Issuu on Google+

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 1

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 3

Πρόλογος

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Το βιβλίο ΒΙΟΛΟΓΙΑ Γ΄ ΛΥΚΕΙΟΥ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ που κρατάς στα χέρια σου πιστεύουμε πως έρχεται να συμπληρώσει τα κενά που δημιουργούν οι νέες απαιτήσεις των μαθητών οι οποίοι προετοιμάζονται για τις Πανελλαδικές εξετάσεις. Η οργάνωση του υλικού, η μεθοδολογία, τα λυμένα προβλήματα καθώς και τα προτεινόμενα προβλήματα για λύση βοηθούν τον μαθητή να αποκτήσει εμπειρία στο πώς να διαχειρίζεται την κάθε περίπτωση προβλήματος∙ τον βοηθούν να εξασκήσει την κριτική του ικανότητα στην επίλυση προβλημάτων σχετικών με τη διδασκόμενη θεωρία και του δίνουν τα εφόδια για επιτυχία στις εξετάσεις. Η δομή του βιβλίου είναι τέτοια, που πραγματεύεται κάθε ενότητα και κάθε κεφάλαιο ξεχωριστά έτσι, ώστε ο μαθητής να ταξινομεί όσο το δυνατόν πιο αποτελεσματικά τις γνώσεις που σταδιακά αποκτά. Οι κρίσιμοι ορισμοί, τα σχεδιαγράμματα και παραθέματα για την κατανόηση της θεωρίας, οι διαφορές όρων και εννοιών, οι ερωτήσεις ανάπτυξης «τύπου Α» και κρίσεως-συνδυαστικές «τύπου Β», η μεθοδολογία για την επίλυση προβλημάτων, τα λυμένα προβλήματα, τα διαγωνίσματα (ωριαία και τρίωρα) και τα κριτήρια αξιολόγησης συμβάλλουν σε αυτή την κατεύθυνση. Στο τέλος του βιβλίου, εξάλλου, υπάρχουν οι απαντήσεις-λύσεις των ερωτήσεων του σχολικού βιβλίου, της τράπεζας θεμάτων, των προβλημάτων για λύση, των διαγωνισμάτων και των κριτηρίων αξιολόγησης. Το περιεχόμενο του βιβλίου έχει δοκιμαστεί με επιτυχία στις αίθουσες των φροντιστηρίων μας καθώς και στις αίθουσες πολλών λυκείων από συναδέλφους σε μαθητές μας, Παράλληλα, γίναμε και εμείς αποδέκτες των παρατηρήσεών τους, και γι’ αυτό τους ευχαριστούμε πολύ.

Οι συγγραφείς Οικονόμου Θωμάς Ηλιάδης Βαγγέλης Σπύρου Βασίλης Βιολόγοι – Εκπαιδευτικοί

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 4

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Ευχαριστούμε τους μαθητές μας των φροντιστηρίων «ΚΕΝΤΡΟΝ» και τους συναδέλφους βιολόγους των λυκείων Λάρισας και Καρδίτσας, αφού πολλά από τα ζητήματα που αναπτύσσονται στο παρόν βοήθημα αποτέλεσαν αντικείμενο συζήτησης στις αίθουσες διδασκαλίας.

Επικοινωνία με τους συγγραφείς ΟΙΚΟΝΟΜΟΥ ΘΩΜΑΣ

site: www.οικονόμουθωμάς.gr e-mail: kuttaro@otenet.gr τηλ.: 6977236333, 2441071223

ΗΛΙΑΔΗΣ ΒΑΓΓΕΛΗΣ e-mail: vanil@otenet.gr τηλ.: 6974918591

ΣΠΥΡΟΥ ΒΑΣΙΛΗΣ τηλ.: 6936646801

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 5

Περιεχόμενα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Κεφάλαιο 1ο ΤΟ ΓΕΝΕΤΙΚΟ ΥΛΙΚΟ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Μεθοδολογία για την επίλυση προβλημάτων .............................................................. Λυμένα προβλήματα...................................................................................................... Προτεινόμενα προβλήματα για λύση .......................................................................... 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

10 12 16 18 21 24 25 28 31 33 39 42 44 46

Κεφάλαιο 2ο ΑΝΤΙΓΡΑΦΗ, ΕΚΦΡΑΣΗ ΚΑΙ ΡΥΘΜΙΣΗ ΤΗΣ ΓΕΝΕΤΙΚΗΣ ΠΛΗΡΟΦΟΡΙΑΣ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Μεθοδολογία για την επίλυση προβλημάτων .............................................................. Λυμένα προβλήματα...................................................................................................... Προτεινόμενα προβλήματα για λύση .......................................................................... 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

50 52 59 62 67 71 72 75 78 82 94 101 103 105

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 6

Κεφάλαιο 4ο ΤΕΧΝΟΛΟΓΙΑ ΤΟΥ ΑΝΑΣΥΝΔΥΑΣΜΕΝΟΥ DNA 110 112 115 116 120 122 124 126 128 130 134 138 140 142

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Μεθοδολογία για την επίλυση προβλημάτων .............................................................. Λυμένα προβλήματα...................................................................................................... Προτεινόμενα προβλήματα για λύση .......................................................................... 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

Κεφάλαιο 5ο ΜΕΝΔΕΛΙΚΗ ΚΛΗΡΟΝΟΜΙΚΟΤΗΤΑ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Μεθοδολογία για την επίλυση προβλημάτων .............................................................. Λυμένα προβλήματα...................................................................................................... Προτεινόμενα προβλήματα για λύση .......................................................................... 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

146 148 155 156 160 162 164 166 168 172 217 225 227 230

Κεφάλαιο 6ο ΜΕΤΑΛΛΑΞΕΙΣ Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................

234 235

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 7

238 240 244 246 248 250 253 256 265 267 269 271

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Μεθοδολογία για την επίλυση προβλημάτων .............................................................. Λυμένα προβλήματα...................................................................................................... Προτεινόμενα προβλήματα για λύση .......................................................................... 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

Κεφάλαιο 7ο ΑΡΧΕΣ ΚΑΙ ΜΕΘΟΔΟΛΟΓΙΑ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

276 278 281 282 285 287 288 290 293 295 297

Κεφάλαιο 8ο ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗΝ ΙΑΤΡΙΚΗ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Λυμένα προβλήματα......................................................................................................

302 303 305 306 309 311 312 314 316

πρωτοσελιδα_Layout 1 19/11/2012 5:35 μμ Page 8

1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

318 320 322

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Κεφάλαιο 9ο ΕΦΑΡΜΟΓΕΣ ΤΗΣ ΒΙΟΤΕΧΝΟΛΟΓΙΑΣ ΣΤΗ ΓΕΩΡΓΙΑ ΚΑΙ ΤΗΝ ΚΤΗΝΟΤΡΟΦΙΑ

Λέξεις-κλειδιά (Επεξηγήσεις όρων και εννοιών) .......................................................... Σχεδιαγράμματα............................................................................................................ Διαφορές όρων και εννοιών.......................................................................................... Ερωτήσεις πολλαπλής επιλογής .................................................................................. Ερωτήσεις του τύπου «Σωστό – Λάθος» ...................................................................... Ερωτήσεις αντιστοίχισης .............................................................................................. Ερωτήσεις ανάπτυξης «τύπου Α» ................................................................................ Ερωτήσεις κρίσεως-συνδυαστικές «τύπου Β» ............................................................ Λυμένα προβλήματα...................................................................................................... 1ο ωριαίο διαγώνισμα .................................................................................................. 2ο ωριαίο διαγώνισμα .................................................................................................. Τρίωρο διαγώνισμα ......................................................................................................

326 327 330 331 333 334 335 336 337 338 340 342

ΑΠΑΝΤΗΣΕΙΣ ΤΩΝ ΕΡΩΤΗΣΕΩΝ ΤΟΥ ΣΧΟΛΙΚΟΥ ΒΙΒΛΙΟΥ ............................

346

ΣΥΝΔΥΑΣΤΙΚΑ ΘΕΜΑΤΑ ΜΕ ΑΠΑΝΤΗΣΕΙΣ ........................................................

362

ΚΡΙΤΗΡΙΑ ΑΞΙΟΛΟΓΗΣΗΣ ........................................................................................ [ανά δύο κεφάλαια, ανά 4 κεφάλαια και εφ’ όλης της ύλης]

396

ΑΠΑΝΤΗΣΕΙΣ - ΛΥΣΕΙΣ Τράπεζας θεμάτων (ερωτήσεις πολλαπλής επιλογής / σωστού-λάθους / αντιστοίχισης / ανάπτυξης / κρίσεως-συνδυαστικές) / Προβλημάτων για λύση / Διαγωνισμάτων ..............................................................................................................

428

ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΚΡΙΤΗΡΙΑ ΑΞΙΟΛΟΓΗΣΗΣ ......................................................

522

Βιβλιογραφία ..............................................................................................................

549

kefalaio 1_Layout 1 19/11/2012 5:39 μμ Page 9

1 ο ι α λ ά φ ε κ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Το

ικο λ Υ ο εΤικ ν ε Γ

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 39

ΠΡΟΒ

προΤεινομενα προΒλημαΤα Για λΥςη

ΛΗΜ

ΑΤΑ ΓΙΑ ΚΕΦΑΛΑΙΟ 1ο: Τ ΛΥΣ Ο Θεμα δ ΓΕΝΕΤΙΚΟ Η ΥΛΙΚΟ ΄-π

ανελλα

δικων

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Έστω ότι σε ένα μόριο DNA υπάρχουν 3.200 νουκλεοτίδια. Τα 2/10 από αυτά αντιστοιχούν σε θυμίνες (Τ). α. Πόσες φορές αντιπροσωπεύεται κάθε βάση στο μόριο αυτό; β. Να καθορίσετε τον αριθμό των δεσμών υδρογόνου που περιέχονται στο μόριο αυτό του DNA. γ. Να βρείτε τον αριθμό των φωσφοδιεστερικών δεσμών στο μόριο αυτό. 2. Το άθροισμα των αζωτούχων βάσεων Α και Τ μιας αλυσίδας ενός μορίου DNA είναι 8.000, ενώ οι βάσεις G στην ίδια αλυσίδα είναι 6.000. Aν οι βάσεις G της συμπληρωματικής αλυσίδας είναι 4.000, να βρείτε: α. Τον συνολικό αριθμό των νουκλεοτιδίων και β. τον αριθμό των δεσμών Η που αναπτύσσονται στο παραπάνω μόριο DNA.

3. Δύο κύτταρα ευκαρυωτικών οργανισμών διαφορετικού είδους έχουν, στην αρχή της μίτωσης, το πρώτο 40 μόρια DNA, ενώ το δεύτερο 34 μόρια DNA. Ποιο από τα δύο κύτταρα είναι απλοειδές; Να αιτιολογήσετε την απάντησή σας. 4. Να συμπληρώσετε τον παρακάτω πίνακα: Δροσόφιλα

Γαμέτης

Σωματικό κύτταρο

Αρχή μεσόφασης

Χρωμοσώματα Μόρια DNA

Ζεύγη βάσεων

Μετά την αντιγραφή

Αρχή μίτωσης

Τέλος μίτωσης

4

1,6 · 108

5. Ένα ινίδιο χρωματίνης έχει μήκος 2 · 103 ζεύγη βάσεων. Να βρείτε τον αριθμό των νουκλεοσωμάτων, εάν θεωρήσουμε ότι μεταξύ αυτών δεν μεσολαβούν ενδιάμεσα τμήματα. 6. Πόσα χρωμοσώματα, χρωματίδες, μόρια DNA και πόσα νουκλεοσώματα έχει ένα μεταφασικό κύτταρο του ανθρώπου; (Θεωρήστε ότι μεταξύ των νουκλεοσωμάτων δεν υπάρχουν ενδιάμεσα τμήματα).

39

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 40

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία 7. Δίνεται δίκλωνο τμήμα DNA 1.000 αζωτούχων βάσεων στο οποίο υπάρχουν 1.350 δεσμοί υδρογόνου. Να βρεθεί ο αριθμός των νουκλεοτιδίων με A, T, G, C.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

8. Ένα ινίδιο χρωματίνης περιέχει περίπου 10.000 νουκλεοτίδια. Από πόσα νουκλεοσώματα αποτελείται, εάν γνωρίζουμε ότι μεταξύ των νουκλεοσωμάτων παρεμβάλλονται τμήματα με 100 ζεύγη αζωτούχων βάσεων το καθένα; (Θεωρήστε ότι το ινίδιο έχει στα δύο άκρα του νουκλεοσώματα). 9. Στα σωματικά κύτταρα της αγελάδας υπάρχουν 60 χρωμοσώματα. Ποιος είναι ο αριθμός: α. Των χρωμοσωμάτων που υπάρχουν σε ένα ωάριο αγελάδας; β. Των φυλετικών χρωμοσωμάτων στο μυϊκό (σωματικό) κύτταρο της αγελάδας; γ. Των μορίων DNA που υπάρχουν στο μεταφασικό κύτταρο της αγελάδας; δ. Των χρωμοσωμάτων μητρικής προέλευσης που υπάρχουν στο ζυγωτό κύτταρο της αγελάδας; 10. Στη μία πολυνουκλεοτιδική αλυσίδα δίκλωνου μορίου DNA υπάρχουν 3.000 νουκλεοτίδια. Στο δίκλωνο μόριο του DNA υπάρχουν 1.800 νουκλεοτίδια που περιέχουν την αζωA+T τούχα βάση αδενίνη. Να υπολογίστε τον λόγο στο δίκλωνο μόριο του DNA. G+C

11. Το μοσχομπίζελο είναι διπλοειδής οργανισμός. Στους γαμέτες αυτού υπάρχουν 7 χρωμοσώματα. Να απαντήσετε στα παρακάτω: α. Πόσα χρωμοσώματα, χρωματίδες και κεντρομερίδια υπάρχουν σε σωματικό κύτταρο του οργανισμού κατά τη μετάφαση της μίτωσης; β. Πόσα χρωμοσώματα υπάρχουν στο ζυγωτό κύτταρο του μοσχομπίζελου και πόσα από αυτά είναι μητρικής προέλευσης; γ. Πόσα μόρια DNA και πόσες πολυνουκλεοτιδικές αλυσίδες έχει ένα σωματικό κύτταρο του οργανισμού στην αρχή της μεσόφασης;

12. Μία πολυνουκλεοτιδική αλυσίδα δίκλωνου γραμμικού μορίου DNA έχει 199 φωσφοδιεστερικούς δεσμούς: α. Πόσα νουκλεοτίδια έχει το δίκλωνο μόριο DNA; β. Πόσα μόρια πεντόζων και πόσα αζωτούχων βάσεων υπάρχουν στο δίκλωνο μόριο DNA; γ. Πόσες ελεύθερες φωσφορικές ομάδες και πόσες ελεύθερες υδροξυλομάδες έχει το δίκλωνο μόριο του DNA; 13. Σε ένα μεταφασικό χρωμόσωμα το μόριο του DNA της μιας χρωματίδας περιέχει 5.000 νουκλεοτίδια, από τα οποία τα 500 νουκλεοτίδια έχουν αζωτούχα βάση την Αδενίνη. Να υπολογίσετε:

40

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 41

ΠΡΟΒ

ΛΗΜ

ΑΤΑ ΓΙΑ ΚΕΦΑΛΑΙΟ 1ο: Τ ΛΥΣ Ο ΓΕΝΕΤ Η ΙΚΟ Υ ΛΙΚΟ

α. Τον αριθμό των νουκλεοτιδίων με αζωτούχα βάση τη G που υπάρχουν στο μόριο του DNA της άλλης αδελφής χρωματίδας του μεταφασικού χρωμοσώματος. β. Τον συνολικό αριθμό των νουκλεοτιδίων που υπάρχουν στο μεταφασικό χρωμόσωμα. A+T που ισχύει για το μόριο του DNA αυτού του οργανισμού. G+C

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

γ. Τον λόγο

14. Δίνεται η παρακάτω αλληλουχία αζωτούχων βάσεων που αποτελεί τμήμα της μίας πολυνουκλεοτιδικής αλυσίδας ενός δίκλωνου μορίου DNA: 3΄...ATGCCCGTAGCTG…5΄

α. Να γράψετε τη συμπληρωματική αλυσίδα του δίκλωνου μορίου και να τοποθετήσετε τα άκρα αυτής, αιτιολογώντας την απάντησή σας. β. Να υπολογίστε τον λόγο στην αλυσίδα που δίνεται καθώς και στη συμπληρωματική της. γ. Πόσα μόρια πεντοζών, αζωτούχων βάσεων και φωσφορικών ομάδων υπάρχουν στο δίκλωνο τμήμα του DNA; 15. Ένα τμήμα ινιδίου χρωματίνης έχει 5 νουκλεοσώματα. Το τμήμα του δίκλωνου μορίου DNA που βρίσκεται μεταξύ δύο διαδοχικών νουκλεοσωμάτων έστω ότι έχει μήκος 54 ζεύγη βάσεων. Να απαντήσετε στα παρακάτω: α. Πόσα μόρια ιστονών υπάρχουν στο παραπάνω τμήμα του ινιδίου της χρωματίνης; β. Ποιο είναι το συνολικό μήκος του DNA που περιέχεται στο τμήμα του ινιδίου της χρωματίνης; γ. Δεδομένου ότι το DNA του ινιδίου αντιγράφεται, πόσα μόρια ιστονών και πόσα δεοξυριβονουκλεοτίδια είναι απαραίτητα, προκειμένου να γίνει η αντιγραφή του παραπάνω τμήματος του DNA; 16. Ένα μεταφασικό χρωμόσωμα περιέχει 880 μόρια ιστονών και η κάθε πολυνουκλεοτιδική αλυσίδα που περιέχεται στα μόρια DNA αυτού έχει 6.200 νουκλεοτίδια. Να απαντήσετε στα παρακάτω: α. Πόσα νουκλεοσώματα υπάρχουν στο μεταφασικό χρωμόσωμα και πόσα μόρια ιστονών υπάρχουν σε κάθε χρωματίδα αυτού; β. Πόσα νουκλεοτίδια υπάρχουν συνολικά στα μόρια DNA του χρωμοσώματος αυτού; γ. Πόσα νουκλεοσώματα και πόσα μόρια ιστονών υπήρχαν στο μεσοφασικό αυτό χρωμόσωμα πριν από τον διπλασιασμό του;

17. Σε μόριο DNA βακτηρίου Α η σύσταση της αζωτούχας βάσης G είναι 30%. Σε μόριο DNA βακτηρίου Β η σύσταση της αζωτούχας βάσης Α είναι 10%, ενώ σε μόριο DNA βακτηρίου Γ η σύσταση της Τ είναι 20%. Τα παραπάνω βακτήρια ανήκουν στο ίδιο είδος ή σε διαφορετικά;

41

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 42

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

1ο ωριαιο διαΓωνιςμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Ο γαμέτης ενός θηλυκού ατόμου στον άνθρωπο φυσιολογικά περιέχει: α. 23 αυτοσωμικά χρωμοσώματα. β. 22 αυτοσωμικά και 1 φυλετικό χρωμόσωμα που μπορεί να είναι Χ ή Ψ. γ. 23 ζεύγη χρωμοσωμάτων. δ. 22 αυτοσωμικά και 1 Χ φυλετικό χρωμόσωμα.

Μονάδες 5

Α2. Η δροσόφιλα είναι διπλοειδής οργανισμός με 8 χρωμοσώματα. Ο καρυότυπος αυτής απεικονίζει: α. 8 ζεύγη αυτοσωμικών χρωμοσωμάτων. β. 8 χρωμοσώματα, 8 κεντρομερίδια και 16 χρωματίδες. γ. 8 χρωμοσώματα και 8 βραχίονες στις χρωματίδες αυτών. δ. 8 χρωμοσώματα, 8 κεντρομερίδια καθώς και 32 χρωματίδες.

Μονάδες 5

Α3. Η λειτουργική μονάδα του γενετικού υλικού είναι: α. Το νουκλεόσωμα. β. Το ινίδιο της χρωματίνης. γ. Το γονίδιο. δ. Τα μόρια του DNA ενωμένα με πρωτεΐνες.

Μονάδες 5

A+T 1 σε μία αλυσίδα δίκλωνου μορίου DNA είναι . Ο λόγος αυτός στην άλλη G+C 2 αλυσίδα του μορίου είναι: α. 3/2. β. 2/3. γ. 1. δ. Τίποτε από τα παραπάνω. Μονάδες 5

Α4. Ο λόγος

42

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 43

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α

ΚΕΦΑΛΑΙΟ 1ο: Τ Ο ΓΕΝΕΤ ΙΚΟ

ΥΛΙΚΟ

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Τα μιτοχονδριακά γονίδια που υπάρχουν στο ζυγωτό των ανώτερων οργανισμών προέρχονται: α. Όλα από τη μητέρα. β. Όλα από τον πατέρα. γ. Ορισμένα από τον πατέρα και ορισμένα από τη μητέρα. δ. Κυρίως από τη μητέρα. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Να περιγράψετε τον τρόπο δημιουργίας του φωσφοδιεστερικού δεσμού.

Μονάδες 5

Β2. Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή; Να αναφέρετε παραδείγματα και από τις δύο κατηγορίες κυττάρων. Μονάδες 5

Β3. Με ποιον τρόπο οι πρωτεΐνες συμβάλλουν στην οργάνωση του γενετικού υλικού των προκαρυωτικών και των ευκαρυωτικών κυττάρων; Μονάδες 8 Β4. Σε τι διαφέρουν μεταξύ τους δύο μη ομόλογα μεταφασικά χρωμοσώματα;

Μονάδες 7

43

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 44

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

2ο ωριαιο διαΓωνιςμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Οι δύο πολυνουκλεοτιδικές αλυσίδες ενός δίκλωνου μορίου DNA: α. Είναι αντιπαράλληλες. β. Απέναντι από την αδενίνη της μιας αλυσίδας βρίσκεται η θυμίνη στην άλλη. γ. Τα νουκλεοτίδια και στις δύο είναι ενωμένα με 3΄-5΄ φωσφοδιεστερικό δεσμό. δ. Όλα τα παραπάνω. Μονάδες 5 Α2. Το νουκλεόσωμα αποτελείται από: α. Πρωτεΐνες ιστόνες, 8 στον αριθμό, και 292 νουκλεοτίδια. β. Πρωτεΐνες ιστόνες, 8 στον αριθμό, και 146 βάσεις. γ. Πρωτεΐνες ιστόνες, καθώς και άλλα είδη πρωτεϊνών, όπως μη ιστόνες. δ. Όλα τα παραπάνω.

Μονάδες 5

Α3. Για το μόριο DNA των πλασμιδίων ισχύει: α. Έχει στον χώρο μορφή διπλής δεξιόστροφης έλικας. β. Είναι κυκλικό. γ. Περιέχει γονίδια που προσδίδουν ανθεκτικότητα έναντι αντιβιοτικών. δ. Όλα τα παραπάνω.

Μονάδες 5

Α4. Στο πείραμα των Hershey και Chase ιχνηθετήθηκαν οι πρωτεΐνες με ραδιενεργό 35S και το DNA με ραδιενεργό 32Ρ, διότι: α. Οι πρωτεΐνες δομούνται από αμινοξέα και τα νουκλεϊκά οξέα από νουκλεοτίδια. β. Οι πρωτεΐνες δομούνται από αμινοξέα που περιέχουν Ρ και τα νουκλεϊκά οξέα από νουκλεοτίδια που περιέχουν S. γ. Τόσο οι πρωτεΐνες όσο και τα νουκλεϊκά οξέα περιέχουν και Ρ και S. δ. Για όλα τα παραπάνω. Μονάδες 5

44

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 45

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α

ΚΕΦΑΛΑΙΟ 1ο: Τ Ο ΓΕΝΕΤ ΙΚΟ

ΥΛΙΚΟ

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Για ένα μεταφασικό χρωμόσωμα ισχύει: α. Αποτελείται από δύο μόρια DNA. β. Έχει ένα κεντρομερίδιο. γ. Εάν στη διπλή έλικα της μιας χρωματίδας αυτού η G=20%, στη διπλή έλικα της αδελφής χρωματίδας η C=20%. δ. Όλα τα παραπάνω. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Ποια δεδομένα βοήθησαν στην ανακάλυψη της διπλής έλικας του DNA;

Μονάδες 6

Β2. Να αναφέρετε συνοπτικά τις λειτουργίες του γενετικού υλικού.

Μονάδες 6

Β3. Ποια οργανίδια του κυττάρου χαρακτηρίζονται ως ημιαυτόνομα και γιατί;

Μονάδες 5

Β4. Δίνεται ο καρυότυπος ενός ανθρώπου-ενήλικου ατόμου: α. Σε ποια φάση απεικονίζονται τα χρωμοσώματα και ποια η μορφολογία αυτών; β. Να περιγράψετε τον τρόπο με τον οποίο δημιουργήθηκε ο καρυότυπος. Μονάδες 8

45

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 46

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

Τριωρο διαΓωνιςμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Μία πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση των νουκλεοτιδίων με: α. Δεσμούς υδρογόνου. β. Φωσφοδιεστερικούς δεσμούς. γ. Πεπτιδικούς δεσμούς. δ. Ετεροπολικούς δεσμούς. Μονάδες 5

Α2. Τα πλασμίδια: α. Είναι δίκλωνα, κυκλικά μόρια DNA με διάφορα μεγέθη. β. Απαντούν σε όλους τους προκαρυωτικούς οργανισμούς. γ. Αποτελούν βασικό συστατικό των νουκλεοσωμάτων. δ. Απαντούν σε όλους τους ευκαρυωτικούς οργανισμούς.

Μονάδες 5

Α3. Ως ημιαυτόνομα οργανίδια χαρακτηρίζονται: α. Τα ριβοσώματα και οι χλωροπλάστες. β. Οι χλωροπλάστες και τα μιτοχόνδρια. γ. Τα χρωμοσώματα και τα ριβοσώματα. δ. Ο πυρήνας και οι χλωροπλάστες.

Μονάδες 5

Α4. Οι αδερφές χρωματίδες συγκροτούν ένα: α. Νουκλεόσωμα. β. Ινίδιο χρωματίνης στην αρχή της μεσόφασης. γ. Καρυότυπο. δ. Μεταφασικό χρωμόσωμα. Μονάδες 5

46

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 47

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α

ΚΕΦΑΛΑΙΟ 1ο: Τ Ο ΓΕΝΕΤ ΙΚΟ

ΥΛΙΚΟ

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Η έκφραση in vitro χρησιμοποιείται για την περιγραφή μιας βιολογικής διαδικασίας που πραγματοποιείται σε: α. Έναν οργανισμό. β. Βακτήρια. γ. Ένα κύτταρο. δ. Δοκιμαστικό σωλήνα. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι ονομάζεται νουκλεόσωμα και πώς αυτό σχετίζεται με τη δομή ενός ινιδίου χρωματίνης; Μονάδες 6 Β2. Να περιγράψετε τη διαδικασία με την οποία μπορεί να κατασκευαστεί ο καρυότυπος ενός ανθρώπου. Μονάδες 8 Β3. Να περιγράψετε το πείραμα με το οποίο επιβεβαιώθηκε οριστικά ότι το DNA είναι το γενετικό υλικό. Μονάδες 5 Β4. Ποια χρωμοσώματα χαρακτηρίζονται ως αυτοσωμικά, ποια ως φυλετικά και πώς καθορίζεται το φύλο στον άνθρωπο; Μονάδες 6 ΘΕΜΑ Γ

Γ1. Ποιες είναι συνοπτικά οι λειτουργίες του γενετικού υλικού;

Μονάδες 5

Γ2. Πώς διατάσσονται οι υδρόφοβες και υδρόφιλες περιοχές ενός μορίου DNA στον χώρο; Μονάδες 4 Γ3. Το DNA σε δύο διαφορετικά κύτταρα ενός οργανισμού βρέθηκε ότι αποτελείται στο ένα από 5 x 108 και στο άλλο από 10 x 108 ζεύγη βάσεων. Πώς μπορεί να εξηγηθεί αυτό; Μονάδες 6

47

kefalaio 1_Layout 1 19/11/2012 5:40 μμ Page 48

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ4. Ο καρυότυπος θηλυκής δροσόφιλας περιέχει 16 χρωματίδες. α. Ποιος είναι ο αριθμός των χρωμοσωμάτων σε σωματικό κύτταρο και ποιος σε γαμέτη δροσόφιλας; β. Πόσα από αυτά είναι αυτοσωμικά και πόσα φυλετικά; γ. Πόσα μόρια DNA έχει το κύτταρο της δροσόφιλας κατά τη μεσόφαση; Μονάδες 10

Έστω ότι ένα μόριο DNA έχει μήκος 1.600 ζεύγη βάσεων. Τα 2/10 των βάσεων αντιστοιχούν σε θυμίνες (Τ). Να βρείτε τον αριθμό των: Δ1. Νουκλεοτιδίων σε καθεμία αζωτούχα βάση.

Μονάδες 8

Δ2. Δεσμών υδρογόνου.

Μονάδες 4

Δ3. Φωσφοδιεστερικών δεσμών που περιέχονται στο μόριο αυτό του DNA.

Moνάδες 6

Δ4. Σε ποια φάση του κυτταρικού κύκλου πραγματοποιείται η αντιγραφή του DNA; Ποια η μορφή του γενετικού υλικού στη φάση αυτή; Πόσα δεοξυριβονουκλεοτίδια απαιτούνται για να γίνει η αντιγραφή του παραπάνω μορίου DNA; Μονάδες 7

48

kefalaio 2_Layout 1 19/11/2012 5:47 μμ Page 49

2 ο ι α λ ά φ ε κ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

και ρυθμιση η σ α ρ φ εκ , η φ Γρα ληροφοριασ ι Π τ σ η αν Γενετικ τησ

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 94

νση κείου / Θετική Κατεύθυ θεμα δ ΄ Ενιαίου Λυ Γ α ί γ ΄ - Πανε ο λ Βιο λ

λαδικω

Προτεινομενα ΠροΒληματα Για λυση

ν

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Μόριο DNA τοποθετείται σε περιβάλλον με ραδιενεργό φωσφόρο 32P και αυτοδιπλασιάζεται δύο φορές. Στη συνέχεια, τα μόρια που προκύπτουν επαναφέρονται σε περιβάλλον με φυσιολογικά νουκλεοτίδια, οπότε αυτοδιπλασιάζονται άλλη μία φορά. Πόσες αλυσίδες με ραδιενεργά και πόσες με φυσιολογικά νουκλεοτίδια θα υπάρχουν στο τέλος; 2. Ένα μόριο DNA περιέχει στον έναν κλώνο 15ν, ενώ στον άλλον 14ν. Το μόριο αυτό διπλασιάζεται σε περιβάλλον στο οποίο περιέχονται νουκλεοτίδια με 14ν. Το αρχικό μόριο του DNA αποτελείται από 7.200 νουκλεοτίδια. α. Πόσα νουκλεοτίδια με 14ν και πόσα με 15ν θα υπάρχουν στα μόρια του DNA που θα προκύψουν μετά από δύο συνεχείς αυτοδιπλασιασμούς στο ίδιο περιβάλλον; β. Πόσες αλυσίδες συντέθηκαν κατά τη διάρκεια των δύο αυτοδιπλασιασμών; 3. να συμπληρώσετε τον παρακάτω πίνακα: 1η Αλυσίδα DNA

2η Αλυσίδα DNA

Μόριο DNA

Αγγελιαφόρο RNA

A: 12%

G: 29% C: 20% T:

4. Σε ένα βακτήριο παράγεται μια πρωτεΐνη 5.000 αμινοξέων, που αποτελείται από 4 ίδιες πολυπεπτιδικές αλυσίδες. Εάν τα νουκλεοτίδια των εξωνίων αποτελούν το 50% του συνολικού mRNA, να βρείτε από πόσα νουκλεοτίδια αποτελείται το τμήμα του γενετικού υλικού που κωδικοποιεί αυτή την πρωτεΐνη. 5. Δίνεται ασυνεχές γονίδιο 12.000 νουκλεοτιδίων. Στο γονίδιο αυτό περιέχονται εσώνια με 3.400 νουκλεοτίδια συνολικά. Εάν οι 5΄ και 3΄ αμετάφραστες περιοχές του mRNA που προκύπτει περιέχουν συνολικά 13 νουκλεοτίδια, να βρείτε από πόσα αμινοξέα αποτελείται η πολυπεπτιδική αλυσίδα που κωδικοποιεί το παραπάνω γονίδιο.

94

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 95

ΠΡΟΒ

ΚΕφΑΛΑιΟ

2Ο: ΑνΤιΓρΑφΗ, ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕΤιΚΗΣ

ΛΗΜ ΑΤΑ ΓΙΑ ΛΥΣ ΠΛΗρΟφΟ Η ρ ιΑ Σ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

6. Το πρόδρομο mRNA που προέκυψε από τη μεταγραφή ενός γονιδίου ευκαρυωτικού κυττάρου έχει 730 νουκλεοτίδια. Οι 5΄ και 3΄ αμετάφραστες περιοχές του mRNA έχουν συνολικά 12 νουκλεοτίδια. Εάν η πολυπεπτιδική αλυσίδα (μη λειτουργική πρωτεΐνη) που προέκυψε από τη μετάφραση έχει 205 αμινοξέα, να βρείτε τον αριθμό των νουκλεοτιδίων που ανήκουν στα εσώνια του γονιδίου. 7. Έστω ότι ένα τμήμα του DNA (ασυνεχές γονίδιο) περιέχει 3.600 νουκλεοτίδια. να βρείτε: α. Τον αριθμό των κωδικονίων του πρόδρομου mRNA που δημιουργείται με τη μεταγραφή του γονιδίου, εάν τα εξώνια αποτελούν το 50% του μορίου αυτού. β. Τον αριθμό των tRNA που θα χρησιμοποιηθούν κατά τη μετάφραση του mRNA. γ. Τον αριθμό των αμινοξέων που θα περιέχονται στην πολυπεπτιδική αλυσίδα. 8. να υπολογίσετε το πλήθος των πεντοζών και των αζωτούχων βάσεων σε ώριμο μόριο mRNA, το οποίο κατά τη μετάφραση δίνει πολυπεπτιδική αλυσίδα, η οποία στη λειτουργική της μορφή έχει 150 αμινοξέα, ενώ στη μη λειτουργική έχει 155 αμινοξέα. Πόσα tRNA μόρια πήραν μέρος κατά τη σύνθεση της αλυσίδας; (να μην υπολογιστούν οι αμετάφραστες περιοχές).

9. Μια λειτουργική πρωτεΐνη αποτελείται από 300 αμινοξέα. Προκειμένου να γίνει λειτουργική, απομακρύνθηκαν 50 αμινοξέα από το αμινικό άκρο της πολυπεπτιδικής αλυσίδας. Εάν οι 3΄ και 5΄ αμετάφραστες περιοχές έχουν μήκος 100 αζωτούχες βάσεις και το γονίδιο που κωδικοποιεί την πρωτεΐνη έχει μήκος 5.000 ζεύγη βάσεων, να βρείτε το μήκος των εσωνίων του γονιδίου. 10. Ένα πρόδρομο mRNA περιλαμβάνει δύο εσώνια, το ένα 50 και το άλλο 150 νουκλεοτιδίων, που αντιστοιχούν στο 40% του πρόδρομου mRNA. Εάν το πολυπεπτίδιο που παράγεται τελικά έχει 90 αμινοξέα, να υπολογίσετε: α. Πόσα νουκλεοτίδια υπάρχουν στις 5΄ και 3΄ αμετάφραστες περιοχές του mRNA. β. Πόσα νουκλεοτίδια έχει το ώριμο mRNA. γ. Τον αριθμό των νουκλεοτιδίων που μεταγράφηκαν. δ. Τον αριθμό των εξωνίων στο πρόδρομο mRNA.

11. Το ενδιάμεσο πεπτίδιο που απομακρύνεται από την προϊνσουλίνη (μη λειτουργική πρωτεΐνη) έχει 70 αμινοξέα. Οι 3΄ και 5΄ αμετάφραστες περιοχές του mRNA που φέρει την πληροφορία για τη σύνθεση της προϊνσουλίνης έχουν 14 νουκλεοτίδια. Εάν κατά την ωρίμανση απομακρυνθούν από το πρόδρομο mRNA 3 εσώνια με 120 συνολικά νουκλεοτίδια, να βρείτε: α. Το μήκος του γονιδίου που κωδικοποιεί την προϊνσουλίνη.

95

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 96

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο β. Πόσοι φωσφοδιεστερικοί δεσμοί σπάνε και πόσοι σχηματίζονται κατά την ωρίμανση του mRNA. Σημείωση: Η ινσουλίνη είναι η λειτουργική πρωτεΐνη και έχει 51 αμινοξέα.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

12. Μια μη λειτουργική πρωτεΐνη ενός ευκαρυωτικού κυττάρου αποτελείται από 99 αμινοξέα. Εάν οι 3΄ και 5΄ αμετάφραστες περιοχές αποτελούν το 40% του ώριμου mRNA και τα εσώνια το 20% του πρόδρομου mRNA, ποιος είναι ο αριθμός των νουκλεοτιδίων του γονιδίου που κωδικοποιεί την παραπάνω πρωτεΐνη; 13. Κατά την αντιγραφή ενός τμήματος DNA, οι DNA ελικάσες έσπασαν 130 δεσμούς υδρογόνου, ενώ οι DNA πολυμεράσες μετέφεραν και ενσωμάτωσαν 100 νουκλεοτίδια. να βρείτε: α. Πόσες και ποιες αζωτούχες βάσεις υπήρχαν στα νουκλεοτίδια του αρχικού τμήματος του DNA. β. Πόσοι φωσφοδιεστερικοί δεσμοί σχηματίστηκαν. 14. Δίνεται η μία αλυσίδα ενός συνεχούς γονιδίου. 1η αλυσίδα: GGTACGGGGATTACCCGGGCATGGG να βρείτε: α. Τη μη κωδική αλυσίδα. β. Το mRNA που προκύπτει. γ. Τα αντικωδικόνια με τη σειρά που παίρνουν μέρος στη μετάφραση. δ. Τον αριθμό των αμινοξέων του πεπτίδιου που θα προκύψει.

15. Δίνεται η ακόλουθη αλληλουχία του 3ου άκρου μορίου (ώριμου) mRNA: ...UGGAUUCUCCCUACAAGGUAAGCGGAAU-3΄ α. Πόσα αμινοξέα κωδικοποιούνται από αυτό το τμήμα του mRNA; β. Ποια είναι η ακολουθία των αζωτούχων βάσεων στο γονίδιο που κωδικοποιεί αυτό το mRNA;

16. Έστω το παρακάτω άκρο ενός τμήματος (ώριμου) mRNA που εμπεριέχει τα κωδικόνια για κάποια αμινοξέα και αμετάφραστη περιοχή: UUUCAGUUUACGUCCUCCUCGAACU α. Ποιο είναι το 3΄ και ποιο το 5΄ άκρο αυτού του τμήματος; β. Το τμήμα αυτό αντιστοιχεί στην αρχή ή στο τέλος του μορίου; γ. Πόσα αμινοξέα θα προκύψουν από αυτό το τμήμα; δ. Ποια είναι τα αντικωδικόνια των tRNA που αντιστοιχούν σε αυτό το τμήμα, με τη σειρά που παίρνουν μέρος στη μετάφραση;

96

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 97

ΠΡΟΒ

ΚΕφΑΛΑιΟ

2Ο: ΑνΤιΓρΑφΗ, ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕΤιΚΗΣ

ΛΗΜ ΑΤΑ ΓΙΑ ΛΥΣ ΠΛΗρΟφΟ Η ρ ιΑ Σ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

17. Δίνεται ένα ινίδιο χρωματίνης (πριν από την αντιγραφή) και το ίδιο ινίδιο, διπλασιασμένο, μετά την αντιγραφή του. α. Πόσα μόρια DNA αποτελούν το αρχικό ινίδιο και πόσα το διπλασιασμένο; Τα μόρια DNA που υπάρχουν στα δύο ινίδια έχουν ίδια αλληλουχία βάσεων ή όχι; να αιτιολογήσετε την απάντησή σας. β. Με δεδομένο ότι κάθε πολυνουκλεοτιδική αλυσίδα στα παραπάνω μόρια DNA αποτελείται από 200.000 νουκλεοτίδια, πόσα δεοξυριβονουκλεοτίδια απαιτήθηκαν για την αντιγραφή του DNA; Πόσες φορές κατά την αντιγραφή παραβίασε η DNA πολυμεράση τον κανόνα της συμπληρωματικότητας των αζωτούχων βάσεων; γ. Εάν στο αρχικό ινίδιο υπήρχαν 300 γονίδια, πόσα γονίδια υπάρχουν ως προς το είδος και πόσα ως προς τον αριθμό στο διπλασιασμένο ινίδιο της χρωματίνης; 18. Τμήμα DNA ενός πλασμιδίου έχει την παρακάτω αλληλουχία βάσεων:  1η αλυσίδα: 3΄...TGCACGAATTCATG…5΄ 2η αλυσίδα: 5΄...ACGTGCTTAAGTAC...3΄  θέση έναρξης αντιγραφής

α. Τι είναι η θέση έναρξης αντιγραφής και πόσες υπάρχουν στο παραπάνω πλασμίδιο; β. να γράψετε την αλληλουχία που θα έχει η νέα πολυνουκλεοτιδική αλυσίδα η οποία συντίθεται με συνεχή τρόπο, όταν στο παραπάνω τμήμα DNA έχει ολοκληρωθεί η αντιγραφή του. γ. Εάν το πρωταρχικό τμήμα που δημιουργήθηκε κατά την αντιγραφή της συνεχούς αλυσίδας έχει πέντε νουκλεοτίδια, να γράψετε την αλληλουχία αυτού καθώς και τα άκρα του. δ. Πώς εφαρμόζεται η συμπληρωματικότητα κατά τη δημιουργία του πρωταρχικού τμήματος και από ποιο ένζυμο;

19. Ένα γονίδιο του πυρηνικού DNA που βρίσκεται στο 12ο χρωμόσωμα έχει μήκος 2.000 ζεύγη βάσεων και περιέχει δύο εσώνια μήκους το Α 360 ζεύγη βάσεων και το Β 540 ζεύγη βάσεων.Όταν το παραπάνω γονίδιο εκφράζεται, συνθέτει μη λειτουργικό πεπτίδιο με 230 αμινοξέα, ενώ το λειτουργικό πρωτεϊνικό μόριο έχει 190 αμινοξέα. α. Ποιο είναι το μήκος του πρόδρομου mRNA που προκύπτει από τη μεταγραφή του παραπάνω γονιδίου και ποιο το μήκος του ώριμου mRNA; β. Ποιο είναι το μήκος των 3΄ και 5΄ αμετάφραστων περιοχών στο mRNA και στο γονίδιο; γ. Ποιος είναι ο αριθμός των κωδικονίων στο πρόδρομο και στο ώριμο mRNA; δ. Ποιες πρωτεΐνες βοήθησαν τόσο στη σύνθεση του mRNA όσο και στην τροποποίησή του, πριν να εξέλθει από τον πυρήνα στο κυτταρόπλασμα;

97

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 98

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο 20. Δίνεται το παρακάτω τμήμα DNA κατά τη φάση της αντιγραφής (διχάλα αντιγραφής). Κλώνος Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Θέση έναρξης

Κλώνος Β

ρ

Έστω ότι η αλληλουχία των βάσεων στον κλώνο Β είναι: 5΄-GTAGCCTTGAAT-3΄

α. Ποια είναι η αλληλουχία των βάσεων της νέας πολυνουκλεοτιδικής αλυσίδας που έχει συντεθεί με συνεχή τρόπο; να αιτιολογήσετε την απάντησή σας. β. Ποια η αλληλουχία και ποια τα άκρα του πρωταρχικού τμήματος που δημιουργήθηκε κατά τη σύνθεση της συνεχούς αλυσίδας, δεδομένου ότι αυτό αποτελείται από έξι νουκλεοτίδια; γ. Κατά τη διαδικασία της αντιγραφής του παραπάνω τμήματος, σε ποια αλυσίδα δημιουργήθηκε ένα πρωταρχικό τμήμα και σε ποια περισσότερα; δ. Πόσα δεοξυριβονουκλεοτίδια χρησιμοποιήθηκαν για την αντιγραφή του παραπάνω τμήματος; 21. Στο παρακάτω σχήμα απεικονίζεται ένα γονίδιο το οποίο έχει αποσυσπειρωθεί πλήρως, προκειμένου να γίνει η μεταγραφή του. γονίδιο

ρ

αλληλουχίες λήξης της μεταγραφής

α. Ποιο ένζυμο και πώς προκάλεσε την αποσυσπείρωση του γονιδίου; β. να δείξετε τη θέση του υποκινητή του γονιδίου καθώς και τη διεύθυνση της μεταγραφής του. γ. να τοποθετήσετε τα 5΄ και 3΄ άκρα στις δύο αλυσίδες του γονιδίου, αιτιολογώντας την απάντησή σας.

