado por segmentos llamados genes. La combinación de genes es específica para cada organismo y permite individualizarnos. Estos genes provienen de la herencia de nuestros padres y por ello se utiliza los test de ADN para determinar el parentesco de alguna persona. Además, se utiliza el ADN para identificar a sospechosos en crímenes (siempre y cuando se cuente con una muestra que los relacione). Actualmente se ha determinado la composición del genoma humano que permite identificar y hacer terapias para las enfermedades que se trasmiten genéticamente como: enanismo, albinismo, hemofilia, daltonismo, sordera, fibrosis quística, etc.

·

Molécula de ADN con sus estructura helicoidal CONCEPTOS CLAVES ADN, ARN, genes, nucleótidos, grupo fosfato, purinas, pirimidinas, ribosa, desoxiribosa EJERCICIO # 1 Responde en tu cuaderno 1. Imagina que estás mirando a través de un microscopio de tanto aumento ( el que desees), que puedes ver en detalle un pedacito de ADN. Si empiezas a disminuir gradualmente el aumento, en que orden crees que verías los siguientes objetos: ¿ cromosomas, núcleo, genes, célula? 2. Elabora un cuadro comparativo entre la conformación química del ADN y del ARN teniendo en cuenta: forma de la molécula, tipo de azúcar y las bases nitrogenadas que los forman. 3. Qué relación hay entre gen y genoma? ¿Y entre gen y cromatina? 4. .¿Cuál es el concepto actual de gen?. 5. 5. ¿Cómo se codifica la información genética dentro del ADN? ACTIVIDAD EXTRACLASES Investiga en el medio que puedes un artículo sobre la importancia del ADN en las células de los seres vivos. REPLICACIÓN O DUPLICACIÓN DEL ADN La duplicación del ADN Para que una especie no se extinga los individuos deben reproducirse, con el fin de engendrar nuevos seres. De la misma manera, para que una célula pueda dividirse es necesario que primero duplique su material genético y así poder garantizar la misma dotación cromosómica a las células hijas. El modelo de la doble hélice de Watson y Crick permitió explicar cómo las moléculas de ADN pueden copiarse, es decir, replicarse y dar una molécula idéntica al molde o patrón. Hipótesis de la duplicación del ADN Hipótesis semiconservativa: formulada por Watson y Crick. En una doble hélice cada hebra servirá de molde y, mediante la complementariedad de bases, se formará una hebra copia de cada hebra molde, quedando al final dos dobles hélices formadas por una hebra antigua (molde) y una hebra nueva (copia). En 1957, experimentos realizados por Meselson y Stahl confirmaron esta hipótesis. Hipótesis conservativa: tras la duplicación quedan dos hebras antiguas y dos hebras nuevas formando una doble hélice. Hipótesis dispersa: se propone que las hebras están formadas por fragmentos distintos de ADN antiguo y ADN recién sintetizado. El crecimiento de las nuevas hebras La ADN-polimerasa: El estudio in vitro de la duplicación del ADN fue posible gracias al aislamiento de la enzima ADN-polimerasa por Kornberg. Esta enzima es incapaz de iniciar una cadena de novo; requiere la presencia de un extremo libre del carbono 3' de un nucleótido, para poder ir añadiendo los nucleótidos nuevos. Este extremo 3' libre lo aporta el cebador o «primer», que es una porción pequeña de nucleótidos complementaria al extremo de la cadena patrón. Por tanto, la cadena naciente siempre crecerá en el sentido 5'®3'. El primer nucleótido de la cadena nueva tiene un extremo 5' libre; se irán añadiendo nucleótidos a los extremos 3' libre y se irán formando los enlaces fosfodiester 3'®5', de forma que el último nucleótido tendrá libre el carbono 3'. Los nucleótidos se añadirán siguiendo las reglas de la complementariedad de bases, de manera que la nueva hebra sintetizada será antiparalela y complementaria a la patrón. Mecanismo de duplicación del ADN en bacterias. Mecanismos de duplicación del ADN