98

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 99

ΠΡΟΒ

ΚΕφΑΛΑιΟ

2Ο: ΑνΤιΓρΑφΗ, ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕΤιΚΗΣ

ΛΗΜ ΑΤΑ ΓΙΑ ΛΥΣ ΠΛΗρΟφΟ Η ρ ιΑ Σ

δ. Ποια από τις δύο αλυσίδες του γονιδίου είναι η κωδική; να εξηγήσετε την απάντησή σας. ε. Ποιος ο ρόλος των αλληλουχιών λήξης της μεταγραφής;

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

22. Δίνεται ένα πολύσωμα με 5 ριβοσώματα. α. Τι είναι το πολύσωμα και ποια η σημασία της δημιουργίας του; β. Ποια είδη RNA σχετίζονται με τη δημιουργία και τη λειτουργικότητα του πολυσώματος; (ονομαστική αναφορά) γ. Με δεδομένο ότι για τη σύνθεση της κάθε πεπτιδικής αλυσίδας που παράγεται από τη λειτουργία του πολυσώματος χρησιμοποιούνται 141 tRNA, να απαντήσετε στα παρακάτω ερωτήματα: i. Ποιο είναι το ελάχιστο μήκος του μεταφραζόμενου mRNA; ii. Πόσα αμινοξέα είναι απαραίτητα για τη σύνθεση όλων των πεπτιδικών αλυσίδων στο παραπάνω πολύσωμα; 23. Δίνεται το παρακάτω γονίδιο που φέρνει την πληροφορία για τη σύνθεση ενός μικρού πεπτιδίου. (Το γονίδιο απεικονίζεται αποσυσπειρωμένο).

CATGGTGGAGTTTAAGCGTGGAGATGTA εσώνιο

TGC GT

ΟΗ

GC G AT

Διεύθυνση μεταγραφής

α. να γράψετε την αλληλουχία των αζωτούχων βάσεων και στη 2η αλυσίδα του γονιδίου. β. να γράψετε την αλληλουχία των mRNA που δημιουργούνται στον πυρήνα του ευκαρυωτικού κυττάρου και να τοποθετήσετε τα άκρα αυτών. να αιτιολογήσετε την απάντησή σας. γ. Ποια είναι η αλληλουχία του mRNA που προσδένεται στο ριβόσωμα, προκειμένου να μεταφραστεί; Πώς ερμηνεύετε τη διαφορά στην αλληλουχία των βάσεων των δύο mRNA; δ. Ποια είναι η αλληλουχία των αμινοξέων του πεπτιδίου που συντίθεται μετά τη μετάφραση του mRNA; (Βλέπε γενετικό κώδικα σελ. 35 σχολικού βιβλίου).

99

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 100

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο 24. Το σχήμα απεικονίζει μια θηλιά αντιγραφής. (Α: η θέση έναρξης της αντιγραφής). Α 

GTACC

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ

Β

 Α

GTACC

α. να σημειώσετε τα 3΄ και 5΄ άκρα όλων των πολυνουκλεοτιδικών αλυσίδων που απεικονίζονται. β. Ποιο ένζυμο λειτούργησε αρχικά στη θέση Α και με ποιον τρόπο; γ. Σε ποια περιοχή Β ή Γ ή και στις δύο μπορεί να δημιουργηθεί πρωταρχικό τμήμα 5΄GGUAC3΄; να αιτιολογήσετε την απάντησή σας. δ. Εάν η παραπάνω θηλιά αντιγραφής είναι η μοναδική στο μόριο του DNA, να εξηγήσετε ποια είναι η μορφή του μορίου του DNA και πού πιθανόν περιέχεται το μόριο αυτό του DNA. ε. Εάν όλα τα πρωταρχικά τμήματα έχουν το ίδιο μήκος και στην κάθε ασυνεχή αλυσίδα δημιουργούνται 5 πρωταρχικά τμήματα, να εξηγήσετε πόσα ριβονουκλεοτίδια είναι απαραίτητα για την αντιγραφή του DNA στην παραπάνω θηλιά αντιγραφής. 25. να συμπληρώσετε τα κενά στον παρακάτω πίνακα. μη κωδική

3΄_ _ _

___

ΑΤΤ5΄

κωδική

5΄_ _ _

Τ__

_ _ _ 3΄

mRNA

5΄AUG

__U

_ _ _3΄

tRNA

_A_

αμινοξύ

φαινυλαλανίνη

26. Στη μη κωδική αλυσίδα ενός γονιδίου βακτηριακού κυττάρου το άθροισμα των νουκλεοτιδίων G και C αντιστοιχεί στο 40% του συνόλου των νουκλεοτιδίων αυτού. Ποιο είναι το ποσοστό των νουκλεοτιδίων Α και Τ στην κωδική αλυσίδα του γονιδίου και ποιο είναι το άθροισμα των νουκλεοτιδίων G και C στο παραγόμενο μόριο του mRNA, μετά τη μεταγραφή του παραπάνω γονιδίου;

100

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 101

ΚΕφΑΛΑιΟ 2Ο:

ΑνΤιΓρΑφΗ,

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΤιΚΗΣ ΠΛ Η

ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕ

ρΟφΟρ ιΑ

Σ

1ο ωριαιο διαΓωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Οι μεταγραφικοί παράγοντες: α. Είναι διαφορετικοί σε κάθε τύπο κυττάρων του ανθρώπου. β. Για τη σύνθεσή τους ευθύνονται γονίδια. γ. Σχετίζονται με τη σωστή λειτουργία της RNA πολυμεράσης. δ. ισχύουν όλα τα παραπάνω.

Μονάδες 5

Α2. Εάν στο κυτταρόπλασμα βακτηριακού κυττάρου υπάρχουν άφθονα μόρια λακτόζης, τότε μετά τη μεταγραφή του συνόλου των γονιδίων του οπερονίου της λακτόζης στο κύτταρο, παράγονται: α. Μόνο ένα είδος μορίου mRNA. β. Κανένα μόριο mRNA, αφού το οπερόνιο είναι σε καταστολή. γ. Δύο είδη μορίων mRNA. δ. Τέσσερα είδη μορίων mRNA. Μονάδες 5

Α3. Tα ένζυμα που καταλύουν τη δημιουργία 3΄-5΄ φωσφοδιεστρικών δεσμών κατά την αντιγραφή της γενετικής πληροφορίας είναι: α. Οι DNA πολυμεράσες και οι DNA ελικάσες. β. Οι DNA πολυμεράσες, τα πριμοσώματα, οι DNA δεσμάσες και τα επιδιορθωτικά ένζυμα. γ. Οι DNA πολυμεράσες και οι RNA πολυμεράσες. δ. Όλα τα ένζυμα που αναφέρονται στο γ, καθώς και τα ριβονοκλεοπρωτεϊνικά σωματίδια. Μονάδες 5 Α4. Το ένζυμο RNA πολυμεράση: α. Αποτελείται από αμινοξέα. β. Συμβάλλει στη μεταγραφή γονιδίων. γ. Για τη σύνθεσή της, η γενετική πληροφορία υπάρχει πάνω σε γονίδια. δ. ισχύουν όλα τα παραπάνω.

101

kefalaio 2_Layout 1 19/11/2012 5:48 μμ Page 102

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Τα ριβονουκλεοπρωτεϊνικά σωματίδια: α. Αποτελούνται από πρωτεΐνες και snRNA. β. Λειτουργούν ως ένζυμα, με ικανότητα να καταλύουν τόσο τη διάσπαση όσο και τη δημιουργία 3΄-5΄ φωσφοδιεστερικών δεσμών. γ. υπάρχουν μόνο στον πυρήνα των ευκαρυωτικών κυττάρων. δ. ισχύουν όλα όσα αναφέρονται στα α, β και γ. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Πώς χαρακτηρίζεται ο μηχανισμός της αντιγραφής του DNA και γιατί;

Μονάδες 4

Β2. Τι ορίζουμε ως μετάφραση της γενετικής πληροφορίας; να εξηγήσετε σε ποιους λόγους οφείλεται το γεγονός ότι στα προκαρυωτικά κύτταρα η διαδικασία της μετάφρασης ενός μορίου mRNA αρχίζει πριν να έχει ακόμη ολοκληρωθεί η μεταγραφή του. Μονάδες 6

Β3. Η αντιγραφή του DNA στα χρωμοσώματα των ευκαρυωτικών κυττάρων γίνεται με μεγάλη ταχύτητα. Πού οφείλεται αυτό; Μονάδες 5 Β4. Δίνεται το παρακάτω γονίδιο βακτηριακού κυττάρου με τον υποκινητή αριστερά: 1η αλυσίδα: CGTTATGTTGCCGAGGAAATGACGTAG 2η αλυσίδα: GCAATACAACGGCTCCTTTACTGCATC α. Ποια από τις δύο αλυσίδες του γονιδίου είναι η κωδική; να αιτιολογήσετε την απάντησή σας. β. να γράψετε την αλληλουχία του mRNA που παράγεται από τη μεταγραφή του παραπάνω γονιδίου. γ. Πόσα αμινοξέα θα έχει το πεπτίδιο που θα συντεθεί από το γονίδιο αυτό; να αιτιολογήσετε την απάντησή σας. δ. Ποιες πρωτεΐνες είναι απαραίτητες για τη μεταγραφή του παραπάνω γονιδίου; (ονομαστική αναφορά) Μονάδες 10

102

kefalaio 2_Layout 1 19/11/2012 5:49 μμ Page 103

ΚΕφΑΛΑιΟ 2Ο:

ΑνΤιΓρΑφΗ,

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΤιΚΗΣ ΠΛ Η

ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕ

ρΟφΟρ ιΑ

Σ

2ο ωριαιο διαΓωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Μόρια tRNA σε ένα μυϊκό κύτταρο του ανθρώπου υπάρχουν: α. Στον πυρήνα και στο κυτταρόπλασμα του κυττάρου. β. Στον πυρήνα, στο κυτταρόπλασμα καθώς και στα μιτοχόνδρια. γ. Στον πυρήνα, στο κυτταρόπλασμα, στα μιτοχόνδρια και στους χλωροπλάστες. δ. Μόνο στα μέρη του κυττάρου όπου υπάρχουν ριβοσώματα.

Μονάδες 5

Α2. Σε ένα μόριο βακτηριακού mRNA υπάρχουν 20 κωδικόνια και τα νουκλεοτίδια των δύο αμετάφραστων περιοχών του είναι 24. Το μήκος του μορίου αυτού είναι: α. 44 ζεύγη βάσεων. β. 84 ζεύγη βάσεων. γ. 84 βάσεις. δ. Το μήκος του δεν μπορεί να υπολογισθεί, αφού δεν γνωρίζουμε τον αριθμό των νουκλεοτιδίων του υποκινητή. Μονάδες 5 Α3. Στο σύμπλοκο έναρξης της μετάφρασης συμμετέχουν τα παρακάτω είδη RNA: α. Μόνο mRNA. β. Μόρια mRNA και tRNA. γ. mRNA + RNA και rRNA. δ. mRNA και snRNA. Μονάδες 5 Α4. To ένζυμο DNA δεσμάση μέσα στο ευκαρυωτικό κύτταρο λειτουργεί: α. Μόνο στον πυρήνα, όπου γίνεται η αντιγραφή του DNA. β. Στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. γ. Στο κυτταρόπλασμα του κυττάρου. δ. ισχύουν όλα τα παραπάνω.

Μονάδες 5

103

kefalaio 2_Layout 1 19/11/2012 5:49 μμ Page 104

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Ένα φυσιολογικό μόριο mRNA έχει τρία κωδικόνια έναρξης και 3 κωδικόνια λήξης. Το μόριο αυτό δημιουργήθηκε: α. Σε ευκαρυωτικό κύτταρο. β. Σε αδενοϊό. γ. Σε βακτηριακό κύτταρο μετά από ενεργοποίηση οπερονίου με τρία δομικά γονίδια. δ. Σε ανθρώπινο κύτταρο. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Τι είναι το πολύσωμα και ποια η σημασία της δημιουργίας του;

Μονάδες 5

Β2. να αναφέρετε ονομαστικά τα ένζυμα που συμμετέχουν στις χημικές αντιδράσεις της αντιγραφής του DNA, με τη σειρά που παίρνουν μέρος. Μονάδες 5

Β3. Σε βακτηριακό κύτταρο δεν υπάρχει στο θρεπτικό του υλικό στο οποίο αναπτύσσεται ο δισακχαρίτης λακτόζη. να περιγράψετε πώς επιτυγχάνεται στην περίπτωση αυτή η καταστολή του οπερονίου της λακτόζης. Μονάδες 5 Β4. Δίνεται το παρακάτω μόριο mRNA που κωδικοποιεί ένα μικρό πεπτίδιο και βρίσκεται μέσα σε μιτοχόνδριο ευκαρυωτικού κυττάρου: 3΄ GCAGCAGUGUGAGAGCGUUUGUAAGCGA 5΄ α. Πώς ονομάζεται η αλυσίδα του γονιδίου που χρησιμοποιήθηκε ως καλούπι για τη σύνθεση του παραπάνω mRNA; Ποια είναι η αλληλουχία αυτής και ποια τα 3΄ και 5΄ άκρα της; να αιτιολογήσετε την απάντησή σας. β. Ποια είναι η αλλουχία των αντικωδικονίων των δύο πρώτων μορίων tRNA που θα χρησιμοποιηθούν για τη μετάφραση αυτού; Μονάδες 10

104

kefalaio 2_Layout 1 19/11/2012 5:49 μμ Page 105

ΚΕφΑΛΑιΟ 2Ο:

ΑνΤιΓρΑφΗ,

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΤιΚΗΣ ΠΛ Η

ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕ

ρΟφΟρ ιΑ

Σ

τριωρο διαΓωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Η DNA ελικάση: α. Αποτελείται από νουκλεοτίδια. β. Δρα κατά τη μεταγραφή. γ. Συμβάλλει στην πιστότητα της μεταγραφής. δ. Δρα στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες των ευκαρυωτικών κυττάρων καθώς και στο κυτταρόπλασμα των προκαρυωτικών κυττάρων. Μονάδες 5

Α2. Τα μόρια με τα οποία μεταφέρονται οι γενετικές πληροφορίες από κύτταρο σε κύτταρο σε έναν οργανισμό είναι: α. Πρωτεΐνες. β. DNA. γ. RNA. δ. Πολυσακχαρίτες. Μονάδες 5 Α3. Στα προκαρυωτικά κύτταρα έχουν εντοπιστεί τα παρακάτω είδη RNA: α. mRNA, snRNA, tRNA. β. mRNA, rRNA, snRNA. γ. rRNA, mRNA, tRNA. δ. snRNA, rRNA, tRNA.

Μονάδες 5

Α4. Kατά την πρωτεϊνοσύνθεση, το ριβόσωμα μετακινείται από: α. Το 5΄ προς το 3΄ άκρο του mRNA. β. Το 3΄ προς το 5΄ άκρο mRNA. γ. Το κωδικόνιο UAG προς το κωδικόνιο AUG του mRNA. δ. Το κωδικόνιο UGA προς το κωδικόνιο AUG του mRNA.

Μονάδες 5

105

kefalaio 2_Layout 1 19/11/2012 5:49 μμ Page 106

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Για να γίνει η μεταγραφή των δομικών γονιδίων στο οπερόνιο της λακτόζης, πρέπει να: α. Συνδεθεί ο επαγωγέας με την πρωτεΐνη-καταστολέα. β. υπάρχει γαλακτόζη στο κύτταρο. γ. Εισέλθει η γλυκόζη στο κύτταρο της E. coli. δ. Συνδεθεί με τον καταστολέα το μόριο της γλυκόζης. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Τι είναι το πριμόσωμα και ποιος ο ρόλος του;

Μονάδες 5

Β2. Σε ποιες κατηγορίες, ανάλογα με το μεταγραφικό τους προϊόν, διακρίνονται τα γονίδια; Μονάδες 10 Β3. να περιγράψετε τον τρόπο με τον οποίο δημιουργείται το σύμπλοκο έναρξης της πρωτεϊνοσύνθεσης. Ποια είδη RNA συμμετέχουν στη δημιουργία του; Μονάδες 6 Β4. να γράψετε δύο διαφορές στον έλεγχο της γονιδιακής έκφρασης ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς. Μονάδες 4 ΘΕΜΑ Γ

Γ1. Στο γονιδίωμα των προκαρυωτικών οργανισμών τα γονίδια των ενζύμων που παίρνουν μέρος σε μια μεταβολική οδό, όπως η δ��άσπαση της λακτόζης ή η βιοσύνθεση διαφόρων αμινοξέων, οργανώνονται σε οπερόνια. α. Τι είναι τα οπερόνια; Ποιες αλληλουχίες DNA περιέχονται στο οπερόνιο της λακτόζης; Μονάδες 5 β. Στο στέλεχος του βακτηρίου Ε. coli δεν λειτουργεί το γονίδιο που παράγει τον καταστολέα του οπερονίου της λακτόζης. Ποιο είναι το αποτέλεσμα σε σχέση με την παραγωγή ενζύμων που μεταβολίζουν τη λακτόζη, όταν το βακτήριο αναπτύσσεται: • παρουσία λακτόζης, • απουσία λακτόζης; Μονάδες 6

106

kefalaio 2_Layout 1 19/11/2012 5:49 μμ Page 107

ΚΕφΑΛΑιΟ 2Ο:

ΑνΤιΓρΑφΗ,

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΤιΚΗΣ ΠΛ Η

ΕΚφρΑΣΗ ΚΑι ρυΘΜιΣΗ ΤΗΣ ΓΕνΕ

ρΟφΟρ ιΑ

Σ

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ2. Ο γενετικός κώδικας είναι ένας κώδικας αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών. α. Ο γενετικός κώδικας χαρακτηρίζεται εκτός των άλλων: α. συνεχής, β. μη επικαλυπτόμενος και γ. εκφυλισμένος. να εξηγήσετε τα χαρακτηριστικά αυτά του γενετικού κώδικα. Μονάδες 4 β. Πού οφείλεται το γεγονός ότι η ανθρώπινη ινσουλίνη (πρωτεΐνη) μπορεί να παραχθεί in vitro και από βακτηριακά κύτταρα; Μονάδες 10

Μια λειτουργική πρωτεΐνη αποτελείται από 185 αμινοξέα. Η πολυπεπτιδική αλυσίδα από την οποία προέκυψε είχε επιπλέον 15 αμινοξέα στο αμινικό της άκρο. Εάν στις 5΄ και 3΄ αμετάφραστες περιοχές του mRNA από το οποίο προέκυψε περιέχονται 17 βάσεις, να βρείτε: Δ1. Το μήκος του ασυνεχούς γονιδίου που κωδικοποιεί την παραπάνω πρωτεΐνη.

Δ2. Πόσοι φωσφοδιεστερικοί δεσμοί σπάνε και πόσοι σχηματίζονται κατά την ωρίμανση του προδρόμου mRNA. Γνωρίζουμε ότι το γονίδιο είναι ασυνεχές, αφού περιέχει 3 εσώνια με 150 ζεύγη βάσεων συνολικά. Μονάδες 25

107

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

kefalaio 2_Layout 1 19/11/2012 6:52 μμ Page 108

kefalaio 4_Layout 1 19/11/2012 5:51 μμ Page 109

4 ο ι α λ ά φ ε Κ Τ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

υ ανασυνδυασμενου DN ο Τ α ι A ογ λ ο εχν

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 134

ική Κατεύθυνση υ Λυκείου / Θετ ο ί Θεμα δ α ι ν Ε ΄ Γ ΄ - πανε Βιολογία

προΤεινομενα προΒλημαΤα για λυση

λλαδιΚ

ων

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Με τη δράση της EcoRI, ένα μόριο DNA από τον πυρήνα ενός ευκαρυωτικού κυττάρου κόπηκε σε 5 κομμάτια. α. σε πόσα σημεία κόπηκε το μόριο; β. Πόσων δεσμών τη διάσπαση προκάλεσε η EcoRI; γ. Πόσα κατάλληλα πλασμίδια χρειάζονται (ο ελάχιστος αριθμός) για την κατασκευή βιβλιοθήκης του συγκεκριμένου μορίου DNA; δ. Πόσων δεσμών τη διάσπαση θα προκαλέσει η EcoRI στα πλασμίδια αυτά;

2. Έστω ότι ένα μόριο DNA έχει την αλληλουχία που αναγνωρίζεται από την EcoRI 15 φορές. α. Με τη χρήση της EcoRI, πόσα κομμάτια θα προκύψουν; β. Πόσοι χημικοί δεσμοί θα σπάσουν; 3. Ένα τμήμα DNA που έχει κοπεί με τη δράση της EcoRI διαθέτει δύο μονόκλωνα άκρα. σε αυτό το τμήμα υπάρχουν 1.428 συνολικά νουκλεοτίδια, τα 420 από τα οποία έχουν G και C. να υπολογίσετε το σύνολο των χημικών δεσμών που υπάρχουν στο τμήμα αυτό.

4. δίνεται δίκλωνο μόριο DNA με 1.000 ζεύγη βάσεων, 200 από τις οποίες είναι αδενίνες. Με την EcoRI κόβεται σε 20 κομμάτια. να βρείτε: α. Τους φωσφοδιεστερικούς δεσμούς και τους δεσμούς υδρογόνου στο δίκλωνο μόριο DNA. β. Πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου παρέμειναν στα 20 κομμάτια που προέκυψαν. 5. Η περιοριστική ενδονουκλεάση Κ αναγνωρίζει την αλληλουχία: 5΄ - CCGG- 3΄ 3΄ - GGCC-5΄ και κόβει κάθε αλυσίδα μεταξύ των C και C, ενώ η περιοριστική ενδονουκλεάση Λ αναγνωρίζει την αλληλουχία: 5΄ -TCGA- 3΄ 3΄ - AGCT- 5΄, την οποία κόβει μεταξύ των βάσεων Τ και C.

134

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 135

ΠΡΟΒ

ΚΕΦΑΛΑιΟ 4ο: ΤΕχνΟΛΟΓιΑ ΤΟΥ ΑνΑσ

ΛΗΜ ΑΤΑ ΓΙΑ ΥνδΥΑσΜ ΛΥΣ ΕνΟΥ D Η

NA

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

δίνεται η αλληλουχία: 5΄- ATTCGAGCCGGTTGATTAACTGACCGGATATCGCGTCGACCGG- 3΄ 3΄ - TAAGCTCGGCCAACTAATTGACTGGCCTATAGCGCAGCTGGCC- 5΄ Έστω ότι θέλουμε να κλωνοποιηθεί το ενδιάμεσο τμήμα που ξεχωρίζει. α. Ποια περιοριστική ενδονουκλεάση είναι κατάλληλη και γιατί; β. σε πόσα και ποια τμήματα θα κοπεί το συγκεκριμένο DNA με την ενδονουκλέαση αυτή; Σημείωση: δίνεται ότι η κατεύθυνση δράσης και των δύο ενδονουκλεασών είναι 5΄  3΄.

6. Κατά τη διαδικασία κατασκευής cDNA βιβλιοθήκης ένα μόριο ώριμου mRNA έχει 2.000 νουκλεοτίδια και χρησιμοποιείται ως καλούπι για σύνθεση υβριδίου mRNA-cDNA. στο υβριδικό μόριο που δημιουργήθηκε τα 800 νουκλεοτίδια περιέχουν την αζωτούχα βάση G και τα 200 την αζωτούχα βάση Τ. να απαντήσετε στις παρακάτω ερωτήσεις: α. Ποιες αλληλουχίες βάσεων (ονομαστική αναφορά) υπάρχουν στο mRNA που χρησιμοποιείται ως καλούπι για τη σύνθεση του cDNA; β. Πόσοι φωσφοδιεστερικοί δεσμοί υπάρχουν στο υβριδικό μόριο mRNA-cDNA; γ. Ποιο ένζυμο δημιούργησε το μονόκλωνο cDNA; δ. Πόσα νουκλεοτίδια περιέχουν την αζωτούχα βάση U και πόσα την Α στο υβριδικό μόριο mRNA-cDNA; 7. δίνονται τα παρακάτω μόρια DNA: το Α που είναι γραμμικό και το Β που είναι κυκλικό.

μόριο Α

μόριο Β

στο μόριο Α υπάρχει 3 φορές η αλληλουχία που αναγνωρίζει η EcoRI και στο μόριο Β υπάρχει 2 φορές. (Oι παραπάνω αλληλουχίες έχουν την κατεύθυνση δράσης της EcoRI). Τα παραπάνω μόρια περιέχονται σε δοκιμαστικό σωλήνα στον οποίο υπάρχει και το ένζυμο EcoRI. α. Πόσα θραύσματα – τμήματα προκύπτουν από τη δράση αυτής; β. Πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου θα διασπαστούν σε κάθε μόριο από τη δράση του ενζύμου; 8. Έστω ότι η αλληλουχία τμήματος DNA που αντιστοιχεί σε εσώνιο κάποιου γονιδίου είναι: 3΄AGGCTATG 5΄ 5΄TCCGATAC 3΄

135

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 136

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Η αλληλουχία αυτή περιέχεται σε έναν βακτηριακό κλώνο βιβλιοθήκης που δημιουργήθηκε σε ευκαρυωτικό οργανισμό. α. σε τι είδους βιβλιοθήκη περιέχεται ο παραπάνω βακτηριακός κλώνος; να αιτιολογήσετε την απάντησή σας. β. Ποια ένζυμα (ονομαστική αναφορά) χρησιμοποιήθηκαν για τη δημιουργία της βιβλιοθήκης αυτής; γ. Εάν μοριακός βιολόγος στοχεύει στον εντοπισμό του βακτηριακού κλώνου, να περιγράψετε τη διαδικασία που θα ακολουθήσει. δ. Έστω ότι για τον εντοπισμό του κλώνου χρησιμοποιήθηκε ανιχνευτής RNA (συμπληρωματικός προς το σύνολο της παραπάνω αλληλουχίας). να γράψετε την αλληλουχία αυτού καθώς και τα άκρα του. 9. Έστω ότι το πρόδρομο mRNA για τη σύνθεση μιας πρωτεΐνης της κότας περιέχει 5 εσώνια (Α-Ε), όπως φαίνεται στο παρακάτω σχήμα (οι λευκές περιοχές αντιστοιχούν στα εξώνια).

Α

Β

Γ

δ

Ε

Εάν απομονωθεί το γονίδιο που ευθύνεται για τη σύνθεση της πρωτεΐνης αυτής και αποδιαταχθεί και στη συνέχεια υβριδοποιηθεί με το πρόδρομο mRNA που παράγει την πρωτεΐνη, να εξηγήσετε: α. Ποια αλυσίδα του DNA (κωδική ή μη κωδική) θα μετέχει στην υβριδοποίηση. να αιτιολογήσετε την απάντησή σας. β. Το πρόδρομο mRNA σε ποιο μέρος του κυττάρου της κότας έχει μετατραπεί σε ώριμο και πώς. Πόσοι φωσφοδιεστερικοί δεσμοί έχουν διασπασθεί και πόσοι έχουν δημιουργηθεί κατά την ωρίμανση του mRNA. 10. δίνεται η αλληλουχία ενός κλώνου DNA που περιέχει την κωδική αλυσίδα ενός γονιδίου: 5΄...ATTCGAAGCTTCTGATGAATTCTTTGCCGTAAGAATTCGAATGC…3΄

Το παραπάνω γονίδιο στοχεύουμε, αφού αρχικά το κόψουμε, να το ενσωματώσουμε σε πλασμίδιο και το ανασυνδυασμένο πλασμίδιο να το μεταφέρουμε σε βακτήριο, ώστε να δημιουργηθεί βακτηριακός κλώνος βιβλιοθήκης που θα περιέχει το συγκεκριμένο γονίδιο. α. Με δεδομένο ότι έχετε στη διάθεσή σας δύο περιοριστικές ενδονουκλεάσες, την EcoRI και την Hind, ποια από τις δύο θα χρησιμοποιήσουμε προκειμένου να κόψουμε το παραπάνω γονίδιο (έστω το παραπάνω είδος της Hind αναγνωρίζει την αλληλουχία: 3΄AAGCTT 5΄ 5΄TTCGAA 3΄ και κόβει μεταξύ Α και Α, με κατεύθυνση 3 ΄ 5΄).

136

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 137

ΠΡΟΒ

ΚΕΦΑΛΑιΟ 4ο: ΤΕχνΟΛΟΓιΑ ΤΟΥ ΑνΑσ

ΛΗΜ ΑΤΑ ΓΙΑ ΥνδΥΑσΜ ΛΥΣ ΕνΟΥ D Η

NA

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

β. Πόσους φωσφοδιεστερικούς δεσμούς και πόσους δεσμούς Η θα διασπάσει η περιοριστική ενδονουκλεάση που θα χρησιμοποιήσουμε, ώστε να κοπεί το παραπάνω γονίδιο; γ. στο βακτήριο που θα εισαχθεί το γονίδιο θα μεταγραφεί. να γράψετε την αλληλουχία των κωδικονίων του παραγόμενου mRNA, αιτιολογώντας την απάντησή σας. να τοποθετήσετε τα άκρα αυτού. δ. Ποια είναι η αλληλουχία των αντικωδικονίων των μορίων tRNA που θα χρησιμοποιηθούν για τη μετάφραση του mRNA αυτού; ε. Προκειμένου να εντοπίσουμε το παραπάνω γονίδιο, στον βακτηριακό κλώνο στον οποίο αυτό περιέχεται, δημιουργήσαμε μόριο ανιχνευτή με αλληλουχία 3΄CUUAAGAAA5΄. Ποιον κλώνο θα υβριδοποιήσει ο ανιχνευτής αυτός και γιατί; Ποια διαδικασία πρέπει να προηγηθεί της υβριδοποίησης του συγκεκριμένου κλώνου; στ. στο πλασμίδιο που θα χρησιμοποιηθεί ως φορέας κλωνοποίησης, πόσες φορές θα περιέχεται η αλληλουχία που αναγνωρίζει η περιοριστική ενδονουκλεάση η οποία χρησιμοποιήθηκε και πόσους φωσφοδιεστερικούς δεσμούς και δεσμούς υδρογόνου θα διασπάσει η περιοριστική αυτή ενδονουκλεάση στο πλασμίδιο;

137

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 138

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

1ο ωριαιο διαγωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Γονίδια που ευθύνονται για τη σύνθεση περιοριστικών ενδονουκλεασών υπάρχουν στο γενετικό υλικό: α. Των βακτηρίων. β. Των ευκαρυωτικών κυττάρων. γ. Των ιών. δ. σε όλους τους παραπάνω οργανισμούς. Μονάδες 5

Α2. Για τη δημιουργία γονιδιωματικής βιβλιοθήκης τα ένζυμα που θα χρησιμοποιηθούν από τον γενετιστή είναι: α. RNA πολυμεράση και DNA δεσμάση. β. Αντίστροφη μεταγραφάση και DNA δεσμάση. γ. Κατάλληλη περιοριστική ενδονουκλεάση και DNA δεσμάση. δ. Πάντα το ένζυμο EcoRι και DNA δεσμάση. Μονάδες 5

Α3. σε μόριο ανιχνευτή υπάρχουν 4 αζωτούχες βάσεις ουρακίλες και 4 αζωτούχες βάσεις θυμίνες. Κατά τη διαδικασία της υβριδοποίησης με τον αντίστοιχο κλώνο του DNA του τμήματος που θέλουμε να εντοπίσουμε θα υπάρχουν στο υβριδικό μόριο: α. 4 αζωτούχες βάσεις Α και 4 αζωτούχες βάσεις Τ. β. 8 ζεύγη αζωτούχων βάσεων Α και Τ. γ. 8 ζεύγη αζωτούχων βάσεων Α και U. δ. 8 αζωτούχες βάσεις Αδενίνης. Μονάδες 5 Α4. Η αλυσιδωτή αντίδραση πολυμερισμού (PCR) στοχεύει: α. στην επιλεκτική αντιγραφή ειδικών αλληλουχιών RNA σε κάποιο κύτταρο. β. στον μετασχηματισμό κυττάρων. γ. στην παραγωγή μεγάλης ποσότητας ειδικών πρωτεϊνών in vitro. δ. στην επιλεκτική αντιγραφή ειδικών αλληλουχιών DNA in vitro. Μονάδες 5

138

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 139

ΚΕΦΑΛΑιΟ 4ο: ΤΕχνΟΛΟΓιΑ ΤΟΥ ΑνΑσ

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΥνδΥΑσΜ Ε νΟΥ

DNA

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Για τα τμήματα του DNA που έχουν προκύψει κατόπιν δράσης της ίδιας περιοριστικής ενδονουκλεάσης, όπως η EcoRI, ισχύει: α. Έχουν πάντα την ίδια αλληλουχία βάσεων EcoRI. β. Έχουν συμπληρωματικά μονόκλωνα άκρα. γ. Περιέχουν ίδιες γενετικές πληροφορίες. δ. ισχύουν όλα τα παραπάνω. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι ορίζουμε ως υβριδοποίηση και ποια η σημασία της στην τεχνολογία του ανασυνδυασμένου DNA; Μονάδες 5 Β2. Τι είναι οι περιοριστικές ενδονουκλεάσες; Ποια κύτταρα παράγουν περιοριστικές ενδονουκλεάσες και ποια η σημασία παραγωγής τους για τα ίδια τα κύτταρα; να δώσετε ένα παράδειγμα περιοριστικής ενδονουκλεάσης. Μονάδες 6 Β3. να περιγράψετε τα βήματα που απαιτούνται για την κατασκευή βακτηριακών κλώνων cDNA βιβλιοθήκης. Μονάδες 10

Β4. να αναφέρετε ονομαστικά τα ένζυμα που είναι απαραίτητα για την κατασκευή cDNA βιβλιοθήκης. Μονάδες 4

139

kefalaio 4_Layout 1 19/11/2012 5:52 μμ Page 140

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

2ο ωριαιο διαγωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Το ανασυνδυασμένο DNA είναι: α. Τεχνητό μόριο DNA. β. Μόριο DNA που περιέχει γονίδια από διαφορετικούς οργανισμούς. γ. Μόριο DNA που έχει δημιουργηθεί in vitro. δ. Μόριο DNA με όλα τα παραπάνω χαρακτηριστικά.

Μονάδες 5

Α2. cDNA βιβλιοθήκη κατασκευάζεται, όταν θέλουμε να κλωνοποιήσουμε: α. Μόνο τα γονίδια που εκφράζονται σε κάποιον οργανισμό. β. Όλα τα γονίδια του οργανισμού. γ. Μόνο τα γονίδια που εκφράζονται σε συγκεκριμένο τύπο κυττάρων του οργανισμού. δ. Μόνο τα γονίδια που εκφράζονται σε συγκεκριμένο τύπο κυττάρων του οργανισμού και ευθύνονται για τη σύνθεση πρωτεϊνών. Μονάδες 5

Α3. Το DNA του βακτηριοφάγου λ ως φορέας κλωνοποίησης έχει το πλεονέκτημα σε σχέση με τα πλασμίδια ότι: α. Αντιγράφεται ανεξάρτητα μέσα στο κύτταρο του ξενιστή. β. Μπορεί να ενσωματώσει μεγαλύτερα κομμάτια ξένου DNA του οργανισμού-δότη. γ. Είναι πιο απλό στη δομή του. δ. ισχύουν όλα τα παραπάνω. Μονάδες 5

140

Α4. Το μόριο του cDNA σε σχέση με το μόριο του mRNA που χρησιμοποιήθηκε ως καλούπι για τη σύνθεση αυτού: α. Είναι συμπληρωματικό και αντιπαράλληλο. β. Έχουν την ίδια αλληλουχία αζωτούχων βάσεων. γ. Είναι συμπληρωματικό, αλλά όχι αντιπαράλληλο. δ. Είναι συμπληρωματικό και αντιπαράλληλο, δεδομένου ότι κατά τη σύνθεση του cDNA εφαρμόστηκε ο κανόνας της συμπληρωματικότητας από το ένζυμο DNA πολυμεράση. Μονάδες 5

kefalaio 4_Layout 1 19/11/2012 5:53 μμ Page 141

ΚΕΦΑΛΑιΟ 4ο: ΤΕχνΟΛΟΓιΑ ΤΟΥ ΑνΑσ

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΥνδΥΑσΜ Ε νΟΥ

DNA

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Ένας γενετιστής μελετά την αλληλουχία βάσεων ενός εσωνίου του γονιδίου Κ. Για τον σκοπό αυτό έχει κατασκευάσει: α. cDNA βιβλιοθήκη κυττάρων που εκφράζουν το συγκεκριμένο γονίδιο. β. Γονιδιωματική βιβλιοθήκη του οργανισμού, στο γονιδίωμα του οποίου περιέχεται το παραπάνω γονίδιο. γ. Είτε cDNA βιβλιοθήκη είτε γονιδιωματική. δ. ισχύουν όλα τα παραπάνω. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι είναι η μέθοδος PCR και ποιες οι εφαρμογές της μεθόδου αυτής;

Μονάδες 4

Β2. Κατά τη δημιουργία βιβλιοθηκών χρησιμοποιούνται συνήθως ως ξενιστές ξένου DNA βακτήρια. α. Τι είδους βακτήρια χρησιμοποιούμε συνήθως ως ξενιστές και γιατί; β. Πώς αντιμετωπίζεται το πρόβλημα ότι τα βακτήρια δέχονται σε πολύ μικρό ποσοστό ξένο DNA; Μονάδες 6

Β3. διαθέτετε ένα πλασμίδιο και θέλετε να το χρησιμοποιήσετε ως φορέα κλωνοποίησης. Η αλληλουχία βάσεων που αναγνωρίζει η EcoRI εντοπίζεται σε μία μόνο θέση του πλασμιδίου, στη θέση έναρξης της αντιγραφής αυτού. να εξηγήσετε εάν το παραπάνω πλασμίδιο είναι κατάλληλο να χρησιμοποιηθεί ως φορέας κλωνοποίησης με χρήση της περιοριστικής ενδουνουκλεάσης EcoRI. Μονάδες 5

Β4. Η περιοριστική ενδονουκλεάση Hind III αναγνωρίζει την αλληλουχία: 5΄AAGCTT3΄ 3΄ΤΤCGAA5΄ και δρα μεταξύ του Α και Α, ενώ η TagI αναγνωρίζει την αλληλουχία: 5΄TCGA3΄ 3΄AGCT5΄ και δρα μεταξύ του Τ και C. Ένα πλασμίδιο διαθέτει από μία φορά μόνο την καθεμία από τις παραπάνω αλληλουχίες. Εάν το πλασμίδιο βρεθεί σε δοκιμαστικό σωλήνα που υπάρχουν και οι δύο περιοριστικές ενδονουκλεάσες, πόσα κομμάτια DNA θα προκύψουν από τη δράση αυτών και πόσοι φωσφοδιεστερικοί δεσμοί και δεσμοί υδρογόνου θα σπάσουν οι παραπάνω περιοριστικές ενδονουκλεάσες; Μονάδες 10

141

kefalaio 4_Layout 1 19/11/2012 5:53 μμ Page 142

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

Τριωρο διαγωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Το γονίδιο για τη σύνθεση της ινσουλίνης εκφράζεται στα ειδικά κύτταρα του παγκρέατος. Ο υποκινητής του γονιδίου αυτού μπορεί να περιέχεται: α. στη cDNA βιβλιοθήκη των ειδικών κυττάρων του παγκρέατος. β. Μόνο στη γονιδιωματική βιβλιοθήκη του ανθρώπου. γ. Τόσο στη γονιδιωματική όσο και σε cDNA βιβλιοθήκη. δ. σε καμία από τις δύο βιβλιοθήκες, αφού ο υποκινητής δεν μεταγράφεται. Moνάδες 5 Α2. Το ένζυμο DNA δεσμάση είναι απαραίτητο για την κατασκευή: α. Μόνο της γονιδιωματικής βιβλιοθήκης. β. Μόνο της cDNA βιβλιοθήκης. γ. Και για τα δύο είδη βιβλιοθηκών. δ. Και για το α και για το β, όσο και για τη μέθοδο RCR.

Moνάδες 5

Α3. H αποδιάταξη των δύο αλυσίδων του DNA γίνεται: α. Με τη χρήση κατάλληλων χημικών ουσιών. β. Με αύξηση της θερμοκρασίας. γ. Με τη βοήθεια του ενζύμου DNA πολυμεράση. δ. ισχύει το α και β.

Moνάδες 5

Α4. Το ένζυμο αντίστροφη μεταγραφάση είναι απαραίτητο: α. Κατά την κατασκευή γονιδιωματικής βιβλιοθήκης. β. Κατά την κατασκευή cDNA βιβλιοθήκης, προκειμένου να συντεθεί cDNA με καλούπι μόριο mRNA. γ. Κατά την εφαρμογή της μεθόδου PCR. δ. σε όλες τις παραπάνω περιπτώσεις. Moνάδες 5

142

kefalaio 4_Layout 1 19/11/2012 5:53 μμ Page 143

ΚΕΦΑΛΑιΟ 4ο: ΤΕχνΟΛΟΓιΑ ΤΟΥ ΑνΑσ

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ΥνδΥΑσΜ Ε νΟΥ

DNA

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. σε ανασυνδυασμένο πλασμίδιο που έχει δημιουργηθεί με τη δράση της EcoRI η αλληλουχία που αναγνωρίζεται από το ένζυμο αυτό υπάρχει: α. Μόνο μία φορά. β. δύο φορές. γ. Πολλές φορές. δ. ισχύουν όλα τα παραπάνω. Moνάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι ορίζουμε ως υβριδοποίηση και τι ως αποδιάταξη; Πώς χρησιμοποιούνται οι παραπάνω διαδικασίες, προκειμένου να εντοπίσουμε μια αλληλουχία DNA στους βακτηριακούς κλώνους μιας γονιδιωματικής βιβλιοθήκης; Μονάδες 6

Β2. σε πείραμα Γενετικής Μηχανικής χρησιμοποιείται πλασμίδιο το οποίο έχει δύο γονίδια ανθεκτικότητας σε αντίστοιχα αντιβιοτικά. Το ένα γονίδιο προσδίδει ανθεκτικότητα σε αμπικιλίνη και το άλλο σε στρεπτομυκίνη. στο πλασμίδιο αυτό εισάγεται τμήμα DNA μέσα στο γονίδιο ανθεκτικότητας της αμπικιλίνης. στη συνέχεια, με το ανασυνδυασμένο πλασμίδιο μετασχηματίζονται κύτταρα Escherichia coli που δεν είναι ανθεκτικά σε κανένα από τα δύο αντιβιοτικά. να εξηγήσετε τον τρόπο με τον οποίο μπορούν να επιλεγούν τα βακτήρια που περιέχουν το ανασυνδυασμένο πλασμίδιο. Μονάδες 8 Β3. σε ποιες θέσεις αναγνωρίζει και πού κόβει το DNA των πλασμίδιων και το DNA ευκαρυωτικών κυττάρων η περιοριστική ενδονουκλεάση EcoRI; Πώς, στη συνέχεια, δημιουργούνται τα ανασυνδυασμένα πλασμίδια; Μονάδες 6 Β4. Θα μπορούσε να αναπτυχθεί η τεχνολογία του ανασυνδυασμένου DNA, αν ο γενετικός κώδικας δεν ήταν καθολικός; να αιτιολογήσετε την απάντησή σας. Μονάδες 5 ΘΕΜΑ Γ Γ1. να αναφέρετε ονομαστικά ποιες κατηγορίες γονιδίων δεν υπάρχουν στη cDNA βιβλιοθήκη των κυττάρων του παγκρέατος. Μονάδες 6

143

kefalaio 4_Layout 1 19/11/2012 5:53 μμ Page 144

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία Γ2. Πότε ως φορέα κλωνοποίησης χρησιμοποιούμε πλασμίδια και πότε βακτηριοφάγους λ; Μονάδες 4

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ3. Αφού σκεφτείτε τα βήματα που πραγματοποιούνται για την κατασκευή cDNA βιβλιοθήκης κυττάρων παγκρέατος, να απαντήσετε στις παρακάτω ερωτήσεις: α. Πώς ονομάζονται τα ένζυμα που συμμετέχουν στη μετατροπή των ώριμων mRNA σε υβριδικά μόρια mRNA-cDNA και των cDNA αλυσίδων σε δίκλωνα μόρια DNA; β. Ποια είναι η διαδικασία μετατροπής των υβριδικών μορίων mRNA-cDNA σε cDNA; Πώς πραγματοποιείται; γ. να αναφέρετε ονομαστικά τις αλληλουχίες των βάσεων που υπάρχουν στο δίκλωνο DNA το οποίο ενσωματώνεται στο πλασμίδιο. δ. Από ποιο μέρος του κυττάρου του παγκρέατος (πυρήνας ή κυτταρόπλασμα) έχει απομονωθεί το μόριο του mRNA για τη σύνθεση της προϊνσουλίνης και γιατί; Μονάδες 15

Δ1. δίνεται η παρακάτω αλυσίδα τμήματος DNA ευκαρυωτικού οργανισμού, στο οποίο τμήμα περιέχεται μικρό γονίδιο χωρίς εσώνια: 5΄...ATGACCGGAATTCTATΑΑ…3΄

Εάν θέλαμε από το DNA του οργανισμού αυτού να κόψουμε το παραπάνω γονίδιο και να το ενσωματώσουμε σε πλασμίδιο, θα μπορούσαμε να χρησιμοποιήσουμε την περιοριστική ενδονουκλεάση EcoRI; να εξηγήσετε την απάντησή σας. Μονάδες 10 Δ2. Έστω ένας ερευνητής βιολόγος δημιούργησε cDNA βιβλιοθήκη κυττάρων ήπατος και cDNA βιβλιοθήκη κυττάρων παγκρέατος. διαπίστωσε ότι στους βακτηριακούς κλώνους των δύο βιβλιοθηκών υπάρχουν ορισμένοι που περιέχουν τα ίδια γονίδια. α. Πώς θα μπορούσε να ερμηνευθεί το παραπάνω γεγονός; β. να ονομάσετε τα κοινά γονίδια των βακτηριακών κλώνων των δύο cDNA βιβλιοθηκών. Μονάδες 15

144

kefalaio 5_Layout 1 19/11/2012 5:55 μμ Page 145

5 ο ι α λ ά φ ε κ Μ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ηρονοΜικοτητα λ κ η λικ ε δ εν

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 225

ΚΕΦΑΛΑΙΟ 5ο: ΜΕνΔΕΛΙΚ η ΚΛ

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ηρΟν ΟΜΙΚΟ ΤηΤΑ

1ο ωριαιο διαγωνιςΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Για τα αλληλόμορφα γονίδια ΙΑ και i που καθορίζουν την ομάδα αίματος ενός ατόμου ισχύει: α. Είναι συνεπικρατή γονίδια. β. Υπάρχουν και τα δύο αλληλόμορφα φυσιολογικά στον γαμέτη κάθε ατόμου. γ. Είναι φυλοσύνδετα γονίδια. δ. Είναι γονίδια με σχέση επικρατές-υπολειπόμενο. Μονάδες 5

Α2. Το αγόρι ενός ζευγαριού εμφανίζει μερική αχρωματοψία στο κόκκινο-πράσινο χρώμα. Το γονίδιο για τη διαταραχή της όρασής του το κληρονόμησε: α. Μόνο από τον πατέρα του. β. Μόνο από τη μητέρα του. γ. Είτε από τη μητέρα του είτε από τον πατέρα του. δ. Και από τους δύο γονείς, δεδομένου ότι η διαταραχή της όρασης ελέγχεται από υπολειπόμενο γονίδιο το οποίο θα πρέπει να βρεθεί σε ομοζυγία. Μονάδες 5

Α3. Μονογονιδιακοί χαρακτήρες ονομάζονται εκείνοι οι χαρακτήρες οι οποίοι: α. Ελέγχονται από τα αλληλόμορφα ενός μόνο γονιδίου. β. Ελέγχονται από ένα και μόνο αλληλόμορφο γονίδιο. γ. Σχετίζονται μόνο με πολλαπλά αλληλόμορφα γονίδια. δ. Ελέγχονται από αλληλόμορφα που έχουν σχέση επικρατές-υπολειπόμενο. Μονάδες 5

Α4. Ποια από τις παρακάτω διασταυρώσεις δεν μπορεί να αφορά διασταύρωση αυτογονιμοποιούμενων ατόμων: α. ΚΚ(x)κκ. β. Kκ(x)Kκ. γ. κκ(x)κκ. δ. KK(x)KK. Μονάδες 5

225

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 226

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. η οικογενής υπερχοληστερολαιμία εμφανίζεται με συχνότητα 1:500 άτομα. η ασθένεια αυτή οφείλεται σε: α. Αυτοσωμικό επικρατές γονίδιο. β. Αυτοσωμικό υπολειπόμενο γονίδιο. γ. Φυλοσύνδετο υπολειπόμενο γονίδιο. δ. Σε μιτοχονδριακό γονίδιο. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι ορίζουμε ως ατελώς επικρατή γονίδια; να δείξετε με κατάλληλη διασταύρωση ποια είναι η φαινοτυπική και η γονοτυπική αναλογία των απογόνων στην F2 γενιά, στην περίπτωση των ατελώς επικρατών γονιδίων, όταν τα άτομα της αρχικής πατρικής γενιάς είναι αμιγή στελέχη. Μονάδες 5 Β2. να διατυπώσετε τον νόμο της ανεξάρτητης μεταβίβασης των γονιδίων. να αναφέρετε μία περίπτωση όπου ο νόμος αυτός δεν ισχύει. Με ποιον τύπο κυτταρικής διαίρεσης σχετίζεται και πώς ο νόμος αυτός; Μονάδες 5

Β3. Πόσοι και ποιοι είναι οι γονότυποι και οι φαινότυποι που σχετίζονται με τις ομάδες αίματος του ανθρώπου; να αναφέρετε τον λόγο για τον οποίο στην περίπτωση της κληρονομικότητας των ομάδων αίματος του ανθρώπου δεν προκύπτουν οι φαινοτυπικές αναλογίες που αναμένονται από τους νόμους του Mendel. Μονάδες 5 Β4. Φυσιολογικός άνδρας με προσκολλημένους λοβούς αυτιών παντρεύεται φυσιολογική γυναίκα με ελεύθερους λοβούς αυτιών και αποκτούν ένα αγόρι με μερική αχρωματοψία στο κόκκινο και πράσινο χρώμα και προσκολλημένους λοβούς αυτιών. Ποιοι είναι οι γονότυποι του άνδρα, της γυναίκας και του παιδιού; Ποια είναι η πιθανότητα το ζευγάρι αυτό να αποκτήσει ένα κορίτσι που να έχει αχρωματοψία και προσκολλημένους λοβούς αυτιών; Μονάδες 10

226

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 227

ΚΕΦΑΛΑΙΟ 5ο: ΜΕνΔΕΛΙΚ η ΚΛ

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ηρΟν ΟΜΙΚΟ ΤηΤΑ

2ο ωριαιο διαγωνιςΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Ένα γνώρισμα του ανθρώπου ελέγχεται από πολλαπλά αλληλόμορφα γονιδια. Το άτομο αυτό σε κύτταρο γαμέτη του περιέχει φυσιολογικά: α. Ένα μόνο από τα πολλαπλά αλληλόμορφα γονίδια. β. Δύο ή και περισσότερα από τα πολλαπλά αλληλόμορφα. γ. Κανένα από τα πολλαπλά αλληλόμορφα γονίδια, λόγω του νόμου της ανεξάρτητης μεταβίβασης. δ. Δεν ισχύει τίποτα από τα παραπάνω. Μονάδες 5

Α2. Δύο γονείς είναι φορείς της κυστικής ίνωσης και σκέφτονται να αποκτήσουν ένα παιδί. Ποια η πιθανότητα το παιδί τους να είναι αγόρι το οποίο θα εμφανίζει την ασθένεια της κυστικής ίνωσης: α. 50%. β. 25%. γ. 12,5%. δ. 100%. Μονάδες 5 Α3. Ένα μοσχομπίζελο που είναι ετερόζυγο για τον χαρακτήρα «ύψος» μπορεί να παραγάγει φυσιολογικά: α. Δύο ειδών γαμέτες σε ίση αναλογία. β. Ένα και μόνο είδος γαμέτη. γ. Με βάση τον δεύτερο νόμο του Mendel, 4 ειδών γαμέτες. δ. Ισχύει το α και το γ. Μονάδες 5

Α4. Εάν ένας άνδρας με αιμορροφιλία Α παντρευτεί με γυναίκα που δεν εμφανίζει την ασθένεια αυτή, τότε: α. Όλα τα αγόρια του ζευγαριού θα κληρονομούν από τον πατέρα τους το παθολογικό γονίδιο και θα εμφανίζουν, συνεπώς, αιμορροφιλία Α.

227

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 228

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

β. Ανεξάρτητα από τον γονότυπο της μητέρας, τα κορίτσια θα κληρονομούν πάντα από τον πατέρα τους ένα παθολογικό γονίδιο υπεύθυνο για την αιμορροφιλία Α. Μονάδες 5 γ. Στους γαμέτες του άνδρα θα υπάρχει πάντα το αλληλόμορφο γονίδιο για την αιμορροφιλία. δ. Ισχύουν όλα τα παραπάνω. Μονάδες 5

Α5. Σε γενεαλογικό δένδρο απεικονίζεται η ασθένεια της υπερχοληστερολαιμίας. Ένα άτομο που δεν πάσχει από την ασθένεια έχει γονότυπο: α. Αα. β. αα. γ. ΑΑ. δ. ΑΑ ή Αα. Μονάδες 5

ΘΕΜΑ B

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι ορίζουμε ως γονότυπο και τι ως φαινότυπο ενός ατόμου; να αναφέρετε τέσσερις διαφορετικές περιπτώσεις όπου ο φαινότυπος που εκδηλώνει ένα άτομο φανερώνει και τον γονότυπο του ατόμου αυτού. Μονάδες 6

Β2. Έχοντας στη διάθεσή σας μόνο μοσχομπίζελα με κίτρινα σπέρματα, με ποιον τρόπο θα μπορούσατε να διαπιστώσετε τον γονότυπο του μοσχομπίζελου αυτού; Μονάδες 5

Β3. Πού οφείλεται η αιμορροφιλία Α; να εξηγήσετε γιατί η αιμορροφιλία Α εμφανίζεται με μεγαλύτερη συχνότητα στα αρσενικά άτομα, ενώ η κυστική ίνωση εμφανίζεται με την ίδια συχνότητα και στα αρσενικά και στα θηλυκά άτομα. Μονάδες 4 Β4. Το παρακάτω γενεαλογικό δένδρο αναπαριστά τον τρόπο κληρονομικότητας του γνωρίσματος «μορφή λοβών» στα αυτιά του ανθρώπου.

228

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 229

ΚΕΦΑΛΑΙΟ 5ο: ΜΕνΔΕΛΙΚ η ΚΛ

ΙI

ΙII

1

1

2

2

3

4

ΟΜΙΚΟ ΤηΤΑ

5

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Ι

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ηρΟν

1

2

Τα άτομα Ι1, ΙΙ2, 4 και ΙΙΙ1, 2 εμφανίζουν ελεύθερους λοβούς αυτιών. α. να γράψετε τον γονότυπο όλων των ατόμων, αιτιολογώντας με κατάλληλες διασταυρώσεις. β. Ποια η πιθανότητα το άτομο ΙΙΙ2 να αποκτήσει απόγονο που θα εμφανίζει προσκολλημένους λοβούς αυτιών; Μονάδες 10

229

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 230

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

τριωρο διαγωνιςΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Στα ομόλογα χρωμοσώματα, αλληλόμορφα λέγονται τα γονίδια που: α. Καλύπτουν την έκφραση άλλων γονιδίων. β. Βρίσκονται στην ίδια γενετική θέση και ελέγχουν την ίδια ιδιότητα. γ. Προκαλούν πρόωρο θάνατο. δ. Βρίσκονται στην ίδια θέση και ελέγχουν διαφορετική ιδιότητα.

Μονάδες 5

Α2. Πόσοι διαφορετικοί φαινότυποι θα μπορούσαν να προκύψουν από τη διασταύρωση δύο ατόμων που είναι ετερόζυγα ως προς δύο ζεύγη αυτοσωμικών γονιδίων με σχέση επικρατές-υπολειπόμενο: α. 9. β. 8. γ. 4. δ. 16. Μονάδες 5 Α3. Ο δεύτερος νόμος του Mendel δεν ισχύει για τα δύο ζεύγη γονιδίων που ελέγχουν: α. Την κυστική ίνωση και τη μερική αχρωματοψία. β. Τη μερική αχρωματοψία και την αιμορροφιλία Α. γ. Τη β-θαλασσαιμία και τη μερική αχρωματοψία. δ. Την αιμορροφιλία Α και την οικογενή υπερχοληστερολαιμία. Μονάδες 5

Α4. Τα φυλοσύνδετα γονίδια βρίσκονται στο: α. Χ χρωμόσωμα και δεν έχουν αλληλόμορφα στο Ψ χρωμόσωμα. β. Ψ χρωμόσωμα και δεν έχουν αλληλόμορφα στο Χ χρωμόσωμα. γ. Ψ χρωμόσωμα και είναι θνησιγόνα. δ. Ψ χρωμόσωμα και τα αλληλόμορφα τους βρίσκονται στο Χ χρωμόσωμα. Μονάδες 5

230

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 231

ΚΕΦΑΛΑΙΟ 5ο: ΜΕνΔΕΛΙΚ η ΚΛ

ΔΙΑΓ ΩΝΙ ΣΜΑ ΤΑ ηρΟν ΟΜΙΚΟ ΤηΤΑ

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Ένας άνδρας έχει μερική αχρωματοψία. Ο αδελφός του είναι υγιής, ενώ μια αδελφή του έπασχε από μερική αχρωματοψία. Ποιοι είναι οι γονότυποι των γονιών τους; α. ΧδΧδ (x) ΧδΨ. β. ΧΔΧΔ (x) ΧδΨ. γ. ΧΔΧδ (x) ΧδΨ. δ. ΧΔΧΔ (x) ΧΔΨ. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Σε ποιου τύπου διασταυρώσεις οι γονοτυπικές και οι φαινοτυπικές αναλογίες είναι ίδιες; Γιατί συμβαίνει αυτό; Μονάδες 6 Β2. Υπάρχει περίπτωση σε μια διασταύρωση διυβριδισμού η φαινοτυπική αναλογία των απογόνων στη�� F2 γενιά να είναι διαφορετική από την αναλογία 9:3:3:1; Μονάδες 8 Β3. Για ποιον λόγο τα άτομα που είναι ομόζυγα για κάποιο υπολειπόμενο θνησιγόνο γονίδιο δεν επιβιώνουν μέχρι τη γέννησή τους; Μονάδες 6 Β4. να εξηγήσετε για ποιον λόγο η μερική αχρωματοψία εμφανίζεται συχνότερα στους άνδρες παρά στις γυναίκες. Μονάδες 5 ΘΕΜΑ Γ

Γ1. να διατυπώσετε τον νόμο του διαχωρισμού των αλληλόμορφων γονιδίων του Mendel. Μονάδες 4 Γ2. να εξηγήσετε γιατί η μελέτη του τρόπου μεταβίβασης των κληρονομικών χαρακτηριστικών στον άνθρωπο εμφανίζει πολλές δυσκολίες. Μονάδες 6 Γ3. Το παρακάτω γενεαλογικό δένδρο αναπαριστά τον τρόπο με τον οποίο κληρονομείται η ανεπάρκεια του ανοσοποιητικού συστήματος σε μια οικογένεια.

231

kefalaio 5_Layout 1 19/11/2012 5:58 μμ Page 232

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία Ι

1

1

2

3

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΙI

2

Με βάση τα δεδομένα του γενεαλογικού δένδρου, να βρείτε αν η ανεπάρκεια του ανοσοποιητικού συστήματος: α. Οφείλεται σε αυτοσωμικό ή φυλοσύνδετο γονίδιο. β. Κληρονομείται ως επικρατής ή υπολειπόμενος χαρακτήρας. να αιτιολογήσετε τις απαντήσεις σας και να προσδιορίσετε τους γονότυπους των μελών της οικογένειας. Μονάδες 15 ΘΕΜΑ Δ

Στον άνθρωπο η έλλειψη μελανίνης (αλφισμός) οφείλεται σε ένα υπολειπόμενο και αυτοσωμικό γονίδιο α, ενώ ο κανονικός χρωματισμός στο επικρατές αλληλόμορφο γονίδιο Α. Από γονείς χωρίς αλφισμό και φυσιολογική όραση γεννήθηκε αγόρι με αλφισμό και μερική αχρωματοψία. α. να προσδιορίσετε τους γονότυπους όλων των ατόμων και να κάνετε τη διασταύρωση. β. Ποια πιθανότητα υπάρχει να αποκτήσει το αγόρι αυτό αδελφό με φυσιολογική όραση και κανονικό χρωματισμό δέρματος; Μονάδες 25

232

kefalaio 6_Layout 1 19/11/2012 6:01 μμ Page 233

ΛΕΞΕ ΙΣ-Κ ΛΕΙ ΔΙΑ

6 ο ι α λ ά φ ε Κ Μ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

εισ ξ α λ λ ετα

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 265

ΘεΜα δ

πρΟτεινΟΜενα πρΟΒληΜατα για λυση

ΔΙΑΓ ΩΝΙΣ ΜΑΤ ΚΕΦΑΛΑιΟ 6ο: Α Μ

΄ - πανε

ΕΤΑΛΛΑ ξΕιΣ

λλαδιΚ

ων

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Η αλληλουχία ...CAC - AAG - UAU - CAC - UAA - GCUCGC αποτελεί τμήμα του mRNA που κωδικοποιεί τα 4 τελευταία αμινοξέα της β-αλυσίδας της αιμοσφαιρίνης. α. Ποιες γονιδιακές μεταλλάξεις σε αυτό προκαλούν πρόωρη λήξη; β. Πόσο μικρότερη θα είναι η πολυπεπτιδική αλυσίδα; 2. Δίνονται οι παρακάτω αλληλουχίες αμινοξέων που αποτελούν τμήματα φυσιολογικής και μη λειτουργικής πρωτεΐνης που ευθύνεται για την κυστική ίνωση: α. φυσιολογική πρωτεΐνη: ...val - val - ser - ile - leu - ser - gly... β. μη λειτουργική πρωτεΐνη: ...val - val - ser - ile - ser - gly... Να προσδιορίσετε τον τύπο της μετάλλαξης που έδωσε τη μη λειτουργική πρωτεΐνη. Σε ποιες περιπτώσεις μια τέτοια μετάλλαξη δεν θα επηρέαζε τη λειτουργικότητα της παραγόμενης πρωτεΐνης; (Συμβουλευτείτε τον πίνακα με τον γενετικό κώδικα.)

3. Μια ανωμαλία του γονιδίου που ελέγχει τη σύνθεση του ενζύμου απαμινάση της αδενοσίνης (ADA) προκαλεί μια ασθένεια του ανοσοποιητικού συστήματος. Απομονώθηκε το mRNA του ενζύμου ADA από υγιές άτομο και από άτομο που ασθενεί. Τμήματα των παραπάνω mRNA είναι: Υγιές άτομο: AUG - GAA - UUU - UGG - GGG - CGC - ACG - UCG... Άρρωστο άτομο: AUG - GAA - UUU - UAG - GGG - CGC - ACG - UCG... Ποια είναι η αιτία της ασθένειας;

4. Η αλληλουχία αμινοξέων: Glu - Cys - Met - Phe - Trp - Asp... αποτελεί τμήμα μιας φυσιολογικής πρωτεΐνης. Να προσδιορίσετε τον τύπο της μετάλλαξης ο οποίος έχει ως αποτέλεσμα την αλλαγή της αλληλουχίας των αμινοξέων στην παρακάτω τροποποιημένη πρωτεΐνη: Glu - Met - Tyr - Val - Leu - Gly... (Συμβουλευτείτε τον πίνακα με τον γενετικό κώδικα.) Ποια είναι η αλληλουχία των αζωτούχων βάσεων τη κωδικής αλυσίδας του DNA, η οποία κωδικοποιεί τη συγκεκριμένη αλληλουχία των αμινοξέων της φυσιολογικής πρωτεΐνης; 5.

Να υποδείξετε έναν πιθανό μηχανισμό που μπορεί να εξηγήσει τη γέννηση από υγιείς γονείς παιδιού με σύνδρομο Klinefelter και αιμορροφιλία.

6. Γυναίκα με κανονική πήξη αίματος (φορέας) παντρεύεται άνδρα που πάσχει από αιμορροφιλία και αποκτούν παιδί με σύνδρομο Klinefelter και αιμορροφιλία. Δώστε δύο πιθανούς μηχανισμούς που μπορούν να εξηγήσουν τη γέννηση αυτού του παιδιού.

265

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 266

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία 7. Από δύο γονείς προέκυψε παιδί με σύνδρομο Klinefelter. Πώς μπορεί να εξηγηθεί το γεγονός;

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

8. Από ζευγάρι στο οποίο η γυναίκα έχει αιμορροφιλία γεννήθηκαν, από δίδυμη κύηση δύο διαφορετικών ζυγωτών, ένα παιδί με σύνδρομο Turner και αιμορροφιλία και δεύτερο παιδί με σύνδρομο Klinefelter και κανονική πήξη αίματος. α. Ποιοι είναι οι γονότυποι γονέων και παιδιών; β. Να υποδείξετε τον μηχανισμό που μπορεί να εξηγήσει τη γέννηση των διδύμων. Υποθέτουμε ότι τα θηλυκά άτομα με αιμορροφιλία επιζούν, κάτι που δεν συμβαίνει στην πραγματικότητα. 9. Να βρείτε τι παιδιά θα γεννηθούν από τον γάμο φυσιολογικού άνδρα με καστανά μαλλιά, του οποίου ο πατέρας έχει ξανθά, με μια γυναίκα που πάσχει από σύνδρομο Down και έχει καστανά μαλλιά, ενώ ο πατέρας της είχε ξανθά. Γνωρίζουμε ότι το γονίδιο για τα καστανά μαλλιά είναι επικρατές και βρίσκεται στο 21ο χρωμόσωμα. Να θεωρήσετε ότι η γυναίκα είναι γόνιμη και δημιουργεί φυσιολογικούς και μη φυσιολογικούς γαμέτες.

266

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 267

ΔΙΑΓ ΩΝΙΣ ΜΑΤ ΚΕΦΑΛΑιΟ 6ο: Α Μ ΕΤΑΛΛΑ ξΕιΣ

1Ο ωριαιΟ διαγωνισΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Στα άτομα με σύνδρομο Klinefelter ο καρυότυπός τους απεικονίζει: α. 47 χρωμοσώματα, από τα οποία δύο είναι φυλετικά. β. 47 χρωμοσώματα, από τα οποία τρία είναι φυλετικά, ένα Χ και δύο Y. γ. 47 χρωμοσώματα από τα οποία τρία είναι φυλετικά, δύο Χ και ένα Υ. δ. ισχύουν όλα τα παραπάνω.

Μονάδες 5

Α2. Το μόριο της αιμοσφαιρίνης Α έχει: α. 4 πεπτιδικές αλυσίδες όλες όμοιες και 4 ομάδες αίμης. β. 4 πεπτιδικές αλυσίδες ανά δύο όμοιες και δύο ομάδες αίμης. γ. 4 πεπτιδικές αλυσίδες ανά δύο όμοιες και 4 ομάδες αίμης. δ. Δεν ισχύει τίποτα από τα παραπάνω.

Μονάδες 5

Α3. Οι αυτόματες γονιδιακές μεταλλάξεις προέρχονται από: α. Τυχαία λάθη που μπορεί να γίνουν κατά την αντιγραφή του DNA. β. Επίδραση κοσμικής και υπεριώδους ακτινοβολίας. γ. Από τυχαία λάθη κατά τον διαχωρισμό των χρωμοσωμάτων. δ. Τα α και γ.

Μονάδες 5

Α4. Ένα ζευγάρι απέκτησε ένα κορίτσι που εμφανίζει χρωμοσωμική ανωμαλία η οποία μπορεί να είναι: α. Τρισωμία 13. β. Σύνδρομο Turner. γ. Σύνδρομο Down. δ. Όλα τα παραπάνω. Μονάδες 5

267

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 268

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Ένας ενήλικος εμφανίζει δρεπανοκυτταρική αναιμία. Στα ερυθροκύτταρα αυτού περιέχονται τα παρακάτω είδη αιμοσφαιρινών: α. Μόνο HbS. β. Κυρίως ΗbS και μικρή ποσότητα HbF. γ. Κυρίως ΗbS αλλά και μικρή ποσότητα HbF και HbA2. δ. ΗbS και HbA καθώς και μικρές ποσότητες HbF και HbA2. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Tι ονομάζουμε μονοσωμία και πώς σχετίζεται η δημιουργία μονοσωμικών ατόμων με τα γεγονότα της μείωσης; Να αιτιολογήσετε γιατί οι μονοσωμίες είναι σπάνιες στον άνθρωπο. Να ερμηνεύσετε την απόκτηση αρσενικού απογόνου με κανονική διάκριση του κόκκινου-πράσινου χρώματος από ένα ζευγάρι όπου η μητέρα εμφανίζει μερική αχρωματοψία στο κόκκινο-πράσινο και ο πατέρας είναι φυσιολογικός (δεν συνέβη γονιδιακή μετάλλαξη). Μονάδες 8 Β2. Με ποιους τρόπους είναι δυνατόν να γίνει η διάγνωση της δρεπανοκυτταρικής αναιμίας; Ποια από τις μεθόδους αυτές μπορεί να εφαρμοστεί σε έμβρυο; Μονάδες 4 Β3. Ποια είναι η δομή ενός μορίου αιμοσφαιρίνης και ποια τα είδη των αιμοσφαιρινών που μπορεί να περιέχονται στα ερυθροκύτταρα ενός φυσιολογικού ατόμου; Μονάδες 5

Β4. Πότε είναι απαραίτητη η διενέργεια προγεννητικού ελέγχου; Να περιγράψετε τις μεθόδους προγεννητικού ελέγχου καθώς και τη διαγνωστική αξία καθεμίας. Μονάδες 8

268

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 269

ΔΙΑΓ ΩΝΙΣ ΜΑΤ ΚΕΦΑΛΑιΟ 6ο: Α Μ ΕΤΑΛΛΑ ξΕιΣ

2Ο ωριαιΟ διαγωνισΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Ένα ζευγάρι απέκτησε ένα αγόρι που εμφανίζει χρωμοσωμική ανωμαλία. Η χρωμοσωμική αυτή ανωμαλία του αγοριού δεν μπορεί να είναι: α. Τρισωμία 13. β. Σύνδρομο Turner. γ. Τρισωμία 18. δ. Σύνδρομο Klinefelter. Μονάδες 5

Α2. Η διάγνωση του συνδρόμου «φωνή της γάτας» σε κάποιο έμβρυο προϋποθέτει: α. Εφαρμογή κάποιας βιοχημικής μεθόδου. β. Δημιουργία καρυότυπου και χρώση των χρωμοσωμάτων. γ. Μέτρηση της συγκέντρωσης κατάλληλων ενζύμων. δ. Όλα τα παραπάνω. Μονάδες 5

Α3. Η μελαγχρωματική ξηροδερμία: α. Οδηγεί πάντα στη δημιουργία καρκίνου του δέρματος. β. Οφείλεται σε έλλειψη κάποιων ογκοκατασταλτικών γονιδίων. γ. Σχετίζεται με μεταλλάξεις των γονιδίων που κωδικοποιούν τα επιδιορθωτικά ένζυμα. δ. Σχετίζεται με το α και το γ. Μονάδες 5 Α4. Στον καρυότυπο ατόμων που πάσχουν από τρισωμία 18 απεικονίζονται: α. 44 αυτοσωμικά χρωμοσώματα και 3 φυλετικά. β. 45 αυτοσωμικά χρωμοσώματα και 2 φυλετικά, που είναι πάντα Χ και Y. γ. 45 αυτοσωμικά χρωμοσώματα και 2 φυλετικά ΧΧ ή ΧΥ. δ. Συνολικά 47 χρωμοσώματα, από τα οποία 3 είναι φυλετικά.

Μονάδες 5

269

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 270

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Σε άτομο που εμφανίζει αμοιβαία μετατόπιση μετα��ύ του 14ου και 21ου χρωμοσώματος, όταν δημιουργούνται γαμέτες κατόπιν μειωτικής διαίρεσης: α. Όλοι είναι μη φυσιολογικοί. β. Όλοι είναι φυσιολογικοί. γ. Ορισμένοι είναι μη φυσιολογικοί και ορισμένοι φυσιολογικοί. δ. ισχύουν όλα τα παραπάνω. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Να αναφέρετε ονομαστικά τις περιπτώσεις στις οποίες τα ερυθροκύτταρα ενός ατόμου δεν συνθέτουν αιμοσφαιρίνη Α. Μονάδες 3 Β2. Σε τι οφείλεται η φαινυλκετονουρία; Με ποιους τρόπους μπορεί να γίνει διάγνωση της ασθένειας αυτής; Μονάδες 8 Β3. Η φυσιολογική κωδική αλυσίδα ενός γονιδίου έχει την αλληλουχία βάσεων (απεικονίζεται το αρχικό τμήμα αυτής): 5΄-GTCTGATGCCCTTGCGCCGACCC…-3΄

Αυτό το φυσιολογικό γονίδιο κωδικοποιεί πρωτεΐνη με 100 αμινοξέα. Κατόπιν γονιδιακής μετάλλαξης, τύπου αντικατάστασης βάσης, στο 5ο κωδικόνιο η C αντικαθίσταται από Τ. Ποιες οι συνέπειες της γονιδιακής μετάλλαξης στο γονιδιακό προϊόν καθώς και στη λειτουργικότητα αυτού; Μονάδες 8 Β4. Πού οφείλεται η α-θαλασσαιμία και πώς ερμηνεύεται η ετερογένεια των συμπτωμάτων της; Μονάδες 6

270

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 271

ΔΙΑΓ ΩΝΙΣ ΜΑΤ ΚΕΦΑΛΑιΟ 6ο: Α Μ ΕΤΑΛΛΑ ξΕιΣ

τριωρΟ διαγωνισΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Κατά την αμοιβαία μετατόπιση έχουμε ανταλλαγή χρωμοσωμικών τμημάτων μεταξύ: α. Των αδελφών χρωματίδων ενός χρωμοσώματος. β. Μη ομόλογων χρωμοσωμάτων. γ. Ομόλογων χρωμοσωμάτων. δ. Τόσο μεταξύ ομόλογων όσο και μεταξύ μη ομολόγων χρωμοσωμάτων. Μονάδες 5

Α2. Ένας ενήλικος εμφανίζει α-θαλασσαιμία. Στο άτομο αυτό παρατηρείται ελάττωση στη σύνθεση: α. Μόνο της HbA. β. Μόνο της HbF. γ. Μόνο της HbA2. δ. Όλων των παραπάνω. Μονάδες 5 Α3. Οι δομικές χρωμοσωμικές ανωμαλίες: α. Μπορεί να συμβούν καθ’ όλη τη διάρκεια του κυτταρικού κύκλου. β. Μπορεί να συμβούν τόσο σε σωματικά όσο και σε γεννητικά κύτταρα. γ. Έχουν αποτέλεσμα είτε αλλαγή στην ποσότητα του γενετικού υλικού είτε αλλαγή της διάταξης των γονιδίων στα χρωμοσώματα. δ. ισχύουν όλα τα παραπάνω. Μονάδες 5

Α4. Στον καρυότυπο ενός ατόμου απεικονίζονται 47 χρωμοσώματα. Το άτομο αυτό μπορεί να εμφανίζει: α. Σύνδρομο Klinefelter. β. Σύνδρομο Down. γ. Σύνδρομο Turner. δ. Είτε σύνδρομο Down είτε σύνδρομο Klinefelter. Μονάδες 5

271

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 272

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Οι αυτόματες μεταλλάξεις προέρχονται από: α. Λάθη που γίνονται κατά την αντιγραφή ή κατά τον διαχωρισμό των χρωμοσωμάτων. β. Επίδραση ακτινοβολίας. γ. Επίδραση χημικών ουσιών. δ. Όλα τα παραπάνω. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι είναι ο καρκίνος και εξηγήστε γιατί ο καρκίνος δεν κληρονομείται ως απλός μενδελικός χαρακτήρας; Μονάδες 8

Β2. Η δρεπανοκυτταρική αναιμία είναι μια χαρακτηριστική αιμοσφαιρινοπάθεια: α. Τι ονομάζουμε αιμοσφαιρινοπάθειες; β. Πού οφείλεται η παραπάνω αιμοσφαιρινοπάθεια και ποια τα δυσμενή συμπτώματα αυτής στα άτομα που την εμφανίζουν; γ. Είναι μονογονιδιακή ασθένεια η δρεπανοκυτταρική αναιμία; Να αιτιολογήσετε την απάντησή σας. Μονάδες 8

Β3. Πού οφείλεται ο αλφισμός. Πώς εξηγείται η ετερογένεια των συμπτωμάτων της ασθένειας; Μονάδες 6 Β4. Τι χαρακτηρίζουμε ως σιωπηλή μετάλλαξη;

Μονάδες 3

ΘΕΜΑ Γ

Γ1. Ποια είδη μεταλλάξεων οδηγούν στην εμφάνιση της β-θαλασσαιμίας και από τι εξαρτάται η σοβαρότητα των συμπτωμάτων της παραπάνω ασθένειας; Δύο γονείς φορείς της β-θαλασσαιμίας έχουν δύο αγόρια-φορείς της παραπάνω ασθένειας. α. Να σχεδιάσετε το γενεαλογικό δένδρο της οικογένειας. β. Ποια η πιθανότητα το παραπάνω ζευγάρι να αποκτήσει ένα ακόμη παιδί που να είναι αγόρι και να πάσχει από β-θαλασσαιμία; Μονάδες 10

272

kefalaio 6_Layout 1 19/11/2012 6:02 μμ Page 273

ΔΙΑΓ ΩΝΙΣ ΜΑΤ ΚΕΦΑΛΑιΟ 6ο: Α Μ ΕΤΑΛΛΑ ξΕιΣ

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ2. Δύο φυσιολογικοί γονείς απέκτησαν απόγονο με χρωμοσωμική σύσταση 44 αυτοσωμικά + ΧΥΥ που εμφανίζει αιμορροφιλία Α. Να γράψετε και να αιτιολογήσετε τον γονότυπο των γονέων ως προς την αιμορροφιλία Α. Να ερμηνεύσετε με βάση τα γεγονότα της μειωτικής διαίρεσης την απόκτηση του παραπάνω απογόνου. Μονάδες 15

Δίνεται το παρακάτω τμήμα του mRNA που κωδικοποιεί τα τελευταία 7 αμινοξέα μιας πολυπεπτιδικής αλυσίδας, η οποία αποτελείται από 105 αμινοξέα: 5΄...ΑΑΑ-UUU-CAC-AAG-UAC-GAC-AAA-UAA-CGCCA-3΄

Λόγω διαφορετικών γονιδιακών μεταλλάξεων που συνέβησαν στον φυσιολογικό γονότυπο είχαμε ως αποτέλεσμα τις παρακάτω περιπτώσεις σχετικά με το συντιθέμενο πεπτίδιο: α. Έχει συντεθεί πεπτίδιο αποτελούμενο από 101 αμινοξέα. β. Έχει συντεθεί πεπτίδιο αποτελούμενο από 98 αμινοξέα. γ. Έχει συντεθεί πεπτίδιο αποτελούμενο από 104 αμινοξέα. Να εξηγήσετε τα είδη των μεταλλάξεων που οδήγησαν στη σύνθεση των παραπάνω τροποποιημένων πεπτιδίων. Μονάδες 25

273

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

kefalaio 6_Layout 1 19/11/2012 6:58 μμ Page 274

kefalaio 7_Layout 1 19/11/2012 6:04 μμ Page 275

ΛΕΞΕ ΙΣ-Κ ΛΕΙ ΔΙΑ

7 ο ι α λ ά φ ε κ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

δολογια ο θ ε αι Μ κ σ ε αρχ ιοτεχνολογιασ Β τησ

kefalaio 7_Layout 1 19/11/2012 6:04 μμ Page 290

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α θεΜα γ ι ν Ε ΄ Γ ΄ - παν Βιολογία

ερωτησεισ κρισεωσ συνδυαστικεσ «τυπου Β»

ελλαδι

κων

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις. 1. Σε ιδανικές συνθήκες ανάπτυξης μικροοργανισμών, από τι εξαρτάται ο ρυθμός ανάπτυξης της καλλιέργειας;

2. να αναφέρετε ονομαστικά μύκητες και βακτήρια που γνωρίζετε ότι χρησιμοποιούνται σε διαδικασίες βιοτεχνολογίας. 3. Ποιες είναι οι πηγές του άνθρακα για τους ετερότροφους μικροοργανισμούς;

4. να δώσετε τον ορισμό της καλλιέργειας και να αναφέρετε τα θρεπτικά συστατικά που θα μπορούσατε να χρησιμοποιήσετε σε μια τέτοια.

5. να περιγράψετε συνοπτικά πώς επιτυγχάνεται η βιομηχανική καλλιέργεια των μικροοργανισμών. 6. να αναφέρετε τον λόγο για τον οποίο αποστειρώνονται οι συσκευές καλλιέργειας μικροοργανισμών πριν από την έναρξη της καλλιέργειας.

7. Σε ποιες φάσεις της κλειστής καλλιέργειας ο αριθμός των βακτηρίων παραμένει σχεδόν σταθερός; να αιτιολογήσετε γιατί συμβαίνει αυτό.

Αριθμός βακτηρίων

8. η παρακάτω γραφική παράσταση απεικονίζει την ανάπτυξη μικροοργανισμών του γένους Mycobacterium.

χρόνος α. να εντοπίσετε τις φάσεις ανάπτυξης και να εξηγήσετε τις μεταβολές του πληθυσμού των βακτηρίων. β. η ανάπτυξη του συγκεκριμένου βακτηρίου γίνεται σε κλειστή ή συνεχή καλλιέργεια; να αιτιολογήσετε την απάντησή σας.

290

kefalaio 7_Layout 1 19/11/2012 6:04 μμ Page 291

ΚΕφΑΛΑιΟ

7ο: ΑρχΕΣ ΚΑι ΜΕΘΟδΟΛΟΓιΑ

ΤΡΑΠ

ΕΖΑ ΘΕΜ ΑΤΩ ΤηΣ ΒιΟΤ Ν Εχν ΟΛΟΓιΑ Σ

Προσθήκη αντιβιοτικού 

Προσθήκη αντιβιοτικού 

χρόνος

β)

Αριθμός βακτηρίων

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

α)

Αριθμός βακτηρίων

9. Οι καμπύλες (α) και (β) αντιπροσωπεύουν δύο κλειστές καλλιέργειες δύο βακτηρίων διαφορετικών ειδών, στις οποίες έχει προστεθεί ισχυρό αντιβιοτικό κατά το τέλος της εκθετικής φάσης. να εξηγήσετε τις διαφορετικές συνέπειες του αντιβιοτικού στις δύο καλλιέργειες.

χρόνος

10. Έστω ότι το βακτήριο E. coli αναπαράγεται κάθε 20 λεπτά. Αφήνουμε μία καλλιέργεια με 80 βακτήρια να εξελιχθεί σε ιδανικές συνθήκες περιβάλλοντος. Πόσα βακτήρια θα υπάρχουν στην καλλιέργεια μετά από 24 ώρες;

Αριθμός βακτηρίων

11. να εξηγήσετε το παρακάτω διάγραμμα, το οποίο παριστάνει τη μεταβολή του αριθμού των μικροοργανισμών μιας καλλιέργειας σε συνάρτηση με τον χρόνο.

0

t1

t2

t3

χρόνος

12. Πραγματοποιούμε κλειστή καλλιέργεια σε βακτήριο E. coli, όπου στο θρεπτικό υλικό υπάρχουν δύο πηγές άνθρακα: γλυκόζη και μελάσα. να σχεδιάσετε την καμπύλη αύξησης του πληθυσμού σε συνάρτηση με τον χρόνο, εάν γνωρίζουμε ότι οι μικροοργανισμοί δεν διασπούν ταυτόχρονα και τις δύο πηγές άνθρακα.

291

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 292

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Αριθμός βακτηρίων

13. να εξηγήσετε το παρακάτω διάγραμμα που απεικονίζει βιομηχανική καλλιέργεια:

t1

t2

t3

χρόνος

14. Ποια είδη καλλιεργειών γνωρίζετε; (ονομαστική αναφορά)

ΟΣ;

ΑΙ ΤΟ ΛΑΘ

ΠΟΙΟ ΕΙΝ

Οι μικροοργανισμοί παράγουν χρήσιμα προϊόντα μόνο κατά την εκθετική φάση ανάπτυξής τους, όταν πολλαπλασιάζονται σε μια κλειστή καλλιέργεια. Οι μικροοργανισμοί σε μια κλειστή καλλιέργεια παράγουν χρήσιμα προϊόντα κατά την εκθετική αλλά και κατά τη στατική φάση ανάπτυξής τους. Και στις δύο φάσεις μεταβολίζουν με υψηλούς ρυθμούς, επομένως παράγουν και τα προϊόντα του μεταβολισμού τους.

292

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 293

ΚΕφΑΛΑιΟ

7ο: ΑρχΕΣ ΚΑι ΜΕΘΟδΟΛΟΓιΑ

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΤηΣ ΒιΟΤ ΕχνΟΛ ΟΓιΑΣ

1ο ωριαιο διαγωνισΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Το άγαρ είναι: α. Πολυσακχαρίτης που προέρχεται από φύκη. β. Πρωτεΐνη που προέρχεται από φύκη. γ. Πηγή αζώτου για τις κυτταροκαλλιέργειες. δ. ρευστό υλικό σε θερμοκρασίες κάτω από 45 οC.