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 8 de 19

Aunque existen algunas diferencias el proceso es básicamente igual en bacterias y en eucariotas: La secuencia de nucleótidos en el origen de replicación del ADN actúa como señal de iniciación. La enzima helicasa separa las dos hebras de la doble hélice para que sirvan de molde. El desenrollamiento de la hélice da lugar al superenrollamiento en los extremos de la horquilla de replicación, actuando entonces las enzimas topoisomerasas que liberan esta tensión. La topoisomerasa I corta una hebra y la topoisomerasa II (denominada girasa en E. coli) las dos. Una vez liberada la tensión vuelven a sellar la doble hélice. Mientras se separan las dos hebras se van uniendo las proteínas estabilizadoras, de forma que se mantengan separadas ambas hebras y se estabilice la horquilla de replicación. El proceso de duplicación es bidireccional; hay dos horquillas de replicación por cada burbuja de replicación. La primasa (una ARN-polimerasa) sintetiza los fragmentos de ARN que sirven de cebador (primer) para la ADN-polimerasa. La ADN-polimerasa III incorpora en dirección 5'®3' los nucleótidos, formando una nueva hebra de crecimiento continuo denominada hebra conductora. Sobre la otra hebra antiparalela, primero, a unos mil nucleótidos del origen de replicación, se sintetizarán unos cincuenta nucleótidos de ARN que servirán para que la ADN-polimerasa III incorpore los desoxinucleótidos, formándose los fragmentos de Okazaki a medida que se va abriendo la horquilla. Una vez formados, la ADN-polimerasa I, gracias a su función exonucleasa, irá eliminando los tramos de ARN y los irá rellenando con ADN, sintetizados gracias a su actividad polimerasa. Finalmente interviene la ADN-ligasa, que empalma entre sí los distintos fragmentos de la hebra de crecimiento discontinuo, denominada hebra retardada. CONCEPTOS CLAVES Hipótesis semiconservativa, conservativa, y dispersa, enzima helicasa, topoisomerasas, la primasa, ADN ligasa EJERCICIO # 2 Después de leer comprensivamente el marco teórico responde: 1. Que entendiste por duplicación 2. Representa mediante un grafico este proceso 3. Por qué crees tu es importante estudiar este proceso 4. En la replicación del ADN. ¿Cuál es la razón por la que la síntesis es continua en una de las cadenas y discontinua en la otra? 5. Por qué la duplicación del ADN exige un estricto control de calidad y que enzimas lo realizan. . En la purificación de un fragmento de ADN se ha perdido una porción de una de las dos hebras, quedando la secuencia de bases nitrogenadas como se indica a continuación. Reconstruye la porción que falta y explica en qué te basas para reconstruirla. ATTACC................. AATGGGCCGAATTCGGCTAAGCT MARCO TEÓRICO TRANSCRIPCIÓN Transcripción Una vez que se conforman las dos cadenas nuevas de ADN, lo que sigue es pasar la información contenida en estas cadenas a una cadena de ARN, proceso que se conoce como transcripción. Aquí la enzima responsable es la ARN polimerasa, la cual se une a una secuencia específica en el ADN denominada promotor y sintetiza ARN a partir de ADN. En la transcripción, la información codificada en un polímero formado por la combinación de 4 nucleótidos (ADN) se convierte en otro polímero cuyas unidades también son 4 nucleótidos (ARN). El ácido ribonucleico es similar al ADN (por eso el proceso se denomina transcripción), pero poseen algunas diferencias, como mostramos en la figura 2.