Μονάδες 5

Α2. Ποιο από τα παρακάτω συστατικά δεν είναι απαραίτητο για την ανάπτυξη ενός αυτότροφου οργανισμού; α. Οξυγόνο. β. Γλυκόζη. γ. Άζωτο. δ. νερό. Μονάδες 5

Α3. Τα τεχνητά θρεπτικά υλικά που χρησιμοποιούνται για την ανάπτυξη μικροβίων στο εργαστήριο: α. Είναι μόνο υγρά. β. Για τη δημιουργία του υγρού θρεπτικού υλικού χρη��ιμοποιείται άγαρ. γ. Είναι τόσο υγρά όσο και στερεά. δ. Είναι μόνο στερεά. Μονάδες 5

Α4. Κατά την τελική κατεργασία: α. Γίνεται αρχικά διαχωρισμός των υγρών από τα στερεά συστατικά της καλλιέργειας. β. Γίνεται εμβολιασμός του θρεπτικού υλικού. γ. Αποστειρώνονται τα θρεπτικά υλικά. δ. Παραλαμβάνονται τα επιθυμητά προϊόντα, όπως τα αντιβιοτικά, από τα στερεά συστατικά της καλλιέργειας. Μονάδες 5

293

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 294

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Σε θρεπτικό υλικό, παρουσία οξυγόνου, μπορούν να καλλιεργηθούν ταυτόχρονα: α. Υποχρεωτικά αερόβιος, προαιρετικά αερόβιος και υποχρεωτικά αναερόβιος οργανισμός. β. Υποχρεωτικά αερόβιος και προαιρετικά αναερόβιος οργανισμός. γ. Υποχρεωτικά αερόβιος και προαιρετικά αερόβιος οργανισμός. δ. Υποχρεωτικά αναερόβιος και προαιρετικά αερόβιος οργανισμός. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. να αναφέρετε ονομαστικά τους παράγοντες που επηρεάζουν τον χρόνο διπλασιασμού των μικροοργανισμών. Μονάδες 5 Β2. Ποιες είναι οι διαφορές μεταξύ κλειστής και συνεχούς καλλιέργειας;

Μονάδες 6

Β3. Πώς προμηθεύονται τον άνθρακα οι αυτότροφοι μικροοργανισμοί και πώς οι ετερότροφοι; Μονάδες 5 Β4. Ποιες διαδικασίες (συνοπτική αναφορά) πρέπει να πραγματοποιηθούν πριν από την εργαστηριακή καλλιέργεια ενός βακτηρίου και γιατί; Μονάδες 9

294

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 295

ΚΕφΑΛΑιΟ

7ο: ΑρχΕΣ ΚΑι ΜΕΘΟδΟΛΟΓιΑ

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΤηΣ ΒιΟΤ ΕχνΟΛ ΟΓιΑΣ

2ο ωριαιο διαγωνισΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Πώς ονομάζεται η διαδικασία προσθήκης μικρής ποσότητας μικροοργανισμών σε θρεπτικό υλικό; α. Γονιδιακή θεραπεία. β. Μετασχηματισμός. γ. Εμβολιασμός. δ. Ψεκασμός με βρογχοσκόπιο. Μονάδες 5

Α2. η ανάπτυξη όλων των μικροοργανισμών που χρησιμοποιεί η Βιοτεχνολογία απαιτεί: α. διαθεσιμότητα θρεπτικών υλικών που περιέχουν μόνο πηγή άνθρακα. β. Υποχρεωτικά παρουσία οξυγόνου. γ. Πολύ υψηλές θερμοκρασίες. δ. pH συνήθως μεταξύ 6-9 και σπανίως 4-5. Μονάδες 5

Α3. Στην κλειστή καλλιέργεια: α. Οι μικροοργανισμοί τροφοδοτούνται συνεχώς με οξυγόνο. β. Οι φάσεις ανάπτυξης των μικροοργανισμών είναι δύο. γ. Κατά τη φάση θανάτου της καλλιέργειας, ο αριθμός των μικροβίων παραμένει σταθερός. δ. Οι φάσεις ανάπτυξης των μικροβίων είναι τέσσερις και η διάρκεια της κάθε φάσης διαφέρει ανάλογα με το είδος των μικροοργανισμών. Μονάδες 5 Α4. Οι μικροοργανισμοί είναι: α. Πάντα βλαβεροί για τον άνθρωπο. β. Πάντα ωφέλιμοι για τον άνθρωπο. γ. Ορισμένοι είναι βλαβεροί και ορισμένοι είναι ωφέλιμοι. δ. Πάντοτε παθογόνοι. Μονάδες 5

295

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 296

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Τα αυτότροφα βακτήρια της Βιοτεχνολογίας προμηθεύονται τον άνθρακα από: α. Τη μελάσα. β. Το άγαρ. γ. Το διοξείδιο του άνθρακα της ατμόσφαιρας. δ. Το διοξείδιο του άνθρακα των αμινοξέων. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Ποια θρεπτικά συστατικά είναι απαραίτητα για την καλλιέργεια των μικροοργανισμών; Μονάδες 6 Β2. Με ποιον τρόπο οι μικροοργανισμοί βρίσκονται διαρκώς σε ανάπτυξη σε μία συνεχή καλλιέργεια; Μονάδες 4 Β3. Τι είναι ο εμβολιασμός εργαστηριακής καλλιέργειας; Ποιο είναι το επόμενο βήμα μετά τον εμβολιασμό των μικροοργανισμών; Μονάδες 5 Β4. Πώς παρασκευάζονται τα στερεά θρεπτικά υλικά;

Μονάδες 10

296

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 297

ΚΕφΑΛΑιΟ

7ο: ΑρχΕΣ ΚΑι ΜΕΘΟδΟΛΟΓιΑ

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΤηΣ ΒιΟΤ ΕχνΟΛ ΟΓιΑΣ

τριωρο διαγωνισΜα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Κατά τη λανθάνουσα φάση σε μια κλειστή καλλιέργεια ο πληθυσμός των μικροοργανισμών: α. Παραμένει σχεδόν σταθερός. β. Αυξάνεται σταθερά. γ. Αρχικά αυξάνεται και μετά μειώνεται. δ. Μειώνεται σταθερά. Μονάδες 5 Α2. Ως πηγή άνθρακα σε εργαστηριακή καλλιέργεια E. coli μπορεί να χρησιμοποιηθεί: α. Το διοξείδιο του άνθρακα. β. Το άγαρ. γ. η γλυκόζη. δ. Τα αμινοξέα. Μονάδες 5

Α3. Σε μια κλειστή καλλιέργεια οι μικροοργανισμοί διαιρούνται με ταχύ ρυθμό: α. Στη λανθάνουσα φάση. β. Στην εκθετική φάση. γ. Στη στατική φάση. δ. Στη φάση θανάτου. Μονάδες 5

Α4. Από τη ζύμωση μικροοργανισμών του είδους Α παράγονται χρήσιμα προϊόντα κυρίως κατά τη στατική φάση, ενώ του είδους Β κατά την εκθετική φάση. Για την παραλαβή των προϊόντων τους επιλέγονται οι τύποι ζύμωσης: α. Κλειστή και συνεχής καλλιέργεια, αντίστοιχα. β. Συνεχής και κλειστή καλλιέργεια, αντίστοιχα. γ. Κλειστή καλλιέργεια σε κάθε περίπτωση. δ. Συνεχής καλλιέργεια σε κάθε περίπτωση. Μονάδες 5

297

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 298

κή Κατεύθυνση υ Λυκείου / Θετι ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Οι υποχρεωτικά αερόβιοι μικροοργανισμοί απαιτούν για την ανάπτυξή τους: α. Υψηλή συγκέντρωση οξυγόνου. β. Μειωμένη συγκέντρωση διοξειδίου του άνθρακα. γ. Υψηλή συγκέντρωση αζώτου. δ. Πολύ υψηλές θερμοκρασίες. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Για ποιον λόγο αποστειρώνονται οι συσκευές καλλιέργειας μικροοργανισμών πριν από την έναρξη της καλλιέργειας; Μονάδες 4 Β2. Τι είναι το άγαρ και ποιος ο ρόλος του στις καλλιέργειες;

Μονάδες 5

Β3. Τι είναι η ζύμωση, ποια είναι τα προϊόντα της και πού πραγματοποιείται;

Μονάδες 7

Β4. Πώς επηρεάζει την ανάπτυξη μικροοργανισμών η θερμοκρασία, το οξυγόνο (Ο2) και το pH; Μονάδες 9 ΘΕΜΑ Γ

Ποσότητα προϊόντος g/mL

log αριθμ. κυττάρων

Δίνονται τα παρακάτω διαγράμματα Α και Β. Στο Α απεικονίζονται οι φάσεις (α, β, γ και δ) ανάπτυξης ενός μικροοργανισμού. Στο Β απεικονίζεται η παραγωγή προϊόντος από τον μικροοργανισμό, για το ίδιο χρονικό διάστημα.

(Α)

δ

α

1

2

3

4

ημέρες

5

(Β)

1

298

γ

β

2

3

4

5

ημέρες

kefalaio 7_Layout 1 19/11/2012 6:05 μμ Page 299

ΚΕφΑΛΑιΟ

7ο: ΑρχΕΣ ΚΑι ΜΕΘΟδΟΛΟΓιΑ

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΤηΣ ΒιΟΤ ΕχνΟΛ ΟΓιΑΣ

Γ1. Με βάση το διάγραμμα Α να χαρακτηρίσετε τον τύπο της καλλιέργειας και να ονομάσετε τις φάσεις της. Μονάδες 7

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ2. Σε ποια φάση παράγεται η μεγαλύτερη ποσότητα του προϊόντος; να αιτιολογήσετε την απάντησή σας. Μονάδες 8

Γ3. Αν το προϊόν εκκρίνεται από τον μικροοργανισμό, πώς θα το παραλάβουμε από την καλλιέργεια; Μονάδες 6 Γ4. Σε ιδανικές συνθήκες ανάπτυξης μικροοργανισμών, από τι εξαρτάται ο ρυθμός ανάπτυξης της καλλιέργειας; Μονάδες 4 ΘΕΜΑ Δ

Δ1. Πραγματοποιούμε κλειστή καλλιέργεια με βακτήριο που στο θρεπτικό του υλικό υπάρχουν δύο πηγές άνθρακα: γλυκόζη και λακτόζη. να σχεδιάσετε την καμπύλη ανάπτυξης του πληθυσμού σε συνάρτηση με τον χρόνο, αν γνωρίζετε ότι τα βακτήρια δεν διασπούν ταυτόχρονα και τις δύο πηγές άνθρακα. να εξηγήσετε τι συμβαίνει σε κάθε φάση. Μονάδες 13 Δ2. Πρόκειται να καλλιεργηθεί στο εργαστήριο ένας ετερότροφος μικροοργανισμός. α. να αναφέρετε ονομαστικά τα θρεπτικά συστατικά τα οποία πρέπει να προστεθούν στο θρεπτικό υλικό, ώστε ο μικροοργανισμός αυτός να αναπτυχθεί φυσιολογικά. β. Πώς μπορούμε να διαπιστώσουμε αν ο μικροοργανισμός αυτός είναι υποχρεωτικά αναερόβιος; Μονάδες 12

299

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

kefalaio 7_Layout 1 19/11/2012 7:03 μμ Page 300

kefalaio 8_Layout 1 19/11/2012 6:06 μμ Page 301

ΛΕΞΕ ΙΣ-Κ ΛΕΙ ΔΙΑ

8 ο ι α λ ά φ ε κ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΙοτΕχνολογΙασ Β σ η τ γΕσ ο μ ρ Εφα ατρΙκη νΙ η τ σ

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 318

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

1ο ωρΙαΙο δΙαγωνΙσμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. η Βιοτεχνολογία συνεισφέρει στην Ιατρική: α. Με τη χρήση της τεχνικής PCR. β. Με τη βοήθεια της τεχνολογίας του ανασυνδυασμένου DNA. γ. Με τη χρήση ανιχνευτών DNA. δ. Με όλα τα παραπάνω.

Μονάδες 5

Α2. στις φαρμακευτικές πρωτεΐνες δεν ανήκουν: α. τα αντιβιοτικά. β. Οι ιντερφερόνες. γ. η ινσουλίνη και η αυξητική ορμόνη. δ. τα μονοκλωνικά αντισώματα.

Μονάδες 5

Α3. σε ποια διαδικασία εισάγονται γενετικά τροποποιημένοι ιοί στα λεμφοκύτταρα (εργαστηριακά); α. Εx vivo γονιδιακή θεραπεία. β. Μεταμόσχευση. γ. Ιn vivo γονιδιακή θεραπεία. δ. Εμβολιασμός. Μονάδες 5 Α4. Για τα αντισώματα ισχύει: α. Είναι πρωτεΐνες με αμυντική δράση. β. Όταν αναγνωρίζουν διαφορετικά αντιγόνα, ονομάζονται μονοκλωνικά. γ. συντήκονται με καρκινικά κύτταρα, οπότε προκύπτουν υβριδικά κύτταρα. δ. Έχουν έναν αντιγονικό καθοριστή που αναγνωρίζει ένα συγκεκριμένο αντιγόνο. Μονάδες 5

318

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 319

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΛΟΓΙΑσ σ

ΚΕΦΑΛΑΙΟ 8ο: ΕΦΑΡΜΟΓΕσ τησ ΒΙΟτΕχνΟ

την ΙΑ τΡΙΚη

Α5. τα αντισώματα στον ανθρώπινο οργανισμό παράγονται από: α. Καρκινικά κύτταρα. β. Έναν κλώνο Β - λεμφοκυττάρων. γ. Βακτήρια. δ. Ερυθρά αιμοσφαίρια.

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. σε ποια τεχνική της Βιοτεχνολογίας στηρίζεται η γονιδιακή θεραπεία και ποιος ο στόχος της; να αναφέρετε δύο ασθένειες οι οποίες αντιμετωπίζονται με τη γονιδιακή θεραπεία. Μονάδες 4 Β2. να περιγράψετε την τεχνική παραγωγής μονοκλωνικών αντισωμάτων για ένα επιλεγμένο αντιγόνο. Μονάδες 5 Β3. Πώς παραγόταν παλιότερα η ινσουλίνη; σε ποια τεχνική της Βιοτεχνολογίας στηρίζεται η παραγωγή της σήμερα; Ποια είναι, συνοπτικά, τα στάδια για την παραγωγή της; Μονάδες 9 Β4. τι είναι η κυστική ίνωση και πώς εφαρμόστηκε σε αυτήν η γονιδιακή θεραπεία; Μονάδες 7

319

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 320

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

2ο ωρΙαΙο δΙαγωνΙσμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Με τη γονιδιακή θεραπεία: α. Παράγονται μονοκλωνικά αντισώματα. β. Γίνεται προσπάθεια αποκατάστασης της γενετικής βλάβης. γ. Γίνεται παραγωγή αντιβιοτικών. δ. Γίνεται ανίχνευση ουσιών οι οποίες δρουν ως αντιγόνα.

Μονάδες 5

Α2. Αντιγονικός καθοριστής ονομάζεται: α. Κάθε παθογόνος μικροοργανισμός ή ξένο προς τον οργανισμό κύτταρο. β. Μία συγκεκριμένη περιοχή του αντιγόνου. γ. Μία συγκεκριμένη πρωτεΐνη που παράγεται από τα Β λεμφοκύτταρα. δ. Κάθε εξειδικευμένο φάρμακο εναντίον παθογόνων μικροοργανισμών ή καρκινικών κυττάρων. Μονάδες 5 Α3. η ινσουλίνη παράγεται σε μεγάλες ποσότητες και με μικρό κόστος από: α. Εκχύλιση ιστών του παγκρέατος χοίρων και βοοειδών. β. Βακτήρια με την τεχνολογία του ανασυνδυασμένου DNA. γ. Μύκητες με σύγχρονες χημικές μεθόδους διαχωρισμού. δ. τον ερυθρό μυελό των οστών με εκχύλιση.

Μονάδες 5

Α4. Οι ιντερφερόνες είναι: α. Μονοκλωνικά αντισώματα. β. Αντι-ιικές πρωτεΐνες. γ. Υβριδώματα. δ. Ορμόνες.

Μονάδες 5

320

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 321

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΛΟΓΙΑσ σ

ΚΕΦΑΛΑΙΟ 8ο: ΕΦΑΡΜΟΓΕσ τησ ΒΙΟτΕχνΟ

την ΙΑ τΡΙΚη

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Οι τεχνικές που αφορούν τον ανασυνδυασμό του DNA συμβάλλουν: α. στην παραγωγή πρωτεϊνών σε μεγάλες ποσότητες. β. στην παραγωγή πρωτεϊνών με μικρό κόστος. γ. στην πλήρη κατανόηση της βιολογικής δράσης των φαρμακευτικών πρωτεϊνών. δ. σε όλα τα παραπάνω. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. τι είναι η «γονιδιακή θεραπεία» και ποιες είναι οι απαραίτητες προϋποθέσεις για την εφαρμογή της; Μονάδες 7 Β2. να περιγράψετε συνοπτικά τη διαδικασία παραγωγής ινσουλίνης με την τεχνολογία του ανασυνδυασμένου DNA. Μονάδες 9 Β3. Ποιο πλεονέκτημα έχει η αντιμετώπιση των καρκινικών κυττάρων με μονοκλωνικά αντισώματα σε σχέση με τη χημειοθεραπεία και τη χειρουργική επέμβαση; Μονάδες 5 Β4. Ποιος είναι ο ρόλος των ιντερφερονών;

Μονάδες 4

321

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 322

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

τρΙωρο δΙαγωνΙσμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. η γονιδιακή θεραπεία έχει ως στόχο τη διόρθωση μιας γενετικής βλάβης με την: α. Αντικατάσταση του μεταλλαγμένου αλληλομόρφου σε όλα τα κύτταρα του ασθενή. β. Αντικατάσταση του μεταλλαγμένου αλληλομόρφου σε ορισμένα σωματικά κύτταρα του ασθενή. γ. Εισαγωγή του φυσιολογικού αλληλομόρφου σε όλα τα κύτταρα του ασθενή. δ. Εισαγωγή του φυσιολογικού αλληλομόρφου σε ορισμένα σωματικά κύτταρα του ασθενή. Μονάδες 5

Α2. τα μονοκλωνικά αντισώματα που χρησιμοποιούνται για τη θεραπεία του καρκίνου απομονώνονται από: α. τον σπλήνα ποντικών που έχουν μολυνθεί με επιλεγμένο αντιγόνο. β. Υβριδώματα λεμφοκυττάρων – καρκινικών κυττάρων. γ. Ανθρώπινα Β – λεμφοκύτταρα που συντήκονται με λεμφοκύτταρα ποντικών. δ. Καρκινικά κύτταρα ποντικών. Μονάδες 5

Α3. Οι ιντερφερόνες που χρησιμοποιεί σήμερα ο άνθρωπος είναι δυνατόν να παράγονται σε μεγάλες ποσότητες από: α. Κύτταρα ανθρώπου. β. Κύτταρα ζώων. γ. Γενετικά τροποποιημένα βακτήρια. δ. Φυτικά κύτταρα. Μονάδες 5

Α4. Ex vivo ονομάζεται η γονιδιακή θεραπεία κατά την οποία: α. τα κύτταρα τροποποιούνται έξω από τον οργανισμό και εισάγονται πάλι σ’ αυτόν. β. τα κύτταρα τροποποιούνται μέσα στον οργανισμό του ασθενούς. γ. τα κύτταρα τροποποιούνται γενετικά κατευθείαν στον οργανισμό του ασθενούς. δ. τα κύτταρα συντήκονται με αντισώματα. Μονάδες 5

322

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 323

ΔΙΑΓ ΩΝΙΣ ΜΑΤ Α ΛΟΓΙΑσ σ

ΚΕΦΑΛΑΙΟ 8ο: ΕΦΑΡΜΟΓΕσ τησ ΒΙΟτΕχνΟ

την ΙΑ τΡΙΚη

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. τα υβριδώματα είναι: α. Υβρίδια καλαμποκιού. β. σύμπλεγμα αντισωμάτων με καρκινικά κύτταρα. γ. Καρκινικά κύτταρα. δ. Κύτταρα που προκύπτουν από σύντηξη Β λεμφοκυττάρων με καρκινικά κύτταρα. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. τι είναι οι ιντερφερόνες, τι προκαλούν και σε ποιες περιπτώσεις μπορούν να χρησιμοποιηθούν για την αντιμετώπιση ασθενειών; Μονάδες 6 Β2. τι είναι η ανεπάρκεια του ανοσοποιητικού συστήματος, πού οφείλεται και τι προκαλεί; Μονάδες 5 Β3. Πού στηρίζεται η εφαρμογή των μονοκλωνικών αντισωμάτων κατά την εξουδετέρωση καρκινικών κυττάρων; Μονάδες 7 Β4. Πώς ο αντιγονικός καθοριστής σχετίζεται με την παραγωγή μονοκλωνικών αντισωμάτων από τον οργανισμό του ανθρώπου; Μονάδες 7 ΘΕΜΑ Γ

Γ1. Γιατί η «διόρθωση» μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους; Μονάδες 5 Γ2. να γράψετε μία διαφορά μεταξύ της ex vivo και της in vivo γονιδιακής θεραπείας; Μονάδες 6

Γ3. Με ποια μέθοδο ήταν δυνατή η εξασφάλιση της ινσουλίνης πριν από την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA; Ποια ήταν τα μειονεκτήματα της μεθόδου; Μονάδες 6

323

kefalaio 8_Layout 1 19/11/2012 6:07 μμ Page 324

ική Κατεύθυνση υ Λυκείου / Θετ ο ί α ι ν Ε ΄ Γ Βιολογία

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ4. τι ονομάζεται χαρτογράφηση του ανθρώπινου γονιδιώματος και με ποιον τρόπο θα συμβάλει στη μελέτη της εξέλιξης του ανθρώπινου γονιδιώματος και στη μαζική παραγωγή προϊόντων; Μονάδες 8

Δ1. σε μια γυναίκα που πάσχει από ανεπάρκεια του ανοσοποιητικού συστήματος εφαρμόστηκε γονιδιακή θεραπεία για την αντιμετώπιση της ασθένειας. στη συνέχεια παντρεύτηκε φυσιολογικό άνδρα. Ποιοι είναι οι πιθανοί γονότυποι και φαινότυποι των παιδιών τους; Μονάδες 15 Δ2. να περιγράψετε τη διαδικασία με την οποία μπορούν να παραχθούν μονοκλωνικά αντισώματα, τα οποία συνεισφέρουν στον προσδιορισμό των ομάδων αίματος του ανθρώπου. Μονάδες 10

324

kefalaio 9_Layout 1 19/11/2012 6:09 μμ Page 325

ΛΕΞΕ ΙΣ-Κ ΛΕΙ ΔΙΑ

9 ο ι α λ ά φ ε κ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

οτεχνολοΓιασ ι Β σ η εσ τ Γ ο μ τηνοτροφια κ ρ ν η τ α ι α εφ ωρΓια κ ε Γ η στ

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 338

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

1ο ωριαιο διαΓωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Το βακτήριο Agrobacterium tumefaciens: α. Είναι ένα επικίνδυνο βακτήριο για την υγεία του ανθρώπου. β. Παράγει μια ισχυρή τοξίνη. γ. Χρησιμοποιείται για τη δημιουργία διαγονιδιακών φυτών. δ. Ζει κυρίως στο νερό.

Μονάδες 5

Α2. Τα διαγονιδιακά ζώα: α. Προέρχονται από τη διασταύρωση επιλεγμένων ζώων. β. Είναι ζώα των οποίων το ζυγωτό έχει υποστεί γενετική τροποποίηση. γ. Μοιάζουν με τη «θετή» μητέρα στη μήτρα της οποίας αναπτύχθηκαν. δ. Μοιάζουν μόνο με τη μητέρα από την οποία προήλθε το ωάριο.

Μονάδες 5

Α3. Το πλασμίδιο Ti: α. Είναι παράγοντας ανθεκτικότητας ενός βακτηρίου. β. Προκαλεί όγκους στα φυτά. γ. Παράγει τοξίνες που καταστρέφουν τα φυτά. δ. Εισάγεται με μικροέγχυση στα κύτταρα των φυτών.

Μονάδες 5

Α4. Στη μέθοδο της μικροέγχυσης: α. Χρησιμοποιούνται ωάρια που έχουν γονιμοποιηθεί φυσιολογικά και σε αυτά γίνεται εισαγωγή ξένου DNA. β. Χρησιμοποιούνται ωάρια και, αφού εισαχθεί το ξένο DNA, αυτά γονιμοποιούνται στο εργαστήριο. γ. Χρησιμοποιούνται ωάρια που έχουν γονιμοποιηθεί στο εργαστήριο και σε αυτά γίνεται εισαγωή ξένου DNA. δ. Χρησιμοποιούνται ωάρια ζώου που, μετά την εισαγωγή του ξένου DNA, τοποθετούνται στη μήτρα της θετής μητέρας για γονιμοποίηση. Μονάδες 5

338

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 339

ΔΙΑΓ

ΩΝΙ ΣΜΑ ΑΡΜΟΓΕΣ ΤΗΣ ΒιΟΤΕΧΝΟΛΟΓιΑΣ ΣΤΗ ΓΕωΡΓιΑ ΚΑ ΤΑ ι ΤΗΝ ΚΤ ΚΕΦΑΛΑιΟ 9ο: ΕΦ ΗΝΟ ΤΡΟΦι Α

Α5. Για να τροποποιηθεί γενετικά το φυτό του καπνού, χρησιμοποιούνται: α. Πλασμίδια από οποιοδήποτε κύτταρο. β. Τεχνητό DNA. γ. Πλασμίδια του βακτηρίου E. coli. δ. Πλασμίδιο του Agrobacterium tumefaciens.

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι είναι οι ελεγχόμενες από τον άνθρωπο διασταυρώσεις και σε τι αποβλέπουν; Μονάδες 5

Β2. Σε ποια κύτταρα εφαρμόζεται η μικροέγχυση και πού αναπτύσσεται το ζυγωτό μετά από αυτή; Μονάδες 5 Β3. Τι ονομάζουμε διαγονιδιακά ζώα; Να περιγράψετε τη σημαντικότερη μέθοδο δημιουργίας τους; Μονάδες 3

Β4. Να περιγράψετε τη μέθοδο με την οποία δημιουργούμε τροποποιημένα γενετικά φυτά, ανθεκτικά στα διάφορα έντομα. Μονάδες 12

339

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 340

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

2ο ωριαιο διαΓωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση.

Α1. Για να τροποποιηθεί το γενετικό υλικό μιας αγελάδας, εισάγεται «ξένο» γονίδιο σε: α. ωάριο του θηλυκού ζώου. β. Ζυγωτό. γ. Σπερματοζωάριο. δ. Μαστικά κύτταρα. Μονάδες 5 Α2. Το πλασμίδιο Ti: α. Προέρχεται από το βακτήριο Bacillus thuringiensis. β. Είναι ένα κυκλικό DNA του βακτηρίου E. coli. γ. Ενσωματώνεται στο γενετικό υλικό των ζώων. δ. Απομονώνεται από το Agrobacterium tumefaciens.

Μονάδες 5

Α3. Διαγονιδιακοί ονομάζονται: α. Οι οργανισμοί που προέρχονται από ελεγχόμενες διασταυρώσεις. β. Οι οργανισμοί στους οποίους έχουν εισαχθεί διάφορες ορμόνες. γ. Οι οργανισμοί που έχουν υποστεί γενετική αλλαγή με τις τεχνικές της Γενετικής Μηχανικής. δ. Οι οργανισμοί που έχουν εμβολιαστεί με το κατάλληλο αντιγόνο in vitro. Μονάδες 5

Α4. Η δημιουργία της Ντόλυ απαίτησε: α. Τη συνεισφορά ωαρίων από τρία διαφορετικά πρόβατα. β. Τη συνεισφορά ωαρίων από δύο διαφορετικά πρόβατα. γ. Τη συνεισφορά ωαρίων από ένα μόνο πρόβατο. δ. Τη συνεισφορά ωαρίων και σπερματοζωαρίων από δύο πρόβατα αντίστοιχα. Μονάδες 5

340

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 341

ΔΙΑΓ

ΩΝΙ ΣΜΑ ΑΡΜΟΓΕΣ ΤΗΣ ΒιΟΤΕΧΝΟΛΟΓιΑΣ ΣΤΗ ΓΕωΡΓιΑ ΚΑ ΤΑ ι ΤΗΝ ΚΤ ΚΕΦΑΛΑιΟ 9ο: ΕΦ ΗΝΟ ΤΡΟΦι Α

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α5. Τροποποιημένος γενετικά οργανισμός σημαίνει ότι έχει: α. Διασταυρωθεί με έναν άλλο οργανισμό με βελτιωμένες ιδιότητες. β. Εισαχθεί στο DNA του όλο το DNA από έναν άλλο οργανισμό, που ανήκει αποκλειστικά στο ίδιο είδος με αυτόν. γ. Εισαχθεί στο DNA του κάποιο γονίδιο, που του προσφέρει νέα ιδιότητα. δ. Εισαχθεί στο DNA του κάποιο γονίδιο συνδεδεμένο πάνω σε έναν ειδικό φορέα. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Ποιο είναι το βακτήριο που χρησιμοποιείται στις μεθόδους παραγωγής διαγονιδιακών φυτών και ποια είναι η χαρακτηριστική του ιδιότητα στην οποία βασίζεται η χρησιμοποίησή του; Μονάδες 6 Β2. Γιατί θεωρήθηκε επικίνδυνη η χρήση των χημικών εντομοκτόνων, προκειμένου να αυξηθεί η φυτική παραγωγή; Μονάδες 3 Β3. Να αναφέρετε τα πλεονεκτήματα από τη χρήση διαγονιδιακών οργανισμών. Μονάδες 6 Β4. Να περιγράψετε τα στάδια που απαιτούνται για την παραγωγή μιας φαρμακευτικής ανθρώπινης πρωτεΐνης από διαγονιδιακό ζώο. Μονάδες 10

341

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 342

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

τριωρο διαΓωνισμα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Η μικροέγχυση είναι μέθοδος: α. Παραγωγής διαγονιδιακών ζώων. β. Εισαγωγής ξένου DNA σε ιούς. γ. Παραγωγής διαγονιδιακών φυτών. δ. Παραγωγής μονοκλωνικών αντισωμάτων.

Μονάδες 5

Α2. Τα ζώα που έχουν υποστεί γενετική τροποποίηση ονομάζονται: α. Ζώα ελεγχόμενων διασταυρώσεων. β. Διαγονιδιακά. γ. Πολυπλοειδικά. δ. Κλωνοποιημένα.

Μονάδες 5

Α3. Το βακτήριο Agrobacterium tumefaciens: α. Είναι επικίνδυνο για την υγεία του ανθρώπου. β. Παράγει ισχυρή τοξίνη, δραστική στα έντομα. γ. Χρησιμοποιείται για τη δημιουργία διαγονιδιακών ζώων. δ. Μολύνει τα φυτικά κύτταρα μεταφέροντας σ’ αυτά το πλασμίδιο Ti.

Μονάδες 5

Α4. Διαγονιδιακούς οργανισμούς δεν αποτελούν: α. Οι απόγονοι των φυτών ποικιλίας Bt. β. Οι απόγονοι της Dolly. γ. Οι κλώνοι ενός διαγονιδιακού ζώου. δ. Τα ζώα που παράγουν ανθρώπινες πρωτεΐνες.

Μονάδες 5

342

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 343

ΔΙΑΓ

ΩΝΙ ΣΜΑ ΑΡΜΟΓΕΣ ΤΗΣ ΒιΟΤΕΧΝΟΛΟΓιΑΣ ΣΤΗ ΓΕωΡΓιΑ ΚΑ ΤΑ ι ΤΗΝ ΚΤ ΚΕΦΑΛΑιΟ 9ο: ΕΦ ΗΝΟ ΤΡΟΦι Α

Α5. Το βακτήριο Bacillus thuringiensis: α. Προκαλεί καρκίνο στα φυτά. β. Χρησιμοποιείται για τη δημιουργία διαγονιδιακών ζώων. γ. Παράγει μια τοξίνη με εντομοκτόνο δράση. δ. Προκαλεί τον μετασχηματισμό των κυττάρων.

ΘΕΜΑ B

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις:

Β1. Τι ονομάζουμε διαγονιδιακά ζώα και τι διαγονιδιακά φυτά;

Μονάδες 5

Β2. Ποια είναι τα πλεονεκτήματα της χρησιμοποίησης διαγονιδιακών ζώων και φυτών για την αύξηση της ζωικής και φυτικής παραγωγής έναντι της κλασικής μεθόδου των διασταυρώσεων; Μονάδες 8 Β3. Να αναφέρετε ονομαστικά δύο φαρμακευτικές πρωτεΐνες που παράγονται σήμερα από διαγονιδιακά ζώα. Για την αντιμετώπιση ποιων ασθενειών χρησιμοποιούνται; Μονάδες 6

Β4. Ποιοι είναι οι κύριοι στόχοι της Βιοτεχνολογίας ως προς τη φυτική παραγωγή; Σε ποια φυτά έχει γίνει εφαρμογή; Μονάδες 6 ΘΕΜΑ Γ

Γ1. Τα έντομα δημιουργούν μεγάλα προβλήματα στη γεωργία και οδηγούν σε σημαντική μείωση της παραγωγής. Γνωρίζετε αν η Βιοτεχνολογία μπορεί να βοηθήσει στην καταπολέμηση των εντόμων και με ποιους τρόπους μπορεί να γίνει αυτό; Μονάδες 8 Γ2. Να αναφέρετε τους διαφορετικούς οργανισμούς από τους οποίους φέρουν γενετικές πληροφορίες οι παρακάτω οργανισμοί: α. Ένα διαγονιδιακό φυτό. β. Ένα διαγονιδιακό ζώο. γ. Ένα κλωνοποιημένο ζώο, όπως π.χ. η Ντόλυ. Μονάδες 7

343

kefalaio 9_Layout 1 19/11/2012 6:10 μμ Page 344

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Γ3. Γιατί η κλωνοποίηση είναι χρήσιμη για τον πολλαπλασιασμό των διαγονιδιακών ζώων; Μονάδες 5

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ4. Για ποιον λόγο χρησιμοποιείται η τεχνολογία του ανασυνδυασμένου DNA σε κτηνοτροφικής σημασίας ζώα; Μονάδες 5

Δ1. Σε χρωμόσωμα του 5ου ζεύγους ζυγωτού, που μετά την κυοφορία στη μήτρα θετής μητέρας έδωσε θηλυκή αγελάδα, ενσωματώθηκε το ανθρώπινο γονίδιο Α για την ινσουλίνη. Σε ζυγωτό αρσενικής αγελάδας ενσωματώθηκε το ίδιο γονίδιο στο Χ φυλετικό χρωμόσωμα. Τα δύο ζώα που προέκυψαν από τα δύο ζυγωτά μετά από κάποιο χρονικό διάστημα διασταυρώνονται. α. Ποια η πιθανότητα να γεννηθεί ζώο με δύο γονίδια Α στον γονότυπό του, που να παράγει ινσουλίνη; β. Ποια η πιθανότητα να προκύψει μη διαγονιδιακή αγελάδα; Μονάδες 13

Δ2. Να αναφέρετε τα βήματα που απαιτούνται για την παραγωγή του παράγοντα ιΧ στο γάλα διαγονιδιακών προβάτων. Μονάδες 12

344

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 345

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ρωτηΣεων ε ν ω τ ιΣ ε Σ η Βλιου Αντ ι Β π υ Α χολικο Σ του

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 346

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο στο βακτήριο θα έχουν τις πρωτεΐνες και το DNA του φάγου Τ4.

κ εφΑλΑιο 1 ο

το Γενετικο υλικο

Σε πολλά βακτήρια... και του προσδίδουν καινούριες ιδιότητες (σελ. 18 σχολικού βιβλίου). Επιπλέον, θα μπορούσε να ζητηθεί ότι... τα πλασμίδια αποτελούν φορείς κλωνοποίησης στη γενετική μηχανική... (σελ. 58, 59 σχολικού βιβλίου), και ότι ειδικά το πλασμίδιο Ti του βακτηρίου Agrobacterium χρησιμοποιείται ως φορέας για την εισαγωγή γονιδίων στα φυτά... σελ. 131 σχολικού βιβλίου.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Γνωρίζουμε ότι το ανθρώπινο γονιδίωμα σε ένα απλοειδές κύτταρο-γαμέτη αποτελείται από περίπου 3 · 109 ζεύγη βάσεων DNA. Το δεύτερο κύτταρο είναι σωματικό-διπλοειδές κύτταρο στην αρχή της μεσόφασης ή στο τέλος της μίτωσης, αφού αποτελείται από 2 · (3 · 109) = 6 · 109 ζεύγη βάσεων.

6.

2. Η δεοξυριβόζη του ενός (OH του 3΄ άνθρακα) με τη φωσφορική ομάδα (5΄ άνθρακα) του επόμενου. 3. 20% Τ λόγω συμπληρωματικότητας. 100 – (20 + 20) = 60 % G, C. 60 : 2 = 30 % G και 30 % C.

4. Συνοπτικά, οι λειτουργίες του γενετικού υλικού είναι: • Η αποθήκευση της γενετικής πληροφορίας... • Η διατήρηση και η μεταβίβαση της γενετικής πληροφορίας... • Η έκφραση των γενετικών πληροφοριών... σελ. 17 σχολικού βιβλίου. 5. Σωστή πρόταση είναι η ε. Σύμφωνα με τα πειράματα των Hershey και Chase, τα αποτελέσματα έδειξαν ότι μόνο το DNA του φάγου (Τ4) εισέρχεται στο βακτηριακό κύτταρο και είναι ικανό να «δώσει τις απαραίτητες εντολές», για να πολλαπλασιαστούν και να παραχθούν οι νέοι φάγοι. Επομένως, οι απόγονοι φάγοι που θα παραχθούν μέσα

346

7. Σωστή πρόταση είναι η γ.

8. Νουκλεοτίδιο  νουκλεόσωμα  γονίδιο  χρωμόσωμα

9. Η σωστή πρόταση είναι: Το γενετικό υλικό των μιτοχονδρίων είναι ένα δίκλωνο μόριο DNA, συνήθως κυκλικό, που περιέχει γενετικές πληροφορίες για μερικές από τις λειτουργίες του.

10. Οι γενετικές πληροφορίες για όλες τις ιδιότητες του μονοκύτταρου οργανισμού, επομένως και για τον σχηματισμό του καπέλου, είναι αποθηκευμένες στο DNA του πυρήνα. Άρα, η σύνθεση του καπέλου καθορίζεται κάθε φορά από τη βάση του οργανισμού που περιέχει τον πυρήνα.

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 347

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ

ΑντιΓρΑφη, εκφρΑΣη κΑι ρύθμιΣη τηΣ ΓενετικηΣ πληροφοριΑΣ

Εισαγωγή για τον κυτταρικό κύκλο... σελ. 20 σχολικού βιβλίου. Επειδή ο μηχανισμός της αντιγραφής είναι ημισυντηρητικός (σελ. 27 σχολικού βιβλίου), μετά από δύο διαδοχικές αντιγραφές του DNA και διαιρέσεις του κυττάρου, στο ραδιενεργό θρεπτικό υλικό προκύπτουν:

4. Σωστή απάντηση είναι η α (αντίστροφη μεταγραφή). 5. Το ποσοστό Α, Τ στον έναν κλώνο είναι ίσο με το ποσοστό στον άλλον κλώνο, και ίσο με το ποσοστό στη διπλή έλικα. Επομένως: μη κωδική: 20 % Α, Τ mRNA: 20 % U, A ή 100 – 20 = 80 % G-C. Επομένως, η σωστή απάντηση είναι η γ. 6.

Αρχικό κύτταρο 1η αντιγραφή DNA

1η κυτταρική διαίρεση

2η αντιγραφή DNA

2η κυτταρική διαίρεση

2.

ΒιΒΛιΟυ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΣχΟΛιΚΟυ

3. γ  β  α.

κ εφΑλΑιο 2 ο

1.

υ

Για να μείνουν «ελεύθερες» οι αζωτούχες βάσεις των μητρικών αλυσίδων του DNA, ώστε να μπορέσουν στη συνέχεια να συνδεθούν –με τη βοήθεια ενζύμων (πριμόσωμα, DNA πολυμεράσες)– με νέους δεσμούς υδρογόνου, με συμπληρωματικές αζωτούχες βάσεις των νουκλεοτιδίων που θα μεταφερθούν. Τα ένζυμα που βοηθούν στο ξετύλιγμα είναι οι DNA ελικάσες.

Αντιγραφή του DNA: α. Μεταξύ μητρικής αλυσίδας και πρωταρχικών τμημάτων RNA, β. μεταξύ μητρικής αλυσίδας και νεοσυντιθέμενης θυγατρικής, γ. κατά τη δράση των επιδιορθρωτικών ενζύμων, δ. κατά την αντικατάσταση των πρωταρχικών τμημάτων. Μεταγραφή του RNA από το DNA: Μεταξύ μη κωδικής αλυσίδας του DNA-γονιδίου και νεοσυντιθέμενης αλυσίδας του RNA. Μετάφραση: α. Μεταξύ της 5΄ αμετάφραστης περιοχής του mRNA και του rRNA της μικρής υπομονάδας του ριβοσώματος, β. μεταξύ των κωδικονίων του mRNA και των αντικωδικονίων των tRNA. Αντίστροφη μεταγραφή των RNA ιών: Με καλούπι το RNA των ιών, δημιουργείται DNA. Αυτοδιπλασιασμός RNA ιών: Από RNA δημιουργούνται νέα αντίγραφα RNA.

7. Μη κωδική: 3΄ - TAC - TGC - ATA - ATG ATT - 5΄ Κωδική: 5΄ - ATG - ACG - TAT - TAC TAA - 3΄

347

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 348

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

Αμινοξέα

2η αλυσίδα 1η αλυσίδα ΑντικωmRNA DNA DNA δικόνια

8. 5΄ ATG

CTT

AAT

10.

3΄ κωδική

TTT

TGA

AAA

5΄ μη ACT κωδική

3΄ GAA TAC

TTA

5΄ CUU AUG

AAU

UUU

UGA

3΄ 3΄ UAC GAA - 5΄ - 5΄

3΄ UUA - 5΄

3΄ AAA - 5΄

ΜεΑσπα ΦαινυΛευθειοραγί- λαλακίνη νίνη νη νίνη

9. α. Επειδή οι διαφορετικές πολυπεπτιδικές αλυσίδες είναι δύο, δύο διαφορετικά mRNA είναι υπεύθυνα για τη σύνθεση των τεσσάρων πολυπεπτιδικών αλυσίδων της αιμοσφαιρίνης. β. α-αλυσίδα = 141 αμινοξέα. mRNA = 141 κωδικόνια (χωρίς το κωδικόνιο λήξης) ή 141 · 3 = 423 αζωτούχες βάσεις. β-αλυσίδα = 146 αμινοξέα. mRNA = 146 κωδικόνια ή 146 · 3 = = 438 αζωτούχες βάσεις. (Δεν λάβαμε υπόψη τις τρεις αζωτούχες

348

βάσεις του κωδικονίου λήξης και τις αζωτούχες βάσεις των 5΄ και 3΄ αμετάφραστων περιοχών). Τα ριβοσώματα δεν είναι εξειδικευμένα, οπότε μπορούν να χρησιμοποιηθούν ως θέση μετάφρασης για οποιοδήποτε mRNA. Αυτό εξηγεί γιατί τα βακτήρια μπορούν να χρησιμοποιηθούν ως «εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών» (σελ. 36 σχολικού βιβλίου). Ο γενετικός κώδικας είναι σχεδόν καθολικός, με συνέπεια τη σύνθεση β-αλυσίδων της αιμοσφαιρίνης στο εκχύλισμα των βακτηριακών κυττάρων (σελ. 35 σχολικού βιβλίου). Οι διαδικασίες της αντιγραφής, μεταγραφής και μετάφρασης πραγματοποιούνται με τον ίδιο τρόπο στα ευκαρυωτικά και προκαρυωτικά κύτταρα. Τέλος, οι πρωτεÀνες, τόσο στα προκαρυωτικά όσο και στα ευκαρυωτικά κύτταρα, δομούνται από τα ίδια 20 αμινοξέα.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Κωδικόνια mRNA: 5΄ - AUG - ACG - UAU - UAC - UAA - 3΄ Αντικωδικόνια των tRNA: 3΄ - UAC - 5΄, 3΄ - UGC - 5΄, 3΄ - AUA - 5΄, 3΄ - AUG - 5΄ Αμινοξέα πεπτιδίου: H2N - Μεθειονίνη Θρεονίνη - Τυροσίνη - Τυροσίνη - COOH Σημείωση: Βλέπε αιτιολόγηση της 3ης κατηγορίας ασκήσεων αυτού του κεφαλαίου.

11. α. β. γ. δ. ε.

είκοσι, συγκεκριμένη αλληλουχία. τριπλέτα, αμινοξύ. ριβοσώματα. mRNA, DNA, ριβοσώματα. βάσεων, DNA, αμινοξέων.

Γονιδιακή Ρύθμιση 1.

Στους προκαρυωτικούς οργανισμούς υπάρχουν γονίδια που οργανώνονται σε οπερόνια. Σε κάθε οπερόνιο υπάρχει ένας μόνο υποκινητής για όλα τα δομικά γονίδια. Αντίθετα, στους ευκαρυωτικούς το καθένα γονίδιο έχει

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 349

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ

2.

Είναι ομάδα γονιδίων που υπόκεινται σε κοινό έλεγχο της έκφρασής τους, π.χ. το οπερόνιο της λακτόζης περιλαμβάνει τρία δομικά γονίδια και αλληλουχίες που ρυθμίζουν τη μεταγραφή τους, βρίσκονται μπροστά τους και είναι κατά σειρά ένα ρυθμιστικό γονίδιο, ο υποκινητής και ο χειριστής (σελ. 40, 41 σχολικού βιβλίου). Συναντώνται στους προκαρυωτικούς οργανισμούς.

3. Σωστή πρόταση είναι η γ. 4. Σωστή πρόταση είναι η ε.

5. Σωστή πρόταση είναι η β. 6.

• •

ΣχΟΛιΚΟυ

ΒιΒΛιΟυ

δένεται στον υποκινητή, τα δομικά γονίδια θα μεταγράφονται και θα μεταφράζονται συνεχώς, οπότε τα ένζυμα που μεταβολίζουν τη λακτόζη θα παράγονται ανεξάρτητα αν το βακτήριο αναπτύσσεται σε θρεπτικό υλικό παρουσία ή απουσία λακτόζης.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

τον δικό του υποκινητή, οπότε λειτουργεί αυτόνομα. Στους προκαρυωτικούς οργανισμούς η γονιδιακή έκφραση ρυθμίζεται κυρίως στο επίπεδο της μεταγραφής (και στο επίπεδο της μετάφρασης), ενώ στους ευκαρυωτικούς σε τέσσερα επίπεδα: κατά τη μεταγραφή, μετά τη μεταγραφή, κατά τη μετάφραση και μετά τη μετάφραση.

υ

Σωστή πρόταση είναι η β. Στα αρχικά στάδια της εμβρυογένεσης ... Κατά συνέπεια, η ρύθμιση των γονιδίων στα ευκαρυωτικά κύτταρα γίνεται σε πολλά επίπεδα (σελ. 40 σχολικού βιβλίου).

7. Σωστή πρόταση είναι η γ. 8. Αφού δεν λειτουργεί το ρυθμιστικό γονίδιο και δεν παράγεται καταστολέας, ο χειριστής του οπερονίου είναι ελεύθερος. Η RNA πολυμεράση θα προσ-

κ εφΑλΑιο 4ο

τεχνολοΓιΑ του ΑνΑΣυνδυΑΣμενου DNA

1. α. Οι περιοριστικές ενδονουκλεάσες είναι απαραίτητα εργαλεία στη Γενετική Μηχανική, γιατί είναι ένζυμα που κόβουν το DNA σε κομμάτια με συγκεκριμένη αλληλουχία βάσεων, αφήνοντας μονόκλωνες ουρές από αζευγάρωτες βάσεις στα κομμένα άκρα. Τα άκρα αυτά μπορούν να σχηματίσουν υδρογονικούς δεσμούς με συμπληρωματικές βάσεις άλλων κομματιών DNA που έχουν κοπεί με το ίδιο ένζυμο. β. Οι φορείς κλωνοποίησης είναι μόρια DNA, όπως πλασμίδια, DNA φάγων ή αδενοϊών, που μπορούν να αυτοδιπλασιάζονται ανεξάρτητα μέσα σε ένα κύτταρο-ξενιστή, όπως π.χ. ένα βακτήριο. Μπορούν να μεταφέρουν DNA από κύτταρο σε κύτταρο. Το DNA απομονώνεται από έναν οργανισμό-δότη, κόβεται ενζυματικά με κάποια περιοριστική ενδονουκλεάση, ενώνεται με τον φορέα κλωνοποίησης που έχει κοπεί με το ίδιο ένζυμο, οπότε δημιουργείται ένα ανασυνδυασμένο DNA.

349

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 350

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο 2. Σωστή πρόταση είναι η γ. •

4.

• •

5.

• •

Εισαγωγή περί καθολικότητας του γενετικού κώδικα... (σελ. 35 σχολικού βιβλίου). Δεν θα μπορούσε να αναπτυχθεί, γιατί τα γονίδια του οργανισμού-δότη εισαγόμενα σε βακτήρια ή δεν θα μπορούσαν να εκφραστούν στα ριβοσώματα του βακτηρίου (αν π.χ. το κωδικόνιο AUG δεν ήταν κωδικόνιο έναρξης της μετάφρασης) ή θα οδηγούσαν στην παραγωγή διαφορετικών πρωτεϊνών, αφού τα κωδικόνια θα κωδικοποιούσαν διαφορετικά αμινοξέα στα κύτταρα του ανθρώπου και στα βακτήρια.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

3.

Εικόνα 4.5, σελ. 60 σχολικού βιβλίου. Για να κατασκευαστεί μια cDNA βιβλιοθήκη... ενός συγκεκριμένου γονιδίου στο κύτταρο-ξενιστή (σελ. 60 σχολικού βιβλίου).

περιοριστικές ενδονουκλεάσες, φορέα κλωνοποίησης, DNA δεσμάση. ώριμο mRNA, αντίστροφη μεταγραφάση, φορέα κλωνοποίησης, βακτήριο.

6. χρησιμοποιούμε κύτταρα στα οποία εκφράζεται το αντίστοιχο γονίδιο, οπότε παράγεται ώριμο mRNA: α. κύτταρα παγκρέατος, β. πρόδρομα ερυθροκύτταρα, γ. B-λεμφοκύτταρα, δ. μυϊκά κύτταρα. 7. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν ειδικές αλληλουχίες δίκλωνου DNA... με τις συμπληρωματικές βά-

350

σεις άλλων κομματιών DNA που έχουν κοπεί με το ίδιο ένζυμο. (σελ. 57 σχολικού βιβλίου). Επομένως, χρησιμοποιείται η ίδια περιοριστική ενδονουκλεάση, γιατί τόσο στο πλασμίδιο όσο και στο DNA του δότη προκύπτουν μονόκλωνα άκρα με αζευγάρωτες αλλά συμπληρωματικές αζωτούχες βάσεις, που μπορούν να ενωθούν με τη βοήθεια του ενζύμου DNA δεσμάση. Έτσι, δημιουργούνται ανασυνδυασμένα πλασμίδια (σελ. 58 σχολικού βιβλίου).

8. α. Βλέπε ερώτηση 1α. β. • Βλέπε ερώτηση 1β. • Το βακτήριο Agrobacterium... πλασμίδιο Τi... δημιουργία διαγονιδιακών φυτών (σελ. 131, 132 σχολικού βιβλίου). γ. • Τα βακτήρια είναι κύτταρα-ξενιστές που δέχονται με τη διαδικασία του μετασχηματισμού τα ανασυνδυασμένα πλασμίδια και, μετά τον πολλαπλασιασμό τους, δημιουργούν βακτηριακούς κλώνους (σελ. 59 σχολικού βιβλίου). • παράγουν τις περιοριστικές ενδονουκλεάσες, ενώ ορισμένα περιέχουν πλασμίδια που αποτελούν φορείς κλωνοποίησης (σελ. 57, 18 σχολικού βιβλίου). • Agrobacterium... διαγονιδιακά φυτά (σελ. 131, 132 σχολικού βιβλίου). • Bacillus... διαγονιδιακά φυτά ανθεκτικά σε έντομα και σκώληκες (ποικιλίες Bt)... (σελ. 133 σχολικού βιβλίου). 9. Σωστή πρόταση είναι η γ.

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 351

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ 10. Λανθασμένη πρόταση είναι η ε, γιατί η DNA δεσμάση ενώνει νουκλεοτιδικές αλυσίδες.

11. Σωστή πρόταση είναι η γ.

ΣχΟΛιΚΟυ

ΒιΒΛιΟυ

Τα παραπάνω συμβαίνουν, επειδή το γονίδιο που ελέγχει έναν χαρακτήρα δεν επηρεάζει τη μεταβίβαση του γονιδίου που ελέγχει έναν άλλο χαρακτήρα, με την προϋπόθεση τα γονίδια να βρίσκονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. (Αυτό συμβαίνει λόγω της τυχαίας διάταξης των ζευγών χρωμοσωμάτων στην αρχή της μειωτικής διαίρεσης). Ο ανεξάρτητος διαχωρισμός των γονιδίων γίνεται, επειδή τα χρωμοσώματα κάθε γονέα συνδυάζονται με τυχαίο τρόπο κατά τη δημιουργία των γαμετών και κάθε γονέας παράγει τέσσερα είδη γαμετών με ίση πιθανότητα για τον καθένα: ΛΚ, Λκ, λΚ, λκ.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

12. Κατά την εισαγωγή του τμήματος DNA του δότη αλλάζει η αλληλουχία των αζωτούχων βάσεων, με αποτέλεσμα το γονίδιο ανθεκτικότητας στην αμπικιλίνη να χάνει τη λειτουργικότητά του. Μετά τον μετασχηματισμό των βακτηρίων E. coli, αυτά θα πρέπει να καλλιεργηθούν σε θρεπτικό υλικό που περιέχει μόνο το αντιβιοτικό στρεπτομυκίνη, γιατί το ανασυνδυασμένο πλασμίδιο περιέχει λειτουργικό μόνο το γονίδιο ανθεκτικότητας στο αντιβιοτικό αυτό (σελ. 59 σχολικού βιβλίου). (Δεν λάβαμε υπόψη τα βακτήρια με πλασμίδιο χωρίς τμήμα DNA του οργανισμού-δότη. Αυτά είναι ανθεκτικά και στα δύο αντιβιοτικά).

υ

3. Βλέπε λυμένα προβλήματα σελ. 174 (3) – Βοήθημα. 4. Σωστή πρόταση είναι η β. Το γκρίζο χρώμα είναι ενδιάμεσος φαινότυπος. 5. Σωστή πρόταση είναι η β.

κ εφΑλΑιο 5 ο

μενδελικη κληρονομικοτητΑ

1. αλληλόμορφα, αλληλόμορφα, ομόζυγο, ετερόζυγο, επικρατές, γονότυπος. 2. Μπορούμε να πραγματοποιήσουμε τη διασταύρωση P: ΛΛΚΚ (x) λλκκ. Στην F2 γενιά θα προκύψει η Φ.Α.: λεία - κίτρινα = 9 λεία - πράσινα = 3 ρυτιδωμένα - κίτρινα = 3 ρυτιδωμένα - πράσινα = 1

6. Σωστή πρόταση είναι η ε, που καλύπτει όλες τις πιθανές περιπτώσεις γονοτύπων των γονέων (P: ♂ ιΒ_ (x) ♀ ιΑ_). 7. 1  γ

2α 3β

P: υυ (x) υυ (υπερχοληστερολαιμία) P: Ββ (x) Ββ (β-θαλασσαιμία) P: χΑχα (x) χΑυ (αιμορροφιλία)

8. Βλέπε λυμένα προβλήματα σελ. 201 (26) – Βοήθημα.

9. υπάρχει περίπτωση όταν: • Τα αλληλόμορφα γονίδια που ελέγχουν τον έναν ή και τους δύο χαρα-

351

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 352

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

• •

F1

A

α

Α

ΑΑ (υγιές)

Αα (υγιές)

α

Αα (υγιές)

αα (πάσχει)

Φ.Α. = 3 (υγιή) : 1 (πάσχει)

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

κτήρες είναι ατελώς επικρατή ή συνεπικρατή ή θνησιγόνα ή πολλαπλά αλληλόμορφα, δηλαδή όταν δεν έχουν σχέση επικρατές – υπολειπόμενο. Τα γονίδια βρίσκονται στο ίδιο ζεύγος ομόλογων χρωμοσωμάτων. Ο ένας ή και δύο χαρακτήρες ελέγχονται από φυλοσύνδετα γονίδια. Οι χαρακτήρες ελέγχονται από γονίδια που εδράζονται στο DNA των μιτοχονδρίων (αυτά κληρονομούνται από τον (♀) γονέα σε όλους τους απογόνους). Έχει συμβεί μετάλλαξη.

10. Η μερική αχρωματοψία στο κόκκινο πράσινο ελέγχεται από υπολειπόμενο φυλοσύνδετο γονίδιο. Το γονίδιο αυτό εκφράζεται φαινοτυπικά σε όλα τα αρσενικά άτομα που φέρουν το γονίδιο, αφού στο Ψ φυλετικό χρωμόσωμα δεν υπάρχει αλληλόμορφο φυλοσύνδετο γονίδιο, αλλά μόνο σε εκείνα τα θηλυκά που είναι ομόζυγα για το υπολειπόμενο γονίδιο. Επομένως, τα υπολειπόμενα φυλοσύνδετα γονίδια οδηγούν σε ασθένειες που εμφανίζονται με μεγαλύτερη συχνότητα σε αρσενικά άτομα και πάρα πολύ σπάνια σε θηλυκά. 11. Δημοσθένης (x) Ευτέρπη Αα  Αα • 3 παιδιά υγιή • 1 παιδί πάσχει Συμβολισμός: α: παθογόνο γονίδιο Α: φυσιολογικό P: ♂ Αα (x) γαμ.: Α, α

Επειδή κάθε γέννηση είναι ανεξάρτητο γεγονός, η πιθανότητα το 4ο παιδί να 1 κληρονομήσει την ασθένεια είναι . 4 Τέλος, θα πρέπει να διατυπωθεί ο 1ος νόμος του Mendel.

12. Βλέπε λυμένα προβλήματα σελ. 203 (27) – Βοήθημα.

13. Βλέπε λυμένα προβλήματα σελ. 197-198 (23) – Βοήθημα.

14. πρέπει να εξετάσουμε τέσσερις περιπτώσεις: η αχονδροπλασία να οφείλεται σε επικρατές ή υπολειπόμενο γονίδιο και να κληρονομείται ως αυτοσωμικός ή φυλοσύνδετος χαρακτήρας. Η περίπτωση που ικανοποιεί όλα τα γενεαλογικά δένδρα ταυτόχρονα είναι το επικρατές - αυτοσωμικό. Συμβολισμός: Α: γονίδιο για την αχονδροπλασία αυτοσωμικό α: φυσιολογικό Α>α ι

1

2

Α_

αυτοσωμικό Α>α ♀ Αα Α, α

ιι

1

2 Αα

ιιι

αα

3 Αα 1

αα Αα

352

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 353

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ

1

ιι ιιι

ι

1 αα 1

Αα

Αα

2

3

4

αα

Α_

αα

αα

1

2

αα

ιι

Α_

ι

2

Αα

3

Αα

ιι

αα

1

ιιι

1

2

Δ_

1

2

Δδ

2

Αα

αα

ιιι

IV

1

1

ιιι

1

δδ

2

Δδ

17. Βλέπε λυμένα προβλήματα σελ. 180 (9) – Βοήθημα.

Α_

2

Αα

2

δδ

2

αα

ιι

1

Δδ

αα

ι

δδ

1

IV

ΒιΒΛιΟυ

16. Συμβολισμός: Δ: διπλή σειρά βλεφ. αυτοσωμικό δ: φυσιολογ. βλεφ. Δ>δ P: ♂ Δδ (x) ♀ δδ γαμ.: Δ, δ δ F1: Δδ, δδ (διπλ. βλεφ.) (φυσ. βλ.) Φ.Α. = 1 (διπλ. βλεφ.) : 1 (φυσ. βλεφ.) Επειδή κάθε κύηση είναι ένα ανεξάρτητο γεγονός, η πιθανότητα το 2ο παιδί να έχει διπλές βλεφαρίδες είναι 1/2. Τέλος, θα πρέπει να διατυπωθεί ο 1ος νόμος του Mendel.

δδ

1

ΣχΟΛιΚΟυ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ι

2

υ

3

Αα

αα

1

κ εφΑλΑιο 6ο

μετΑλλΑξειΣ

Αα 15. Βλέπει λυμένα προβλήματα σελ. 188 (18) – Βοήθημα.

1. Σωστή πρόταση είναι η ε. Αυτό συμβαίνει, γιατί με την αντικατάσταση μπορεί να προκύψει συνώνυμο κωδικόνιο.

353

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 354

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο Μεταλλαγμένη πρωτεΐνη Α: Στην κωδική αλυσίδα του DNA, το φυσιολογικό κωδικόνιο ATG αντικαθίσταται από το ΑΤΤ (ή το ATC ή το ΑΤΑ). • Μεταλλαγμένη πρωτεΐνη Β: Από την τριπλέτα TGT, που κωδικοποιεί την κυστεΐνη, όταν αφαιρεθεί το πρώτο νουκλεοτίδιο, τότε αλλάζει η αλληλουχία των αμινοξέων στην πολυπεπτιδική αλυσίδα. • Μεταλλαγμένη πρωτεΐνη Γ: Η τριπλέτα TGG, που κωδικοποιεί την τρυπτοφάνη, αντικαθίσταται από την τριπλέτα TGA ή TAG, που μετά τη μεταγραφή δίνει κωδικόνιο λήξης. (Άλλος τρόπος εξήγησης του προβλήματος αυτού αποτελεί η προσθήκη Α μεταξύ U και G ή μεταξύ G και G στο κωδικόνιο που κωδικοποιεί την τρυπτοφάνη). • Μεταλλαγμένη πρωτεΐνη Δ: Μεταξύ του τρίτου και τέταρτου νουκλεοτιδίου της κωδικής αλυσίδας του DNA προστίθεται νουκλεοτίδιο με Α, οπότε αλλάζει τελικά η αλληλουχία όλων των αμινοξέων μετά το πρώτο αμινοξύ. Σημείωση: Στην παραπάνω ερώτηση πρώτα βρίσκουμε την αλλαγή που συνέβη στο mRNA, μετά στη μη κωδική αλυσίδα και τέλος στην κωδική αλυσίδα του γονιδίου. Το ίδιο ισχύει και για τις επόμενες ερωτήσεις. Βλέπε λυμένα προβλήματα σελ. 256, 257 (1, 2, 3) – Βοήθημα. •

Το κωδικόνιο AAG (ή ΑΑΑ) αντικαθίσταται από το CAG (ή το CAA). Μεταλλαγμένη αιμοσφαιρίνη Hb D Ibadan: Το κωδικόνιο ACG (ή ACA) αντικαθίσταται από το AAG (ή το ΑΑΑ). Μεταλλαγμένη αιμοσφαιρίνη Hb G Philadelphia: Το κωδικόνιο ΑΑΤ (ή AAC) αντικαθίσταται από το AAG (ή το ΑΑΑ).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

2.

3.

354

Μεταλλαγμένη αιμοσφαιρίνη Hb Hi kari: Το κωδικόνιο AAG (ή ΑΑΑ) αντικαθίσταται από το ΑΑΤ (ή το AAC). Μεταλλαγμένη αιμοσφαιρίνη Hb I:

4. Η αντικατάσταση του αμινοξέος είναι αποτέλεσμα γονιδιακής μετάλλαξης στην τριπλέτα που κωδικοποιεί το 6ο αμινοξύ. Στην κωδική αλυσίδα του DNA, το κωδικόνιο GAA (ή GAG), που κωδικοποιεί το γλουταμινικό οξύ, αντικαθίσταται από το ΑΑΑ (ή το AAG), που κωδικοποιεί τη λυσίνη.

5. α. Η αλλαγή που οδηγεί στον φαινότυπο της Constant Spring είναι μια γονιδιακή μετάλλαξη αντικατάστασης βάσης στην τριπλέτα του DNA που κωδικοποιεί τη λήξη (ΤΑΑ ή TAG ή TGA), με αποτέλεσμα να προκύπτει η τριπλέτα CAA (ή CAG) που κωδικοποιεί τη γλουταμίνη και να συνεχίζεται η μετάφραση. β. Όπως και παραπάνω, το κωδικόνιο λήξης αντικαθίσταται από το κωδικόνιο TCA (ή TCG) που κωδικοποιεί τη σερίνη ή από το κωδικόνιο ΑΑΑ (ή AAG) που κωδικοποιεί τη λυσίνη. γ. Το συμπέρασμα που εξάγεται είναι ότι έγινε γονιδιακή μετάλλαξη αντικατάστασης βάσης μόνο στο κωδικόνιο λήξης στο DNA που κωδικοποιεί τη φυσιολογική αιμοσφαιρίνη, με αποτέλεσμα να συνεχίζεται η μετάφραση.

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 355

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ 6. Λανθασμένη πρόταση είναι η δ, επειδή η έλλειψη τμήματος ενός χρωμοσώματος είναι δομική χρωμοσωμική ανωμαλία και όχι αριθμητική, όπως η ανευπλοειδία.

ΒιΒΛιΟυ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΣχΟΛιΚΟυ

κό χρωμόσωμα (44 αυτοσωμικά + χχυ). • Στον καρυότυπο των ατόμων που πάσχουν από το σύνδρομο Down εμφανίζεται ένα επιπλέον αυτοσωμικό χρωμόσωμα στο 21ο ζεύγος (45 αυτοσωμικά + χχ ή χυ). • Στον καρυότυπο των ατόμων που πάσχουν από το σύνδρομο Turner εμφανίζεται ένα χ φυλετικό χρωμόσωμα από το ζεύγος των φυλετικών χρωμοσωμάτων (44 αυτοσωμικά + χΟ). Σημείωση: Με τον καρυότυπο μπορούν να ανιχνευτούν αριθμητικές χρωμοσωμικές ανωμαλίες και δομικές, μετά από χρώση των χρωμοσωμάτων και σύγκρισή τους, στη συνέχεια, με φυσιολογικά χρωμοσώματα).

7. Σωστή στήλη είναι η Δ. 8.

υ

Αν με την αντικατάσταση μίας βάσης προκύψει συνώνυμο κωδικόνιο, τότε δεν αλλάζει η ακολουθία των αμινοξέων στην παραγόμενη πρωτεΐνη (σιωπηλή μετάλλαξη). Στις περισσότερες όμως περιπτώσεις, μία αντικατάσταση βάσης δημιουργεί τριπλέτα που κωδικοποιεί ένα διαφορετικό αμινοξύ ... HbS στη δρεπανοκυτταρική αναιμία (σελ. 91 σχολικoύ βιβλίου). Σε άλλες περιπτώσεις, μια αντικατάσταση βάσης μπορεί να μετατρέψει ένα κωδικόνιο που κωδικοποιεί κάποιο αμινοξύ σε ένα κωδικόνιο λήξης ... λειτουργικότητα της πρωτεΐνης (σελ. 91 σχολικoύ βιβλίου). Τέλος, η αντικατάσταση μιας βάσης σε κωδικόνιο λήξης οδηγεί σε κωδικόνιο που κωδικοποιεί κάποιο αμινοξύ, με συνέπεια τον σχηματισμό μεγαλύτερης και συνήθως μη λειτουργικής πρωτεΐνης.

9. α  4, β  1, γ  2, δ  3.

10. Σωστές προτάσεις είναι οι β, γ και στ, που οφείλονται σε αριθμητικές χρωμοσωμικές ανωμαλίες. • Στον καρυότυπο των ατόμων που πάσχουν από το σύνδρομο Klinefelter εμφανίζεται ένα επιπλέον χ φυλετι-

11.

Σωστές προτάσεις είναι οι α και γ, αφού στη μεν έλλειψη έχουμε απώλεια γενετικού υλικού, στον δε διπλασιασμό έχουμε επανάληψη ενός χρωμοσωμικού τμήματος στο χρωμόσωμα. Αντίθετα, η αναστροφή και η αμοιβαία μετατόπιση έχουν ως αποτέλεσμα την αλλαγή στη διάταξη των γονιδίων στα χρωμοσώματα.

12. Βλέπε λυμένα προβλήματα σελ. 259 (5) – Βοήθημα.

13. Βλέπε λυμένα προβλήματα σελ. 259-260 (6) – Βοήθημα.

355

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 356

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

κ εφΑλΑιο 7 ο

ΑρχεΣ κΑι μεθοδολοΓιΑ τηΣ ΒιοτεχνολοΓιΑΣ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. pH, O2, θερμοκρασία, βιοαντιδραστήρες, βιομάζα, προϊόντα κυττάρων, σταθερός, εκθετική. 2. Δεν ισχύουν το α και το δ.

356

α. Το pH, η παρουσία ή απουσία Ο2 και η θερμοκρασία... (σελ. 108 σχολικού βιβλίου). β. Η διαθεσιμότητα θρεπτικών συστατικών (νερό, πηγή C, πηγή Ν, μεταλλικά ιόντα)... (σελ. 108 σχολικού βιβλίου).

5. Οι παράγοντες που επηρεάζουν το σχήμα της καμπύλης είναι αυτοί που οδηγούν στις τέσσερις φάσεις μιας κλειστής καλλιέργειας (λανθάνουσα, εκθετική, στατική, φάση θανάτου).

550

γ

Αριθμός βακτηρίων

3. α. Στα διαστήματα που αναφέρονται έχουμε: 0-2 ώρες: λανθάνουσα φάση 2-6 ώρες: τμήμα εκθετικής φάσης 8-10 ώρες: τμήμα στατικής φάσης 12-14 ώρες: φάση θανάτου. β. Η παραγωγή της αιθανόλης ακολουθεί τις φάσεις ανάπτυξης του ζυμομύκητα. γ. 0-20 ώρες: λανθάνουσα φάση. Στη φάση αυτή η παραγωγή πενικιλίνης είναι μηδενική. 20-80 ώρες: εκθετική φάση. Στην αρχή της φάσης αυτής η παραγωγή πενικιλίνης είναι ελάχιστη, αλλά αυξάνεται με την πάροδο του χρόνου. 80-160 ώρες: στατική φάση. Από το μέσον της εκθετικής φάσης και, κυρίως, στη στατική φάση έχουμε την παραγωγή μεγαλύτερης ποσότητας πενικιλίνης. 4.

γ. Ο έλεγχος της συγκέντρωσης τοξικών προϊόντων του μεταβολισμού των μικροοργανισμών... (σελ. 111 σχολικού βιβλίου). Η διασφάλιση των συνθηκών ασηψίας είναι απαραίτητη, για να μην αναπτυχθούν άλλοι μικροοργανισμοί ταυτόχρονα με τον επιθυμητό στην καλλιέργεια, κάτι που αν συνέβαινε, θα μείωνε την παραγωγή του επιθυμητού προϊόντος.

δ

β

α

χρόνος (ώρες)

α. β. γ. δ.

Λανθάνουσα φάση Εκθετική φάση Στατική φάση Φάση θανάτου

}

σελ. 110, 111 σχολικού βιβλίου

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 357

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ

εφΑρμοΓεΣ τηΣ ΒιοτεχνολοΓιΑΣ Στην ιΑτρικη

• • • • • • •

ώριμα mRNA από κύτταρα παγκρέατος. Ένζυμα (αντίστροφη μεταγραφάση, DNA πολυμεράση, περιοριστική ενδονουκλεάση, DNA δεσμάση, για τη μετατροπή της προϊνσουλίνης σε ινσουλίνη). Ουσίες για την αποδιάταξη των mRNA των υβριδικών μορίων cDNA-mRNA. πλασμίδια (φορείς κλωνοποίησης) Βακτήρια E. coli (κύτταρα-ξενιστές). Αντιβιοτικό. Θρεπτικό υλικό. Νουκλεοτίδια για τη δημιουργία cDNA αλυσίδων και δίκλωνων μορίων DNA. Ανιχνευτές.

ΒιΒΛιΟυ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΣχΟΛιΚΟυ

κης, δημιουργούνται δίκλωνα μόρια DNA που είναι ολόκληρα γονίδια και περιέχουν μόνο εξώνια. Τα γονίδια αυτά, αφού εισαχθούν σε βακτήρια μέσω πλασμιδίων, εκφράζονται και παράγουν πρωτεÀ νες μεταξύ των οποίων και προϊνσουλίνη.

κ εφΑλΑιο 8 ο

1.

υ

2. α. Στον πυρήνα και τα ριβοσώματα του κυτταροπλάσματος, αντίστοιχα. β. • Εισάγοντας σε βακτήριο το ανθρώπινο γονίδιο που κωδικοποιεί την ινσουλίνη, με τη μεταγραφή παράγεται πρόδρομο mRNA (τα περισσότερα γονίδια του πυρήνα των ευκαρυωτικών κυττάρων είναι ασυνεχή ή διακεκομμένα). Επειδή στα βακτήρια δεν πραγματοποιείται ωρίμανση (αφού δεν παράγουν snRNA), δεν παράγεται τελικά προϊνσουλίνη. • Αντίθετα, με την απομόνωση ώριμων mRNA από κύτταρα παγκρέατος και ακολουθώντας τη διαδικασία δημιουργίας cDNA βιβλιοθή-

3.

Για την αποκάλυψη των εξελικτικών σχέσεων που υπάρχουν μεταξύ των ειδών... (σελ. 126 σχολικού βιβλίου). Επειδή χρησιμοποιούνται ως πειραματόζωα για τη μελέτη ασθενειών, όπως π.χ. του καρκίνου. Για την παραγωγή μονοκλωνικών αντισωμάτων... (σελ. 119 σχολικού βιβλίου).

4. παλιότερα παίρναμε ανθρώπινη αυξητική ορμόνη από εγκεφάλους πτωμάτων σε πολύ μικρή ποσότητα, με αποτέλεσμα το μεγάλο κόστος. Σήμερα, με τη Γενετική Μηχανική, παράγονται σημαντικές ποσότητες με μικρό κόστος. 5.

Γιατί ο αριθμός των διαβητικών είναι πολύ μεγάλος. Σήμερα υπολογίζεται ότι πάνω από 60.000.000 άτομα στον κόσμο πάσχουν από διαβήτη... (σελ. 117 σχολικού βιβλίου). Η χρήση ινσουλίνης από χοίρους και από βοοειδή προκαλούσε αλλεργικές αντιδράσεις... (σελ. 118 σχολικού βιβλίου). Επιπλέον, με τη Γενετική Μηχανική παράγονται μεγάλες ποσότητες με μικρό κόστος.

357

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 358

νση κείου / Θετική Κατεύθυ ΄ Ενιαίου Λυ Γ α ί γ ο λ Βιο

κ εφΑλΑιο 9 ο •

εφΑρμοΓεΣ τηΣ ΒιοτεχνολοΓιΑΣ Στη ΓεωρΓιΑ κΑι την κτηνοτροφιΑ •

2.

• •

358

Με τη βοήθεια του πλασμιδίου Ti. Το ανασυνδυασμένο πλασμίδιο Ti που φέρει το επιθυμητό γονίδιο εισάγεται σε φυτικά κύτταρα που αναπτύσσονται σε ειδικές καλλιέργειες στο εργαστήριο με τη βοήθεια του βακτηρίου Agrobacterium. Τα τροποποιημένα αυτά φυτικά κύτταρα δίνουν τελικά έναν νέο φυτικό οργανισμό, που περιέχει και εκφράζει το ξένο γονίδιο... (σελ. 131, 132 σχολικού βιβλίου). Με τη μέθοδο της μικροέγχυσης. Το επιθυμητό γονίδιο εισάγεται με ειδική μικροβελόνα σε γονιμοποιημένο ωάριο. Το ξένο γενετικό υλικό ενσωματώνεται συνήθως σε κάποιο από τα χρωμοσώματα του πυρήνα του ζυγωτού. Το ζυγωτό τοποθετείται στη συνέχεια στη μήτρα της «θετής» μητέρας, ενός ζώου στο οποίο θα αναπτυχθεί το έμβρυο... (σελ. 133 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1.

συνθήκες περιβάλλοντος, όπως σε συνθήκες παγετού. παραγωγή νέων ποικιλιών φυτών, ανθεκτικών σε ζιζάνια. Φυτά ανθεκτικά σε μολύνσεις από ιούς, βακτήρια και μύκητες.

Διαγονιδιακά φυτά που παράγουν τοξίνες εναντίων εντόμων και σκωλήκων (ποικιλίας Bt). Διαγονιδιακά φυτά που παράγουν προϊόντα τα οποία έχουν μεγαλύτερη «διάρκεια ζωής» από το χωράφι έως τον καταναλωτή. Γενετικά τροποποιημένα φυτά με μεγάλο μέγεθος καρπών. Φυτά προσαρμοσμένα σε ακραίες

3.

Μετά την απομόνωση του γονιδίου του βακτηρίου Bacillus, που παράγει την ισχυρή τοξίνη, αυτό εισάγεται στο πλασμίδιο Ti. Στη συνέχεια, το ανασυνδυασμένο πλασμίδιο Ti εισάγεται σε φυτικά κύτταρα που αναπτύσσονται σε ειδικές καλλιέργειες στο εργαστήριο με τη βοήθεια του βακτηρίου Agrobacterium. Τα τροποποιημένα φυτικά κύτταρα δίνουν τελικά έναν νέο φυτικό οργανισμό, που περιέχει και εκφράζει το ξένο γονίδιο. Μ’ αυτό τον τρόπο έχουν σήμερα δημιουργηθεί γενετικά τροποποιημένα φυτά, που αποτελούν τις ποικιλίες Bt... (σελ. 133, 131, 132 σχολικού βιβλίου). Άλλη μέθοδος αποτελεί ο πολλαπλασιασμός των βακτηρίων Bacillus στο εργαστήριο και ο ψεκασμός τους στη συνέχεια στον αγρό... (σελ. 133 σχολικού βιβλίου).

4. α. Με τη μέθοδο της επιλογής και των διασταυρώσεων δεν θα μπορούσε, γιατί φυσιολογικά δεν υπάρχουν μηρυκαστικά που να παράγουν τον ανθρώπινο πηκτικό παράγοντα ιχ στο γάλα τους. β. Με τη μέθοδο της μικροέγχυσης όμως –Γενετική Μηχανική– θα μπορούσε να προκύψει διαγονιδιακό μηρυκαστικό που να παράγει τον πα-

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 6:12 μμ Page 359

ΑπΑΝΤΗΣΕιΣ ΤωΝ ΕρωΤΗΣΕωΝ ΤΟ ράγοντα ιχ στο γάλα του (βήματα που απαιτούνται για την παραγωγή φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης από διαγονιδιακό ζώο, σελ. 135 σχολικού βιβλίου). •

ΣχΟΛιΚΟυ

ΒιΒΛιΟυ

αυξημένη σωματική ανάπτυξη, που παράγουν περισσότερο γάλα. Για τη δημιουργία διαγονιδιακών ζώων, στο γάλα των οποίων να εκκρίνονται φαρμακευτικές πρωτεΐνες.

Για τη δημιουργία διαγονιδιακών ζώων ανθεκτικών σε ασθένειες, με

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

5.

υ

359

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ΑΠΑΝΤΗΣΕΙΣ ΣΧΟΛΙΚΟΥ_Layout 1 19/11/2012 7:08 μμ Page 360

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 361

ατα μ ε Θ Στικα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

υα δ λλαδικων ν ε ν υ α Σ ΄- Π Γ α Θεμ

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 362

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

κ εφαλαιο 1 ο: τ ο Γ ενετικο υλικο

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Πώς μπορούμε να διαπιστώσουμε με βάση το γενετικό υλικό αν δύο ευκαρυωτικοί οργανισμοί ανήκουν σε διαφορετικά είδη;

Α ΠΑΝΤΗΣΗ

• •

Εφαρμόζοντας την αναλογία Α+Τ/G+C… (σελ. 14 σχολικού βιβλίου). Από τον αριθμό και τη μορφή των χρωμοσωμάτων-καρυότυπος ... (σελ. 20 σχολικού βιβλίου).

2. Να περιγράψετε τον σχηματισμό μιας πολυνουκλεοτιδικής αλυσίδας με προσανατολισμό 5΄  3΄.

Α ΠΑΝΤΗΣΗ

• • •

Εισαγωγή για τη δημιουργία 3΄-5΄ φωσφοδιεστερικού δεσμού... (σελ. 14 σχολικού βιβλίου). Κατά την αντιγραφή με τη βοήθεια του πριμοσώματος και των DNA πολυμερασών... (σελ. 28, 30 σχολικού βιβλίου). Κατά τη μεταγραφή με τη βοήθεια των RNA πολυμερασών... (σελ. 32, 33 σχολικού βιβλίου).

3. Ποια είναι τα θεμελιώδη χαρακτηριστικά των αλυσίδων της διπλής έλικας του DNA;

Α ΠΑΝΤΗΣΗ

• •

O προσανατολισμός κάθε πολυνουκλεοτιδικής αλυσίδας είναι 5΄  3΄... (σελ. 14 σχολικού βιβλίου). Οι δύο αλυσίδες είναι συμπληρωμαιτκές και αντιπαράλληλες... (σελ. 17 σχολικού βιβλίου).

4. Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα;

Α ΠΑΝΤΗΣΗ

• • •

362

Το δίκλωνο και κυκλικό μόριο DNA αναδιπλώνεται και πακετάρεται με τη βοήθεια κυρίως πρωτεϊνών... (σελ. 18 σχολικού βιβλίου). Σε πολλά βακτήρια, εκτός από το κύριο κυκλικό μόριο DNA, υπάρχουν και τα πλασμίδια... (σελ. 18 σχολικού βιβλίου). Εκτός από τα γονίδια που λειτουργούν συνεχώς και αυτόνομα σε φυσιολογικές συνθήκες (π.χ. το γονίδιο για τη διάσπαση της γλυκόζης) υπάρχουν γονίδια που οργανώνονται σε οπερόνια... (σελ. 41,40 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 363

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

5. Πώς οργανώνεται το γενετικό υλικό στα ευκαρυωτικά κύτταρα;

Α ΠΑΝΤΗΣΗ

• •

Στον πυρήνα: Νουκλεοσώματα... ινίδια χρωματίνης (μεσόφαση)... χρωμοσώματα (μίτωση)... (σελ. 18, 19, 20 σχολικού βιβλίου). Στα μιτοχόνδρια: 2-10 αντίγραφα κυκλικού μορίου DNA ... (σελ. 21 σχολικού βιβλίου). Στους χλωροπλάστες: Το DNA τους είναι κυκλικό μόριο και έχει μεγαλύτερο μέγεθος από το μιτοχονδριακό DNA.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

6. Ποια είναι τα χαραστηριστικά του μεταφασικού χρωμοσώματος ανθρώπινου σωματικού κυττάρου;

Α ΠΑΝΤΗΣΗ

• • •

Αποτελείται από δύο αδελφές χρωματίδες ενωμένες στο κεντρομερίδιο. Το κεντρομερίδιο διαιρεί κάθε χρωματίδα σε δύο βραχίονες (σελ. 20 σχολικού βιβλίου). Οι δύο αδελφές χρωματίδες είναι πανομοιότυπες μεταξύ τους Εμφανίζει τον μέγιστο βαθμό συσπείρωσης.

7. Σε ποια μέρη ενός ανθρώπινου σωματικού κυττάρου υπάρχει DNA;

Α ΠΑΝΤΗΣΗ

• •

Στον πυρήνα: 44 αυτοσωμικά χρωμοσώματα και δύο φυλετικά (ΧΧ ή ΧΨ). Στα μιτοχόνδρια: 2-10 αντίγραφα κυκλικού μορίου DNA.

8. Ποιες πληροφορίες αντλούμε παρατηρώντας τον καρυότυπο ενός οργανισμού;

Α ΠΑΝΤΗΣΗ

• • •

Προσδιορίζουμε το είδος του οργανισμού από τον αριθμό και τη μορφολογία των χρωμοσωμάτων... (σελ. 20 σχολικού βιβλίου). Προσδιορίζουμε το φύλο, παρατηρώντας το ζευγάρι των φυλετικών χρωμοσωμάτων... (σελ. 20 σχολικού βιβλίου). Εντοπίζουμε τυχόν χρωμοσωμικές ανωμαλίες... (σελ. 96, 97 σχολικού βιβλίου).

9. Ποιες θεμελιώδεις μεταβολικές διαδικασίες πραγματοποιούνται στα μιτοχόνδρια και τους χλωροπλάστες;

Α ΠΑΝΤΗΣΗ • • • • •

Αντιγραφή, αφού έχουν δικό τους DNA. Μεταγραφή. Μετάφραση, αφού έχουν ριβοσώματα. Οξειδωτική φωσφορυλίωση στα μιτοχόνδρια. Φωτοσύνθεση στους χλωροπλάστες.

363

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 364

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

κ εφαλαιο 2 ο : α ντιΓραφη , ε κφραΣη και ρ υΘμιΣη τηΣ Γ ενετικηΣ Π ληροφοριαΣ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Πού πραγματοποιούνται η αντιγραφή και η μεταγραφή;

Α ΠΑΝΤΗΣΗ

• •

Ευκαρυωτικά κύτταρα: στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Προκαρυωτικά κύτταρα: στο κυτταρόπλασμα.

2. Ποιες είναι οι κατηγορίες γονιδίων με κριτήριο το προϊόν της μεταγραφής τους;

Α ΠΑΝΤΗΣΗ

1η διάκριση: • Γονίδια που μεταγράφονται σε mRNA και μεταφράζονται στη συνέχεια σε πρωτεΐνες. • Γονίδια που μεταγράφονται και παράγουν tRNA, rRNA και snRNA... (σελ. 31 σχολικού βιβλίου). 2η διάκριση: • Ασυνεχή ή διακεκομμένα, που με τη μεταγραφή δίνουν πρόδρομο mRNA... (σελ. 33 σχολικού βιβλίου). • Συνεχή, που με τη μεταγραφή δίνουν mRNA που περιέχει μόνο εξώνια... (σελ. 33 σχολικού βιβλίου). 3. Ποια είδη RNA γνωρίζετε; (ονομαστική αναφορά)

Α ΠΑΝΤΗΣΗ

• • • • • •

Aγγελιαφόρο RNA (mRNA) Ριβοσωμικό RNA (rRNA) Μεταφορικό RNA (tRNA) Μικρό πυρηνικό RNA (snRNA) RNA- γενετικό υλικό ιών Πρωταρχικά τμήματα RNA

4. Ποια τμήματα του γονιδιώματος δεν μεταγράφονται;

Α ΠΑΝΤΗΣΗ • •

364

Περιοχές που δεν αποτελούν γονίδια... (σελ. 60 σχολικού βιβλίου). Οι υποκινητές των γονιδίων... (σελ. 32, 41 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 365

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ • •

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

Τα ανενεργά γονίδια λόγω κυτταρικής διαφοροποίησης... (σελ. 40 σχολικού βιβλίου). Οι χειριστές των οπερονίων... (σελ. 41 σχολικού βιβλίου).

5. Ποια τμήματα του γονιδιώματος μεταγράφονται, αλλά δεν μεταφράζονται;

Α ΠΑΝΤΗΣΗ • • •

Οι 3΄ και 5΄ αμετάφραστες περιοχές της μη κωδικής αλυσίδας των γονιδίων. Τα εσώνια των ασυνεχών ή διακεκομμένων γονιδίων. Τα κωδικόνια λήξης. Γονίδια που μεταγράφονται και παράγουν tRNA, rRNA και snRNA.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

6. Σε ποιες περιπτώσεις σχηματίζονται υβρίδια DNA-RNA;

Α ΠΑΝΤΗΣΗ

• • • • •

Μητρικές αλυσίδες- πρωταρχικά τμήματα RNA (αντιγραφή). Μη κωδική αλυσίδα γονιδίου – RNA (μεταγραφή). RNA ιών – DNA (αντίστροφη μεταγραφή)... (σελ. 31 σχολικού βιβλίου). Ώριμα RNA- cDNA αλυσίδες (κατασκευή cDNA βιβλιοθηκών)... (σελ. 60 σχολικού βιβλίου). Ανιχνευτές RNA – μόριο DNA με επιθυμητό γονίδιο (υβριδοποίηση)... (σελ. 61 σχολικού βιβλίου).