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 9 de 19

Figura 2. Diferencias entre el ADN y el ARN. Ambos polímeros de nucleótidos están formados por un código de 4 bases nitrogenadas. Sin embargo, en la célula el ADN se encuentra como una doble cadena y el ARN generalmente como simple cadena. La similitud en el alfabeto permite la síntesis de un polímero utilizando el otro como molde, en presencia de las enzimas adecuadas. La transcripción de genes puede dar lugar a ARN mensajero (ARNm, molécula que sirve como molde de la traducción), ARN ribosomal (ARNr, que forma parte de los ribosomas, un complejo compuesto por proteínas y ARNr donde se realiza el proceso de traducción) o ARN de transferencia (ARNt, moléculas que funcionan como adaptadores en el proceso de traducción). Fenómenos postranscripción Si bien estos pasos básicos son los mismos para la mayoría de los organismos, hay diferencias entre los distintos dominios de seres vivos (Bacteria, Arquea y Eucaria) tanto en la replicación como en la transcripción y en la traducción. En organismos procariontes, el ARNm se une a los ribosomas y puede ser traducido tal y como es liberado de la ARN polimerasa, ya que se encuentra en el citoplasma celular y no sufre ninguna modificación. Incluso, puede ser traducido a medida que es transcripto. En los eucariontes, sin embargo, la traducción y transcripción ocurren en forma separada. La transcripción ocurre en el núcleo y la traducción, en el citoplasma, puede ocurrir minutos, horas o incluso días más tarde. Antes de salir del núcleo para ser traducido, el ARNm sufre dos modificaciones, por lo que es llamado pre-ARNm. La primera de ellas es el procesamiento por corte y empalme (splicing, en inglés), en el cual se eliminan algunos secuencias no codificantes (o intrones) y se unen las secuencias codificantes (exones). Una molécula de ARNm puede llegar a tener hasta 70 intrones, que pueden llegar a variar de tamaño entre 80 y 10.000 nucleótidos. La segunda modificación ocurre en los extremos: al extremo 5’ se le une una caperuza (compuesta por guanina metilada) y al extremo 3’ se agrega una “cola” de poliadenina o poliA (Figura 3). Luego de todas estas modificaciones, tenemos un ARN maduro.

Módulo Biología I Periodo

CONCEPTOS CLAVES Transcripción, exón, intrón, ARN mensajero, ARN ribosomal, ARN de transferencia, ARN maduro EJERCICIO # 3 1. ¿Qué función realizan en general las ADN polimerasas y las ARN polimerasas? 2. Señala los aspectos diferentes que encuentras entre replicación y transcripción.¿ Qué tienen en común? 3. ¿Por qué es importante la transcripción? 4. ¿Qué función cumplen los intrones y los exones? 5. Observa el gráfico que representa la transcripción, elabora un resumen explicando el proceso. MARCO TEÓRICO TRADUCCIÓN O SÍNTESIS DE PROTEÍNAS CODIGO GENÉTICO El código genético es el conjunto de reglas usadas para traducir la secuencia de nucleótidos del ARNm a una secuencia de proteína en el proceso de traducción.

GAF-50-V1 Fecha:17-03-09 Página 10 de 19

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 11 de 19

Características del código genético: • La correspondencia entre nucleótidos y aminoácidos se hace mediante codones. Un codón es un triplete de nucleótidos que codifica un aminoácido concreto. • El código genético es degenerado: un mismo aminoácido es codificado por varios codones, salvo Triptófano y Metionina que están

codificados por un único codón. Existen 64 codones diferentes para codificar 20 aminoácidos. Los codones que codifican un mismo aminoácido en muchos casos comparten los dos primeros nucleótidos. • El codón AUG que codifica la metionina es el codón de inicio y hay tres codones que establecen la señal de terminación de la traducción (UAA, UAG, UGA). • Es casi universal. Es el mismo para la mayoría de los organismos, con algunas excepciones en protozoarios, micoplasmas y las mitocondrias. La traducción del ARNm INTRODUCCION El ARN mensajero es el que lleva la información para la síntesis de proteínas, es decir, determina el orden en que se unirán los aminoácidos La síntesis de proteínas o traducción tiene lugar en los ribosomas del citoplasma celular. Los aminoácidos son transportados por el ARN de transferencia (ARNt) , específico para cada uno de ellos, y son llevados hasta el ARN mensajero (ARNm), dónde se aparean el codón de éste y el anticodón del ARN de transferencia, por complementariedad de bases, y de ésta forma se sitúan en la posición que les corresponde. Una vez finalizada la síntesis de una proteína, el ARN mensajero queda libre y puede ser leído de nuevo. De hecho, es muy frecuente que antes de que finalice una proteína ya está comenzando otra, con lo cual, una misma molécula de ARN mensajero, está siendo utilizada por varios ribosomas simultáneamente.  Los ARNt desempeñan un papel central en la síntesis de las proteínas La síntesis proteica tiene lugar en el ribosoma, que se arma en el citosol ( medio acuoso del citoplasma) a partir de dos subunidades riborrucleoproteicas provenientes del nucléolo. En el ribosoma el ARN mensajero (ARNm) se traduce en una proteína, para lo cual se requiere también la intervención de los ARN de transferencia (ARNt). El trabajo de los ARNt consiste en tomar del citosol a los aminoácidos y conducirlos al ribosoma en el orden marcado por los nucleótidos del ARNm, que son los moldes del sistema La síntesis de las proteínas comienza con la unión entre sí de dos aminoácidos y continúa por el agregado de nuevos aminoácidos -de a uno por vez- en uno extremos de la cadena. Como se sabe la clave de la traducción reside en el código genético, compuesto por combinaciones de tres nucleótidos consecutivos o tripletes- en el ARNm. Los distintos tripletes se relacionan específicamente con tipos de aminoácidos usados en la síntesis de las proteínas. Cada triplete constituye un codón: existen en total 64 codones, 61 de los cuales sirven para cifrar aminoácidos y 3 para marcar el cese de la

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 12 de 19

traducción. Tal cantidad deriva de una relación matemática simple: los cuatro nucleótidos (A, U, C y G)se combinan de a tres, por lo que pueden generarse 64 (43). Dado que existen más codones, (61) que tipos de aminoácidos (20), casi todos pueden ser reconocidos por más de un codón, por lo que algunos tripletes a como "sinónimos". Solamente el triptófano y la metionina -dos de los aminoácidos menos frecuentes en las proteínas son codificados, cada uno, por un solo codón Fig. A-1. Los dibujos ilustran cuatro de los seis codones que codifican al aminoácido leucina (Leu). Los dos de la izquierda se aparean con un mismo anticodón, igual que el par de codones de la derecha. Ello es posible porque la tercera base de los codones suele ser "adaptable ", es decir, puede establecer uniones con una base no complementaria.