7. Σε ποιες περιπτώσεις συνδέονται αλυσίδες DNA;

Α ΠΑΝΤΗΣΗ

• • •

Στη διπλή έλικα του DNA (γενετικό υλικό)... (σελ. 16 σχολικού βιβλίου). Μητρικές αλυσίδες – νεοσυντιθέμενες (αντιγραφή). Ανιχνευτές DNA – μόριο DNA με επιθυμητό γονίδιο (υβριδοποίηση)... (σελ. 60, 61 σχολικού βιβλίου).

8. Σε ποιες περιπτώσεις συνδέονται αλυσίδες RNA μεταξύ τους;

Α ΠΑΝΤΗΣΗ

• • • •

rRNA μικρής υπομονάδας ριβοσώματος – 5΄ αμετάφραστη περιοχή mRNA (μετάφραση)... (σελ. 36 σχολικού βιβλίου). Κωδικόνια mRNA – αντικωδικόνια των tRNA (μετάφραση)... (σελ. 37 σχολικού βιβλίου). Αυτοδιπλασιασμός RNA ιών... (σελ. 31 σχολικού βιβλίου). Στο δίκλωνο RNA (γενετικό υλικό ορισμένων ιών)... (σελ. 22 σχολικού βιβλίου).

365

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 366

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

9. Πότε νουκλεϊκά οξέα, προκειμένου να αποκτήσουν βιολογικό ρόλο, ενώνονται με πρωτεΐνες;

Α ΠΑΝΤΗΣΗ

• •

DNA + πρωτεΐνες ... νουκλεοσώματα ... ινίδια χρωματίνης ... χρωμοσώματα ... (σελ. 18, 20 σχολικού βιβλίου). rRNA + πρωτεΐνες ... ριβοσώματα ... (σελ. 36 σχολικού βιβλίου). snRNA + πρωτεΐνες ... μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» ... (σελ. 33 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

10. Ποια ένζυμα συνδέουν νουκλεοτίδια με 3΄-5΄ φωσφοδιεστερικό δεσμό;

Α ΠΑΝΤΗΣΗ

• • • • •

DNA πολυμεράσες... (σελ. 28 σχολικού βιβλίου). DNA δεσμάση... (σελ. 30, 58 σχολικού βιβλίου). Ειδικά επιδιορθωτικά ένζυμα... (σελ. 30 σχολικού βιβλίου). RNA πολυμεράση... (σελ. 32 σχολικού βιβλίου). Αντίστροφη μεταγραφάση... (σελ. 31, 60 σχολικού βιβλίου).

11. Ποια ένζυμα σπάζουν 3΄-5΄ φωσφοδιεστερικούς δεσμούς;

Α ΠΑΝΤΗΣΗ

• • •

DNA πολυμεράσες ... (σελ. 28, 30 σχολικού βιβλίου). Ειδικά επιδιορθωτικά ένζυμα... (σελ. 30 σχολικού βιβλίου). περιοριστικές ενδονουκλεάσες... (σελ. 57 σχολικού βιβλίου).

12. Πού συναντώνται τα ριβοσώματα;

Α ΠΑΝΤΗΣΗ

• • • •

Στο κυτταρόπλασμα των ευκαρυωτικών κυττάρων. Στα μιτοχόνδρια. Στους χλωροπλάστες. Στο κυτταρόπλασμα των προκαρυωτικών κυττάρων.

13. Κατά την αντιγραφή του DNA, πού βρίσκει εφαρμογή η συμπληρωματικότητα των βάσεων;

Α ΠΑΝΤΗΣΗ •

366

Μεταξύ των μητρικών αλυσίδων DNA και των πρωταρχικών τμημάτων RNA… (σελ. 28 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 367

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

• •

ΛΑδιΚω Ν

)

Μεταξύ των μητρικών αλυσίδων DNA και των νεοσυντιθέμενων θυγατρικών αλυσίδων... (σελ. 28 σχολικού βιβλίου). Κατά την αντικατάσταση των πρωταρχικών τμημάτων RNA από τις DNA πολυμεράσες... (σελ. 30 σχολικού βιβλίου). Κατά την επιδιόρθωση των λαθών από τις DNA πολυμεράσες και τα ειδικά επιδιορθωτικά ένζυμα... (σελ. 28, 30 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Γ ΄ - ΠΑΝΕΛ

14. Κατά τη μεταγραφή του DNA, πού βρίσκει εφαρμογή η συμπληρωματικότητα των βάσεων;

Α ΠΑΝΤΗΣΗ

Μεταξύ της μη κωδικής αλυσίδας του γονιδίου και του RNA που προκύπτει με τη βοήθεια του ενζύμου RNA πολυμεράση... (σελ. 26, 27 σχολικού βιβλίου).

15. Κατά τη μετάφραση του mRNA, πού βρίσκει εφαρμογή η συμπληρωματικότητα των βάσεων;

Α ΠΑΝΤΗΣΗ

• •

Μεταξύ της 5΄ αμετάφρασης περιοχής του mRNA και του rRNA της μικρής υπομονάδας του ριβοσώματος... (σελ. 36 σχολικού βιβλίου). Μεταξύ των κωδικονίων του mRNA και των αντικωδικονίων των tRNA που συμμετέχουν στην μετάφραση... (σελ. 36, 37 σχολικού βιβλίου).

16. Με ποιους τρόπους ένα κύτταρο μπορεί να δημιουργεί ταυτόχρονα πολλά μόρια της ίδιας πρωτεΐνης;

Α ΠΑΝΤΗΣΗ

• •

Από ένα μόνο γονίδιο, με τη μεταγραφή, προκύπτουν πολλά αντίγραφα του mRNA… (σελ. 37 σχολικού βιβλίου). Κάθε αντίγραφο του mRNA μπορεί να μεταφράζεται ταυτόχρονα από πολλά ριβοσώματα, το καθένα σε διαφορετικό σημείο κατά μήκος του μορίου (πολύσωμα)... (σελ. 38 σχολικού βιβλίου).

17. Ποιες περιοχές του οπερονίου της λακτόζης δεν κωδικοποιούν αμινοξέα;

Α ΠΑΝΤΗΣΗ • • • •

Ο υποκινητής των τριών δομικών γονιδίων. Ο χειριστής. Οι αμετάφραστες περιοχές του ρυθμιστικού γονιδίου και των δομικών γονιδίων. Το κωδικόνιο λήξης του ρυθμιστικού γονιδίου και τα κωδικόνια λήξης των δομικών γονιδίων.

367

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 368

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

18. Ποιος είναι ο ρόλος των μεταγραφικών παραγόντων;

Α ΠΑΝΤΗΣΗ

διευκολύνουν την πρόσδεση της RNA πολυμεράσης στον υποκινητή του γονιδίου... (σελ. 32 σχολικού βιβλίου). Στο επίπεδο της μεταγραφής... (σελ. 41, 42 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

19. Ποια γονίδια παραμένουν λειτουργικά σε όλους τους κυτταρικούς τύπους, παρά την κυτταρική διαφοροποίηση που συμβαίνει στα αρχικά στάδια της εμβρυογένεσης;

Α ΠΑΝΤΗΣΗ

• • •

• • •

Γονίδια που κωδικοποιούν τις ιστόνες και τα άλλα είδη πρωτεϊνών που συμμετέχουν στη δημιουργία των ινιδίων χρωματίνης... (σελ. 18 σχολικού βιβλίου). Γονίδια που κωδικοποιούν τις πρωτεΐνες που συνδέονται με το rRNA και δημιουργούν τα ριβοσώματα... (σελ. 31 σχολικού βιβλίου). Γονίδια που κωδικοποιούν τις πρωτεΐνες που συνδέονται με το snRNA και δημιουργούν τα μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» που συμμετέχουν στη διαδικασία της ωρίμανσης... (σελ. 33 σχολικού βιβλίου). Γονίδια που μεταγράφονται και παράγουν tRNA, rRNA και snRNA. Τα γονίδια που κωδικοποιούν τα ένζυμα της αντιγραφής, μεταγραφής και μετάφρασης. Τα γονίδια που κωδικοποιούν τις πρωτεΐνες-ένζυμα που συμμετέχουν στην οξειδωτική φωσφορυλίωση των μιτοχονδρίων.

20. Γιατί ο αριθμός των αμινοξέων μιας πολυπεπτιδικής αλυσίδας ευκαρυωτικού κυττάρου είναι κατά πολύ μικρότερος του αριθμού των νουκλεοτιδίων του αντίστοιχου γονιδίου;

Α ΠΑΝΤΗΣΗ

• • • • •

368

Τα νουκλεοτίδια του πρόδρομου mRNA είναι τα μισά του γονιδίου, αφού μεταγράφεται η μη κωδική ασλυδία. Αν το γονίδιο είναι ασυνεχές, τα νουκλεοτίδια των εσωνίων του πρόδρομου mRNA αφαιρούνται με τη διαδικασία της ωρίμανσης. Τα νουκλεοτίδια των 5΄ και 3΄ αμετάφραστων περιοχών του ώριμου mRNA δεν κωδικοποιούν αμινοξέα. Τα νουκλεοτίδια του κωδικονίου λήξης δεν κωδικοποιούν αμινοξέα. Τρία νουκλεοτίδια (κωδικόνιο) κωδικοποιούν ένα αμινοξύ, αφού ο γενετικός κώδικας είναι κώδικας τριπλέτας.

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 369

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

21. Σε ποια επίπεδα ρυθμίζεται η γονιδιακή έκφραση στα προκαρυωτικά κύτταρα;

Α ΠΑΝΤΗΣΗ • •

Στο επίπεδο της μεταγραφής κυρίως... (σελ. 41, 42 σχολικού βιβλίου). Στο επίπεδο της μετάφρασης.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

22. Έστω ότι στο γονιδίωμα ενός βακτηρίου υπάρχουν δύο οπερόνια. Το ένα αποτελείται από 2 δομικά γονίδια και το άλλο από 3 δομικά γονίδια. Το καθένα από τα οπερόνια έχει το δικό του ρυθμιστικό γονίδιο. α. Πόσα γονίδια έχουν συνολικά τα δύο οπερόνια; β. Πόσα διαφορετικά mRNA παράγονται; γ. Πόσες συνολικά πρωτεΐνες κωδικοποιούνται από τα δύο οπερόνια;

Α ΠΑΝΤΗΣΗ

• •

2 ρυθμιστικά και 5 δομικά γονίδια, οπότε 7 γονίδια συνολικά. Αν τα οπερόνια είναι σε καταστολή, παράγονται 2 mRNA από τη μεταγραφή των ρυθμιστικών γονιδίων. Αντίθετα, αν τα οπερόνια είναι σε επαγωγή, τότε παράγονται 2 mRNA επιπλέον από την μεταγραφή των δομικών γονιδίων. 2 ρυθμιστικές πρωτεΐνες-καταστολείς από την έκφραση των ρυθμιστικών γονιδίων και 5 πρωτεΐνες-ένζυμα από την έκφραση των αντίστοιχων δομικών γονιδίων, οπότε συνολικά παράγονται 7 πρωτεΐνες.

369

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 370

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

κ εφαλαιο 4 ο: τ εχνολοΓια του α ναΣυνδυαΣμενου DNA

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Σε πλασμίδιο που χρησιμοποιείται ως φορέας κλωνοποίησης πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου σπάζουν με τη δράση της EcoRI;

Α ΠΑΝΤΗΣΗ

• •

2 φωσφοδιεστερικοί δεσμοί. 8 δεσμοί υδρογόνου... (σελ. 57 σχολικού βιβλίου).

2. Σε ανασυνδυασμένο πλασμίδιο, αν επιδράσουμε με την EcoRI, πόσοι φωσφοδιεστερικοί δεσμοί και πόσοι δεσμοί υδρογόνου σπάζουν;

Α ΠΑΝΤΗΣΗ

• •

4 φωσφοδιεστερικοί δεσμοί. 16 δεσμοί υδρογόνου.

3. Ποιες μεθόδους παραγωγής αντιγράφων ενός γονιδίου γνωρίζετε;

Α ΠΑΝΤΗΣΗ

• •

Με την τεχνολογία του ανασυνδυασμένου DNA μέσω βακτηρίων (κλώνος βακτηρίων με το επιθυμητό γονίδιο)... εικ. 4.1. σχολικού βιβλίου. Με την αλυσιδωτή αντίδραση πολυμεράσης (PCR)… (σελ. 61 σχολικού βιβλίου).

4. Ποιες προϋποθέσεις πρέπει να εκπληρώνουν τα πλασμίδια που χρησιμοποιούνται ως φορείς κλωνοποίησης;

Α ΠΑΝΤΗΣΗ

• • •

370

Να έχουν μόνο μία φορά την αλληλουχία που αναγνωρίζει η EcoRI... (σελ. 58 σχολικού βιβλίου). Να διαθέτουν γονίδιο ανθεκτικότητας σε αντιβιοτικό... (σελ. 59 σχολικού βιβλίου). Προϋπόθεση αποτελεί η αλληλουχία που αναγνωρίζει η EcoRI να μην εμπεριέχεται στο γονίδιο ανθεκτικότητας, στο αντιβιοτικό που πρόκειται να χρησιμοποιήσουμε.

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 371

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

5. Ποιες γονιδιακές μεταλλάξεις κάνουν το πλασμίδιο ακατάλληλο για φορέα κλωνοποίησης;

Α ΠΑΝΤΗΣΗ

• • •

Στην αλληλουχία 5΄-GAATTC-3΄ 3΄-CTTAAG-5΄ που αναγνωρίζει η περιοριστική ενδονουκλεάση EcoRI, η οποία συνήθως χρησιμοποιείται. Που δημιουργούν μία ακόμη θέση αναγνώρισης από την περιοριστική ενδονουκλεάση. Στα γονίδια ανθεκτικότητας σε αντιβιοτικά που διαθέτει. Στη μία και μοναδική θέση έναρξης της αντιγραφής που διαθέτει, με αποτέλεσμα να μην μπορεί να αυτοδιπλασιάζεται ανεξάρτητα μέσα σε ένα κύτταρο-ξενιστή, όπως ένα βακτήριο.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

6. Ποιες κατηγορίες γονιδίων που υπάρχουν στο γονιδίωμα ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cDNA βιβλιοθήκη;

Α ΠΑΝΤΗΣΗ

• • •

Γονίδια που μεταγράφονται και παράγουν tRNA, rRNA και snRNA… (σελ. 31 σχολικού βιβλίου). Τα ανενεργά γονίδια λόγω κυτταρικής διαφοροποίησης... (σελ. 40, 31 σχολικού βιβλίου). Τα γονίδια μιτοχονδριακού DNA… (σελ. 21 σχολικού βιβλίου).

7. Πώς μπορεί να πραγματοποιηθεί αποδιάταξη;

Α ΠΑΝΤΗΣΗ

• •

Με κατάλληλες χημικές ουσίες. Αυξάνοντας τη θερμοκρασία... (σελ. 60 σχολικού βιβλίου).

8. Σε ποιες περιπτώσεις ξεχωρίζουν αλυσίδες δίκλωνου μορίου DNA;

Α ΠΑΝΤΗΣΗ

• • • •

Κατά την αντιγραφή του DNA… (σελ. 28 σχολικού βιβλίου). Κατά τη μεταγραφή του DNA σε RNA… (σελ. 32 σχολικού βιβλίου). Κατά τη διαδικασία της αποδιάταξης... (σελ. 60 σχολικού βιβλίου). Στη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης... (σελ. 61 σχολικού βιβλίου).

371

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 372

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

9. Ποιες τεχνικές της τεχνολογίας του ανασυνδυασμένου DNA εξαρτώνται από τη συμπληρωματικότητα των βάσεων;

Α ΠΑΝΤΗΣΗ • • •

Η δημιουργία του ανασυνδυασμένου DNA… (σελ. 58 σχολικού βιβλίου). Η δημιουργία cDNA αλυσίδων με καλούπι τα ώριμα mRNA... (σελ. 60 σχολικού βιβλίου). Η δημιουργία δίκλωνων μορίων DNA που είναι ολόκληρα γονίδια και περιέχουν μόνο εξώνια (κατασκευή cDNA βιβλιοθηκών)... (σελ. 60 σχολικού βιβλίου). Η διαδικασία υβριδοποίησης, που είναι η σύνδεση μονόκλωνων συμπληρωματικών αλυσίδων DNA ή συμπληρωματικών DNA-RNA (χρήση ιχνηθετημένων ανιχνευτών μονόκλωνων μορίων DNA ή RNA). Η μέθοδος αλυσιδωτής αντίδρασης πολυμεράσης (PCR)… (σελ. 61 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

10. Πού βρίσκει εφαρμογή η ιχνηθέτηση;

Α ΠΑΝΤΗΣΗ

• • • •

Ορισμός ιχνηθέτησης... (σελ. 14 σχολικού βιβλίου). Πειράματα των Hershey και Chase… (σελ. 14 σχολικού βιβλίου). Στον εντοπισμό και την απομόνωση τμήματος DNA μέσα από ένα μείγμα χιλιάδων μορίων DNA με τη χρήση ιχνηθετημένων ανιχνευτών... (σελ. 60, 61 σχολικού βιβλίου). Στην απομόνωση ενός συγκεκριμένου γονιδίου από μία cDNA βιβλιοθήκη... (σελ. 61 σχολικού βιβλίου).

11. Πού βρίσκει εφαρμογή η κατασκευή γονιδιωματικής βιβλιοθήκης;

Α ΠΑΝΤΗΣΗ

• • • • • •

372

Στη μελέτη της αλληλουχίας των βάσεων των γονιδίων των διαφόρων οργανισμών. Συνέβαλε δηλαδή στη χαρτογράφηση του ανθρώπινου γονιδιώματος. Στη μελέτη των υποκινητών των γονιδίων, αφού αποτελούν τμήμα του γονιδιώματος που δεν μεταγράφεται. Στη μελέτη των αλληλουχιών των βάσεων του γονιδιώματος που δεν αποτελούν γονίδια. Στη μελέτη των αλληλουχιών των γονιδίων που μεταγράφονται σε tRNA, rRNA, snRNA. Στη μελέτη των αλληλουχιών των βάσεων των γονιδίων που δεν μεταφράζονται σε αμινοξέα, δηλαδή των εσωνίων και των 5΄ και 3΄ αμετάφραστων περιοχών. Στην παραγωγή ανθρώπινων πρωτεϊνών που κωδικοποιούνται από συνεχή γονίδια με τη βοήθεια των βακτηρίων.

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 373

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

12. Πού βρίσκει εφαρμογή η κατασκευή cDNA βιβλιοθήκης;

Α ΠΑΝΤΗΣΗ

Στην παραγωγή ανθρώπινων πρωτεϊνών που κωδικοποιούνται είτε από ασυνεχή είτε από συνεχή γονίδια, με τη βοήθεια βακτηρίων. Στη μελέτη της αλληλουχίας των βάσεων των εξωνίων, των γονιδίων που εκφράζονται σε κύτταρα ενός κυτταρικού τύπου.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

373

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 374

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

κ εφαλαιο 5 ο : μ ενδελικη κ ληρονομικοτητα

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Ποιοι οι πιθανοί γονότυποι μοσχομπίζελου με λεία και κίτρινα σπέρματα;

Α ΠΑΝΤΗΣΗ

• • • •

ΛΛΚΚ ΛΛΚκ ΛλΚΚ ΛλΚκ

2. Όταν διασταυρώνονται δύο ετερόζυγα άτομα με γονότυπο ΑαΒβ, πόσοι διαφορετικοί γονότυποι και φαινότυποι προκύπτουν, αν τα γονίδια είναι αυτοσωμικά;

Α ΠΑΝΤΗΣΗ

• •

Γονότυποι: 9. Φαινότυποι: 4.

3. Σε ποιες περιπτώσεις γονιδίων φαίνεται ότι δεν ισχύουν οι νόμοι του Mendel, κάτι που δεν συμβαίνει όμως στην πραγματικότητα, επειδή οι φαινοτυπικές αναλογίες των απογόνων δεν είναι οι αναμενόμενες;

Α ΠΑΝΤΗΣΗ

• • • • •

Στα ατελώς επικρατή. Στα συνεπικρατή. Στα θνησιγόνα. Στα πολλαπλά αλληλόμορφα. Στα φυλοσύνδετα.

4. Σε ποιες περιπτώσεις δεν είναι απαραίτητη η διασταύρωση ελέγχου για τον προσδιορισμό ενός γονοτύπου;

Α ΠΑΝΤΗΣΗ • • •

374

Όταν το άτομο είναι ομόζυγο σε υπολειπόμενο αλληλόμορφο γονίδιο (γονότυπος: αα, αν είναι αυτοσωμικό και XαXα, αν είναι φυλοσύνδετο). Σε ομόζυγα και ετερόζυγα άτομα για ατελώς επικρατή γονίδια. Σε ομόζυγα και ετερόζυγα άτομα για συνεπικρατή γονίδια.

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 375

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ •

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

Σε αρσενικά άτομα, με ιδιότητα που οφείλεται σε φυλοσύνδετο γονίδιο (γονότυπος: XαΨ), αφού στο Ψ φυλετικό χρωμόσωμα δεν υπάρχει φυλοσύνδετο αλληλόμορφο γονίδιο.

5. Ποιες ασθένειες οφείλονται σε αυτοσωμικό επικρατές γονίδιο;

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α ΠΑΝΤΗΣΗ

Η οικογενής υπερχοληστερολαιμία... (σελ. 79 σχολικού βιβλίου). Η αχονδροπλασία... (σελ. 84 σχολικού βιβλίου).

6. Ποιες ασθένειες οφείλονται σε φυλοσύνδετο υπολειπόμενο γονίδιο;

Α ΠΑΝΤΗΣΗ

• •

Η αιμορροφιλία Α... (σελ. 80 σχολικού βιβλίου). Η μερική αχρωματοψία στο πράσινο και το κόκκινο.

7. Πότε μια ασθένεια που οφείλεται σε υπολειπόμενο γονίδιο εκδηλώνεται σε ένα άτομο;

Α ΠΑΝΤΗΣΗ

• •

Όταν το άτομο είναι ομόζυγο στο υπολειπόμενο γονίδιο (γονότυπος: αα, αν είναι αυτοσωμικό, ΧαΧα, αν είναι φυλοσυνδετο). Σε αρσενικό άτομο, αν πρόκειται για ιδιότητα που οφείλεται σε φυλοσύνδετο γονίδιο (γονότυπος: ΧαΨ), αφού στο Ψ φυλετικό χρωμόσωμα δεν υπάρχει αλληλόμορφο φυλοσύνδετο γονίδιο.

8. Σε ποιες περιπτώσεις γονείς με τον ίδιο φαινότυπο αποκτούν παιδί με διαφορετικό φαινότυπο;

Α ΠΑΝΤΗΣΗ

• •

• •

Από γονείς-φορείς αυτοσωμικού υπολειπόμενου γονιδίου γεννιέται παιδί με διαφορετικό φαινότυπο, με πιθανότητα 1/4 (γονότυπος: αα). Από γονείς ετερόζυγους, που πάσχουν από ασθένεια που οφείλεται σε αυτοσωμικό επικρατές γονίδιο (π.χ. οικογενής υπερχοληστερολαιμία), όταν γεννιέται υγιές παιδί. Από μητέρα υγιή-φορέα φυλοσύνδετης υπολειπόμενης ασθένειας και πατέρα υγιή, όταν γεννιέται αγόρι που πάσχει. Όταν συμβαίνει μετάλλαξη σε γεννητικό κύτταρο γονέα.

375

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 376

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

9. Δίνονται δύο πληθυσμοί αμιγών στελεχών δροσόφιλας που διαφέρουν στο χρώμα των ματιών τους. Το ένα στέλεχος έχει κόκκινα μάτια, ενώ το άλλο στέλεχος λευκά μάτια. Το γονίδιο για τα κόκκινα μάτια επικρατεί του γονιδίου για τα λευκά μάτια. Ποια διασταύρωση πρέπει να πραγματοποιήσουμε, για να διαπιστώσουμε εάν το γονίδιο είναι αυτοσωμικό ή φυλοσύνδετο;

376

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α ΠΑΝΤΗΣΗ

Θα πρέπει να διασταυρώσουμε θηλυκό άτομο με λευκά μάτια και αρσενικό με κόκκινα μάτια. Αν όλοι οι απόγονοι έχουν κόκκινα μάτια, το γονίδιο είναι αυτοσωμικό, ενώ, αντίθετα, αν όλοι οι θηλυκοί απόγονοι έχουν κόκκινα μάτια και όλοι οι αρσενικοί λευκά μάτια, τότε το γονίδιο είναι φυλοσύνδετο. (Ρ: ♀ ααΧΧ (Χ) ΑΑΧΨ, Ρ: ♂ ΧαΧα (Χ) ΧΑΨ)

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 377

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

κ εφαλαιο 6 ο: μ εταλλαξειΣ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Ποιο είναι το αποτέλεσμα στο γονιδιακό προϊόν γονιδιακών μεταλλάξεων που συμβαίνουν σε αλληλουχίες αζωτούχων βάσεων οι οποίες δεν κωδικοποιούν αμινοξέα;

Α ΠΑΝΤΗΣΗ

• •

• • •

Στον υποκινητή των γονιδίων, με αποτέλεσμα να μην μπορεί να προσδεθεί η RNA πολυμεράση, οπότε δεν αρχίζει η μεταγραφή. Στην πρώτη αμετάφραστη περιοχή του γονιδίου, που με τη μεταγραφή δίνει την 5΄ αμετάφραστη περιοχή του mRNA. Η μετάλλαξη αυτή αποτρέπει την πρόσδεση του mRNA στην μικρή υπομονάδα του ριβοσώματος. Σε εσώνιο. Επειδή τα εσώνια απομακρύνονται στη διαδικασία της ωρίμανσης, φυσιολογικά δεν επηρεάζεται η παραγωγή της πρωτεΐνης. Στο κωδικόνιο λήξης. Αν το νέο κωδικόνιο δεν είναι λήξης, συνεχίζεται η μετάφραση, οπότε παράγεται πολυπεπτιδική αλυσίδα με μεγαλύτερο αριθμό αμινοξέων. Στις αλληλουχίες λήξης της μεταγραφής (τελευταία αμετάφραστη περιοχή του γονιδίου), με αποτέλεσμα να παρεμποδίζεται τελικά η απελευθέρωση του mRNA στο τέλος της μετάφρασης.

2. Ποια είδη μεταλλάξεων δεν αλλάζουν τον φαινότυπο ενός ατόμου;

Α ΠΑΝΤΗΣΗ

• • • • •

Οι σιωπηλές. Οι ουδέτερες. Οι μεταλλάξεις στην αλληλουχία των βάσεων εσωνίων και περιοχών του γονιδιώματος που δεν αποτελούν γονίδια. Των ανενεργών, λόγω κυτταρικής διαφοροποίησης, γονιδίων. Οι μεταλλάξεις που οδηγούν σε υπολειπόμενο γονίδιο, όταν στον γονότυπο του ατόμου υπάρχει και το επικρατές φυσιολογικό αλληλόμορφό του (αυτοσωμικό ή φυλοσύνδετο).

3. Άνδρας με 3 από τα 4 γονίδια και γυναίκα με 2 από τα 4 γονίδια για τη σύνθεση των α-αλυσίδων της αιμοσφαιρίνης παντρεύονται. Ποιοι είναι οι πιθανοί γονότυποί τους;

Α ΠΑΝΤΗΣΗ • •

♂ αα/α_ ♀ αα/_ _ή α_/α_, όπου α το γονίδιο για τη σύνθεση της α-αλυσίδας της αιμοσφαιρίνης , _ η έλλειψη του γονιδίου και / ξεχωρίζει τα δύο ομόλογα χρωμοσώματα... (σελ. 95 σχολικού βιβλίου).

377

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 378

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

4. Ποιες μεταλλάξεις έχουν ως αποτέλεσμα έλλειψη γενετικού υλικού;

Α ΠΑΝΤΗΣΗ • • •

Μονοσωμία, π.χ. σύνδρομο Turner (αριθμητική χρωμοσωμική ανωμαλία). Έλλειψη τμήματος χρωμοσώματος, π.χ. σύνδρομο φωνή της γάτας (δομική χρωμοσωμική ανωμαλία). Έλλειψη βάσεων (γονιδιακή μετάλλαξη). Έλλειψη γονιδίων, όπως π.χ. στην α-θαλασσαιμία, στο ρετινοβλάστωμα.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

5. Πώς μπορούμε να διαγνώσουμε δομική χρωμοσωμική ανωμαλία σε έμβρυο;

Α ΠΑΝΤΗΣΗ

• • • •

Προγεννητικός έλεγχος... (σελ. 99, 100 σχολικού βιβλίου). δημιουργία καρυότυπου... (σελ. 20 σχολικού βιβλίου). Χρώση των χρωμοσωμάτων με τεχνικές που δημιουργούν ζώνες στο χρωμόσωμα, όπως ζώνες Giemsa. Τέλος, συγκρίνουμε τα χρωμοσώματα του εμβρύου με φυσιολογικά χρωμοσώματα που έχουν βαφεί με τις ίδιες χρωστικές.

6. Ποιες μεταλλάξεις οδηγούν σε διανοητική καθυστέρηση;

Α ΠΑΝΤΗΣΗ

• • • •

Σύνδρομο Down... (σελ. 96 σχολικού βιβλίου). Σύνδρομο φωνή της γάτας (cri-du-chat)... (σελ. 97 σχολικού βιβλίου). Φαινυλκετονουρία (PKU)... (σελ. 94 σχολικού βιβλίου). (Τρισωμία 13 και 18).

7. Παιδί με σύνδρομο Klinefelter έχει τρεις διαφορετικές αλληλουχίες βάσεων DNA στα φυλετικά χρωμοσώματά του. Να εξηγήσετε τον πιθανό μηχανισμό σύμφωνα με τον οποίο γεννήθηκε το παιδί αυτό από φυσιολογικούς γονείς. Θα μπορούσε το παραπάνω παιδί να έχει δύο πανομοιότυπες αλληλουχίες βάσεων DNA και μία διαφορετική;

Α ΠΑΝΤΗΣΗ

378

Το παιδί προέκυψε από τη γονιμοποίηση φυσιολογικού ωαρίου (22 αυτοσωμικά + X) από μη φυσιολογικό σπερματοζωάριο (22 αυτοσωμικά + ΧΨ) – μη διαχωρισμός των φυλετικών χρωμοσωμάτων κατά την 1η μειωτική διαίρεση. Τα δύο Χ φυλετικά χρωμοσώματα του παιδιού έχουν διαφορετική αλληλουχία βάσεων, αφού το ένα Χ είναι μητρικής προέλευσης και το άλλο Χ πατρικής προέλευσης.

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:14 μμ Page 379

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ •

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

Θα μπορούσε να προκύψει από τη γονιμοποίηση μη φυσιολογικού ωαρίου (22 αυτοσωμικά + ΧΧ) –μη διαχωρισμός των αδελφών χρωματίδων του Χ φυλετικού χρωμοσώματος κατά τη 2η μειωτική διαίρεση–, από φυσιολογικό σπερματοζωάριο (22 αυτοσωμικά +Ψ), αφού γνωρίζουμε ότι οι αδελφές χρωματίδες έχουν φυσιολογικά πανομοιότυπη αλληλουχία.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

8. Πώς μπορούμε να διαγνώσουμε δρεπανοκυτταρική αναιμία σε έμβρυο και σε νεογνό;

Α ΠΑΝΤΗΣΗ

• • •

Με τη μοριακή διάγνωση, δηλαδή με την ανάλυση των βάσεων του DNA – γονιδίου που κωδικοποιεί την β-αλυσίδα της αιμοσφαιρίνης (σε έμβρυο και νεογνό). Με τη δοκιμασία δρεπάνωσης (σε νεογνό)... (σελ. 90, 99 σχολικού βιβλίου). Με βιοχημική ανάλυση –εντοπισμός του είδους της αιμοσφαιρίνης (HbA ή HbS) στα ερυθροκύτταρα του αίματος (νεογνό).

9. Για ποιους λόγους νομίζετε ότι γυναίκες με πολλαπλές αποβολές πρέπει να καταφεύγουν σε γενετική συμβουλή;

Α ΠΑΝΤΗΣΗ

• •

Όταν ο άνδρας και η γυναίκα είναι φορείς του ίδιου θνησιγόνου γονιδίου, τότε έχουν πιθανότητα 1/4 να δημιουργήσουν έμβρυο ομόζυγο στο υπολειπόμενο γονίδιο... αιμομιξία (σελ. 80 σχολικού βιβλίου). Όταν η γυναίκα φέρει φυλοσύνδετο θνησιγόνο γονίδιο, έχει αυξημένη πιθανότητα να αποκτήσει μη βιώσιμους αρσενικούς απογόνους. Μπορεί να είναι αυξημένη η πιθανότητα μη διαχωρισμού κατά τη μειωτική διαίρεση δημιουργίας των γαμετών ή κάποιας δομικής χρωμοσωμικής ανωμαλίας, με αποτέλεσμα τη μείωση της βιωσιμότητας του εμβρύου.

379

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 380

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

κ εφαλαιο 7ο: α ρχεΣ και μ εΘοδολοΓια τηΣ Β ιοτεχνολοΓιαΣ

• • • • •

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Ποια συστατικά περιέχονται σε στερεό θρεπτικό υλικό εργαστηριακής καλλιέργειας;

}

Α ΠΑΝΤΗΣΗ

Πηγή άνθρακα Πηγή αζώτου θρεπτικά συστατικά... (σελ. 108 σχολικού βιβλίου). Μεταλλικά ιόντα Νερό Άγαρ... (σελ. 109 σχολικού βιβλίου).

2. Ποιες είναι οι πηγές άνθρακα για τους μικροοργανισμούς μιας καλλιέργειας;

Α ΠΑΝΤΗΣΗ

• • •

CO2, για τους αυτότροφους μικροοργανισμούς. υδατάνθρακες (γλυκόζη, λακτόζη), για τους ετερότροφους... (σελ. 108 σχολικού βιβλίου). Μελάσα, στους βιοαντιδραστήρες... (σελ. 109 σχολικού βιβλίου).

3. Ποια χαρακτηριστικά μιας καλλιέργειας εξαρτώνται από το είδος του μικροοργανισμού που χρησιμοποιούμε;

Α ΠΑΝΤΗΣΗ

• • • •

380

Ο χρόνος διπλασιασμού... (σελ. 108 σχολικού βιβλίου). Η πηγή άνθρακα - θρεπτικό υλικό... (σελ. 108 σχολικού βιβλίου). Συνθήκες όπως το Ο2, το pH, η θερμοκρασία... (σελ. 108 σχολικού βιβλίου). Η διάρκεια κάθε φάσης σε κλειστή καλλιέργεια... (σελ. 111 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 381

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

κεφαλαιο 8 ο: ε φαρμοΓεΣ τηΣ Β ιοτεχνολοΓιαΣ Στην ι ατρικη

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Σε ποιες περιπτώσεις οι ιοί χρησιμοποιούνται σε τεχνικές της Γενετικής Μηχανικής;

Α ΠΑΝΤΗΣΗ

• • • •

Το DNA των φάγων λ αποτελεί φορέα κλωνοποίησης... (σελ. 60 σχολικού βιβλίου). Από RNA ιούς απομονώσαμε την αντίστροφη μεταγραφάση... cDNA βιβλιοθήκες. Για την παραγωγή ιντερφερονών επιλέγονται κύτταρα που μολύνονται από ιούς... (σελ. 119 σχολικού βιβλίου). ιοί-φορείς για τη μεταφορά του φυσιολογικού αλληλόμορφου γονιδίου στα κύτταρα ασθενών που εμφανίζουν τη βλάβη ... γονιδιακή θεραπεία.

2. Ποια ένζυμα είναι απαραίτητα για την παραγωγή ανθρώπινης ινσουλίνης από γενετικά τροποποιημένα βακτήρια;

Α ΠΑΝΤΗΣΗ

• • • • •

Αντίστροφη μεταγραφάση. DNA πολυμεράση. Περιοριστική ενδονουκλεάση. DNA δεσμάση. Ένζυμο μετατροπής της προϊνσουλίνης σε ινσουλίνη... (σελ. 118, 119 σχολικού βιβλίου).

3. Με ποια διαδικασία είναι δυνατή η παραγωγή μεγάλων ποσοτήτων ανθρώπινης ιντερφερόνης από βακτήρια;

Α ΠΑΝΤΗΣΗ

• •

Από ανθρώπινα κύτταρα που μολύνθηκαν από ιό απομονώνεται το ολικό ώριμο mRNA. Συνοπτικά τα στάδια παραγωγής ιντερφερόνης είναι ίδια με τα αντίστοιχα στάδια παραγωγής ινσουλίνης... (σελ. 118, 119 σχολικού βιβλίου).

4. Με ποιους τρόπους η Γενετική Μηχανική συμβάλλει στη θεραπεία του καρκίνου ή στη βελτίωση της υγείας των καρκινοπαθών;

Α ΠΑΝΤΗΣΗ •

Με την παραγωγή μονοκλωνικών αντισωμάτων... θεραπευτικά (σελ. 119, 120 σχολικού βιβλίου).

381

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 382

Γ ΄ Εν Βιολογία •

/ Θετική Κατεύθυνση ιαίου Λυκείου

Με την παραγωγή μεγάλων ποσοτήτων ιντερφερονών. Οι ιντερφερόνες έχουν ιδιαίτερο ενδιαφέρον ως αντιιικοί και πιθανόν ως αντικαρκινικοί παράγοντες.

5. Ποιες προϋποθέσεις πρέπει να ισχύουν για την εφαρμογή της γονιδιακής θεραπείας;

• •

• •

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α ΠΑΝΤΗΣΗ

Απομόνωση και κλωνοποίηση του φυσιολογικού αλληλόμορφου γονιδίου. Προσδιορισμός των κυττάρων που εμφανίζουν τη βλάβη από την ασθένεια. Η ανάπτυξη κατάλληλων ιών-φορέων για τη μεταφορά του φυσιολογικού αλληλόμορφου γονιδίου στα κύτταρα του ασθενούς που εμφανίζουν τη βλάβη, αφού πρώτα καταστούν αβλαβείς. Προϋπόθεση αποτελούσε η ολοκλήρωση της χαρτογράφησης του ανθρώπινου γονιδιώματος. Η ασθένεια πρέπει να οφείλεται σε υπολειπόμενο γονίδιο.

6. Ποια προβλήματα σχετίζονται με τη γονιδιακή θεραπεία;

Α ΠΑΝΤΗΣΗ

• • •

Οι ιοί-φορείς, αν και καθίστανται αβλαβείς, έχουν μικρή πιθανότητα να προκαλέσουν παρενέργειες και σε ορισμένες περιπτώσεις καρκίνο. δεν αποτελεί μόνιμη θεραπεία συνήθως, οπότε πρέπει να επαναλαμβάνεται σε τακτά διαστήματα. δεν γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου στα κύτταρα του οργανισμού, αλλά ενσωμάτωση του φυσιολογικού αντιγράφου του στο γονιδίωμα συγκεκριμένων σωματικών κυττάρων. Συνεπώς, δεν μεταβιβάζεται στους απογόνους.

7. Ποιες φαρμακευτικές πρωτεΐνες έχουν παραχθεί με τις μεθόδους της Γενετικής Μηχανικής; (ονομαστική αναφορά)

Α ΠΑΝΤΗΣΗ

• • • • • •

382

ινσουλίνη. ιντερφερόνες α, β, γ. Αυξητική ορμόνη. α1-αντιθρυψίνη (ΑΑΤ). Παράγοντας ιΧ. Μονοκλωνικά αντισώματα.

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 383

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

κ εφαλαιο 9 ο: εφαρμοΓεΣ τηΣ Βιοτε��νολοΓιαΣ Στη Γ εωρΓια και την κ τηνοτροφια

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Ποιους τρόπους βελτίωσης της φυτικής και ζωικής παραγωγής γνωρίζετε;

Α ΠΑΝΤΗΣΗ

• •

Οι ελεγχόμενες από τον άνθρωπο διασταυρώσεις φυτών και ζώων... (σελ. 131 σχολικού βιβλίου). Η δημιουργία διαγονιδιακών φυτών και ζώων με τις τεχνικές της Γενετικής Μηχανικής... (σελ. 131, 133 σχολικού βιβλίου).

2. Ποιων διαφορετικών οργανισμών τις γενετικές πληροφορίες φέρει ένα διαγονιδιακό φυτό;

Α ΠΑΝΤΗΣΗ

• • •

Του είδους του. Του πλασμιδίου Τi του βακτηρίου Agrobacterium… (σελ. 131, 132 σχολικού βιβλίου). Την επιθυμητή ιδιότητα που φέρει το γονίδιο το οποίο ενσωματώθηκε στο πλασμίδιο Τi, π.χ. τη γενετική πληροφορία του βακτηρίου Bacillus για την παραγωγή ισχυρής τοξίνης (όταν δημιουργούμε γενετικά τροποποιημένα φυτά ποικιλίας Βt).

3. Με ποιους τρόπους αντιμετωπίζονται τα έντομα που δημιουργούν μεγάλα προβλήματα στη γεωργία και οδηγούν σε σημαντική μείωση της παραγωγής;

Α ΠΑΝΤΗΣΗ

• • •

Χρήση εντομοκτόνων... (σελ. 132 σχολικού βιβλίου). Πολλαπλασιασμός του βακτηρίου Βacillus στο εργαστήριο και στη συνέχεια ψεκασμός στον αγρό... (σελ. 133 σχολικού βιβλίου). δημιουργία και καλλιέργεια διαγονιδιακών φυτών ποικιλία Bt… (σελ. 133, 131 σχολικού βιβλίου).

4. Ποιων διαφορετικών οργανισμών τις γενετικές πληροφορίες φέρει ένα κλωνοποιημένο ζώο, όπως η Dolly;

Α ΠΑΝΤΗΣΗ • •

Του πυρήνα του σωματικού κυττάρου του μαστικού αδένα του οργανισμού-δότη (εξάχρονο πρόβατο). Του μιτοχονδριακού DNA του θηλυκού προβάτου από το οποίο προέρχεται το απύρηνο ωάριο.

383

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 384

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

5. Με ποιους τρόπους μεταφέρεται γενετικό υλικό σε κύτταρα οργανισμών;

Α ΠΑΝΤΗΣΗ

• • • •

Με την εισαγωγή ανασυνδυασμένου πλασμιδίου σε βακτήρια... μετασχηματισμός (σελ. 59 σχολικού βιβλίου). Τα πλασμίδια μεταφέρονται από ένα βακτήριο σε άλλο. Με τον τρόπο αυτό μετασχηματίζουν το βακτήριο στο οποίο εισέρχονται και του προσδίδουν καινούριες ιδιότητες (σελ. 18 σχολικού βιβλίου). Με το πλασμίδιο Ti… δημιουργία διαγονιδιακών φυτών (σελ. 131, 132 σχολικού βιβλίου). Με μικροέγχυση... δημιουργία διαγονιδιακών ζώων (σελ. 133 σχολικού βιβλίου). Με γενετικά τροποποιημένους ιούς... γονιδιακή θεραπεία (σελ. 123, 125 σχολικού βιβλίου). Με τη μεταφορά πυρήνα σωματικού κυττάρου μαστικού αδένα σε απύρηνο ωάριο, κατά την κλωνοποίηση ζώων, όπως η Dolly (σελ. 136 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

6. Ποιοι μικροοργανισμοί χρησιμοποιούνται σε εφαρμογές της Γενετικής Μηχανικής;

Α ΠΑΝΤΗΣΗ

• • •

• • • •

384

Agrobacterium tumefaciens … δημιουργία διαγονιδιακών φυτών. Bacillus thuringiensis … δημιουργία διαγονιδιακών φυτών ανθεκτικών στα έντομα και στους σκώληκες (ποικιλίες Βt). Escherichia coli: παράγει την περιοριστική ενδονουκλεάση EcoRI, διαθέτει πλασμίδιο που αποτελεί τον συνηθέστερο φορέα κλωνοποίησης και αποτελεί βακτήριοξενιστή (4ο κεφάλαιο). ιοί-φορείς στη γονιδιακή θεραπεία της ανεπάρκειας του ανοσοποιητικού συστήματος... (σελ. 123 σχολικού βιβλίου). Αδενοϊοί-φορείς στη γονιδιακή θεραπεία της κυστικής ίνωσης... (σελ. 125 σχολικού βιβλίου). Saccharomyces (ζυμομύκητας): μύκητας που χρησιμοποιείται για την παραγωγή αιθανόλης (σελ. 113 σχολικού βιβλίου). Penicillium: μύκητας που χρησιμοποιείται για την παραγωγή του αντιβιοτικού πενικιλίνη (σελ. 113 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 385

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

Σ υνδυαΣτικα Θ εματα ε φ ’ ο ληΣ τηΣ υληΣ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

1. Ποιες είναι οι μέθοδοι παραγωγής της ινσουλίνης;

Α ΠΑΝΤΗΣΗ

• • •

Εκχύλιση ιστών παγκρέατος βοοειδών και χοίρων... (σελ. 118 σχολικού βιβλίου). Κατασκευή cDNA βιβλιοθήκης από κύτταρα παγκρέατος (γενετικά τροποποιημένα βακτήρια)... (σελ. 60, 118 σχολικού βιβλίου). Χρησιμοποίηση διαγονιδιακών ζώων... (σελ. 135 σχολικού βιβλίου).