Generalmente los codones que representan a un mismo aminoácido se parecen entre sí y es frecuente que difieran sólo en el tercer nucleótido. La baja especificidad de este nucleótido ha llevado a decir que existe una "degeneración" en tercera base de la mayoría de los codones. Resta agregar que el número de codones en el ARNm determina la longitud de la proteína.  Existen 31 tipos diferentes de ARNt Las moléculas intermediarias entre los codones del ARNm y los aminoácidos son los ARNt, los cuales tienen un dominio que se liga específicamente a uno de los 20 arninoácidos y otro que lo hace, específicamente también, con el codón apropiado. El segundo dominio consta de una combinación de tres nucleótidos -llamada anticodón - que es complementaria de la del codón. Cada tipo de ARNt lleva antepuesto el nombre del aminoácido que transporta. por ejemplo, leucinil-ARNt para el aminoacil-ARNt de la leucina, lisinil-ARNt para el de la lisina, fenilalanil-ARNt para el de la fenilalanina, metionil-ARNt para el de la metionina, etcétera. Por su lado. El ARNt unido al aminoácido compatible con él se designa aminoacil-ARNtAA, en el que "AA" correspnde a la sigla del aminoácido. Por ejemplo, leucinil-ARNtLeu, lisinil-ARNtlys, fenilalanil-ARNtPhe. metionil-ARNtMet, etcétera. Si bien teóricamente pueden existir 61 tipos de ARNt diferentes, sólo hay 31. El déficit se resuelve por la capacidad que tienen algunos ARNt de reconocer a más de un codón. Lo logran porque sus anticodones suelen poseer la primera base "adaptable", es decir, que puede unirse con una base no complementaria situada en la tercera posición del codón (recuérdese la "degeneración" de esta base). Así, la G en la primera posición del anticodón puede aparearse tanto con una C -es lo habitual - como con una U del codón (fig. A-1). Similarmente, la U en la primera posición del anticodón puede hacerlo con una A -es lo habitual - o con una G. Por otra parte, la inosina (I) una de las bases inusuales se encuentra en la primera posición del anticodón en varios ARNt y es capaz de aparearse con cualquier base (excepto con una G) localizada en la tercera posición del codón.  El codón de iniciación es el triplete AUG El primer codón que se traduce en los ARNm es siempre el triplete AUG. cuya información codifica al aminoácido metionina (fig. A-2). Por lo tanto, este codón cumple dos funciones: señala el sitio de comienzo de la traducción -caso en el cual recibe el nombre de codón de iniciación -, y cuando se halla en otras localizaciones en el ARNm codifica a las metioninas del interior de las moléculas proteicas. Al especificar el primer aminoácido de la proteína, el codón AUG de iniciación determina el encuadre de los sucesivos tripletes, lo que asegura la síntesis correcta de la molécula. Tómese como ejemplo la secuencia AUGGCCUGUAACGGU. Si el ARNm es traducido a partir del codón AUG, los codones siguientes serán GCC, UGU, AAC y GGU, que codifican, respectivamente, a los aminoácidos alanina, cisteina ,asparagina y glicina. En cambio, si se omitiera la A del codón de iniciación, el encuadre de los tripletes sería el siguiente: UGG, CCU, GUA y ACG, los cuales se traducen en los aminoácidos triptófano, prolina, valina y treonina, respectivamente. Algo semejante ocurriría si también se omitiera la U, pues resultaría un tercer tipo de encuadre: GGC, CUG, UAA y CGC. En este caso, después de codificar los dos primeros codones a los aminoácidos glicina y leucina, la traducción se detendría, ya que UAA es un codón de terminación.