2. Ποιοι είναι οι μηχανισμοί διόρθωσης λαθών του DNA; Τι συνεπάγεται η αδρανοποίηση αυτών των μηχανισμών;

Α ΠΑΝΤΗΣΗ

• •

δράση DNA πολυμεράσης και ειδικών επιδιορθωτικών ενζύμων... (σελ. 28, 30 σχολικού βιβλίου). Όταν δεν λειτουργούν οι μηχανισμοί αυτοί, εμφανίζεται μελαγχρωματική ξηροδερμία και καρκίνος... (σελ. 101 σχολικού βιβλίου).

3. Ποια είναι η έννοια του φορέα στη Βιολογία (π.χ. γενετικής ασθένειας ή φορέα γονιδίου);

Α ΠΑΝΤΗΣΗ

• • • •

Άτομο ετερόζυγο, με φυσιολογικό φαινότυπο, που μπορεί να μεταβιβάσει το υπολειπόμενο αλληλόμορφο στους απογόνους του... (σελ. 80 σχολικού βιβλίου). Μόριο DNA (πλασμιδίου ή φάγου) - φορέας κλωνοποίησης που αυτοδιπλασιάζεται ανεξάρτητα σε βακτήρια... (σελ. 57 σχολικού βιβλίου). ιός - φορέας σε γονιδιακή θεραπεία (π.χ. αδενοϊός)... (σελ. 119, 120 σχολικού βιβλίου). Μεταφορείς ισχυρών αντικαρκινικών φαρμάκων (μονοκλωνικά αντισώματα).

4. Ποιες πρωτεΐνες συμβάλλουν στην άμυνα των οργανισμών;

Α ΠΑΝΤΗΣΗ • •

Περιοριστική ενδονουκλεάση στα βακτήρια... (σελ. 57 σχολικού βιβλίου). ADA (απαμινάση της αδενοσίνης) στα κύτταρα του μυελού των οστών... (σελ. 123 σχολικού βιβλίου).

385

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 386

Γ ΄ Εν Βιολογία • •

/ Θετική Κατεύθυνση ιαίου Λυκείου

Μονοκλωνικά αντισώματα... (σελ. 119 σχολικού βιβλίου). ιντερφερόνες... (σελ. 119 σχολικού βιβλίου).

5. Ποιες μεθόδους διάγνωσης ασθενειών από παθογόνους μικροοργανισμούς γνωρίζετε;

• •

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Α ΠΑΝΤΗΣΗ

Μέθοδος PCR (διάγνωση AIDS)... (σελ. 61 σχολικού βιβλίου). Ανοσοδιαγνωστικά μονοκλωνικά αντισώματα... (σελ. 119 σχολικού βιβλίου).

6. Ένα γνώρισμα κληρονομείται πάντα από τη μητέρα στους αρσενικούς και θηλυκούς απογόνους, ενώ δεν κληρονομείται ποτέ από τον πατέρα στους απογόνους. Πώς αιτιολογείται η κληρονομικότητα του γνωρίσματος;

Α ΠΑΝΤΗΣΗ

Οφείλεται σε γονίδιο που βρίσκεται στο μιτοχονδριακό DNA, το οποίο έχει μητρική προέλευση... (σελ. 21 σχολικού βιβλίου). 7. Υποθέτουμε ότι ένας ιός εισέρχεται σε ένα κύτταρο-ξενιστή. Συνήθως ο ιός πολλαπλασιάζεται και δημιουργούνται νέοι ιοί. Εκτός της περίπτωσης αυτής, τι μπορεί να ακολουθήσει κατόπιν εισόδου ενός ιικού νουκλεϊκού οξέος σε κύτταρο-ξενιστή; (συνοπτική αναφορά)

Α ΠΑΝΤΗΣΗ

• • • •

Το νουκλεϊκό οξύ ενσωματώνεται στο γενετικό υλικό του ξενιστή (γονιδιακή θεραπεία)... (σελ. 123, 125 σχολικού βιβλίου). Το νουκλεϊκό οξύ κόβεται με τη δράση περιοριστικών ενδονουκλεασών, εάν το κύτταρο-ξενιστής είναι βακτήριο... (σελ. 57 σχολικού βιβλίου). Σε RNA ιούς, με τη δράση του ενζύμου αντίστροφη μεταγραφάση, δημιουργείται DNA... (σελ. 31 σχολικού βιβλίου). Παράγονται ιντερφερόνες... (σελ. 119 σχολικού βιβλίου).

8. Πώς το Χ χρωμόσωμα επηρεάζει τον φαινότυπο του ανθρώπου;

Α ΠΑΝΤΗΣΗ

• • • •

386

Τα φυσιολογικά θηλυκά άτομα έχουν ΧΧ (καθορισμός φύλου)... (σελ. 20 σχολικού βιβλίου). Στο Χ υπάρχουν τα φυλοσύνδετα γονίδια... (σελ. 80 σχολικού βιβλίου). Ένα επιπλέον Χ χρωμόσωμα δηλ. ΧΧυ  σύνδρομο Klinefelter... (σελ. 97 σχολικού βιβλίου). Απουσία Χ χρωμοσώματος, δηλ. ΧΟ  σύνδρομο Turner... (σελ. 97 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 387

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

9. Τι γνωρίζετε για τα ογκογονίδια στους διάφορους οργανισμούς;

Α ΠΑΝΤΗΣΗ • •

Στον άνθρωπο προκαλούν καρκίνο... (σελ. 101 σχολικού βιβλίου). Στα φυτά προκαλούν όγκους (πλασμίδιο Ti)... (σελ. 131 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

10. Που βρίσκουν εφαρμογή και ποια είναι η χρησιμότητα των ιών σε τομείς της Βιολογίας;

Α ΠΑΝΤΗΣΗ

• • •

Στη γονιδιακή θεραπεία (αδενοϊοί)... (σελ. 123, 125 σχολικού βιβλίου). Σε πειράματα γενετικής (Hershey - Chase)... (σελ. 14 σχολικού βιβλίου). ως φορείς κλωνοποίησης (DNA βακτηριοφάγου λ)... (σελ. 59, 60 σχολικού βιβλίου).

11. Ποια είναι η χρησιμότητα των μυκήτων σε εφαρμογές της Βιοτεχνολογίας;

Α ΠΑΝΤΗΣΗ

• • •

Παραγωγή αντιβιοτικών σε βιοαντιδραστήρες... (σελ. 113 σχολικού βιβλίου). Παραγωγή τροφίμων, ποτών... (σελ. 107 σχολικού βιβλίου). Παραγωγή φαρμάκων με μεθόδους βιοτεχνολογίας... (σελ. 107 σχολικού βιβλίου).

12. Σε ποιες περιπτώσεις δημιουργείται: α. υβριδικό μόριο, β. υβριδικό άτομο και γ. υβριδικό κύτταρο;

Α ΠΑΝΤΗΣΗ

α. δημιουργία υβριδικού μορίου cDNA-mRNA στην κατασκευή cDNA βιβλιοθήκης και ανίχνευση κλώνων γονιδιωματικής ή cDNA βιβλιοθήκης... (σελ. 60, 61 σχολικού βιβλίου). β. δημιουργία υβριδικών ατόμων από διασταυρώσεις αμιγών ατόμων... (σελ. 70 σχολικού βιβλίου). γ. δημιουργία υβριδωμάτων μεταξύ καρκινικών κυττάρων και Β-λεμφοκυττάρων... (σελ. 119 σχολικού βιβλίου). 13. Ποιες αλληλουχίες υπάρχουν στο πρόδρομο mRNA; Ποιος ο ρόλος των αλληλουχιών που υπάρχουν στο ώριμο mRNA;

Α ΠΑΝΤΗΣΗ α.

• • • •

3΄ - 5΄ αμετάφραστες περιοχές Εξώνια (περιέχουν κωδικόνια) Κωδικόνιο λήξης Εσώνια.

387

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 388

Γ ΄ Εν Βιολογία •

• •

3΄ - 5΄ αμετάφραστες περιοχές (μέσω της 5΄ αμετάφραστης περιοχής, το ώριμο mRNA συνδέεται στη μικρή υπομονάδα του ριβοσώματος, οπότε αρχίζει η μετάφραση). Τα κωδικόνια λήξης που ορίζουν τον τερματισμό της μετάφρασης. Εξώνια κωδικοποιούν αμινοξέα και σχηματίζεται πεπτιδική αλυσίδα στη μετάφραση.

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

β.

/ Θετική Κατεύθυνση ιαίου Λυκείου

14. Ποιος ο ρόλος της DNA δεσμάσης;

Α ΠΑΝΤΗΣΗ

• • • •

Στην αντιγραφή συνδέει τα τμήματα της ασυνεχούς αλυσίδας... (σελ. 30 σχολικού βιβλίου). Συνδέει τα κομμάτια που προκύπτουν στις διαφορετικές θέσεις έναρξης της αντιγραφής... (σελ. 30 σχολικού βιβλίου). Στη δημιουργία γονιδιωματικής ή cDNA βιβλιοθήκης... (σελ. 58, 60 σχολικού βιβλίου). Στη δημιουργία διαγονιδιακών φυτών με το πλασμίδιο Ti... (σελ. 132 σχολικού βιβλίου).

15. Ένα άτομο έχει σε ένα χρωμόσωμά του το γονίδιο το υπεύθυνο για τη σύνθεση της φυσιολογικής β πολυπεπτιδικής αλυσίδας της αιμοσφαιρίνης καθώς και το γονίδιο βs. Τι είδους μετάλλαξη φέρει; Τι είδους πεπτιδικές αλυσίδες παράγει; Πώς μπορεί να εντοπιστεί ένα τέτοιο άτομο;

Α ΠΑΝΤΗΣΗ

• • •

δομική χρωμοσωμική ανωμαλία - διπλασιασμός και ταυτόχρονα γονιδιακή μετάλλαξη (Β  βs). Φυσιολογικές και τροποποιημένες (γλουταμινικό  βαλίνη) β-αλυσίδες. Με μοριακή διάγνωση και ταυτόχρονα χρώση των χρωμοσωμάτων (ζώνες Giemsa), με δοκιμασία δρεπάνωσης και με βιοχημική ανάλυση εντοπισμού του είδους της αιμοσφαιρίνης.

16. Γιατί η μονοσωμία είναι συνήθως θανατηφόρος για τον οργανισμό; Υπάρχει περίπτωση μονοσωμίας που το άτομο να είναι βιώσιμο;

Α ΠΑΝΤΗΣΗ

• •

Γιατί τα χρωμοσώματα με τα γονίδια που περιέχουν πρέπει να υπάρχουν σε δύο δόσεις για την εξασφάλιση βιώσιμων ατόμων... (σελ. 96 σχολικού βιβλίου). Στο σύνδρομο Turner, που το άτομο είναι βιώσιμο: ΧΟ... (σελ. 97 σχολικού βιβλίου).

17. Σε ποια περίπτωση η συγκέντρωση της HbA2 αποτελεί διαγνωστικό δείκτη;

Α ΠΑΝΤΗΣΗ 388

Στην ετερόζυγη β-θαλασσαιμία (Ββ)... (σελ. 93 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 389

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

18. Πώς γίνεται η κλωνοποίηση ζώων και ποια η γενικότερη σημασία της κλωνοποίησης των ζώων;

Α ΠΑΝΤΗΣΗ

Ο πυρήνας κυττάρου του μαστικού αδένα ενός ζώου τοποθετείται σε απύρηνο ωάριο ενός άλλου ζώου. Το έμβρυο που δημιουργείται ύστερα από 3-4 διαιρέσεις εμφυτεύεται στη μήτρα θετής μητέρας-ζώου και γεννιέται το κλωνοποιημένο ζώο (Ντόλυ)... (σελ. 136 σχολικού βιβλίου). Είναι πολύ χρήσιμη για τον πολλαπλασιασμό των διαγονιδιακών ζώων και, συνεπώς, για την αύξηση παραγόμενης ποσότητας μιας φαρμακευτικής πρωτεΐνης... (σελ. 136 σχολικού βιβλίου). Επίσης, συνεισφέρει στην προστασία των απειλούμενων με εξαφάνιση ειδών... (σελ. 136 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

19. Τι είναι το εμφύσημα και τι το ρετινοβλάστωμα;

Α ΠΑΝΤΗΣΗ

• •

Εμφύσημα  γενετική ασθένεια που οφείλεται στην έλλειψη (λόγω μετάλλαξης) της α1 αντιθρυψίνης... (σελ. 135 σχολικού βιβλίου). Ρετινοβλάστωμα  καρκίνος του αμφιβληστροειδούς χιτώνα που οφείλεται στην έλλειψη (λόγω μετάλλαξης) ογκοκατασταλτικού γονιδίου... (σελ. 101 σχολικού βιβλίου).

20. Πού βασίζεται η άποψη ότι ο καρκίνος είναι μια πολύπλοκη ασθένεια και όχι απλώς ένας κληρονομικός χαρακτήρας; Πώς μπορεί να κατανοηθεί ο μηχανισμός καρκινογένεσης;

Α ΠΑΝΤΗΣΗ

Στο ότι προκαλείται από συσσώρευση γενετικών αλλαγών στα κύτταρα ως αποτέλεσα διαφορετικών μεταλλαξογόνων παραγόντων και στο ότι στη δημιουργία του συμμετέχουν ογκογονίδια και ογκοκατασταλτικά γονίδια... (σελ. 101 σχολικού βιβλίου). Η διαλεύκανση των μηχανισμών ρύθμισης της γονιδιακής έκφρασης θα απαντήσει στο πώς τα κύτταρα μετατρέπονται σε καρκινικά... (σελ. 41 σχολικού βιβλίου).

21. Σε ένα ζώο που προήλθε από ζυγωτό στο οποίο έγινε, επιτυχής μικροέγχυση, ποιων ατόμων ιδιότητες θα εκφράζονται στο ζώο αυτό;

Α ΠΑΝΤΗΣΗ Του αρσενικού και του θηλυκού γονέα καθώς και η επιθυμητή ιδιότητα του ατόμου από το οποίο προήλθε το γονίδιο που εισάγεται με μικροέγχυση στο ζυγωτό... (σελ. 133 σχολικού βιβλίου).

389

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 390

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

22. Ποια μόρια νουκλεϊκών οξέων αφορά η υβριδοποίηση; Πού εφαρμόζεται υβριδοποίηση νουκλεϊκών οξέων στα φυτά;

Α ΠΑΝΤΗΣΗ

Μονόκλωνες συμπληρωματικές αλυσίδες DNA ή DNA - RNΑ... (σελ. 60, 61 σχολικού βιβλίου). Στο βακτήριο Bacillus thuringiensis εφαρμόζεται για τον εντοπισμό του γονιδίου που κωδικοποιεί την ισχυρή τοξίνη και σε κατάλληλη βιβλιοθήκη φυτικών οργανισμών για τον εντοπισμό επιθυμητών γονιδίων. Στη συνέχεια, με το επιθυμητό γονίδιο ανασυνδυάζουμε το πλασμίδιο Ti, οπότε δημιουργούμε διαγονιδιακά φυτά... (σελ. 131, 132, 133 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

23. Ποιες είναι οι παθήσεις οι οποίες οφείλονται σε αλλαγή του ποσού της γενετικής πληροφορίας που περιέχεται στα κύτταρα;

Α ΠΑΝΤΗΣΗ

• • • •

Σύνδρομο «φωνή της γάτας»... (σελ. 97 σχολικού βιβλίου). α-Θαλασσαιμία... (σελ. 93 σχολικού βιβλίου). Καρκίνος (ρετινοβλάστωμα)... (σελ. 101 σχολικού βιβλίου). Σύνδρομο Turner (ΧΟ)... (σελ. 97 σχολικού βιβλίου).

24. Τί γνωρίζετε για τον καρκίνο;

Α ΠΑΝΤΗΣΗ

• • • • • • • • •

390

Μετά από μεταλλάξεις σε πρωτοογκογονίδια και ογκοκατασταλτικά γονίδια προκαλείται καρκίνος στον άνθρωπο... (σελ. 101 σχολικού βιβλίου). Βλάβες στους μηχανισμούς επιδιόρθωσης του DNA έχουν ως αποτέλεσμα την αυξημένη συχνότητα εμφάνισης καρκίνου... (σελ. 101 σχολικού βιβλίου). Εμφανίζει πολυπλοκότητα ως ασθένεια... (σελ. 101 σχολικού βιβλίου). Σε ασθενείς με ανεπάρκεια του ανοσοποιητικού συστήματος εμφανίζεται προδιάθεση για ανάπτυξη καρκίνου σε πολύ μικρή ηλικία... (σελ. 123 σχολικού βιβλίου). Σε εφαρμογή γονιδιακής θεραπείας, οι ιοί-φορείς (αν και είναι αβλαβείς) μπορεί να προκαλέσουν σε ορισμένες περιπτώσεις καρκίνο... (σελ. 125 σχολικού βιβλίου). Τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν θεραπευτικά ως μεταφορείς ισχυρών αντικαρκινικών φαρμάκων... (σελ. 119, 120 σχολικού βιβλίου). Η απορρύθμιση του μηχανισμού της γονιδιακής έκφρασης μετατρέπει τα κύτταρα σε καρκινικά... (σελ. 41 σχολικού βιβλίου). Οι ιντερφερόνες ως αντικαρκινικοί παράγοντες... (σελ. 119 σχολικού βιβλίου). Το πλασμίδιο Τi περιέχει γονίδια που δημιουργούν εξογκώματα (όγκους) στο σώμα των φυτών... (σελ. 131 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 391

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

25. Τι γνωρίζετε για την πιστότητα αντιγραφής του DNA;

Α ΠΑΝΤΗΣΗ

• • •

Εφαρμογή του κανόνα της συμπληρωματικότητας των αζωτούχων βάσεων (ημισυντηρητικός τρόπος αντιγραφής)... 1ος ρόλος DNA πολυμερασών (σελ. 28 σχολικού βιβλίου). DNA πολυμεράση ως επιδιορθωτικό ένζυμο... (σελ. 28 σχολικού βιβλίου). Ειδικά επιδιορθωτικά ένζυμα... (σελ. 30 σχολικού βιβλίου). Μεταλλάξεις των γονιδίων που κωδικοποιούν τα επιδιορθωτικά ένζυμα (μελαγχρωματική ξηροδερμία, καρκίνος)... (σελ. 101 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

26. Πώς θα αιτιολογούσατε το γεγονός ότι οι δύο αδελφές χρωματίδες ενός χρωμοσώματος είναι πανομοιότυπες; Να αναφέρετε περιπτώσεις όπου οι δύο αδελφές χρωματίδες δεν περιέχουν τις ίδιες πληροφορίες σε όλο το μήκος τους.

Α ΠΑΝΤΗΣΗ

• • •

Προέρχονται από την αντιγραφή των ινιδίων χρωματίνης στη μεσόφαση (πιστότητα αντιγραφής - ημισυντηρητικός τρόπος)... (σελ. 27 σχολικού βιβλίου). Ένζυμα που συμβάλλουν στην πιστότητα (DNA πολυμεράση, ειδικά επιδιορθωτικά)... (σελ. 28, 30 σχολικού βιβλίου). Μόνο στην περίπτωση που έχει συμβεί γονιδιακή μετάλλαξη ή δομική χρωμοσωμική ανωμαλία στη μία εκ των δύο.

27. Ποιες μεθόδους διάγνωσης ασθενειών γνωρίζετε;

Α ΠΑΝΤΗΣΗ

• • • • • • •

δοκιμασία δρεπάνωσης... (σελ. 69 σχολικού βιβλίου). Μέθοδος PCR (AIDS)... (σελ. 61 σχολικού βιβλίου). Μονοκλωνικά αντισώματα... (σελ. 119 σχολικού βιβλίου). Ανάλυση καρυότυπου και μέθοδος βαφής χρωμοσωμάτων (ζώνες Giemsa)... (σελ. 98 σχολικού βιβλίου). Βιοχημικές αναλύσεις π.χ. μέτρηση ενεργότητας ενζύμου (φαινυλκετονουρία)... (σελ. 98 σχολικού βιβλίου). Ανάλυση DNA (μοριακή διάγνωση)... (σελ. 98 σχολικού βιβλίου). Αυξημένη σύνθεση HbA2... (σελ. 93 σχολικού βιβλίου).

391

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 392

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

28. Ποιες ασθένειες στον άνθρωπο οφείλονται είτε στη μη σύνθεση είτε στη σύνθεση τροποποιημένων αιμοσφαιρινών;

Α ΠΑΝΤΗΣΗ •

α- και β-Θαλασσαιμία... (σελ. 93 σχολικού βιβλίου). δρεπανοκυτταρική αναιμία... (σελ. 89, 90 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

29. Σε τι μπορεί να διαφέρουν μεταξύ τους τα ερυθρά αιμοσφαίρια του ανθρώπου;

Α ΠΑΝΤΗΣΗ

• • •

Στα αντιγόνα Α και Β (ομάδες αίματος) που φέρουν στην επιφάνειά τους... (σελ. 75, 76 σχολικού βιβλίου). ως προς το είδος των αιμοσφαιρινών που περιέχουν (Hb A, Hb F, Hb A2, Hb S)... (σελ. 89, 93 σχολικού βιβλίου). ως προς το σχήμα τους (στρογγυλό ή δρεπανοειδές)... (σελ. 90 σχολικού βιβλίου).

30. Τι προκύπτει από τη διαδικασία της μεταγραφής;

Α ΠΑΝΤΗΣΗ

• •

Όλα τα είδη RNA (mRNA, tRNA, rRNA, snRNA)... (σελ. 31 σχολικού βιβλίου). Το mRNA μπορεί να είναι πρόδρομο ή ώριμο... (σελ. 33 σχολικού βιβλίου).

31. Πού βασίζεται η δυνατότητα χρησιμοποίησης των μονοκλωνικών αντισωμάτων ως διαγνωστικών μέσων;

Α ΠΑΝΤΗΣΗ

Επειδή αναγνωρίζουν ειδικά έναν αντιγονικό καθοριστή... (σελ. 119 σχολικού βιβλίου). 32. Σε ποιες περιπτώσεις εφαρμόζεται η συμπληρωματικότητα μεταξύ των αζωτούχων βάσεων δεσοξυριβονουκλεοτιδίων και ριβονουκλεοτιδίων;

Α ΠΑΝΤΗΣΗ

• • • • •

392

δημιουργία cDNA βιβλιοθήκης (mRNA - cDNA)... (σελ. 60 σχολικού βιβλίου). Πρωταρχικά τμήματα - μητρικές αλυσίδες DNA... (σελ. 28 σχολικού βιβλίου). Μη κωδική - RNA (μεταγραφή)... (σελ. 33 σχολικού βιβλίου). Αντίστροφη μεταγραφή (RNA - DNA)... (σελ. 31 σχολικού βιβλίου). Ανιχνευτές RNA για ανίχνευση γονιδίου DNA... (σελ. 61 σχολικού βιβλίου).

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 393

ΣυΝδυΑΣΤιΚΑ ΘΕΜΑΤΑ (ΘΕΜΑ

Γ ΄ - ΠΑΝΕΛ

ΛΑδιΚω Ν

)

33. Ποιος είναι ο ρόλος της αντίστροφης μεταγραφάσης;

Α ΠΑΝΤΗΣΗ •

δημιουργία cDNA βιβλιοθήκης... (σελ. 60 σχολικού βιβλίου). RNA ιοί (για τον πολ/σμό τους)... (σελ. 31 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

34. Κύτταρα δύο διαφορετικών οργανισμών έχουν κατά τη μετάφαση της μίτωσης τα παρακάτω μόρια DNA : 38 μόρια DNA και 28 μόρια DNA. Ποιο από τα δύο κύτταρα είναι απλοειδές και ποιο διπλοειδές;

Α ΠΑΝΤΗΣΗ

• •

Εισαγωγή για τα μεταφασικά χρωμοσώματα... (σελ. 20 σχολικού βιβλίου). 38 μόρια DNA, άρα 38 : 2 = 19 χρωμοσώματα με τη μορφή αδελφών χρωματίδων ενωμένων στο κεντρομερίδιο. Τα 19 χρωμοσώματα δεν μπορούν να είναι σε ζεύγη, οπότε το κύτταρο είναι απλοειδές. 28 : 2 = 14 χρωμοσώματα, άρα 7 ζεύγη, οπότε το κύτταρο μπορεί να είναι διπλοειδές.

35. Ποιες γενετικές διαταραχές στον άνθρωπο γνωρίζετε ότι οφείλονται στην έλλειψη ενός ενζύμου;

Α ΠΑΝΤΗΣΗ

• • • •

Φαινυλκετρονουρία (PKU)... (σελ. 94 σχολικού βιβλίου). Αλφισμός... (σελ. 94 σχολικού βιβλίου). Ανεπάρκεια ανοσοποιητικού συστήματος (ADA)... (σελ. 123 σχολικού βιβλίου). Μελαγχρωματική ξηροδερμία... (σελ. 101 σχολικού βιβλίου).

36. Γνωρίζετε περιπτώσεις στις οποίες αντί να υπάρχουν δύο αλληλόμορφα γονίδια για μια ιδιότητα υπάρχουν περισσότερα;

Α ΠΑΝΤΗΣΗ

• • • • •

Τα γονίδια που κωδικοποιούν την α πολυπεπτιδική αλυσίδα είναι διπλά, δηλαδή υπάρχουν δύο γονίδια α σε κάθε ομόλογο χρωμόσωμα... (σελ. 93 σχολικού βιβλίου). Στα πολλαπλά αλληλόμορφα, π.χ στις ομάδες αίματος και στη β-Θαλασσαιμία (σε πληθυσμό ατόμων)... (σελ. 77 σχολικού βιβλίου). Στον διπλασιασμό (δομική χρωμοσωμική ανωμαλία)... (σελ. 97 σχολικού βιβλίου). Στις τρισωμίες (Down, 13, 18)... (σελ. 96 σχολικού βιβλίου). Στα κύτταρα ανθρώπων που έχουν υποβληθεί σε γονιδιακή θεραπεία (ασθενής με κυστική ίνωση κκΚ)... (σελ. 123, 125 σχολικού βιβλίου).

393

ΣΥΝΔΥΑΣΤΙΚΑ_Layout 1 19/11/2012 6:15 μμ Page 394

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

37. Γνωρίζετε περιπτώσεις στις οποίες για κάποιες ιδιότητες αντί να υπάρχουν δύο αλληλόμορφα υπάρχει μόνο ένα;

Α ΠΑΝΤΗΣΗ • • • • •

394

Τα φυλοσύνδετα γονίδια αρσενικών ατόμων... (σελ. 80 σχολικού βιβλίου). Στα απλοειδή κύτταρα (γαμέτες)... (σελ. 71 σχολικού βιβλίου). Σύνδρομο «φωνή της γάτας»... (σελ. 97 σχολικού βιβλίου). Σε άτομα που πάσχουν από α-θαλασσαιμία μπορεί να λείπει ένα, δύο, τρία ή και τα τέσσερα αλληλόμορφα γονίδια για την α αλυσίδα... (σελ. 93 σχολικού βιβλίου). Ρετινοβλάστωμα, έλλειψη ενός ογκοκατασταλτικού γονιδίου... (σελ. 101 σχολικού βιβλίου). Σύνδρομο Turner, λείπουν όλα τα αλληλόμορφα γονίδια ενός Χ φυλετικού χρωμοσώματος.... (σελ. 97 σχολικού βιβλίου).

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 395

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

ρια η τ ι Κρ

σησ η γ ο λ ο αξι

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 396

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Κ ριτηριο Α ξιολογησησ Κεφάλαια 1ο, 2ο

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Τα φυλετικά χρωμοσώματα του ανθρώπου: α. Δεν περιέχουν γονίδια. β. Είναι όμοια μορφολογικά στους άνδρες και στις γυναίκες. γ. Καθορίζουν το φύλο. δ. Δεν μεταβιβάζονται στους απογόνους. Μονάδες 5 Α2. Στους περισσότερους οργανισμούς, ένα μιτοχόνδριο περιέχει: α. Ένα μόριο κυκλικού DNA. β. Δύο έως δέκα μόρια κυκλικού DNA. γ. Ένα μόριο γραμμικού RNA. δ. Πολλά μόρια γραμμικού RNA.

Μονάδες 5

Α3. Οι DNA πολυμεράσες που συμμετέχουν στην αντιγραφή του DNA μπορούν να ξε κινήσουν τη διαδικασία της αντιγραφής, αν βοηθηθούν από: α. Τα ένζυμα που διορθώνουν τα λάθη της αντιγραφής. β. Το πριμόσωμα. γ. Την DNA δεσμάση. δ. Το κωδικόνιο. Μονάδες 5 Α4. Από RNA αποτελούνται: α. Τα πρωταρχικά τμήματα. β. Οι υποκινητές. γ. Οι μεταγραφικοί παράγοντες. δ. Τα πριμοσώματα.

Μονάδες 5 Α5. Πολύσωμα είναι: α. Το οργανίδιο στο οποίο γίνεται η πρωτεϊνοσύνθεση. β. Ομάδα ριβοσωμάτων στο κυτταρόπλασμα.

396

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 397

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ. Το σύνολο των εξωνίων ενός ώριμου mRNA. δ. Το σύμπλεγμα πολλών ριβοσωμάτων με το mRNA. Μονάδες 5 ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Γιατί ο μηχανισμός αυτοδιπλασιασμού του DNA ονομάζεται ημισυντηρητικός; Μονάδες 4 Β2. Πώς σχηματίζεται το ώριμο mRNA στα ευκαρυωτικά κύτταρα;

Μονάδες 7

Β3. Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα; Όλα τα γονίδιά του μεταγράφονται αυτόνομα; Μονάδες 10

Β4. Τι εννοούμε με τον όρο γονιδίωμα; Ποια κύτταρα ονομάζονται απλοειδή και ποια διπλοειδή; Μονάδες 4 ΘΕΜΑ γ

Δίνονται τρία κωδικόνια ενός τμήματος γονιδίου από ένα μόριο DNA ευκαρυωτικού κυττάρου που κωδικοποιούν τη σύνθεση ενός πεπτιδικού τμήματος μιας πρωτεΐνης, καθώς και η διεύθυνση της μεταγραφής. Διεύθυνση μεταγραφής

Αλυσίδα 1 ... ACA-AAG-ATA ... ελεύθερο υδροξύλιο Αλυσίδα 2 ... TGT-TTC-TAT ...

γ1. Να ορίσετε τα άκρα 3΄ και 5΄ των παραπάνω αλυσίδων DNA και να αιτιολογήσετε την απάντησή σας. Μονάδες 5

γ2. Να γράψετε την αλληλουχία των βάσεων του τμήματος mRNA που προκύπτει από τη μεταγραφή, σημειώνοντας τα άκρα 3΄ και 5΄, και να αιτιολογήσετε την απάντησή σας. Μονάδες 5 γ3. Ποιο ένζυμο καταλύει τον μηχανισμό της μεταγραφής και ποια είναι η δράση του μετά την πρόσδεσή του στον υποκινητή; Σε ποια περίπτωση μετά την πρόσδεσή του στον υποκινητή δεν μπορεί να αρχίσει τη μεταγραφή; Μονάδες 10

397

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 398

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

γ4. Γιατί στους ευκαρυωτικούς οργανισμούς το mRNA, το οποίο παράγεται κατά τη μεταγραφή ενός γονιδίου, δεν αρχίζει να μεταφράζεται σε πρωτεΐνη προτού ακόμη ολοκληρωθεί η μεταγραφή του; Μονάδες 5 ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Πάνω σε ένα ώριμο mRNA που περιέχει 142 κωδικόνια βρίσκονται ταυτόχρονα 4 ριβοσώματα (πολύσωμα). Έστω ότι σε μία δεδομένη χρονική στιγμή απομακρύνονται ταυτόχρονα: από το 1ο ριβόσωμα το 94ο tRNA, από το 2ο ριβόσωμα το 69ο tRNA, από το 3ο ριβόσωμα το 44ο tRNA και από το 4ο ριβόσωμα το 9ο tRNA. Δ1. Να υπολογίσετε τον συνολικό αριθμό των αμινοξέων που έχουν χρησιμοποιηθεί μέχρι τη στιγμή αυτή για τη σύνθεση των πεπτιδικών αλυσίδων, αιτιολογώντας ταυτόχρονα την απάντησή σας. Μονάδες 15 Δ2. Πόσοι πεπτιδικοί δεσμοί υπάρχουν στην πεπτιδική αλυσίδα που συντίθεται από το 1ο ριβόσωμα; Μονάδες 3 Δ3. Πόσα μόρια tRNA θα πρέπει να χρησιμοποιηθούν ακόμα για την ολοκλήρωση της σύνθεσης της πολυπεπτιδικής αλυσίδας από το 4ο ριβόσωμα; Μονάδες 7

398

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 399

ΚριΤηριΑ Αξ

ιΟΛΟΓη

Κ ριτηριο Α ξιολογησησ Κεφάλαια 1ο, 2ο

ΣηΣ

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Τι από τα παρακάτω δεν ισχύει για τους πνευμονιόκοκκους: α. Δεν εμφανίζουν ποτέ προστατευτικό κάλυμμα. β. Δημιουργούν αποικίες. γ. Μπορεί να μην είναι παθογόνοι. δ. Μπορούν να εμφανίσουν νέο γνώρισμα. Μονάδες 5

Α2. Οι επιστήμονες μπορούν να κατασκευάσουν έναν σύνθετο ιό που προσβάλλει βακτήρια (βακτηριοφάγος ή φάγος) και ο οποίος έχει το πρωτεϊνικό κάλυμμα του φάγου Τ4 και το DNA του φάγου Τ2. Όταν ο σύνθετος αυτός φάγος μολύνει ένα βακτήριο, οι απόγονοι φάγοι που θα παραχθούν θα έχουν: α. Τις πρωτεΐνες του φάγου Τ4 και το DNA του φάγου Τ2. β. Τις πρωτεΐνες του φάγου Τ2 και το DNA του φάγου Τ4. γ. Τις πρωτεΐνες και το DNA του φάγου Τ4. δ. Τις πρωτεΐνες και το DNA του φάγου Τ2. Μονάδες 5 Α3. Από RNA αποτελείται: α. Ο υποκινητής. β. η RNA πολυμεράση. γ. Τα πρωταρχικά τμήματα. δ. η αντίστροφη μεταγραφάση.

Μονάδες 5

Α4. Το κωδικόνιο είναι: α. Μια τριάδα νουκλεοτιδίων. β. Μια τριάδα αμινοξέων. γ. Έξι νουκλεοτίδια συνδεδεμένα με δεσμούς υδρογόνου. δ. Το αμινοξύ μεθειονίνη.

Μονάδες 5

399

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 400

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Α5. Κάθε μεταφορικό RNA: α. Σχηματίζει το ριβόσωμα. β. Περιέχει θυμίνη. γ. Καταλύει την ωρίμανση του mRNA. δ. Μεταφέρει ένα συγκεκριμένο αμινοξύ στο ριβόσωμα.

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Να περιγράψετε πειράματα που απέδειξαν ότι το DNA αποτελεί γενετικό υλικό. Μονάδες 8 Β2. Ποια είναι η μορφή του DNA των μιτοχονδρίων και των χλωροπλαστών;

Μονάδες 4

Β3. Ποιος είναι, συνοπτικά, ο ρόλος των σταδίων του κεντρικού δόγματος της Μοριακής Βιολογίας; Μονάδες 9

Β4. Να γράψετε τρεις διαφορές ανάμεσα στο γενετικό υλικό των προκαρυωτικών και των ευκαρυωτικών κυττάρων. Μονάδες 4 ΘΕΜΑ γ

γ1. Από πρόδρομα ερυθρά αιμοσφαίρια απομονώνουμε mRNA που κωδικοποιεί τη β-αλυσίδα της αιμοσφαιρίνης και το τοποθετούμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε σύνθεση β-αλυσίδων της αιμοσφαιρίνης. Να εξηγήσετε το φαινόμενο. (Το εκχύλισμα κυττάρων περιέχει όλα τα λειτουργικά συστατικά που είναι απαραίτητα για τη διαδικασία της πρωτεϊνοσύνθεσης.) Μονάδες 4 γ2. Ποιος είναι ο ρόλος των DNA πολυμερασών στην αντιγραφή του DNA;

Μονάδες 6

γ3. Με ποιον τρόπο πρωτεΐνες συμμετέχουν στην οργάνωση του γενετικού υλικού των οργανισμών; Μονάδες 7

400

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 401

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ4. Σε ποιες περιπτώσεις μόρια RNA, προκειμένου να αποκτήσουν βιολογικό ρόλο, ενώνονται με πρωτεΐνες; Ποιος είναι τότε ο βιολογικός τους ρόλος; Μονάδες 8 ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Δ1. Μια λειτουργική πρωτεΐνη αποτελείται από 300 αμινοξέα. Προκειμένου να γίνει λειτουργική, απομακρύνθηκαν 50 αμινοξέα από το αμινικό άκρο της πολυπεπτιδικής αλυσίδας. Εάν οι 3΄ και 5΄ αμετάφραστες περιοχές έχουν 100 αζωτούχες βάσεις και το γονίδιο που κωδικοποιεί την πρωτεΐνη έχει μήκος 5.000 ζεύγη βάσεων, να βρείτε το μήκος των εσωνίων του γονιδίου. Μονάδες 15 Δ2. Δίνονται πέντε αμινοξέα και, δίπλα τους, τριπλέτες του γενετικού κώδικα που κωδικοποιούν τα αμινοξέα αυτά: Τυροσίνη (tyr) - UAU Φαινυλαλανίνη (phe) - UUU Προλίνη (pro) - CCC Μεθειονίνη (met) - AUG Γλυκίνη (gly) - GGG Τα πέντε παραπάνω αμινοξέα συγκροτούν ολιγοπεπτίδιο που αποτελεί το πρώτο τμήμα πρωτεΐνης ενός βακτηριακού κυττάρου. α. Να γράψετε στο τετράδιό σας ποιο είναι το πρώτο (αρχικό) και ποιο το τέταρτο αμινοξύ του ολιγοπεπτιδίου. phe

pro

gly

β. Να γράψετε μια αλληλουχία νουκλεοτιδίων του mRNA που κωδικοποιεί το παραπάνω ολιγοπεπτίδιο, σημειώνοντας τα άκρα 3΄ και 5΄. γ. Να γράψετε την αλληλουχία των νουκλεοτιδίων της κωδικής αλυσίδας του DNA και να σημειώσετε το 5΄ και το 3΄ άκρο της. Να αιτιολογήσετε τις απαντήσεις σας. Μονάδες 10

401

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 402

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Κ ριτηριο Α ξιολογησησ Κεφάλαια 4ο, 5ο

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Ο φορέας κλωνοποίησης είναι: α. Ειδικό ένζυμο που αποκόπτει γονίδια. β. Ένα μόριο DNA όπως, για παράδειγμα, ένα πλασμίδιο. γ. Ένας οργανισμός που έχει υποστεί κλωνοποίηση. δ. Κρατικός φορέας που ελέγχει τις κλωνοποιήσεις. Μονάδες 5 Α2. Οι περιοριστικές ενδονουκλεάσες: α. Παράγονται από ιούς. β. Είναι απαραίτητες για την έναρξη της αντιγραφής. γ. Συμμετέχουν στην αντίστροφη μεταγραφή. δ. Παράγονται από βακτήρια.

Μονάδες 5

Α3. η αιμορροφιλία Α είναι μια ασθένεια που εμφανίζεται: α. Συχνότερα στα θηλυκά άτομα. β. Μόνο στα θηλυκά άτομα. γ. Συχνότερα στα αρσενικά άτομα. δ. Μόνο στα αρσενικά άτομα.

Μονάδες 5

Α4. Για τη δημιουργία ανασυνδυασμένου DNA ενώνονται τμήματα DNA διαφορετικών οργανισμών, τα οποία κόπηκαν από την ίδια περιοριστική ενδονουκλεάση. η ένωση αυτή γίνεται με τη βοήθεια του ενζύμου: α. DNA ελικάση. β. DNA πολυμεράση. γ. RNA πολυμεράση. δ. DNA δεσμάση. Μονάδες 5 Α5. Ο χαρακτήρας «προσκολλημένοι λοβοί των αυτιών» στον άνθρωπο καθορίζεται από: α. Αυτοσωμικό επικρατές γονίδιο. β. Φυλοσύνδετο επικρατές γονίδιο.

402

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 403

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ. Αυτοσωμικό υπολειπόμενο γονίδιο. δ. Φυλοσύνδετο υπολειπόμενο γονίδιο. Μονάδες 5

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Ποια βήματα ακολουθούνται για την κατασκευή μιας cDNA βιβλιοθήκης;

Μονάδες 9

Β2. Τι μπορούμε να πετύχουμε με τη μέθοδο της αλυσιδωτής αντίδρασης πολυμεράσης (PCR) και ποιες είναι οι πρακτικές εφαρμογές της; Μονάδες 5

Β3. Τι είναι τα πολλαπλά αλληλόμορφα γονίδια και γιατί μπορεί να αλλάζουν τις αναλογίες των νόμων του Mendel; Μονάδες 5 Β4. Πώς διατυπώνονται οι δύο νόμοι του Mendel;

Μονάδες 6

ΘΕΜΑ γ

γ1. Το παρακάτω γενεαλογικό δένδρο αναπαριστά τον τρόπο με τον οποίο κληρονομείται η ανεπάρκεια του ανοσοποιητικού συστήματος σε μια οικογένεια. 1

2

ι

ιι

1

2

3

Με βάση τα δεδομένα του γενεαλογικού δένδρου, να βρείτε αν η ανεπάρκεια του ανοσοποιητικού συστήματος: α. Οφείλεται σε αυτοσωμικό ή φυλοσύνδετο γονίδιο. β. Κληρονομείται ως επικρατής ή υπολειπόμενος χαρακτήρας. Να αιτιολογήσετε τις απαντήσεις σας και να προσδιορίσετε τους γονότυπους των μελών της οικογένειας. Μονάδες 14

403

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 404

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

γ2. Δίνεται το παρακάτω τμήμα DNA ενός προκαρυωτικού οργανισμού: Αλυσίδα I: CCAGAATTCAATTCAGGACCTTAAGAATTCAAC Αλυσίδα II: GGTCTTAAGTTAAGTCCTGGAATTCTTAAGTTG α. Ποιοι οργανισμοί διαθέτουν περιοριστικές ενδονουκλεάσες και ποιος είναι ο φυσιολογικός τους ρόλος; Μονάδες 3 β. Το παραπάνω τμήμα DNA κόβεται με την περιοριστική ενδονουκλεάση EcoRI. Να γράψετε τα τμήματα DNA που προκύπτουν μετά τη δράση της EcoRI και να αιτιολογήσετε την απάντησή σας. Μονάδες 8 ΘΕΜΑ Δ

Γυναίκα με ομάδα αίματος Α παντρεύεται άνδρα με ομάδα αίματος Β και γεννούν δύο παιδιά, εκ των οποίων το πρώτο, που είναι κορίτσι, έχει ομάδα αίματος Α και το δεύτερο ομάδα αίματος Ο. Το δεύτερο παιδί πάσχει από κληρονομική ασθένεια. Οι δύο γονείς είναι υγιείς, ενώ μόνο η μητέρα είναι φορέας του υπολειπόμενου γονιδίου που ελέγχει την ασθένεια αυτή. Για τα γονίδια που ελέγχουν τους παραπάνω χαρακτήρες ισχύει ο δεύτερος νόμος του Mendel. Δ1. Να βρείτε τους γονότυπους των γονέων και των παιδιών τους ως προς τους δύο χαρακτήρες, κάνοντας τις κατάλληλες διασταυρώσεις. Μονάδες 15 Δ2. Να δικαιολογήσετε το φύλο του δεύτερου παιδιού.