Fig. A-2

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 13 de 19

 Los aminoácidos se ligan por medio de uniones peptídicas La unión de los aminoácidos entre sí para construir una proteína se produce de modo que el grupo carboxilo de un aminoácido se combina con el grupo a amínoácido siguiente, con pérdida de una molécula de agua H2O y recordemos que esa combinación se llama unión peptídica. Cualquiera que sea su longitud, la proteína mantiene el carácter anfotérico de los aminoácidos aislados, ya que contiene un grupo amino libre en uno de sus extremos y un grupo carboxilo en el otro extremo. La proteína se sintetiza a partir de extremo que lleva el grupo amino libre. Ello se corresponde con la dirección 5´ ® 3´ usada para la traducción del ARNm, la misma con que el ADN se transcribe (ver figura ) Antes de describir los procesos que dan lugar a la síntesis de las proteínas analizaremos cómo arriban los ARNm al citoplasma, qué configuración poseen los ARNt y cuál es la estructura de los ribosomas.  Los ARNm arribados al citoplasma se conectan con ríbosomas Los transcriptos primarios de los ARNm se hallan combinados con diversas proteínas, con las que forman las nueleoproteínas heterogéneas nucleares o RNPhn.. No obstante, muchas de esas proteínas se desprenden de los ARNm a medida que éstos abandonan el núcleo. Los ARNm salen hacia el citoplasma por los poros de la envoltura nuclear. Ya en el citosol, cada ARNm se combina con nuevas proteínas y con ribosomas, lo que lo habilita para ejercer su función codificadora durante la síntesis proteica. Entre las proteínas se encuentra la llamada CBP (por capbinding protein), que se combina con el cap en el extremo 5´ del ARNm. Su papel será analizado más adelante. Algunos ARNm se localizan en sitios prefijados en el citoplasma, de modo que las proteínas que codifican se sintetizan y se concentran en esos sitios. Un ejemplo es el ARNm de la actina, que se sitúa en la zona periférica de las células epiteliales donde se deposita la mayor parte de la actina . El extremo 5' de los ARNm contiene una secuencia de alrededor de 10 nucleótidos previa al codón de iniciación -entre éste y el cap - que, como es lógico, no se traduce (fig. A-2). En algunos ARNm esta secuencia participa en el control de 1a traducción y en otros regula la estabilidad del ARNm, es decir, su supervivencia. Otra secuencia especial del ARNm, de hasta miles de nucleótidos, suele hallarse después del codón de terminación. entre éste y la poli A (fig. A-2). Tiene por función controlar la supervivencia del ARNm.  Las moléculas de los ARNt adquieren una forma característica Hemos visto que los codones del ARNm no seleccionan a los aminoácidos directamente y que la traducción de los ARNM en proteínas depende de un conjunto de moléculas intermediarias -los ARNt- que actúan como adaptadores, ya que discriminan tanto a los codones del ARNm como a los aminoácidos compatibles con ellos. Así la función básica de los ARNt es alinear a los aminoácidos siguiendo el orden de los codones para poder cumplir con sus funciones, los ARNt ,adquieren una forma característica semejante a un trébol de cuatro hojas (fig. A-3). Los cuatro brazos se generan por la presencia en los ARNt de secuencias de 3 a 5 pares de nuelcótidos complementarios, los cuales se aparean entre sí como los nucleótidos de las dos cadenas del ADN. En la punta de uno de los brazos confluyen los extremos 5' y 3´ del ARNt. El extremo 3´ es más largo, de modo que sobresale el trinucleótido CCAque fue incorporado durante el procesamiento. Este brazo se llama aceptador porque a él se liga el aminoácido, que se une a la A del CCA. Los tres brazos restantes poseen en sus extremos secuencias de 7 a 8 nucleótidos no apareados, -con forma de asas -, cuyas denominaciones derivan de los nucleótidos que las caracterizan. Una de ellas contiene el triplete de nueleótidos del anticodón,por lo que su composición varía en cada tipo de ARNt. Otra, en virtud de que contiene dihidrouridinas (D), se denomina asa D. La tercera se conoce como asa T, por el trinucleótido Ty C que la identifica. La letra T simboliza a la ribotimidina y la y a la seudouri dina. Entre el asa T y el anticodón existe un asa adicional, llamada variable porque su longitud difiere en los distintos ARN de transferencia. Un plegamiento ulterior en el ARNt hace que deje de parecerse a un trébol de cuatro hojas y adquiera la forma de la letra L (fig. A-4). El cambio se debe a que se establecen apareamientos inusuales entre algunos nueleótidos, como la combinación de un nucleótido con dos a la vez. Formada la L, las asas D y T pasan a la zona de unión de sus dos ramas y el brazo aceptador y el triplete de bases del anticodón se sitúan en las puntas de la molécula (fig. A-4).