Μονάδες 10

404

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 405

ΚριΤηριΑ Αξ

ιΟΛΟΓη

Κ ριτηριο Α ξιολογησησ Κεφάλαια 1ο, 2ο, 4ο, 5ο

ΣηΣ

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Στα πειράματά τους οι Avery, Mac-Leod και McCarty διαπίστωσαν ότι ο μετασχηματισμός των αδρών βακτηρίων σε λεία οφείλεται: α. Στο DNA. β. Στο RNA. γ. Στους υδατάνθρακες. δ. Στις πρωτεΐνες. Μονάδες 5

Α2. η εισαγωγή ανασυνδυασμένου μορίου DNA σε βακτηριακό κύτταρο-ξενιστή ονομάζεται: α. Γονιδιωματική βιβλιοθήκη. β. cDNA βιβλιοθήκη. γ. Βακτηριακός κλώνος. δ. Μετασχηματισμός. Μονάδες 5

Α3. Ένα αγόρι πάσχει από μερική αχρωματοψία στο πράσινο και στο κόκκινο χρώμα. Αυτό οφείλεται στο γεγονός ότι: α. Κληρονόμησε αυτή την ιδιότητα από τον πατέρα του. β. Κληρονόμησε αυτή την ιδιότητα από τη μητέρα του. γ. Κληρονόμησε αυτή την ιδιότητα και από τους δύο γονείς. δ. Είναι ομόζυγο για το υπολειπόμενο γονίδιο της αχρωματοψίας. Μονάδες 5 Α4. η ωρίμανση του mRNA: α. Είναι μια διαδικασία που καταλύεται από DNA ελικάσες. β. Συμβαίνει μόνο στους προκαρυωτικούς οργανισμούς. γ. Συμβαίνει στον πυρήνα των ευκαρυωτικών κυττάρων. δ. Είναι μια διαδικασία στην οποία παραμένουν για μετάφραση τα εσώνια. Μονάδες 5 Α5. η DNA δεσμάση: α. Ενώνει τα κομμάτια της αλυσίδας DNA που αντιγράφεται ασυνεχώς. β. Είναι το ένζυμο με το οποίο σχηματίζονται τα πρωταρχικά τμήματα.

405

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 406

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

γ. Είναι το κύριο ένζυμο της αντιγραφής. δ. Επιδιορθώνει τα λάθη της αντιγραφής. Μονάδες 5 ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Ποιες ονομάζονται θέσεις έναρξης της αντιγραφής του DNA και γιατί το DNA των ευκαρυωτικών κυττάρων αντιγράφεται πολύ γρήγορα; Μονάδες 5

Β2. Πώς μπορούμε να εντοπίσουμε ένα συγκεκριμένο κομμάτι κλωνοποιημένου DNA σε μια γονιδιωματική βιβλιοθήκη; Μονάδες 6 Β3. Ποια είναι τα τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή και ποιος ο ρόλος καθενός από αυτά; Μονάδες 6

Β4. Σε ποιες κατηγορίες γονιδίων, στην F2 γενιά, ταυτίζεται η γονοτυπική με τη φαινοτυπική αναλογία; Να δώσετε τη σχετική εξήγηση, κάνοντας τις κατάλληλες διασταυρώσεις. Μονάδες 8 ΘΕΜΑ γ

γ1. Στα σωματικά κύτταρα του ανθρώπου υπάρχουν σαράντα έξι (46) χρωμοσώματα. α. Πόσα χρωμοσώματα κληρονομεί ένα παιδί από τον πατέρα του; Να αιτιολογήσετε την απάντησή σας. Μονάδες 3 β. Πόσα αυτοσωμικά και πόσα φυλετικά χρωμοσώματα υπάρχουν στα σωματικά κύτταρα μιας γυναίκας; Να αιτιολογήσετε την απάντησή σας. Μονάδες 5

γ2. Φυτό Α διασταυρώνεται με φυτό Β του ίδιου είδους που έχει κόκκινα άνθη. Από τη διασταύρωση αυτή παίρνουμε φυτά με λευκά και φυτά με κόκκινα άνθη. Το κόκκινο χρώμα καθορίζεται από υπολειπόμενο και αυτοσωμικό γονίδιο. α. Να γράψετε τη διασταύρωση μεταξύ των φυτών Α και Β και να αιτιολογήσετε τον γονότυπο του φυτού Α. Μονάδες 12 β. Τι ονομάζεται διασταύρωση ελέγχου και για ποιον σκοπό τη χρησιμοποιούμε; Μονάδες 5

406

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 407

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Δίνεται το παρακάτω τμήμα mRNA που προκύπτει από τη μεταγραφή ενός γονιδίου βακτηριακού κυττάρου: mRNA: 5΄-AUG-CCU-CAU-CGU-UCU-ACU-UUU-UAA-3΄ Δ1. Να γράψετε στο τετράδιό σας τη μη κωδική αλυσίδα από την οποία προήλθε το παραπάνω mRNA και να ορίσετε τα ελεύθερα άκρα. Μονάδες 7 Δ2. Αντικαθιστούμε μία τριπλέτα του παραπάνω mRNA με την τριπλέτα 5΄-UGA-3΄, και το πεπτίδιο που κωδικοποιείται δεν υφίσταται την παραμικρή αλλαγή. Ποια είναι η τριπλέτα αυτή; (Μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (Μονάδες 4) Μονάδες 6 Δ3. η τριπλέτα 5΄-UCU-3΄ του παραπάνω mRNA κωδικοποιεί το αμινοξύ σερίνη. Αν αντικαταστήσουμε αυτή την τριπλέτα με την τριπλέτα 5΄-UCC-3΄, δεν προκύπτει η παραμικρή αλλαγή στο πεπτίδιο. Πώς ερμηνεύεται το γεγονός αυτό, με βάση τα χαρακτηριστικά του γενετικού κώδικα; Μονάδες 6 Δ4. Να βρείτε: • Τα αντικωδικόνια και τα ελεύθερα άκρα τους, με τη σειρά με την οποία παίρνουν μέρος στη μετάφραση. • Τον αριθμό των αμινοξέων του πεπτιδίου που θα προκύψει. Να αιτιολογήσετε τις απαντήσεις σας. Μονάδες 6

407

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 408

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Κ ριτηριο Α ξιολογησησ Κεφάλαια 6ο, 7ο

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Τα εμβρυϊκά κύτταρα που λαμβάνονται με την αμνιοπαρακέντηση χρησιμοποιούνται για: α. Την ανάλυση DNA. β. Τη βιοχημική ανάλυση ορισμένων πρωτεϊνών και ενζύμων. γ. Τη διάγνωση χρωμοσωμικών ανωμαλιών. δ. Όλα τα παραπάνω. Μονάδες 5 Α2. Το σύνδρομο φωνή της γάτας (cri du chat) οφείλεται σε: α. Γονιδιακή μετάλλαξη. β. Έλλειψη τμήματος ενός χρωμοσώματος. γ. Επίδραση ιών και βακτηρίων. δ. Προσθήκη βάσεων και νουκλεοτιδίων.

Μονάδες 5

Α3. Το άγαρ είναι: α. Πολυσακχαρίτης που προέρχεται από φύκη. β. Πρωτεΐνη που προέρχεται από φύκη. γ. Πηγή αζώτου για τις κυτταροκαλλιέργειες. δ. ρευστό υλικό σε θερμοκρασίες κάτω από 45 οC.

Μονάδες 5

Α4. Στη στατική φάση μιας κλειστής καλλιέργειας μικροοργανισμών, ο πληθυσμός: α. Αυξάνεται. β. Αυξάνεται με ταχύ ρυθμό. γ. Δεν αυξάνεται. δ. Μηδενίζεται. Μονάδες 5 Α5. Εμβολιασμός είναι: α. η απομάκρυνση άχρηστων προϊόντων από μια καλλιέργεια. β. η αποστείρωση του θρεπτικού υλικού.

408

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 409

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ. η προσθήκη θρεπτικών συστατικών σε μια καλλιέργεια. δ. η προσθήκη μικρής ποσότητας μικροοργανισμών σε θρεπτικό υλικό. Μονάδες 5 ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Ποιοι περιβαλλοντικοί παράγοντες έχουν μεταλλαξογόνο δράση και πώς αντιμετωπίζονται από το κύτταρο οι αλλαγές που προκαλούνται από τη δράση των παραγόντων αυτών; Μονάδες 5

Β2. Ποιοι παράγοντες επηρεάζουν τον ρυθμό ανάπτυξης των μικροοργανισμών σε μια μικροβιακή καλλιέργεια και με ποιον τρόπο; Μονάδες 8 Β3. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση, προτού προχωρήσουν στην απόκτηση απογόνων; Μονάδες 4

Β4. Να περιγράφετε τις διαδικασίες που πρέπει να ακολουθηθούν για τη διάγνωση του συνδρόμου Turner πριν από τη γέννηση ενός παιδιού. Μονάδες 8 ΘΕΜΑ γ

γ1. Βιοτεχνολογία, με την ευρεία έννοια, είναι η χρήση ζωντανών οργανισμών προς όφελος του ανθρώπου και στηρίζεται κυρίως σε τεχνικές καλλιέργειας και ανάπτυξης των μικροοργανισμών και σε τεχνικές ανασυνδυασμένου DNA. α. Με ποιον τρόπο καλλιεργούνται οι μικροοργανισμοί σε μεγάλη κλίμακα (βιομηχανική καλλιέργεια); Ποια είναι συνοπτικά τα βήματα που προηγούνται της βιομηχανικής καλλιέργειας; Μονάδες 10 β. Τι εννοούμε με τον όρο ζύμωση και ποια είναι τα προϊόντα της ζύμωσης; Μονάδες 4 γ2. Το σύνδρομο Down είναι η πιο κοινή χρωμοσωμική ανωμαλία. α. Ποια είναι τα φαινοτυπικά χαρακτηριστικά των ατόμων που πάσχουν από σύνδρομο Down; Μονάδες 4

409

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:17 μμ Page 410

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

β. Στον καρυότυπο των ατόμων με το συγκεκριμένο σύνδρομο εμφανίζεται ένα επιπλέον χρωμόσωμα. Να περιγράψετε τον μηχανισμό που προκαλεί αυτή τη χρωμοσωμική ανωμαλία. Μονάδες 7 ΘΕΜΑ Δ

t0

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Αριθμός κυττάρων

η παρακάτω καμπύλη αποδίδει την ανάπτυξη μικροοργανισμών του είδους E. coli σε κάποια κλειστή καλλιέργεια.

t1

t2

t3

t4

t5

t6

Χρόνος

Δ1. Πώς ονομάζεται η φάση από τη χρονική στιγμή t0 έως και τη χρονική στιγμή t1 και τι συμβαίνει με τον πληθυσμό των μικροοργανισμών; Μονάδες 5

Δ2. Πού οφείλεται η αύξηση του αριθμού των μικροοργανισμών η οποία παρατηρείται στο διάστημα από τη χρονική στιγμή t1 έως τη χρονική στιγμή t2 και πώς ονομάζεται η φάση αυτή; Μονάδες 5

Δ3. Τη χρονική στιγμή t3 και ενώ η στατική φάση είναι σχεδόν στο μέσον της, από βλάβη στον βιοαντιδραστήρα η θερμοκρασία ανεβαίνει απότομα στους 62 οC. η βλάβη αποκαθίσταται ταχύτατα. Να ερμηνεύσετε τις μεταβολές του πληθυσμού των μικροοργανισμών από τη χρονική στιγμή t3 και μετά, όπως αυτές περιγράφονται από την καμπύλη ανάπτυξης. Μονάδες 15

410

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 411

ΚριΤηριΑ Αξ

ιΟΛΟΓη

Κ ριτηριο Α ξιολογησησ Κεφάλαια 8ο, 9ο

ΣηΣ

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Στη μέθοδο της μικροέγχυσης χρησιμοποιούνται: α. Β-λεμφοκύτταρα. β. Πλασμίδια. γ. Καρκινικά κύτταρα. δ. Γονιμοποιημένα ωάρια ζώων. Μονάδες 5

Α2. Στην ex vivo γονιδιακή θεραπεία, τα κύτταρα του ασθενούς: α. Τροποποιούνται μέσα στον οργανισμό του. β. Τροποποιούνται έξω από τον οργανισμό του και εισάγονται πάλι σ’ αυτόν. γ. Συντήκονται με καρκινικά κύτταρα. δ. ιχνηθετούνται με ραδιενεργό φωσφόρο. Μονάδες 5 Α3. Το βακτήριο Bacillus thuringiensis που ζει στο έδαφος: α. Διαθέτει τη φυσική ικανότητα να μολύνει φυτικά κύτταρα, μεταφέροντας σ’ αυτά το πλασμίδιο Ti. β. Μολύνει τα διαγονιδιακό ζώα. γ. Εκκρίνει μια ισχυρή ορμόνη. δ. Παράγει μια ισχυρή τοξίνη. Μονάδες 5 Α4. Οι ιντερφερόνες είναι πρωτεΐνες που: α. Παράγονται από τα κύτταρα του παγκρέατος. β. Παράγονται από υβριδώματα. γ. Έχουν αντιιική δράση. δ. Φέρουν γενετικές πληροφορίες.

Μονάδες 5 Α5. η ινσουλίνη είναι μια ορμόνη που: α. ρυθμίζει την παραγωγή αντιικών πρωτεϊνών. β. ρυθμίζει τον μεταβολισμό των υδατανθράκων.

411

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 412

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

γ. Παράγεται από πρόδρομα ερυθροκύτταρα. δ. Παράγεται από Β-λεμφοκύτταρα. Μονάδες 5 ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Γιατί η «διόρθωση» μιας γενετικής βλάβης που επιτυγχάνεται με τη γονιδιακή θεραπεία δεν μεταβιβάζεται στους απογόνους; Μονάδες 5 Β2. Τι είναι και πού οφείλεται η κυστική ίνωση; Ποια είναι η διαδικασία που εφαρμόστηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993; Μονάδες 8

Β3. Τι είναι τα διαγονιδιακά ή γενετικά τροποποιημένα φυτά; Να αναφέρετε δύο δυνατότητες που μπορούν να προσφέρουν στους αγρότες τα γενετικά τροποποιημένα φυτά. Μονάδες 5 Β4. Τι είναι το πλασμίδιο Ti και πώς χρησιμοποιείται για τη δημιουργία των διαγονιδιακών φυτών; Μονάδες 7 ΘΕΜΑ γ

γ1. η βιοτεχνολογία με την παραγωγή μονοκλωνικών αντισωμάτων και τη γονιδιακή θεραπεία έχει συμβάλει αποτελεσματικά στην υλοποίηση των βασικών στόχων της ιατρικής, μεταξύ των οποίων είναι και η αποτελεσματική θεραπεία ασθενειών. α. Γιατί τα μονοκλωνικά αντισώματα μπορούν να χρησιμοποιηθούν στη θεραπεία του καρκίνου και ποια είναι τα πλεονεκτήματα που παρουσιάζει η χρήση τους έναντι άλλων μεθόδων θεραπείας του; Μονάδες 6

β. Ποιες είναι οι απαραίτητες προϋποθέσεις για την εφαρμογή της γονιδιακής θερα πείας; Γιατί η χρήση της θα είναι περιορισμένη στο άμεσο μέλλον; Μονάδες 8 γ2. η παραγωγή μιας φαρμακευτικής πρωτεΐνης ανθρώπινης προέλευσης μπορεί να γίνει και από τα διαγονιδιακά ζώα. α. Ποια είναι τα βήματα της διαδικασίας που προηγούνται της γέννησης ενός διαγονιδιακού ζώου; Μονάδες 4

412

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 413

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

β. Εκτός από τα διαγονιδιακά ζώα, από ποιους άλλους οργανισμούς είναι δυνατή η παραγωγή ανθρώπινης φαρμακευτικής πρωτεΐνης και σε ποιο χαρακτηριστικό του γενετικού κώδικα στηρίζεται η δυνατότητα αυτή; Μονάδες 7 ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

για τη δημιουργία ενός κλωνοποιημένου προβάτου –όπως ήταν η Dolly– χρησιμοποιούνται τρία πρόβατα A, Β, γ. Από το πρόβατο Α απομονώνεται ο πυρήνας από κύτταρο των μαστικών αδένων. Από ένα ωάριο του προβάτου Β αφαιρείται ο πυρήνας και στη θέση του εισάγεται ο πυρήνας του κυττάρου από το πρόβατο Α. Προκύπτει, έτσι, ένα νέο κύτταρο. το κύτταρο αυτό υφίσταται λίγες διαιρέσεις και το έμβρυο που προκύπτει εμφυτεύεται στη μήτρα του προβάτου γ. Μετά από λίγους μήνες γεννιέται το νέο πρόβατο (πρόβατο Δ). Πρόβατο Α

Πρόβατο Β

Πρόβατο γ

πυρήνας κυττάρου μαστικού αδένα

ωάριο (αφαιρείται ο πυρήνας)

εμφυτεύεται το έμβρυο

Δ1. Ποιο από τα πρόβατα A, Β, Γ έχει ταυτόσημο πυρηνικό DNA με το πρόβατο Δ και γιατί; Μονάδες 5

Δ2. Ποιο από τα πρόβατα A, Β, Γ έχει ταυτόσημο μιτοχονδριακό DNA με το πρόβατο Δ και γιατί; Μονάδες 5 Δ3. Γιατί η κλωνοποίηση είναι χρήσιμη στον πολλαπλασιασμό διαγονιδιακών ζώων; Μονάδες 6

Δ4. Με ποιον τρόπο η κλωνοποίηση μπορεί να συνεισφέρει στην προστασία από την εξα φάνιση διαφόρων ζωικών οργανισμών του πλανήτη μας; Μονάδες 6 Δ5. Τι εννοούμε με τον όρο κλώνο και τι με τον όρο κλωνοποίηση; Μονάδες 3

413

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 414

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Κ ριτηριο Α ξιολογησησ Κεφάλαια 4o, 7o, 8ο, 9ο

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Σε μια συνεχή καλλιέργεια, η ανάπτυξη των μικροοργανισμών βρίσκεται διαρκώς σε: α. Λανθάνουσα φάση. β. Στατική φάση. γ. Εκθετική φάση. δ. Φάση θανάτου. Μονάδες 5 Α2. Για να δημιουργήσουμε διαγονιδιακά φυτά, χρησιμοποιούμε: α. Τη μέθοδο της μικροέγχυσης. β. Το πλασμίδιο Τi. γ. Τις ελεγχόμενες από τον άνθρωπο διασταυρώσεις φυτών. δ. ιούς-φορείς, αφού πρώτα καταστούν αβλαβείς.

Μονάδες 5

Α3. Οι ιντερφερόνες που χρησιμοποιεί σήμερα ο άνθρωπος είναι δυνατόν να παράγονται σε μεγάλες ποσότητες από: α. Κύτταρα ανθρώπου. β. Ωάρια ζώων. γ. Γενετικά τροποποιημένα βακτήρια. δ. Φυτικά κύτταρα. Μονάδες 5 Α4. Σε άτομα που πάσχουν από αιμορροφιλία Β, χορηγείται: α. η αυξητική ορμόνη. β. Ο παράγοντας IX. γ. η α1 - αντιθρυψίνη. δ. η απαμινάση της αδενοσίνης.

Μονάδες 5 5. Στο θρεπτικό υλικό για αυτότροφους μικροοργανισμούς δεν είναι απαραίτητο να υπάρχει: α. Νερό. β. Πηγή αζώτου.

414

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 415

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ. Πηγή άνθρακα. δ. Μεταλλικό ιόν. Μονάδες 5 ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. η τεχνολογία του ανασυνδυασμένου DNA περιλαμβάνει όλες τις τεχνικές που οδηγούν σε μεταφορά του γενετικού υλικού από τον έναν οργανισμό στον άλλο. Να περιγράψετε συνοπτικά τα στάδια της διαδικασίας αυτής. Μονάδες 8 Β2. η ινσουλίνη ήταν η πρώτη πρωτεΐνη που παρήχθη με μεθόδους Γενετικής Μηχανικής. Για ποιους λόγους νομίζετε ότι παρήχθη η ορμόνη αυτή; Μονάδες 6

Β3. Γιατί σήμερα χρησιμοποιούμε τις cDNA βιβλιοθήκες και όχι τις γονιδιωματικές, πρoκειμένου να παράγουμε πρωτεΐνες του ανθρώπου σε μεγάλες ποσότητες; Μονάδες 6 Β4. Να γράψετε τα πλεονεκτήματα από τη χρήση διαγονιδιακών φυτών και ζώων. Μονάδες 5 ΘΕΜΑ γ

γ1. Για πρώτη φορά η γονιδιακή θεραπεία εφαρμόστηκε σε ένα κορίτσι που είχε έλλειψη του ενζύμου απαμινάση της αδενοσίνης (ADA). α. Ποιος είναι ο ρόλος του ενζύμου αυτού (Μονάδες 2) και ποια τα συμπτώματα που εμφανίζουν τα άτομα με την έλλειψη του συγκεκριμένου ενζύμου (Μονάδες 3); Μονάδες 5 β. Πώς ονομάζεται ο τύπος της γονιδιακής θεραπείας που εφαρμόστηκε (Μονάδα 1) και γιατί (Μονάδες 2); Σε ποια κύτταρα του ανθρώπου μπορεί να εφαρμοστεί (Μονάδα 1); Μονάδες 4 γ. Ποια είναι τα βήματα της διαδικασίας που ακολουθούνται στη γονιδιακή θεραπεία της παραπάνω ασθένειας; Μονάδες 5

415

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 416

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

γ2. Ποιος είναι ο ρόλος των παρακάτω στις τεχνικές Γενετικής Μηχανικής; α. Πλασμίδια. Μονάδες 4 β. Βακτήρια.

ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Μονάδες 7

Δίνεται το παρακάτω τμήμα DNA του βακτηρίου Bacillus thuringiensis: CCAGAATTCAATTCAGGACCATAAGAATTCAAC GGTCTTAAGTTAAGTCCTGGTATTC TTAAGTTG Δ1. To παραπάνω τμήμα DNA κόβεται με την περιοριστική ενδονουκλεάση EcoRI. Να γράψετε τα τμήματα του DNA που προκύπτουν και να αιτιολογήσετε την απάντησή σας. Μονάδες 8

Δ2. Σε κάποιο από τα τμήματα του DNA που προέκυψαν μετά τη δράση της EcoRI υπάρχει γονίδιο που εκφράζεται. Να γράψετε την αλληλουχία του mRNA που προκύπτει με τη μεταγραφή και να σημειώσετε το 5΄ και το 3΄ άκρο της. Να αιτιολογήσετε την απάντησή σας. Μονάδες 10 Δ3. Ποιος είναι ο αριθμός των αμινοξέων του πεπτιδίου που προκύπτει;

Μονάδες 4

Δ4. Ποιοι οργανισμοί διαθέτουν περιοριστικές ενδονουκλεάσες και ποιος είναι ο φυσιολογικός ρόλος τους; Μονάδες 3

416

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 417

ΚριΤηριΑ Αξ

ιΟΛΟΓη

Κ ριτηριο Α ξιολογησησ 1ο Επαναληπτικό

ΣηΣ

Διάρκεια εξέτασης: 3 ώρες

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Ο όρος αλληλουχία βάσεων: α. Εκφράζει την ακολουθία των νουκλεοτιδίων σε ένα νουκλεϊκό οξύ. β. Εκφράζει την ακολουθία των πεντοζών μιας πολυνουκλεοτιδικής αλυσίδας. γ. Αναφέρεται στον αριθμό των φωσφοδιεστερικών δεσμών. δ. Αναφέρεται στην ακολουθία των φωσφορικών ομάδων. Μονάδες 5

Α2. Ο τύπος της γονιδιακής μετάλλαξης που μπορεί να μην αλλάξει την παραγόμενη πρωτεΐνη είναι: α. η προσθήκη τριών διαδοχικών βάσεων. β. η έλλειψη δύο διαδοχικών βάσεων. γ. η αντικατάσταση μιας βάσης από άλλη. δ. Τίποτε από τα παραπάνω. Μονάδες 5 Α3. Στις φαρμακευτικές πρωτεΐνες ανήκουν: α. η ινσουλίνη και τα αντιβιοτικά. β. Οι ιντερφερόνες και η α1-αντιθρυψίνη. γ. η αυξητική ορμόνη και τα υβριδώματα. δ. Τα εμβόλια και ο παράγοντας IX.

Μονάδες 5

Α4. Ένας άνδρας πάσχει από μερική αχρωματοψία. Ο αδελφός του είναι υγιής, ενώ μια αδελφή του έπασχε επίσης από μερική αχρωματοψία. Ποιοι είναι οι γονότυποι των γονέων τους; α. ΧαΧα (x) ΧαΨ. β. ΧΑΧΑ (x) ΧαΨ. γ. ΧΑΧα (x) ΧαΨ. δ. ΧΑΧΑ (x) ΧΑΨ. Μονάδες 5

417

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 418

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

5Α. Ex vivo γονιδιακή θεραπεία είναι δυνατό να εφαρμοστεί για την αντιμετώπιση: α. Της β - θαλασσαιμίας. β. Της κυστικής ίνωσης. γ. Του σακχαρώδη διαβήτη. δ. Της μυϊκής δυστροφίας Duchenne. Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Με ποιον τρόπο τα ανασυνδυασμένα πλασμίδια εισάγονται στα βακτήρια και πώς, στη συνέχεια, επιλέγουμε τα βακτήρια που δέχθηκαν το ανασυνδυασμένο πλασμίδιο; Μονάδες 4 Β2. Τι είναι η ζύμωση, ποια τα προϊόντα της (Μονάδες 3) και με ποιον τρόπο γίνεται η παραλαβή τους (Μονάδες 3); Μονάδες 6

Β3. Από την παρατήρηση των καρυότυπων τεσσάρων εμβρύων (λήψη εμβρυϊκών κυττάρων με αμνιοπαρακέντηση) διαπιστώθηκε ότι στον έναν παρουσιάζεται μονοσωμία, στον δεύτερο τρισωμία, στον τρίτο αναστροφή, ενώ ο τέταρτος είναι καρυότυπος φυσιολογικού ατόμου. Πόσα μόρια DNA υπάρχουν σε καθέναν καρυότυπο; Να αιτιολογήσετε την απάντησή σας. Μονάδες 6 Β4. Ποιες ασθένειες γνωρίζετε οι οποίες οφείλονται σε έλλειψη ενός ενζύμου και τι επιπτώσεις έχει καθεμία στον οργανισμό; Μονάδες 9 ΘΕΜΑ γ

γ1. Ζευγάρι με οικογενειακό ιστορικό ως προς τη δρεπανοκυτταρική αναιμία επιθυμεί να αποκτήσει παιδί. Επισκέπτεται ειδικό επιστήμονα, ο οποίος τους ενημερώνει ότι και οι δύο είναι ετερόζυγοι ως προς την ασθένεια. α. Να αναφέρετε τι πρέπει να γνωρίζει ο επιστήμονας για να είναι σε θέση να συμβουλέψει σωστά το ζευγάρι (Μονάδες 3), καθώς και μια μέθοδο την οποία χρησιμοποίησε για να διαπιστώσει τον γονότυπο των γονέων (Μονάδες 1). Μονάδες 4

β. Να εξηγήσετε τις πληροφορίες που θα μεταφέρει στο ζευγάρι (γενετική καθοδήγηση) ο επιστήμονας, για να βοηθηθεί στη λήψη αποφάσεων, κυρίως σχετικά με την απόκτηση υγιών απογόνων. Μονάδες 6

418

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 419

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

γ2. Δίνεται το ασυνεχές γονίδιο: Κωδική: 5΄-ACCGATGCTTACCGGTTGTGTCATGAAACA-3΄ Μη κωδική: 3΄-TGGCTACGAATGGCCAACACAGTACTTTGT-5΄ το οποίο παράγει το λειτουργικό πεπτίδιο: η2Ν - Λευκίνη - Βαλίνη - Σερίνη - COOH (Γενετικός κώδικας: Λευκίνη - CUU, Βαλίνη - GUG, Σερίνη - UCA) α. Να εντοπίσετε, αφού γράψετε το mRNA που προκύπτει, τις 5΄ και 3΄ αμετάφραστες περιοχές, το εσώνιο, τα εξώνια και το κωδικόνιο λήξης, αιτιολογώντας την απάντησή σας. Μονάδες 7 β. Σε τι είδους οργανισμό ανήκει το γονίδιο;

Μονάδες 2

γ. Με ποιες διαδικασίες καταλήξαμε από το γονίδιο στο πεπτίδιο; (Μονάδες 4) Σε ποιες περιοχές του κυττάρου πραγματοποιούνται; (Μονάδες 2) Μονάδες 6 ΘΕΜΑ Δ

Ένα ζευγάρι υγιών γονιών αποκτά παιδί με κάποιο κληρονομική ασθένεια. Εάν αποκλείσουμε την περίπτωση της μετάλλαξης: Δ1. Ποιο είναι το φύλο του παιδιού; Δ2. Ποια είναι η πιθανότητα το δεύτερο παιδί να πάσχει; Δ3. Σε πόσα από τα ζυγωτά περιμένουμε να υπάρχουν δύο αντίγραφα του παθολογικού γονιδίου και σε πόσα ένα αντίγραφο; Να αιτιολογήσετε τις απαντήσεις σας σε κάθε περίπτωση, προσδιορίζοντας ταυτόχρονα τους γονότυπους των μελών της οικογένειας. Μονάδες 25

419

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 420

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Κ ριτηριο Α ξιολογησησ 2ο Επαναληπτικό

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. η γονιδιακή ρύθμιση στους ευκαρυωτικούς οργανισμούς: α. Είναι ίδια με αυτή των προκαρυωτικών. β. Πραγματοποιείται σε τρία στάδια. γ. Πραγματοποιείται σε δύο στάδια. δ. Συμβάλλει στη δημιουργία διαφορετικών κυτταρικών τύπων. Μονάδες 5 Α2. Για την κατασκευή cDNA βιβλιοθήκης δεν χρησιμοποιείται το ένζυμο: α. Αντίστροφη μεταγραφάση. β. DNA ελικάση. γ. Περιοριστική ενδονουκλεάση. δ. DNA πολυμεράση.

Μονάδες 5

Α3. η α-θαλασσαιμία οφείλεται στις περισσότερες περιπτώσεις σε έλλειψη: α. Γονιδίου. β. Χρωμοσωμικού τμήματος. γ. Ενός νουκλεοτιδίου. δ. Ενός κωδικονίου.

Μονάδες 5

Α4. Διαφορετική φαινοτυπική αναλογία απογόνων ως προς το φύλο υποδεικνύει ότι ένα χαρακτηριστικό είναι: α. Αυτοσωμικό. β. Φυλοσύνδετο. γ. Επικρατές. δ. Υπολειπόμενο. Μονάδες 5 Α5. Ex vivo γονιδιακή θεραπεία είναι δυνατόν να εφαρμοστεί για την αντιμετώπιση: α. Της β-θαλασσαιμίας. β. Της κυστικής ίνωσης.

420

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 421

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ. Του διαβήτη. δ. Της μυϊκής δυστροφίας Duchenne. Μονάδες 5 ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Από την παρατήρηση των καρυότυπων τεσσάρων εφήβων διαπιστώθηκε ότι στον ένα παρουσιάζεται μονοσωμία, στον δεύτερο τρισωμία, στον τρίτο αναστροφή, ενώ ο τέταρτος είναι καρυότυπος φυσιολογικού ατόμου. Πόσα μόρια DNA απεικονίζονται στον καρυότυπο καθενός από αυτά τα άτομα; Να αιτιολογήσετε την απάντησή σας. Μονάδες 8 Β2. Ποια μόρια ονομάζονται ανιχνευτές και ποιος είναι ο ρόλος τους στην τεχνολογία του ανασυνδυασμένου DNA; Μονάδες 6 Β3. Να αναφέρετε τα θρεπτικά συστατικά που είναι απαραίτητα για την καλλιέργεια ενός αυτότροφου μικροοργανισμού σε στερεό θρεπτικό υλικό. Μονάδες 5

Β4. Με ποια μέθοδο ήταν δυνατή η εξασφάλιση ινσουλίνης πριν από την ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA; Ποια ήταν τα μειονεκτήματα της μεθόδου; Μονάδες 6 ΘΕΜΑ γ

γ1. Ένα υγιές ζευγάρι –ο Δημήτρης και η Μαρία– γέννησαν παιδί με κυαμισμό, ασθένεια που προκαλείται από την έλλειψη ενός ενζύμου, λόγω της παρουσίας ενός μεταλλαγμένου αλληλομόρφου σε γενετική θέση που εντοπίζεται μόνο στο Χ χρωμόσωμα. Ο αδελφός της Μαρίας πάσχει επίσης από κυαμισμό, παρόλο που οι δύο γονείς τους είναι υγιείς. Δεδομένου ότι δεν συνέβη γονιδιακή μετάλλαξη στα γεννητικά κύτταρα του Δημήτρη: α. Να συμβολίσετε κατάλληλα το γονίδιο και τους γονότυπους των μελών της οικογένειας. Να αιτιολογήσετε την απάντησή σας. Μονάδες 8 β. Να απεικονίσετε το γενεαλογικό δένδρο της οικογένειας, στο οποίο να απεικονίζονται κατάλληλα και τα ετερόζυγα για την ιδιότητα άτομα. Μονάδες 4

421

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 422

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

γ. Να προσδιορίσετε την πιθανότητα το επόμενο παιδί του Δημήτρη και της Μαρίας να πάσχει από την εν λόγω ασθένεια και να αιτιολογήσετε πώς προκύπτει η πιθανότητα αυτή. Μονάδες 6

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

γ2. Ο κυαμισμός είναι δυνατόν να αποφευχθεί με την απομάκρυνση από το διαιτολόγιο του ατόμου συγκεκριμένων τροφίμων. α. Ποιας άλλης ασθένειας τα συμπτώματα γνωρίζετε ότι αποφεύγονται με κατάλληλο διαιτολόγιο; Μονάδες 2

β. Τι προκαλεί η ασθένεια που αναφέρατε στο προηγούμενο ερώτημα και με ποιον τρόπο κληρονομείται; Μονάδες 5 ΘΕΜΑ Δ

Δίνεται αλληλουχία DNA του Bacillus thuringiensis που περιέχει υποκινητή και γονίδιο υπεύθυνο για τη σύνθεση πεπτιδίου. 1η αλυσίδα: CACTTCAATGTCGAAGTGGACACATCGATTAAGTG 2η αλυσίδα: GTGAAGTTACAGCTTCACCTGTGTAGCTAATTCAC η αλληλουχία GTGAAT CACTTA αποτελεί τον υποκινητή του γονιδίου. Δ1. Να γράψετε ποια αλυσίδα είναι η μη κωδική και να σημειώσετε τα άκρα του τμήματος DNA. Να αιτιολογήσετε τις απαντήσεις σας. Μονάδες 8 Δ2. Ποια είναι η αλληλουχία του mRNA που προκύπτει από τη μεταγραφή του γονιδίου; Μονάδες 3

Δ3. Όταν κατά τη διάρκεια της μετάφρασης ένα ριβόσωμα συναντά το κωδικόνιο λήξης του συγκεκριμένου mRNA, πόσοι δεσμοί υδρογόνου έχουν σπάσει μεταξύ των κωδικονίων και των αντικωδικονίων όσων tRNA έχουν μεταφέρει αμινοξέα στο ριβόσωμα αυτό; Να αιτιολογήσετε την απάντησή σας. Μονάδες 9

Δ4. Δεδομένου ότι το πεπτίδιο είναι η εντομοτοξίνη που παράγει το βακτήριο, να περιγράψετε τη μέθοδο με την οποία χρησιμοποιήθηκε η ουσία για την καταπολέμηση εντόμων σε αγροτικές καλλιέργειες, πριν από την ανάπτυξη της Γενετικής Μηχανικής. Μονάδες 5

422

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 423

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

Κ ριτηριο Α ξιολογησησ 3o Επαναληπτικό

ΘΕΜΑ Α

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Δύο αδελφές χρωματίδες συγκροτούν: α. Τον καρυότυπο. β. Το νουκλεόσωμα. γ. Κάθε μεταφασικό χρωμόσωμα. δ. Το δίκτυο ινιδίων χρωματίνης. Μονάδες 5

Α2. Ένα αγόρι πάσχει από μερική αχρωματοψία στο πράσινο και στο κόκκινο χρώμα. Αυτό οφείλεται στο γεγονός ότι: α. Κληρονόμησε αυτή την ιδιότητα από τον πατέρα του. β. Κληρονόμησε αυτή την ιδιότητα από την μητέρα του. γ. Κληρονόμησε αυτή την ιδιότητα και από τους δύο γονείς του. δ. Είναι ομόζυγο για το υπολειπόμενο γονίδιο της αχρωματοψίας. Μονάδες 5 Α3. Σε μια κλειστή καλλιέργεια οι μικροοργανισμοί παράγουν χρήσιμα προϊόντα κατά τη διάρκεια της: α. Εκθετικής φάσης της ανάπτυξής τους. β. Στατικής φάσης της ανάπτυξής τους. γ. Εκθετικής και στατικής φάσης της ανάπτυξής τους. δ. Φάσης θανάτου. Μονάδες 5

Α4. η μεταφορά ανασυνδυασμένου μορίου DNA στο κύτταρο-ξενιστή λέγεται: α. Αποδιάταξη. β. Μετασχηματισμός. γ. Υβριδοποίηση. δ. Κλωνοποίηση. Μονάδες 5

423

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 424

Γ ΄ Εν Βιολογία

/ Θετική Κατεύθυνση ιαίου Λυκείου

Α5. Το βακτήριο Bacillus thuringiensis: α. Προκαλεί καρκίνο στα φυτά. β. Χρησιμοποιείται για τη δημιουργία διαγονιδιακών ζώων. γ. Παράγει μία τοξίνη με εντομοκτόνο δράση. δ. Προκαλεί το μετασχηματισμό των κυττάρων.

ΘΕΜΑ Β

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Μονάδες 5

Να απαντήσετε στις παρακάτω ερωτήσεις: Β1. Ποιες πρωτεΐνες σχετίζονται με την πήξη του αίματος και ποιες παθολογικές καταστάσεις δημιουργεί η απουσία τους; Μονάδες 4 Β2. Τι γνωρίζετε για τη σύσταση των αιμοσφαιρινών ενός υγιούς ατόμου;

Μονάδες 6

Β3. Τι ονομάζεται χαρτογράφηση του ανθρώπινου γονιδιώματος; Σε ποιους τομείς έρευνας θα συμβάλλει; Μονάδες 8

Β4. Αναφέρετε δύο κατηγορίες γονιδίων που σχετίζονται με τον φυσιολογικό έλεγχο του κυτταρικού πολλαπλασιασμού. Ποιες οι συνέπειες από μεταλλάξεις αυτών των γονιδίων; Μονάδες 7 ΘΕΜΑ γ

Από ζευγάρι, εκ των οποίων ο άνδρας είναι υγιής και η γυναίκα έχει αιμορροφιλία, γεννήθηκαν δύο παιδιά. Το ένα παιδί με σύνδρομο Turner και αιμορροφιλία και το άλλο παιδί με σύνδρομο Klinefelter και φυσιολογική πήξη αίματος. γ1. Ποιοι είναι οι γονότυποι των γονέων; Μονάδες 8 γ2. Ποια η χρωμοσωμική σύσταση των παιδιών με σύνδρομο Turner και Klinefelter; Μονάδες 4 γ3. Τι είδους χρωμοσώματα και γονίδια περιείχαν οι γαμέτες που ενώθηκαν για να δημιουργήσουν τους συγκεκριμένους απογόνους; Μονάδες 8

424

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 425

ΚριΤηριΑ Αξ

ιΟΛΟΓη

ΣηΣ

γ4. Να εξηγήσετε πώς προέκυψαν οι γαμέτες αυτοί. σημείωση: Να μη ληφθεί υπόψη η περίπτωση γονιδιακής μετάλλαξης. Μονάδες 5 ΘΕΜΑ Δ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Σε ένα ζευγάρι ο άνδρας είναι υγιής, ενώ η γυναίκα πάσχει από κληρονομική ασθένεια. Απέκτησαν τρία παιδιά, από τα οποία τα δύο αγόρια είναι υγιή, ενώ το κορίτσι πάσχει. Δ1. Είναι δυνατόν η ασθένεια που εκδηλώνεται στα μέλη αυτής της οικογένειας να ελέγχεται από υπολειπόμενο φυλοσύνδετο γονίδιο; Δ2. Να απεικονίσετε το γενεαλογικό δένδρο. σημείωση: Να μη ληφθεί υπόψη η περίπτωση μετάλλαξης και να μην εξεταστεί η περίπτωση του φυλοσύνδετου επικρατούς γονιδίου. Μονάδες 25

425

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

KRITHRIA AXIOLOGISHS_Layout 1 19/11/2012 6:18 μμ Page 426

τα θέματα στις πανελλαδικές εξετάσεις θα είναι πιο εύκολα από τα Κριτήρια Αξιολόγησης που προηγήθηκαν. Επειδή θα συνεχίσετε τις επαναλήψεις, δεν έχετε λόγο να φοβάστε τίποτα! ΚΑλη ΕΠιτΥΧιΑ στισ ΠΑΝΕλλΑΔιΚΕσ ΕξΕτΑσΕισ

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

απαντησεις κριτηριων αξιολογησης_Layout 1 19/11/2012 6:26 μμ Page 548

απαντησεις κριτηριων αξιολογησης_Layout 1 19/11/2012 6:26 μμ Page 549

Βιβλιογραφία

Ο ΘΩ ΙΚ Μ Ο Α Ν Σ Ο Μ Ο Υ

Βιολογία Γ ΄ Λυκείου Θετικής Κατεύθυνσης, Β. Αλεπόρου, Α. Αργυροκαστρίτης, Α. Κομητοπούλου, π. πιαλόγλου, Β. Σγουρίτσα, Αθήνα 2008, ΟΕΔΒ. Βιολογία 2ης Δέσμης, Απ. Μιχαηλίδη, Γ. Λόγγου, Σπ. Μολφέτα, Εκδόσεις Καστανιώτη, 1986. Μεθοδολογία και Προβλήματα Βιολογίας Γ ΄ Ενιαίου Λυκείου, Β. ηλιάδης, Θ. Οικονόμου, Εκδόσεις Ελληνικά Γράμματα, 2002.

Βιολογία Θετικής Κατεύθυνσης, Β. ηλιάδης, Θ. Οικονόμου, Β. Σπύρου, Εκδόσεις Ελληνικά Γράμματα, 2007.


ΒΙΟΛΟΓΙΑ Γ΄ ΛΥΚΕΙΟΥ - ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ - ΘΩΜΑΣ ΟΙΚΟΝΟΜΟΥ