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 14 de 19

FIGURA A-3 FIGURA A-4

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 15 de 19

 Una aminoacil-ARNt sintetasa une el aminoácido al ARNt El aminoácido se liga a su correspondiente ARNt por la acción de una enzima llamada aminoacil-ARNt sintetasa, que cataliza la unión en dos pasos. Durante el primero, el aminoácido se liga a un AMP , con el cual forma un aminoacil AMP. Por ejemplo leucinil –AMP , lisinil AMP, fenilalanil AMP, metionil-AMP, etc.. Dado que el AMP deriva de la hidrólisis de un ATP , se libera pirofosfato (PP) y energía , que también pasa al aminoacil- AMP AA + ATP® AA-AMP + PP En el segundo paso esa energía es utilizada por la aminoacil ARNt sintetasa para transferir el aminoácido del aminoacil –AMP a la A del brazo aceptador del ARNt compatible, con lo cual se forma una molécula esencial para la síntesis proteica: el aminoacil-ARNtAA que reconoce el codón complementario en el ARNm. AA-A + ARNt ® ( AMINOACIL SINTETASA)® AA-ARNtAA + AMP Debe señalarse que la energía del ATP usada en la primera reacción queda depositada en la unión química entre el aminoácido y la A del trinucleótido CCA.  Existen 20 amínoacil – ARNt sintetasas diferentes Existen 20 aminoacil-ARNt sintetasas diferentes, cada una diseñada para reconocer a un aminoácido y al ARNt compatible con él. Ambos reconocimientos permiten que cada uno de los 31 tipos de ARNt se ligue sólo a uno de los 20 aminoácidos usados en la síntesis proteica. Ello es posible porque cada aminoacil ARNt sintetasa identifica al ARNt por el anticodón, la parte más específica del ARNt (Fig A-3). No obstante, en los ARNt existen otras señales que son reconocidas por la enzima, generalmente tramos de nucleótidos cercanos al anticodón. Como es obvio, la existencia de 11 clases de ARNt hace que algunos aminoácidos sean reconocidos por más de un ARNt. Uno de los ARNt redundantes es el llamado ARNt iniciador o ARNt[i], pues transporta a la metionina destinada exclusivamente al codón AUG de iniciación (FIG A-9). Es muy probable que cerca de ese codón existan señales que diferencien al metionil-ARNt[i]met –portador de la metionina dirigida a él- de los metionil ARNtmet comunes, portadores de las metioninas destinadas a los restantes codones AUG del ARNm.  Los ribosomas están compuestos por dos subunidades Los mecanismos para alinear a los aminoacil ARNtAA de acuerdo con el orden de los codones del ARNm son algo complicados. Requieren de los ribosomas cuya primera tarea es localizar al codón AUG de iniciación y acomodarlo correctamente para que el encuadre de ese triplete y el de los siguientes sea el adecuado. Luego el ribosoma se desliza hacia el extremo 3´del ARNm y traduce a los sucesivos tripletes en aminoácidos. Estos son traídos – de a uno por vez – por los respectivos ARNt. Las reacciones que ligan a los aminoácidos entre sí - es decir , las uniones peptídicas - se producen dentro del ribosoma . Finalmente, cuando el ribosoma arriba al codón de terminación – en el extremo 3´del ARNm – cesa la síntesis proteica y se libera la proteína. Como podemos notar, los ribosomas constituyen las "fábricas de las proteínas" Cada ribosoma está compuesto por dos subunidades - una mayor y otra menor – identificadas con las siglas 40S y 60S respectivamente (los números hacen referencia a los coeficientes de sedimentación de las subunidades, es decir a las velocidades con que sedimentan cuando son ultracentrifugadas, la 60S migra más rápido al fondo del tubo). En la subunidad menor algunas proteínas forman dos áreas - una al lado de la otra – denominadas sitio P (por peptidil) y sitio A (por aminoacil).

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 16 de 19

Por otro lado en la subunidad mayor las proteínas ribosómicas formarían un túnel por el que saldría la cadena polipeptídicas a medida que se sintetiza Las etapas de la síntesis de proteínas La síntesis de las proteínas se divide en tres etapas, llamadas de iniciación , de alargamiento y de terminación (fig. A-9). a) Iniciación. La subunidad ribosómica más pequeña se une al extremo 5´ de una molécula de ARNm. La primera molécula de ARNt, que lleva el aminoácido modificado fMet, se enchufa en el codón iniciador AUG de la molécula deARNm. La unidad ribosómica más grande se ubica en su lugar, el ARNt ocupa el sitio P (peptidico). El sitio A (aminoacil) está vacante. El complejo de iniciación está completo ahora. b) Alargamiento. Un segundo ARNt con su aminoácido unido se mueve al sitio A y su anticodón se enchufa en el mRNA. Se forma un enlace peptidico entre los dos aminoácidos reunidos en el ribosoma. Al mismo tiempo, se rompe el enlace entre el primer aminoácido y su ARNt. El ribosoma se mueve a lo largo de la cadena de ARNm en una dirección 5´ a 3´ y el segundo ARNt, con el dipéptido unido se mueve al sitio P desde el sitio A, a medida que el primer ARNt se desprende del ribosoma. Un tercer ARNt se mueve al sitio A y se forma otro enlace peptÍdico. La cadena peptídica naciente siempre está unida al tRNA que se está moviendo del sitio A al sitio P, y el ARNt entrante que lleva el siguiente aminoácido siempre ocupa el sitio A. Este paso se repite una y otra vez hasta que se completa el polipéptido. c) Terminación. Cuando el ribosoma alcanza un codón de terminación (en este ejemplo UGA), el polipéptido se escinde del último ARNt y el ARNt se desprende del sitio P. El sitio A es ocupado por el factor de liberación que produce la disociación de las dos subunidades del ribosoma

Módulo Biología I Periodo

CONCEPTOS CLAVES Código genético, codón, anticodón, traducción, codón de iniciación, codón de terminación EJERCICIO # 4 Responde en tu cuaderno: 1.¿ Qué es el código Genético? 2. ¿Qué significa qué el código genético es altamente específico y al mismo tiempo degenerado?. 3. ¿Puede esto ofrecer alguna ventaja?. 4. ¿ Qué es la Traducción y donde se realiza?

GAF-50-V1 Fecha:17-03-09 Página 17 de 19

GAF-50-V1 Fecha:17-03-09 Página 18 de 19

Módulo Biología I Periodo

5. Qué función cumple el ARN de transferencia en la Síntesis de Proteínas? 6. Explique la función del codón de iniciación 7. ¿ Cuál es la función de los Ribosomas en la síntesis de proteínas? 8. Explique las etapas de la síntesis de Proteínas? 9. Observa los siguientes esquemas, relativos al funcionamiento de los ácidos nucleicos, e indica cuáles son verdaderos y cuáles son falsos:

ADN

Transcripción

ARN

ADN

Traducción

Proteína

ADN

Replicación

ADN1+ ADN2

ADN

Traducción

ARN

10. Explicar el siguiente esquema:

¿Es correcto este esquema?. Razona la respuesta. La secuencia de bases de una de las hebras de un fragmento de ADN es: AATCCGCGCTATTATCGT 11.Representar: a. La cadena complementaria b. Replicar el fragmento formado siendo el punto de iniciación el 12. Después de responder las preguntas anteriores diseña un resumen con el grafico de la síntesis de proteínas.

extremo

izquierdo.

BIBLIOGRAFÍA Y DIRECCIONES ELECTRÓNICAS (PARA PROFUNDIZAR ) http://personales.ya.com/geopal/biologia_2b/unidades/ejercicios/act1gmtema5.htm( actividad) http://www.ucm.es/info/genetica/grupod/Basemol/base_molecular_de_la_herencia.htm http://biologia-lacienciadelavida.blogspot.com/2010/09/adn-la-molecula-de-la-herencia-4-ano.html http://www.profesorenlinea.cl/Ciencias/AcidosNucleicos.htm http://personales.ya.com/geopal/biologia_2b/unidades/unidad3_5.htm#bia http://www.hiru.com/biologia/la-duplicacion-del-adn http://aportes.educ.ar/biologia/nucleo-teorico/estado-del-arte/como-se-encienden-y-apagan-los-genes-el-dogma-central-de-la-biologia-pasoa-paso/transcripcion.php

Módulo Biología I Periodo

GAF-50-V1 Fecha:17-03-09 Página 19 de 19


Modulo de biologia Grado 9